Factors for direct cross-differentiation of motor neurons

Abstract

The present application relates to novel differentiation factors for direct cross-differentiation of somatic cells into motor neural cells and uses thereof.

Description

[Technical field]

[0001] The present application relates to novel differentiation factors for direct cross-differentiation of motor neurons.

[0002] The present application relates to compositions comprising said novel differentiation factors.

[0003] The present application relates to a method for direct cross-differentiation utilizing said composition.

[0004] The present application relates to various uses of said novel differentiation factors. [Background technology]

[0005] Stem cells are widely used in regenerative medicine. Stem cells are pluripotent cells that can differentiate into any cell that makes up the human body, and in theory can differentiate into any type of functional cell and proliferate indefinitely. Depending on their origin, stem cells are classified as embryonic stem cells, adult stem cells, garden stem cells, and dedifferentiated stem cells (or induced pluripotent stem cells).

[0006] However, stem cells have ethical issues, stability issues, and low differentiation efficiency depending on the type. Also, dedifferentiated stem cells have problems such as the possibility of teratoma formation and low differentiation efficiency.

[0007] Because stem cells have such a variety of problems, new technologies are required in the field of regenerative medicine.

[0008] Recently, direct cross-differentiation technology has been attracting attention. Direct cross-differentiation is different in that it directly induces transformation into the target cells without going through the process of reprogramming induced pluripotent stem cells and redifferentiating them into the target cells.

[0009] In other words, it is a method to induce conversion between mature (completely differentiated) cells that have completely different cell types. However, the conventional direct cross-differentiation method has the limitation of low efficiency, so a new method that can overcome this limitation is required. Summary of the Invention [Problem to be solved by the invention]

[0010] One object of the present application is to provide a novel differentiation factor for direct crossing of motor neurons. In particular, the novel differentiation factor relates to Gsta4 (Glutathione S-transferase A4) protein or a nucleic acid encoding the same.

[0011] Another object of the present application is to provide a composition containing the novel differentiation factor.

[0012] Another object of the present application is to provide a method for direct cross-differentiation using the composition.

[0013] Another object of the present application is to provide various uses of the novel differentiation factor. [Means for solving the problem]

[0014] In order to solve the above-mentioned problems, the present application In one embodiment, the present application provides a composition for direct cross-differentiation of somatic cells into induced motor neurons, the composition comprising: Gsta4 (Glutathione S-Transferase Alpha 4) protein or a nucleic acid encoding same.

[0015] The composition may further comprise ii) one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or a nucleic acid encoding the same.

[0016] The composition is characterized in that Hb9 and Lhx3 are selected from ii).

[0017] In this case, the Ascl1 protein can be SEQ ID NO: 17, and the nucleic acid encoding the Ascl1 protein can have the sequence of SEQ ID NO: 18; The Brn2 protein can be SEQ ID NO:19, and the nucleic acid encoding the Brn2 protein can have the sequence of SEQ ID NO:20; The Myt1L protein can be SEQ ID NO:21, and the nucleic acid encoding the Myt1L protein can have the sequence of SEQ ID NO:22; The Hb9 protein can be SEQ ID NO:13, and the nucleic acid encoding the Hb9 protein can have the sequence of SEQ ID NO:14; The Isl1 protein can be SEQ ID NO:23, and the nucleic acid encoding the Isl1 protein can have the sequence of SEQ ID NO:24; The Lhx3 protein can be SEQ ID NO:15, and the nucleic acid encoding the Lhx3 protein can have the sequence of SEQ ID NO:16; The Ngn2 protein can be SEQ ID NO:25, and the nucleic acid encoding the Ngn2 protein can have the sequence of SEQ ID NO:26; The NeuroD1 protein can be SEQ ID NO:27, and the nucleic acid encoding the NeuroD1 protein can have the sequence of SEQ ID NO:28.

[0018] In another embodiment of the present application, a vector for expressing a differentiation factor for direct cross-differentiation, said direct cross-differentiation being converted from a somatic cell into an induced motor neuron, said vector being i) a nucleic acid encoding a Gsta4 protein; and ii) a promoter; In this case, a vector can be provided in which i) and ii) are operably linked.

[0019] The vector may further include iii) a nucleic acid encoding one or more proteins selected from among Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0020] A vector for expressing a differentiation factor for direct cross-differentiation, the direct cross-differentiation being converted from a somatic cell into an induced motor neuron, the vector may include at least a first vector and a second vector; The first vector is i) a nucleic acid encoding a Gsta4 protein; and ii) a promoter; In this case, i) and ii) are operably linked, The second vector is iii) a nucleic acid encoding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; and iv) a promoter; In this case, iii) and iv) are operably linked, The promoters ii) and iv) are the same or different, The iii) may be provided as a vector, which may be included in one vector or in two or more vectors.

[0021] The vector may be a viral vector or a non-viral vector, and the viral vector may be one or more selected from retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), veccinia virus, poxvirus, HIV (Human immunodeficiency virus), MLV (Murine leukemia virus), ASLV (Aviansarcoma / leukosis), SNV (Spleennecirosis virus), Rous sarcoma virus (RSV), MMTV (Mouse mammary tumor virus), Herpes simplex virus, episomal, and simplex virus.

[0022] In another embodiment of the present application, there is provided a method for direct cross-differentiation of somatic cells into induced motor neurons, the method comprising: introducing into the somatic cells a composition comprising a Gsta4 protein or a nucleic acid encoding the same; wherein the method does not result in the generation of induced pluripotent stem cells (iPSCs).

[0023] The somatic cells may be one or more selected from the group consisting of fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (Gcells), B cells, hepatic cells, astrocytes, blood cells, and rare dendritic precursor cells.

[0024] Such introduction allows the somatic cells to differentiate into induced motor neurons within one to seven weeks.

[0025] As another embodiment of the present application, there is provided a pharmaceutical composition for preventing or treating a nervous system disease, comprising a Gsta4 protein for direct cross-differentiation of somatic cells into induced motor neurons.

[0026] In addition, a pharmaceutical composition for preventing or treating a nervous system disease can be provided, comprising a somatic cell into which a Gsta4 protein or a nucleic acid encoding the same has been introduced for direct cross-differentiation of the somatic cell into an induced motor neuron.

[0027] The pharmaceutical composition may further comprise a nucleic acid encoding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0028] A pharmaceutical composition for preventing or treating nervous system diseases involving motor neurons may be provided in which differentiation factors for direct cross-differentiation from somatic cells into induced motor neurons are overexpressed, and the motor neurons may overexpress one or more differentiation factors selected from Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1).

[0029] In another embodiment of the present application, a method for preventing or treating a nervous system disease includes: administering to a subject: i) a Gsta4 protein; or ii) a Gsta4 protein; and one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; wherein the direct cross-differentiation does not result in the production of induced pluripotent stem cells (iPSCs).

[0030] As a method for preventing or treating a nervous system disease, a method can be provided which comprises administering to a subject a composition containing a Gsta4 protein or a nucleic acid encoding the same; into which a somatic cell has been introduced.

[0031] As a method for preventing or treating a nervous system disease, a method may be provided which includes: introducing a composition containing Gsta4 protein or a nucleic acid encoding the same into somatic cells; and administering the induced motor neurons to a subject.

[0032] The nervous system disease may be one or more selected from spinal cord injury, Parkinson's disease, stroke, amyotrophic lateral sclerosis, motor nerve injury, peripheral nerve injury due to trauma, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, epilepsy, incurable disease, Alzheimer's disease, congenital metabolic nervous system disease, traumatic brain injury, motor neuron injury, or diseases induced thereby. Effect of the Invention

[0033] According to the present application, the following effects are obtained.

[0034] First, the present application provides a novel differentiation factor for direct cross-differentiation of motor neurons, which enables effective differentiation of somatic cells into motor neurons and may be useful for the treatment of neurological diseases. [Brief description of the drawings]

[0035] [Figure 1]1 is a schematic diagram of the AAV vector used in this example: (a) is a schematic diagram of an AAV vector containing Gsta4; (b) is a schematic diagram of an AAV vector containing Ascl1, Isl1, Lhx3, and Ngn2 (also called Neurog2); (c) is a schematic diagram of an AAV vector containing Brn2, Hb9 (also called Mnx1), and NeuroD1; (d) is a schematic diagram of an AAV vector containing Gsta4 and Myt1l; and (e) is a schematic diagram of an AAV vector containing Gsta4, Hb9, and Lhx3. [Diagram 2] Figure 2 shows the results of introducing a novel differentiation factor, Gsta4, into mouse-derived fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by the expression of neuronal markers (ChaT, Map2). (a) shows the results of immunofluorescence staining, and (b) is a quantification of the results of (a). [Diagram 3] Figure 3 shows the results of introducing conventional differentiation factors (Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) into human-derived fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2, Hb9). [Figure 4] Figure 4 shows the results of introducing a novel differentiation factor Gsta4 and conventional differentiation factors (Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) into mouse-derived fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2, Hb9). [Diagram 5] Figure 5 shows the results of introducing differentiation factors into mouse-derived fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by immunofluorescence staining to confirm the expression of neuronal markers (ChaT, Map2). The differentiation factors used were Gsta4 alone; and a combination of Gsta4 and a conventional differentiation factor. [Figure 6] FIG. 6 is a graph showing the numerical values ​​of the immunofluorescently stained cells in FIG. [Figure 7]Figure 7 shows the results of introducing differentiation factors into mouse-derived fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2). The differentiation factors used were: a conventional differentiation factor alone; and a combination of Gsta4 and a conventional differentiation factor. [Figure 8] Figure 8 shows the results of introducing differentiation factors into mouse-derived fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by immunofluorescence staining to confirm the expression of neuronal markers (ChaT, Map2). The differentiation factors used were a combination of Mnx1 and Lhx3; and a combination of Gsta4, Mnx1, and Lhx3. (a) shows the results of immunofluorescence staining, and (b) is a quantification of the results of (a). [Figure 9] Figure 9 shows the results of introducing differentiation factors into mouse fibroblasts and examining the degree of direct cross-differentiation into motor neurons by measuring the expression of neuronal markers (Synapsin, Map2, and Hb9). The differentiation factors used were Gsta4 alone; a combination of Mnx1 and Lhx3; and a combination of Gsta4, Mnx1, and Lhx3. [Figure 10] Figure 10 shows the results of introducing differentiation factors into mouse-derived fibroblasts and examining the degree of direct differentiation into motor neurons by measuring the expression of neuronal markers (Synapsin, Map2). The differentiation factors used were a combination of Ascl1, Brn2, and Myt1L; and a combination of Gsta4, Ascl1, Brn2, and Myt1L. [Figure 11] 11 shows the results of confirming the degree of direct cross-differentiation into motor neurons by the expression change of neuronal markers (Synapsin, Map2, Hb9) after introducing differentiation factors into human-derived fibroblasts. The differentiation factors used were a combination of Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; and a combination of Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, NeuroD1, and Gsta4. [Figure 12]Figure 12 shows the results of introducing differentiation factors into mouse phenotype cells and confirming the expression of neuronal markers (vChaT, Map2) by immunofluorescence staining to determine the degree of direct cross-differentiation into motor neurons. The differentiation factors used were a combination of Hb9, Isl1, Lhx3, and Ascl1; a combination of Hb9, Isl1, Lhx3, Ascl1, Brn2, Myt1L, and Ngn2 (listed as known factors); and a combination of known factors and Gsta4. [Figure 13] FIG. 13 shows the results of introducing a differentiation factor into human fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by immunofluorescence staining to confirm the expression of neuronal markers (NEUN, Map2). [Figure 14] Figure 14 shows the general experimental design for administering (indicated as "injection") differentiation factors to the L5 spinal cord injury site in a mouse model of spinal cord injury (SCI), which is a model of lower body paralysis caused by spinal cord injury, and for investigating morphological changes, physiological analysis, behavioral analysis, etc. [Figure 15] Figure 15 shows the results of crystal violet staining to confirm morphological changes at the site of spinal cord injury after administration of differentiation factors to SCI mouse models. Mock refers to a group administered with AAV (Adeno-associated virus); Control refers to a group administered with AAV transduced with conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1); +Gsta4 refers to a group administered with AAV transduced with the conventional differentiation factors and Gsta4. [Figure 16] Figure 16 shows the results of immunofluorescence staining of motor neuron markers (ChaT, Map2) after administration of differentiation factors to SCI mouse models. Mock refers to a group administered with AAV (Adeno-associated virus), Control refers to a group administered with AAV transduced with conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1), and +Gsta4 refers to a group administered with AAV transduced with the conventional differentiation factors and Gsta4. [Figure 17] Figure 17 shows the results of checking the area enclosed by the white dotted line in Figure 16. [Figure 18] Figure 18 shows the quantification of the immunofluorescence staining results in Figure 16. [Figure 19] Figure 19 shows the results of analyzing electrophysiological changes in motor neurons after administration of differentiation factors to SCI mouse models. (a) shows patch-clamped neurons; (b) shows the results of measuring action potentials; (c) shows the results of measuring signals from presynaptic neurons. In this study, Sham refers to a normal group with no spinal cord damage; Mock refers to a group in which AAV was administered to an SCI mouse model; Control refers to a group in which AAV containing conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1) was administered; +Gsta4 refers to a group in which AAV containing the conventional differentiation factors and Gsta4 was administered. [Figure 20] FIG. 20 shows the results of an analysis of the therapeutic effect of paraplegia at the site of spinal cord injury (L5) after administration of differentiation factors to an SCI mouse model, using the BBB score (Basso Beatie, and Bresnahan score). (a) is a graph that quantifies the observation results of (b). Here, Sham refers to a normal group with no spinal cord injury; mock refers to a group of SCI mouse models administered with AAV; -Gsta4 refers to a group administered with conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1); and +Gsta4 refers to a group administered with the conventional differentiation factors and Gsta4. [Figure 21] Figure 21 shows the results of behavioral analysis of the therapeutic effect of paraplegia after administration of differentiation factors to SCI mouse models: (a) Forced swimming test; (b) Self urination; (c) Numerical values ​​of (a) and (b); (d) Foot printing test. MODE FOR CARRYING OUT THEINVENTION

[0036] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or identical to those described in this application can be used in the practice or testing of this application, suitable methods and materials are described below. All publications, patent applications, articles and other references mentioned in this application are incorporated by reference in their entirety. Furthermore, the materials, methods and practices are merely illustrative and are not intended to be limiting.

[0037] Term definition Direct Reprogramming / Direct cell-Conversion / Transdifferentiation

[0038] The terms "Direct Reprogramming / Direct Conversion / Transdifferentiation" as used herein refer to the introduction of differentiation factors into terminally differentiated cells to convert them into cells of interest. In particular, direct cross differentiation induces conversion between mature cells of completely different cell types, i.e., converting somatic cells into cells of interest without passing through a pluripotent state. The terms direct cross differentiation, direct differentiation, and direct cross differentiation can be used interchangeably.

[0039] ● Direct cross-differentiation factor (Direct cell-Conversion factor, converting factor)

[0040] In this application, the term "direct cell-conversion factor" refers to a factor involved in the above-mentioned direct cross-differentiation. In this case, the differentiation factor can be a gene, a compound, a protein, a nucleic acid, etc. The term 'direct cell-conversion factor' can be used interchangeably with 'converting factor'.

[0041] Induced Motor Neuron (iMN)

[0042] In the present application, the term "induced motor neurons" refers to motor neurons induced by direct cross-differentiation. The induced motor neurons refer to motor neurons artificially produced by directly cross-differentiating somatic cells using the novel differentiation factors of the present application. The term 'induced motor neurons' can be used interchangeably with motor neurons, iMNs.

[0043] ● Treatment The term "treatment" as used in this application means to alleviate a disease, illness, symptom, etc., or to inhibit its progression. The treatment means any action that improves or favorably changes symptoms by the composition of the present invention, direct cross-differentiation factor, etc. Substances that exhibit such therapeutic effects are commonly called "treatment agents" or "pharmaceutical compositions." In particular, a gene therapy agent means a genetic material that delivers genes into the human body in various forms and methods for the purpose of treating a disease, etc. Also, a cell therapy agent means a case where a therapeutic material is delivered into the human body in the form of cells for the purpose of treating a disease, etc.

[0044] About The term "medicament" as used in this application refers to an amount, level, value, number, frequency, percentage, size, amount, weight or length that varies by about 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1% from a reference amount, level, value, number, frequency, percentage, size, quantity, weight or length.

[0045] 1. A novel factor for direct cross-differentiation: Gsta4 (glutathione S-transferase alpha 4)

[0046] Characteristics of direct cross differentiation

[0047] Direct cross-differentiation is the process of turning a fully differentiated cell into a cell of another lineage without the step of reprogramming it into a stem cell. This process has the effect of converting a fully differentiated cell into a specific cell of another lineage without going through the stem cell stage.

[0048] To date, two methodologies for direct cross-differentiation have been proposed: SDR (Somatic cell-specific factor-mediated Direct Reprogramming) and PDR (Pluripotent cell-specific factor-mediated Direct Reprogramming). SDR involves overexpressing factors that are highly expressed in the target cells in the target cells, inducing direct cross-differentiation into the target cells. PDR involves dedifferentiating the target cells into an incomplete intermediate cell type (cells similar to stem cells) using factors OCT4, SOX2, KLF4, and C-Myc, which are used in the reprogramming of induced pluripotent stem cells, and then directly cross-differentiating the target cell type through the creation of a culture medium. In the case of PDR, even when direct cross-differentiation into various cell types is performed, the four reprogramming factors (OCT4, SOX2, KLF4, and C-Myc) that are overexpressed at the initial stage are commonly used.

[0049] Known Direct Cell-Conversion Factors

[0050] Known differentiation factors that have been used for direct cross-differentiation include Ascl1 (Achaete-scute homolog 1), Nurr1 (Nuclear Receptor Subfamily 4 Group A Member 2), Lmx1a (LIM Homeobox Transcription Factor 1 Alpha), Foxa2 (Forkhead box protein A2), Brn2 (POU Class 3 Homeobox 2), Sox2 (sex determining region Y-box 2), Foxg1 (Forkhead Box G1), Lhx3 (LIM homeobox 3), HB9 (Homeobox HB9), IsL1 (ISL LIM homeobox 1), Ngn2 (neurogenin 2), NeuroD1 (Neuronal Differentiation 1), Myt1l (Myelin Transcription Factor 1 Like), NeuroD2 (Neuronal Differentiation 2), miR-9 (microRNA-9), miR-124 (microRNA-124), Zic1 (Zic Family Member 1), Gata5 (GATA Binding Protein 5), Hnf4α (Hepatocyte nuclear factor 4 alpha), HNF1α (hepatocyte nuclear factor 1 alpha), Foxa1 (Forkhead Box A1), Foxa3 (Forkhead Box A3), Tbx5 (T-Box Transcription Factor 5), Mef2c (Myocyte Enhancer Factor 2C), Oct4 (Octamer-binding transcription factor 4), PRDM16 (PR / SET Domain 16), MyoD (myoblast determination protein 1), Klf4 (Kruppel-like factor 4), and c-Myc (cellular Myc) are known (Mol Cell. 2012 Sep 28;47(6):827-838.).

[0051] In particular, differentiation factors used for direct cross-differentiation into motor neurons include Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0052] Problems with conventional direct cross-reactivity factors The direct cross-differentiation has the advantage that it allows for the conversion of cells that have already completed differentiation into completely different cell types without going through the induced pluripotent stem cell stage. However, the differentiation factors known to date have had problems in that the conversion efficiency between cells is low or almost nonexistent when used alone or in combination.

[0053] Overview of Gsta4, a novel factor for directed cross-differentiation The present application discloses a novel factor, Gsta4 (glutathione S-transferase alpha 4), for direct cross-differentiation.

[0054] The Gsta4 alone can effectively direct cross-differentiate somatic cells into motor neurons, and when used together with conventional direct cross-differentiation factors, it can further increase the efficiency of differentiation into motor neurons compared to the use of conventional differentiation factors alone.

[0055] The novel differentiation factor Gsta4 will now be described in more detail.

[0056] Previously known features of Gsta4 Gsta4 is an enzyme that belongs to the glutathione S-transferases (GST) family. Eight types of GST, alpha, kappa, mu, omega, pi, sigma, theta, and zeta, are known to be produced in the cytoplasm of mammals. Among them, alpha is located on chromosome 6, and there are GSTA1, GSTA2, GSTA3, GSTA4, GSTA5, etc.

[0057] Gsta4, also known as GTA4, is known to be involved in cell defense mechanisms, toxin decomposition, and anticancer effects. It is also known to play a major role in reducing cellular stress by reducing reactive oxygen species. The absence of Gsta4 is known to be negatively associated with diseases such as Parkinson's disease and Alzheimer's disease. However, its function as a direct cross-differentiation factor between cells has not been reported.

[0058] What's new in Gsta4? The present application discloses a novel function of Gsta4 that enables directed cross-differentiation, i.e., discloses Gsta4 as a novel differentiation factor for directed cross-differentiation.

[0059] In particular, the fact that Gsta4 of the present application has the function of converting somatic cells into motor neurons (direct cross-differentiation) has never been reported before, and was experimentally confirmed and discovered by the present inventor. The term Gsta4 listed below is understood to function as a direct cross-differentiation factor, which is a novel function. In addition, when Gsta4 is referred to below for convenience, it is interpreted as referring to the Gsta4 protein or a nucleic acid encoding it depending on the context.

[0060] Forms of Gsta4 (1) - Gsta4 protein In one aspect, the present application discloses Gsta4 protein for direct cross-differentiation.

[0061] The Gsta4 protein may be wild-type or mutant. The mutant may have one or more deletions, substitutions, or insertions in the wild-type amino acid sequence. The Gsta4 mutant may have a sequence identity with the wild-type amino acid sequence. In this case, the sequence identity may be 50% to 99%. Preferably, the Gsta4 protein has 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity with the wild-type amino acid sequence.

[0062] As an optional example, the Gsta4 protein for direct cross-linking of the present application may be the amino acid sequence shown in SEQ ID NO:1.

[0063] SEQ ID NO:1: maarpklhyp ngrgrmesvr wvlaaagvef deefletkeq lyklqdgnhl lfqqvpmvei dgmklvqtrs ilhyiadkhn lfgknlkert lidmyvegtl dllellimhp flkpddqqke vvnmaqkaii ryfpvfekil rghgqsflvg nqlsladvil lqtilaleek ipnilsafpf lqeytvklsn iptikrflep gskkkpppde iyvrtvynif rp

[0064] In other embodiments, the Gsta4 protein can have a sequence that has 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity to the amino acid sequence set forth in SEQ ID NO:1.

[0065] Forms of Gsta4 (2) - Nucleic acid encoding the Gsta4 protein

[0066] As another example, the present application discloses a nucleic acid encoding a Gsta4 protein for direct cross-differentiation. The nucleic acid can be DNA or RNA.

[0067] The nucleic acid encoding the Gsta4 protein may be a wild type or a mutant. The mutant may be a product of the addition, substitution, or insertion of one or more of the wild type nucleic acid sequences. The Gsta4 mutant may have a sequence identity with the nucleic acid sequence encoding the wild type protein. In this case, the sequence identity may be 50% to 99%. Preferably, the nucleic acid encoding the Gsta4 protein may have a sequence with 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity with the wild type nucleic acid sequence.

[0068] The nucleic acid sequence encoding the Gsta4 protein can be a known sequence.

[0069] The nucleic acid sequence can include intron and exon sequences.

[0070] The nucleic acid sequence may include only exon sequences.

[0071] For example, the nucleic acid sequence encoding the Gsta4 protein may include a coding sequence (CDS) sequence excluding introns.

[0072] The nucleic acid sequence may be a DNA sequence encoding a Gsta4 protein and its corresponding mRNA sequence (the transcription product).

[0073] The nucleic acid sequence may be an mRNA sequence (the result of transcription) that corresponds to an exon sequence of the Gsta4 gene.

[0074] In one embodiment, the nucleic acid encoding the Gsta4 protein can comprise SEQ ID NO:2, which is the full DNA sequence of the Gsta4 gene.

[0075] Sequence number 2: gctttgtgcg gctccaggcc tccgagtgga ctccagaaag cctgaaaagc tatcatggca gcaaggccca agctccacta tcccaacgga agaggccgga tggagtccgt gagatgggtt ttagctgccg ccggagtcga gtttgatgaa gaatttctgg aaacaaaaga acagttgtac aagttgcagg atggtaacca cctgctgttc caacaagtgc ccatggttga aattgacggg atgaagttgg tacagacccg aagcattctc cactacatag cagacaagca caatctcttt ggcaagaacc tcaaggagag aaccctgatt gacatgtacg tggaggggac actggatctg ctggaactgc ttatcatgca tcctttctta aaaccagatg atcagcaaaa ggaagtggtt aacatggccc agaaggctat aattagatac tttcctgtgt ttgaaaagat tttaaggggt cacggacaaa gctttcttgt tggtaatcag ctgagccttg cagatgtgat tttactccaa accattttag ctctagaaga gaaaattcct aatatcctgt ctgcatttcc tttcctccag gaatacacag tgaaactaag taatatccct acaattaaga gattccttga acctggcagc aagaagaagc ctccccctga tgaaatttat gtgagaaccg tctacaacat ctttaggcca taaaacaaca catccatgtg tgagtgacag tgtgttccta gagatggtat tgtctacagt catgtcttaa tggatcccag ctctgtcatg gtgctatcta tgtattaagt tgggtcctaa gttgggtctt ttgtgtcaac gagatcatct cttctagaaa tatcaacctt ttttgtccagtaaataattg ttaggggatc tttattggaa aacttttttg gagaggctgg tatttaagtt agatctgatt gggctactca tgtcctgtag ccagttcatc ctcataataa gaatgggcag gatctcttgt tctctcctga gtgtctttct actctcctga gcgtctttct gctctcctta tcctgttctc ttatccttat cccctccagt ctctgcctaa tttttagtgt ttaataacaa ccgaatgtct agtaaatgac tctcctctga gctgtaataa ataaaatggt agtaatgaat gcaatcagta ttagccaaaa taaagaattt atgagtcatt

[0076] In another embodiment, the nucleic acid encoding the Gsta4 protein can have the CDS sequence SEQ ID NO:12.

[0077] SEQ ID NO: 12: Atggcagcaaggcccaagctccactatcccaacggaagaggccggatggagtccgtgagatgggttttagctgccgccggagtcgagtttgatgaagaatttctggaaacaaaagaacagttgtacaagttgcaggatggtaaccacctgctgttccaacaa gtgcccatggttgaaattgacgggatgaagttggtacagaccgaagcattctccactacatagcagacaagcacaatctctttggcaagaacctcaaggagagaaccctgattgacatgtacgtggaggggacactggatctgctggaactgcttatcatgcatcctt tcttaaaaccagatgatcagcaaaaggaagtggttaacatggcccagaaggctataattagatactttcctgtgtttgaaaagattttaaggggtcacggacaaagctttcttgttggtaatcagctgagccttgcagatgtgattttactccaaaccattttagctct agaagagaaaattcctaatatcctgtctgcatttcctttcctccaggaatacacagtgaaactaagtaatatccctacaattaagagattccttgaacctggcagcaagaagaagcctccccctgatgaaatttatgtgagaaccgtctacaacatctttaggccataa

[0078] In other embodiments, a nucleic acid encoding a Gsta4 protein can have a sequence that has 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity to the DNA sequence set forth in SEQ ID NO:2.

[0079] In other embodiments, the nucleic acid encoding the Gsta4 protein can have a sequence that has 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity to the CDS sequence set forth in SEQ ID NO:12.

[0080] Features of Gsta4 (1) The novel direct cross-differentiation factor Gsta4 of the present application can directly transform somatic cells into motor neurons. As an example, Gsta4 can transform fibroblasts into motor neurons. As another example, Gsta4 can transform astrocytes into motor neurons.

[0081] Features of Gsta4 (2) A problem with conventional differentiation factors is that they have low or almost no direct cross-differentiation efficiency. In contrast, Gsta4, a novel differentiation factor of the present application, has a higher direct cross-differentiation efficiency than conventional differentiation factors. For example, when Gsta4 is used alone, the differentiation efficiency can be about 2 to 10 times higher than that of conventional differentiation factors.

[0082] Features of Gsta4 (3) Gsta4 has a boosting function that enhances the differentiation efficiency of conventional differentiation factors that have low or almost no differentiation efficiency. The boosting function refers to the function of significantly increasing the differentiation efficiency when conventional differentiation factors are used together with Gsta4 compared to when only the conventional differentiation factors are used. For example, when Gsta4 is used in combination with a conventional differentiation factor, it can increase the direct cross-differentiation efficiency by about 2 to 10 times compared to when it is not used.

[0083] Features of Gsta4 (4) Gsta4 has the effect of directly inducing somatic cells to motor neurons, so it can be used to treat nervous system diseases induced by motor neuron damage, and Gsta4 can be used together with conventional direct cross-differentiation factors to improve the therapeutic effect of nervous system diseases.

[0084] For example, administration of Gsta4 to treat a neurological disease can result in a reduction in inflammatory cell-mediated scavenging, an increase in action potentials, and increased signal transmission between presynaptic neurons.

[0085] 2. Differentiation factors that can be combined with Gsta4 Overview of differentiation factors that can be combined with Gsta4 In one aspect of the present application, the Gsta4 protein or a nucleic acid encoding the same, which is a novel differentiation factor for direct cross-differentiation, can be used alone or together with a known differentiation factor (known Direct Cell-Conversion factor, known e-DC factor).

[0086] When Gsta4 is used in combination with conventionally known differentiation factors, not only can the efficiency of direct cross-differentiation be improved, but also the time required for differentiation during direct cross-differentiation can be reduced.

[0087] The known differentiation factors are not limited as long as they are known to be directly involved in cross-differentiation. They may also include mutants of conventional differentiation factors. In this case, the mutants may have one or more deletions, substitutions, or insertions in the wild-type amino acid sequence or nucleic acid sequence.

[0088] For example, the conventional differentiation factor may be one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0089] In one embodiment, the present application discloses a combination of Gsta4 and one or more known differentiation factors.

[0090] Possible combinations of Gsta4 with conventional differentiation factors are described in more detail below.

[0091] Example of combination of Gsta4 and conventional differentiation factors (1) The Gsta4 can be used in combination with one of the conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0092] In this case, the combination can be selected from, for example, Gsta4+Brn2 (referring to a combination of Gsta4 and Brn2); Gsta4+Ascl1; Gsta4+Hb9; Gsta4+Lhx3; Gsta4+Myt1L; Gsta4+Isl1; Gsta4+Ngn2; Gsta4+NeuroD1; etc.

[0093] Example of combination of Gsta4 and conventional differentiation factors (2) The Gsta4 can be used in combination with two conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0094] In this case, the combination can be selected from, for example, Gsta4+Brn2+Hb9 (referring to a combination of Gsta4, Brn2 and HB9); Gsta4+Ascl1+Hb9; Gsta4+Lhx3+Hb9; Gsta4+Ngn2+Hb9; Gsta4+Ngn2+NeuroD1; Gsta4+Lhx3+Ngn2; Gsta4+Lhx3+NeuroD1, etc.

[0095] Combination example of Gsta4 and conventional differentiation factors (3) The Gsta4 can be used in combination with three conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0096] In this case, the combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1 (referring to a combination of Gsta4, Brn2, Hb9 and Ascl1); Gsta4+Brn2+Hb9+NeuroD1; Gsta4+Ascl1+Hb9+NeuroD1; Gsta4+Lhx3+Hb9+NeuroD1; Gsta4+Lhx3+Hb9+Ngn2; Gsta4+Lhx3+Ngn2+NeuroD1; Gsta4+Hb9+Ngn2+NeuroD1; etc.

[0097] Combination example of Gsta4 and conventional differentiation factors (4) The Gsta4 can be used in combination with four conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0098] In this case, the combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1+Isl1 (referring to a combination of Gsta4, Brn2, Hb9, Ascl1 and Isl1); Gsta4+Ascl1+Brn2+Myt1L+Hb9; Gsta4+Brn2+Hb9+NeuroD1+Isl1; Gsta4+Ascl1+Hb9+NeuroD1+Isl1; Gsta4+Lhx3+Hb9+NeuroD1+Isl1; Gsta4+Lhx3+Hb9+Ngn2+Isl1; Gsta4+Lhx3+Ngn2+NeuroD1+Isl1; Gsta4+Hb9+Ngn2+NeuroD1+Isl1; and the like.

[0099] Combination of Gsta4 and conventional differentiation factors (5) The Gsta4 can be combined with five conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0100] In this case, the combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1+Isl1+NeuroD1 (referring to a combination of Gsta4, Brn2, Hb9, Ascl1, Isl1, and NeuroD1); Gsta4+Ascl1+Brn2+Ngn2+Isl1+Lhx3; Gsta4+Brn2+Hb9+NeuroD1+Isl1+Lhx3; Gsta4+Ascl1+Hb9+NeuroD1+Isl1+Lhx3; Gsta4+Lhx3+Hb9+NeuroD1+Isl1+Ascl1; Gsta4+Lhx3+Hb9+Ngn2+Isl1+NeuroD1; Gsta4+Lhx3+Ngn2+NeuroD1+Isl1+Ascl1; Gsta4+Hb9+Ngn2+NeuroD1+Isl1+Ascl1; and the like.

[0101] Combination of Gsta4 and conventional differentiation factors (6) The Gsta4 can be combined with six conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0102] In this case, the combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1+Isl1+NeuroD1+Lhx3 (referring to a combination of Gsta4, Brn2, Hb9, Ascl1, Isl1, NeuroD1 and Lhx3); Gsta4+Ascl1+Brn2+Ngn2+Isl1+Lhx3+Myt1L; Gsta4+Brn2+Hb9+NeuroD1+Isl1+Lhx3+Ngn2; Gsta4+Ascl1+Hb9+NeuroD1+Isl1+Lhx3+Ngn2; etc.

[0103] Combination of Gsta4 and conventional differentiation factors (7) The Gsta4 can be combined with seven conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0104] In this case, the combination is, for example, Gsta4+Brn2+Myt1L+Hb9+Isl1+Lhx3+Ngn2+NeuroD1 (referring to the combination of Gsta4, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1); Gsta4+Ascl1+Myt1L+Hb9+Isl1+Lhx3+Ngn2+NeuroD1; Gsta4+Ascl1+Brn2+Hb9+Isl1+Lhx3+Ngn2+NeuroD1; Gsta4+Ascl1+B You can choose from rn2+Myt1L+Isl1+Lhx3+Ngn2+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Lhx3+Ngn2+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Isl1+Ngn2+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Isl1+Lhx3+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Isl1+Lhx3+Ngn2; etc.

[0105] Combination of Gsta4 and conventional differentiation factors (8) The Gsta4 can be combined with eight conventional differentiation factors, namely Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0106] Combination ratio of Gsta4 and conventional differentiation factors As mentioned above, Gsta4 and conventional differentiation factors can be used in a variety of combinations.

[0107] In this case, Gsta4 and conventional differentiation factors can be used in the same ratio for direct cross-differentiation.

[0108] For example, when Gsta4 and one of the conventional differentiation factors are used, they can be used in a ratio of 1:1.

[0109] As another example, when Gsta4 and two conventional differentiation factors are used, they can be used in a ratio of 1:1:1, 2:1:1, 2:1:2, 1:2:1, etc.

[0110] As another example, when Gsta4 and three conventional differentiation factors are used, they can be used in a ratio of 1:1:1:1.

[0111] Alternatively, Gsta4 and conventional differentiation factors can be used in different ratios for direct cross-differentiation.

[0112] As a specific example, when Gsta4, Hb9 and Lhx3 are used, they can be used in a ratio of 1:1:1, 2:1:1, 2:1:2 or 1:2:1.

[0113] 3. Compositions containing Gsta4 Overview of compositions containing Gsta4 The present application discloses a composition essentially comprising Gsta4, which is a novel differentiation factor as described above.

[0114] As an example, the composition may include only Gsta4 alone.

[0115] In another example, the composition can include a combination of Gsta4 and a conventional differentiation factor, such as those described above under combination examples (1) to (8).

[0116] In this case, each differentiation factor can be included in the composition as an amino acid sequence constituting each protein.

[0117] Alternatively, each differentiation factor can be included in the composition as a nucleic acid sequence encoding the respective protein.

[0118] In one embodiment, the amino acid sequence of the Gsta4 protein can be SEQ ID NO:1, and the nucleic acid encoding the Gsta4 protein can have the sequence of SEQ ID NO:2 or SEQ ID NO:12.

[0119] In one embodiment, the amino acid sequence of the Ascl1 protein can be SEQ ID NO:17, and the nucleic acid encoding the Ascl1 protein can have the sequence of SEQ ID NO:18.

[0120] In one embodiment, the amino acid sequence of the Brn2 protein can be SEQ ID NO:19, and the nucleic acid encoding the Brn2 protein can have the sequence of SEQ ID NO:20.

[0121] In one embodiment, the amino acid sequence of the Myt1L protein can be SEQ ID NO:21, and the nucleic acid encoding the Myt1L protein can have the sequence of SEQ ID NO:22.

[0122] In one embodiment, the amino acid sequence of the Hb9 protein can be SEQ ID NO:13, and the nucleic acid encoding the Hb9 protein can have the sequence of SEQ ID NO:14.

[0123] In one embodiment, the amino acid sequence of the Isl1 protein can be SEQ ID NO:23, and the nucleic acid encoding the Isl1 protein can have the sequence of SEQ ID NO:24.

[0124] In one embodiment, the amino acid sequence of the Lhx3 protein can be SEQ ID NO:15, and the nucleic acid encoding the Lhx3 protein can have the sequence of SEQ ID NO:16.

[0125] In one embodiment, the Ngn2 protein can be SEQ ID NO:25 and the nucleic acid encoding the Ngn2 protein can have the sequence of SEQ ID NO:26.

[0126] In one embodiment, the amino acid sequence of the NeuroD1 protein can be SEQ ID NO:27, and the nucleic acid encoding the NeuroD1 protein can have the sequence of SEQ ID NO:28.

[0127] The composition will now be described in more detail.

[0128] Composition examples Composition (1): Contains Gsta4 alone The compositions of the present application can include a Gsta4 protein or a nucleic acid encoding same.

[0129] Furthermore, the composition of the present application may contain the protein variant or the nucleic acid variant.

[0130] Composition (2): Contains Gsta4 + 1 conventional differentiation factor The composition of the present application comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) a protein selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or a nucleic acid encoding said selected protein; may include.

[0131] For example, the composition comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Ascl1 protein or a nucleic acid encoding the same;

[0132] For example, the composition comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Brn2 protein or a nucleic acid encoding the same;

[0133] For example, the composition comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Myt1L protein or a nucleic acid encoding same.

[0134] For example, the composition comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Hb9 protein or a nucleic acid encoding the same;

[0135] For example, the composition comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Isl1 protein or a nucleic acid encoding the same;

[0136] At this time, For example, the composition comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) It may contain Lhx3 protein or a nucleic acid encoding the same.

[0137] For example, the composition comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Ngn2 protein or a nucleic acid encoding same;

[0138] For example, the composition comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) NeuroD1 protein or a nucleic acid encoding the same.

[0139] Composition (3): Contains Gsta4 + 2 conventional differentiation factors

[0140] The composition of the present application comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) two proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or a nucleic acid encoding said two selected proteins; may include.

[0141] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; and iii) Lhx3 protein or a nucleic acid encoding same; may include.

[0142] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; and iii) Ngn2 protein or a nucleic acid encoding same; may include.

[0143] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; and iii) Ngn2 protein or a nucleic acid encoding same; may include.

[0144] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; and iii) Isl1 protein or a nucleic acid encoding same; may include.

[0145] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; and iii) Isl1 protein or a nucleic acid encoding same; may include.

[0146] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) the Ngn2 protein or a nucleic acid encoding same; and iii) Isl1 protein or a nucleic acid encoding same; may include.

[0147] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; and iii) Ascl1 protein or a nucleic acid encoding same; may include.

[0148] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; and iii) Ascl1 protein or a nucleic acid encoding same; may include.

[0149] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) the Ngn2 protein or a nucleic acid encoding same; and iii) Ascl1 protein or a nucleic acid encoding same; may include.

[0150] Composition (4): Contains Gsta4 + 3 conventional differentiation factors

[0151] The composition of the present application comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) three proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or nucleic acids encoding the three selected proteins; may include.

[0152] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Brn2 protein or a nucleic acid encoding same; iii) Hb9 protein or a nucleic acid encoding same; and iv) NeuroD1 protein or a nucleic acid encoding same; may include.

[0153] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; and iv) Ngn2 protein or a nucleic acid encoding same; may include.

[0154] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; and iv) Isl1 protein or a nucleic acid encoding same; may include.

[0155] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; and iv) Ascl1 protein or a nucleic acid encoding same; may include.

[0156] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; and iv) Brn2 protein or a nucleic acid encoding same; may include.

[0157] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; and iv) Myt1L protein or a nucleic acid encoding same; may include.

[0158] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; and iv) NeuroD1 protein or a nucleic acid encoding same; may include.

[0159] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; and iv) Isl1 protein or a nucleic acid encoding same; may include.

[0160] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; and iv) Ascl1 protein or a nucleic acid encoding same; may include.

[0161] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; and iv) Isl1 protein or a nucleic acid encoding same; may include.

[0162] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; and iv) Ascl1 protein or a nucleic acid encoding same; may include.

[0163] Composition (5): Contains Gsta4 + 4 conventional differentiation factors

[0164] The composition of the present application comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) four proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or nucleic acids encoding said four selected proteins; may include.

[0165] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Ascl1 protein or a nucleic acid encoding same; iii) Brn2 protein or a nucleic acid encoding same; iv) Myt1L protein or a nucleic acid encoding same; and v) Hb9 protein or a nucleic acid encoding same; may include.

[0166] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; and v) Isl1 protein or a nucleic acid encoding same; may include.

[0167] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; and v) Ascl1 protein or a nucleic acid encoding same; may include.

[0168] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; and v) Brn2 protein or a nucleic acid encoding same; may include.

[0169] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; and v) Myt1L protein or a nucleic acid encoding same; may include.

[0170] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; and v) NeuroD1 protein or a nucleic acid encoding same; may include.

[0171] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; and v) Ascl1 protein or a nucleic acid encoding same; may include.

[0172] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Ascl1 protein or a nucleic acid encoding the same; and v) Brn2 protein or a nucleic acid encoding same; may include.

[0173] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; and v) Ascl1 protein or a nucleic acid encoding same; may include.

[0174] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; v) Brn2 protein or a nucleic acid encoding same; may include.

[0175] Composition (6): Contains Gsta4 + 5 conventional differentiation factors

[0176] The composition of the present application comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) five proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or nucleic acids encoding said five selected proteins; may include.

[0177] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Ascl1 protein or a nucleic acid encoding same; iii) Brn2 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; and vi) Lhx3 protein or a nucleic acid encoding same; may include.

[0178] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; and vi) Ascl1 protein or a nucleic acid encoding same; may include.

[0179] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; and vi) Brn2 protein or a nucleic acid encoding same; may include.

[0180] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; and vi) Myt1L protein or a nucleic acid encoding same; may include.

[0181] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; and vi) NeuroD1 protein or a nucleic acid encoding same; may include.

[0182] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) Brn2 protein or a nucleic acid encoding same; may include.

[0183] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) Myt1L protein or a nucleic acid encoding same; may include.

[0184] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) NeuroD1 protein or a nucleic acid encoding same; may include.

[0185] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) Brn2 protein or a nucleic acid encoding same; may include.

[0186] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) Myt1L protein or a nucleic acid encoding same; may include.

[0187] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) NeuroD1 protein or a nucleic acid encoding same; may include.

[0188] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) Brn2 protein or a nucleic acid encoding same; may include.

[0189] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) Myt1L protein or a nucleic acid encoding same; may include.

[0190] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) NeuroD1 protein or a nucleic acid encoding same; may include.

[0191] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) Brn2 protein or a nucleic acid encoding same; may include.

[0192] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) Myt1L protein or a nucleic acid encoding same; may include.

[0193] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; and vi) NeuroD1 protein or a nucleic acid encoding same; may include.

[0194] Composition (7): Contains Gsta4 + 6 conventional differentiation factors

[0195] The composition of the present application comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) six proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or nucleic acids encoding the six selected proteins; may include.

[0196] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Ascl1 protein or a nucleic acid encoding same; iii) Brn2 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; vi) Lhx3 protein or a nucleic acid encoding same; and vii) Myt1L protein or a nucleic acid encoding same; may include.

[0197] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; vi) Ascl1 protein or a nucleic acid encoding same; and vii) Brn2 protein or a nucleic acid encoding same; may include.

[0198] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; vi) Ascl1 protein or a nucleic acid encoding same; and vii) Myt1L protein or a nucleic acid encoding same; may include.

[0199] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; vi) Ascl1 protein or a nucleic acid encoding same; and vii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0200] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; and vii) Myt1L protein or a nucleic acid encoding same; may include.

[0201] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; and vii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0202] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; and vii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0203] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; and vii) Myt1L protein or a nucleic acid encoding same; may include.

[0204] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; and vii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0205] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; and vii) Myt1L protein or a nucleic acid encoding same; may include.

[0206] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; and vii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0207] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; and vii) Myt1L protein or a nucleic acid encoding same; may include.

[0208] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; and vii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0209] Composition (8): Contains Gsta4 + 7 conventional differentiation factors

[0210] The composition of the present application comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) seven proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or nucleic acids encoding the seven selected proteins; may include.

[0211] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Brn2 protein or a nucleic acid encoding same; iii) Myt1L protein or a nucleic acid encoding same; iv) Hb9 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; vi) Lhx3 protein or a nucleic acid encoding same; vii) Ngn2 protein or a nucleic acid encoding same; and viii) Ascl1 protein or a nucleic acid encoding same; may include.

[0212] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding the same ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; vi) Ascl1 protein or a nucleic acid encoding same; vii) Brn2 protein or a nucleic acid encoding same; and viii) Myt1L protein or a nucleic acid encoding same; may include.

[0213] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; vi) Ascl1 protein or a nucleic acid encoding same; vii) Brn2 protein or a nucleic acid encoding same; and viii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0214] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; vii) Myt1L protein or a nucleic acid encoding same; and viii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0215] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; vii) Myt1L protein or a nucleic acid encoding same; and viii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0216] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; vi) Ascl1 protein or a nucleic acid encoding same; vii) Myt1L protein or a nucleic acid encoding same; and viii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0217] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Ngn2 protein or a nucleic acid encoding same; v) Isl1 protein or a nucleic acid encoding same; vi) Ascl1 protein or a nucleic acid encoding same; vii) Brn2 protein or a nucleic acid encoding same; and viii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0218] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Lhx3 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; vii) Myt1L protein or a nucleic acid encoding same; and viii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0219] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Hb9 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; vii) Myt1L protein or a nucleic acid encoding same; and viii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0220] For example, the composition comprises: i) Gsta4 protein or a nucleic acid encoding same; ii) Lhx3 protein or a nucleic acid encoding same; iii) Ngn2 protein or a nucleic acid encoding same; iv) Isl1 protein or a nucleic acid encoding same; v) Ascl1 protein or a nucleic acid encoding same; vi) Brn2 protein or a nucleic acid encoding same; vii) Myt1L protein or a nucleic acid encoding same; and viii) NeuroD1 protein or a nucleic acid encoding same; may include.

[0221] Composition (9): Contains Gsta4 + 8 conventional differentiation factors

[0222] The composition of the present application comprises: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1 proteins; or nucleic acids encoding same; may include.

[0223] Here, the composition may include, but is not limited to, a protein form, a nucleic acid form, or a mixture of protein and nucleic acid, and the nucleic acid may be DNA, RNA, or a mixture of DNA and RNA.

[0224] In one example, the composition may contain all of the factors in protein form.

[0225] In another example, the composition may contain all of the included factors in the form of nucleic acids.

[0226] In another example, the composition may contain some of the factors in protein form and other factors in nucleic acid form.

[0227] In this case, the nucleic acid may be in the form of a vector, and the vector may consist of one or more vectors.

[0228] The composition can also include a viral capsid.

[0229] In this case, the differentiation factor can be delivered by being contained in the viral capsid.

[0230] As an example, the pharmaceutical composition of the present application may include a viral capsid that contains a Gsta4 gene alone.

[0231] In another embodiment, the composition comprises a viral capsid that contains Gsta4; and It may also comprise a viral capsid containing one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

[0232] Vector for expression of converting factor For example, the composition may include a vector for expressing a differentiation factor. In this case, the vector may include a nucleic acid encoding a Gsta4 protein. Alternatively, the vector may further include a nucleic acid encoding a conventional differentiation factor in addition to the nucleic acid encoding the Gsta4 protein.

[0233] The vector has the function of effectively expressing the desired differentiation factor in the target cell, and may further include other necessary additional components such as a promoter and an enhancer for this purpose.

[0234] Essential components of the vector - nucleic acid encoding the Gsta4 protein The vector essentially contains a nucleic acid encoding the Gsta4 protein.

[0235] The encoding nucleic acid may be the full length or a partial sequence of the Gsta4 gene.

[0236] For example, the partial sequence may be an exon sequence of Gsta4. In this case, the exon sequence may be a CDS (Coding Sequence) sequence in which introns are excluded from the sequence of the Gsta4 gene.

[0237] As an example, the vector may comprise the DNA sequence of SEQ ID NO:2 or SEQ ID NO:12.

[0238] Selective construction of vectors - nucleic acids encoding conventional differentiation factors The vector may optionally further contain a nucleic acid encoding a conventional differentiation factor in addition to the nucleic acid encoding the Gsta4 protein. The nucleic acids encoding the Gsta4 and conventional differentiation factors may be contained in one vector or in two or more vectors.

[0239] In one embodiment, the vector can include a nucleic acid encoding a combination of Gsta4 and a differentiation factor selected from the combinations of conventional differentiation factors (1) to (8).

[0240] For example, the vector i) a sequence selected from SEQ ID NO: 2 and SEQ ID NO: 12; and ii) one sequence selected from among SEQ ID NOs: 14, 16, 18, 20, 22, 24, 26, and 28;

[0241] For example, the expression vector may be i) a sequence selected from SEQ ID NO: 2 and SEQ ID NO: 12; and ii) two sequences selected from among SEQ ID NOs: 14, 16, 18, 20, 22, 24, 26, and 28;

[0242] For example, the expression vector may be i) a sequence selected from SEQ ID NO: 2 and SEQ ID NO: 12; and ii) three sequences selected from among SEQ ID NOs: 14, 16, 18, 20, 22, 24, 26, and 28;

[0243] For example, the expression vector may be i) a sequence selected from SEQ ID NO: 2 and SEQ ID NO: 12; and ii) four sequences selected from among SEQ ID NOs: 14, 16, 18, 20, 22, 24, 26, and 28;

[0244] For example, the expression vector may be i) a sequence selected from SEQ ID NO: 2 and SEQ ID NO: 12; and ii) five sequences selected from among SEQ ID NOs: 14, 16, 18, 20, 22, 24, 26, and 28;

[0245] For example, the expression vector may be i) a sequence selected from SEQ ID NO: 2 and SEQ ID NO: 12; and ii) six sequences selected from among SEQ ID NOs: 14, 16, 18, 20, 22, 24, 26, and 28;

[0246] For example, the expression vector may be i) a sequence selected from SEQ ID NO: 2 and SEQ ID NO: 12; and ii) seven sequences selected from among SEQ ID NOs: 14, 16, 18, 20, 22, 24, 26, and 28;

[0247] For example, the expression vector may be i) a sequence selected from SEQ ID NO: 2 and SEQ ID NO: 12; and ii) the sequences of SEQ ID NOs: 14, 16, 18, 20, 22, 24, 26 and 28;

[0248] Additional component of vector (1)

[0249] The vector may contain, in addition to the essential and optional components of the target protein, additional components necessary for the expression of differentiation factors in cells.

[0250] For example, the additional components may include expression regulatory elements, selection elements, and the like.

[0251] The expression regulatory element may be a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an internal ribosome entry site (IRES), a 2A self-cleaving peptide, or the like.

[0252] For example, the promoter may be an SV40 early promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an Ad MLP (adenovirus major late) promoter, an HSV (herpes simplex virus) promoter, a CMV (cytomegalovirus) promoter, an RSV (roussarcoma virus) promoter, a U6 promoter, etc.

[0253] For example, the 2A self-cleaving peptide can be T2A, P2A, E2A, F2A, etc. The vector for expressing the differentiation factor can contain one or more 2A self-cleaving peptides. In this case, the 2A self-cleaving peptide produces multiple proteins from the same transcript. Therefore, the 2A self-cleaving peptide can be located between two or more different proteins to be expressed in the vector.

[0254] The selection element can be a fluorescent protein gene, a tag, a reporter gene, an antibiotic resistance gene, or the like.

[0255] For example, the fluorescent protein gene may be a GFP gene, a YFP gene, an RFP gene, or an mCherry gene.

[0256] For example, the tag can be a histidine (His) tag, a V5 tag, a FLAG tag, an influenza hemagglutinin (HA) tag, a Myc tag, a VSV-G tag, a thioredoxin (Trx) tag, and the like.

[0257] For example, the reporter gene can be glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, and the like.

[0258] For example, the antibiotic resistance gene may be a hygromycin resistant gene, a neomycin resistant gene, a kanamycin resistant gene, a blasticidin resistant gene, a zeocin resistant gene, or the like.

[0259] The vectors of the present application can be utilized to effectively express a desired differentiation factor, including selective constructs and additional constructs.

[0260] In one embodiment, when a vector of the present application comprises a nucleic acid encoding a Gsta4 protein, the vector can consist of the sequence of SEQ ID NO:36.

[0261] In one embodiment, when an expression vector contains a nucleic acid encoding a Gsta4 protein and a nucleic acid encoding a Myt1l protein, the vector may be made with the sequence of SEQ ID NO:5.

[0262] In another embodiment, when an expression vector includes a nucleic acid encoding a Gsta4 protein; a nucleic acid encoding an MNX1 protein; and a nucleic acid encoding an LHX3 protein, the vector may be made with the sequence of SEQ ID NO:29.

[0263] Additional vector configuration (2) (knock-in configuration)

[0264] In another embodiment, the expression vector may further comprise an additional component (2) for knocking in a differentiation factor into the genome of a subject.

[0265] The knock-in technique refers to the insertion of a differentiation factor into the genome of a target cell. In this case, the expression of the inserted differentiation factor is sustained in the cell, which can further increase the efficiency of differentiation of the target cell (e.g., somatic cell) into a motor neuron.

[0266] In one embodiment, the differentiation factor can be knocked into a safe harbor region in the genome of a target cell.

[0267] The safe harbor refers to a genetic locus where an exogenous differentiation factor can be inserted into a specific region of a subject's genome without inducing side effects and where the expression of the differentiation factor can be sustained.

[0268] For example, the safe harbor may be a locus region encoding AAVS1, ROSA26, etc. in the genomic sequence of the subject cell.

[0269] The knock-in of the differentiation factor can be performed by methods known in the art.

[0270] As a specific example, the method can utilize a transposable element (TE) system, a CRISPR / Cas system, or the like.

[0271] The transposable element system utilizes DNA fragments that can be translocated within a dielectric.

[0272] For example, the transposable element system can include a piggyBac transposable element, a Sleeping Beauty transposable element, and the like.

[0273] The CRISPR / Cas system may be composed of a Cas protein, a guide RNA, a donor, etc. In this case, the donor may include (i) a differentiation factor to be expressed, and (ii) a sequence having homology to a partial sequence of a safe harbor gene in the genome of the target cell. In this case, the sequence having homology to a partial sequence of the safe harbor gene in (ii) may function as a homology arm at each end of the donor.

[0274] For example, the Cas protein and guide RNA form a complex to cause a double strand break (DSB) cleavage in a safe harbor gene sequence in the genome of a target cell, and at this time, a differentiation factor (donor) sequence having homologous sequences at both ends can be inserted into the cleavage site by homologous recombination (HDR). At this time, the two homologous sequences are a sequence that has homology to a partial upstream sequence and a sequence that has homology to a partial downstream sequence centered on the cleavage site.

[0275] Vector types In one example, the vector can be a viral vector.

[0276] For example, the viral vector may be a retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), veccinia virus, fox virus, HIV (Human immunodeficiency virus), MLV (Murine leukemia virus), ASLV (Avian sarcoma / leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), Herpes simplex virus, episomal or simplex virus, etc. Preferably, it may be an adenovirus or adeno-associated virus (AAV).

[0277] In other instances, the vector can be a non-viral vector.

[0278] By way of example, the non-viral vector may be a plasmid, a phage, naked DNA, a DNA-lipid complex, a DNA-polymer complex, or mRNA.

[0279] 4. Direct Cross Differentiation Method Overview of direct cross differentiation methods In another aspect of the present invention, there is provided a method for direct cross-differentiation of somatic cells into motor neurons using the composition for expression of the differentiation factors described above.

[0280] Thus, the present application discloses a method for direct cross-differentiation utilizing a composition comprising Gsta4.

[0281] By using the composition, the target cells can be directly cross-differentiated without a retrodifferentiation step, and can be converted into motor neurons. The direct cross-differentiation method can be appropriately selected by a person skilled in the art from the methods disclosed, and is not particularly limited as long as it can achieve the intended purpose.

[0282] In one embodiment, the direct cross-differentiation method includes introducing a composition selected from compositions (1) to (9) into a subject cell.

[0283] At this time, the composition is characterized by essentially containing Gsta4,

[0284] The above direct cross-differentiation method does not have the effect of retrodifferentiating the target cells into induced pluripotent stem cells (iPSCs).

[0285] In an optional embodiment, the direct cross-differentiation method of the present application can include introducing into a subject cell a vector containing a nucleic acid encoding a Gsta4 protein.

[0286] In any embodiment, the direct cross-differentiation method of the present application A Gsta4 protein; or a nucleic acid encoding the same; and The method may include introducing into a subject cell a vector comprising one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or a nucleic acid encoding the selected protein.

[0287] In one embodiment, the direct cross-differentiation method of the present application may include introducing a vector containing a nucleic acid encoding a Gsta4 protein, a nucleic acid encoding an Lhx3 protein, and a nucleic acid encoding an Hb9 protein into a target cell.

[0288] Target cells for direct cross differentiation (starting cells) The direct cross-differentiation that the present application aims to achieve involves introducing the factors of the present application into "differentiated cells" to directly convert them into the desired cells.

[0289] The differentiated cells that are the target cells used in the direct cross-differentiation method of the present application can be somatic cells, which means all cells except germ cells.

[0290] For example, the somatic cells may be fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (Gcells), B cells, hepatic cells, astrocytes, blood cells, rare dendritic precursor cells, etc.

[0291] The somatic cells can be derived from or isolated from mammals such as humans, dogs, cats, horses, sheep, rabbits, pigs, mice and camels.

[0292] As an example, the direct cross differentiation method of the present application includes: introducing into the somatic cells a composition for expression of a differentiation factor for said directed cross-differentiation.

[0293] In this case, the somatic cells may be somatic cells that have been cultured for a certain period of time prior to introduction of the composition.

[0294] The differentiation method may further include a step of culturing the somatic cells into which the composition has been introduced in a culture medium for neural cell differentiation.

[0295] The following describes the culture medium for somatic cell culture, the culture medium for neural cell differentiation, the differentiation period (i.e., the period during which somatic cells into which the composition has been introduced are cultured), the introduction method, etc., used in the differentiation method.

[0296] Culture medium The culture medium may be a culture medium for somatic cell culture or a culture medium for neural cell differentiation depending on the purpose.

[0297] The culture medium for somatic cell culture and the culture medium for neural cell differentiation may be any culture medium known in the art. In addition, the culture medium may be appropriately modified for a specific purpose. For example, in order to increase the efficiency of direct cross-differentiation, which is the object of the present application, the carbon source, nitrogen source, trace elements, growth factors, etc. known in the art may be appropriately adjusted and used.

[0298] For example, the culture medium can be DMEM, MEM, RPMI-1640, Ham's F-10, or Ham's F-12, and the like.

[0299] Cell confluence, culture period and chicken culture In the culture of somatic cells, the cells can be cultured at an adjusted confluence so as to facilitate experiments.

[0300] In this case, the confluence of the somatic cells can be appropriately adjusted depending on the state before the introduction of the composition or the state after the introduction of the composition.

[0301] The somatic cells can be cultured until the cell confluence reaches about 60% to 100%, preferably until the somatic cell confluence reaches about 80% to 100%.

[0302] In addition, the somatic cell culture can be cultured for about 12 to 60 hours so as to reach a suitable confluence for easy experimentation, but is not limited thereto.

[0303] The somatic cell culture may be subcultured 1 to 3 times to achieve the appropriate confluence, but is not limited thereto.

[0304] Order of introduction of each component of the composition for expression of differentiation factors In the direct cross-differentiation method, the order of introducing the composition selected from composition (1) to composition (9) into the target cells is not particularly limited. For example, when the composition contains two or more differentiation factors, they may be introduced into the target cells simultaneously or sequentially.

[0305] For example, the direct cross-differentiation method of the present application can include simultaneously or sequentially introducing an expression vector containing a nucleic acid encoding a Gsta4 protein, an expression vector containing a nucleic acid encoding an Lhx3 protein, and an expression vector containing a nucleic acid encoding an Hb9 protein.

[0306] Method for introducing a composition for expression of a differentiation factor into a subject cell

[0307] In the direct cross-differentiation method, a composition for expressing a differentiation factor for the direct cross-differentiation can be introduced into a target cell by a person skilled in the art by appropriately selecting a known technique.

[0308] For example, the composition can be introduced into cells using electroporation, gene gun, ultrasonic poration, magnetofection, microinjection, temporary cell compression or squeezing, cationic liposome method, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (Polyethyleneimine)-mediated transfection, DEAE-dextran-mediated transfection, and the like, but is not limited thereto.

[0309] Characteristics of somatic cells transfected with compositions for expression of differentiation factors

[0310] Somatic cells into which the composition for expressing a differentiation factor provided by the present application has been introduced are in a state in which the expression of the differentiation factor and the expression of neural cell markers increase over the course of the culture period.

[0311] The neuronal markers can be NEUN, ChAT, Map2, Hb9, Synapsin, Tuj1, IsL1, PAX6, Olig2, Nkx2.2, SMI-32, etc.

[0312] For example, somatic cells into which a composition for expressing a differentiation factor of the present application has been introduced may show increased expression of one or more neural cell markers selected from NEUN, ChAT, Map2, Hb9, and Synapsin on the third day of the culture period compared to the first day.

[0313] differentiation period

[0314] When a differentiation factor is introduced into a somatic cell using the above-mentioned direct cross-differentiation method, the somatic cell is transformed into a motor neuron after a suitable time has passed. The differentiation environment can be maintained by modifying the medium until the somatic cell is transformed into a motor neuron. The suitable time can be determined depending on the target cell.

[0315] For example, fibroblasts transfected with a composition for expression of a differentiation factor can be transformed into motor neurons within about 7 to 30 days.

[0316] As another example, astrocytes transfected with a composition for expression of a differentiation factor can be transformed into motor neurons within about 7 to 30 days.

[0317] Direct cross-differentiation method results

[0318] Using the direct cross differentiation method of the present application, it is possible to obtain motor neurons induced by direct crossing of somatic cells. Motor neurons are nerve cells that transmit motor stimuli generated in the brain and spinal cord to muscles and glands.

[0319] In particular, the induced motor neuron in which the direct cross-differentiation factor of the present application is introduced into somatic cells has an expression characteristic in which the differentiation factor is over-expressed in the cells. Therefore, due to the over-expression environment of such differentiation factor, the induced motor neuron can also have the characteristic of over-expressing neuronal markers.

[0320] The direct cross-differentiation factors may be, but are not limited to, Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), NeuroD1 (Neuronal Differentiation 1), etc.

[0321] For example, Gsta4 is overexpressed in motor neurons obtained by the above-mentioned direct cross differentiation.

[0322] For example, in the motor neurons obtained by the above-mentioned direct cross differentiation, the direct cross differentiation factors Gsta4 and one or more selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Neuren(2), and NeuroD1 (Neuronal Differentiation 1) are overexpressed.

[0323] Moreover, overexpression of such differentiation factors leads to increased expression of neuronal marker proteins in motor neurons, such as, but not limited to, NEUN, ChAT, Map2, Synapsin, HB9, Tuj1, IsL1, Notch1, HES1, HES3, E-cadherin, occludin, PAX6, N-cadherin, SOX2, etc.

[0324] For example, the motor neurons obtained by the above-mentioned direct cross differentiation can overexpress one or more neuronal markers among ChAT, Map2, Hb9, and Synapsin.

[0325] As another example, motor neurons obtained by the above-mentioned direct cross differentiation may be induced to overexpress one or more of Tuj1, IsL1, and NEUN.

[0326] Confirmation of direct cross differentiation results The direct cross-differentiation method of the present application can additionally include a step of selectively confirming conversion to motor neurons.

[0327] In this case, the identification process can be performed using a neuronal marker known in the art, and can be performed through various molecular biology techniques known in the art, such as, but not limited to, immunofluorescence staining, Western blot, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), enzyme-linked immunosorbent assay (ELISA), etc.

[0328] Characteristics of the direct cross-differentiation method of the present application (1) The direct cross-differentiation method disclosed in the present application is characterized in that it does not generate induced pluripotent stem cells (iPSCs), i.e., it is characterized in that it directly induces the conversion of somatic cells into the desired motor neurons without going through the induced pluripotent stem cell stage by the retrodifferentiation process of somatic cells.

[0329] For example, somatic cells such as fibroblasts or astrocytes can be directly differentiated into motor neurons by treating them with Gsta4 alone or with Gsta4 together with conventional differentiation factors.

[0330] Characteristics of the direct cross-differentiation method of the present application (2) In addition, as described above, the method of the present application does not go through the induced pluripotent stem cell stage, so there is an advantage in that there is a low possibility of teratoma formation in the target cells. In other words, it is a method that significantly reduces the probability of teratoma formation, which is a problem with the use of conventional stem cells. This advantage suggests that the method of the present application may be more useful for treating nervous system diseases.

[0331] Characteristics of the direct cross-differentiation method of the present application (3) The direct cross-differentiation method disclosed in this application contributes greatly to improving the differentiation efficiency, which is a problem with conventional differentiation factors. In particular, the direct differentiation efficiency of motor neurons can be significantly improved by treating fibroblasts or astrocytes with both Gsta4 and conventional differentiation factors, rather than treating them with conventional differentiation factors alone.

[0332] 5. Pharmaceutical composition for direct cross-differentiation containing Gsta4 Overview of pharmaceutical compositions containing Gsta4 for direct cross-differentiation In addition, the present application discloses a pharmaceutical composition selected from the above compositions (1) to (9) for the treatment of neurological disorders. The components that the pharmaceutical composition may contain and specific indications for therapeutic use are disclosed below.

[0333] Active Ingredients of the Pharmaceutical Composition The active ingredient of the pharmaceutical composition of the present application can be any one or more of the following:

[0334] (1) Differentiation factor of the present application (2) Somatic cells containing the differentiation factor of the present application (3) Motor neurons induced using the differentiation factors of the present application

[0335] In this case, the differentiation factor may be Gsta4 alone or a combination of Gsta4 and a conventional differentiation factor, wherein the conventional differentiation factor is one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0336] The differentiation factor (1) may be in the form of a protein or a nucleic acid.

[0337] As an example, the pharmaceutical composition for preventing or treating a nervous system disease of the present application may contain a Gsta4 protein or a nucleic acid encoding the same.

[0338] As another example, a pharmaceutical composition for preventing or treating a nervous system disease of the present application may include a Gsta4 protein or a nucleic acid encoding the same; an Hb9 protein or a nucleic acid encoding the same; and an Lhx3 protein or a nucleic acid encoding the same.

[0339] As another example, the pharmaceutical composition for preventing or treating nervous system diseases of the present application may include Gsta4 protein or a nucleic acid encoding the same; Hb9 protein or a nucleic acid encoding the same; Lhx3 protein or a nucleic acid encoding the same; and Ngn2 protein or a nucleic acid encoding the same.

[0340] In this case, the (1) differentiation factor can be delivered by being contained in a viral capsid. As an example, the pharmaceutical composition of the present application can include a viral capsid containing a Gsta4 gene alone. As another example, the composition can include a viral capsid containing Gsta4, a viral capsid containing Hb9, and a viral capsid containing Lhx3 together. When the pharmaceutical composition of the present application includes a viral capsid containing the differentiation factor, it can be used as a kind of gene therapy agent.

[0341] In addition, the (2) somatic cells containing a differentiation factor may be i) somatic cells into which a vector containing a nucleic acid encoding a differentiation factor has been introduced; or ii) somatic cells into which a differentiation factor protein has been introduced. When the somatic cells containing the differentiation factor of the present application are contained as an active ingredient, they can be used as a type of cell therapy. A cell therapy refers to a therapy that uses autologous, allogenic, or xenogenic "cells" as an active ingredient to restore tissue function.

[0342] As an example, the pharmaceutical composition for preventing or treating a nervous system disease of the present application may include a somatic cell into which a vector containing a nucleic acid encoding a Gsta4 protein has been introduced. The pharmaceutical composition for preventing or treating a nervous system disease of the present application may include a somatic cell into which a Gsta4 protein has been introduced.

[0343] As another example, the pharmaceutical composition for preventing or treating a nervous system disease of the present application may include a somatic cell into which a vector containing a nucleic acid encoding a Gsta4 protein, a nucleic acid encoding a Hb9 protein, and a nucleic acid encoding a Lhx3 protein has been introduced. The pharmaceutical composition for preventing or treating a nervous system disease of the present application may include a somatic cell into which a Gsta4 protein, a Hb9 protein, and a Lhx3 protein have been introduced.

[0344] In addition, the motor neuron induced using the differentiation factor (3) is a motor neuron generated by direct cross-differentiation of somatic cells using the above-mentioned [4. Direct cross-differentiation method]. When the induced motor neuron of the present application is contained as an active ingredient, it can be used as another type of cell therapy agent.

[0345] Pharmaceutically acceptable extra components

[0346] The pharmaceutical composition may further include pharma- ceutically acceptable additional components other than the active ingredient, such as, but not limited to, carriers, excipients, diluents, preservatives, etc.

[0347] For example, the carriers, excipients and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, distilled water, saline, glycerol, ethanol, HSA (Humanserumalbumin) and the like.

[0348] For example, the preservatives are benzoic acid, sodium benzoate, sorbic acid, paraoxybenzoic acid, chlorobutanol, and the like.

[0349] When the pharmaceutical composition is formulated, it may further include a filler, an extender, a binder, a wetting agent, and the like.

[0350] Formulation of pharmaceutical compositions The pharmaceutical compositions can be formulated for oral or parenteral use.

[0351] For example, when formulated for oral administration, the formulation may be prepared in a solid, liquid, capsule, semi-solid form, or the like.

[0352] As another example, when the composition is formulated for parenteral use, it may be produced as an injection, an aerosol, etc. Preferably, the composition can be formulated as an injection.

[0353] Target Diseases of the Pharmaceutical Composition

[0354] The pharmaceutical composition can be applied to nervous system diseases. In particular, the pharmaceutical composition can be used for treating or preventing nervous system diseases. The nervous system diseases of the present application can be caused by nerve cell damage or diseases induced thereby.

[0355] For example, the nervous system disease may be, but is not limited to, spinal cord injury, Parkinson's disease, stroke, Huntington's disease, Lou Gehrig's disease, ataxia telangiectasia, amyotrophic lateral sclerosis, motor nerve injury, peripheral nerve injury due to trauma, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, peripheral paralysis, central paralysis, quadriplegia, diplegia, epilepsy, neuronal development disorder, neuralgia, intractable epilepsy, Alzheimer's disease, congenital metabolic nervous system disease, and traumatic brain injury, motor neuron injury or a disease induced thereby, etc. Preferably, the nervous system disease may be selected from spinal cord injury, Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis, peripheral paralysis, central paralysis, quadriplegia, and diplegia.

[0356] 6. Treatment of nervous system diseases Overview of treatment methods for nervous system disorders A method for treating nervous system diseases using the above-mentioned [5. Pharmaceutical composition for direct cross-differentiation containing Gsta4] is disclosed.

[0357] As described above, the pharmaceutical composition comprises: Gsta4 or Gsta4 and one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; Includes.

[0358] The method for treating nervous system diseases of the present application can be carried out by (i) administering the composition directly to a subject (patient), (ii) administering somatic cells into which the composition has been introduced to a subject, or (iii) generating ex vivo induced motor neurons and administering the generated motor neurons to a subject. In this case, the method (i) can have the effect of generating in vivo induced motor neurons in the body of a subject.

[0359] Treatment method (1) The method for treating a nervous system disease may involve administering the "pharmaceutical composition" of the present application to a subject in need of treatment or prevention of a nervous system disease, thereby generating induced motor neurons in vivo.

[0360] As an example, the method of treating a nervous system disorder of the present application includes: The method can include administering to a subject a composition comprising a Gsta4 protein or a nucleic acid encoding the same;

[0361] As another example, the method of treating a nervous system disorder of the present application includes: i) Gsta4 protein; and ii) one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; administering to a subject a composition comprising:

[0362] Treatment method (2) A method for treating a nervous system disease comprises administering to a subject "somatic cells" into which a pharmaceutical composition of the present application has been introduced.

[0363] As an example, the method of treating a nervous system disorder of the present application includes: administering to a subject somatic cells into which a composition containing a Gsta4 protein or a nucleic acid encoding the same has been introduced; may include.

[0364] As another example, the method of treating a nervous system disorder of the present application includes: i) a Gsta4 protein or a nucleic acid encoding the same; and ii) one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or a nucleic acid encoding said protein; administering to a subject the transduced somatic cells in a composition comprising the may include.

[0365] As described above, when the somatic cells into which the composition of the present application has been introduced are administered to a subject, the somatic cells are directly cross-differentiated into motor neurons in the subject's body by the differentiation factors introduced into the somatic cells, and thus the motor neurons proliferate in the subject to which the composition has been administered, thereby treating or preventing nervous system diseases.

[0366] Treatment method (3) The method for treating nervous system diseases can be carried out by introducing the composition of the present application into isolated somatic cells to obtain directly cross-differentiated motor neurons ex vivo, and then administering the "motor neurons" to a subject in need of treatment or prevention of nervous system diseases, i.e., by administering the induced motor neurons of the present application to a subject as a direct active ingredient of a therapeutic agent.

[0367] As an example, the method of treating a nervous system disorder of the present application includes: administering to a subject motor neurons induced by introducing a composition containing a Gsta4 protein or a nucleic acid encoding the same into somatic cells; may include.

[0368] As another example, the method of treating a nervous system disorder of the present application includes: In somatic cells i) a Gsta4 protein or a nucleic acid encoding the same; and ii) one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or a nucleic acid encoding said protein; administering to a subject a composition comprising the compound, and induced motor neurons; may include.

[0369] Target of administration The subject of the method for treating a nervous system disease may be, but is not limited to, a subject whose motor neuron function is reduced compared to a healthy subject, or a subject whose disease is caused by a decrease in motor neurons.

[0370] The subject in need of treatment or prevention of a nervous system disorder may be a mammal, for example, a human, dog, horse, cat, mouse, rabbit, sheep, monkey, etc.

[0371] The administration method, administration dose, concentration of the pharmaceutical composition, and administration cycle described below may be determined taking into consideration the age, body weight, general health condition, diet, severity of the nervous system disease, whether or not other drugs are being taken, and treatment period of the subject.

[0372] Method of administration The method of treating a nervous system disorder can be administered to a subject via a variety of routes.

[0373] Administration can be oral or parenteral, where parenteral administration can be by injection.

[0374] The site of administration of the above-mentioned injection may be, but is not limited to, muscle, intradermal, subcutaneous, venous, abdominal cavity, artery, mucosa, spinal cord, bone marrow, intraspinal cavity, transdermal, etc.

[0375] As an example, when the administration site is the spinal cord, it may be L1 (lumbar 1), L2 (lumbar 2), L3 (lumbar 3), L4 (lumbar 4), L5 (lumbar 5), T1 (thoracic 1), T2 (thoracic 2), T3 (thoracic 3), T4 (thoracic 4), T5 (thoracic 5), T6 (thoracic 6), T7 (thoracic 7), C1 (cervical 1), C2 (cervical 2), C3 (cervical 3), C4 (cervical 4), C5 (cervical 5), etc.

[0376] As another example, it can be administered to the site itself where the nervous system disease occurs. As an optional example, it can be administered directly to the brain where Parkinson's disease occurs.

[0377] Concentration of the Pharmaceutical Composition

[0378] The concentration of the pharmaceutical composition may be as follows based on the total composition: In this case, the pharmaceutical composition may be in the form of a vector, a virus purified from a vector, a cell containing a vector, a protein, a cell containing a protein, etc., but is not limited thereto.

[0379] As an example, when the viral vector comprising the pharmaceutical composition of the present application is purified with a virus, it can be contained at the following concentrations based on the total composition.

[0380] For example, 1x10 based on the entire pharmaceutical composition 5 vg(viral genome) / mL or 1x10 20 May contain virus at concentrations of vg(viral genome) / mL.

[0381] For example, 1x10 based on the entire pharmaceutical composition 5 GC(genome copies) / mL or 1x10 20The virus may be contained in a concentration of vg (genome copies) / mL.

[0382] In another example, 1×10 5 VP(viral particle) / mL or 1x10 20 May contain virus at a concentration of VP (viral particle) / mL.

[0383] Dosage

[0384] The dosage of the pharmaceutical composition can be determined appropriately taking into consideration the administration method, subject, etc.

[0385] For example, the dosage may be 1 uL to 20 mL per administration, but is not limited thereto.

[0386] Specifically, the amount of the agent administered per spinal injection may be 1 uL / kg to 20 uL / kg, and the amount of the agent administered per intravenous injection may be 0.5 mL / kg to 10 mL / kg.

[0387] Administration Cycle

[0388] The frequency of administration of the pharmaceutical composition to a subject may vary depending on the disease and the severity of the disease.

[0389] The dosage may be once or several times a day, or may be administered several times over a long period of time, with the administration being spaced at regular intervals.

[0390] The administration interval may be 1 day to 60 days, etc. In this case, the administration may be continuous or discontinuous.

[0391] Confirmation of treatment effect

[0392] After administering the above-mentioned method for treating a nervous system disease to a subject, the effect of alleviating, improving, or treating the nervous system disease can be confirmed by various methods.

[0393] For example, this can be confirmed through scar reduction, changes in neuronal marker expression, BBB score, action potentials, spontaneous responses, etc.

[0394] As an example, the method for treating a nervous system disorder can be used to reduce scalyness by approximately 2- to 50-fold.

[0395] As another example, the method for treating a nervous system disorder may result in an increase in expression of neuronal markers of about 2-fold to about 50-fold.

[0396] As another example, the use of the methods for treating nervous system disorders may result in an increase in BBB score of about 2-fold to about 50-fold.

[0397] As another example, when the above-mentioned methods for treating nervous system disorders are used, action potentials or spontaneous responses may appear similar to those of normal individuals.

[0398] 7. Applications of Induced Motor Neurons Overview of uses of induced motor neurons

[0399] This application discloses various applications of the motor neurons obtained by the direct cross-differentiation method, including drug screening and biomaterial applications using the motor neurons.

[0400] Uses of Motor Neurons (1) - Drug Screening As an example, the present application discloses a drug screening application using the induced motor neurons, which can be particularly useful for screening of drugs for preventing and treating nervous system diseases.

[0401] The method can be useful for screening drugs for preventing and / or treating nervous system diseases, such as by confirming the reactivity of motor neurons before and after administration of a candidate drug to the induced motor neurons.

[0402] Uses of Motor Neurons (2) - Artificial Organs

[0403] As another example, the present application discloses an artificial organ containing the induced motor neurons. Organoids, which are created by inducing stem cells to develop into specific body organs and reproducing the organ in a similar manner outside the body, are also a type of artificial organ. The present application does not go through the induced pluripotent stem cell stage, so it can be used for artificial organs with fewer side effects than organoids that use stem cells.

[0404] The motor neurons of this application can be applied to 3D bioprinting, which involves building up layers of bioink using living cells in a 3D printing process to create artificial organs such as nerves, corneas, livers, skin, and blood vessels. Therefore, the induced motor neurons of this application can be 3D bioprinted to create artificial organs for treating nervous system diseases and injuries.

[0405] [Possible embodiments of the invention]

[0406] Example 1: Gsta4 alone 1. A composition for direct cross-differentiation of somatic cells into motor neural cells, said composition comprising: Gsta4 (Glutathione S-transferase A4) protein or a nucleic acid encoding the same; wherein the motor neuron is a motor neuron induced (differentiated) from the somatic cell.

[0407] A composition characterized by the direct cross-differentiation of somatic cells into induced motor neurons.

[0408] Example 2: Gsta4 + 1 conventional factor In embodiment 1, The composition comprises: A protein selected from the group consisting of Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2) and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding said protein; The composition may further comprise:

[0409] Example 3: Gsta4 + 2 conventional factors In embodiment 1, The composition comprises: two proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2) and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding said protein; The composition may further comprise:

[0410] Example 4: Gsta4 + 3 conventional factors In embodiment 1, The composition comprises: three proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2) and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding said protein; The composition may further comprise:

[0411] Example 5: Gsta4 + 4 conventional factors In embodiment 1, The composition comprises: four proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2) and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding said protein; The composition may further comprise:

[0412] Example 6: Gsta4 + 5 conventional factors In embodiment 1, The composition comprises: Five proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2) and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding said protein; The composition may further comprise:

[0413] Example 7: Gsta4 + 6 conventional factors In embodiment 1, The composition comprises: six proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2) and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding said protein; The composition may further comprise:

[0414] Example 8: Gsta4 + 7 conventional factors In embodiment 1, The composition comprises: Seven proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2) and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding said protein; The composition may further comprise:

[0415] Example 9: Gsta4 + 8 conventional factors In embodiment 1, The composition comprises: Seven proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2) and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding said protein; The composition may further comprise:

[0416] Example 10: Combination of Compositions In embodiment 2, The composition comprises: Gsta4 protein or a nucleic acid encoding same; and Brn2 protein or a nucleic acid encoding the same; or Ascl1 protein or a nucleic acid encoding the same; A composition comprising:

[0417] Example 11: Combination of Compositions In embodiment 3, The composition comprises: Gsta4 protein or a nucleic acid encoding same; Hb9 protein or a nucleic acid encoding same; and Lhx3 protein or a nucleic acid encoding same; A composition comprising:

[0418] Example 12: Combination of Compositions In embodiment 4, The composition comprises: Gsta4 protein or a nucleic acid encoding same; Brn2 protein or a nucleic acid encoding same; Hb9 protein or a nucleic acid encoding same; and NeuroD1 protein or nucleic acid encoding same A composition comprising:

[0419] Example 13: Combination of Compositions In embodiment 5, The composition comprises: Gsta4 protein or a nucleic acid encoding same; Brn2 protein or a nucleic acid encoding same; Hb9 protein or a nucleic acid encoding same; Ascl1 protein or a nucleic acid encoding same; and Myt1L protein or a nucleic acid encoding same; A composition comprising:

[0420] Example 14: Combination of Compositions In embodiment 6, The composition comprises: Gsta4 protein or a nucleic acid encoding same; Brn2 protein or a nucleic acid encoding same; Ascl1 protein or a nucleic acid encoding same; Ngn2 protein or a nucleic acid encoding same; Isl1 protein or a nucleic acid encoding same; and Lhx3 protein or a nucleic acid encoding same; A composition comprising:

[0421] Example 15: Combination of Compositions There is Example 7, The composition comprises: Gsta4 protein or a nucleic acid encoding same; Brn2 protein or a nucleic acid encoding same; Ascl1 protein or a nucleic acid encoding same; Ngn2 protein or a nucleic acid encoding same; Isl1 protein or a nucleic acid encoding same; and Lhx3 protein or a nucleic acid encoding same; Myt1L protein or a nucleic acid encoding same; A composition comprising:

[0422] Example 16: Gsta4 sequence In embodiment 1, The composition, wherein the Gsta4 protein is an amino acid sequence represented by SEQ ID NO: 1 or a sequence having 70% or more identity thereto.

[0423] Example 17: Hb9 sequence In embodiment 2, The composition, wherein the Hb9 protein is an amino acid sequence represented by SEQ ID NO: 14 or a sequence having 70% or more identity thereto.

[0424] Example 18: Lhx3 arrangement In embodiment 2, The composition, wherein the Lhx3 protein is an amino acid sequence represented by SEQ ID NO: 15 or a sequence having 70% or more identity thereto.

[0425] Example 19: Array Restriction In embodiment 11, The Gsta4 protein is an amino acid sequence represented by SEQ ID NO: 1 or a sequence having an identity of 70% or more thereto; The Hb9 protein is an amino acid sequence represented by SEQ ID NO: 14 or a sequence having an identity of 70% or more thereto; The composition, wherein the Lhx3 protein is an amino acid sequence represented by SEQ ID NO: 15 or a sequence having 70% or more identity thereto.

[0426] Example 20: Vector 1 As a vector for direct cross-differentiation of somatic cells to motor neurons, the vector comprises: i) embodiment 1 or 16; and ii) promoter; Including, i) is operably connected to ii); A vector, wherein the motor neuron is a motor neuron induced (differentiated) from the somatic cell.

[0427] Example 21: Additional configuration of vector 1 In embodiment 20, The vector is one selected from embodiments 2 to 9; The vector may further include:

[0428] Example 22: Vector 2 As a vector for direct cross-differentiation of somatic cells to motor neurons, the vector comprises: i) embodiment 3 or embodiment 11; and ii) promoter; Including, i) is operably connected to ii); A vector, wherein the motor neuron is a motor neuron induced (differentiated) from the somatic cell.

[0429] Example 23: Vector 3 As a vector for direct cross-differentiation of somatic cells to motor neural cells, the vector may comprise two or more vectors, In this case, the two or more vectors include at least a first vector and a second vector, The first vector is i) embodiment 1 or 16; and ii) promoter; Including, i) is operably linked to ii), The second vector is iii) the vector is one or more selected from among embodiments 2 to 9; and iv) promoter; Including, said iii) being operably connected to iv); In this case, iii) the vector may be included in one or more individual vectors selected from embodiments 2 to 9; A vector, wherein the motor neuron is a motor neuron induced (differentiated) from the somatic cell.

[0430] Example 24: Vector addition configuration In any one of embodiments 21 to 23, The vector may optionally further include one or more of the following: ii) a promoter other than the promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an internal ribosome entry site (IRES), a fluorescent protein gene, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, a histidine (His) tag, a V5 tag, a FLAG tag, an influenza hemagglutinin (HA) tag, a Myc tag, a 2A self-cleaving peptide, and an antibiotic resistance gene.

[0431] Example 25: Vector additional configuration limited In embodiment 24, The vector, wherein the 2A self-cleaving peptide is one or more selected from T2A, P2A, E2A and F2A.

[0432] Example 26: Vector additional configuration limited In any one of embodiments 21 to 23, The vector may further include one or more selected from the group consisting of a donor, a piggyBac transposable element, and a Sleeping Beauty transposable element.

[0433] Example 27: Vector type limited In any one of embodiments 21 to 23, The vector is a viral vector, which is one or more of retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), veccinia virus, foxvirus, HIV (Human immunodeficiency virus), MLV (Murine leukemia virus), ASLV (Avian sarcoma / leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), Herpes simplex virus, episomal, and simplex virus.

[0434] Example 28: Differentiation method (1) A method for direct cross-differentiation of somatic cells into motor neurons, The direct cross-differentiation is the direct cross-differentiation of the somatic cells into induced (differentiated) motor neurons; The method includes the steps of: a) introducing embodiment 1 or embodiment 16 or embodiment 20 into a somatic cell; The method includes:

[0435] Example 29: Differentiation method (1) In embodiment 28, In the somatic cells b) incorporating any one of embodiments 2 to 9 and 21; The method may further include:

[0436] Example 30: Differentiation method (1) In embodiment 28 or embodiment 29, After the introduction Cultivate somatic cells using a medium for neural differentiation; The method may further include:

[0437] Example 31: Differentiation method (2) A method for direct cross-differentiation of somatic cells into motor neurons, The direct cross-differentiation is the direct cross-differentiation of the somatic cells into induced (differentiated) motor neurons; The method includes the steps of: a) mixing embodiment 1, embodiment 16, or embodiment 20 into a culture medium; b) culturing somatic cells using said mixture; The method includes:

[0438] Example 32: Differentiation method (3) A method for direct cross-differentiation of somatic cells into motor neurons, The direct cross-differentiation is the direct cross-differentiation of the somatic cells into induced (differentiated) motor neurons; The method includes the steps of: introducing into a somatic cell the vector of embodiment 11, embodiment 19, or embodiment 22; or introducing embodiment 16, embodiment 17 and embodiment 18 into a somatic cell; The method includes:

[0439] Example 33: Introduction method In any one of embodiments 28 to 32, The method is characterized in that the introduction is carried out by any one or more selected from electroporation, gene gun, sonoporation, magnetofection, microinjection, temporary cell compression or squeezing, cationic liposome method, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (Polyethyleneimine)-mediated transfection, and DEAE-dextran mediated transfection.

[0440] Example 34: Somatic cell type In any one of embodiments 28 to 32, The somatic cells are characterized in that they are selected from fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (Gcells), B cells, mesenchymal cells, astrocytes, blood cells, and rare process bud precursors.

[0441] Example 35: Differentiation Period In any one of embodiments 28 to 32, The method is characterized in that the introduction causes the somatic cells to differentiate into motor neurons within 1 to 10 weeks.

[0442] Example 36: Differentiation method characteristics In any one of embodiments 28 to 32, The method is characterized in that the introduction causes the somatic cells to become induced motor neurons without generating induced pluripotent stem cells (iPSCs).

[0443] Example 37: Differentiation method yield - Motor neuron (overexpression of differentiation factors) In motor neurons overexpressing direct cross-differentiation factors, In this case, the direct cross-differentiation factor is one or more selected from Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); The motor neuron is characterized in that it is directly cross-differentiated from a somatic cell.

[0444] Example 38: Differentiation method acquisition - Motor neuron (neuron marker overexpression)

[0445] In motor neurons where neuronal markers are overexpressed, At this time, the nerve cell marker is one or more selected from NEUN, ChAT, Map2, Hb9, Synapsin, Tuj1, IsL1, PAX6, Olig2, Nkx2.2, and SMI-32; The motor neuron is characterized in that it is directly cross-differentiated from a somatic cell.

[0446] Example 39: Pharmaceutical Composition (1) Including embodiment 1, 16, or 20 A pharmaceutical composition for the prevention or treatment of nervous system diseases.

[0447] Example 40: Pharmaceutical Composition (2) Embodiment 1 or 16 or 20; and One selected from among embodiments 2 to 9 and 21; A pharmaceutical composition for preventing or treating a nervous system disease comprising:

[0448] Example 41: Pharmaceutical Composition (3) Including embodiment 37 or 38 A pharmaceutical composition for the prevention or treatment of nervous system diseases.

[0449] Example 42: Indications In any one of embodiments 39 to 41, The nervous system disease is one or more selected from spinal cord injury, Parkinson's disease, stroke, Huntington's disease, Lou Gehrig's disease, ataxia telangiectasia, amyotrophic lateral sclerosis, motor nerve injury, peripheral nerve injury due to trauma, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, peripheral paralysis, central paralysis, quadriplegia, diplegia, epilepsy, neuronal development disorder, neuralgia, intractable epilepsy, Alzheimer's disease, congenital metabolic nervous system disease, and traumatic brain injury, motor neuron injury, or diseases induced thereby.

[0450] Example 42: Additional configuration In any one of embodiments 39 to 41, The pharmaceutical composition may further comprise one or more selected from the group consisting of acceptable carriers, excipients, diluents and preservatives.

[0451] Example 43: Treatment method (1) 1. A method for treating a nervous system disorder, said method comprising: administering to a subject the somatic cells of embodiment 39 or 40; Including, In this method, the somatic cells do not generate induced pluripotent stem cells (iPSCs) but become induced motor neurons.

[0452] Example 44: Treatment Method (2) 1. A method for treating a nervous system disorder, said method comprising: administering to a subject somatic cells into which the vector of embodiment 39 or 40 has been introduced; In this method, the somatic cells do not generate induced pluripotent stem cells (iPSCs) but become induced motor neurons.

[0453] Example 45: Treatment method (3) 1. A method for treating a nervous system disorder, said method comprising: administering embodiment 41 to a subject; Including,

[0454] In this case, the subject's somatic cells do not generate induced pluripotent stem cells (iPSCs), but rather become induced motor neurons.

[0455] Example 46: Limited to one target (1) In any one of embodiments 43, 44, and 45, The method, wherein the subject is a mammal.

[0456] Example 47: Limited Target (2) In embodiment 46, The method, wherein the mammal is one selected from the group consisting of a human, a mouse, a dog, and a cat.

[0457] Example 48: Administration Limited In any one of embodiments 43, 44, and 45, The method is characterized in that the site of administration is any one or more selected from the group consisting of muscle, intradermal, subcutaneous, venous, peritoneal, arterial, mucosal, spinal cord, bone marrow, intrathecal, and transdermal.

[0458] Example 49: Dosage

[0459] In any one of embodiments 43, 44, and 45, The method is characterized in that the administration is at a dose of 1 uL / kg to 20 uL / kg per administration.

[0460] Example 50: Indications

[0461] In any one of embodiments 43, 44, and 45,

[0462] The nervous system disease is one or more selected from the group consisting of spinal cord injury, Parkinson's disease, stroke, amyotrophic lateral sclerosis, motor nerve injury, peripheral nerve injury due to trauma, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, epilepsy, intractable epilepsy, Alzheimer's disease, congenital metabolic nervous system disease, traumatic brain injury, motor neuron injury, and diseases induced thereby.

[0463] Hereinafter, the present application will be described in more detail with reference to examples.

[0464] These examples are provided solely for the purpose of illustrating the present application more specifically, and it will be obvious to those skilled in the art to which the present application pertains that the scope of the present application is not limited by these examples.

[0465] Experimental materials ● Vector design

[0466] The vector used in the experiments described below is an AAV vector (VPK-402, Cell Biolabs, Inc.), and a schematic diagram of the AAV vector used to introduce differentiation factors is shown in FIG. 1.

[0467] Figure 1(a) corresponds to SEQ ID NO:36; Figure 1(b) corresponds to SEQ ID NO:3; Figure 1(c) corresponds to SEQ ID NO:4; Figure 1(d) corresponds to SEQ ID NO:5; and Figure 1(e) corresponds to SEQ ID NO:29.

[0468] ● AAV production

[0469] 293T celline was used to produce AAV. 293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, Thermal Fisher, #12430112) supplemented with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% antibiotic-antimycotic (Thermal Fisher, #15240096) at 37°C with 5% CO2. 293T cells were also transfected with AAV vector 1, pHelper, and pRapCap and cultured for 48 hours. After that, a virus extraction process was performed to extract the virus containing the differentiation factor.

[0470] Cell culture and intracellular AAV transduction

[0471] Human dermal fibroblasts (Sigma, 106-05A) were cultured in a badge of fibroblast growth medium (Sigma, 116-500) supplemented with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% antibiotic-antimycotic (Thermal Fisher, #15240096) at 37°C and 5% CO2.

[0472] Human dermal fibroblasts were placed in 24 wells at 0.025x10 6 The cells were prepared by seeding at 100x the cells. 24 hours after cell seeding, differentiation factors were treated. 24 hours after differentiation factor treatment, the medium was replaced with fibroblast growth medium. 24 hours later, the medium was replaced with neural induction medium. The medium was replaced every two days. On days 14-17, the cells were fixed and immunofluorescent stained.

[0473] Mouse astrocytes (Abm, T0289) were cultured in Prigrow III medium (Abm, TM003) supplemented with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% penicillin / streptomycin (Gibco) at 37°C under 5% CO2.

[0474] Mouse astrocytes were placed in 24 wells at 0.025x10 6 The cells were prepared by seeding at 100x the number of cells. 24 hours after cell seeding, differentiation factors were treated. 24 hours after differentiation factor treatment, the medium was replaced with Prigrow III medium. 24 hours later, it was replaced with Neural induction medium. The medium was replaced every two days. On days 14-17, the cells were subjected to fixation and immunofluorescence staining.

[0475] Mouse embryonic fibroblasts were cultured in DMEM (Gibco) medium containing 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% penicillin / streptomycin (Gibco) at 37°C under 5% CO2.

[0476] Mouse embryonic fibroblasts were placed in 24 wells at 0.025x10 6O The cells were prepared by seeding at 100x. 24 hours after cell seeding, differentiation factors were treated. 24 hours after differentiation factor treatment, the medium was replaced with DMEM. 24 hours later, it was replaced with Neural Induction Medium. The medium was replaced every 2 days. On days 14-17, the cells were fixed and immunofluorescent stained.

[0477] When introducing AAV into the SCI model, the injury site (Lumbar 5) of the mouse spinal cord injury model was microscanned using a stereotaxic device (Stereotaxic, Harvard Apparatus) and then analyzed for 60 days.

[0478] ● Immunofluorescence staining

[0479] For cell fixation, the cells were washed twice with PBS (Gibco) for 5 minutes each time, then 4% paraformaldehyde (ThermoFisher) was added and incubated at room temperature for 10 minutes.

[0480] For permeabilization, PBS + 0.1% Triton-X was added and incubated at room temperature for 10 minutes. The cells were washed three times with PBS for 5 minutes each.

[0481] For blocking and immunostaining, 1% BSA+PBST (PBS+0.1% Tween20) was added and incubated at room temperature for 30 minutes. The primary antibodies used were ChAT (Invitrogen, 1:1000), Map2 (Millipore, 1:200), and NeuN (Merck Millipore, 1:100). The primary antibodies were added to 1% BSA+PBST and incubated at 4℃ overnight. After washing three times with PBS for 5 minutes each, the secondary antibody Alexa FluorTM 488 / 594 (Thermo Fisher, 1:1000) was added to 1% BSA+PBST and incubated at room temperature in the dark for 1 hour. After washing three times with PBS for 5 minutes each, DAPI staining was performed.

[0482] ● RNA extraction and cDNA synthesis

[0483] cells 2x10 6After removing the supernatent with trypsin (ThemoFisher), the tube was centrifuged at 13,000 rpm for 10 seconds. After removing the supernatent, 1 ml of easy-BlueTM (IntRON) was added and port excised for 10 seconds, after which 200 μl Choloroform was added and port excised. After centrifugation at 13,000 rpm for 10 minutes, 400 μl of upper fluid was transferred to a new 1.5 ml tube. 400 μl 2-propanol (Sigma) was added, inverted 2-3 times, and then left at RT for 10 minutes. After centrifugation at 13,000 rpm for 5 minutes, the upper layer was removed. 1 ml of 75% EtOH (Sigma) was added and inverted 2-3 times. After centrifugation at 10,000 rpm for 5 minutes at 4℃, the upper layer was removed. After drying at RT for 5 minutes, 20 μl of distilled water was added to dissolve the RNA. The final RNA was stored at -70°C.

[0484] JPEG2025505925000002.jpg16152

[0485] ● Real-time quantitative reverse transcription PCR (qRT-PCR)

[0486] qPCR (SYBRGreen Realtime PCR Master Mix, TOYOBO) was used. qRT-PCR confirmed the expression of Synapsin, Map2, and Hb9 in cells induced to differentiate into motor neurons from human fibroblasts. The expression of Synapsin, Map2, and Hb9 in cells induced to differentiate into motor neurons from mouse fibroblasts was confirmed.

[0487] The primers used at this time are as shown in the table below.

[0488] JPEG2025505925000003.jpg138154

[0489] Example 1: Confirmation of direct cross-differentiation of Gsta4 into motor neurons in cells GSTA4 was introduced into mouse-derived fibroblasts using AAV. The differentiation of neurons from somatic cells by Gsta4 was confirmed by immunofluorescence staining and qPCR (Figure 2). The expression of ChAT, a marker for motor neurons, and Map2, a marker for mature neurons, was confirmed by immunofluorescence staining. The degree of differentiation of neurons was confirmed by the change in the expression of Synapsin, a marker for synapse formation, Map2, a marker for mature neurons, and Hb9, a marker for mature neurons, using qPCR.

[0490] When Gsta4 was treated alone, the expression level of synapsin was increased by about 4 times compared to the control group (shown as control), the expression level of Map2 was increased by about 5 times compared to the control group (shown as control), and the expression level of Hb9 was increased by about 2 times compared to the control group (shown as control). These experimental results confirmed that Gsta4 alone can effectively convert somatic cells into neural cells.

[0491] Example 2: Confirmation of direct cross-differentiation of intracellularly expressed differentiation factors into motor neurons

[0492] To confirm the direct cross-differentiation effect of known factors, conventional differentiation factors were introduced into human-derived fibroblasts, and the degree of direct cross-differentiation into motor neurons was confirmed (Figure 3).

[0493] At this time, conventional differentiation factors were introduced as follows:

[0494] Administration of Ascl1 alone; administration of a combination of Ascl1, Brn2, and Myt1l (denoted as ABM); administration of a combination of Hb9, Isl1, and Lhx3 (denoted as HIL); administration of a combination of ABM and HIL; and administration of a combination of ABM, HIL, Ngn2, and NeuroD1 (denoted as HND).

[0495] In Example 1, when Gsta4 was administered alone, the expression of Synapsin, Map2, and Hb9 was increased by approximately 4, 5, and 2 times, respectively, compared to the control group. In contrast, when Ascl1 was administered alone, the expression of Synapsin, Map2, and Hb9 was increased by only approximately 1 to 1.5 times. This suggests that the efficiency of direct cross-differentiation into motor neurons is higher when Gsta4, the novel differentiation factor of the present application, is administered alone, compared to when Ascl1, the published factor, is administered alone.

[0496] In addition, when ABM, a combination of three known factors, was administered, the expression of Synapsin, Map2, and Hb9 increased by only about 2, 4, and 1 times, respectively. And when HIL, a combination of three published factors, the expression of Synapsin, Map2, and Hb9 increased by only about 2, 1.5, and 1.5 times, respectively. This confirmed that the direct cross-differentiation efficiency into motor neurons was low or similar when the combination of three published factors was administered compared to the single treatment with Gsta4, a novel differentiation factor of the present application.

[0497] Meanwhile, the expression of neuronal markers was confirmed to be increased when ABM+HIL, a combination of six known factors, was administered; and ABM+HND, a combination of eight known factors, was administered, compared to administration of one or three known factors. In other words, the combination of six or more factors showed a significant effect.

[0498] Example 3: Confirmation of direct cross-differentiation by combined use of Gsta4

[0499] After confirming the neuronal transformation effect of the factors disclosed in Example 2 alone, we attempted to confirm the effect of combining them with Gsta4 of the present invention.

[0500] To this end, we introduced AAV, Gsta4, and conventional differentiation factors in various combinations into mouse-derived fibroblasts, and confirmed the degree of differentiation by qPCR, which confirmed the expression of neuronal markers (Synapsin, Map2, Hb9) (Figure 4).

[0501] As a result, it was confirmed that the expression of neural cell markers in the group in which Gsta4 was combined with conventional differentiation factors was increased by about 5-10 times compared to the control group (referred to as Control). Compared to the case in which only conventional factors were used as confirmed in Example 2, the expression results (fold change) of each identical marker was found to be even higher when combined with Gsta4 of the present invention.

[0502] In addition, immunofluorescence staining confirmed the expression of ChAT, a marker for motor neurons, and Map2, a marker for mature neurons (Figures 5 and 6). Immunofluorescence staining confirmed the expression of ChAT and Map2 in the group treated with a combination of Gsta4 and conventional differentiation factors.

[0503] That is, it was found from Figures 4 to 6 that somatic cells can be effectively and directly cross-differentiated into motor neurons even when Gsta4 is used together with conventional differentiation factors.

[0504] Example 4: Confirmation of direct cross-differentiation of conventional differentiation factors into motor neurons depending on the presence or absence of Gsta4 in cells

[0505] After confirming the results of Examples 2 and 3, the effect of combining Gsta4 of the present invention with known differentiation factors was examined more specifically.

[0506] Comparison of one conventional differentiation factor vs. one conventional differentiation factor + Gsta4 combination Conventional differentiation factors with or without Gsta4 were introduced into mouse-derived fibroblasts using AAV, and the degree of differentiation was confirmed by qPCR for the expression of neuronal markers (Synapsin, Map2) (Figure 7).

[0507] We confirmed that the expression of neuronal markers (Synapsin, Map2) increased approximately 2-5 times when Gsta4 and Ascl1 were administered in combination (Gsta4+Ascl1) and when Gsta4 and Brn2 were administered in combination (Gsta4+Brn2) compared to when the conventional differentiation factors Ascl1 and Brn2 were administered alone.

[0508] Comparison of two conventional differentiation factors vs. two conventional differentiation factors + Gsta4 combination

[0509] Conventional differentiation factors, with or without Gsta4, were introduced into mouse-derived fibroblasts using AAV, and the degree of differentiation was confirmed by immunohistochemical staining and fluorescence, confirming the expression of neuronal markers (ChaT, Map2) (Figure 8).

[0510] We confirmed that the number of cells immunostained for neuronal markers increased by approximately 40-fold or more when Gsta4 was administered in combination with Mnx1 and Lhx3 (shown as Gsta4+Mnx1+Lhx3) compared to when the conventional differentiation factors Mnx1 and Lhx3 were administered in combination (shown as Mnx1+Lhx3).

[0511] In addition, the expression of neuronal markers (Synapsin, Map2) was confirmed by qPCR (Figure 9).

[0512] It was confirmed that the expression of neuronal markers was increased by approximately 2-4 times when Gsta4 was administered in combination with Mnx1 and Lhx3 (Gsta4+Mnx1+Lhx3) compared to the combination of conventional differentiation factors Mnx1 and Lhx3 (Mnx1+Lhx3). In addition, when Gsta4 was administered alone (Gsta4), the expression of neuronal markers was increased by approximately 2-4 times compared to the control group (Control).

[0513] Comparison of the combination of three conventional differentiation factors vs. three conventional differentiation factors + Gsta4 Conventional differentiation factors with or without Gsta4 were introduced into mouse-derived fibroblasts using AAV, and the degree of differentiation was confirmed by qPCR for the expression of neuronal markers (Synapsin, Map2) (Figure 10).

[0514] It was confirmed that the expression of neuronal markers (Synapsin, Map2) was increased by approximately 2 to 4 times when Gsta4 was administered in combination with Ascl1, Brn2, and Myt1L (shown as Gsta4+Ascl1+Brn2+Myt1l) compared to when the conventional differentiation factors Ascl1, Brn2, and Myt1L were administered in combination (shown as Ascl1+Brn2+Myt1l).

[0515] Comparison of the combination of 8 conventional eruption factors vs. 8 conventional eruption factors + Gsta4 Conventional differentiation factors with or without Gsta4 were introduced into human-derived fibroblasts using AAV, and the degree of differentiation was confirmed by checking the expression of neuronal markers (Synapsin, Map2, Hb9) using qPCR (Figure 11).

[0516] It was confirmed that the expression of neuronal markers was increased by about 2 to 5 times when Gsta4 was administered in combination with Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 (shown as ABM+HIL+Ngn2+NeuroD1(HND)) compared to the conventional differentiation factors Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 (shown as ABM+HND+Gsta4). It was also confirmed that the expression of neuronal markers was increased by about 10 to 12 times when Gsta4 was administered in combination with Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 compared to the control group (shown as Control).

[0517] In addition, conventional differentiation factors, with or without Gsta4, were introduced into human-derived fibroblasts using AAV, and the degree of differentiation was confirmed by the expression of neuronal markers (vChaT, Map2) using immunofluorescence staining (Figure 13).

[0518] When the conventional differentiation factors Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 were introduced in combination (shown as known factors), approximately 15.51% of the cells differentiated into mature neurons. In contrast, when the conventional differentiation factors and Gsta4 were introduced in combination (shown as known factors + Gsta4), approximately 48.72% of the cells were confirmed to differentiate into mature neurons.

[0519] Comparison of the combination of 4 conventional eruption factors vs. 7 conventional eruption factors vs. 7 conventional eruption factors + Gsta4 Conventional differentiation factors, with or without Gsta4, were introduced into mouse astrocytes via AAV, and the degree of differentiation was confirmed by immunofluorescence staining to determine the expression of neuronal markers (vChaT, Map2) (Figure 12).

[0520] When conventional differentiation factors Hb9, Isl1, Lhx3 and Ascl1 were administered in combination, the neuronal marker was expressed by about 20%. When conventional differentiation factors Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3 and Ngn2 were administered in combination (shown as known factors), the neuronal marker was expressed by about 50%, but when the known factors and Gsta4 were administered in combination (shown as known factors + Gsta4), the neuronal marker was expressed by about 70%. In other words, it was found that the expression of ChaT and Map2 was increased when Gsta4 was administered in combination with seven conventional differentiation factors compared to when only seven conventional differentiation factors were administered.

[0521] From the above results, it was found that Gsta4 of the present application is a differentiation factor that has the function of directly cross-differentiating somatic cells such as fibroblasts and fibroblasts into induced motor neurons. In addition, it was found that Gsta4 has a higher differentiation efficiency than conventional direct cross-differentiation factors, and further, when Gsta4 is used together with conventional differentiation factors, it enhances the differentiation efficiency of conventional differentiation factors with low differentiation efficiency.

[0522] Example 5: Direct cross-differentiation into motor neurons in vivo and confirmation of therapeutic effects Based on the results of Examples 1 to 4, which confirmed the efficacy of Gsta4 in differentiating neural cells in cells, experiments were conducted based on the schematic diagram in Figure 14 to confirm direct cross-differentiation into motor neural cells and therapeutic effects in vivo.

[0523] The effect of improving or treating the damaged area of ​​the spinal nerve was confirmed through morphological, physiological, and behavioral analyses in an SCI mouse model, an animal model of paraplegia.

[0524] 1) SCI (Spinal cord injury) mouse model production To create a SCI mouse model, which is a model of paralysis of the lower body caused by spinal cord injury, ICR mice were anesthetized and injured at the Lumbar 5 site of the spinal cord (hereinafter referred to as L5; corresponding to vertebrae T13-L1). After injury, the mice were used for the experiment 5 weeks after the injury.

[0525] 2) AAV administration to SCI mouse models

[0526] AAV2ul was microinjected into the L5 site of the SCI mouse model using a microsyringe (Hamilton, 705).

[0527] Example 5-1: Confirmation of morphological changes at the site of spinal cord injury

[0528] SCI mouse models were treated with eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) (referred to as Control); eight conventional differentiation factors plus Gsta4 (referred to as +Gsta4); and an AAV without differentiation factors (referred to as Mock). Crystal violet (Sigma) staining was performed to observe morphological changes at the site of spinal cord injury (L5) in each group (Figure 15).

[0529] Looking at Figure 15, in the Mock group, which does not contain differentiation factors that directly induce cross-differentiation, many inflammatory cells gathered together and thick scars were formed (red dotted line). The Control group, which was transfected with eight conventional differentiation factors, showed less scarring where cells gathered compared to the Mock group. On the other hand, in the group transfected with eight conventional differentiation factors and GSTA4, it was confirmed that scarring caused by inflammatory cells was alleviated compared to the Control group.

[0530] Example 5-2: Confirmation of changes in expression of motor neuron markers

[0531] SCI mouse models were divided into three groups: a group in which eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) were introduced (called Control); a group in which eight conventional differentiation factors and Gsta4 were introduced together (called +Gsta4); and a group in which an AAV that did not introduce any differentiation factors was introduced (called Mock). Immunofluorescence staining was performed to observe changes in the expression of motor neuron markers at each spinal cord injury site (L5) (Figures 16, 17, and 18).

[0532] As shown in Figures 16, 17, and 18, the expression of ChaT and Map2 increased approximately two-fold in the control group compared to the mock group. Meanwhile, in the group in which eight conventional differentiation factors and GSTA4 were co-introduced, the expression of ChaT and Map2 increased approximately five-fold compared to the control group. This means that the direct cross-differentiation of astrocytes to motor neurons by Gsta4 is more efficient than that of the control group.

[0533] Example 5-3: Confirmation of therapeutic effect of paraplegia by electrophysiological analysis

[0534] A normal group with no spinal cord damage (referred to as Sham); a group in which an SCI mouse model was administered AAV containing eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) (referred to as Control); a group in which an AAV containing both eight conventional differentiation factors and Gsta4 (referred to as +Gsta4) was administered; and a group in which an AAV was administered to an SCI mouse model (referred to as Mock); electrophysiological changes were confirmed at the site of spinal cord injury (L5) in each group (Figure 19).

[0535] FIG. 19(a) is a photograph of a neuron in which patch clamp was performed.

[0536] Looking at the action potential measurement results in Figure 19(b), the action potential was 25 Hz in the sham group, but 2 Hz in the mock group, a decrease of more than 1 / 10. On the other hand, the action potential increased at 6 Hz in the control group, into which eight conventional differentiation factors were introduced, and increased more than twice as much as the control group at 13 Hz in the group into which eight conventional differentiation factors and Gsta4 were both introduced.

[0537] An increase in action potentials indicates the ability of nerve cells to transmit signals when they receive them. Signal transmission is not possible without action potentials. Action potentials are also the most representative characteristic of nerve cells. The occurrence and increase of action potentials means that differentiation into nerve cells has been successful. Therefore, the group in which eight differentiation factors and Gsta4 were introduced together showed the highest rate of differentiation into nerve cells, indicating that this combination is highly efficient at differentiating into nerve cells.

[0538] The results of measuring the signal from the presynaptic neuron in Figure 19(c) were 1 Hz in the Mock group, 6 Hz in the Control group, and 47 Hz in the +Gsta4 group.

[0539] The increase in signals coming from presynaptic neurons indicates increased signal transmission between neurons, suggesting that the neuronal connections severed by SCI have led to the regeneration of new motor neurons. Example 5-4: Confirmation of direct cross-differentiation by behavioral analysis

[0540] A group in which no damage was done to the spinal cord (referred to as Sham); a group in which eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) were introduced into an SCI mouse model (referred to as -Gsta4); a group in which eight conventional differentiation factors and Gsta4 were introduced together (referred to as +Gsta4); and a group in which AAV was administered to an SCI mouse model (referred to as Mock); changes in the BBB score were confirmed at each spinal cord injury site (L5) (Figure 20).

[0541] The BBB score (Basso, Beattie, and Bresnahan score) in Figure 20 is a measurement method traditionally used in spinal cord injury models, and is calculated by comprehensively judging the shape and angle of the lower limbs, the angle of the knee, the shape and angle of the sole of the foot, and the position, etc. The score ranges from 0 to 21, with normal animals scoring 21.

[0542] The group in which only eight conventional differentiation factors were introduced (indicated as -Gsta4) showed no difference from the Mock group (BBB score of approximately 4 points). However, the group in which eight conventional differentiation factors and Gsta4 were introduced together (indicated as +Gsta4) showed a BBB score of approximately 8 points, which was more than double that of the -Gsta4 group, 3 weeks after AAV administration.

[0543] We also confirmed changes in the forced swimming test, self-urination, foot printing test, etc. in each of the following groups: a normal group with no damage to the spinal cord (referred to as Sham); a group in which AAV was introduced into an SCI mouse model (referred to as Mock); a group administered with AAV that introduced eight conventional differentiation factors as well as Gsta4 (referred to as Gsta4+); and a group administered with AAV that introduced only eight conventional differentiation factors (referred to as Control) (Figure 21).

[0544] In the forced swimming test shown in Figure 21(a), the animal model was placed in a water tank for 3 minutes, and the number of times the lower limbs moved was measured. In the mock group, the lower limbs did not move due to spinal cord injury. However, when eight conventional differentiation factors were introduced together with Gsta4, the movement of the lower limbs increased by approximately 6 to 12 times.

[0545] Figures 21(b) and (c) show the results of measuring the ability to urinate on one's own. Mice with spinal cord injury are unable to urinate on their own. It was confirmed that mice were able to urinate on their own 14 or 16 days after administration of AAV from the group in which eight conventional differentiation factors and Gsta4 were introduced together.

[0546] Figure 21(d) shows the results of a foot printing test. Foot printing is an experiment in which red ink is applied to the soles of the mouse's lower legs to observe the shape of the soles. In the case of Sham, the soles of the mouse's lower legs are clearly visible (number 11 / 20cm), but the shape of the soles of the mouse's feet could not be confirmed (number 11 / 20cm). In contrast, in the group in which eight conventional differentiation factors and Gsta4 were introduced together, the soles of the mouse's lower legs (number 5 / 20cm) were visible.

[0547] From the above results, it was found that Gsta4, a novel differentiation factor discovered by the inventors of the present application, is an important factor for direct cross-differentiation of somatic cells into motor neurons. In addition, Gsta4 has a higher differentiation efficiency than conventional differentiation factors, and when conventional differentiation factors and Gsta4 are used together, the differentiation efficiency is even higher than when conventional differentiation factors are used alone. Furthermore, the inventors confirmed the therapeutic effect of a lower body paralysis model with spinal cord injury, and Gsta4 is expected to play an important role in various nervous system diseases in the future. [Industrial Applicability]

[0548] The present application provides a novel differentiation factor for direct cross-differentiation from somatic cells to motor neurons and its use. Sequence Listing FreeText

[0549] This relates to Gsta4 (Glutathione S-Transferase Alpha 4) protein or a nucleic acid sequence encoding the same.

Claims

1. A composition for direct cross-differentiation of somatic cells into induced motor neurons, The composition comprises: Gsta4 (Glutathione S-Transferase Alpha 4) protein or a nucleic acid encoding the same; A composition comprising:

2. The composition according to claim 1, wherein the Gsta4 protein is an amino acid sequence represented by SEQ ID NO: 1 or a sequence having an identity of 70% or more thereto.

3. The composition according to claim 1 , wherein the nucleic acid encoding the Gsta4 protein has the sequence of SEQ ID NO: 2 or 12.

4. The composition comprises: ii) one or more proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2) and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid encoding the same; The composition according to claim 1, further comprising:

5. The composition according to claim 4, characterized in that in ii) Hb9, Lhx3 or Ngn2 is selected.

6. The composition according to claim 4, characterized in that in ii) Hb9 and Lhx3; or Hb9 and Ngn2; or Lhx3 and Ngn2 are selected.

7. The composition according to claim 4, characterized in that in ii) Hb9, Lhx3 and Ngn2 are selected.

8. The composition according to claim 4, characterized in that Hb9, Lhx3, Ngn2 and Isl1 are selected in ii).

9. The composition according to claim 4, characterized in that in ii) Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1 are selected.

10. The Ascl1 protein can be SEQ ID NO: 17, the nucleic acid encoding the Ascl1 protein can have the sequence of SEQ ID NO: 18; The Brn2 protein can be SEQ ID NO: 19, the nucleic acid encoding the Brn2 protein can have the sequence of SEQ ID NO: 20; The Myt1L protein can be SEQ ID NO:21, the nucleic acid encoding the Myt1L protein can have the sequence of SEQ ID NO:22; The Hb9 protein can be SEQ ID NO:13, the nucleic acid encoding the Hb9 protein can have the sequence of SEQ ID NO:14; The Isl1 protein can be SEQ ID NO:23, the nucleic acid encoding the Isl1 protein can have the sequence of SEQ ID NO:24; The Lhx3 protein can be SEQ ID NO: 15, the nucleic acid encoding the Lhx3 protein can have the sequence of SEQ ID NO: 16; The Ngn2 protein can be SEQ ID NO:25, the nucleic acid encoding the Ngn2 protein can have the sequence of SEQ ID NO:26; The composition according to claim 4, wherein the NeuroD1 protein can be SEQ ID NO: 27, and the nucleic acid encoding the NeuroD1 protein can have the sequence of SEQ ID NO:

28.

11. As a vector for expression of differentiation factors for direct cross-differentiation The direct cross-differentiation converts somatic cells into derived motor neurons, The vector is A nucleic acid encoding a Gsta4 protein; and a promoter; In this case, said vector is characterized in that i) and ii) are operably linked.

12. The vector comprises iii) a nucleic acid encoding one or more proteins selected from among Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; 12. The vector of claim 11, further comprising:

13. The vector according to claim 12, characterized in that Hb9 and Lhx3 are selected in iii).

14. As a vector for expression of differentiation factors for direct cross-differentiation The direct cross-differentiation converts somatic cells into derived motor neurons, The vectors may include at least a first vector and a second vector; The first vector is a nucleic acid encoding a Gsta4 protein; and ii) a promoter; In this case, i) and ii) are operably linked, The second vector is iii) a nucleic acid encoding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; and iv) a promoter; At this time, iii) and iv) are operably connected, The promoters ii) and iv) are the same or different from each other; The vector iii) can be included in one vector or can be included in two or more vectors.

15. The vector may contain any of the following sequences: an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an internal ribosome entry site (IRES), a fluorescent protein gene, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, histidine (His) tag, V5 tag, FLAG tag, influenza hemagglutinin (HA) tag, Myc tag, 2A self-cleaving peptide ( ...

15. The vector according to claim 11, further comprising one or more selected from the group consisting of a gene encoding a nucleotide sequence for a nucleotide sequence of ...

16. The vector according to claim 15, wherein the 2A self-cleaving peptide is one or more selected from the group consisting of T2A, P2A, E2A, and F2A.

17. The vector can be a viral vector or a non-viral vector, The vector according to any one of claims 11 to 14, wherein the viral vector is one or more of retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), vaccinia virus, foxvirus, HIV (Human immunodeficiency virus), MLV (Murineleukemia virus), ASLV (Aviansarcoma / leukosis), SNV (Spleen necrosis virus), RSV (Rousarcoma virus), MMTV (Mouse mammary tumor virus), Herpes simplex virus, episomal and simplex virus.

18. Methods for direct cross-differentiation It switches from somatic cells to induced motor neurons, The method includes the steps of: introducing a composition comprising a Gsta4 protein or a nucleic acid encoding same into a somatic cell; At this time, the method is characterized in that induced pluripotent stem cells (iPSCs) are not generated.

19. 20. The method of claim 18, wherein the somatic cells are one or more selected from the group consisting of fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (G cells), B cells, hepatic cells, astrocytes, blood cells, and rare dendritic precursor cells.

20. 20. The method according to claim 19, wherein the somatic cells are derived from a mammal selected from the group consisting of humans, dogs, cats, horses, sheep, rabbits, pigs, mice, and camels.

21. The method according to claim 18, further comprising culturing the somatic cells into which the composition has been introduced in a culture medium for neural cell differentiation.

22. The method of claim 18, wherein the introduction can be performed by one or more selected from the group consisting of electroporation, gene gun, sonoporation, magnetofection, microinjection, temporary cell compression or squeezing, cationic liposome method, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (Polyethyleneimine)-mediated transfection, and DEAE-dextran-mediated transfection.

23. 20. The method of claim 18, wherein the introduction induces differentiation of the somatic cells into induced motor neurons within 1 to 7 weeks.

24. For direct cross-differentiation of somatic cells into induced motor neurons, Containing the Gsta4 protein, A pharmaceutical composition for the prevention or treatment of nervous system diseases.

25. The pharmaceutical composition comprises: The pharmaceutical composition according to claim 24, further comprising one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

26. For direct cross-differentiation of somatic cells into induced motor neurons, a somatic cell into which a Gsta4 protein or a nucleic acid encoding the same has been introduced; A pharmaceutical composition for the prevention or treatment of nervous system diseases.

27. The pharmaceutical composition comprises: The pharmaceutical composition of claim 26, further comprising a nucleic acid encoding one or more proteins selected from among Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1.

28. A pharmaceutical composition for preventing or treating a nervous system disease involving a motor neuron, the pharmaceutical composition overexpressing a differentiation factor for direct cross-differentiation from a somatic cell into an induced motor neuron, The pharmaceutical composition is characterized in that the motor neuron overexpresses one or more differentiation factors selected from Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1).

29. The pharmaceutical composition according to any one of claims 24 to 28, characterized in that the pharmaceutical composition may further comprise one or more selected from acceptable carriers, excipients, diluents and preservatives.

30. The pharmaceutical composition according to any one of claims 24 to 28, wherein the nervous system disease is one or more selected from spinal cord injury, Parkinson's disease, stroke, Huntington's disease, Lou Gehrig's disease, ataxia telangiectasia, amyotrophic lateral sclerosis, motor nerve injury, peripheral nerve injury due to trauma, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, peripheral paralysis, central paralysis, quadriplegia, diplegia, epilepsy, neuronal development disorder, neuralgia, intractable epilepsy, Alzheimer's disease, congenital metabolic nervous system disease, and traumatic brain injury, motor neuron injury, or diseases induced thereby.

31. The pharmaceutical composition according to any one of claims 24 to 28, characterized in that the pharmaceutical composition is in one or more forms selected from the group consisting of a solid, a liquid, a capsule, and a semi-solid form.

32. As a method for preventing or treating nervous system disorders, The method includes the steps of: i) Gsta4 protein; or ii) Gsta4 protein; and one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; administering to a subject; wherein the direct cross-differentiation does not produce induced pluripotent stem cells (iPSCs).

33. As a method for preventing or treating nervous system disorders, The method includes the steps of: administering to a subject a somatic cell into which a Gsta4 protein or a composition comprising a nucleic acid encoding the same has been introduced; wherein the direct cross-differentiation does not produce induced pluripotent stem cells (iPSCs).

34. As a method for preventing or treating nervous system disorders, The method includes the steps of: administering to a subject a motor neuron induced by introducing into a somatic cell a composition comprising a Gsta4 protein or a nucleic acid encoding the same; wherein the direct cross-differentiation does not produce induced pluripotent stem cells (iPSCs).

35. The method of any one of claims 33 to 34, wherein the composition may further comprise one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1; or a nucleic acid encoding said protein.

36. The method of claim 35, wherein the composition can further comprise Hb9 and Lhx3 proteins; or nucleic acids encoding same.

37. the subject is a mammal; The method according to any one of claims 32 to 34, wherein the mammal is one selected from the group consisting of humans, mice, dogs and cats.

38. The method according to any one of claims 32 to 34, characterized in that the nervous system disease is one or more selected from spinal cord injury, Parkinson's disease, stroke, amyotrophic lateral sclerosis, motor nerve injury, peripheral nerve injury due to trauma, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, epilepsy, intractable epilepsy, Alzheimer's disease, congenital metabolic nervous system disease, traumatic brain injury, motor neuron injury, or diseases induced thereby.

39. The method according to any one of claims 32 to 34, characterized in that the site of administration is one or more selected from the group consisting of muscle, intradermal, subcutaneous, venous, peritoneal, arterial, mucosal, spinal cord, bone marrow, intrathecal, and transdermal.

40. The method is characterized in that the administration is performed at a dose of 1 uL / kg to 20 uL / kg per administration.

Images