Anti-BCMA CARs targeting immune-related disorders, compositions and methods thereof

Abstract

The present disclosure provides chimeric antigen receptor (CAR) molecules, compositions, and methods specific for B-cell maturation antigen (BCMA) for the treatment of immune-related disorders, specifically plasma cell pathologies such as multiple myeloma (MM).

Description

[Technical field]

[0001] The present disclosure relates to immunotherapy, more particularly to chimeric antigen receptor (CAR) molecules specific for B cell maturation antigen (BCMA), compositions and methods thereof for the treatment of immune-related disorders. [Background technology]

[0002] References that are deemed relevant as background to the presently disclosed subject matter are listed below. [1]Friedman KM, Garrett TE, Evans JW et al.Effective Targeting of Multiple B-Cell Maturation Antigen-Expressing Hematological Malignances by Anti-B-Cell Maturation Antigen Chimeric Antigen Receptor T Cells.Hum.Gene Ther 2018;29:585-601. [2]Carpenter RO, Evbuomwan MO, Pittaluga S et al.B-cell maturation antigen is a promising target for adoptive T-cell therapy of multiple myeloma.Clin.Cancer Res 2013;19:2048-2060. [3]Ali SA, Shi V, Maric I et al.T cells expressing an anti-B-cell maturation antigen chimeric antigen receptor cause remissions of multiple myeloma.Blood 2016;128:1688-1700. [4]Brudno JN,Maric I,Hartman SD et al.T Cells Genetically Modified to Express an AntiГaoB-Cell Maturation Antigen Chimeric Antigen Receptor Cause Remissions of Poor-Prognosis Relapsed Multiple Myeloma.JCO 2018;36:2267-2280. [5]Raje N,Berdeja J,Lin Y et al.Anti-BCMA CAR T-Cell Therapy bb2121 in Relapsed or Refractory Multiple Myeloma.N Engl J Med 2019;380:1726-1737. [6]Cohen AD,Garfall AL,Stadtmauer EA et al.B cell maturation antigenГaospecific CAR T cells are clinically active in multiple myeloma.J Clin Invest 2019;129:2210-2221. [7]Jiang S,Jin J,Hao S et al.Low Dose of Human scFv-Derived BCMA-Targeted CAR-T Cells Achieved Fast Response and High Complete Remission in Patients with Relapsed / Refractory Multiple Myeloma.Blood 2018;132:960. [8]Liu Y,Chen Z,Fang H et al.Durable Remission Achieved from Bcma-Directed CAR-T Therapy Against Relapsed or Refractory Multiple Myeloma.Blood 2018;132:956. [9]Mailankody S,Ghosh A,Staehr M et al.Clinical Responses and Pharmacokinetics of MCARH171,a Human-Derived Bcma Targeted CAR T Cell Therapy in Relapsed / Refractory Multiple Myeloma:Final Results of a Phase I Clinical Trial.Blood 2018;132:959.

[10] Munshi NC,Anderson LD,Jr.,Shah N et al.Idecabtagene Vicleucel in Relapsed and Refractory Multiple Myeloma.N.Engl.J.Med.2021;384:705-716.

[11] Eisenberg V,Hoogi S,Shamul A,Barliya T,Cohen CJ.T-cells「a la CAR-T(e)」-Genetically engineering T-cell response against cancer.Adv.Drug Deliv.Rev.2019;141:23-40.

[12] Kawalekar OU,O’Connor RS,Fraietta JA et al.Distinct Signaling of Coreceptors Regulates Specific Metabolism Pathways and Impacts Memory Development in CAR T Cells.Immunity.2016;44:380-390.

[13] Watanabe N,Bajgain P,Sukumaran S et al.Fine-tuning the CAR spacer improves T-cell potency.Oncoimmunology.2016;5:e1253656.

[14] Ying Z, Huang XF, Xiang X et al.A safe and potent anti-CD19 CAR T cell therapy.Nat.Med.2019;25:947-953.

[0003] The acknowledgment of the above references herein should not be inferred as meaning that they are in any way relevant to the patentability of the presently disclosed subject matter.

[0004] 2. Background of the Invention Multiple myeloma (MM) develops in the bone marrow by clonal expansion of malignant plasma cells and is associated with overproduction of monoclonal immunoglobulins in the blood and urine. Despite significant progress achieved in the treatment of MM, the disease remains incurable with poor prognosis in relapsed / refractory (R / R) patients. Thus, there is a need to develop novel therapeutic approaches targeting multiple myeloma. Following the great success of CD19-targeted CAR therapy for hematological malignancies and its FDA approval in 2017, new potential targets for CAR therapy are needed. In this regard, B-cell maturation antigen (BCMA) is a cell surface protein that belongs to the tumor necrosis factor receptor (TNFR) superfamily. Following interaction with APRIL and BAFF, BCMA can promote B-cell survival and proliferation. Apart from mature B lymphocytes and plasma cells, BCMA is highly expressed in most cases of MM, making it an attractive target for CAR therapy [1].

[0005] Kochenderfer and colleagues tested anti-BCMA CARs in clinical trials, with 0.3–3 × 10 6 The study produced a 20% objective response rate in the group of patients treated with CAR T cells / kg [2]. A higher overall response rate (ORR) (81%) was observed with the highest dose of CAR T cells (9 × 106 This was achieved in a patient population that received 1000 mg / kg of anti-BCMA cells [3, 4]. Several recent trials have demonstrated the potential of the anti-BCMA CAR approach in promising Phase I / II studies, reaching ORRs of up to 80% in heavily pretreated patients with R / R multiple myeloma, with deep and durable responses [5-10]. Based on the impressive results of a Phase II study published in NEJM, the FDA and EMA approved Ide-Cabtagene Bileucel (Ide-cel or bb2121) for the treatment of R / R MM patients. An additional CAR T cell product that shows very promising results is Ciltacabtagene autoleucel (Cilta-cel), which incorporates two anti-BCMA single heavy chain domains and a 4-1BB costimulatory domain. In terms of cytokine release syndrome or neurotoxicity, most clinical trials using this construct have not demonstrated ORRs of over 80% without excessive toxicity.

[0006] It is reasonable to speculate that the need for high doses of CAR T cells to achieve a response and prevent relapse

[10] may correlate with low affinity of the targeting moiety, poor antigen expression, lack of T cell persistence over time, and / or reduced CAR expression and stability

[11] . Thus, CAR molecules may be modulated to enhance engineered T cell function.

[0007] CAR molecules consist of two essential parts: an extracellular binding domain and a signaling domain. The binding domain is usually composed of a single-chain variable fragment (scFv) targeting engineered antibody, whereas the signaling domain is usually composed of a costimulatory moiety (CD28 and / or 4-1BB) that, together with CD3ζ, promotes T cell activation. In addition, the type of costimulation can significantly promote CAR T cell persistence and metabolic activity (such as that seen in 4-1BB-based CARs), whereas CD28 promotes a more potent but short-lived response

[12] . Connecting both CAR parts, the hinge and transmembrane domain, provides the appropriate linkage and flexibility of the CAR molecule, affecting CAR-T cell function, construct stability and expression. The choice of the hinge domain specific to the CAR is often chosen according to the proximity of the target ligand to the cell membrane.

[0008] The composition and structure of a CAR are important determinants of its function and are therefore generally optimized by experience. For example, a study by Zhang et al. suggested that incorporating the transmembrane domains of CD8 or CD28 instead of the transmembrane domain of CD3ζ could result in higher CAR surface expression. In another study, Smith et al. showed that the use of longer hinge domains increased CAR potency and specificity. It was also shown how optimization of CAR design and costimulation could reduce activation induced cell death (AICD) and lead to improved CAR expression over time. Beyond specificity, hinge composition can also affect tonic signaling and improved in vivo activity, and modifications in IgG-based hinges were shown to improve in vivo activity and reduce tonic signaling effects mediated by the CH2CH3 domains located in the IgG hinge

[13] . It has also been recently demonstrated that modifications in the CD8α hinge and TM domains result in higher anti-apoptotic molecule expression and reduced cytokine secretion in CAR-T cells, with retained cytotoxic function

[14] . A recent retrospective analysis of anti-CD19 CAR-T-based clinical studies further supports the idea that the structural composition of the CAR domain beyond the scFv and costimulatory moieties influences clinical outcomes and associated toxicities. For example, it has been suggested that CD28 hinge-TM-based CARs showed higher clinical efficacy and severe cytotoxicity compared to CD8 hinge-TM-based CARs.

[0009] Thus, there is a need in the art to provide improved BCMA-CAR-T molecules that have been empirically evaluated for optimal configuration and that exhibit increased specificity and high in vitro and long-term in vivo efficacy. These needs are addressed herein. Summary of the Invention

[0010] A first aspect of the present disclosure relates to a chimeric antigen receptor (CAR) molecule comprising the following components: (i) at least one target binding domain, at least one of which specifically recognizes and binds to B cell maturation antigen (BCMA); and (ii) at least one hinge and at least one transmembrane domain derived from Cluster of Differentiation 8 alpha (CD8α) protein (also known as T cell surface glycoprotein CD8 alpha chain). It should be noted that the hinge region of the domain comprises the amino acid sequence set forth by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises (iii) at least one intracellular T cell signaling domain. More specifically, this domain comprises at least one domain of a tumor necrosis factor (TNF) receptor family member, and optionally at least one domain of a T cell receptor (TCR) molecule. In some embodiments, the CAR T molecule of the present disclosure comprises an amino acid sequence set forth in any one of SEQ ID NO: 1, or any fragment or derivative thereof, for example, an amino acid sequence set forth in SEQ ID NO: 40.

[0011] Further aspects of the present disclosure relate to a nucleic acid molecule comprising at least one nucleic acid sequence encoding at least one CAR molecule, or any cassette, vector, or vehicle comprising said nucleic acid molecule. In some embodiments, such an encoded CAR molecule comprises the following components: first, (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA; second, (ii) at least one hinge and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence represented by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises at least one intracellular T cell signaling domain as a third component (iii). More specifically, this domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0012] A further aspect of the present disclosure is a gene editing system comprising: First, (i) at least one nucleic acid molecule as defined by the present disclosure, or any cassette, vector, or vehicle comprising at least one nucleic acid molecule; Secondly, the present invention relates to a gene editing system comprising at least one gene editing component or a nucleic acid sequence encoding the gene editing component. In some specific embodiments, at least one nucleic acid molecule of the gene editing system provided by the present disclosure encodes at least one CAR molecule comprising the following components: (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA; and (ii) at least one hinge and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence shown by SEQ ID NO: 9, and any fragments, derivatives, and variants thereof, and (iii) at least one intracellular T cell signaling domain. More specifically, this domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0013] A further aspect of the present disclosure relates to a genetically engineered cell of a T cell lineage expressing at least one CAR molecule, or any population of cells comprising at least one of the genetically modified cells disclosed herein. More specifically, in some embodiments, the CAR expressed by the engineered cell comprises the following components: first, (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA, and second, (ii) at least one hinge and at least one transmembrane domain derived from the CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence represented by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises, as a third component (iii), at least one intracellular T cell signaling domain. More specifically, this domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0014] A further aspect of the present disclosure relates to a composition comprising at least one CAR molecule, any nucleic acid molecule comprising at least one nucleic acid sequence encoding the CAR molecule, or any cassette, vector, vehicle, or gene editing system comprising a nucleic acid molecule, any host cell expressing the CAR molecule, and / or any genetically engineered cell of T lineage expressing the CAR, or a population of cells comprising at least one genetically engineered cell of T lineage. More specifically, such a CAR molecule comprises the following components: first, (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA, and second, (ii) at least one hinge and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence depicted by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises, as a third component (iii), at least one intracellular T cell signaling domain. More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0015] It should be noted that the compositions of the present disclosure, according to optional embodiments, further comprise at least one of a pharma- ceutically acceptable carrier, diluent, excipient, and additive.

[0016] A further aspect of the disclosure relates to a method for treating, preventing, ameliorating, inhibiting, or delaying the onset of an immune-related disorder in a mammalian subject. In some embodiments, the method comprises administering to the subject an effective amount of: The method includes administering at least one of: (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one cassette, vector vehicle, or gene editing system comprising the nucleic acid molecule of (a); (c) at least one cell expressing the CAR (specifically, a cell of T lineage), or a population of such cells; and (d) a composition comprising at least one of (a), (b), and (c). More specifically, in some embodiments of the disclosed method, such e CAR molecule comprises the following components: first, (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA; and second, (ii) at least one hinge and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence set forth by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises, as a third component (iii), at least one intracellular T cell signaling domain, more specifically, this domain comprises at least one domain of a TNF receptor family member and, optionally, at least one domain of a TCR molecule.

[0017] A further aspect of the disclosure provides for use in a method for treating, preventing, ameliorating, inhibiting, or delaying the onset of an immune-related disorder in a mammalian subject, comprising an effective amount of: The present invention relates to at least one of the following: (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one cassette, vector vehicle, or gene editing system comprising the nucleic acid molecule of (a); (c) at least one cell expressing the CAR molecule, specifically a cell of T lineage, or a population of these cells; and (d) at least one composition comprising at least one of (a), (b), and (c). In some embodiments of the contemplated use, such a CAR molecule comprises the following components: first, (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA; second, (ii) at least one hinge and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence represented by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises at least one intracellular T cell signaling domain as a third component (iii). More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0018] In yet some further aspects, the present disclosure provides methods for targeted activation of cells of the T lineage to target cells and / or tissues containing target cells expressing a BCMA protein. More specifically, cells of the T lineage are activated by administering to the target cells an effective amount of: The method comprises the steps of: (a) contacting at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one cassette, vector vehicle, or gene editing system comprising the nucleic acid molecule of (a); and (c) at least one composition comprising at least one of (a) and (b). More specifically, such a CAR molecule comprises the following components: first, (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA; and second, (ii) at least one hinge and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence represented by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises, as a third component (iii), at least one intracellular T cell signaling domain. More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0019] These and other aspects of the invention will become evident upon reading the following disclosure.

[0020] In order to better understand the subject matter disclosed herein, and to illustrate how it may be carried out in practice, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which: [Brief description of the drawings]

[0021] [Figure 1A] Characterization of anti-BCMA based chimeras. Schematic representation of different designs of anti-BCMA chimeric receptors as described in the Materials and Methods section. [Figure 1B]Characterization of anti-BCMA-based chimeras. Different anti-BCMA chimeric antigen receptors (CARs) or truncated CD34 (CD34t, control gene) were transduced into anti-CD3-activated human primary PBMCs as indicated. These cells were stained using protein L or anti-CD34 antibodies, respectively. Transgene expression was assessed by flow cytometry. The dotted line represents the staining of mock-transduced controls. The percentage of positive cells and the mean fluorescence intensity (MFI) (in brackets) are shown. The graphs represent the average of four different donors and the difference in staining between BCMA-CAR-transduced and control populations was found to be statistically significant (p<0.05; calculated using Student's paired t-test). [Figure 1C] Characterization of anti-BCMA-based chimeras. 105 transduced cells were co-cultured with either 105 K562-BCMA or K562 cells (negative control) in 96-well plates for 16 hours. Interferon gamma (IFNγ) secreted into the co-culture supernatant was measured by enzyme-linked immunosorbent assay (ELISA). The results are representative of three independent experiments. [Figure 1D] Characterization of anti-BCMA-based chimeras. Cell concentrations of BCMA-CAR T cells and control T cells were determined every 2-3 days for 3 weeks. The results are representative of 3 independent experiments with different donors (ICBB vs. H8BB / H828, P<0.05; by two-way ANOVA). [Figure 1E] Characterization of anti-BCMA-based chimeras. Cell viability was assessed 3 weeks after transduction. BCMA-CAR T cells were stained with propidium iodide (PI) and analyzed by flow cytometry, ICBB vs. H8BB / H828, p<0.001 by paired Student's t-test). [Figure 2A]Antitumor function of BCMA-CAR-T cells. Retroviral vectors encoding either ICBB-, H828-, H8BB-, and truncated CD34 (CD34t control) were transduced into OKT3-activated human primary B-cell maturation antigen (PBMC). Transduced T cells were co-cultured with different tumor lines as indicated. Interferon gamma (IFNγ) secreted in the co-culture supernatant was measured by enzyme-linked immunosorbent assay (ELISA). The results are presented as mean ± standard error of the mean (SEM) (n=4, 3 different donors; normalized to the activity of the positive control CAR H828 against K562-BCMA with a mean secretion of 5928 pg / ml). The difference between H8BB and H828 was found to be statistically significant (p=0.00098; calculated using a paired Student's t-test). [Figure 2B] Antitumor function of BCMA-CAR-T cells. Similarly, these cells were co-cultured with the indicated target T cells and the secreted TNFα (Figure 2B) and IL2 (Figure 2C) concentrations in the culture supernatant were determined by ELISA. The results are presented as mean ± SEM (n=3, 3 different donors; normalized to the activity of the positive control CAR H828 against K562-BCMA with a mean secretion of 1453 pg / ml IL2 and 2990 pg / ml TNFα). The difference between H8BB and H828 was found to be statistically significant (p=0.01 for IL2 and -p=3.7×10-5 for TNF; calculated using a paired Student's t-test). [Figure 2C]Antitumor function of BCMA-CAR-T cells. Similarly, these cells were co-cultured with the indicated target T cells and the secreted TNFα (Figure 2B) and IL2 (Figure 2C) concentrations in the culture supernatant were determined by ELISA. The results are presented as mean ± SEM (n=3, 3 different donors; normalized to the activity of the positive control CAR H828 against K562-BCMA with a mean secretion of 1453 pg / ml IL2 and 2990 pg / ml TNFα). The difference between H8BB and H828 was found to be statistically significant (p=0.01 for IL2 and -p=3.7×10-5 for TNF; calculated using a paired Student's t-test). [Figure 3A] Phenotypic characterization of BCMA-CAR transduced T cells. CD4 / CD8 ratios of different anti-BCMA chimeras. CAR-transduced or control T cells were stained with anti-CD4 and CD8 antibodies and analyzed by flow cytometry on day 7. The results are representative of 4 independent experiments with different donors. No significant differences were observed between the different groups. [Figure 3B] Phenotypic characterization of BCMA-CAR transduced T cells. Memory phenotype of T cells transduced with different BCMA chimeras. Three weeks after transduction, CAR-transduced or control T cells were stained with anti-CD45RO and CCR7 antibodies and analyzed by flow cytometry. The results are representative of the average of four independent experiments with different donors (n=4). [Figure 3C] Phenotypic characterization of BCMA-CAR transduced T cells. BCMA CAR T cells in culture were monitored over time (as indicated) for expression of exhaustion markers PD-1 (Figure 3C i), LAG-3 (Figure 3C ii), TIM-3 (Figure 3C iii), and TIGIT (Figure 3C iv). [Figure 4A]Exhaustion and activation profile of BCMA CAR T cells. BCMA-CAR-T cells were co-cultured in the presence of H929-MM cell line, or BCMA-overexpressing K562 (K562-BCMA), or K562 cell line at an effector to target (E:T) ratio of 10:1 in IL-2-free T cell medium for 24 hours at 37°C. After incubation, cells were washed and stained with a mixture of fusion proteins / antibodies (as indicated) for 20 minutes at 4°C, and expression of PD-1 (Figure 4Ai), LAG-3 (Figure 4Aii), TIM-3 (Figure 4Aiii), and TIGIT (Figure 4Aiv) was assessed by flow cytometry (gated on BCMA.CAR+). These results are representative of three different experiments with different donors. Data are presented as mean ± standard error (SEM). [Figure 4B(i)] Exhaustion and activation profile of BCMA CAR T cells. CAR-transduced T cells or CD34t cells were co-cultured with BCMA-positive targets as shown. After overnight or 4 h (for CD69) co-culture, cells were analyzed by flow cytometry for expression of CD25 (Figure 4B(i)), CD69 (Figure 4B(ii)), and 4-1BB (Figure 4B(iii)). Cells were gated on the CD8+ population for 4-1BB and CD69 expression and on CAR+ cells for CD25 expression. The mean percentage of positive cells ± SEM is shown on the histogram overlay. The grey histogram represents CAR-T cell staining and the dotted histogram represents staining of CD34t control cells. These results are representative of three independent experiments with three different donors. [Figure 4B(ii)]Exhaustion and activation profile of BCMA CAR T cells. CAR-transduced T cells or CD34t cells were co-cultured with BCMA-positive targets as shown. After overnight or 4 h (for CD69) co-culture, cells were analyzed by flow cytometry for expression of CD25 (Figure 4B(i)), CD69 (Figure 4B(ii)), and 4-1BB (Figure 4B(iii)). Cells were gated on the CD8+ population for 4-1BB and CD69 expression and on CAR+ cells for CD25 expression. The mean percentage of positive cells ± SEM is shown on the histogram overlay. The grey histogram represents CAR-T cell staining and the dotted histogram represents staining of CD34t control cells. These results are representative of three independent experiments with three different donors. [Figure 4B(iii)] Exhaustion and activation profile of BCMA CAR T cells. CAR-transduced T cells or CD34t cells were co-cultured with BCMA-positive targets as shown. After overnight or 4 h (for CD69) co-culture, cells were analyzed by flow cytometry for expression of CD25 (Figure 4B(i)), CD69 (Figure 4B(ii)), and 4-1BB (Figure 4B(iii)). Cells were gated on the CD8+ population for 4-1BB and CD69 expression and on CAR+ cells for CD25 expression. The mean percentage of positive cells ± SEM is shown on the histogram overlay. The grey histogram represents CAR-T cell staining and the dotted histogram represents staining of CD34t control cells. These results are representative of three independent experiments with three different donors. [Figure 5A]BCMA chimeras mediate antitumor cytotoxic activity in vitro and in vivo. T cells transduced with BCMA CAR or CD34t (control) were co-cultured with CFSE-labeled tumor cells at the effector to target (E:T) ratios shown. After 4 hours, propidium iodide (PI) was added and cells were analyzed by flow cytometry. Cytotoxicity was calculated based on the percentage of the CFSE+ / PI+ population out of the total CFSE+ population. The results are presented as the mean ± standard error (SEM) of three independent experiments with three different donors (Figure 5A(i): K562; Figure 5A(ii): RPMI-8226; and Figure 5A(iii): H929), and the difference between the BCMA-CAR and CD34t populations was found to be statistically significant (p<0.05, calculated using Student's paired t-test). [Figure 5B] BCMA chimeras mediate antitumor cytotoxic activity in vitro and in vivo. In vivo function of BCMA-CAR T cells. NSG xenografts (n=8 per group) were inoculated with H929 myeloma cells. One week after tumor inoculation, mice were intravenously injected with either 15×106 BCMA-CAR+ (FIG. 5B(iii): ICBB, FIG. 5B(iv): H828, or FIG. 5B(v); H8BB), CD34t transduced control cells (FIG. 5B(ii)), or no treatment (FIG. 5B(i)). Tumor volumes were measured in a blinded fashion using calipers and calculated using the following formula: (D×d2)×π / 6, where D is the maximum tumor diameter and d is its perpendicular. [Figure 5C] BCMA chimeras mediate anti-tumor cytotoxic activity in vitro and in vivo. Overall survival analysis. The difference in mean survival of the H828 and H8BB groups compared to the untreated or control groups was found to be statistically significant p<1e-4; using log-rank analysis). [Figure 6A]Anti-myeloma effect of H8BB CAR T cells. Persistence of CAR+-T cells in mice is associated with elimination of NCI-H929 multiple myeloma tumors. NSG mice (4-5 animals per group) bearing subcutaneous NCI-H929 tumors averaging approximately 200 mm3 per treatment group received a single intravenous (iv) dose of 15x106 non-transduced (NT) control cells (Figure 6A(i)), or 5 (Figure 6A(ii)), 10 (Figure 6A(iii)), or 15x106 (Figure 6A(iv)) H8BB-CAR+T cells / mouse, respectively. Tumor size was measured by caliper twice weekly by personnel blinded to treatment condition. [Figure 6B] Anti-myeloma effect of H8BB CAR T cells. Persistence of CAR+-T cells in mice is associated with elimination of NCI-H929 multiple myeloma tumors. Serum B-cell maturation antigen (BCMA) protein levels (dashed lines) assessed by enzyme-linked immunosorbent assay (ELISA) are plotted with corresponding tumor volume measurements (black lines) for 15×106 non-transduced (NT) control cells (FIG. 6B(i)), or 5 (FIG. 6B(ii)), 10 (FIG. 6B(iii)), or 15×106 (FIG. 6B(iv)) H8BB-CAR+T cells / mouse, respectively. Error bars indicate standard error of the mean (SEM). [Figure 6C] Anti-myeloma efficacy of H8BB CAR T cells. CAR+-T cell persistence in mice is associated with elimination of NCI-H929 multiple myeloma tumors. Myeloma development was monitored by bioluminescence imaging (BLI). BLI measurements in photons per second per cm2 per steradian (p / s / cm2 / sr) were converted to color to indicate disease activity in mice according to the legend shown. The weight of tumors excised from NSG xenografts in the NT group is shown in the table to show that the BLI reduction at this time point is due to tumor necrosis rather than tumor size reduction. [Figure 6D]Anti-myeloma effect of H8BB CAR T cells. Persistence of CAR+-T cells in mice is associated with elimination of NCI-H929 multiple myeloma tumors. Kaplan-Meier survival curves of the study shown in (Figure 6A and Figure 6C). * represents NSG mice found to have died 60 days after tumor inoculation, without apparent association with multiple myeloma. [Figure 6E] Anti-myeloma effect of H8BB CAR T cells. Persistence of CAR+-T cells in mice is associated with elimination of NCI-H929 multiple myeloma tumors. 25 μL of blood was collected from the tail vein, lysed with IOTEST3 lysis solution (Beckman Coulter) for 10 min, and stained with a mixture of fluorescent recombinant human B-cell maturation antigen (BCMA) protein, anti-CD3, anti-CD8, and anti-CD4. The percentage of H8BB CAR T cells (% of CD3+BCMA.CAR+ cells) in NSG blood was assessed by flow cytometry. [Figure 6F] Anti-myeloma efficacy of H8BB CAR T cells. CAR+-T cell persistence in mice is associated with elimination of NCI-H929 multiple myeloma tumors. Mean tumor weight resected from NCI-H929 multiple myeloma (MM) xenografts 9 days after T cell infusion. H8BB CAR T xenograft tumors are shown in the lower panel and non-transduced (NT) xenograft control tumors are shown in the upper panel. [Figure 6G] Anti-myeloma effect of H8BB CAR T cells. Persistence of CAR+-T cells in mice is associated with elimination of NCI-H929 multiple myeloma tumors. Infiltration of tumor tissue by CD3+ T cells (shown in Figure 6F, upper panel) was assessed by immunohistochemistry using anti-human CD3 antibody up to day 9 after H8BB CAR or NT T cell injection. Marker bar represents 50 μm. Note: Figures 6A-D and 6E-G refer to experiments performed on different cohorts of mice. [Figure 7A]H8BB CAR T cells target plasma cells in patients with multiple myeloma. Bone marrow (BM) aspirates from patients with multiple myeloma (MM), amyloidosis (AL), monoclonal gammopathy of undetermined significance (MGUS), plasmacytoma (PC), and Walden-Ström's macroglobulinemia (WDS) were assessed for B-cell maturation antigen (BCMA) expression by flow cytometry. Graphs represent median BCMA expression in patients' bone marrow gated on CD38++CD138++ plasma cells. n=3 (AL, circles), N=16 (MM, squares), n=3 (MGUS, up triangles), n=3 (PC, down triangles), and n=2 (WDS, diamonds). Error bars indicate standard error of the mean (SEM). [Figure 7B] H8BB CAR T cells target plasma cells in patients with multiple myeloma. CD3+ T cell activation was determined by assessing CD137 (4-1BB) expression by flow cytometry. H8BB CAR T and non-transduced (NT) T cells were incubated overnight in the presence of bone marrow-derived mononuclear cells (BM-MCs). Statistical analysis was based on Student's paired t-test. [Figure 7C] H8BB CAR T cells target plasma cells in patients with multiple myeloma. Mean fluorescence intensity (MFI) of BCMA expression on targeted CD38++CD138++ plasma cell populations in patients P1-P4 (p=0.01 by Student's t-test). [Figure 7D] H8BB CAR T cells target plasma cells in multiple myeloma patients. The presence of CD38++CD138++ plasma cells in MM- patients after co-culture with H8BB CAR T cells or NT control cells was assessed by flow cytometry (P1-P4). [Figure 8A]Animal model. NSG mice (N=5 animals per group) bearing subcutaneous NCI-H929 tumors of approximately 100 mm3 were administered a single intravenous (iv) dose of 7.5x106 CAR+ T cells / mouse on day 11 after tumor inoculation. Tumor size was measured by caliper twice weekly by personnel blinded to treatment conditions. [Figure 8B] Animal model. Kaplan-Meier survival curves of the study. [Figure 8C] Animal Model. Myeloma progression was monitored by bioluminescence imaging (BLI). BLI measurements in photons per second per cm2 per steradian (p / s / cm2 / sr) were converted to color to indicate disease activity in mice according to the indicated legend. [Figure 9] Schematic diagram of the HBI0101 CAR construct. C11D5-3-CD8-41-BBZ encoding the anti-BCMA CAR is shown. The BCMA CAR sequence consists of the C11D5-3 anti-BCMA single chain variable fragment (scFv), the CD8α hinge and transmembrane regions, the cytoplasmic portion of the 4-1BB costimulatory molecule, and the CD3ζ T cell activation domain. [Figure 10] An overview of the HBI0101-clinical study is given. Prior to enrollment, candidates are screened for eligibility. 10 days prior to infusion, lymphocytes are collected using the Sprectra Optia apheresis device. The patient is then admitted for baseline evaluation and HBI0101 production is initiated from fresh / frozen apheresis. On days -5 to -2, the patient's T cells are depleted with fludarabine and cyclophosphamide and the manufactured HBI0101 (day 0) is infused 2 days after "washout" from lymphodepletion. After infusion, the patient is admitted for 2 weeks for safety follow-up. Routine follow-up at the indicated time points (1, 2, 4, 6, 9, 12, 15...60 months after HBI0101 infusion) is performed for 5 years or until the patient discontinues the study. [Figure 11] "3+3" dose escalation study design is shown. DLT, dose-limiting toxicity; MTD, maximum tolerated dose. [Figure 12A]QC and Sterility Testing Alongside HBI0101 Manufacturing. For QC, HBI0101 culture samples were collected at the indicated time points. [Figure 12B] QC and sterility testing along HBI0101 manufacturing. HBI0101 culture samples were collected at the indicated time points for sterility in-process (IE) and end-of-process (EOP) control. Td, transduction; CPN, copy number. [Figure 13] Consort diagram. Of the 22 patients enrolled and underwent leukapheresis, a total of 20 MM patients underwent lymphodepletion and were treated according to a "3+3" dose-escalation study design: cohort 1 received 150x10^6 CAR+ cells (N=6), cohort 2 received 450x10^6 CAR+ (N=7), and cohort 3 received 800x10^6 CAR+ (N=7). DEX, dexamethasone; Rx, radiation. [Figure 14A] Objective responses in patients treated with HBI0101 CART cells. Overall response (OR) rates. Best response of each patient grouped by dose cohort (150-, 450-, and 800x106 CAR+ cells / dose) is shown. Disease response was determined according to the International Myeloma Working Group (IMWG) consensus criteria [Kumar S, et al. Lancet Oncol. 17(8):e328-e346(2016)]. Minimal residual disease (MRD) is defined as the number of MM plasma cells detected in the bone marrow per 1x105 total nucleated cells. MRD ≤ 1x10^-5 is considered MRD negative. [Figure 14B]Objective responses in patients treated with HBI0101 CART cells. Responses to HBI0101 treatment. Swimmer plots of best responses in individual MM patients are shown according to cell dose (150-~800x10^6CAR+). Response assessment according to IMWG criteria: grey-progressive disease (PD); light grey-stable disease (SD); green-very good partial response (VGPR); light blue-stringent complete response / complete response with MRD positive (sCR / CR(MRD+)); blue-stringent complete response / complete response with MRD negative (sCR / CR(MRD-)). [Figure 15A] Survival of patients with R / R MM receiving HBI0101 CAR T cells. Kaplan-Meier analysis of progression-free survival (PFS) in all patients. [Figure 15B] Survival of patients with R / R MM receiving HBI0101 CAR T cells. Kaplan-Meier analysis of progression-free survival (PFS) grouped by dose cohort. [Figure 15C] Survival of patients with R / R MM receiving HBI0101 CAR T cells. Kaplan-Meier analysis of overall survival (OS) across all patients. [Figure 15D] Survival of patients with R / R MM receiving HBI0101 CAR T cells. Kaplan-Meier analysis of overall survival (OS) grouped by dose cohort. [Figure 16A]MM Disease Surveillance. Free light chain levels were determined at the indicated time points before and after HBI0101 infusion in cohort 1 (N=6) (FIG. 16A), cohort 2 (N=6) (FIG. 16B), and cohort 3 (N=6) (FIG. 16C). Normal range for kappa light chain: 6.7-22.4 mg / L, and normal range for lambda light chain: 8.3-27 mg / L. [Figure 16B] MM Disease Surveillance. Free light chain levels were determined at the indicated time points before and after HBI0101 infusion in cohort 1 (N=6) (FIG. 16A), cohort 2 (N=6) (FIG. 16B), and cohort 3 (N=6) (FIG. 16C). Normal range for kappa light chain: 6.7-22.4 mg / L, and normal range for lambda light chain: 8.3-27 mg / L. [Figure 16C] MM Disease Surveillance. Free light chain levels were determined at the indicated time points before and after HBI0101 infusion in cohort 1 (N=6) (FIG. 16A), cohort 2 (N=6) (FIG. 16B), and cohort 3 (N=6) (FIG. 16C). Normal range for kappa light chain: 6.7-22.4 mg / L, and normal range for lambda light chain: 8.3-27 mg / L. [Figure 16D] MM disease surveillance. Soluble BCMA (sBCMA) levels were determined by ELISA before and after CART infusion in the "responder" (blue squares) vs. "non-responder" (black dots) groups. [Figure 17A] Correlation between laboratory parameters and response to HBI0101. Lactate dehydrogenase (LDH) levels assessed 14 days after HBI0101 infusion are shown. [Figure 17B] Correlation between laboratory parameters and response to HBI0101. Peak C-reactive protein (CRP) levels assessed 14 days after HBI0101 infusion are shown. [Figure 17C] Correlation between laboratory parameters and response to HBI0101. Fibrinogen levels assessed 14 days after HBI0101 infusion are shown. [Figure 17D]Correlation between laboratory parameters and response to HBI0101. Ferritin ratios assessed 14 days after HBI0101 infusion are shown. Bars represent median values. [Figure 18A] Efficacy of HBI0101 CART-based therapy in eliminating CD38++CD138++ malignant PC. The flow cytometry gating strategy for evaluation of BCMA and CD56 expression on MM-PC is indicated by the arrows. [Figure 18B] Efficacy of HBI0101 CART-based therapy in eliminating CD38++CD138++ malignant PC. Presence of PC (as % of CD38++CD138++ cells) was assessed by flow cytometry in BM samples pre- and 1 month post-HBI0101-CART infusion by gating on white blood cells (WBCs), as depicted in (Figure 18A). [Figure 18C] Efficacy of HBI0101 CART-based therapy in eliminating CD38++CD138++ malignant PC. Analysis of BCMA and CD56 expression on MM-PC by "response" (blue squares) vs. "non-response" (black dots) groups is shown. BCMA expression levels in multiple myeloma patients (N=12). Mean fluorescence intensity (MFI) (FIG. 18C) and percent of BCMA-positive PC (FIG. 18D) were determined by flow cytometry. [Figure 18D] Efficacy of HBI0101 CART-based therapy in eliminating CD38++CD138++ malignant PC. Analysis of BCMA and CD56 expression on MM-PC by "response" (blue squares) vs. "non-response" (black dots) groups is shown. BCMA expression levels in multiple myeloma patients (N=12). Mean fluorescence intensity (MFI) (FIG. 18C) and percent of BCMA-positive PC (FIG. 18D) were determined by flow cytometry. [Figure 18E]Efficacy of HBI0101 CART-based therapy in eliminating CD38++CD138++ malignant PC. Analysis of BCMA and CD56 expression on MM-PC by "response" (blue squares) vs. "non-response" (black dots) groups is shown. Percentage of CD56 positive PC in "response" (N=9) vs. "non-response" (N=3) groups. Samples were gated on CD38++CD138++ cells (as depicted in (Figure 18A)). [Figure 19A] Analysis of BCMA expression on MM-PCs. HBI0101 CART in vivo kinetics. Analysis of BCMA expression on MM-PCs. HBI0101-treated MM patients were classified according to SD / PD (black dots, N=3), VGPR (green squares, N=3), and sCR / CR (blue circles, N=6) groups. Mean fluorescence intensity (MFI) (FIG. 19A) and percentage of BCMA-positive PCs (FIG. 19B) were determined by flow cytometry. (FIGS. 19C-F) HBI0101 CART in vivo kinetics in MM patients treated with HBI0101 and classified according to SD / PD (dots, N=5), VGPR (squares, N=5), and sCR / CR (circles, N=10). [Figure 19B] Analysis of BCMA expression on MM-PCs. HBI0101 CART in vivo kinetics. Analysis of BCMA expression on MM-PCs. HBI0101-treated MM patients were classified according to SD / PD (black dots, N=3), VGPR (green squares, N=3), and sCR / CR (blue circles, N=6) groups. Mean fluorescence intensity (MFI) (FIG. 19A) and percentage of BCMA-positive PCs (FIG. 19B) were determined by flow cytometry. (FIGS. 19C-F) HBI0101 CART in vivo kinetics in MM patients treated with HBI0101 and classified according to SD / PD (dots, N=5), VGPR (squares, N=5), and sCR / CR (circles, N=10). [Figure 19C]Analysis of BCMA expression on MM-PCs. HBI0101 CART in vivo kinetics. Median HBI0101-CART cells per mL of blood in SD / PD vs. VGPR and sCR / CR groups were determined by quantification of CAR transgene levels by qRT-PCR after CART infusion at the indicated times, and further adjusted for copy number per transduced cell on the day of CART infusion. The limit of quantitation (LOQ) was 500 CART / mL of blood. [Figure 19D] Analysis of BCMA expression on MM-PCs. HBI0101 CART in vivo kinetics. Global expansion of HBI0101 CART cells in the first month of CART therapy. Area under the curve (AUC) was calculated using Prism software (GraphPad) as a measure of global CART expansion. [Figure 19E] Analysis of BCMA expression on MM-PCs. HBI0101 CART in vivo kinetics. Median in vivo peak concentration (Cmax) of HBI0101 cells in SD / PD (dots) vs. VGPR (squares) and sCR / CR (triangles) groups. [Figure 19F] Analysis of BCMA expression on MM-PC. HBI0101 CART in vivo kinetics. Median time to Cmax (Tmax) in SD / PD vs. VGPR and sCR / CR groups. Top and bottom bars represent maximum and minimum values, respectively. SD, stable disease; PD, progressive disease; VGPR, very good partial response. (s)CR, (definite) complete response. *p<0.05, **p<0.01 by unpaired t-test. [Figure 20A] sBCMA clearance and HBI0101 CART in vivo kinetics. Median HBI0101-CART cells per mL of blood in "responder" vs. "non-responder" groups were determined by quantification of CAR transgene levels by qRT-PCR after CART infusion at the indicated times, and further adjusted for copy number per transduced cell on the day of CART infusion. The limit of quantification (LOQ) was 500 CART / mL of blood. [Figure 20B]sBCMA clearance and HBI0101 CART in vivo kinetics. Overall expansion of HBI0101 CART cells during the first month of CART therapy. Area under the curve (AUC) was calculated using Prism software (GraphPad) as a measure of overall CART expansion. [Figure 20C] sBCMA clearance and HBI0101 CART in vivo kinetics. Median in vivo concentration (Cmax) of HBI0101 cells at peak in "responder" (squares) vs. "non-responder" (dots) groups. [Figure 20D] sBCMA clearance and HBI0101 CART in vivo kinetics. Median time to Cmax (Tmax) in "responder" (squares) vs. "non-responder" (dots) groups. Top and bottom bars represent maximum and minimum values, respectively. [Figure 20E] sBCMA clearance and HBI0101 CART in vivo kinetics. Soluble BCMA (sBCMA) levels before and after HBI0101 infusion were determined by ELISA and further normalized to sBCMA concentrations at baseline (right y-axis; open circles) versus HBI0101 cell expansion as indicated by CART / mL (left y-axis; closed circles) in the "non-responder" (FIG. 20E) and "responder" (FIG. 20F) groups. **p<0.01 by unpaired t-test. [Figure 20F] sBCMA clearance and HBI0101 CART in vivo kinetics. Soluble BCMA (sBCMA) levels before and after HBI0101 infusion were determined by ELISA and further normalized to sBCMA concentrations at baseline (right y-axis; open circles) versus HBI0101 cell expansion as indicated by CART / mL (left y-axis; closed circles) in the "non-responder" (FIG. 20E) and "responder" (FIG. 20F) groups. **p<0.01 by unpaired t-test. [Figure 21A]Analysis of HBI0101 cell persistence and sBCMA levels by dose cohort. Soluble BCMA (sBCMA) levels before and after CART infusion in different dose cohorts were determined by ELISA. Legend: closed circle, 150×106 CAR+; closed square, 450×106 CAR+, and closed triangle, 800×106 CAR+ cells. Statistical analysis by two-way ANOVA. [Figure 21B] Analysis of HBI0101 cell persistence and sBCMA levels by dose cohort. HBI0101 in vivo kinetics by HBI0101 dose. The number of HBI0101 CARTs per mL of blood was determined by quantification of CAR transgene levels by qRT-PCR after CART infusion at the indicated times and further adjusted for the CPN of HBI0101 cells before infusion. The limit of quantification (LOQ) was 500 CARTs / mL of blood. [Figure 22A] Comparison of cytokine profiles to predict response to HBI0101 treatment. Heatmap analysis of 12 cytokines detected in serum samples of "responder" (N=15) vs. "non-responder" (N=5) patients at baseline (day -10) and Tmax after HBI0101 treatment. Rows represent cytokines affected by HBI0101 treatment in patients of "responder" and "non-responder" groups "before" and "after" HBI0101 infusion, columns represent median cytokine values ​​of those patients. Cytokine values ​​at the day of Cmax after CART infusion in the "responder" group were used as reference value. Key color legend indicates darker colors are higher cytokine values, lighter colors are lower cytokine values. Median and range values ​​of represented cytokines are detailed in Table 6. [Figure 22B-1]Comparison of cytokine profiles to predict response to HBI0101 treatment. Graphical representation of significantly differentially expressed cytokines between "responder" and "non-responder" groups before and after HBI0101 infusion. More specifically, in FIG. 22B, IL-10 (FIG. 22B(i)), IL-1ra (FIG. 22B(ii)), CCL4 (FIG. 22B(iii)), IL-15 (FIG. 22B(iv)), G-CSF (FIG. 22B(v)), and IL-6 (FIG. 22B(vi)); in FIG. 22C, IFN-γ (FIG. 22C(i)), IL-2 (FIG. 22C(ii)), and TNF-α (FIG. 22C(iii)). Black lines represent median values, and upper and lower bars represent maximum and minimum values, respectively. R, responder; NR, non-responder. Statistical analysis by two-way ANOVA. [Figure 22B-2] Comparison of cytokine profiles to predict response to HBI0101 treatment. Graphical representation of significantly differentially expressed cytokines between "responder" and "non-responder" groups before and after HBI0101 infusion. More specifically, in FIG. 22B, IL-10 (FIG. 22B(i)), IL-1ra (FIG. 22B(ii)), CCL4 (FIG. 22B(iii)), IL-15 (FIG. 22B(iv)), G-CSF (FIG. 22B(v)), and IL-6 (FIG. 22B(vi)); in FIG. 22C, IFN-γ (FIG. 22C(i)), IL-2 (FIG. 22C(ii)), and TNF-α (FIG. 22C(iii)). Black lines represent median values, and upper and lower bars represent maximum and minimum values, respectively. R, responder; NR, non-responder. Statistical analysis by two-way ANOVA. [Figure 22C]Comparison of cytokine profiles to predict response to HBI0101 treatment. Graphical representation of significantly differentially expressed cytokines between "responder" and "non-responder" groups before and after HBI0101 infusion. More specifically, in FIG. 22B, IL-10 (FIG. 22B(i)), IL-1ra (FIG. 22B(ii)), CCL4 (FIG. 22B(iii)), IL-15 (FIG. 22B(iv)), G-CSF (FIG. 22B(v)), and IL-6 (FIG. 22B(vi)); in FIG. 22C, IFN-γ (FIG. 22C(i)), IL-2 (FIG. 22C(ii)), and TNF-α (FIG. 22C(iii)). Black lines represent median values, and upper and lower bars represent maximum and minimum values, respectively. R, responder; NR, non-responder. Statistical analysis by two-way ANOVA. [Figure 23A] Effect of belantamab prior treatment on the response of MM patients to HBI0101 therapy. Kaplan-Meier analysis of progression-free survival (PFS) (Figure 23A) and overall survival (OS) (B) in the "belantamab(+)" vs. "belantamab(-)" groups. [Figure 23B] Effect of belantamab prior treatment on the response of MM patients to HBI0101 therapy. Kaplan-Meier analysis of progression-free survival (PFS) (Figure 23A) and overall survival (OS) (B) in the "belantamab(+)" vs. "belantamab(-)" groups. [Figure 23C] Effect of belantamab pretreatment on MM patient response to HBI0101 therapy. Effect of belantamab pretreatment on PC BCMA expression. The percentage of BCMA expressing BM-PC (Figure 23C) and BCMA expression MFI (Figure 23D) relative to BM-PC were determined by flow cytometry prior to HBI0101 infusion and analyzed according to patient pre-exposure to belantamab. Samples were gated on CD38++CD138++ cells. [Figure 23D]Effect of belantamab pretreatment on MM patient response to HBI0101 therapy. Effect of belantamab pretreatment on PC BCMA expression. The percentage of BCMA expressing BM-PC (Figure 23C) and BCMA expression MFI (Figure 23D) relative to BM-PC were determined by flow cytometry prior to HBI0101 infusion and analyzed according to patient pre-exposure to belantamab. Samples were gated on CD38++CD138++ cells. [Figure 23E] - [Figure 24A] HBI0101 Key steps in the translation of CART based therapy from bench to bedside. POC, Proof of Concept; GMP, Good Manufacturing Practice; IMPD, Investigational Medicinal Product; IB, Inventor Brochure; JACIE, Joint Accreditation Committee ISCT-Europe &EBMT; MOH, Ministry of Health; QA, Quality Assurance; QC, Quality Control. [Figure 24B] HBI0101 Key steps in the translation of CART-based therapy from bench to bedside. Timeline of different stages shown. [Figure 25A] HBI0101 Pre-Clinical Evaluation. BCMA Expression Levels and Pre-Clinical Evaluation for Amyloidosis and Multiple Myeloma-PC. BCMA Expression Levels in Patients with AL (n=18) and Multiple Myeloma (n=39). BCMA% of expression (Figure 25A(i)) and MFI (Figure 25A(ii)) were determined by flow cytometry. Samples were gated on CD38++CD138++ cells. [Figure 25B] HBI0101 pre-clinical evaluation. Clearance of bone marrow (BM)-derived primary plasma cells (PCs) from AL donors (gated on CD38++CD138++) following overnight co-incubation with autologous HBI0101 CART cells (at a 1:1 E:T ratio) compared to non-transduced (NT) cells. [Figure 25C]HBI0101 pre-clinical evaluation. HBI0101 CAR T activation after overnight co-incubation of BM-derived primary plasma cells (PCs) from AL1 and AL2 as shown by the percentage of CD137+ (4-1BB+) cells (gated on CAR+ cells). Co-culture with autologous NT cells serves as control. n=2, p<0.05 (Figure 25C(i)). Figures 25C(ii)-(iii): Cytokine secretion by HBI0101 CAR T or NT cells after co-incubation with BM-MNCs (P<0.05). [Figure 25D] HBI0101 Pre-Clinical Evaluation. Increased apoptosis of MM- and AL3-CD138+ magnetically enriched cells after 2 hours of co-incubation with autologous HBI0101 CAR T cells compared to autologous NT control cells. Co-cultures of the CD138- cell fraction with autologous CAR T cells or autologous NT cells serve as controls. Apoptosis was assessed by determination of intracellular levels of cleaved caspase-3 in CD3-BCMA+ plasma cells by flow cytometry. Of note, the percentage of CD138+ cells before magnetic isolation was 1.50% in patients with multiple myeloma and 2.50% in patients with AL, and increased significantly after enrichment (50.9% and 86.5%, respectively; see FIG. 27). [Figure 26] Plasma-free cell viability. BM-MNC derived from AL1 and AL2 were co-cultured with HBI0101 or AL1 non-transduced (NT) cells (autologous vs. allogeneic settings) for 1 hour. Plasma-free BM-MNC viability was assessed by flow cytometry using 7-AAD staining (lower panel). Samples were analyzed by gating out CD38++CD138++ and CART cells as depicted in the upper panel. [Figure 27]Enrichment of plasma cells (PCs) from AL- and MM-bone marrow aspirates. Bone marrow mononuclear cells (BM-MNCs) were isolated from fresh bone marrow samples of AL-patient 3 (upper panel) and MM-patient (lower panel) after Ficoll fractionation. CD138+ PCs were magnetically sorted using the EasySep™ Human CD138 Positive Selection Kit II. The percentage of PCs before and after CD138+ enrichment in the negative and positive fractions was determined by flow cytometry (samples were gated on CD38++CD138++ cells). [Figure 28A] HBI0101 pre-clinical evaluation. 4-1BB upregulation in HBI0101 CART or NT cells after co-incubation with autologous CD138+ or CD138- cell fractions (gated on CAR+ cells). HBI0101 vs. NT, p<0.0001; HBI0101:CD138+ vs. HBI0101:CD138-, p<0.0001. [Figure 28B] Pre-clinical evaluation of HBI0101. Cytokine secretion by HBI0101 CART or NT cells following co-incubation with autologous CD138+ or CD138- cell fractions (IFN-γ, TNF-α, respectively). [Figure 28C] Pre-clinical evaluation of HBI0101. Cytokine secretion by HBI0101 CART or NT cells following co-incubation with autologous CD138+ or CD138- cell fractions (IFN-γ, TNF-α, respectively). [Figure 29A]Specificity of BCMA.CART (HBI0101) cells for targeting BCMA-expressing cells. After 2 hours of co-incubation with HBI0101 cells, apoptosis was increased in BCMA-expressing NCI-H929 myeloma cells, but not in BCMA-negative K562 chronic myelogenous leukemia (CML) cells. Target cells were not affected by the presence of non-transduced (NT) cells, regardless of BCMA expression. Apoptosis is shown as the percentage of cleaved caspase-3 cells (gated on H929 or K562 target cells). [Figure 29B] Specificity of BCMA.CART (HBI0101) cells for targeting BCMA-expressing cells. 4-1BB activation markers were upregulated on the surface of HBI0101 cells after overnight incubation with BCMA-expressing H929 myeloma cells, but not after incubation with BCMA-negative K562 cells (p<0.0005). 4-1BB expression was barely detectable on the surface of NT cells, regardless of whether they were co-cultured with H929 or K562 target cells. The percentage of 4-1BB+ cells was determined by flow cytometry (samples were gated on CAR+ cells). [Figure 30A] Feasibility of HBI0101 CART production from AL amyloidosis patients. Growth kinetics of HBI0101 transduced cells from AL patients along the CART production process. Drug product (DP) was generated from leukapheresis of four AL patients. The production process continues for 10 days in all four patients. Peak cell growth was observed from day -7 to day -4. [Figure 30B]Feasibility of HBI0101 CART production from AL amyloidosis patients. Characterization of HBI0101 drug product (DP) on the day of infusion (day 0). DP identity. Percentage of CD3+, CD4+, and CD8+ cells (gated on live CAR+ cells) was determined by flow cytometry. DP impurities. Percentage of "cell impurities" was determined by flow cytometry for CD19+, CD14+, and CD3-CD56+ (gated on live cells) and did not exceed 1% each in all four batches. Percentage of BCMA.CAR+ cells (gated on live cells) was determined by flow cytometry using human recombinant BCMA protein. DP potency. Copy number (CPN) of HBI0101 insert into all transduced cells was quantified by qRT-PCR and further adjusted for transduced cells as described in Supplementary Materials and Methods. Potency of drug product. The percentage of activated cytotoxic T cells (CD3+CD56+) was determined by flow cytometry (gated on either CD4+ or CD8+ T cells). Secretion of IFN-γ by each HBI0101-transduced cell was assessed by ELISA on day -2. IFN-γ was released into the co-culture supernatant of HBI0101-transduced cells and NCI-H929 (at a 1:1 E:T ratio) after overnight incubation. The total amount of IFN-γ in each culture well was quantified and then divided by the number of transduced cells introduced into the well. [Figure 30C] Feasibility of HBI0101 CART production from AL amyloidosis patients. The exhaustion profile of DPs on the day of infusion (day 0) was established by assessing the percentage of PD-1+, LAG-3+, and TIM-3+ cells by flow cytometry (gated on CAR+ and CD4+ [Figure 30C(i)] or CD8+ [Figure 30C(ii)] T cells). [Figure 30D]Feasibility of HBI0101 CART production from AL amyloidosis patients. The differentiation profile of DPs on the day of infusion was established by assessing the percentage of CD45RA+ / CCR7+ (naive cells), CD45RA- / CCR7+ (central memory - CM), CD45RA- / CCR7- (effector memory - EM), and CD45RA+ / CCR7- (terminally differentiated effector memory - TEMRA) by flow cytometry (gated on CAR+ cells and CD4+ [Figure 30D(i)] or CD8+ [Figure 30D(ii)] T cells). [Figure 31A] Clinical outcomes of HBI0101 CART-based therapy in the treatment of AL amyloidosis. Differences between tumor-involved FLCs (iFLCs) and non-tumor-derived FLCs (dFLCs) in four AL patients were evaluated at baseline and after HBI0101 CART infusion. [Figure 31B] Clinical outcomes of HBI0101 CART-based therapy in the treatment of AL amyloidosis. Non-tumor-derived FLCs in four patients with AL were evaluated at baseline and after HBI0101 CART infusion on day 30. Normal range for kappa light chains: 6.7-22.4 mg / L, and normal range for lambda light chains: 8.3-27 mg / L. [Figure 31C] Clinical outcomes of HBI0101 CART-based therapy in the treatment of AL amyloidosis. Immunoglobulin levels were monitored over time before and after HBI0101 CART infusion. # indicates intravenous Ig (IVIG) uptake by patients 1 and 4 on day 26 after CART infusion. [Figure 31D] Clinical outcomes of HBI0101 CART-based therapy in the treatment of AL amyloidosis. BCMA median expression (mean fluorescence intensity; MFI) in bone marrow-derived plasma cells (gated on CD38++CD138++ cells) of AL patients prior to HBI0101 CART infusion was assessed by flow cytometry. Red dots represent PCs (gated on CD38++CD138++ cells) and grey dots represent non-PCs. [Figure 31E]Clinical outcomes of HBI0101 CART-based therapy in the treatment of AL amyloidosis. Demonstration of efficacy of HBI0101 CART-based therapy in eliminating CD38++CD138++ AL primary plasma cells. Bone marrow samples pre- and 1 month post-HBI0101 CART infusion were assessed for the presence of plasma cells by flow cytometry (by gating on CD38++CD138++ cells). [Fig. 31F] Clinical outcomes of HBI0101 CART-based therapy in the treatment of AL amyloidosis. Dot plot of flow cytometry data for patient 4 shown in (FIG. 31E). [Figure 31G] Clinical outcomes of HBI0101 CART-based therapy in the treatment of AL amyloidosis. Positron emission tomography-computed tomography (PET-CT) scans from before and after HBI0101 CART treatment. [Figure 32A] HBI0101 in vivo kinetics. The number of HBI0101 CARTs per mL of blood was determined by quantification of CAR transgene levels by qRT-PCR after CART infusion at the indicated times and further adjusted for percent transduction on the day of CART infusion. Limit of quantification (LOQ) 102 CARTs / mL of blood. [Figure 32B] HBI0101 in vivo kinetics. HBI0101 cell in vivo expansion rate. The black line represents the median value, while the upper and lower bars represent the maximum and minimum values, respectively. [Figure 32C] HBI0101 in vivo kinetics. HBI0101 CART / mL in bone marrow aspirates of AL patients one month after CART infusion (determined as detailed in (Figure 32A)). [Fig. 32D] HBI0101 in vivo kinetics. The difference between tumor-derived and non-tumor-derived FLC (dFLC) levels (right y-axis; filled circles) is compared to CART cell expansion indicated by CART / mL (left y-axis; open circles) before and after CART infusion. [Diagram 33]HBI0101 vs. sBCMA in vivo kinetics. Serum BCMA (sBCMA) levels (right y-axis; filled circles) before and after CART infusion as determined by ELISA are depicted relative to CART cell expansion in blood (left y-axis; open circles). [Figure 34A] Efficacy clinical results with HBI0101 CAR T cells HBI0101 (N=29 in 800x106 cohort). Overall response (OR) rate. Best response for each patient grouped by dose cohort (150-, 450-, and 800x106 CAR+ cells / dose) is shown. Disease response was determined according to the International Myeloma Working Group (IMWG) consensus criteria [Kumar S, et al. Lancet Oncol. 17(8):e328-e346(2016)]. Minimal residual disease (MRD) is defined as the number of MM plasma cells detected in the bone marrow per 1x105 total nucleated cells. MRD of 1x10-5 or less is considered MRD negative. [Figure 34B] Efficacy clinical outcomes with HBI0101 CAR T cells HBI0101 (N=29 in 800x106 cohort). Kaplan-Meier analysis of progression-free survival (OS) grouped by dose cohort. [Figure 34C] Efficacy clinical outcomes with HBI0101 CAR T cells HBI0101 (N=29 in 800x106 cohort). Kaplan-Meier analysis of overall survival (PFS) grouped by dose cohort. EXAMPLES

[0022] Experimental procedure PBMCs and cell lines Peripheral blood mononuclear cells (PBMCs) were from healthy donors obtained from the Israeli Blood Bank (Sheba Medical Center, Tel-Hashomer, Israel, Pheresis Collection Unit, (IRB approval number 0458-19-HMO) or from blood of patients with plasma cell malignancies. Blood was collected from patients with plasma cell malignancies according to IRB approval number 0253-20-HMO.

[0023] Bone marrow (BM) aspirates were obtained from patients with plasma cell dyscrasia in accordance with Helsinki approval from the Ethical Committee of Hadassah Ein-Kerem Medical Center. BM-derived mononuclear cells were isolated by centrifugation on a density gradient medium (Lymphocyte Separation Medium, Lonza).

[0024] BCMA + The cell lines are RPMI8226 (ATCC / CCL-155), (NCI)-H929 (ATCC / CRL-9068), and MM1.S (ATCC / CRL-2974). K562 (ATCC / CCL-243) is an erythroleukemia line BCMA neg K562-BCMA was engineered to overexpress BCMA. All cell lines were cultured in RPMI medium (Invitrogen, Carlsbad, CA) containing 10% heat-inactivated fetal bovine serum (Biological Industries, Beth Haemek, Israel) and maintained in a 37°C and 5% CO2 incubator.

[0025] Lymphocytes were cultured in BioTarget medium (Biological Industries, Beth Haemek, Israel) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 1% L-glutamine, 1% penicillin / streptomycin, and 300 IU / ml IL-2 (Peprotech Asia, Israel) [Daniel-Meshulam I, et al. Int J Cancer. 13(12):2903-2913. (2013); Eisenberg V, et al. Front Immunol. 8:1212. (2017); Meril S, et al. Mol Carcinog. 59(7):713-723 (2020)].

[0026] Anti-BCMA chimeric receptor The different chimeras ICBB, IC28, and H8BB (Figure 1A) were generated by overlapping polymerase chain reaction (PCR) based on the heavy chain followed by the light chain derived from C11D5.3 as previously described [Carpenter RO, et al. Clin. Cancer Res. 19(8):2048-2060. (2013)]. ICBB and IC28 incorporated an optimized short IgG4-derived spacer and a Strep Tag [Liu L, et al., Nat. Biotechnol. 34:430-434 (2016)], while H828 and H8BB incorporated the hinge and transmembrane (TM) domains derived from CD8α. H828 CARs were a gift from Dr. Kochenderfer, NCI, NIH [Carpenter RO,et al.Clin.Cancer Res.19(8):2048-2060.(2013)]. These chimeras were subcloned into the well-characterized retroviral vector backbone pMSGV1 (a gift from Dr Steven Rosenberg, NCI). Retroviral transduction, co-culture, ELISA, and cytotoxicity assays were performed as previously described [Hoogi S,et al.J.Immunother.Cancer.7:243.(2019); Shamalov K,et al.,Oncoimmunology.6:e1285990.(2017).Tal Y,et al.Oncotarget.5:10949-10958.(2014)].

[0027] Generation of clinical grade HBI0101 retrovirus bank PG13 HBI0101 was generated by transiently transfecting Phoenix-ECO cells (ATCC) with a plasmid encoding the gamma-retroviral vector MSGV1-HBI0101 using JetPrime reagent (Tamar) and then transducing PG13 cells (ATCC) with the HBI0101-Phoenix-ECO cell-free vector supernatant. The PG13 transduced population was then subcloned by limiting dilution and PG13-HBI0101 was expanded to generate a seed bank. The qualified PG13 seed bank was sent to the Indiana University Vector Production Facility (IU-VPF) in Indianapolis, which generated a master cell bank (MCB) and GMP-certified HBI0101 clinical grade retroviral supernatant for the transduction of autologous T cells from MM patients.

[0028] HBI0101 cell production For ex vivo studies: Peripheral blood mononuclear cells were isolated from the blood of patients with AL and / or multiple myeloma, and CD3-activated peripheral blood mononuclear cells were used for further production. Blood was collected from patients with AL or / and multiple myeloma (0253-20-HMO) and processed on a Ficoll gradient (Lymphocyte Separation Medium, Lonza) to isolate peripheral blood mononuclear cells (PBMCs). PBMCs were suspended at a concentration of 1×10^6 cells per mL in T-cell medium (TCM) containing 5% human serum (Valley), AIM-V (Gibco) supplemented with 1% Glutamax (Gibco). IL2 (300IU / mL; Proleukin, Novartis) and anti-CD3 monoclonal antibody OKT-3 (50ng / mL; Miltenyi Biotech) were added to TCM and cultured for 2 days. Non-tissue culture treated 24-well plates were coated with 10 mg / mL RectroNectin (R / N; Takara) in PBS (Lonza) overnight at 4°C, followed by blocking with 2.5% human albumin in PBS for 30 min and then washing. Retroviral supernatants were thawed, diluted 1:20 in TCM, added to wells and centrifuged at 2000g for 2 h at 32°C. The supernatants were then aspirated and 0.5 × 10 6 CD3-activated PBMCs / mL were seeded into each well in TCM containing 300 IU / mL IL2, centrifuged at 1,000g for 10 min, and incubated overnight at 37°C. Activated but non-transduced (NT) cells were generated and used as T cell controls. Transduction efficacy was determined on days 6 and 10 of culture via flow cytometry by labeling BCMA CAR T cells with human recombinant BCMA protein (Active; ACRO).

[0029] Clinical Grade Production: Production of HBI0101 cells was carried out using the same protocol described above for production of cells for ex vivo use. Modifications were made to the source of starting material, the use of clinical grade media and reagents, and production under GMP conditions to generate CART cells suitable for the clinic.

[0030] Leukocytes are collected on day -10 by leukapheresis using a Spectra Optia apheresis system and then transferred to the Facility for Advanced Cellular Therapy-Hadassah (FACT-H). Cells are separated into peripheral mononuclear cells (PBMCS) and T cells are stimulated using anti-CD3 and IL-2 (Figure 12). On day -8, T cells stimulated with 1 / 25 or 1 / 50 diluted HBI0101 retroviral supernatant are transduced overnight. Cells are then seeded into GRex100 devices filled with AIM-V medium (Gibco) supplemented with 5% human AB serum (Access Cell Culture or Valley), 1% Glutamax (Gibco), and 300 IU / mL IL-2 and expanded for 7 days (Figure 12). Medium and IL-2 supplementation is performed every 2-3 days. On the day of patient infusion, cells were washed three times with saline containing 1% human albumin (Kederion) and then cultured at 15 × 10 6 The final drug product (DP) was formulated at a concentration of CART cells / mL. The DP injection volume was varied according to the cell dose.

[0031] Overview of QC and Sterility Testing for HBI0101 Production Quality control testing of HBI0101 cells in-process (IP) and end-of-process (EOP) was performed along with the manufacturing process detailed in FIG. 12A and included: i) determination of the percentage of transduction assessed by flow cytometry using BCMA-FITC recombinant protein (ACROBiosystems) performed on days −7, −2, and 0; ii) in vitro efficacy of CART cells assessed by ELISA of interferon-γ release after stimulation with a myeloma cell line (R&D) performed on day −2; iii) determination of vector copy number (CPN) by real-time (RT) PCR of genomic DNA of transduced cells on day −2; iv) confirmation of the absence of replication competent retrovirus (RCR) on day −2 by PCR analysis of genomic DNA of transduced cells using a GALV primer set as detailed in 3; v) following anti-CD3 (Beckman vi) characterization of different cell subsets by flow cytometry on day 0 using an antibody mixture such as anti-CD4 (Biolegend), anti-CD8 (BD), anti-CD56 (Biolegend), anti-CD19 (Biolegend), and anti-CD14 (Beckman Coulter); vi) evaluation of the pH of the DP on day 0. All tested parameters represent the release criteria for the final DP, the specifications of which are further detailed in Table 5.

[0032] In addition, in accordance with ANNEX 1 guidelines for Advanced Therapy Medicinal Products (ATMP), IP and EOP HBI0101 cells are tested for sterility according to the timeline detailed in Figure 12B. Sterility testing was performed by an outsourced GMP certified organization (HyLabs).

[0033] HBI0101 CART in vivo detection Blood was collected from MM or AL patients at the indicated times before and after HBI0101 cell infusion. Genomic DNA was extracted and purified using the Qiagen QIAamp DNA Blood Mini Kit. CAR copy number (CPN) was determined by quantitative real-time PCR using Taqman-based primers as follows: MSGV1 primer (forward: CGGCAGCCTACCAAGAACA as indicated by SEQ ID NO:29, reverse primer: TGTGTCGCCGACTCGGTAA as indicated by SEQ ID NO:30, probe: CGGTGGTACCTCACC as indicated by SEQ ID NO:31), and TaqMan Fast advance Master Mix (Applied Biosystems). A standard curve of MSGV1 plasmid (10 7 ~10 0 A range of copy numbers (range of copy numbers) was generated by serial dilution of the MSGV1 plasmid. The number of circulating CART in 1 mL of blood was then calculated by extrapolating the copy number of the retrovirus inserted into each CART cell.

[0034] For vector CPN determination, 20 x 10 6 DNA was extracted (QIAamp DNA Blood Mini Kit) from expanded HBI0101-T cells. Unknown samples, no template controls, and standards were run in triplicate. The average MSGV1-HBI0101 vector CPN per transduced cell (CPN / Td) was calculated by normalizing to the endogenous number of diploid albumin copies and further adjusted for percent transduction.

[0035] For amyloidosis studies, quantification of MSGV1-based HBI0101 vector CPN was performed using Applied Biosystems StepOne real-time PCR system. PCR reaction mixtures contained 1x Taqman Fast advance Master Mix (Applied Biosystems), Taqman-based primer mix for MSGV1 insert or albumin amplification, Taqman-labeled probe, and sterile nuclease-free water. MSGV1 primers / probes are as follows: forward: CGGCAGCCTACCAAGAACA as shown by SEQ ID NO:29, reverse: TGTGTGCCGACTCGGTAA as shown by SEQ ID NO:30, probe: CGGTGGTACCTCACC as shown by SEQ ID NO:31), albumin primers / probes are as follows: forward: GAGTCACCAAATGCTGCACAGA as shown by SEQ ID NO:32, reverse: GAACGTATGTTTCATCG as shown by SEQ ID NO:33, probe: ACAGGCGACCATGCT as shown by SEQ ID NO:34. Unknown samples, no template controls, and standards were run in triplicate. The average MSGV1-HBI0101 vector CPN per transduced cell (CPN / Td) was calculated by normalizing to the endogenous number of diploid albumin copies and further adjusted for the percentage of transduction.

[0036] Study Design and Patient Assessment - Amyloidosis Study At the beginning of 2021, a phase I clinical trial for the treatment of MM was launched and registered at clinical.gov.il (NCT04720313). The study aimed to evaluate the safety and efficacy of HBI0101 in patients with MM and further plasma cell dyscrasias, including AL. Enrolled patients had to be refractory to at least three lines of treatment, including proteasome inhibitors, immunomodulators (IMiDs), and anti-CD38 antibodies, and had to have not received other available registered therapies. At the start of the study, all patients had progressive disease. The first part of the phase I trial included 150, 450, and 800 × 10 6 The study consisted of administration of HBI0101-transduced T cells at increasing cell doses of CAR+ cells. Each patient reported herein participated in a different safety cohort. The complete study protocol, outlined in Figure 10, was approved by the Hadassah Medical Center's institutional review board (IRB) and the central ethics committee of the Israeli Ministry of Health. Written informed consent was obtained from each patient, and the study was conducted and approved in accordance with the ethical guidelines of the Declaration of Helsinki under the auspices of the Hadassah IRB. One patient was treated on a compassionate basis after informed consent and IRB approval due to the concomitant occurrence of an active malignancy (myelodysplastic syndrome). At the time of treatment, safety (800 × 10 6 cells) had not yet been evaluated, so this patient was divided into 450 × 10 6 Patients were treated with a dose of 1000 cells. Adverse events were graded according to the National Cancer Institute Common Terminology Criteria for Adverse Events (NCI CTCAE), version 4.03. Cytokine release syndrome was graded according to published criteria [Lee DW, et al. Biol Blood Marrow Transplant 2019;25(4)].

[0037] Bone marrow immunophenotyping Bone marrow (BM) aspirates were collected from patients with multiple myeloma and / or AL before and 1 month after HBI0101 infusion. BM samples were labeled with α-hCD38 (A07778), α-hCD138 (B37788; Beckman Coulter), and α-hBCMA (19F2; Biolegend) and further analyzed using a 10-color Navios flow cytometer (Beckman Coulter). Flow cytometry analysis was performed using KALUZA software. For amyloidosis studies, samples were lysed with IOTest3 Lysis Solution × 1 (Beckman Coulter), washed, and then flow cytometry was performed.

[0038] Quantification of serum dFLC and serum soluble BCMA (sBCMA) Levels of tumor- and non-tumor-derived FLC (Siemens FLC assay) were determined in the serum of patients (in the MM and AL studies) at the indicated time points.

[0039] Serum samples for serum BCMA (sBCMA) were diluted 1:1,000 and analyzed by sBCMA ELISA kit (R&D Systems). ELISA plates were analyzed using a plate reader (Biotek Industries) set at 450 nm with Gen5 3.05 software. Values ​​represent the average of duplicate samples for each specimen. Assay range: 15.6-2000 pg / mL; user-validated assay sensitivity: 8.28 pg / mL.

[0040] Multiple analysis Sera from MM patients at baseline (day -10) and T(t)max (day of CART peak concentration (Cmax) were processed with Luminex Performance Human XL Cytokine Magnetic Panel (25-Plex) FCSTM18-26 (R&D) and analyzed by Luminex MAGPIX using xPONENT4.2. The parameters were further evaluated by the Instrument. The multiplex panel included the following cytokines / chemokines: CCL2, CCL3, CCL4, CXCL10, IL-8, G-CSF, GM-CSF, IFN-α, IFN-γ, IL-10, IL-12, IL-13, IL-15, IL-17, IL-1b, IL-1ra, IL-2, IL-4, IL-5, IL-6, IL-7, CCL5, TNF-α, VEGF, and FGF. Precision and sensitivity data for these parameters are reported in the manufacturer's manual. Data were analyzed using MILLIPLEX® Analyst 5.1 software. Concentrations of IFN-γ, TNF-α, and IL-2 were determined by ELISA (R&D).

[0041] T cell exhaustion / activation after antigen stimulation and at rest To assess T cell exhaustion / activation following antigen stimulation, anti-BCMA chimeras were cultured in the presence of either H929-MM cell lines, or BCMA-overexpressing K562 (K562-BCMA), or K562 cell lines in T cell medium without IL-2 for 24 h. Co-cultures were performed in 96 round-bottom well plates. 0.05 × 10 6Co-cultures of CAR+ effector T cells were mixed with 0.05x10^6 target cells (E:T ratio of 10:1) in T cell medium without IL-2 and incubated for 24 hours at 37°C. After incubation, cells were washed and stained for 20 minutes at 4°C with a mixture of the following fusion proteins / antibodies: BCMA-FITC (Acro), anti-CD3 (Beckman Coulter), anti-PD-1 (Beckman Coulter), anti-LAG-3 (eBioscience), anti-TIM-3 (eBioscience), anti-TIGIT (eBioscience) for the assessment of T cell exhaustion, and with a mixture of the following fusion proteins / antibodies: BCMA-FITC (Acro), anti-CD137 (4-1BB) (Beckman Coulter), anti-CD69 (BD Pharmingen), anti-CD25 (Beckman Coulter) for the assessment of T cell activation. Cells were washed twice with FACS buffer. Samples were acquired on a Navios cytometer. Data was analyzed using Kaluza software. Cells were gated for BCMA CAR+.

[0042] To assess resting T cell exhaustion / activation, anti-BCMA chimeras were cultured 12 days post-transduction in T cell medium supplemented with 300 IU / mL IL-2. Cells without prior antigen stimulation were stained every 2-4 days with the T cell exhaustion and activation antibody cocktail described above.

[0043] Establishment of tumor assays NOD / SCID / gamma mice approximately 6-12 weeks of age were administered 4 × 10 IgG resuspended in 100 μl of HBSS medium (Biological Industries, Beth Haemek, Israel) and 100 μl of Cultrex matrix (Trevigen, MD). 6NCI H929 cells were injected subcutaneously. After tumor inoculation, injection of transduced lymphocytes resuspended in 200 μl of HBSS medium was performed. Tumor size was assessed every 2-3 days using calipers in a blinded fashion or by injection of luciferin solution (5 mg / ml, 200 μl / mouse, Promega) and bioluminescence imaging (BLI) evaluation. Animals were humanely euthanized if tumors exceeded 16 mm in diameter. All procedures were performed in accordance with the guidelines of the University Committee on Animal Welfare.

[0044] T cell persistence in the blood of NSG mice Twenty-five microliters of blood was collected from the tail vein of the mice, lysed with IOTEST3 lysis solution x 1 (Beckman Coulter) for 10 minutes, stained with a mixture of recombinant human BCMA protein (Active) (FITC) (Abcam, ab246085), anti-CD3 (Beckman Coulter), anti-CD8 (BioLegend), and anti-CD4 (BioLegend), and CD3+BCMA.CAR+ cells were referred to as "CAR T cells."

[0045] immunohistochemistry Four-micron-thick formalin-fixed paraffin-embedded (FFPE) tumor sections were stained with anti-human CD3 antibody (103A-76, 1507011D, CellMarque, 1:1000 dilution) on a BenchMark ULTRA Autostainer (Ventana Medical Systems) using standard antigen retrieval (CC1 buffer, 40 min). Detection was performed using the ultraView Universal DAB Detection Kit (Ventana Medical Systems).

[0046] Coculture of BM-MNCs with BCMA.CART cells Bone marrow aspirates were obtained from patients with different types and stages of plasma cell dyscrasia according to the Helsinki approval of the Ethical Committee of Hadassah EinKerem Medical Center. Bone marrow-derived mononuclear cells (BM-MNC) were isolated by centrifugation in density gradient medium (Lymphocyte Separation Medium, Lonza) either immediately after BM aspiration or after overnight incubation at room temperature. BM-MNC were co-cultured with H8BB CART effector cells or control non-transduced (NT) T cells overnight at 37°C and then analyzed by flow cytometer.

[0047] In vitro PC elimination BM mononuclear cells (BM-MNC) from primary BM samples isolated by ficoll density gradient centrifugation were cultured in a 1:1 mixture of CART:BM-MNC cells (10 5 The cells were co-cultured with 100 μg / ml of 10 ...

[0048] In vitro CD138PC cytotoxicity BM-MNCs were enriched in CD138PCs using EasySep human CD138 Positive Selection Kit II (STEMCELL Technologies). BM-MNCs, CD138, or CD138 fractions of BM-MNCs were co-cultured with either HBI0101 or NT effector cells at an E:T ratio of 1:1 in TCM for 2 hours (for caspase-3 killing assays) or overnight (for cytokine release and 4-1BB activation assays). Cell fractions were extracellularly labeled with hBCMA recombinant protein, a-CD3, and a-CD137 for T cell activation assays, or a-BCMA, a-CD3, and a-CD138 for cytotoxicity assays, fixed, permeabilized, and intracellularly labeled with cleaved caspase-3. Stained cells were analyzed by flow cytometer. Cell supernatants were collected and IFNγ and TNFα secretion was quantified by ELISA (R&D) according to the manufacturer's instructions.

[0049] CD138PC apoptosis Cell fractions of in vitro PC cultured cell suspensions were extracellularly labeled with anti-BCMA (Bio-Legend), anti-CD3 (Beckman Coulter), and anti-CD138 (Beckman Coulter) for 20 min at 4° C. Cells were then washed twice in PBS 2% FBS, fixed and permeabilized with Fix / Perm solution (BD), and then intracellularly stained with anti-active caspase-3 antibody (BD Pharmingen). The percentage of cleaved caspase-3 in CD3-BCMA gated cells was determined using flow cytometry.

[0050] Non-PC viability by 7AAD staining BM-MNCs were co-cultured 1:1 E:T with either HBI0101 or NT cells in AIM-V (Gibco) supplemented with 5% human AB serum (Access Biological LLC) and 1% Glutamax (Gibco) for 1 h at 37°C. After incubation, cells were washed with PBS and stained with anti-CD38 and anti-CD138 (Beckman Coulter) for 20 min. 7-AAD (Tonbo Bioscience) was added 5 min prior to sample acquisition (10-color Navios flow cytometer). Samples were gated on the CD38-CD138-“AND NOT” CART. Samples were analyzed using Kaluza 2.1 software.

[0051] 4-1BB activation assay HBI0101-transduced or NT T cells were co-cultured with either BMMNCs or CD138-positive or CD138-negative fractions of BM-MNCs (1:1 E:T ratio) in U-bottom 96-well plates. After overnight incubation at 37°C, cells were labeled with human BCMA recombinant protein (ACRO), anti-CD3 (Beckman Coulter), and anti-CD137 (4-1BB; BioLegend) and then analyzed by flow cytometry. To assess the percentage of 4-1BB CAR cells, samples were gated on live CD3 CAR cells and NT cell samples were gated on live CD3 cells.

[0052] Clinical studies, inclusion and exclusion criteria Inclusion criteria: 18 years of age or older; willingly signed an informed consent form (ICF); Eastern Cooperative Oncology Group (ECOG) performance status 0-2; diagnosed with MM with relapsed or refractory disease and having previously received at least three different lines of treatment, including a proteasome inhibitor, an immunomodulatory therapy, and at least one antibody therapy; Subjects must have measurable disease, including at least one of the following criteria: • Serum M-protein ≥0.5 g / dL; ● Urinary M-protein ≥200mg / 24h; • Serum free light chain (FLC) assay: tumor-derived FLC levels ≥ 5 mg / dL (50 mg / L), provided the serum FLC ratio is abnormal; • Biopsy-proven, evaluable plasmacytoma; ● Bone marrow plasma cells are more than 20% of total bone marrow cells; • Nonsecretor patients will be allowed, provided they have measurable disease by PET-CT or bone marrow aspiration as specified; ● Women of child-bearing potential (WCBP) must have a negative serum pregnancy test prior to treatment. All sexually active WCBP and all sexually active male subjects must agree to use effective contraception throughout the study; • Resolution of any non-hematologic toxicity attributable to prior treatment to grade 2 or less or to baseline, except for alopecia and grade 3 neuropathy; • Ability and willingness to comply with study visit schedule and all protocol requirements.

[0053] Exclusion criteria: • Any prior systemic therapy for MM within 14 days prior to leukapheresis. • Use of long-acting growth factors or drugs for cell mobilization within 14 days prior to leukapheresis. • Use of short-acting growth factors or drugs for cell mobilization within 5 days prior to leukapheresis. • Therapeutic doses of steroids within 3 days prior to leukapheresis (physiologic replacement doses of steroids up to 12 mg / m2 / d of hydrocortisone or equivalent are permitted). • Any prior systemic therapy for MM within 14 days prior to initiation of lymphodepletion. CNS-directed radiation within 8 weeks prior to lymphodepletion • Use of long-acting growth factors or drugs for cell mobilization within 14 days prior to lymphodepletion. • Use of short-acting growth factors or drugs for cell mobilization within 3 days prior to lymphodepletion. Investigational cell therapy within 8 weeks prior to lymphodepletion • Subjects with known bulky central nervous system disease. ● Inadequate liver function ALT>3 normal. ● Inadequate renal function CRCL<20. • International ratio (INR) or partial thromboplastin time (PTT) >1.5 x ULN unless taking a stable dose of anticoagulant for a thromboembolic event consistent with exclusion. Inadequate bone marrow function as defined by an absolute neutrophil count (ANC) <1000 cells / mm3 or a platelet count <30,000 mm3; or Hemoglobin <8 g / dL (transfusions are acceptable), absolute lymphocyte count <500 cells / mm3. ● Left ventricular ejection fraction <40%. • Treatment with chronic immunosuppressants is ongoing. • Presence of active infection within 72 hours prior to lymphodepletion. • History of allogeneic bone marrow transplant or treatment with any gene therapy-based cancer drug. - Significant co-morbid conditions or illnesses which, in the judgment of the inventors, would place the subject at undue risk or preclude the study. - Known human immunodeficiency virus (HIV) positive status. • Active Hepatitis B or C infection (see acceptance criteria for HBV, HCV, and HIV). • Subjects with a history of stroke, unstable angina, myocardial infarction, or ventricular arrhythmia requiring medication or mechanical control within the last 3 months. ● Subjects with a second malignancy in addition to myeloma, if the second malignancy has required treatment within the past two years or is not in complete remission; exceptions to this criterion include successfully treated non-metastatic basal or squamous cell skin cancer or prostate cancer that does not require treatment. - Subjects who have had a venous thromboembolic event requiring anticoagulation and meet any of the following criteria: ● had been receiving a stable dose of anticoagulation for less than 1 month (excluding acute intubation-induced thrombus); - Grade 2, 3, or 4 bleeding in the past 30 days • experiencing ongoing symptoms from the venous thromboembolic event (e.g. ongoing dyspnea or oxygen requirement); ● Pregnant or breastfeeding women.

[0054] [Table 1]

[0055] All data are presented as number of patients, percentage of patients (number, %).

[0056] statistical analysis Statistical analysis was performed using GraphPad Prism (V9.1.0). Unless otherwise stated, paired Student's t-test or two-way ANOVA test was used for normal data with equal variance. P<0.05 was considered significant and is indicated in the figures. * T cells from at least three different healthy donors were used for all in vitro and in vivo experiments. Kruskal-Wall analyses with Dunn post-hoc analysis were performed on mouse tumor volumes. Analysis of variance or log-rank (Mantel-Cox) tests were performed on survival data.

[0057] For the purpose of comparison between different HBI0101 doses for both safety and short-term efficacy (clinical trial NCT04720313), a sample size of 20 patients was planned. Descriptive statistics were performed using medians with ranges for continuous variables and counts and percentages for categorical variables. OS was defined as the time from randomization to death from any cause and is measured on an intention-to-treat basis. PFS was defined as the time from CART infusion to disease progression or death from any cause. Kaplan-Meier methods were used to estimate OS and PFS. Overall response rate (ORR) was defined as the proportion of patients who achieved either a stringent complete response (sCR), complete response (CR), very good partial response (VGPR), or partial response (PR). Descriptive statistics were performed using percentages. For the purpose of this Phase I data analysis, data were collected until February 3, 2022. Data were compiled using Excel software and all statistical analyses were performed using GraphPad Prism (v9.2.0) software. Appropriate statistical methods were used to calculate significance as described in the figure briefs (2-way ANOVA and paired or unpaired t-tests).

[0058] Example 1 Generation and preliminary evaluation of different anti-BCMA CARs Based on the same scFv derived from the C11D5.3 antibody [2], three second generation anti-BCMA CARs were constructed. As costimulatory molecules, these CARs incorporate either 4-1BB (in H8BB and ICBB) or intracellular domains derived from CD28 (in IC28) (Figure 1A). More specifically, H8BB contains hinge and transmembrane (TM) domains derived from CD8α, which were replaced by IgG4 hinge and CD28 TM in ICBB. IC28 shares the same hinge and CD28 TM domains as the ICBB CAR, but switched its costimulatory domain from 4-1BB to CD28 (Figure 1A). As a reference, we used the previously described [2] and clinically tested [3] H828 CAR, which incorporates CD8α-derived hinge-TM and CD28 as costimulatory domains.

[0059] Next, the function of BCMA-specific CARs was evaluated. To that end, anti-CD3 stimulated human PBMCs were transduced with these different CARs. As illustrated in Figure 1B, BCMA CAR molecules were expressed at high levels ranging from 66% for ICBB CARs to 81% for H8BB CARs. Then, to evaluate the basic function of BCMA CARs, overnight co-cultures of CAR-transduced T cells with target cells (K562 vs. K562-BCMA) were performed and IFNγ secretion was measured by ELISA. Figure 1C shows that all four anti-BCMA CARs were able to mediate IFNγ release. These results confirm that different anti-BCMA CARs can be expressed on the T cell surface (Figure 1B) and can mediate anti-tumor functions in those cells (Figure 1C). Furthermore, IC28 was able to induce cytokine release upon certain stimulation, but this molecule was less efficient than ICBB-, H8BB-, and H828 CARs in mediating cytokine release (Figure 1C, IC28 vs. CD34t, ns), in killing assays, and in upregulating activation markers upon antigen stimulation (data not shown). In addition, Figure 1C shows that H8BB CAR T cells secrete less IFNγ than corresponding ICBB CAR T cells when cultured in the presence of the BCMA-negative control cell line K562 (p<0.05). As both chimeras share identical scFv and costimulatory domains, this observation may indicate that the hinge and TM moieties incorporated into these CARs may affect their "off-target" specificity. Given these preliminary data and based on new studies demonstrating 4-1BB costimulatory benefits [11, 12], we therefore focused on 4-1BB-based CARs, namely ICBB and H8BB.

[0060] Example 2 Growth and viability of T cells transduced with different anti-BCMA chimeras Next, we evaluated the ability of the different anti-BCMA CARs to promote T cell proliferation over several weeks in culture. To this end, the growth of the different BCMA CAR-transduced T cells was monitored over 18 days of culture. Figure 1D shows that ICBB CAR T cells display a slower expansion profile compared to H828-, H8BB- and CD34t-CAR T cells (ICBB vs. H8BB / H828 / CD34t, p<0.05). In addition, BCMA CAR T cell viability was also evaluated by determining the percentage of dead cells by staining transduced lymphocytes with propidium iodide (PI). Figure 1E shows that the majority of ICBB-transduced cells were PI positive (61.4% ± 2.0) compared to the significantly reduced number of PI-positive cells detected in all other groups (5.3-9.1%, p<0.0001). The data show that H8BB-transduced cells have a similar ability to expand over time in vitro as H828-transduced cells, while ICBB-transduced cells exhibit increased cell death (Figure 1E) and subsequent reduced expansion capacity (Figure 1D).

[0061] Example 3 Cytokine secretion by BCMA-specific CAR Following the initial evaluation of CAR functionality, more extensive cytokine secretion assays were performed by co-culturing BCMA-CAR transduced T cells with different plasma and MM cell lines. In general, BCMA-CAR T cells were able to specifically secrete higher levels of cytokines important for antitumor immunity (IFNγ, TNFα, and IL-2) when compared to CD34t negative control CAR T cells [Wilde S, et al. J Immunol. 189(2):598-605. 2012)] (Figure 2, p<0.05). More precisely, when performing co-culture with target RPMI8226, it was observed that the H8BB CAR mediated an average secretion of 6721 pg / ml, the ICBB CAR 4520 pg / ml, and the H828 CAR 5055 pg / ml of IFNγ. Similar results were observed when measuring TNFα and IL-2 secretion (e.g., IL-2 on average 970 pg / ml for ICBB CARs, 1450 pg / ml for H8BB CARs, and 260 pg / ml for H828 CARs using RPMI-8226 targets). The differences between H8BB and H828 were found to be statistically significant (p=0.00098 for IFNγ, p=0.01 for IL-2, and p=3.7×10 for TNFα-). -5 ; calculated using paired Student's t-test). As previously described herein (Figure 1B), it is noteworthy that H8BB- and H828-CAR T cells showed the lowest non-specific cytokine secretion in control co-cultures with antigen-negative targets (K562) or without any targets (Figures 2A-2C). This observation reinforces the idea that "off-target" (i.e., non-specific targets) and tonic (i.e., without antigen stimulation) signaling can be influenced by the CAR configuration.

[0062] Example 4 Phenotypic analysis of BCMA-engineered CAR T cells We then sought to characterize the phenotype of BCMA-CAR T cells. We focused on the CD4 / CD8 ratio and memory differentiation patterns. To this end, BCMA-CAR transduced T cells were sampled 3 weeks after PBMC activation and analyzed for marker expression by flow cytometry. As can be seen in Figure 3A, no substantial differences were observed between the different CAR expressing populations for the CD4 / CD8 ratio, which was approximately 1:2. Furthermore, analysing the expression of memory markers CD45RO and CCR7, we found that 44 / 40% of central memory T cells (CM-CD45RO) were expressed in ICBB- and H8BB-CAR T cells, respectively. + / CCR7 + ) and 33 / 39% of effector memory T cells (EM-CD45RO + / CCR7 -) was observed (Figure 3B). However, H828-transduced T cells showed a higher percentage of effector memory T cells compared to 4-1BB-based CARs (57% vs. 36%, p = 0.037) (Figure 3B). It has been reported that CAR T cells exhibiting a "less differentiated profile" (i.e., central memory cells) persist and therefore function better in vivo [Ren H, et al. Front Immunol. 12: 745109. (2021)]. In addition, it has been reported that exhausted T cells can progress to functional impairment and that the loss of function is mediated by upregulation of inhibitory receptors such as programmed death receptor-1 (PD-1), lymphocyte activation gene-3 (LAG-3), T cell immunoglobulin-3 (TIM-3), and T cell immunoreceptor with Ig and ITIM domains (TIGIT) [Anderson AC, et al. Immunity. 44(5):989-1004. (2016)]. Therefore, the expression of these exhaustion markers was monitored over time in different BCMA-CAR T cells in culture. Figure 3C(i)-(iv) show that there is a significant increase in the expression levels of PD-1 (Figure 3C(i)), LAG-3 (Figure 3C(ii)), TIM-3 (Figure 3C(iii)), and TIGIT (Figure 3C(iv)) on the surface of H828-transduced cells when compared to 4-1BB-based CARs over time in culture (p<0.001). It is noteworthy that H828-transduced T cells exhibit significantly higher levels of exhaustion markers at very early stages of culture after transduction. This increase in basal expression of exhaustion markers may be mediated by tonic signaling enhanced by the CD28 costimulatory portion of the CAR and, importantly, may interfere with in vivo CAR T cell function.

[0063] Example 5 Upregulation of activation markers and exhaustion profile of anti-BCMA chimeras following antigen stimulation To further explore the observation that high basal expression of exhaustion markers on the surface of H828-based CAR T cells may affect their functionality, while reducing the expression levels of these markers may improve the T cell function of 4-1BB-based CAR T cells, the expression of PD-1, LAG-3, TIM-3, and TIGIT on the surface of different BCMA CAR T cells was analyzed after overnight co-culture with BCMA-positive targets. Figure 4A (i)-(iv) shows that all four exhaustion markers are highly expressed on the surface of H828 CAR-T cells, even in the absence of targets, as previously illustrated in Figure 3C. In contrast, 4-1BB-based CAR T cells responded specifically to the different stimuli by upregulating PD-1 (Figure 4A (i)), LAG-3 (Figure 4A (ii)), and TIM-3 (Figure 4A (iii)) upon BCMA-mediated specific stimulation. The only exception is for the inhibitory receptor TIGIT (Figure 4A (iv)), which was found to be basally lower in 4-1BB-based CAR T cells compared to H828-CAR T cells, but did not respond to antigen stimulation. This marker may require longer stimulation. Interestingly, the basal expression of TIM-3 in ICBB-CAR T cells was significantly higher (p<0.05) than in H8BB CAR T cells. Considering the fact that TIM-3 expression can also be induced upon activation [Han G, Front Immunol. 4:449 (2013)], this observation could explain the nonspecific activity observed in cytokine release (Figure 1C and Figure 2A-B).

[0064] Next, to test the hypothesis that high basal expression of exhaustion markers may interfere with CAR T cell function (Figure 3C), we investigate whether these CARs are able to mediate the upregulation of T cell activation markers upon antigen stimulation. After overnight or 4 h co-culture with BCMA-positive target cells, BCMA-CAR T cells were analyzed for surface expression of activation markers, including 4-1BB (i.e., CD137), CD25, and CD69. As expected, a correlation between the activation state of CAR T cells and the exhaustion profile was found. Indeed, Figure 4B ((iii)) shows that H828-CAR T cells upregulate their 4-1BB molecule after stimulation with BCMA-expressing targets, but to a lower extent than 4-1BB-based CAR T cells (H828 vs. ICBB and H8BB, p<0.05). Similar results were achieved when measuring CD69 expression after a short co-culture (4 h) of myeloma target cells (Figure 4B(ii)). CD25 expression (Figure 4B(i)) shows that H828 CAR T cells are highly activated compared to H8BB CAR T cells (H828 vs. H8BB, p<0.001), even when unstimulated ("no target") or stimulated with BCMA-negative cells (K562). In addition, after stimulation with specific targets, H8BB CAR T cells significantly upregulate CD25 (p<0.01), whereas ICBB- and H828 CAR T cells did not significantly respond to antigen stimulation (Figure 4B(i)). For example, although CD25 expression levels were generally higher (62-65%) following co-culture with BCMA-positive targets in H828-CAR T cells compared to H8BB-CAR T cells (52.9-58.6%-H828 vs. H8BB, P<0.001), they were not significantly increased from those observed in co-culture with unstimulated or BCMA-negative cells (59.3-60.8%). Furthermore, consistent with the TIM-3 elevation detected in ICBB CAR T cells (Figure 3C and Figure 4A), Figure 4B shows that these cells express high levels of 4-1BB (p<0.001) upon stimulation with the non-specific cell line K562.These results indicate that H8BB exhibits the lowest levels of exhausted receptors and increased upregulation of activation markers, which may promote better specific and long-term in vivo activity. Thus, the H8BB CAR appears to be a safer and more effective configuration in the context of MM targeting.

[0065] Example 6 H8BB-CAR mediates improved in vitro cytotoxicity and in vivo biological activity Next, to evaluate the hypothesis that H8BB CAR is safe and efficient in mediating tumor eradication, we investigated the cytotoxic activity of T cells transduced with different BCMA-CARs. To that end, tumor target cells were labeled with carboxyfluorescein succinimidyl ester (CFSE) and co-cultured with BCMA CAR- or CD34t control T cells for 4 hours. CFSE-positive cells were then analyzed for PI staining as a surrogate for cytotoxic activity. As observed in Figure 5A, all CAR constructs mediated significant cytotoxicity against H929 and RPMI-8226 myeloma cell lines compared to CD34t control T cells (p<0.0001). Moreover, 4-1BB-based CAR T cells demonstrated significantly higher cytotoxicity against RPMI-8226 myeloma cells, even at the lowest ratio of 2.5:1 (ICBB or H8BB vs. CD34t, p<0.001). Similar results were obtained when H8BB CAR T cells were co-cultured with H929 (Figure 5A(iii), H8BB vs. CD34t, p<0.05). In addition, the H8BB CAR, but not ICBB, was more efficient than the H828 CAR in mediating cytotoxicity against RPMI-8226 at increasing E:T ratios (Figure 5A(ii), H8BB vs. H828, both at 5:1 and 10:1 ratios, p<0.05). As expected, the CAR T cells did not show any significant cytotoxicity against the BCMA-negative cell line K562 when compared to the corresponding control T cells (Figure 5A(i)). These results suggest that the H8BB CAR shows an advantage over the H828 and ICBB CARs in mediating myeloma cell elimination in vitro, even at low E:T. Since cytotoxicity is mediated through spatial recognition between the CAR molecule on the effector cell and the cognate antigen on the surface of the target cell, one can speculate that the configuration of the H8BB CAR on the T cell surface is optimal to enable BCMA recognition and induce myeloma killing.

[0066] Finally, the in vivo function of BCMA-CAR was analyzed using a human tumor xenograft model. Immunodeficient NSG mice were injected with 4 × 106 NCI-H929 cells were inoculated into the mice. Five days later, the mice were adoptively transferred intravenously with either BCMA-CAR or control T cells (CD34t transduced T cells) or left untreated ("No Treatment"). Tumor volumes were assessed blindly every 2-3 days. Figure 5B shows that mice injected with H8BB- or H828-CAR T cells (Figure 5B(v) and Figure 5B(iv) respectively) show a significant delay and / or significant regression of tumor volume when compared to the control groups ("no treatment" and / or CD34t groups (Figure 5B(i) and Figure 5B(ii) respectively), or ICBB groups (Figure 5B(iii)) (H8BB vs. control group, p<0.0001, and H828 vs. control group, p<0.001). This observation is also reflected by an improvement in overall survival (Figure 5C, H8BB and H828 groups vs. control group, p<0.0001 by log-rank analysis). Moreover, compared to the tumor volumes of the H828 CAR-treated cohorts, the H8BB A significant reduction was found in the tumor volume of CAR-treated mice (H8BB vs. H828, p<0.05, by Kruskal-Wallis test with Dunn post-hoc analysis). Surprisingly, ICBB CAR T cells did not show significant anti-tumor activity compared to the control group. Thus, we conclude that ICBB CAR was unable to mediate myeloma eradication in vivo, whereas H8BB CAR proved to be statistically more efficient than H828CAR in mediating significant anti-tumor cytotoxicity both in vitro and in vivo. Of the nine mice administered either H8BB- or H828-CAR T cells, H828 It is noteworthy that while 4 mice in the CAR group relapsed and 2 additional mice showed variation in their tumor volume, only 2 mice in the H8BB group experienced a relapse (Figure 5B). Although this data is not directly reflected in the median survival between the H8BB and H828 groups (Figure 5C), it does imply that in the long term, H8BB CAR T cells may persist longer (i.e., less exhaustion, less nonspecific activation, less tonic signaling) than their H828 counterparts, thereby preventing relapse.

[0067] Example 7 Further evaluation of anti-tumor / off-target activity of H8BB CAR T cells in vivo Therefore, considering several advantages of the H8BB CAR over other BCMA CARs presented herein (i.e., adequate optimal cell growth (Figure 1C), antitumor cytokine production with minimal nonspecific secretion (Figures 2A-C), reduced exhaustion profile (Figure 4A), reduced tonic signaling and nonspecific activation (Figure 4B), high antitumor cytotoxic activity both in vitro and in vivo (Figures 5A-C), we focused all our efforts on evaluating the potential therapeutic value of the H8BB CAR targeting BCMA in the treatment of plasma cell malignancies. In this endeavor, we chose to study the antitumor function mediated by H8BB CAR T cells, aiming to determine the optimal effective dose of H8BB CAR T cells for infusion to achieve the desired therapeutic effect. To that end, NSG mice were injected with 4 × 10 6 An additional model was established in which the H8BB CAR T cells were injected with luciferase-expressing NCI-H929 myeloma cells. In the experiment described in Figure 6, it was decided to challenge the H8BB CAR T cells with a higher tumor burden than detailed above in Figures 5B-5C. Only once the tumors were fully established (164 ± 30 mm 3 , approximately 2 weeks after myeloma inoculation), mice were administered increasing doses of H8BB CAR T cells (5, 10 or 15 × 10 6 As illustrated in Figure 6, H8BB CAR T cells exhibit potent anti-myeloma effects. Specifically, 10 or 15x10 6 Groups of mice that received a single injection of 5 × 10 H8BB CAR T cells showed an initial increase in tumor volume followed by rapid and complete tumor regression by 2–3 weeks after injection (Figure 6A(i)–Figure 6A(iv), Figure 6C). 6In the group of mice that received CAR T cells, 4 / 5 mice showed complete tumor regression, except for one that initially showed a higher tumor burden on the day of CAR T injection (Figure 6A, Figure 6C). Survival curves are shown in Figure 6D. These results suggest that the minimal effective dose for therapeutic efficacy against NCI-H929 is between 5 and 10 × 10 6 The results show that the sBCMA expression level ranged from 0.1 to 0.5 cells. For the control group (treated with NT T cells), all mice were sacrificed within one month after tumor inoculation for ethical reasons. In parallel, the concentration of soluble BCMA in the serum from mice treated in this experiment was evaluated as a biomarker of MM and as evidence of tumor eradication [Ghermezi M.Haematologica(2017);102:785-795]. As seen in Figure 6B(i) to Figure 6B(iv), sBCMA levels rapidly declined in conjunction with tumor regression after H8BB CAR T cell infusion. This data also confirms that the high concentration of sBCMA in the blood of NSG xenografts did not appear to block the anti-myeloma activity of H8BB CAR T cells in vivo.

[0068] To investigate the persistence of H8BB CAR T-cell therapy in NSG myeloma xenografts, the presence of CAR T cells both within the tumor and in the blood was assessed. Figure 6E shows that H8BB CAR+T cells were detected in the peripheral blood of myeloma NSG xenografts 3 days after T-cell injection, significantly increased 13-22 days after adoptive transfer, and then declined over the next 3 weeks. In a parallel cohort of NSG MM xenografts, mice were injected with 7.5 × 10 6Mice were treated with H8BB-CAR T cells or control (NT) T cells and sacrificed 9 days after T cell administration (i.e., 20 days after tumor inoculation). Tumors were excised and weighed. Figure 6F shows that the average weight of tumors from H8BB CAR T-treated mice was significantly lower than the NT control group (p=0.03). Immunohistochemistry analysis performed on tumor sections for the human T cell marker CD3 shows that human T cells were abundantly present in H8BB sections (Figure 6G, lower panel). In contrast, staining of tumor sections from the control NT mouse group revealed only sparse stained areas (Figure 6G, upper panel). Similar results are also shown in Figures 8A-C. Taken together, these data demonstrate that after injection into the tail vein of NSG mice, H8BB CAR T actively proliferates and traffics to the tumor site, where it exerts a potent antitumor effect resulting in tumor eradication.

[0069] Example 8 Anti-myeloma efficacy of H8BB CAR T cells against primary cells from multiple myeloma patients As a preclinical evaluation of H8BB CAR T cells in myeloma patients, BCMA expression was assessed by flow cytometry on plasma cells from bone marrow of patients suffering from different plasma cell pathologies (e.g., multiple myeloma-MM, amyloidosis-AL, monoclonal gammopathy of undetermined significance-MGUS, plasmacytoma-PC, and Waldenström's macroglobulinemia-WDS). Consistent with previously reported data [Bal S, Sigler A, Blood. 134(Suppl 1):S5452(2019)], BCMA expression was significantly higher (CD38 ++ CD138 ++Differential median BCMA expression by plasma cells (gated against MM patients) was observed. The mean BCMA mean fluorescence intensity (MFI) in MM patients is significantly higher compared to other plasma cell disorders, but the p-value does not meet significance. Given the efficacy of BCMA CAR T therapy described herein in xenograft models of multiple myeloma cell lines, we sought to investigate whether H8BB-CAR T cells are efficient in targeting primary myeloma cell co-cultures. To this end, bone marrow-derived mononuclear cells (BM-MNCs) from MM patients were co-cultured with either H8BB CAR T cells or NT (control) in an allogeneic system (Figures 7B-7D). Figure 7B shows that H8BB T cells, when co-cultured with MM patients' BM-MCs, significantly upregulate their 4-1BB expression compared to NT cells (p=0.027). Figure 1C shows that the BM-MCs of MM patients (CD38 + CD138 + Figure 7D shows the level of BCMA expression on BM-MNCs (gated on CD38++CD138++, Figure 7D, lower panel). Overnight co-incubation of BM-MNCs isolated from MM patients with H8BB CAR T cells resulted in near-complete elimination of plasma cells (gated on CD38++CD138++, Figure 7D, lower panel). In contrast, plasma cells were not affected by the presence of control NT cells (Figure 7D, upper panel), demonstrating the specificity of BCMA-CAR targeting. In addition, we examined the expression of CD137 (4-1BB) as a marker of T cell activation. Taken together, these data support the potential efficacy of H8BB CAR T-based therapy for the treatment of multiple myeloma.

[0070] Example 9 Clinical study in MM patients - Evaluation of the clinical applicability of the CAR T of the present invention A clinical study (NCT04720313) began enrolling R / R malignant plasma cell patients in February 2021 who will be treated with autologous H8BB-CAR T cells in a dose-escalation study to first evaluate the safety and then efficacy of this approach.

[0071] Therefore, to evaluate the therapeutic applicability of the CAR T (H8BB, the CAR molecule of the present disclosure is also referred to as HBI0101 in all clinical studies herein) molecule, a non-randomized, open-label, single-center Phase 1 clinical study is conducted at the Department of Bone Marrow Transplantation and Cancer Immunotherapy, Hadassah Medical Center (HMO). The structure of the HBI0101 / H8BB CAR molecule is disclosed in FIG. 9. The complete study protocol and design are detailed in FIG. 10 and FIG. 11.

[0072] Subjects selected according to specific exclusion and inclusion criteria in the experimental procedure undergo lymphopheresis on day -10 prior to infusion to provide starting material for preparation of CAR T cells. The collected cells are delivered to a GMP facility for further stimulation, transduction, and expansion (Figure 12A-B). Lymphodepletion of patients prior to HBI0101 infusion is achieved by administration of fludarabine 25 mg / m2 and cyclophosphamide 250 mg / m2 on days -5 to -3 (Figure 10). Patients with creatinine clearance <30 ml / min receive bendamustine at a dose of 90 mg / m2 on days -4 and -3. Fresh HBI0101 cells are administered in increasing doses of 150- (cohort 1), 450- (cohort 2), and 800 x 10^6 (cohort 3) CAR+ cells. Following the infusion, patients will remain hospitalized for at least 10 days as per protocol requirements. Patients will be followed for adverse events (AEs) daily during their hospital stay, as well as for safety and efficacy on a set schedule detailed in Figure 10.

[0073] Clinical Surveillance of Multiple Myeloma Response to HBI0101 will be evaluated at a predefined time schedule according to IMWG criteria [Kumar S, et al. Lancet Oncol. 17(8):e328-e346(2016)]. Bone marrow biopsy and computed tomography / positron emission tomography (PET / CT) will be utilized to evaluate response in patients with nonsecretory disease [Kumar S, et al. Lancet Oncol. 17(8):e328-e346(2016)]. Minimal residual disease will be evaluated by flow cytometry according to Euroflow standards [Theunissen P, et al. Blood. 129(3):347-357.2017]. Patients will be classified as "non-responders" and "responders" as follows: "non-responders"; stable disease (SD) / progressing disease (PD), and "responders" ≥ VGPR. Analysis of data for patients grouped by PD / SD, VGPR, and CR is also provided.

[0074] Primary and secondary endpoints The primary endpoints of the study were safety and determination of the maximum tolerated dose (MTD) of HBI0101. Hematologic and non-hematologic adverse events will be graded according to the National Cancer Institute Common Terminology Criteria for Adverse Events (NCI CTCAE), version 5.00. Cytokine Release Syndrome (CRS) and Immune effector Cell Associated Neurotoxicity Syndrome (ICANS) adverse events will be graded according to the 2019 American Society for Transplantation and Cellular Therapy (ASTCT) criteria [Lee DW, et al., Biol Blood Marrow Transplant. 2019;25(4):625-638]. Secondary endpoints included overall response rate (ORR), as well as progression-free survival (PFS) and overall survival (OS).

[0075] A positive correlation was established between the level of BCMA expression on the surface of BM plasma cells in MM patients and responsiveness to HBI0101 treatment (Figure 19A and Figure 19B). In addition, the pharmacokinetics of HBI0101 cells is assessed at serial time points in peripheral blood (Figure 19C). The levels of BCMA+ plasma cells in the bone marrow and circulating soluble BCMA in peripheral blood are also assessed before and after treatment.

[0076] Furthermore, cytokine / chemokine secretion is assessed in the blood of subjects before and after infusion of the CART of the present invention.

[0077] Example 10 Patient and disease characteristics Between January 24, 2021 and December 23, 2021, 22 patients were screened, enrolled, and leukapheresis was performed. For three patients, apheresis material was cryopreserved, and two patients discontinued (one patient achieved CR and one patient died) prior to CART cell manufacturing (Figure 13). HBI0101 drug product (DP) was successfully produced (no production failures occurred) from fresh (n=19) and cryopreserved (n=1) material and infused back into the patient. Three patients received bridging therapy during the manufacturing period. Two patients were treated with local radiation therapy for pain control, and one patient received high-dose dexamethasone and plasma apheresis due to hyperviscosity. The majority of patients (n=18) underwent lymphodepletion with fludarabine-cyclophosphamide and two patients received bendamustine due to renal dysfunction (Figure 13). All patients were infused with fresh DP 10 days after production. The median duration of hospitalization after CART infusion was 17 days (range 11-166 days), with the majority of patients being discharged after a maximum of 25 days, except for P2, who had prolonged neutropenia and thrombocytopenia and therefore remained hospitalized for 166 days.

[0078] Patient characteristics are detailed in Table 2. Median age was 62 years (range, 44-75 years), median time from first disease diagnosis was 55 months (range, 8-241 months), and median number of previous lines of therapy was 6 (range, 3-13). The majority of patients had previously undergone autologous bone marrow (BM) transplantation (85%), and all were refractory to proteasome inhibitors (PIs), immunomodulatory agents (IMiDs), anti-CD38 antibodies (daratumumab), and their last line of therapy. Seven of 20 patients (35%) were penta-refractory. Nine patients (45%) had previously been exposed to and were refractory to an anti-BCMA conjugate antibody (belantamab mafodotin) (Table 2). A detailed description of previous lines of therapy and refractory status is presented in Table 1. Cohort 1 patients had higher rates of extramedullary and penta-refractory disease, high LDH and extensive BM disease (defined by >50% plasma cells in BM biopsy), whereas cohort 3 patients had worse ECOG performance scores and a lower incidence of high-risk cytogenetic disease (Table 2).

[0079] [Table 2]

[0080] Abbreviations: ECOG-Eastern Cooperative Oncology Group, R-ISS-Revised International Staging System; * High-risk cytogenetic abnormalities included del(17p), t(4;14), and t(14;16).

[0081] Example 11 HBI0101 CART cell manufacturing HBI0101 CART cells were produced locally at Hadassah Medical Center's good manufacturing procedure (GMP) certified facility for advanced cell therapy and were successfully manufactured for all patients. Median lymphocyte count at time of apheresis collection was 1.0 × 10 6 / mL (range, 0.5-2.1) and did not affect the success of CART cell manufacturing. All final DPs were released in compliance with the criteria specified in Table 3. No significant differences were observed in the production data or in vitro functionality of CART cells in the "responder" and "non-responder" groups (Table 3), demonstrating the robustness of the production process despite the high variability in the starting material from MM patients.

[0082] [Table 3]

[0083] The production process continues for 10 days for all patients. HBI0101 drug product (DP) on the day of infusion (day 0) was characterized as follows: DP identity. The percentage of CD3+, CD4+, and CD8+ cells (gated on live CAR+ cells) was determined by flow cytometry. DP potency. The percentage of BCMA.CAR+ cells (gated on live cells) was determined by flow cytometry using human recombinant BCMA protein. The percentage of activated cytotoxic T cells (CD3+CD56+) was determined by flow cytometry (gated on either CD4+ or CD8+ T cells). Secretion of IFN-γ by each HBI0101-transduced cell was assessed by ELISA on day -2. IFN-γ was released into the co-culture supernatant of HBI0101-transduced cells and NCI-H929 (at a 1:1 E:T ratio) after overnight incubation. The total amount of IFN-γ in each culture well was quantified and then divided by the number of transduced cells introduced into the well. The copy number (CPN) of HBI0101 insert into all CAR transduced cells was quantified by qRT-PCR as described in Materials and Methods and further adjusted for transduced cells. Release criteria specifications are listed in the right column of the table. No statistical significance was observed in any of the released parameters, proving the robustness of the production process. DP impurities. The percentage of "cell impurities" was determined by flow cytometry for CD19+, CD14+, and CD3-CD56+ (gated on live cells) and did not exceed 1% each in all 20 batches. * ND, not determined. ** fg, femtogram.

[0084] Example 12 Clinical Research - Safety Evaluation hematological toxicity All patients developed grade 3-4 neutropenia, two-thirds of whom had grade 3 febrile neutropenia (FN) (Table 4). The entire cohort developed grade 3-4 lymphopenia, and approximately 60% had grade 3-4 thrombocytopenia and anemia. There was a higher incidence of thrombocytopenia and FN in cohort 3 compared with cohorts 1 and 2. The median duration of grade 3-4 neutropenia and grade 3-4 thrombocytopenia was 15 days (range, 1-65) and 24 days (range, 8-138), respectively (excluding three patients whose counts did not recover and who progressed and died). Less than one-third of patients had grade 3-4 cytopenias that persisted beyond 28 days after CART cell infusion (Table 4).

[0085] [Table 4]

[0086] CRS and ICANS Ninety percent of patients developed any grade of cytokine release syndrome (CRS) with a median of 0 (range, 0-21) and median duration of 2 days (range, 1-5) mostly on the day of CART infusion, and none developed grade 3 or higher CRS (Table 5). However, a higher proportion of CRS grade 2 was observed in cohorts 3 and 2 compared with cohort 1 (3 / 7, 4 / 7, and 1 / 6, respectively) (Table 5). Tocilizumab was used in 40 percent of patients, with a median dose of 1 (range, 1-4). There were no immune effector cell-associated neurotoxicity syndrome (ICAN) events, and none required glucocorticoids.

[0087] [Table 5]

[0088] Non-hematological toxicity Non-hematological toxicities (Table 4) were reported in 80% (n=16) of patients. Bacteremia was recorded in 15% of patients. Grade 3-4 reported toxicities were sepsis (n=3), elevated liver enzymes (n=2), atrial fibrillation (n=1), infectious gastroenteritis (n=1), infusion overload, and pulmonary edema secondary to the heart to sepsis (n=2), all of which resolved. One patient developed a grade 3 pulmonary embolism (PE) that was in remission after 10 months of CART therapy. The PE was due to the patient's restraint after infection with Pseudomonas aeruginosa pneumonia, which was successfully treated with anticoagulation. Five patients were readmitted during the subsequent follow-up period due to COVID19 infection for observation 9 months after cell infusion (n=1); pulmonary embolism, pneumonia, and atrial fibrillation 8 months after cell infusion that were treated with anticoagulation, antibiotics, and cardioversion (n=1); infectious gastroenteritis due to fecal Salmonella and adenovirus that were treated with antibodies and infusions 27 days after cell infusion (n=1); fever that was treated with broad-spectrum antibodies and two doses of tocilizumab 21 days after cell infusion (n=1); and nausea, vomiting, and dyspnea that resolved with infusions and antiemetics 19 days after cell infusion (n=1) (Table 4). No other severe adverse effects (SAEs) were observed in any of the cohorts. One patient died within 30 days of infusion due to disease progression. There were no treatment-related deaths.

[0089] Example 13 Short-term efficacy At a median follow-up of 136 days (80, 182, and 160 days for cohorts 1, 2, and 3, respectively), the ORR was 75% across cohorts, with 50% (3 / 6), 85% (6 / 7), and 85% (6 / 7) of patients responding in cohorts 1, 2, and 3, respectively (Figure 14A). Ten patients achieved a (definite) complete response (sCR / CR), six patients achieved minimal residual disease (MRD) negativity (four in cohort 3), five patients achieved a very good partial response (VGPR) (four in cohort 2), and two patients achieved MRD negativity (Figures 14A-B). Best response for all patients was achieved 1 month after CART infusion, except for patients P7 and P11, who achieved VGPR at first follow-up and further deepened their response to sCR / CR and VGPR MRD (several months later), respectively (Figure 14B). Median PFS for the entire cohort was 160 days (range, 14-326+), with 80 days (range, 23-248), 182 days (range, 33-326+), and not reached (range, 14-223+) for cohorts 1, 2, and 3, respectively (Figures 15A-B). Median OS was 308 days (range, 25-466+), with estimated OS being 55% at the time of median data cutoff of June 27, with follow-up for all three cohorts being 160 days (range, 14-326). Median OS was 237 days (range, 25-466+), 282 days (range, 63-347+), and not reached in cohorts 1, 2, and 3, respectively (Figure 15D). All deaths except one (9 / 20, 45%) were due to disease progression. Death of P7 was related to COVID19 infection. FLC levels before and after CART cell infusion in responders vs. non-responders are shown in Figure 16A-C (F3A-C#2). In addition, soluble BCMA (sBCMA) levels, as a biomarker of responsiveness to anti-myeloma therapy9,10,17-19, rapidly declined in serum of responding patients, whereas the levels were largely unaffected in non-responding patients (Figure 16D). In addition, pre-lymphodepletion of median LDH levels tended to be higher in non-responding patients compared to responding patients (p=0.068).The relative increase in peak CRP, fibrinogen, and ferritin levels during the first 14 days after CART infusion was not found to correlate with response (Figures 17A-D). No significant differences in CRS between the "responder" and "non-responder" groups were observed (data not shown).

[0090] Example 14 BM plasma cell (PC) assessment and phenotypic characterization. To assess the patient response to HBI0101 treatment at the cellular level, BM aspirates were analyzed by flow cytometry before (n=12) and one month after (n=11) CART administration (Figure 18A). Of these patients, three patients were non-responsive to HBI0101 therapy and showed only a slight decrease or even an increase in the percentage of BM-PCs (Figure 18B). In contrast, the nine patients who responded showed a significant decrease in the percentage of BM-PCs (Figure 18B). In addition, we found that the baseline BCMA expression percentage and mean fluorescence intensity (MFI) on the surface of PCs were significantly higher in the "responder" group of patients compared to the "non-responder" group of patients (Figures 18C-D and 19A-B). Interestingly, CD56 molecules were found to be significantly expressed on PCs of HBI0101-responsive patients (Figure 18E).

[0091] Example 15 CART cell dynamics The pharmacokinetics of HBI0101 cells was evaluated at consecutive time points in peripheral blood of MM patients after CART administration. The median time to HBI0101 peak concentration (Cmax) was 10 days (range, 6-13 days) in the "responder" group (sCR / CR (range, 6-13 days) and VGPR (range, 10-13 days)) and 13 days (range, 10-13 days) in the "non-responder" group (Figures 20D and 19F), with a rapid decline in HBI0101 cell proliferation within one month after CART infusion. The area under the curve (AUC) as a measure of overall CART cell expansion within the first month after CART infusion was marginally significant (p=0.0597) between the two groups (Figure 20B). This difference was more pronounced when patients were divided into SD / PD, VGPR, and sCR / CR subgroups (Figures 19C-D). Consistent with this observation, Cmax values, as a measure of maximum CART cell expansion, were found to be significantly different between the two groups (60,655 HBI0101 cells / mL of blood (range, 4,945-493,152) in the "responder" group vs. 3,740 HBI0101 cells / mL of blood (range, 1,117-21,857) in the "non-responder" group (Figure 20C). Figure 19E further shows that increased Cmax values ​​correlate with the depth of response to HBI0101. It is noteworthy that although significant differences in the levels of sBCMA were observed between cohort 1 and cohorts 2 and 3 (p<0.0004), no significant differences regarding HBI0101 cell kinetics in peripheral blood were found between these cohorts (Figure 21). In the "responder" group, the decrease observed in sBCMA levels was consistent with the increase in HBI0101 cells / mL of blood (range, 1,117-21,857) in the "non-responder" group, in contrast to the "non-responder" group. Concurrent with CART expansion (Figures 20E-F), sBCMA reduction was associated with HBI0101 CART cell anti-myeloma activity, suggesting that this results in PC eradication and subsequent sBCMA clearance.

[0092] Example 16 Cytokine profiling analysis for predicting response to HBI0101 therapy Next, to better understand and potentially predict patient responsiveness to HBI0101 therapy, we determined a cytokine "signature" that could be associated with the anti-myeloma function of HBI0101 CART cells in vivo. To this end, serum was collected from MM patients at baseline (day -10) and Tmax (day of Cmax for each patient) and analyzed for cytokine secretion by multiplex array. The multiplex panel included 25 pro- and anti-inflammatory chemokines / cytokines. Among the 25 biomarkers analyzed, cytokines that were differentially expressed in different groups (at baseline and Tmax) are described in a heatmap diagram (Figure 22A). Of these, six cytokines, IL-1ra, IL-10, CCL4, IL-15, G-CSF, and IL-6, were significantly differentially expressed between different groups (Figure 22B(i) to Figure 22B(vi), respectively). More specifically, at Tmax, IL-10, CCL4, and IL-15 were found at higher levels in the "non-responder" group, whereas G-CSF and IL-6 were found at higher levels in the "responder" group (Figure 22A and Table 6). IL-1ra was significantly upregulated at Tmax in the "non-responder" group, but not in the "responder" group. As illustrated in Figure 22A, another cytokine with a significant increase at Tmax in the "responder" vs. "non-responder" patient groups was IFN-γ. No statistical differences were observed in the levels of TNF-α or IL-2 in either group (Figure 22C(i)-Figure 22C(iii)).

[0093] [Table 6]

[0094] Example 17 Effect of prior anti-BCMA antibody exposure on HBI0101 therapy In this study, 9 of 20 patients (2 of 6 from cohort 1, 5 of 7 from cohort 2, and 2 of 7 from cohort 3) received belantamab mafodotin prior to HBI0101 therapy. Patients exposed to belantamab ("belantamab(+)") tended to have shorter PFS and higher progression rates (7 / 9, 78%) compared to unexposed ("belantamab(-)") patients (6 / 11, 55%) (Figure 23A). Furthermore, OS was lower in "belantamab(+)" patients (3 / 9, 33%) than in "belantamab(-)" patients (8 / 11, 73%) (Figure 23B). ORR was higher in the "belantamab(-)" group compared to the "belantamab(+)" group (91% vs. 55%, respectively) (Figure 23C). Of note, when we looked at the "depth of response," we found that "belantamab(-)" patients achieved a significantly deeper response than "belantamab(+)" patients (sCR / CR, p=0.002; VGPR, p=0.02; by unpaired t-test). However, there was no significant difference in the level of BCMA expression on PCs (determined by MFI) and the percentage of BCMA-positive PCs between the two groups. Figures 23D and 23E show the expression of BCMA in patients.

[0095] These results represent the complete CART production cycle: development of a new CART therapeutic, in vitro and in vivo proof of concept, regulatory approval, local production in a GMP facility, and delivery to patients (Figures 24A-B). The main advantages of such an approach over commercially available products are the availability of DP and the shortened "vein-to-venous" delivery. Moreover, the significance of these results extends far beyond the clinical dimension alone. Affordable, locally produced CART represents an important step in widening access to this cutting-edge advanced cell therapy.

[0096] Example 18 BCMA expression in AL PC vs. MM PC Primary light chain amyloidosis (AL) is a rare monoclonal plasma cell (PC) disorder characterized by the systemic deposition of misfolded immunoglobulin light chain (LC) protein products as insoluble fibrils in multiple organs. Because AL is a disease caused by malignant PC, most available treatments are adopted from multiple myeloma-directed therapies. However, due to the wide clinical spectrum of organ failure in AL, the same regimens can be extremely toxic for these patients (1-4), and clinical trials directed at multiple myeloma usually exclude patients with AL.

[0097] Herein, the present disclosure describes the ex vivo applicability of the anti-BCMA CAR construct of the present disclosure to primary AL cells, as well as the safety and efficacy in four patients with relapsed / refractory (RR) primary AL treated in a Phase I clinical trial (NCT04720313) described above in Example 9.

[0098] As a preclinical evaluation of HBI0101-based CART for the treatment of MM and amyloidosis, the percentage of BCMA+ cells in the BM of MM and AL patients was evaluated, and the expression levels of BCMA on AL- and MM-PCs were measured by flow cytometry (Figure 25A(i)). Although BM samples of AL and MM patients showed similar percentages of BCMA+ cells, Figure 25A(ii) shows that the mean fluorescence intensity (MFI) of BCMA on AL-PCs was significantly lower (mean MFI in AL patients=1.9, n=18 vs. MFI in MM patients=3.8, n=39, p<0.05). However, based on the preclinical data disclosed above for the MM clinical study, we showed that MM-PCs with a mean MFI of BCMA expression of approximately 2.1 were eradicated after incubation with BCMA. Therefore, in line with the recent publication on CART cells and BCMA targeting in patients with AL amyloidosis [Oliver-Caldes A,9(12)(2021)], it was expected that this level would be sufficient for PC recognition by BCMA-CART cells and may represent a potential target for the treatment of AL.

[0099] Example 19 Evaluating the efficacy of HBI0101 on primary AL-PCs ex vivo The efficacy of HBI0101 CART on MM-PCs ex vivo was demonstrated in Examples 9-17 herein above. Encouraged by the results in MM patients, we next tested whether HBI0101-based CART was similarly effective in eradicating AL primary PCs. After overnight co-culture with HBI0101, a near-complete eradication of AL-PCs by HBI0101 was observed (Figure 25B), an effect that was already evident after 1 hour of co-culture (Figure 26). In contrast, AL-PCs were not affected by the presence of non-transduced (NT) control cells, suggesting that HBI0101 cells were able to recognize AL-PCs and exert specific BCMA-directed anti-tumor functions. In this regard, non-tumor BM-MNCs were not affected by the presence of HBI0101, as shown by 7AAD staining (Figure 26). In addition, after incubation with AL BM-MNCs, HBI0101 cells underwent significant activation as evidenced by upregulation of 4-1BB markers and increased secretion levels of the pro-inflammatory cytokines IFN-γ and TNF-α compared to NT cells (Figure 25C(i), (ii), (iii) respectively) (p<0.05). Thus, we conclude that HBI0101-mediated anti-BCMA function is restricted to CD38++CD138++ cells while sparing other BM cell populations.

[0100] To further substantiate the observation that PC elimination by HBI0101 cells is apoptosis-mediated, intracellular levels of cleaved caspase-3 were analyzed. Figure 25D confirms that there is a significant increase in apoptosis of AL- or MM-malignant enriched CD138+ BM-PCs after incubation with HBI0101 cells but not NT cells (Figure 27). Furthermore, Figure 28 further suggests that HBI0101 cell activation and pro-inflammatory cytokine secretion upon stimulation with AL- or MM-CD138+ cells is specifically mediated via BCMA-CAR, since NT cells showed significantly lower levels of 4-1BB (Figure 28A) and barely detectable levels of IFN-γ and TNF-α (Figures 28A-C), regardless of whether NT cells were incubated with the CD138+ cell fraction (Figure 28) or the CD138- cell fraction. Data demonstrating the specificity of HBI0101 for BCMA-expressing myeloma cells are provided herein above in Examples 9-17, as well as in Figures 29A-B. Collectively, these data support the proof-of-concept for the potential efficacy of HBI0101 CAR T-based therapy for the treatment of AL.

[0101] Example 20 HBI0101 CART cell production and treatment of AL patients. Considering the ex vivo results, and toward clinical evaluation of HBI0101 in AL patients, we generated autologous BCMA-CART cells (obtained by leukapheresis procedure) for patients 1-4. After 10 days of production, all four patients were infused with fresh BCMA-CART cells. Although CART production was initiated from diverse apheresis sources, the final drug products (DPs) met the release criteria, indicating that the process is robust (Table 7). All four clinical batches shared similar expansion patterns in culture (from day -7 to day 0) and DP characteristics, as illustrated by Figure 30. Figures 30C(i)-30C(ii), 30D(i)-30D(ii) show the exhaustion and differentiation state of DPs on the day of release (day 0), respectively.

[0102] [Table 7]

[0103] Example 21 Treatment of Patients with AL with HBI0101 This study aimed to evaluate the safety and efficacy of HBI0101 in patients with multiple myeloma and additional plasma cell dyscrasias, including amyloidosis (AL). Enrolled patients had to be refractory to at least three lines of therapy, including proteasome inhibitors, immunomodulatory agents (IMiDs), and anti-CD38 antibodies, and had to have not received other available registered therapies.

[0104] The Phase I clinical trial consisted of three escalating cell doses as described in Example 9. Three patients were treated within this clinical trial (NCT04720313) in a different safety cohort and the fourth was treated on a compassionate basis. Patient baseline characteristics, medical history, and prior treatments are summarized in Table 8. All patients were refractory to their last line of therapy, three were penta-refractory, and two were anti-BCMA belantamab mefadotin-refractory. All patients had progressive disease at the time of enrollment. None received bridging therapy. The complete study protocol is further outlined in Figure 10.

[0105] Before enrolling patients in the HBI0101 study, candidates are screened for eligibility. Ten days prior to infusion, lymphocytes are collected using a Sprectra Optia apheresis device. Immediately following, patients are admitted to hospital for baseline evaluation and to begin HBI0101 production. Patients are then T-cell depleted using 25 mg / m2 fludarabine and 250 mg / m2 cyclophosphamide on days -5 to -2, and infused with HBI0101 produced on day 0, two days after "washout" from lymphodepletion. A 2-week hospital stay after HBI0101 infusion is mandatory for safety follow-up. Continued follow-up was routinely performed until progression or death.

[0106] [Table 8]

[0107] Patient 1: A 61-year-old male with concomitant MM and AL with cardiac, renal, and autonomic nervous system involvement, previously treated with eight lines of therapy. At the time of CART, clinical NYHA3 was evident, MAYO stage 3A disease, and proBNP was 7500 pg / ml. In April 2021, the patient was enrolled in the first safety cohort of the study and will receive a 150 × 10 6 HBI0101 cells were infused. The patient did not experience CRS (Table 9) or worsening of heart failure and remained stable until discharge. No further adverse events (AEs) or organ decompensation were noted following HBI0101 therapy. The patient remained hypogammaglobulinemic and 8.5 months later presented with grade 3 Pseudomonas aeruginosa pneumonia requiring hospitalization that subsequently resolved with antibiotic treatment.

[0108] Patient 2: A 59-year-old woman with cardiac, renal, and hepatic involvement, diagnosed with AL in 2017. In July 2021, after six previous lines of treatment, the patient was enrolled in the second safety cohort and received 450 × 10 6CART cells were infused. At the time of CART infusion, the patient suffered from NYHA grade 4 heart failure and worsening liver function tests, elevated alkaline phosphatase levels, had severe anasarca before infusion and was stabilized with supportive care. After infusion, the patient experienced grade 2 CRS for 2 days (Table 9), which required a single dose of tocilizumab. Worsening heart failure was evident pre-hospital and throughout the hospital stay, requiring high doses of diuretics, and the patient remained stable until discharge. After discharge, on day 45, the patient developed hepatic decompensation and ascites. There was no evidence of hepatic portal vein or portal vein obstruction. Decompensation gradually resolved, with hepatic organ response noted, alkaline phosphatase reduced, and ascites eventually resolved. Concurrently, the patient developed a fever that proved to be secondary to osteomyelitis of the spine, which eventually resolved and required prolonged antibiotic treatment.

[0109] Patient 3: An 82-year-old male with AL FLC K amyloidosis diagnosed in 2006, renal (3 gr albuminuria) and gastrointestinal involvement, but no cardiac involvement. After six lines of treatment, in November 2021, the patient was enrolled in the third safety cohort and received 800 × 10 6 The patient was infused with 1000 HBI0101 cells. The patient experienced grade 3 CRS requiring 3 doses of tocilizumab (Table 9). There was no renal failure and the patient remained stable until discharge, although a grade 3 infection was noted.

[0110] Patient 4: The last patient was treated on a compassionate basis due to myelodysplastic syndrome and low blood counts. A 61-year-old male diagnosed with FLC L cardiac, autonomic nervous system, soft tissue, and renal AL in 2017. The last evaluation before CART infusion showed clinical NYHA stage 3, MAYO stage 3A disease with a proBNP of 2773 pg / ml. After informed consent (the patient is fully aware of the CART treatment risks for both diseases) and ethical committee approval in December 2021, the patient was administered 450 × 10 6HBI0101 cells were infused. The patient experienced a brief grade 3 CRS (Table 9), which required a single dose of tocilizumab. At the time of CRS, there was a worsening of heart failure, which responded to tocilizumab and supportive care. There was no renal failure, and 24 hours later, patient 4 remained stable until discharge. Before treatment, the patient's blood counts presented with grade 1 neutropenia, grade 2 anemia, and grade 4 thrombocytopenia. These worsened to grade 4 neutropenia, grade 3 anemia, and grade 4 thrombocytopenia after HBI0101 infusion. Neutropenia and anemia resolved to grade 2, but grade 4 thrombocytopenia is still ongoing. Repeated bone marrow biopsy 30 days after treatment showed severe hypocellularity, implying higher CART toxicity than worsening MDS.

[0111] None of the patients developed immune effector cell neurotoxicity (ICAN) or any new treatment-related AEs, except for one early infection (osteomyelitis) at 2 months and one late pneumonia at 8 months after CART therapy. All AEs were short and controllable. All patients presented with panhypogammaglobulinemia and received IVIG supplementation. It should be emphasized that for patients 2 (pre- and post-infusion) and 4, early cardiac deterioration was noted during and after CART, which was clinically controllable. Currently, with a median follow-up of 5.2 months (range 2.5-9.5), all patients are alive. Detailed AEs and CART-related toxicities are summarized in Table 9.

[0112] Patient outcomes As illustrated in Table 10 and Figure 31A, all four patients achieved hematological CR with dFLC between 0 and 8 mg / L. Furthermore, non-tumor derived FLC values ​​were also reduced to below the normal range compared to the corresponding values ​​before CART treatment (Figure 31B). The reduction in both tumor and non-tumor derived FLC 30 days after HBI0101 infusion reflects the robust effect of HBI0101 on both malignant and normal PC. In patients 1, 3, and 4, approximately 30 days after HBI0101 treatment, 10 -5A negative BM MRD assessment was achieved. Patient 2 was unavailable for MRD testing at that time, but MRD assessed 180 days after CART infusion showed negative MRD. The time to best response ranged from 17 to 57 days. None of the patients have yet progressed, and the duration of response continues for all patients, despite the various HBI0101 infusion doses, respectively. Although the follow-up of the patients is short, organ responses were already evident in all four patients. All cardiac patients showed a significant reduction in proBNP levels and clinical improvement of NYHA status (Table 10). Patient 2 initially experienced hepatic decompensation and cardiac dysfunction lasting for 3 months, but recovered over time and showed both hepatic and cardiac organ responses at 6 months, as evidenced by NYHA clinical stage improvement and resolution of ascites. Indeed, the NYHA clinical stage of all cardiac patients improved, and patient 3 with renal involvement showed improvement in peripheral edema in parallel with reduction in albuminuria. Although quality of life (QoL) questionnaires were not administered in this study, it is clear that clinical improvement of symptoms was evident and correlated with subjective QoL improvement. All four patients developed panhypogammaglobulinemia after CART infusion (Figure 31C) and received IVIG supplementation. Figure 31D shows the expression levels of BCMA on BM PCs of AL patients before HBI0101 infusion, and Figures 31E-F show the percent reduction in BM PCs 30 days after HBI0101 infusion. In addition, the PET-CT scan of patient 1 with concomitant MM 30 days after HBI0101 infusion shows a marked reduction in size and intensity at most tumor sites compared to lesions detected by PET-CT before CART infusion (Figure 31G). Detailed efficacy results are summarized in Table 10.

[0113] [Table 9]

[0114] [Table 10]

[0115] Example 22 HBI0101 CART in vivo kinetics In vivo expansion of HBI0101 cells was observed in all four infused patients (Figure 32A). The median time of detectable CAR by qPCR in peripheral blood was 24 ± 10 days after CART infusion, and T cells were still detectable in all four patients at 27 ± 10 days. Peak CART cell growth rate in peripheral blood was observed between days 6 and 10 after CART infusion (Figure 32B). Despite receiving low and intermediate doses of CART cells (150- and 450 × 106), patients 1 and 4 showed maximum CART cell expansion in vivo (Figure 32A). In contrast, patients 2 and 3, who received intermediate and high doses of CART cells (450- and 800 × 106, respectively), showed lower in vivo expansion (Figure 32A). Consistent with this observation, higher numbers of CART cells were detected in the bone marrow of patients 1 and 4 one month after CART cell infusion, whereas almost no CART cells were detected in patients 2 and 3 (Figure 32C). In addition, by analyzing the dynamics of dFLC levels in the serum of all four AL patients before and after CART cell infusion, a significant decline was observed during the first month of treatment. This decrease in dFLC levels was concurrent with CART expansion in peripheral blood (Figure 32D). A similar trend was observed by measuring the levels of serum BCMA [sBCMA], an additional biomarker for MM and AL monitoring [Ali SA, et al. Blood. 128: 1688-700. (2016), Munshi NC, et al. N Engl J Med; 384: 705-16., Raje N, et al. NEngl J Med 2019; 380: 1726-37. (2019)] (Figure 33). Overall, these data indicate that reduced dFLC and sBCMA serum levels correlate with successful HBI0101 in vivo expansion.

[0116] Example 23 Follow-up of clinical trial NCT04720313 150~800×10 6Additional follow-up of a Phase Ia / b study (NCT04720313) was conducted by the inventors to investigate the safety and efficacy effects in 47 patients (42 MM and 5 AL patients) at escalating doses ranging from 100x10^6 CAR+ cells. The median follow-up (mFU) was 146 days (range, 18-314 days), and the median progression-free survival (mPFS) and median overall survival (mOS) were still not reached at the higher dose of 800x10^6 CAR+ cells. The overall response rate of all cohorts was 83%, with a median response rate of 800x10^6 CAR+ cells. 6 There was a 90% response rate in this cohort (Figure 34A). Both the OS% (Figure 34B) and PFS% (Figure 34C) were 800x10 compared to other previously reported prior art cohorts. 6 The results were significantly better in this cohort.

[0117] No immune effector cell-associated neurotoxicity syndrome (ICANS) events were recorded. CRS of any grade occurred in 90% (38 / 42) of MM patients and was clinically controllable in 80% (4 / 5) of AL patients. The majority of CRS events began on the day of infusion. The median duration of CRS was 2 days (range 1-7 days) in MM patients and 4 days (range 1-5 days) in AL patients. A median of 1 dose of tocilizumab (range 1-4 doses) was required in grade 2 or higher CRS events. Two of 42 MM patients and 1 of 5 AL patients required steroids, and 1 of 42 MM patients and 3 of 5 AL patients required vasopressors. Grade 3-4 thrombocytopenia occurred in 23 of 42 MM patients, anemia occurred in 25 of 42, neutropenia and lymphopenia occurred in 42 of 42, and febrile neutropenia occurred in 27 of 42 MM patients. Hypoglobulinemia lasting >28 days occurred in 30 of 42 MM patients and 3 of 5 AL patients.

[0118] In summary, 800 x 10 6The dose showed significantly improved outcomes, specifically increased efficacy, but did not affect toxicity. It is noteworthy that due to its clinically demonstrated safety profile, higher doses of HBI0101 were tolerable, thereby accounting for the substantially improved efficacy of HBI0101. Given the data presented herein, it is clear that H8BB CAR T cell-based therapy offers significant value in the treatment of MM and additional plasma cell-related pathologies. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0119] CAR T cell strategies include CD19 + It has revolutionized the treatment of lymphoma. Application of such an approach to other hematological malignancies, such as multiple myeloma, requires the identification and design of suitable chimeric receptors that target specific antigens. Herein, the inventors designed four different BCMA-specific CARs based on the same antibody chains forming the targeting moiety and evaluated their therapeutic function. Two of the evaluated CARs incorporated a CD28 moiety (IC28 and H828), while the other two (ICBB and H8BB) were 4-1BB-based. Initial studies showed that the IC28 CAR was the least functional (Figure 1B), so the inventors rushed to focus on other constructs.

[0120] Compared to the CAR constructs evaluated herein, the H8BB CAR demonstrated the highest biological activity in most cases by means of upregulation of cytokine secretion, cytotoxicity, and activation. Surprisingly, both the H8BB and H828 constructs of the present disclosure mediated almost complete regression of human tumors in xenograft experiments, while the ICBB construct did not show significant biological activity. Several reasons can explain this - indeed, both the H8BB and H828 constructs contain hinge and transmembrane regions derived from CD8, but the ICBB construct uses a shorter hinge (21aa vs. 46aa) and TM from the CD28 molecule. Not much is known about the role of the TM region in CAR function, but several studies have shown that the nature and length of the hinge needs to be customized to the antigen being targeted [Guedan S, et al., Mol. Ther. Methods. Clin. Dev. (2018); 12: 145-156, Lindner SE, et al. Sci. Adv. (2020]. The lack of in vivo function of ICBB-CARs can also be linked to tonic signaling and non-specific activity observed in some assays (e.g., as can be seen in the cytokine secretion assay or activation marker upregulation by antigen-negative targets in Figures 2A and 3D, respectively), which may ultimately result in reduced function [Long AH, et al., Nat. Med. (2015); 21: 581-590].

[0121] Comparing the H8BB of the present disclosure with the H828 construct of the prior art, the present disclosure clearly shows that the former generally demonstrated superior activity at lower PD1 levels. Both functioned effectively in vivo, with the H8BB-CAR group showing a significant advantage over the H828-CAR group (88% vs. 55% survival, respectively, log-rank test, p=0.09). Thus, this appears to at least partially substantiate the long-term advantage shown by the 4-1BB-based CAR over the CD28-based receptor, as previously described

[12] . In addition, since MM is known for its high relapse rate and duration of response to novel or immunological agents, these findings may have important implications for the clinical implementation of this line of therapy.

[0122] Thus, this study reinforces the need to empirically evaluate CARs to determine their optimal configuration and presents an optimized BCMA-CAR with demonstrated long-term in vivo efficacy. Moreover, by enhancing specificity with reduced "off-target" effects, such protection may be influenced by the nature of the receptor utilized - either its basic structure as shown herein or its origin (e.g., mouse vs. human) [Wang D, et al. (2021); 137: 2890-2901]. Importantly, considering that BCMA is expressed by plasma cells from the bone marrow of patients suffering from different plasma cell pathologies (Figure 7A), anti-BCMA CAR T cell therapy may be used to treat more vulnerable patients with other than MM plasma cell pathologies, such as light chain amyloidosis. Given the very encouraging data collected so far regarding the in vitro and ex vivo safety and efficacy of H8BB, we aim to evaluate the therapeutic potential of H8BB CAR T cell-based therapy in patients with plasma cell pathologies. An academic GMP grade H8BB CAR engineered T cell based therapy for R / R MM approved by the Israeli Ministry of Health has been successfully produced. R / R plasma cell malignant patients have been enrolled and initiated in a clinical study (NCT04720313) disclosed by Example 9 treated with autologous H8BB-CAR T cells in a dose escalation study that will first evaluate the safety and then efficacy of this approach. In light of the data presented herein, it is clear that the H8BB CAR T cell based therapy disclosed herein offers significant value in the treatment of MM and additional plasma cell related pathologies.

[0123] Taken together, these data demonstrate that the H8BB-based CAR T cells of the present disclosure respond more specifically to stimulation with alloantigen than ICBB CAR T cells, which exhibit "off-target" activity, or H828-CAR T cells, which were found to be continuously activated regardless of antigenic stimulation. These data correlate with the fact that H828 CAR T cells exhibit a significantly more pronounced exhaustion profile than the H8BB CAR T cells disclosed herein (Figure 4A). In addition, H8BB CAR T cells exhibit reduced tonic signaling compared to ICBB CAR T cells, which may importantly affect the "off-target" activity specificity of the cells. Taken together, the present disclosure provides improved CAR molecules and CAR T cells that exhibit superior therapeutic efficacy.

[0124] Thus, a first aspect of the present disclosure relates to a chimeric antigen receptor (CAR) molecule comprising the following components: (i) at least one target binding domain, at least one of which specifically recognizes and binds to B-cell maturation antigen (BCMA); and (ii) at least one hinge and transmembrane domain derived from cluster of differentiation 8 alpha (CD8α) protein (also known as T-cell surface glycoprotein CD8 alpha chain). It should be noted that the hinge region of the domain comprises the amino acid sequence depicted by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises (iii) at least one intracellular T-cell signaling domain. More specifically, this domain comprises at least one domain of a tumor necrosis factor (TNF) receptor family member, and optionally at least one domain of a T-cell receptor (TCR) molecule.

[0125] Thus, the present disclosure provides a CAR molecule. As used herein, chimeric antigen receptor (CAR) refers to a recombinant polypeptide that includes at least an extracellular antigen-binding domain, a transmembrane domain, and an intracellular cytoplasmic signaling domain that includes a functional stimulatory domain. The receptor is chimeric because it couples between extracellular antigen-binding ability and intracellular T or B cell activation function in a single receptor molecule. CAR is engineered to make B or T cells express new ability to recognize a specific antigen of interest, thereby promoting an immune response to the specific antigen. For example, this technology is used in immunotherapy to specifically recognize antigens of specific cancer cells of interest in order to more effectively direct immune cells to their target cells and destroy them.

[0126] As used herein, CAR refers to artificial T cell receptors (also known as chimeric T cell receptors, chimeric immune receptors). These are engineered receptors that add any specificity onto immune effector cells. Typically, these receptors are used to add the specificity of monoclonal antibodies onto T cells.

[0127] The first design (also called first generation) joined an antibody-derived scFv through the hinge and transmembrane domain to the CD3 zeta intracellular signaling domain of the T cell receptor.

[0128] Second generation CARs added intracellular signaling domains from various costimulatory protein receptors (e.g., CD28, 41BB, ICOS) to the cytoplasmic tail of the CAR to provide additional signals to T cells. More recently, third generation CARs have combined multiple signaling domains, such as CD27, CD28, 4-1BB, ICOS, or OX40, to enhance efficacy.

[0129] It should be understood that the disclosed CAR molecules can be further improved by adding at least one additional signaling domain.

[0130] The term "chimeric protein" refers to a protein created through the joining / fusion of two or more genes that originally coded for separate proteins. This conversion of chimeric / fusion genes results in a single or multiple polypeptides that have functional properties derived from each of the original proteins. Recombinant chimeric / fusion proteins are artificially created by recombinant DNA technology. Chimeric or chimera usually refers to a hybrid protein created with polypeptides that have different functions, sources, or physicochemical patterns.

[0131] As shown above, the CAR T molecules disclosed herein are specifically directed against the BCMA protein. B-cell maturation antigen (BCMA), also referred to as TNFRSF17 or CD269, is a member of the tumor necrosis factor receptor (TNFR) superfamily. Ligands for BCMA include B-cell activating factor (BAFF) and a proliferation-inducing ligand (APRIL), of which APRIL has a higher affinity for BCMA. BCMA is preferentially expressed by mature B lymphocytes, with minimal expression in hematopoietic stem cells or non-hematopoietic tissues, and is essential for the survival of long-lived bone marrow plasma cells (PCs), but not for overall B cell homeostasis. Membrane-bound BCMA can undergo gamma-secretase-mediated shedding from the cell surface, resulting in circulation of soluble BCMA (sBCMA) and reduced activation of surface BCMA by APRIL and BAFF. Overexpression and activation of BCMA are associated with MM. Furthermore, the use of BCMA as a biomarker for MM is supported by its prognostic value. Still further, in some embodiments, BCMA as used herein refers to human BCMA comprising the amino acid sequence represented by Q02223. In still some further embodiments, BCMA is encoded by the nucleic acid sequence represented by Genebank Accession No. Z14954.1. In still some further embodiments, BCMA comprises the amino acid sequence represented by SEQ ID NO: 25, as well as any variants and derivatives thereof.

[0132] In some embodiments, at least one target binding domain of a CAR molecule of the present disclosure comprises (i) at least one target recognition element, and / or (ii)) at least one adaptor component that recognizes and binds to at least one tagged target recognition element.

[0133] In some embodiments, such an adaptor component can include at least one portion that specifically recognizes and binds to at least one tag of a tagged target recognition element.

[0134] Thus, in certain embodiments, the target binding portion of the CAR molecule of the present disclosure may comprise an antibody or antigen-binding fragment thereof, or any aptamer directed to two or more antigens (e.g., a bispecific or trispecific antibody), or alternatively, a different antibody or any other affinity molecule that targets the BCMA molecule.

[0135] In some embodiments, the adaptor component comprises at least one moiety that specifically recognizes and binds to at least one tag of the tagged target recognition element. According to such specific embodiments, the CAR molecules of the present disclosure can be adapted to various target recognition elements that are tagged with the recognized tag and the adaptor component, thereby forming a recognition pair. These CAR molecules can also be referred to herein as universal CARs. In some specific embodiments, the recognition pair can include a biotin / avidin affinity pair. For example, the target recognition component can be tagged with biotin and can be bound to the adaptor component of the disclosed CAR that includes streptavidin. However, it should be understood that any other binding pair, such as leucine zipper adaptor (zipCAR and zipFv), peptide neo-epitope (PNE) and anti-PNE, fluorescein (FITC) and anti-FITC, 10 amino acid (5B9 tag) and anti-5B9, FLAG, HA, SpyTag / SpyCatcher, leucine zipper, SNAP-tag, CLIP-tag, Halo-tag, Spy tag, Snoop tag, Isopep-tag, etc., are applicable for this purpose.

[0136] Still further, in some embodiments, the target recognition domain and / or elements of the CAR molecules of the present disclosure include any affinity molecule that recognizes and binds to the BCMA target molecule and / or any other additional target. The affinity molecule may include any ligand for the target molecule, any aptamer that specifically recognizes BCMA or any other target molecule, any peptide that specifically interacts with a particular antigen (e.g., a peptibody), a receptor molecule that specifically interacts with a particular antigen, a protein that includes a ligand-binding portion of a receptor that specifically binds to a particular antigen or antigen-binding scaffold, or at least one antibody or any antigen-binding fragment thereof. As used herein, "aptamer" in some embodiments refers to peptide aptamers, which are small peptides with a single variable loop region attached to a protein scaffold at both ends that bind to specific molecular targets (e.g., proteins), and bind to their targets only at that variable loop region, and usually with high specificity properties.

[0137] In some specific embodiments, the target recognition domain of the disclosed CAR molecules comprises at least one antibody specific for BCMA, or any antigen-binding fragment, portion, or chimera thereof.

[0138] The CAR molecules provided herein comprise at least one target binding domain, which in some embodiments may be any target recognition element, such as at least one antibody, or any antigen-binding fragment or domain thereof, as discussed herein above. In yet some further embodiments, the target recognition element of the CAR molecules of the present disclosure comprises at least one antibody, or any antigen-binding fragment, portion, or chimera thereof.

[0139] Exemplary categories of antigen-binding domains that can be used in the context of the present invention include antibodies, antigen-binding portions of antibodies (e.g., single-chain variable fragments (scFv)), peptides that specifically interact with a particular antigen (e.g., peptibodies), receptor molecules that specifically interact with a particular antigen, and proteins that contain the ligand-binding portion of a receptor that specifically binds to a particular antigen or antigen-binding scaffold. An antigen-binding domain according to the present invention is capable of recognizing and binding to a particular antigen or epitope. Thus, it should be noted that the terms "binding specificity," "specifically binds to an antigen," "specifically immunoreactive," "specifically directed against," or "specifically recognizes," when referring to an antigen or a particular epitope, refer to a binding reaction that determines the presence of an epitope in a heterogeneous population of proteins and other biologics. The term "epitope" is meant to refer to a portion of any molecule that can be bound by an antibody and also recognized by that antibody. An epitope or "antigenic determinant" usually consists of a chemically active surface group of a molecule, such as an amino acid or sugar side chain, and has specific three-dimensional structural characteristics, as well as specific charge characteristics. Still further, as indicated above, an "antigen-binding domain" may comprise or consist of an antibody or an antigen-binding fragment of an antibody, such as a single-chain variable fragment (scFv). As used herein, the term "antibody" refers to any antigen-binding molecule or molecular complex that comprises at least one complementarity determining region (CDR) that specifically binds to or interacts with a particular antigen or any epitope thereof. The term "antibody" includes immunoglobulin molecules comprising four polypeptide chains, two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, as well as multimers thereof (e.g., IgM). Each heavy chain comprises a heavy chain variable region (herein referred to as HCVR or VVR). H Each light chain comprises a light chain variable region (abbreviated herein as LCVR or VVR) and a heavy chain constant region. The heavy chain constant region comprises three domains, CH1, CH2, and CH3. Each light chain comprises a light chain variable region (abbreviated herein as LCVR or VVR) and a heavy chain constant region. L The light chain constant region contains one domain (CL1).H and V L The regions can be further subdivided into regions of hypervariability, called complementarity determining regions (CDRs), interspersed with more conserved regions, called framework regions (FRs). H and V L is composed of three CDRs and four FRs, arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0140] A typical antibody is composed of two immunoglobulin (Ig) heavy chains and two Ig light chains. In humans, antibodies are encoded by three independent loci: the immunoglobulin heavy locus (IgH) on chromosome 14, which contains the gene segment for the immunoglobulin heavy chain, the immunoglobulin kappa (κ) locus (IgK) on chromosome 2, which contains some gene segments for the immunoglobulin light chain, and the immunoglobulin lambda (λ) locus (IgL) on chromosome 22, which contains the gene segment for the immunoglobulin light chain.

[0141] Antibody and BCR heavy chains contain 51 variable (V) gene segments, 27 diverse (D) gene segments, and 6 joining (J) gene segments. Antibody and BCR light chains contain 40 Vκ, 31 Vλ, 5 Jκ, and 4 Jλ gene segments.

[0142] Still further, as used herein, an "antigen-binding fragment" of an antibody or the like includes any naturally occurring, enzymatically obtainable, synthetic or genetically engineered polypeptide or glycoprotein that specifically binds to an antigen to form a complex. Antigen-binding fragments of antibodies can be derived from complete antibody molecules using any suitable standard techniques, such as, for example, proteolytic digestion or recombinant genetic engineering techniques involving the manipulation and expression of DNA encoding antibody variable domains and, optionally, constant domains. Such DNA is known and / or readily available, for example, from commercial sources, DNA libraries (including, for example, phage-antibody libraries), or can be synthesized. The DNA can be sequenced and manipulated chemically or by using molecular biology techniques, for example, to place one or more variable and / or constant domains into a suitable configuration, or to introduce codons, create cysteine ​​residues, modify, add or delete amino acids, etc.

[0143] Non-limiting examples of antigen-binding fragments include: (i) Fab fragments, (ii) F(ab')2 fragments, (iii) Fd fragments, (iv) Fv fragments, (v) single chain Fv (scFv) molecules, (vi) dAb fragments, and (vii) minimal recognition units consisting of amino acid residues that mimic the hypervariable regions of an antibody (e.g., isolated complementarity determining regions (CDRs)). Domain-specific antibodies, single domain antibodies, domain deleted antibodies, chimeric antibodies, CDR-grafted antibodies, diabodies, triabodies, tetrabodies, minibodies, nanobodies (e.g., monovalent nanobodies, bivalent nanobodies, etc.), small modular immunopharmaceuticals (SMIPs), and other engineered molecules such as shark variable IgNAR domains are also encompassed within the term "antigen-binding fragment" as used herein.

[0144] Single domain antibodies, also known as nanobodies (also known as camelid single domain antibodies or VHHs), have previously been obtained by immunizing dromedaries, camels, llamas, alpacas, sharks, mice, rabbits, and humans).

[0145] An antigen-binding fragment of an antibody will typically contain at least one variable domain. The variable domain may be of any size or amino acid composition and will generally contain at least one CDR adjacent to or in frame with one or more framework sequences. L Domain associated with V H In an antigen-binding fragment having a domain, H and V L The domains can be positioned relative to each other in any suitable configuration. For example, the variable region can be a dimer, with the V H -V H , V H -V L , or V L -V L Alternatively, the antigen-binding fragment of the antibody may contain a monomeric V dimer. H Or V L It may contain domains.

[0146] In yet some further embodiments of the CAR molecules of the present disclosure, such antigen-binding fragments, portions, or chimeras of antibodies comprise at least one of a single chain variable fragment (scFv) and / or a nanobody. As used herein, a single chain variable fragment (scFv) comprises the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin connected by a short linker peptide. A single chain variable fragment lacks the constant Fc region found in a complete antibody molecule. Nevertheless, scFvs retain the specificity of the original immunoglobulin despite the removal of the constant region and the introduction of the linker.

[0147] An antibody suitable for the present invention may be a bispecific antibody (or a trispecific antibody. As indicated above, an antibody suitable for the present invention may also be a variable new antigen receptor antibody (V-NAR), as well as any humanized form thereof.

[0148] In some embodiments, the antibody is the murine anti-BCMA antibody c11d5.3, also described by (Susan L. Kalled, Concord, MA and Yen-Ming Hsu, U.S. Patent No. 9,034,324 (B2)), or any fragment thereof. This antibody comprises the heavy and light chain sequences shown by SEQ ID NO:3 and SEQ ID NO:5.

[0149] In some particular embodiments of the CAR molecules of the present disclosure, the antibodies specifically recognize and bind to the BCMA protein or any fragment thereof. More specifically, such antibodies include an immunoglobulin heavy chain (HC) comprising the amino acid sequence set forth in SEQ ID NO:3, and any derivative or variant thereof, and an immunoglobulin light chain (LC) comprising the amino acid sequence set forth in SEQ ID NO:5, and any derivative or variant thereof.

[0150] In still some further embodiments, at least one target binding domain of the CAR molecule of the present disclosure comprises the amino acid sequence set forth by SEQ ID NO: 11, and any derivative or variant thereof.

[0151] The second component of the disclosed CAR molecule comprises a hinge region and / or a transmembrane domain.

[0152] Hinge region or hinge domain as used herein refers to an extracellular flexible structure that connects the targeting moiety and the T cell plasma membrane. These sequences are generally derived from IgG subclasses (such as IgG1 and IgG4), IgD, and CD8 domains.

[0153] In yet some further embodiments, the "transmembrane region" or transmembrane domain (TMD, also referred to herein as TM) of the disclosed CAR is a functional region of a protein that spans the phospholipid bilayer of a biological membrane, such as the plasma membrane of a cell. Integral membrane proteins typically contain two or more such domains, alternating with intracellular and extracellular domains located on either side of the membrane. The TMD may be composed primarily of non-polar amino acid residues and may generally adopt an alpha-helical conformation. The amino acids of the transmembrane domain interact with fatty acyl groups of membrane phospholipids, thereby anchoring the protein to the membrane.

[0154] In some embodiments, the hinge region may comprise about 10-100, 20-90, 30-80, 30-70, or 30-60 amino acid residues, specifically about 25-50 aa, specifically 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acid residues.

[0155] In some embodiments, the hinge region of the disclosed CAR molecules can include any sequence derived from the cluster of differentiation 8 alpha (CD8α) protein. Cluster of differentiation 8 (CD8), also known as Ly-2 or Leu-2, and T cell surface glycoprotein CD8 alpha chain, is a two-chain and transmembrane glycoprotein expressed on the surface of circulating T cells. CD8 functions as a co-receptor for the T cell receptor (TCR). Like the TCR, CD8 binds to major histocompatibility complex (MHC) molecules but is specific for class I MHC proteins presented by antigen presenting cells (APCs). There are two isoforms of CD8 protein, alpha and beta, each encoded by a different gene. CD8 exists as a disulfide-linked dimer, either as an α / β heterodimer or as an α / α homodimer. In some embodiments, CD8α as used herein refers to the human CD8α homodimer. In some embodiments, the human CD8α is represented by Uniprot Accession No. P01732-1. In still further embodiments, the human CD8α comprises the amino acid sequence represented by SEQ ID NO:26. In some embodiments, the hinge region of the disclosed CAR molecule may comprise the amino acid sequence represented by SEQ ID NO:9, or any fragments, derivatives, and variants thereof. In still further embodiments, the disclosed hinge region of SEQ ID NO:9 further comprises at least one residue, and is thus an example of a fragment of a hinge region. In some embodiments, the hinge region of SEQ ID NO:9 further comprises a lysine residue. In still further embodiments, such a hinge region is as represented by SEQ ID NO:35.

[0156] Still further, in some alternative embodiments, the hinge region of the disclosed CAR molecule may comprise an IgG4 hinge region. In some embodiments, a suitable hinge region may comprise the amino acid sequence set forth by SEQ ID NO: 38. Still further, in some embodiments, the second component of the disclosed CAR molecule may comprise a transmembrane domain.

[0157] In some embodiments, the TM region may comprise about 30-15 amino acid residues, specifically about 25-17 aa, specifically 25, 24, 23, 22, 21, 20, 19, 18, 17 amino acid residues.

[0158] In some embodiments, the transmembrane domain may be derived from a CD8α protein.

[0159] In yet some further specific embodiments, the TM region used in the disclosed CAR molecules may comprise the amino acid sequence set forth in SEQ ID NO: 10, or any fragments, derivatives, and variants thereof.

[0160] In some alternative embodiments, the TM region of the disclosed car molecule may comprise a TM region derived from a CD28 molecule. A non-limiting embodiment of such a TM is a TM comprising the amino acid sequence represented by SEQ ID NO:39.

[0161] In yet some further embodiments, the hinge and transmembrane domains of the CAR molecule of the present disclosure comprise the amino acid sequence set forth by SEQ ID NO:6, and any derivative or variant thereof.

[0162] As shown by the disclosed examples, the CAR T molecule of the present disclosure, specifically the H8BB CAR molecule, shows clear advantages over prior art CARs, such as the same molecule, specifically the H828 CAR T, which shares a similar target binding domain derived from CD8αtm and hinge, and / or a similar TM and / or hinge region. However, it should be noted that the hinge region of the disclosed CAR T, specifically represented by SEQ ID NO: 9, is different from the hinge region of the H828 CAR T, which includes the hinge region represented by SEQ ID NO: 22. Still further, in some embodiments, the hinge region useful for the CAR molecule of the present disclosure comprises the amino acid sequence represented by SEQ ID NO: 35.

[0163] Furthermore, the third component of the CAR molecule of the present disclosure is at least one signaling domain.As used herein, the term signaling domain refers to the functional intracellular part of a receptor protein, which in some embodiments acts to transmit the stimuli detected in the cell, thereby regulating cell activity through a specific signaling pathway.According to some embodiments, this domain is the intracellular domain connected to the transmembrane domain, specifically the TM domain used by the CAR molecule of the present disclosure.

[0164] Still further, in some embodiments, at least one intracellular T cell signaling domain of the CAR molecule of the present disclosure comprises at least one tumor necrosis factor (TNF) receptor family member. Tumor necrosis factor receptor (TNFR) superfamily members are membrane-bound or soluble receptors that interact with membrane-bound and / or soluble ligands of the TNF superfamily. Most members of this TNF / TNFR superfamily are expressed by immune cells. Activation of TNFR members via their ligands affects cell proliferation, survival, differentiation, and apoptosis of responding cells.

[0165] TNF-like receptors are type I transmembrane proteins characterized by a cysteine-rich domain (CRD), characteristic of the TNFR superfamily. These pseudorepeats are defined by intrachain disulfides generated by highly conserved cysteine ​​residues in the receptor chain. Members of the tumor necrosis factor (TNF) / tumor necrosis factor receptor (TNFR) superfamily are critically involved in maintaining immune system homeostasis. The biological functions of this system include beneficial and protective effects in inflammation and host defense, as well as a key role in organogenesis. At the same time, members of this superfamily are responsible for host damaging effects in sepsis, cachexia, and autoimmune diseases. The TNFR superfamily includes, for example, TNFR1 (sometimes also referred to as p55 / p60), TNFR2 (also known as p75 / p80), and B-cell activating factor receptor (BAFFR). Still further, the tumor necrosis factor (TNF) family includes, for example, TNF alpha (TNFα), TNF beta (TNFβ), CD40 ligand (CD40L), Fas ligand (FasL), TNF-related apoptosis inducing ligand (TRAIL), and LIGHT (homologous to lymphotoxin, exhibits inducible expression, and competes with HSV glycoprotein D for HVEM, a receptor expressed by T lymphocytes), some of the most important cytokines involved in the initiation of physiological processes, systemic inflammation, tumor lysis, apoptosis, and the acute phase response.

[0166] In some embodiments, a TNF receptor family member useful as a signaling intracellular domain of the CAR molecule of the present disclosure is 4-1BB. Thus, in some embodiments, the CAR molecule of the present disclosure sacrifices an intracellular domain derived from 4-1BB. 4-1BB (TNFRSF9, CD137) is an activation-induced T cell costimulatory molecule and a TNFR superfamily member. 4-1BB inhibits the signaling intracellular domain of resting CD8 + It is expressed on a subset of T cells and, after activation, CD4 + and CD8 + 4-1BB is upregulated on both inflammatory and T cell lines. Upon binding to trimeric 4-1BBL (TNFSF9, CD137L) on APCs, 4-1BB recruits TNFR-associated factor family members (TRAF1, TRAF2, and TRAF3) to its cytosolic domain, forming the 4-1BB signalosome, leading to downstream activation of NF-κB, MAPK, and ERK. Agonistic stimulation of 4-1BB upregulates the antiapoptotic protein Bcl-x L Furthermore, 4-1BB activation upregulates the expression of CD8 + IL-2 and IFN-γ, and CD4 + T cells expressing CARs incorporating the 4-1BB domain increase IL-2 and IL-4 in T cells. T cells expressing CARs incorporating the 4-1BB domain increase granzyme B, IFN-γ, TNF-α, GM-CSF, and the anti-apoptotic protein Bcl-x L Furthermore, incorporation of the 4-1BB TM and cytoplasmic domains into the CAR results in improved persistence and antitumor activity, as well as prolonged T cell division.

[0167] In some embodiments, 4-1BB as used herein refers to human 4-1BB. In some embodiments, human 4-1BB is as set forth by Uniprot Accession No. Q07011. In some further embodiments, human 4-1BB comprises the amino acid sequence set forth by SEQ ID NO: 28, as well as any variants and derivatives thereof.

[0168] In yet some further optional embodiments, at least one intracellular T cell signaling domain of the CAR molecule of the present disclosure further comprises at least one TCR molecule or any fragment thereof. More specifically, the T cell receptor (TCR) is a protein complex found on the surface of T cells or T lymphocytes that is responsible for recognizing fragments of antigens as peptides bound to major histocompatibility complex (MHC) molecules. When the TCR engages an antigenic peptide and MHC (peptide / MHC), the T lymphocyte is activated through signal transduction, i.e., a series of biochemical events mediated by associated enzymes, co-receptors, specialized adapter molecules, and activated or released transcription factors.

[0169] The core TCR complex consists of two TCR chains and six cluster of differentiation 3 (CD3) chains. The human genome expresses four TCR genes, known as TCRα, TCRβ, TCRγ, and TCRδ, which form two distinct heterodimers: TCRα / TCRβ or TCRγ / TCRδ. The majority of mature T cells express TCRα and TCRβ isoforms, commonly referred to as T cells (or αβ T cells), while a small fraction (0.5-5%) of T lymphocytes (γδ T cells) express TCRγ and TCRδ isoforms. Both heterodimers form multiprotein complexes with the CD3 δ, γ, ε, and ζ chains. However, in both complexes, there are three dimers of the CD3 protein, the δε and γε heterodimers, and the ζζ homodimer. These CD3 proteins associate with the TCR through non-covalent hydrophobic interactions and are required for complete TCR localization on the cell surface. The TCR mediates recognition of antigenic peptides bound to MHC molecules (pMHC), and the CD3 molecules transmit activation signals to the T cell.

[0170] In more specific embodiments, the CAR molecule of the present disclosure may comprise at least one domain of the TCR, specifically at least one region derived from the cluster of differentiation 3 (CD3) zeta chain. Thus, in some embodiments, the CAR molecule of the present disclosure sacrifices an intracellular domain that further comprises a domain derived from CD3-zeta. The T cell surface glycoprotein CD3 zeta chain (cluster of differentiation 247), also known as the T cell receptor T3 zeta chain or CD247, is a protein that in humans is encoded by the CD247 gene. More specifically, the CD3 (cluster of differentiation 3) T cell co-receptor helps to activate cytotoxic T cells. It consists of a protein complex and is composed of four separate chains. In mammals, the complex contains the CD3 gamma chain, the CD3 delta chain, and two CD3 epsilon chains. These chains associate with the T cell receptor (TCR) and the zeta chain (zeta chain) to generate an activation signal in T lymphocytes. The TCR, zeta chain, and CD3 molecule together constitute the TCR complex. T cell receptor zeta, together with T cell receptor alpha / beta and gamma / delta heterodimers, and CD3-gamma, -delta, and -epsilon, forms the T cell receptor-CD3 complex. The zeta chain plays an important role in coupling antigen recognition to several intracellular signaling pathways, and is therefore included in the CAR T molecules of the present disclosure. In some embodiments, CD3 zeta as used herein refers to human CD3 zeta. In some embodiments, human CD3 zeta is as represented by Uniprot accession number P20963-1. Still further, in some embodiments, human CD3 zeta as used in the present disclosure may include the amino acid sequence represented by SEQ ID NO: 27, and any derivative or variant thereof.

[0171] In some specific and non-limiting embodiments, at least one intracellular T cell signaling domain of the CAR molecule of the present disclosure comprises an amino acid sequence set forth by SEQ ID NO: 12, or any variants and derivatives thereof.

[0172] In yet some further specific embodiments, the CAR molecule of the present disclosure comprises the amino acid sequence set forth by SEQ ID NO: 1, or any variants and derivatives thereof. It should be noted that in some embodiments, the CAR T of the present disclosure is also referred to herein as H8BB CART, and HBI0101 (clinical grade as used herein) CART.

[0173] It should further be understood that the present disclosure further encompasses any of the disclosed CAR T molecules, specifically, the ICBB CAR molecule comprising the amino acid sequence set forth in SEQ ID NO: 36. Still further, the present disclosure further encompasses the IC28 CAR molecule comprising the amino acid sequence set forth in SEQ ID NO: 37.

[0174] In yet some further embodiments, expression of the disclosed CAR molecule by at least one cell of the T lineage results in several characteristics that distinguish the disclosed CAR molecule from any prior art CAR molecule and further define the superiority of the disclosed CAR molecule over prior art CAR molecules, according to some alternative or additional embodiments. More specifically, in some embodiments (i), the disclosed CAR molecule exhibits or is characterized by increased specificity for the target. In particular, increased specificity for any cell expressing the target BCMA.

[0175] In some embodiments, specificity as used herein refers to the ability of a CAR molecule to activate T cell expression in response to a particular antigen, while inducing no or only a minimal response to cells expressing a different antigen.

[0176] In yet some further additional or alternative embodiments, expression of the disclosed CAR molecule by at least one of the cells of the T lineage results in (ii) reduced tonic signaling. Thus, in some embodiments, the disclosed CAR molecule exhibits or is characterized by reduced tonic signaling. More specifically, as used herein, the term tonic signaling may be defined as the constitutive or chronic activation of T cells in the absence of ligand. Physiologically, low levels of continuous tonic signaling via the interaction between endogenous TCR and autologous peptide-loaded MHC molecules constitute an important mechanism for regulating T cell homeostasis. In contrast, tonic signaling mediated by T cell grafted CAR constructs appears to be more complex. Tonic signaling may be influenced by the configuration of the CAR, as demonstrated in Figure 2 and Figure 3C.

[0177] Still further, in some additional or alternative embodiments, expression of the disclosed CAR molecule by at least one cell of the T lineage results in (iii) reduced off-target activation. Thus, in some embodiments, the disclosed CAR molecule exhibits or is characterized by reduced off-target activation. More specifically, off-target activation herein refers to non-specific cytokine secretion with an antigen-negative target (such as K562) or in a control co-culture without any target, as demonstrated in Figures 2 and 4. Off-target activation can be influenced by the CAR configuration.

[0178] In some further additional or alternative embodiments, expression of the disclosed CAR molecule by at least one cell of the T lineage results in (iv) increased expression of an activation marker in response to a specific stimulus. Thus, in some embodiments, the disclosed CAR molecule exhibits or is characterized by increased expression of an activation marker. In yet some further embodiments, the disclosed CAR molecule increases activation of T cells. T cells are generated in the thymus and are programmed to be specific for one particular foreign particle (antigen). Once they leave the thymus, they circulate throughout the body until they recognize their antigen on the surface of an antigen-presenting cell (APC). The T cell receptor (TCR) on both CD4+ helper T cells and CD8+ cytotoxic T cells binds to the antigen as it is held in a structure called the MHC complex on the surface of the APC. This triggers the initial activation of the T cell. The CD4 and CD8 molecules then also bind to the MHC molecule, stabilizing the entire structure. This initial binding between a T cell specific for one antigen and an antibody-MHC matching the antigen sets in motion the entire response. This usually occurs in the secondary lymphoid organs.

[0179] In addition to TCR binding to antigen-loaded MHC, both helper and cytotoxic T cells require several secondary signals to become activated and respond to a threat. In the case of helper T cells, the first of these is provided by CD28. This molecule on the T cell binds to one of two molecules on the APC-B7.1 (CD80) or B7.2 (CD86), initiating T cell proliferation. This process results in the production of millions of T cells that recognize the antigen. To control the response, stimulation of CD28 by B7 induces the production of CTLA-4 (CD152). This molecule competes with CD28 for B7, thus reducing the activation signal to the T cell and dampening the immune response. Cytotoxic T cells are less dependent on CD28 for activation, but require signals from other costimulatory molecules such as CD70 and 4-1BB (CD137). T cells must strongly and specifically recognize foreign antigens to mount an effective immune response, and those that do are given survival signals by several molecules, including ICOS, 4-1BB, and OX40. These molecules are found on the T cell surface and are stimulated by their respective ligands, which are typically found on APCs. Unlike CD28 and TCR, ICOS, OX40, and 4-1BB are not constitutively expressed on T cells. Similarly, their respective ligands are only expressed on APCs after pathogen recognition. This is important because it ensures that T cells are only activated by APCs that have encountered and responded to a pathogen. The interaction of TCR with peptide-MHC in the absence of costimulation switches off the T cells so they do not respond inappropriately. Once T cells receive both a specific antigen signal and a general signal, they receive further instructions in the form of cytokines. The instructions determine what type of responder the cell will become - in the case of helper T cells, they are driven towards Th1 type (cells exposed to the cytokine IL-12), Th2 (IL-4), or IL-17 (IL-6, IL-23). ​​Each of these cells plays a specific role in the tissue and in generating further immune responses. As shown above, increased activation of T cells can be reflected, for example, by increased expression of activation markers.Activation markers herein refer to molecules that are upregulated during T cell activation, each at a different stage of the activation process.For example, the earliest activation marker is CD69, which is an inducible cell surface glycoprotein that is expressed upon activation via TCR or IL-2 receptor (CD25).It plays a role in the proliferation and survival of activated T lymphocytes.

[0180] According to some embodiments, the increased expression of activation markers may include, for example, increased expression of at least one of leukocyte antigen 37 (CD37), CD25 (also known as the alpha chain of the high affinity IL-2 receptor), and cluster of differentiation 69 (CD69). It should be further understood that the specific stimulus as used herein is the presence of BCMA-positive target cells. Still further, in some additional or alternative embodiments, expression of the CAR molecule of the present disclosure by at least one cell of the T lineage results in (v) a reduced expression of exhaustion markers in response to the specific stimulus. T cell exhaustion as used herein refers to a state of T cell dysfunction that occurs during many chronic infections and cancers. It is defined by insufficient effector function, persistent expression of inhibitory receptors, and a transcriptional state that differs from that of functional effector or memory T cells. By "dysfunction" herein, it is understood that some T cells, after activation and proliferation, do not fulfill the functions expected of them to function as effector T cells - typically, they are unable to eliminate cancerous or infected cells and control tumors or viruses, respectively. As originally described, antigen-specific T cells become "dysfunctional" during the chronic phase of high viral load infection, progressing to a loss of interleukin (IL)-2, then tumor necrosis factor alpha (TNFα), and finally interferon gamma (IFNγ). Thus, in some embodiments, the disclosed CAR molecules exhibit or are characterized by a reduced expression of exhaustion markers. More specifically, in some embodiments, the exhaustion markers can be at least one of programmed cell death-1 receptor (PD-1), lymphocyte activation gene-3 (LAG-3, also named CD223 or FDC protein), T cell immunoglobulin and mucin domain-containing 3 (TIM3), T cell immunoreceptor with Ig and ITIM domains (TIGIT), in an in vivo and / or in vitro / ex vivo setting and as disclosed by FIG. 3C.Further still, in some additional non-limiting embodiments, exhaustion markers applicable in the present disclosure include inducible T-cell co-stimulator (ICOS), cytotoxic T-lymphocyte-associated protein-4 (CTLA-4), CD244 (2B4), CD160, killer cell lectin-like receptor subfamily G member 1 (KLRG1), and the like.

[0181] As shown above, one of the main and advantageous properties exhibited by the disclosed CAR molecules is the reduction of tonic signaling. More specifically, tonic signaling may be dependent or independent of associated Ag and has a major effect on CAR-based therapy. On the one hand, CAR tonic signaling can promote T cell expansion by providing stimulatory signals. On the other hand, CAR tonic signaling can induce end effector T cell differentiation, exhaustion, and / or enhanced activation-induced cell death, thus limiting in vivo persistence and antitumor potential. Thus, as shown by the disclosed CAR T molecules, its reduction increases the specificity and efficacy of the response.

[0182] As shown above, the CAR molecules of the present disclosure exhibit superior properties in in vivo and / or in vitro / ex vivo settings, characterized by at least one of reduced tonic signaling, reduced off-target activation, reduced expression of exhaustion markers in response to specific stimuli, and increased specificity and expression of activation markers in response to specific stimuli. As used herein in relation to various improved properties of the CAR molecules of the present disclosure, "increase" refers to an increase or enhancement of an indicated parameter by about 1% to 100%, specifically 5% to 100%, more specifically about 1% to about 5%, about 5% to 10%, about 10% to 15%, about 15% to 20%, about 20% to 25%, about 25% to 30%, about 30% to 35%, about 35% to 40%, about 40% to 45%, about 45% to 50%, about 50% to 55%, about 55% to 60%, about 60% to 65%, about 65% to 70%, about 75% to 80%, about 80% to 85%. This means that the increase or elevation in a indicated activity (e.g., specificity, expression of an activation marker, etc.) may be about 85% to 90%, about 90% to 95%, about 95% to 99%, or about 99% to 99.9%, or may be 100% or more. In yet some further embodiments, the terms "inhibit," "alleviate," "reduce," "reduce," or "attenuate" as referred to herein with respect to various properties of the CAR molecules of the present disclosure (e.g., expression of exhaustion markers, reduction of tonic signaling) refer to an inhibition of about 1% to about 99.9%, specifically, about 1% to about 5%, about 5% to 10%, about 10% to 15%, about 15% to 20%, about 20% to 25%, about 25% to 30%, about 30% to 35%, about 35% to 40%, about 40% to 45%, about 45% to 50%, about 50% to 55%, about 55% to 60%, about 60% to 65%, about 65% to 70%, about 75% to 80%, about 80% to 85%. It relates to a delay, inhibition, or reduction of the indicated parameter by any one of about 85%-90%, about 90%-95%, about 95%-99%, or about 99%-99.9%, 100% or more. More specifically, the terms "increase," "enhance," and "potentiate" as used herein refer to the act of gradually increasing in size, amount, number, or intensity. Alternatively, the terms "inhibit," "mitigate," "reduce," "reduce," or "attenuate" as used herein refer to the act of gradually decreasing in size, amount, number, or intensity.In particular, a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 200%, 300%, 400%, 500%, 600%, 70%, 800%, 900%, 1000% or more increase or alternatively decrease in the indicated activity (e.g., increased specificity and / or expression of activation markers, or alternatively decreased expression of exhaustion markers and / or tonic signaling) compared to a suitable control, e.g., in the absence of a CAR molecule of the present disclosure, or compared to other CAR molecules, e.g., any of the other (e.g., see H828) CAR molecules disclosed herein.

[0183] More specifically, the CAR molecules of the present disclosure exhibit a significant reduction in exhaustion. In some embodiments, the reduction in exhaustion is reflected by a reduction in the expression of various exhaustion markers. More specifically, as demonstrated by the examples, the exhaustion profile of HBI0101 (H8BB) CART cells in resting cells is dramatically lower than that of H828 CART cells, i.e., the expression of PD1, LAG3, TIM3, and TIGIT T cell exhaustion markers on the surface of HBI0101 (H8BB) CART cells is reduced by 79% (range 72%-86%), 68% (range 59%-74%), 77% (range 69%-84%), and 43% (range 37%-47%), respectively, compared to H828 CART cells of the prior art.

[0184] The exhaustion profile of HBI0101(H8BB) CART cells activated with BCMA-expressing NCI-H929 cells was significantly lower than that of H828 CART cells activated with the same BCMA-expressing NCI-H929 cells, i.e., expression of PD1, LAG3, TIM3, and TIGIT T cell exhaustion markers on the surface of target-activated HBI0101(H8BB) CART cells was reduced by 64% (range 59%-69%), 54% (range 43%-66%), 58% (range 50%-63%), and 55% (range 50%-58%), respectively, compared to prior art target-activated H828 CART cells.

[0185] The exhaustion profile of HBI0101(H8BB) CART cells following activation with BCMA-expressing K562-BCMA overexpressing cells is significantly lower than that of H828 CART cells activated with the same BCMA-expressing NCI-H929 cells, i.e., expression of PD1, LAG3, TIM3, and TIGIT T cell exhaustion markers on the surface of target-activated HBI0101(H8BB) CART cells was reduced by 55% (range 47%-63%), 41% (range 31%-43%), 55% (range 50%-61%), and 38% (range 33%-42%), respectively, compared to target-activated H828 CART cells. Thus, in some embodiments, the CAR T cells of the present disclosure exhibit about 30% to about 90%, about 35%-80%, and about 38%-80% reduction in the expression of exhaustion markers, i.e., PD1, LAG3, TIM3, and TIGIT. Specifically, about a 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more, such as a 95%, 100% reduction. More specifically, in some embodiments, about a 79%, 64%, 55% reduction in PD1 expression. In certain embodiments, about a 68%, 54%, 41% reduction in LAG3 expression. In still some further embodiments, the reduction is about a 77%, 58%, 55% reduction in TIM3 expression. In still some further embodiments, the reduction is about a 43%, 55%, or 38% reduction in TIGIT expression. It should be understood that in some embodiments, the reductions shown herein are compared to CAR T cells of the prior art (e.g., H828 CAR T cells). Still further, as shown by the examples, the CAR T cells of the present disclosure exhibit increased cytotoxicity against BCMA-expressing target cells. In some embodiments, the cytotoxicity is increased by about 50% to about 100% or more, specifically about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% cytotoxicity, or in some embodiments, about a 57% or 75% or more increase, compared to prior art (H828) CAR T cells.

[0186] In yet some further embodiments, the increase in activation markers can range from about 50% to about 100% compared to prior art (H828) CAR T cells, specifically, a 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, e.g., about 69% or more increase in expression of an activation marker, e.g., CD69.

[0187] In some embodiments, expression of a CAR molecule of the present disclosure by at least one cell of the T lineage of a subject suffering from an immune-related disorder results in modulation of the immune response in the subject.

[0188] Still further, in some embodiments, such immune-related disorder may be any immune-related disorder associated with increased expression of BCMA markers. In yet some further embodiments, such immune-related disorder may be at least one plasma cell pathology. In some embodiments, such pathology may include at least one proliferative disorder, and / or at least one deposition disorder, and / or at least one autoimmune disease.

[0189] In yet some further alternative embodiments, the CAR molecules of the present disclosure may be applicable to inflammatory disorders, autoimmune disorders, infectious diseases caused by pathogens, neurodegenerative diseases, congenital disorders, allergic conditions, cardiovascular diseases, immune deficiencies (acquired or inherited), and metabolic conditions. Specific examples of disorders applicable to the present disclosure or any aspect thereof are disclosed later herein in connection with other aspects of the invention.

[0190] The present disclosure provides CAR T molecules that are composed of amino acid residues and thus are polypeptides. The term "polypeptide" as used herein refers to amino acid residues connected by peptide bonds. A polypeptide sequence is generally reported from the N-terminus containing a free amino group to the C-terminus containing a free carboxyl group and may include any polymeric chain of amino acids. In some embodiments, a polypeptide has a naturally occurring amino acid sequence. In some embodiments, a polypeptide has a non-naturally occurring amino acid sequence. In some embodiments, a polypeptide has an amino acid sequence that contains portions that naturally occur separately from each other (i.e., from two or more different organisms, e.g., human and non-human portions). In some embodiments, a polypeptide has an engineered amino acid sequence in that it is designed and / or produced by the action of the human hand. More specifically, an "amino acid sequence" or "peptide sequence" is the order in which amino acid residues connected by peptide bonds occur in a chain of peptides and proteins. The sequence is generally reported from the N-terminus containing a free amino group to the C-terminus containing an amide. An amino acid sequence is often referred to as a peptide or protein sequence when it represents the primary structure of a protein. However, a distinction must be made between the terms "amino acid sequence" or "peptide sequence" and "protein", since a protein is defined as an amino acid sequence that is folded into a specific three-dimensional configuration and that typically undergoes post-translational modifications such as phosphorylation, acetylation, glycosylation, manosylation, amidation, carboxylation, sulfhydryl bond formation, cleavage, etc.

[0191] The present invention should be understood to encompass the use of any variant or derivative of the polypeptide of the present invention, specifically any polypeptide comprising at least one of the amino acid sequences as set forth by any one of SEQ ID NO: 1, or any fragment thereof, such as the leader sequence as set forth by SEQ ID NO: 2-12 or any portion thereof, or any derivative thereof, and the CAR T molecule of SEQ ID NO: 40 that does not contain any polypeptide that is substantially identical or homologous to the polypeptide encoded by the nucleic acid sequence of the present invention as set forth herein above. The term "derivative" is used to define an amino acid sequence (polypeptide) having any insertion, deletion, substitution, and modification to the amino acid sequence (polypeptide) that does not change at least one of the activities of the original polypeptide, such as increased specificity, reduced tonic signaling, reduced off-target activation, increased expression of activation markers in response to specific stimuli, and / or reduced expression of exhaustion markers in response to specific stimuli in an in vivo and / or in vitro / ex vivo setting as discussed above. The term "derivative" also refers to its homologs, variants, and analogs. Proteins of interest according to the present invention, in particular protein orthologs or homologs having sequence homology or identity to the receptors, chimeras, and antibodies described herein, may share at least 50%, at least 60%, in particular 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, compared to the entire sequence of a protein of interest according to the present invention, in particular any one of SEQ ID NO: 1, or any fragment thereof, such as a CAR T molecule of SEQ ID NO: 40, which does not contain the leader sequence as depicted by SEQ ID NOs: 2-12 or any portion thereof, or any derivative thereof.

[0192] In some embodiments, a derivative refers to a polypeptide that differs from a polypeptide specifically defined in the present invention by an insertion, deletion, or substitution of an amino acid residue. The terms "insertion", "deletion", or "substitution" as used herein should be understood to mean any addition, deletion, or replacement of amino acid residues, of 1 to 50 amino acid residues, 20 to 1 amino acid residues, specifically 1 to 10 amino acid residues, respectively, to the polypeptide disclosed by the present invention shown above. More specifically, the insertion, deletion, or substitution can be an insertion, deletion, or replacement of any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. It should be noted that the insertion, deletion, or substitution encompassed by the present invention can be made at any position of the modified peptide, as well as at either its N' or C' terminus. With respect to amino acid sequences, one of skill in the art will recognize that individual substitutions, deletions, or additions to a nucleic acid, peptide, polypeptide, or protein sequence that modify, add, or delete a single amino acid or a small percentage of amino acids in the encoded sequence are "conservatively modified variants" where the modification results in the replacement of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to, and do not exclude, polymorphic variants, interspecies homologs, and alleles of the invention. For example, substitutions may be made in which an aliphatic amino acid (G, A, I, L, or V) is replaced with another member of the group, or one polar residue is replaced with another, such as arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine. Each of the following eight groups contains other exemplary amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G), 2) Aspartic acid (D), Glutamic acid (E), 3) Asparagine (N), Glutamine (Q), 4) Arginine (R), Lysine (K), 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V), 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W), 7) Serine (S), Threonine (T), and 8) Cysteine ​​(C), Methionine (M).

[0193] More specifically, an amino acid "substitution" is the result of replacing one amino acid with another amino acid having similar structural and / or chemical properties, i.e., a conservative amino acid replacement. Amino acid substitutions can be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues involved. For example, non-polar "hydrophobic" amino acids are selected from the group consisting of valine (V), isoleucine (I), leucine (L), methionine (M), phenylalanine (F), tryptophan (W), cysteine ​​(C), alanine (A), tyrosine (Y), histidine (H), threonine (T), serine (S), proline (P), glycine (G), arginine (R), and lysine (K); and "polar" amino acids are selected from the group consisting of: The "positively charged" amino acids are selected from the group consisting of arginine (R), lysine (K), aspartic acid (D), glutamic acid (E), asparagine (N), and glutamine (Q), and the "acidic" amino acids are selected from the group consisting of aspartic acid (D), asparagine (N), glutamic acid (E), and glutamine (Q).

[0194] Variants of the polypeptides of the present disclosure may have at least 80% sequence similarity or identity, often at least 85% sequence similarity or identity, 90% sequence similarity or identity, or at least 95%, 96%, 97%, 98%, or 99% sequence similarity or identity at the amino acid level to a protein of interest, such as the various polypeptides of the present invention. It should be understood that the percentage of similarity or identity refers to the similarity or identity to the entire sequence set forth in any one of SEQ ID NO: 1 or any fragment thereof, such as the CAR T molecule of SEQ ID NO: 40 that does not contain the leader sequence set forth in SEQ ID NO: 2-12 or any portion thereof, and any variant or derivative thereof.

[0195] Further aspects of the present disclosure relate to a nucleic acid molecule comprising at least one nucleic acid sequence encoding at least one CAR molecule, or any cassette, vector, or vehicle comprising a nucleic acid molecule. In some embodiments, such an encoded CAR molecule comprises the following components: first, (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA; second, (ii) at least one hinge and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence depicted by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises at least one intracellular T cell signaling domain as a third component (iii). More specifically, this domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0196] In some embodiments, the present disclosure provides any nucleic acid molecule encoding any of the CAR molecules defined by the present disclosure.

[0197] Still further, in some embodiments, the nucleic acid molecule of the present disclosure may be flanked at least one of its 5' and 3' ends by at least one of (i) homology arms for integration into a genomic target site by homologous recombination, and / or (ii) a recognition site for a site-specific nuclease, a site-specific integrase, or a site-specific recombinase. As used herein, the term "flanked" refers to a nucleic acid sequence located between two defined regions. For example, as shown above, a nucleic acid molecule of the present disclosure encoding a CAR is flanked by at least one homology arm and / or recognition site located 5' (or upstream) and / or 3' (or downstream) relative to the nucleic acid molecule of the present disclosure. As used herein, a homology arm is a genomic DNA fragment located 5' and / or 3' of a nucleic acid sequence, also referred to herein as 5'- and 3'-homology arms (or simply 5' and 3' arms, or left and right arms) flanking at least one nucleic acid sequence of interest (e.g., in a donor cassette). The arms homologously recombined with complementary sequences flanking the target nucleic acid sequence to achieve successful genetic modification of the target nucleic acid sequence.

[0198] The present invention includes the provision of a nucleic acid molecule encoding a disclosed CAR, and in some embodiments, the nucleic acid molecule may be a cassette and / or may be included within a cassette for use in the methods, cells, compositions, and uses of all aspects of the invention. The term "nucleic acid cassette" refers to a polynucleotide sequence comprising at least one regulatory sequence operably linked to a sequence encoding a nucleic acid sequence encoding a CAR T as disclosed herein. All elements included within a cassette of the present invention are operably linked together. The term "operably linked" as used in reference to regulatory sequences and structural nucleotide sequences means that the nucleic acid sequences are linked in a manner that allows for regulated expression of the linked structural nucleotide sequence. Any nucleic acid cassette provided herein should be understood to include a nucleic acid sequence disclosed herein (e.g., a sequence encoding a CAR T of the present invention as depicted by SEQ ID NO: 13, and any homologs and variants thereof, or a coding sequence for any fragment thereof as depicted by SEQ ID NOs: 14-20, and any homologs and variants thereof). According to some embodiments, such a nucleic acid cassette may further comprise any regulatory sequence that facilitates transcription and / or translation of the CAR T molecule of the present disclosure. Such sequences include, by way of non-limiting example, promoter sequences, specifically DNA regulatory regions capable of binding RNA polymerase in cells and initiating transcription of downstream (3' direction) coding sequences. For purposes of defining the present invention, a promoter sequence includes the minimum number of bases or elements required to be bound at its 3' end by a transcription initiation site and extend upstream (5' direction) to initiate transcription at a level detectable above background. Within the promoter sequence will be found the transcription initiation site, as well as protein binding domains responsible for binding RNA polymerase. Eukaryotic promoters often, but not always, contain "TATA" and "CAT" boxes. A variety of promoters, including inducible promoters, can be used to drive the various vectors of the present invention.

[0199] In some embodiments, the promoter applicable in the present invention can be either inducible or constitutive. In still some further embodiments, a minimal promoter can be used, and even further, endogenous or heterologous promoters are also applicable in the cassette disclosed herein. In some embodiments, the cassette of the present disclosure can further comprise a signal peptide leader, such as a signal peptide leader derived from CD8, as used herein, specifically SEQ ID NO: 2, and any derivatives and variants thereof. In still some further embodiments, the nucleic acid molecule encoding a CAR provided by the present invention can further comprise at least one degron sequence, at least one 2A peptide sequence or CHYSEL site, at least one mRNA stabilizing sequence, at least one stop codon (or termination codon), at least one 3-frame stop codon sequence, at least one protein stabilizing sequence, at least one polyadenylation sequence, at least one transcription enhancer, splice donor and / or splice acceptor site, and any transcription and / or translation elements.

[0200] The present invention provides nucleic acid molecules, coding sequences, cassettes encoding immune effectors and engineered CAR Ts subject to the present disclosure, as well as methods, cells, uses, and compositions thereof. The terms "nucleic acid", "nucleic acid sequence", or "polynucleotide" and "nucleic acid molecule" refer to polymers of nucleotides, including, but not limited to, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), DNA / RNA hybrids containing polynucleotide chains of regularly and / or irregularly alternating deoxyribosyl and ribosyl moieties (i.e., alternating nucleotide units have --OH, then --H, then --OH, then --H, etc., at the 2' position of the sugar moiety), and modifications of these types of polynucleotides, including attachment of various entities or moieties to the nucleotide units at any position. The terms should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, as well as single-stranded (such as sense or antisense) and double-stranded polynucleotides, as applicable to the described embodiments. The preparation of nucleic acids is well known in the art. Still further, it should be understood that the present invention encompasses, as an additional aspect thereof, any vector or vehicle comprising any of the nucleic acid molecules of the present invention or any cassette described by the present invention.

[0201] Furthermore, in some embodiments, the nucleic acid molecules of the present invention or any cassette used by the present invention may be contained within a nucleic acid vector. In more specific embodiments, such a vector may be any one of a viral vector, a non-viral vector, and a naked DNA vector.

[0202] As used herein, a vector can incorporate a nucleic acid molecule of a specific sequence into a vehicle, and then introduce the vehicle into a host cell, thereby producing a transformed host cell. A vector can include a nucleic acid sequence, such as an origin of replication, that allows it to replicate in a host cell. A vector can also include one or more selectable marker genes and other genetic elements known in the art, including promoter elements that direct nucleic acid expression. Many vectors useful for transferring nucleic acids to target cells, such as plasmids, cosmids, minicircles, phages, viruses, etc., can be applied in the present invention. A vector containing a nucleic acid can be maintained episomally, for example, as a plasmid, minicircle DNA, virus such as cytomegalovirus, adenovirus, or can be integrated into a target cell genome through homologous recombination or random integration, for example, retrovirus-derived vectors such as AAV, MMLV, HIV-1, ALV, etc. A vector can be provided directly to a subject cell. In other words, the cell is contacted with a vector comprising a nucleic acid molecule and / or a cassette of the present invention comprising a nucleic acid sequence encoding an immune effector of interest and an engineered CAR T as disclosed herein, so that the vector is taken up by the cell. Methods for contacting a cell with a nucleic acid vector that is a plasmid, such as electroporation, calcium chloride transfection, and lipofection, are well known in the art. DNA can be introduced as naked nucleic acid, as a nucleic acid complexed with an agent such as liposome or poloxamer, or delivered by a virus (e.g., adenovirus, AAV). More specifically, in some embodiments, the vector can be a viral vector.Further, in some specific embodiments, such a viral vector can be any one of recombinant adeno associated vector (rAAV), single stranded AAV (ssAAV), self-complementary rAAV (scAAV), Simian vacuolating virus 40 (SV40) vector, adenovirus vector, helper-dependent adenovirus vector, retrovirus vector, and lentivirus vector. As indicated above, in some embodiments, a viral vector can be applicable in the present invention. The term "viral vector" refers to a replication-competent or replication-deficient viral particle that can transfer a nucleic acid molecule to a host. The term "virus" refers to any of the obligate intracellular parasites that do not have protein synthesis or energy generation mechanisms. The viral genome can be RNA or DNA containing a lipid membrane protein coating structure. Examples of viruses useful in the practice of the present invention include Baculoviridae, Parvoviridae, Picornaviridae, Herpesviridae, Poxviridae, Adenoviridae, and Picornaviridae. The term recombinant virus includes chimeric (or more multimeric) viruses, i.e., vectors constructed using complementary coding sequences from two or more viral subtypes.

[0203] In some embodiments, the nucleic acid molecules and / or cassettes of the present invention can be contained within a retroviral vector. Retroviral vectors as used herein consist of a proviral sequence that can accommodate the nucleic acid molecule encoding the engineered CAR T disclosed herein, allowing integration of both into the target cell. The vector can also contain a coding nucleic acid molecule encoding an immune effector of interest, and viral and cellular gene promoters that enhance the expression of the engineered CAR T disclosed herein in the target cell. Retroviral vectors are stably integrated into the target cell genome during division, so that the introduced gene is passed on and expressed in all daughter cells. They contain reverse transcriptase enzyme that allows integration into the host genome.

[0204] In some specific and non-limiting embodiments, the pMSGV1 retroviral vector is used in the CAR T molecules of the present disclosure. More specifically, the pMSGV1 retroviral vector contains the long terminal repeat and RNA processing signal of murine stem cell virus similar to the MFG class of retroviral vectors. The retroviral vector backbone used in the present disclosure, pMSGV1, utilizes the long terminal repeat (LTR) of murine stem cell virus (MSCV) [Hawley et al., Gene Ther. 1:136-138 (1994) and contains the extended gag region and env splice site from the vector SFGtcLuc+ITE4 [Lindemann et al., Mol. Med. 1997; 3:466-476 (1997)], a derivative of the vector pMSGV (MSCV-based splice-gag vector). The vector pMSGV was generated from pMINV by replacing the 756-bp SpeI / XhoI fragment with the 798-bp SpeI / XhoI fragment from SFGtcLuc+ITE4 and replacing the 1955-bp XhoI / BamH1 fragment containing the PGK-IRES-NEO cassette with a 47-bp XhoI / BamH1 polylinker containing unique XhoI, EcoRI, SalI, SacII, and BamH1 sites [Hawley et al., Ann. NY Acad. Sci. 795:341-345. (1996)]. The vector pMSGV1 was derived from pMSGV by replacing the 43-bp PmlI / XhoI fragment of pMSGV with a 76-bp PmlI / XhoI fragment from the vector Gcsap [Onodera et al., J. Virol. 72:1769-1774 (1998)]. The latter modification incorporates a naturally occurring Kozak sequence to enhance translation efficiency. In some alternative embodiments, the nucleic acid molecules and / or cassettes of the invention may be contained within an adeno-associated virus (AAV). The term "adenovirus" is synonymous with the term "adenoviral vector."AAV is a small (approximately 20 nm) protein-encapsulated, single-stranded DNA virus belonging to the Parvoviridae family, specifically referring to viruses of the genus Adenoviridae, which collectively refers to animal adenoviruses of the genus Mastadenovirus, including but not limited to human, bovine, ovine, equine, canine, porcine, murine, and simian Adenovirus subgenera. In particular, human adenoviruses include subgenera A through F, including, but not limited to, the individual serotypes thereof, as well as human adenovirus types 1, 2, 3, 4, 4a, 5, 6, 7, 8, 9, 10, 11 (AdllA and Ad IIP), 12, 13, 14, 15, 16, 17, 18, 19, 19a, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 34a, 35, 35p, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, and 91. Due to its inability to replicate in the absence of helper virus co-infection (typically adenovirus or herpesvirus infection), AAV is often referred to as a dependovirus. AAV infection produces only a mild immune response and is considered non-pathogenic, a fact also reflected by the reduced biosafety level requirements for research with recombinant AAV (rAAV) compared to other common viral vector systems. Due to its low immunogenicity and the absence of cytotoxic responses, AAV-based expression systems offer the possibility to express coding nucleic acid sequences encoding targeted immune effectors and engineered CAR Ts disclosed herein for several months in quiescent cells. rAAV vector production systems typically consist of DNA-based vectors containing a transgene expression cassette flanked by inverted terminal repeats. Construct size is limited to approximately 4.7-5.0 kb, corresponding to the length of the wild-type AAV genome. rAAV is produced in cell lines. The expression vector is co-transfected with a helper plasmid that mediates expression of the AAV rep gene, which is important for viral replication, and the cap gene, which encodes the proteins that form the capsid.Recombinant adeno-associated viral vectors can transduce dividing and non-dividing cells, and different rAAV serotypes can transduce a variety of cell types. These single-stranded DNA viral vectors have high transduction rates and the unique property of stimulating endogenous homologous recombination without causing double-stranded DNA breaks in the host genome.

[0205] It should be understood that many intermediate steps in the wild-type infection cycle of AAV depend on specific interactions between capsid proteins and infected cells. These interactions are important determinants of efficient transduction and expression of the coding nucleic acid molecules encoding targeted immune effectors and engineered CAR Ts disclosed herein when rAAV is used as a gene delivery tool. Indeed, significant differences in the transduction efficacy of various serotypes in certain tissues and cell types have been described.

[0206] The rate-limiting step of AAV-mediated expression of transgenes is believed to be the formation of double-stranded DNA. Recent reports have demonstrated the use of rAAV constructs with self-complementing structure (scAAV), in which the two halves of the single-stranded AAV genome can form intramolecular duplexes. This approach reduces the effective genome size available for gene delivery to about 2.3 kB, but results in a significantly shortened start of expression compared to conventional single-stranded AAV expression constructs (ssAAV). Thus, in some embodiments, ssAAV may be applicable as a viral vector by the method of the present invention.

[0207] In yet some further embodiments, HDAd vectors may be suitable for the CAR molecules, coding sequences, cells, compositions, and methods of the present disclosure. Helper-Dependent Adenoviral (HDAd) Vectors HDAd have innovative features, including the complete absence of viral coding sequences and the ability to mediate high levels of transgene expression with little chronic toxicity. HDAd are constructed by removing all viral sequences, except packaging sequences and inverted terminal repeats, from the adenoviral vector genome, thereby eliminating the problem of residual viral gene expression associated with early generation adenoviral vectors. HDAd can mediate highly efficient transduction, do not integrate into the host genome, and have a large cloning capacity of up to 37 kb, which allows the delivery of multiple transgenes or entire genomic loci, or large cis-acting elements to enhance or regulate tissue-specific transgene expression. One of the most attractive features of HDAd vectors is the long-term expression of transgenes. Still further, in some embodiments, SV40 can be used as a suitable vector by the methods of the present invention. SV40 vectors (SV40) are vectors derived from modifications that resulted in the icosahedral papovavirus to simian virus-40. Recombinant SV40 vectors are good candidates for gene transfer because they exhibit several unique features: SV40 is a well-known virus, the non-replicating vectors are easy to make, and can be produced at titers of 10 (12) IU / ml. They also efficiently transduce both quiescent and dividing cells, deliver persistent transgene expression to a wide range of cell types, and are non-immunogenic. Current drawbacks of rSV40 vectors for gene therapy are their small cloning capacity and possible risks associated with random integration of the viral genome into the host genome. In yet some alternative embodiments, lentiviral vectors may be used in the present invention. Lentiviral vectors are derived from lentiviruses, a subclass of retroviruses. Commonly used retroviral vectors are "defective," i.e., unable to produce viral proteins necessary for productive infection.Rather, replication of the vector requires growth in a packaging cell line. To generate viral particles containing the nucleic acid molecules, vectors, and / or cassettes according to the present invention, the retroviral nucleic acid containing the nucleic acid is packaged into a viral capsid by a packaging cell line. Different packaging cell lines provide different envelope proteins (ecotropic, amphotropic, or xenotropic) that are incorporated into the capsid, and this envelope protein determines the specificity of the viral particle to the cell (ecotropic for mouse and rat, amphotropic for most mammalian cell types including human, dog, and mouse, xenotropic for most mammalian cell types except mouse cells). Appropriate packaging cell lines can be used to ensure that the cell is targeted by the packaged viral particles. Methods for introducing retroviral vectors containing the nucleic acid molecules, vectors, and / or cassettes of the present invention containing the nucleic acid sequence encoding the CAT-T of the present invention into a packaging cell line, as well as methods for harvesting the viral particles produced by the packaging line, are well known in the art. Non-viral vectors, according to the present invention, refer to all physical and chemical systems except viral systems, and generally include either chemical methods such as cationic liposomes and polymers, or physical methods such as gene guns, electroporation, microprojectile bombardment, ultrasound, and magnetofection. Although the efficiency of this system is lower than that of viral systems in gene transduction, their cost-effectiveness, availability, and more importantly, reduced induction of the immune system, as well as the absence of size limitations of transgenic DNA compared to viral systems, make them attractive for gene delivery as well.

[0208] For example, physical methods applied in vitro and in vivo gene delivery are based on the transient permeabilization of cell membranes by mechanical, electrical, ultrasonic, hydrodynamic, or laser-based energy to facilitate DNA entry into targeted cells.

[0209] In a more specific embodiment, the vector can be a naked DNA vector. More specifically, such vectors can be, for example, plasmids, minicircles, or linear DNA. Naked DNA alone, when directly injected, can facilitate the transfer of genes (2-19 kb) into skin, thymus, cardiac muscle, and especially skeletal muscle and liver cells. It also allows long-term expression. Naked DNA injection is a safe and simple method, but the efficiency of gene delivery is very low.

[0210] Minicircles are modified plasmids in which the bacterial origin of replication (ori) has been removed, and therefore cannot replicate in bacteria. Linear DNA or Doggybone™ is a double-stranded linear DNA construct that encodes only the antigen expression cassette, including the antigen, promoter, polyA tail, and telomeric end. It should be understood that all DNA vectors disclosed herein may also be applicable to all nucleic acid molecules, vectors, and / or cassettes used in the methods and compositions of the present invention, as described herein. Still further, it should be understood that the present invention further provides any vector or vehicle comprising any of the nucleic acid molecules, vectors, and / or nucleic acid cassettes disclosed by the present invention, as well as any host cell expressing the nucleic acid molecules and / or nucleic acid cassettes disclosed by the present invention.

[0211] A further aspect of the present disclosure is a gene editing system comprising: First, (i) at least one nucleic acid molecule as defined by the present disclosure, or any cassette, vector, or vehicle comprising at least one nucleic acid molecule; Secondly, the present invention relates to a gene editing system comprising at least one gene editing component or a nucleic acid sequence encoding the gene editing component. In some specific embodiments, at least one nucleic acid molecule of the gene editing system provided by the present disclosure encodes at least one CAR molecule comprising the following components: (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA, and optionally (ii) at least one hinge and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence shown by SEQ ID NO: 9, and any fragments, derivatives, and variants thereof, and (iii) at least one intracellular T cell signaling domain. More specifically, this domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0212] As discussed herein, such a system further comprises any gene editing components discussed later herein that enable and facilitate the insertion of a nucleic acid sequence encoding any of the CAR molecules of the present disclosure into a target site within the genome of any target cell.

[0213] In some embodiments, the gene editing component of the gene editing system disclosed herein can be any one of a site-specific nuclease, a class switch recombination, a site-specific integrase, and a site-specific recombinase.

[0214] In some particular embodiments, the gene editing component useful in the systems of the present disclosure may be CRISPR / Cas.

[0215] More specifically, in some embodiments, the nucleic acid sequence encoding the CAR T (e.g., in a nucleic acid cassette) is inserted into the appropriate target genomic locus using a site-specific nuclease. The nuclease can be one of the following: CRISPR / Cas9 / Cpf1 / CTc(1 / 2 / 3), SpCas9, SaCas9, engineered CAS9, ZFN, TALEN, homing endonuclease, meganuclease, Mega-TALEN. The nuclease can be encoded on a DNA vector, such as a plasmid, minicircle, or viral vector. Alternatively, an mRNA encoding the nuclease can be delivered, or the nuclease can be delivered as a protein. A guide RNA, or a DNA vector encoding the guide RNA, can be provided. The integration catalyzed by the nuclease can utilize homology arms flanking the DNA to be inserted, or can utilize the recognition site of the site-specific nuclease, if one is encoded before and / or after the DNA to be inserted. Delivery of the nuclease, or a vector encoding the nuclease, can be performed in vivo or ex vivo using autologous or allogeneic cells, as discussed later herein.

[0216] As specified above, in some embodiments, nucleases useful for targeted insertion of a nucleic acid sequence encoding a desired CAR molecule disclosed herein may comprise at least one component of a CRISPR-Cas system. The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system is a bacterial immune system modified for genome manipulation. CRISPR-Cas systems are divided into two classes. Class 1 systems use a complex of multiple Cas proteins to degrade foreign nucleic acids. Class 2 systems use a single large Cas protein for the same purpose. More specifically, class 1 can be subdivided into types I, III, and IV, and class 2 can be subdivided into types II, V, and VI.

[0217] It should be understood that the present invention contemplates the use of any of the known CRISPR systems, particularly any of the CRISPR systems disclosed herein. CRISPR-Cas systems have evolved in prokaryotes to protect against phage attack and unwanted plasmid replication by targeting foreign DNA or RNA. In bacterial immunity, CRISPR-Cas systems target DNA molecules based on short homologous DNA sequences, called spacers, that have been previously extracted by bacteria from foreign pathogen sequences and inserted between repeats as a memory system. These spacers are transcribed and processed, and this RNA, named crRNA or guide-RNA (gRNA), guides CRISPR-associated (Cas) proteins to matching (and / or complementary) sequences in the foreign DNA, called protospacers, which are then cleaved. Spacers, or other suitable constructs, or RNAs, can be rationally designed and produced to target any DNA sequence. Furthermore, this recognition element can be separately designed to recognize and target any desired target, including outside the bacteria.

[0218] In some specific embodiments, the CRISPR-Cas protein used in the present disclosure may be of the CRISPR class 2 system. In some further specific embodiments, such class 2 system may be any one of the CRISPR type II and type V systems. In certain embodiments, the Cas applicable in the present invention may be any Cas protein of the CRISPR type II system. Type II CRISPR-Cas systems include the "HNH" type system (Streptococcus-like; also known as Nmeni subtype, Neisseria meningitidis serotype A str.Z2491, or CASS4), in which a single very large protein, Cas9, appears to be sufficient to generate crRNA and cleave target DNA, in addition to the ubiquitous Cas1 and Cas2. Cas9 contains at least two nuclease domains, a RuvC-like nuclease domain near the amino terminus, and an HNH (or McrA-like) nuclease domain in the middle of the protein. It should be understood that any type II CRISPR-Cas system, specifically any one of type II-A or type II-B, can be applicable in the present invention.Thus, in some further and alternative embodiments, the at least one cas gene used in the method and system of the present invention can be at least one cas gene of type II CRISPR system (either type II-A or type II-B).In more particular embodiments, the at least one cas gene of type II CRISPR system used by the method and system of the present invention can be cas9 gene.

[0219] According to such an embodiment, the CRISPR-Cas protein used in the system of the present invention is CRISPR-associated endonuclease 9 (Cas9). Double-stranded DNA (dsDNA) cleavage by Cas9 is a hallmark of the "type II CRISPR-Cas" immune system. The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA:DNA complementary to the target site (protospacer). After the recognition between Cas9 and the target sequence, double-stranded DNA (dsDNA) cleavage occurs, creating a double strand break (DSB).

[0220] The CRISPR type II system as used herein requires the inclusion of two essential components: a "guide" RNA (gRNA) and a CRISPR-associated endonuclease (Cas9). A gRNA is an RNA molecule composed of a "scaffold" sequence (also named tracrRNA) required for Cas9 binding and a "spacer" or "targeting" sequence of about 20 nucleotides in length that defines the genomic target to be modified. Guide RNA (gRNA), as used herein, refers to the annealing of a synthetic or, alternatively, endogenous tracrRNA and a targeting sequence (also named crRNA) that provides both scaffold / binding capacity and target specificity for the Cas9 nuclease. Also referred to as a "single guide RNA" or "sgRNA" or specificity conferring nucleic acid (SCNA).

[0221] In some further specific embodiments, the class 2 system according to the present invention can be a CRISPR V-type system. In more specific embodiments, the RNA-guided DNA-binding protein nuclease can be a CRISPR-associated endonuclease X (CasX) system, or a CRISPR-associated endonuclease 14 (Cas14) system, or a CRISPR-associated endonuclease F (CasF, also known as Cas12j) system. The V-type CRISPR-Cas system is distinguished by a single RNA-guided RuvC domain-containing nuclease. Similar to the II-type CRISPR-Cas system, the CRISPR V-type system used herein requires the inclusion of two essential components: gRNA and CRISPR-associated endonuclease (CasX / Cas14 / CasF). gRNAs are short synthetic RNAs composed of a "scaffold" sequence required for CasX / Cas14 / CasF binding and a roughly 20 nucleotide long "spacer" or "targeting" sequence that defines the genomic target to be modified.

[0222] It should be noted that gRNAs as used herein can contain from about 3 nucleotides to about 100 nucleotides, specifically, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides, and more specifically, from about 10 nucleotides to 70 or more nucleotides.

[0223] It should be noted that in some embodiments of the present disclosure, any CRISPR / Cas protein may be used by the gene editing system of the present disclosure, and the endonuclease may be selected from the group consisting of Cas9, CasX, Cas12, Cas13, Cas14, Cas6, Cpf1, CMS1 proteins, or the endonucleases of Methanococcus maripaludis C7, Corynebacterium diphtheria, Corynebacterium efficiens YS-314, Corynebacterium glutamicum (ATCC 13032), Corynebacterium glutamicum R, Corynebacterium kroppenstedtii (DSM 44385), Mycobacterium abscessus (ATCC 19977), Nocardia farcinica IFM10152, Rhodococcus erythropolis PR4, Rhodococcus jostii RFIA1, Rhodococcus opacus B4(uid36573), Acidothermus cellulolyticus 11B, Arthrobacter chlorophenolicus A6, Kribbella flavida(DSM 17836), Thermomonospora curvata(DSM43183), Bifidobacterium dentium Bd1, Bifidobacterium longum DJO10A, Slackia heliotrinireducens (DSM 20476), Persephonella marina EX H 1, Bacteroides fragilis NCTC 9434, Capnocytophaga ochracea (DSM 7271), Flavobacterium psychrophilum JIP02 86, Akkermansia muciniphila (ATCC BAA 835), Roseiflexus castenholzii (DSM 13941), Roseiflexus RS1, SynechocystisPCC6803、Elusimicrobium minutum Pei191、uncultured Termite group 1 bacterium phylotype Rs D17、Fibrobacter succinogenes S85、Bacillus cereus(ATCC 10987)、Listeria innocua、Lactobacillus casei、Lactobacillus rhamnosus GG、Lactobacillus salivarius UCC118、Streptococcus agalactiae-5-A909、Streptococcus agalactiae NEM316、Streptococcus agalactiae 2603、Streptococcus dysgalactiae equisimilis GGS124、Streptococcus equi zooepidemicus MGCS10565、Streptococcus gallolyticus UCN34(uid46061)、Streptococcus gordonii Challis subst CH1、Streptococcus mutans NN2025(uid46353)、Streptococcus mutans、Streptococcus pyogenes M1 GAS、Streptococcus pyogenes MGAS5005、Streptococcus pyogenes MGAS2096、Streptococcus pyogenes MGAS9429、Streptococcus pyogenes MGAS10270、Streptococcus pyogenes MGAS6180、Streptococcus pyogenes MGAS315、Streptococcus pyogenes SSI-1、Streptococcus pyogenes MGAS10750、Streptococcus pyogenes NZ131、Streptococcus thermophiles CNRZ1066、Streptococcus thermophiles LMD-9、Streptococcus thermophiles LMG18311, Clostridium botulinum A3 Loch Maree, Clostridium botulinum B Eklund 17B, Clostridium botulinum Ba4 657, Clostridium botulinum F Langeland, Clostridium cellulolyticum H10, Finegoldia magna (ATCC 29328), Eubacterium rectale (ATCC 33656), Mycoplasma gallisepticum, Mycoplasma mobile 163K, Mycoplasma penetrans, Mycoplasma synoviae 53, Streptobacillus, moniliformis (DSM 12112), Bradyrhizobium BTAil, Nitrobacter hamburgensis X14, Rhodopseudomonas palustris BisB18, Rhodopseudomonas palustris BisB5, Parvibaculum lavamentivorans DS-1, Dinoroseobacter shibae.DFL 12, Gluconacetobacter diazotrophicus Pal 5 FAPERJ, Gluconacetobacter diazotrophicus Pal 5 JGI, Azospirillum B510 (uid46085), Rhodospirillum rubrum (ATCC 11170), Diaphorobacter TPSY (uid29975), Verminephrobacter eiseniae EF01 -2, Neisseria meningitides 053442, Neisseria meningitides alpha14, Neisseria meningitides Z2491, Desulfovibrio salexigens DSM 2638, Campylobacter jejuni doylei 269 97, Campylobacter jejuni 81116, Campylobacter jejuni, Campylobacter lariRM2100, Helicobacter hepaticus, Wolinella succinogenes, Tolumonas auensis DSM 9187, Pseudoalteromonas atlantica T6c, Shewanella pealeana (ATCC 700345), Legionella pneumophila Paris, Actinobacillus succinogenes 130Z, Pasteurella multocida, Francisella tularensis novicida U 112, Francisella tularensis holarctica, Francisella tularensis FSC 198, Francisella tularensis, Francisella tularensis WY96- 3418, or Treponema denticola (ATCC 35405), or any variant thereof expressed therefrom.

[0224] In some embodiments, the nucleic acid sequence encoding the CAR T (e.g., in a nucleic acid cassette) is inserted into the appropriate genomic locus using a site-specific recombinase / integrase. The recombinase / integrase can be one of the following: PhiC31, HK022, Cre, Flp, etc. The recombinase / integrase can be encoded on a DNA vector, such as a plasmid, minicircle, or viral vector. Alternatively, an mRNA encoding the recombinase / integrase can be delivered, or the recombinase / integrase can be delivered as a protein. Delivery of the nuclease, or the vector encoding the recombinase / integrase, can be performed in vivo or ex vivo using autologous or allogeneic cells.

[0225] Further aspects of the present disclosure relate to genetically engineered cells of a T cell lineage expressing at least one CAR molecule, or any population of cells comprising at least one genetically modified cell disclosed herein. More specifically, in some embodiments, the CAR expressed by the engineered cells comprises the following components: first, (i) at least one target binding domain. It should be noted that at least one of the target binding domains specifically recognizes and binds BCMA. The second component (ii) is at least one hinge and at least one transmembrane domain derived from the CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence represented by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises, as a third component (iii), at least one intracellular T cell signaling domain. More specifically, this domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0226] In some embodiments, the present disclosure provides any engineered cell that expresses any of the CAR molecules defined by the present disclosure.

[0227] In some embodiments, the genetically engineered cells of the present disclosure can be any hematopoietic cell. In some embodiments, such cells can be any lymphocyte. In some further embodiments, such cells can be any cell of the T lineage. In some specific embodiments, such cells are at least one T cell and / or at least one NK T cell.

[0228] As shown in this aspect, the invention provides engineered cells that can be any lymphocyte, specifically any lymphocyte of the T lineage. "Lymphocytes" are mononuclear non-phagocytic white blood cells found in blood, lymph, and lymphoid tissues. They are subdivided into two classes, B and T lymphocytes, based on ontogeny and function, responsible for humoral and cellular immunity, respectively. Most are small lymphocytes, 7-10 μm in diameter, with a round or slightly depressed heterochromatic nucleus that nearly fills the entire cell, and a thin rim of basophilic cytoplasm that contains few granules. When "activated" by contact with an antigen, small lymphocytes begin macromolecular synthesis, the cytoplasm expands until the cell is 10-30 μm in diameter, the nucleus becomes completely non-heterochromatic, and they are then referred to as large lymphocytes or lymphoblasts. These cells then proliferate and differentiate into B and T memory cells and into various effector cell types: B cells into plasma cells, T cells into helper, cytotoxic, and suppressor cells.

[0229] As demonstrated by this disclosure, the engineered cells expressing the CAR molecules disclosed herein can be cells of the T lineage. As used herein, "T cells" or "T lymphocytes" are characterized by the presence of a T cell receptor (TCR) on the cell surface. It should be noted that T cells include helper T cells ("effector T cells" or "Th cells"), cytotoxic T cells ("Tc", "CTL", or "killer T cells"), memory T cells, and regulatory T cells, as well as natural killer T cells, mucosal associated invariant, and gamma delta T cells.

[0230] More specifically, thymocytes are hematopoietic precursor cells present in the thymus. Thymopoiesis is the process in the thymus where thymocytes differentiate into mature T lymphocytes. The thymus provides an inductive environment that allows the development and selection of physiologically useful T cells. The processes of beta selection, positive selection, and negative selection shape the population of thymocytes into a peripheral pool of T cells that can respond to foreign pathogens and are immunologically tolerant to self-antigens.

[0231] Thymocytes are classified into several distinct stages of maturation based on the expression of cell surface markers. The earliest thymocyte stage is the double negative (DN) stage (negative for both CD4 and CD8), which has more recently been better described as lineage negative and can be subdivided into four substages. The next major stage is the double positive (DP) stage (positive for both CD4 and CD8). The final stage of maturation is the single positive (SP) stage (positive for either CD4 or CD8).

[0232] More specifically, the maturation stages of thymocytes may include the following substages: Double negative 1 (DN1) or ETP (Early T lineage progenitor), characterized by CD44+CD25-CD117+ defining surface markers, thymocytes are located in the cortex and loss of proliferation, B and myeloid potential is observed; Double negative 2 (DN2) characterized by CD44+CD25+CD117+ defining surface markers, thymocytes are located in the cortex; Double negative 3 (DN3) characterized by CD44-CD25+ defining surface markers, thymocytes are located in the cortex and TCR-beta rearrangement and beta selection are observed; Double negative 4 (DN5) characterized by CD44-CD25+ defining surface markers, thymocytes are located in the cortex and TCR-beta rearrangement and beta selection are observed; 4, DN4) are characterized by surface markers defining CD44-CD25-, thymocytes are located in the cortex, double positives are characterized by surface markers defining CD4+CD8+, thymocytes are located in the cortex and TCR-alpha rearrangement, positive selection, negative selection is observed, single positives are characterized by surface markers defining CD4+CD8- or CD4-CD8+, thymocytes are located in the medulla and negative selection is observed.

[0233] In humans, circulating CD34+ hematopoietic stem cells (HSCs) reside in the bone marrow. They produce precursors of T lymphocytes, which seed the thymus (thus becoming thymocytes) and differentiate under the influence of Notch and its ligands. Early double negative thymocytes express (and can be identified by) CD2, CD5, and CD7. While still in the double negative stage, CD34 expression ceases and CD1 is expressed. Expression of both CD4 and CD8 makes them double positive and matures into either CD4+ or CD8+ cells. It should be understood that the cells of the T lineage disclosed herein can be any of the thymocytes disclosed herein at any stage / substage and / or expressing any of the disclosed markers.

[0234] In some embodiments of the invention, the host cell is a T cell. For purposes herein, a T cell can be any T cell, such as a cultured T cell (e.g., primary T cell), or a T cell from a cultured T cell line (e.g., Jurkat, SupT1, etc.), or a T cell obtained from a mammal. If obtained from a mammal, the T cell can be obtained from a number of sources, including, but not limited to, blood, bone marrow, lymph nodes, thymus, or other tissues or fluids. The T cells can also be enriched or purified. The T cell can be a human T cell. The T cell can be a T cell isolated from a human. The T cell can be any type of T cell and can be at any stage of development, including, but not limited to, CD4.sup.+ / CD8.sup.+ double positive T cells, CD4+ helper T cells (e.g., Th.sub.1 and Th.sub.2 cells), CD8.sup.+ T cells (e.g., cytotoxic T cells), tumor infiltrating cells, memory T cells, naive T cells, and the like. The T cells can be CD8.sup.+ T cells or CD4.sup.+ T cells.

[0235] In one embodiment of the present invention, the host cell is a natural killer (NK) cell. NK cells are a type of cytotoxic lymphocyte that plays a role in the innate immune system. NK cells are defined as large granular lymphocytes and constitute the third type of cell differentiated from a common lymphocyte precursor that also gives rise to B and T lymphocytes. NK cells differentiate and mature in the bone marrow, lymph nodes, spleen, tonsils, and thymus. After maturation, NK cells enter the circulation as large lymphocytes with unique cytotoxic granules. NK cells can recognize and kill some abnormal cells, such as some tumor cells and virus-infected cells, and are believed to be important in the innate immune defense against intracellular pathogens. As described above with respect to T cells, the NK cells can be any NK cell, such as cultured NK cells (e.g., primary NK cells), or NK cells from a cultured NK cell line, or NK cells obtained from a mammal. If obtained from a mammal, the NK cells can be obtained from a number of sources, including, but not limited to, blood, bone marrow, lymph nodes, thymus, or other tissues or fluids. The NK cells can also be enriched or purified. The NK cells are preferably human NK cells (e.g., isolated from a human).

[0236] Still further, in some alternative embodiments, the engineered cells may be of the B lineage. Also provided by embodiments of the present invention are populations of cells that include at least one host cell, e.g., of the T lineage, as described herein. The population of cells may be a heterogeneous population that includes host cells that include and / or are engineered with any of the nucleic acid sequences, cassettes, vectors, and gene editing systems described herein, in addition to at least one other cell, e.g., a host cell (e.g., a T cell), that does not include any of the recombinant expression vectors, or cells other than T cells, e.g., B cells, macrophages, neutrophils, erythrocytes, hepatocytes, endothelial cells, epithelial cells, muscle cells, brain cells, etc. Alternatively, the population of cells may be a substantially homogenous population, where the population primarily includes host cells that include (e.g., consist essentially of) the recombinant expression vector, cassette, gene editing system. The population may also be a clonal population of cells, where all cells of the population include the recombinant expression vector, and therefore all cells of the population may be clones of a single host cell that includes the recombinant expression vector. In one embodiment of the invention, the population of cells is a clonal population that comprises gene-edited host cells and / or comprises the nucleic acid sequences, cassettes, and vectors described herein.

[0237] The present disclosure provides cells, particularly of the T lineage, that have been genetically engineered to express the CAR T molecules disclosed herein. However, it should be noted that the present disclosure also encompasses any host cell that contains, is transfected with, is transformed with, and / or is engineered with, and / or is edited with, a nucleic acid sequence, cassette, or vector disclosed herein.

[0238] The term "host cell" includes a cell into which a heterologous (e.g., exogenous) nucleic acid or protein has been introduced. Those skilled in the art upon reading this disclosure will understand that such terms are used to refer not only to a particular subject cell, but also to the progeny of such a cell. Because certain modifications may occur in successive generations, either due to mutations or environmental influences, such progeny may not in fact be identical to the parent cell, but are still included within the scope of the term "host cell". As used herein, a cell is "transformed" or "transfected" by exogenous or heterologous DNA, such as a nucleic acid molecule of the present invention, or any cassette, vector, and / or gene editing system of the present invention, when such DNA is introduced into the cell. The transforming DNA may be integrated (covalently linked) into the genome of the cell. In the context of the present invention, a stably transformed cell is one in which the transforming DNA is integrated into a chromosome such that the transforming DNA is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of a eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. It should be understood that in some embodiments the host cells of the invention can be any engineered T cell of the invention, or any population of cells at least partially comprising the T cells of the invention. Still further, the invention further encompasses any population of cells comprising at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99.9% or more, particularly 100%, particularly 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99.9% or more, particularly 100% host cells, particularly engineered T cells of the invention.

[0239] A further aspect of the present disclosure relates to a composition comprising at least one CAR molecule, any nucleic acid molecule comprising at least one nucleic acid sequence encoding the CAR molecule, or any cassette, vector, vehicle, or gene editing system comprising a nucleic acid molecule, any host cell expressing the CAR molecule, and / or any genetically engineered cell of T lineage expressing the CAR, or a population of cells comprising at least one genetically engineered cell of T lineage. More specifically, such a CAR molecule comprises the following components: First, (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA. Second component (ii), at least one hinge and / or at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence depicted by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises, as a third component (iii), at least one intracellular T cell signaling domain. More specifically, the domain comprises at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule.

[0240] It should be noted that the compositions of the present disclosure, according to optional embodiments, further comprise at least one of a pharma- ceutically acceptable carrier, diluent, excipient, and additive.

[0241] It should be further understood that in some embodiments, the compositions of the present invention may comprise any of the CAR molecules defined by the present disclosure. In some alternative or additional embodiments, the compositions disclosed herein may comprise any of the nucleic acid molecules defined by the present disclosure. In some further alternative or additional embodiments, the compositions disclosed herein may comprise any of the gene editing systems defined by the present disclosure. In some further alternative or additional embodiments, the compositions disclosed herein may comprise any of the cells or populations of cells defined by the present disclosure.

[0242] The compositions of the present invention may comprise an effective amount of the nucleic acid molecule, and / or cassette thereof, or any vector thereof, or any cell comprising it, or any CAR T molecule described by the present invention. The term "effective amount" refers to the amount of active agent, specifically the nucleic acid molecule, vector, and / or cassette of the present invention described herein, present in the composition required to provide a desired level of the active agent in the bloodstream or at the site of action (e.g., thymus or bone marrow) of the individual to be treated to give the physiological response expected to which such composition is administered. The exact amount depends on a number of factors, such as the active agent, the activity of the composition, the delivery device used, the physical characteristics of the composition, the intended patient use (i.e., the number of doses administered per day), patient considerations, etc., and can be readily determined by one of skill in the art based on the information provided herein. An "effective amount" of the engineered CAR T cells disclosed herein, or any nucleic acid molecule of the present invention, or any cassette of the present invention, and its gene editing system, may be administered in a single administration or through multiple administrations of an amount that totals an effective amount, preferably within a 24-hour period. An effective amount can be determined using standard clinical procedures to determine the appropriate amount and timing of administration. It is understood that an "effective amount" may be the result of empirical and / or individualized (case-by-case) determinations on the part of the treating medical professional and / or individual. Still further, administration and dosage will be determined by good medical practice of the attending physician and may depend on the age, sex, weight, and general condition of the subject in need.

[0243] It should be understood that the effective amounts discussed herein are applicable to any and all embodiments of any and all aspects of the present disclosure, in particular any of the CAR molecules, CAR T cells expressing a CAR molecule of the present disclosure, and / or any nucleic acid sequence encoding a disclosed CAR molecule, any construct or ene editing system comprising same, any dosage form thereof, dosage unit form thereof, compositions, kits, uses, and methods thereof.

[0244] In some embodiments, the active ingredient of the therapeutic compositions and / or dosage forms disclosed herein are T cells genetically engineered to express the HBI101 CAR molecule of the present disclosure (also designated herein as H8BB CAR molecule). Various effective amounts of these cells were used, as shown in the clinical studies disclosed herein. In some embodiments, an effective amount of HBI101 CAR T cells is about 50×10 6 ~ approx. 1500 x 10 cells 6 cells, specifically, 50 × 10 6 , 60×10 6 , 70×10 6 , 80×10 6 , 90×10 6 , 100×10 6 , 110×10 6 , 120×10 6 , 130×10 6 , 140×10 6 , 150×10 6 , 160×10 6 , 170×10 6 , 180×10 6 , 190×10 6 , 200×10 6 , 210×10 6 , 220×10 6 , 230×10 6 , 240×10 6 , 250×10 6 , 260×10 6 , 270×10 6 , 280×10 6 , 290×10 6 , 300×10 6 , 310×10 6 , 320×10 6 , 330×10 6 , 340×10 6 , 350×10 6 , 360×10 6 , 370×10 6 , 380×10 6 , 390×10 6 , 400×10 6 , 410×10 6 , 420×10 6 , 430×106 , 440×10 6 , 450×10 6 , 460×10 6 , 470×10 6 , 480×10 6 , 490×10 6 , 500×10 6 , 510×10 6 , 520×10 6 , 530×10 6 , 540×10 6 , 550×10 6 , 600×10 6 , 650×10 6 , 700×10 6 , 750×10 6 , 800×10 6 , 850×10 6 , 900×10 6 , 950×10 6 , 1000×10 6 , 1050×10 6 , 1100×10 6 , 1150×10 6 , 1200×10 6 , 1250×10 6 , 1300×10 6 , 1350×10 6 , 1400×10 6 , 1450×10 6 , 1500×10 6 More specifically, the amount and / or number of HBI101 CAR T cells can range from about 100×10 6 ~About 1000×10 6 , about 90×10 6 ~About 900×10 6 , about 150×10 6 ~About 800×10 6 Furthermore, in some embodiments, the effective amount and / or number of cells may range from 800×10 per dose. 6 In yet some other embodiments, the effective amount and / or number of cells is 450×10 per dose. 6HBI101 CAR T cells. Still further, in some embodiments, the effective amount and / or number of cells is 150×10 per dose. 6 HBI101 CAR T cells. Still further, in some embodiments, the effective amount and / or number of cells is about 0.5×10 6 ~About 50×10 6 The range may be from about 1 to about 40, about 2 x 10 HBI101 CAR T cells / Kg of body weight. 6 ~Approx. 30×10 6 , about 2×10 6 ~Approx. 25×10 6 , about 2×10 6 ~About 20×10 6 , about 2×10 6 ~Approx. 15×10 6 , about 2×10 6 ~Approx. 14×10 6 , about 2×10 6 ~Approx. 13×10 6 , about 2×10 6 ~Approx. 12×10 6 , about 2×10 6 ~Approx. 11×10 6 , about 2×10 6 ~About 10×10 6 HBI101 CAR T cells / Kg body weight. In some specific and non-limiting embodiments, the effective amount of cells is 11×10 6 HBI101 CAR T cells / Kg body weight. In some other specific and non-limiting embodiments, the effective amount of cells is 10×10 6 HBI101 CAR T cells / Kg of body weight. Still further, in some embodiments, the effective amount is 12×10 6 Furthermore, as demonstrated by the clinical data disclosed herein, in some embodiments, 800×10 6provides a clear increase in efficacy without affecting toxicity. More specifically, as shown by Figure 34, about 58% of patients showed a complete response, OS was about 95% (study day 380), and PFS was about 70%. These results showed improved efficacy, especially when compared to prior art CAR T derived from C11D5-3 anti-BCMA antibody (e.g., References [2], [5], and

[10] ), which uses lower doses of cells showing reduced efficacy. Thus, in some embodiments, the effective amount used herein is 800 x 10 6 This refers to the daily dose.

[0245] The pharmaceutical compositions of the present invention can be administered and dosed systemically, e.g., parenterally, e.g., intrathymic, intramedullary and intravenous, in accordance with good medical practice, by the methods of the present invention. However, it should be noted that the present invention can further include additional modes of administration. In other examples, the pharmaceutical compositions can be introduced to the site by any suitable route, including intraperitoneal, subcutaneous, transdermal, topical, intramuscular, intraarticular, subconjunctival, or mucosal, e.g., oral, intranasal, or intraocular, administration.

[0246] Local administration to the area requiring treatment can be achieved, for example, by local injection during surgery, topical application, direct injection into a particular organ (bone marrow, spleen, lymph nodes), etc. More specifically, the compositions used in any of the methods of the invention described herein can be adapted for administration parenterally, intraperitoneally, transdermally, orally (including buccal or sublingual), rectally, topically (including buccal or sublingual), vaginally, intranasally, and by any other suitable route. Such formulations can be prepared by any method known in the art of pharmacy, for example, by bringing the active ingredient into association with the carrier or excipient.

[0247] More specifically, pharmaceutical compositions according to the present invention used for treating subjects in need of treatment, which can be conveniently presented in unit dosage form, can be prepared according to prior art well known in the pharmaceutical industry. Such techniques include the step of bringing the active ingredient into association with a pharma- ceutically acceptable carrier or excipient. In general, the formulation is prepared by uniformly and intimately bringing the active ingredient, specifically the CAR T of the present invention, nucleic acid molecule or any cassette thereof, into association with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. The composition can be formulated into any of many possible dosage forms, including, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The composition of the present invention can also be formulated as a suspension in aqueous, non-aqueous, or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, such as, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension may contain a stabilizer. Pharmaceutical compositions of the present invention also include, but are not limited to, emulsions and liposome-containing formulations. In addition to the components specifically mentioned above, it should be understood that the formulation may also include other agents standard in the art considering the type of formulation in question. Still further, a pharmaceutical preparation is a composition that includes one or more of the nucleic acid molecules, vectors, and / or cassettes, and / or cells in a pharmaceutically acceptable vehicle. A "pharmaceutically acceptable vehicle" may be a vehicle approved by a federal or state regulatory agency, or a vehicle listed in the United States Pharmacopoeia or other generally recognized pharmacopoeias for use in mammals, such as humans. The term "vehicle" when referring to a composition in this embodiment refers to a diluent, adjuvant, excipient, or carrier with which the compound of the present invention is formulated for administration to a mammal. Such pharmaceutical vehicles can be lipids, e.g., liposomes, e.g., liposomal dendrimers; liquids such as water, as well as oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, saline; gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like.In addition, auxiliary agents, stabilizers, thickeners, lubricants and coloring agents may be used. The pharmaceutical composition can be formulated into preparations in solid, semi-solid, liquid or gas form, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres and aerosols. Thus, administration of the nucleic acid molecules encoding any engineered cells of the CAR or T lineage of the present invention and the system of the present invention can be accomplished in various ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, intratracheal, etc. The active agent may be systemic after administration or may be localized by using topical administration, intramural administration, or the use of an implant that acts to retain the active dose at the implantation site. The active agent may be formulated for immediate activity or for sustained release.

[0248] In many embodiments, the compositions of the present invention can be administered in the form of combination therapy, i.e., in combination with one or more additional therapeutic agents. Combination therapy can include administration of a single pharmaceutical dosage formulation that includes at least one composition of the present invention and an additional therapeutic agent; as well as administration of at least one composition of the present invention and one or more additional agents in their own separate pharmaceutical dosage formulations. Furthermore, when separate dosage formulations are used, the compositions of the present invention and one or more additional agents can be administered simultaneously or separately at a staggered time, i.e., sequentially. Furthermore, simultaneous or separate administration can be carried out by the same or different administration routes. Thus, in some further embodiments, the CAR T molecules, nucleic acid sequences, cassettes, systems, and cells of the present disclosure can be applicable to boost the immune response of subjects suffering from immune-related disorders, particularly any disorder involving B cells, or B cell malignancies, and can be used in combination therapy with any therapeutic agent, e.g., chemotherapeutic agents.

[0249] As used herein, "chemotherapeutic agent" or "chemotherapeutic drug" (also referred to as chemotherapy) refers to drug treatments intended to eliminate or destroy (kill) cancer cells or cells of any other proliferative disorder. The mechanism underlying the activity of some chemotherapeutic agents is based on destroying rapidly dividing cells, since many cancer cells grow and multiply more rapidly than normal cells. As a result of their mode of activity, chemotherapeutic agents also harm cells that divide rapidly under normal circumstances, such as bone marrow cells, gastrointestinal cells, and hair follicles. Injury or damage to normal cells results in common side effects of chemotherapy: myelosuppression (reduced production of blood cells, and therefore also immunosuppression), mucositis (inflammation of the lining of the gastrointestinal tract), and alopecia (hair loss).

[0250] A variety of different types of chemotherapy drugs are available. Chemotherapeutic drugs can be used alone or in addition to the CAR T of the present disclosure in combination with another chemotherapy drug or other forms of cancer therapy, such as other biological drugs (antibodies, ligands, receptors), radiation therapy, or surgery.

[0251] Chemotherapeutic drugs affect cell division or DNA synthesis and function, and can generally be classified into several groups based on their structure or biological function. More specifically, chemotherapeutic drugs are classified into alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumor agents, such as DNA alkylating agents, antitumor antibiotic agents, tubulin stabilizers, tubulin destabilizers, hormone antagonists, protein kinase inhibitors, HMG-CoA inhibitors, CDK inhibitors, cyclin inhibitors, caspase inhibitors, metalloproteinase inhibitors, antisense nucleic acids, triple helix DNA, nucleic acid aptamers, and molecularly modified viruses, bacteria, or exotoxins. It should be understood that any combination therapy disclosed herein using any of the compounds shown with the CAR T, DNA cassette, system, and cells of the present disclosure together with any of the therapeutic agents discussed above is encompassed by the present disclosure.

[0252] Still further, in some embodiments, constructs encoding the disclosed CAR molecules of the present disclosure, also referred to herein as HBI0101 (prepared in clinical grade), can be generated by transiently transfecting Phoenix-ECO cells (ATCC) with a plasmid encoding the gamma-retroviral vector MSGV1-HBI0101 using JetPrime reagent (Tamar), and then transducing PG13 cells (ATCC) with the HBI0101-Phoenix-ECO cell-free vector supernatant. The PG13 transduced population was then subcloned by limiting dilution to expand PG13-HBI0101 to generate a seed bank. The certified PG13 seed bank was sent to the Indiana University Vector Production Facility (IU-VPF) in Indianapolis, which generated the Master Cell Bank (MCB) and GMP-certified HBI0101 clinical grade retroviral supernatant for the transduction of autologous T cells of MM patients.

[0253] Still further, for ex vivo transduction of cells, peripheral blood mononuclear cells were isolated from the blood of subjects (e.g., AL and / or multiple myeloma patients) and used for further production of CD3-activated peripheral blood mononuclear cells. Blood was collected from patients with AL and / or multiple myeloma (0253-20-HMO) and processed, e.g., using a Ficoll gradient, to isolate peripheral blood mononuclear cells (PBMCs). PBMCs were cultured at 1×10 per mL in T cell medium (e.g., TCM) containing AIM-V (Gibco) supplemented with 5% human serum (Valley), 1% Glutamax (Gibco). 6The retroviral supernatant was thawed, diluted 1:20 in TCM, added to the wells, and centrifuged at 2000g for 2 hours at 32°C. The supernatant was then aspirated and 0.5×10 cells were cultured in 100% TCM for 2 days. IL2 (e.g., 300 IU / mL; e.g., Proleukin, Novartis) and anti-CD3 monoclonal antibody OKT-3 (e.g., 50 ng / mL; Miltenyi Biotech) were added to TCM and cultured for 2 days. Non-tissue culture treated 24-well plates were coated with 10 mg / mL RectroNectin (e.g., R / N; Takara) in PBS (e.g., Lonza) overnight at 4°C, followed by blocking with 2.5% human albumin in PBS for 30 minutes and then washed. The retroviral supernatant was thawed, diluted 1:20 in TCM, added to the wells, and centrifuged at 2000g for 2 hours at 32°C. The supernatant was then aspirated and 0.5×10 cells were cultured in 100% TCM for 2 days. 6 CD3-activated PBMCs / mL were seeded into each well in TCM containing 300 IU / mL IL2, centrifuged at 1,000g for 10 min, and incubated overnight at 37°C. Activated but non-transduced (NT) cells were generated and used as T cell controls. Transduction efficacy was determined on days 6 and 10 of culture via flow cytometry by labeling BCMA CAR T cells with human recombinant BCMA protein (e.g., Active; ACRO).

[0254] Furthermore, in some embodiments, clinical grade production of HBI0101 cells can use the same protocols described above for production of cells for ex vivo applications. Modifications have been made in the source of starting material, use of clinical grade media and reagents, and production under GMP conditions to generate CART cells suitable for the clinic.

[0255] More specifically, in some embodiments, leukocytes are collected on day -10 by leukapheresis using a Spectra Optia apheresis system. Cells are separated into peripheral mononuclear cells (e.g., PBMCS) and T cells are stimulated using anti-CD3 and IL-2. On day -8, T cells stimulated with 1 / 25 or 1 / 50 diluted HBI0101 retroviral supernatant are transduced overnight. Cells are then seeded into GRex100 devices filled with AIM-V medium (e.g., Gibco) supplemented with 5% human AB serum (e.g., Access Cell Culture or Valley), 1% Glutamax (Gibco), and 300 IU / mL IL-2 and expanded for 7 days. In some embodiments, medium and IL-2 supplementation is performed every 2-3 days. On the day of patient infusion, cells were washed three times with saline containing 1% human albumin (Kedrion) and then cultured at 15 × 10 6 The final drug product (DP) was formulated at a concentration of CART cells / mL. The DP injection volume was varied according to the cell dose.

[0256] Still further, in some embodiments, quality control testing of in-process (IP) and end-of-process (EOP) HBI0101 cells is performed along the manufacturing process. In some embodiments, quality control testing includes: i) determination of percent transduction assessed by flow cytometry using BCMA-FITC recombinant protein (e.g., ACROBiosystems) and performed on day -7, day -2, and day 0; ii) in vitro efficacy of CART cells assessed by release of interferon-γ by ELISA (R&D) after stimulation with a myeloma cell line and performed on day -2; iii) determination of vector copy number (CPN) on day -2 by real-time (RT) PCR of genomic DNA of transduced cells; iv) confirmation of absence of replication-competent retrovirus (RCR) on day -2 by PCR analysis of genomic DNA of transduced cells using GALV primer set as detailed in 3; v) following anti-CD3 (e.g., Beckman vi) characterization of different cell subsets by flow cytometry on day 0 using an antibody mixture such as anti-CD4 (e.g., Biolegend), anti-CD8 (e.g., BD), anti-CD56 (e.g., Biolegend), anti-CD19 (e.g., Biolegend), and anti-CD14 (e.g., Beckman Coulter); vi) evaluating the pH of the DP on day 0. All tested parameters represent the release criteria of the final DP, the specifications of which are further detailed in Table 5. In addition, in compliance with the ANNEX 1 guidelines for Advanced Therapy Medicinal Products (ATMP), IP and EOP HBI0101 cells are tested for sterility according to the timeline detailed in FIG. 12B. Sterility testing was performed by an outsourced GMP certified organization (HyLabs).

[0257] A further aspect of the disclosure relates to a method for treating, preventing, ameliorating, inhibiting, or delaying the onset of an immune-related disorder in a mammalian subject. In some embodiments, the method comprises administering to the subject an effective amount of: The method includes administering at least one of: (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one cassette, vector vehicle, or gene editing system comprising the nucleic acid molecule of (a); (c) at least one cell (specifically, a cell of T lineage) expressing the CAR, or a population of such cells; and (d) a composition comprising at least one of (a), (b), and (c). More specifically, in some embodiments of the disclosed method, such e CAR molecule comprises the following components: first, (i) at least one target binding domain, at least one of which specifically recognizes and binds to BCMA; and second, (ii) at least one hinge and at least one transmembrane domain derived from CD8α protein. It should be noted that the hinge region of the domain comprises the amino acid sequence set forth by SEQ ID NO: 9, as well as any fragments, derivatives, and variants thereof. The CAR molecule further comprises, as a third component (iii), at least one intracellular T cell signaling domain, more specifically, this domain comprises at least one domain of a TNF receptor family member and, optionally, at least one domain of a TCR molecule.

[0258] In some embodiments, at least one target binding domain of the CAR molecule of the disclosed methods comprises (i) at least one target recognition element, and / or (ii)) at least one adaptor component that recognizes and binds to at least one tagged target recognition element.

[0259] In some embodiments, such an adaptor component can include at least one portion that specifically recognizes and binds to at least one tag of a tagged target recognition element.

[0260] In some further embodiments, the target recognition domain of the CAR molecule of the disclosed methods comprises at least one antibody, or any antigen-binding fragment, portion, or chimera thereof, specific for the target BCMA.

[0261] In yet some further embodiments, the antigen-binding fragment, portion, or chimera of an antibody used as the target recognition domain of the CAR molecule of the disclosed methods comprises at least one of an scFv and / or a nanobody.

[0262] In a more specific embodiment, the antibody used as the target recognition domain of the CAR molecule of the disclosed method specifically recognizes and binds to the BCMA protein. In a more specific embodiment, the antibody comprises an immunoglobulin HC comprising the amino acid sequence set forth in SEQ ID NO: 3, and any derivatives and variants thereof, and an immunoglobulin LC comprising the amino acid sequence set forth in SEQ ID NO: 5, and any derivatives and variants thereof.

[0263] In a more specific embodiment, at least one target binding domain of a CAR used by the methods of the present disclosure comprises the amino acid sequence set forth by SEQ ID NO: 11, and any derivatives and variants thereof.

[0264] Furthermore, in some embodiments, the hinge and transmembrane domain of the CAR used by the methods of the present disclosure comprises the amino acid sequence set forth by SEQ ID NO:6, as well as any derivatives and variants thereof.

[0265] In yet some further embodiments, at least one intracellular T cell signaling domain of the CAR used by the method of the present disclosure comprises at least one TNF receptor family member. In some embodiments, such a TNF receptor family member is 4-1BB. Thus, the CAR molecule used by the method of the present disclosure comprises at least one intracellular T cell signaling domain derived from a 4-1BB protein. In yet some further embodiments, the CAR molecule used by the method of the present disclosure comprises at least one intracellular T cell signaling domain derived from a TCR molecule. More specifically, the CAR molecule used by the method of the present disclosure comprises at least one intracellular T cell signaling domain derived from the CD3 zeta chain.

[0266] In some specific embodiments, at least one intracellular T cell signaling domain of the CAR molecule used by the methods of the present disclosure comprises the amino acid sequence set forth by SEQ ID NO: 12, and any derivatives and variants thereof.

[0267] In yet some further specific and non-limiting embodiments, the CAR molecule used by the methods of the present disclosure, for example a CAR T molecule of SEQ ID NO: 40 that does not contain a leader sequence, comprises the amino acid sequence shown by SEQ ID NO: 1, or any variants and derivatives thereof.

[0268] Still further, in some embodiments of the disclosed methods, expression of the CAR molecule by at least one of the cells of the T lineage of a subject treated by the methods of the invention results in at least one of the following alternative or additional effects:

[0269] In some alternative or additional embodiments, expression of the CAR molecule by at least one of the cells of the T lineage of the subject treated by the method of the present invention (i) results in increased specificity for the target. In particular, the specificity for any cell expressing the target BCMA is increased. In yet some further additional or alternative embodiments, expression of the CAR molecule by at least one of the cells of the T lineage of the subject treated by the method of the present invention (ii) results in reduced tonic signaling. Still further, in some further or alternative embodiments, expression of the CAR molecule by at least one of the cells of the T lineage of the subject treated by the method of the present invention (iii) results in reduced off-target activation. In some further additional or alternative embodiments, expression of the CAR molecule by at least one of the cells of the T lineage of the subject treated by the method of the present invention (iv) results in increased expression of an activation marker in response to a specific stimulus. According to some embodiments, such an activation marker can be, for example, at least one of CD137, CD25, CD69. It should be further understood that the specific stimulus used herein is the presence of a BCMA-positive target cell. In still further some additional or alternative embodiments, expression of the CAR molecule by at least one of the cells of the T lineage of the subject treated by the method of the invention results in (v) a reduction in the expression of an exhaustion marker in response to a specific stimulus. More specifically, in some embodiments, the exhaustion marker can be at least one of PD-1, LAG-3, TIM3, TIGIT. In still further some alternative and / or additional embodiments, expression of the CAR molecule by at least one of the cells of the T lineage of the subject treated by the method of the invention results in (vi) an increase in the survival of the treated subject. In still further some additional and / or alternative embodiments, expression of the CAR molecule by at least one of the cells of the T lineage of the subject treated by the method of the invention results in (vii) a reduction in the relapse rate in the treated subject. In still further some specific alternative and / or additional embodiments, expression of the CAR molecule by at least one of the cells of the T lineage of the subject treated by the method of the invention results in (viii) a long-term effect in the treated subject.More specifically, in some embodiments, the disclosed CAR molecules and CAR T cells thereof, as well as any compositions, systems, and methods thereof, result in an increase in survival of the treated subject. As used herein, increased survival refers herein to any increase in either overall survival, progression-free survival, or disease-free survival. Still further, in some embodiments, overall survival (also referred to herein as OS) is the length of time that a patient diagnosed with a disease, such as cancer, remains alive, either from the date of diagnosis of the disease or the date of initiation of treatment. In clinical trials, measuring overall survival is one way to see how well a new treatment works. In yet some further embodiments, progression-free survival (also referred to herein as PFS) is the length of time that a patient lives with a disease, such as cancer, but the disease does not worsen, during and after treatment of the disease. In clinical trials, measuring progression-free survival is one way to see how well a new treatment works. In yet some further embodiments, the disclosed CAR molecules and CAR T cells thereof, as well as any compositions, systems, and methods thereof, result in an increase in DFS. Disease-free survival (also referred to herein as DFS, recurrence-free survival, and RFS). In cancer, the length of time a patient lives without any signs or symptoms of the cancer after the first-line treatment for the cancer has ended. In clinical trials, measuring disease-free survival is one way of finding out how well a new treatment works.

[0270] In yet some further embodiments, the disclosed CAR molecules and CAR T cells thereof, as well as any compositions, systems, and methods thereof, result in a reduced relapse rate. As used herein, the term "relapse" refers to the recurrence of any signs and symptoms of a condition, disease, or disorder that has previously affected a person, or a disease after a period of improvement. For example, the term refers to the recurrence of a disease that has been treated with any therapeutic compound, such as the HBI101 CAR T cells of the present disclosure.

[0271] In some embodiments, the reduction in relapse rate is determined according to the International Myeloma Working Group (IMWG). More specifically, clinical relapse of multiple myeloma requires one or more of the following: the development of new soft tissue plasmacytomas or bone lesions; a definite increase in the size of existing plasmacytomas or bone lesions. A definite increase is defined as a 50% (and at least 1 cm) increase as measured consecutively by the sum of the products of the crossed diameters of measurable lesions, hypercalcemia (>11.5 mg / dL) [2.65 mmol / L], a decrease in hemoglobin of >2 g / dL [1.25 mmol / L], or an increase in serum creatinine of ≥2 mg / dL [≥177 mmol / L].

[0272] Still further, in some embodiments, the disclosed CAR molecules and CAR T cells thereof, as well as any compositions, systems, and methods thereof, provide long-term effects as demonstrated by the examples. More specifically, in some embodiments, the long-term effects refer to higher proliferation capacity and sustained long-term survival benefits for T cells, including proliferation of central memory T cells (Tcm), significantly enhanced respiratory capacity, increased fatty acid oxidation, and enhanced mitochondrial biogenesis. T cell memory is a key component of the immune response. Following antigen-driven expansion and death of effector T cells after antigen clearance, a portion of the remaining T cells differentiate into two different types of memory T cells: central memory (Tcm) (identified as CD45RO+CCR7+ cells) and effector memory T cells (Tem) (identified as CD45RO+CCR7- cells). The first one is located in lymphoid organs and bone marrow and has a high proliferation capacity, while the second one remains in peripheral tissues in a pre-activated form that allows immediate action on pathogen recognition. Naive and memory T cells rely primarily on mitochondrial oxidation of free fatty acids for development and persistence. In contrast, activated effector T cells shift to glycolysis or simultaneously upregulate oxidative phosphorylation and aerobic glycolysis to meet the metabolic demands of proliferation.

[0273] In some embodiments, the therapeutic methods of the present disclosure may use any of the CAR molecules defined by the present disclosure. In some alternative or additional embodiments, the methods of the present disclosure may use any of the nucleic acid molecules defined by the present disclosure. In some further alternative or additional embodiments, the methods of the present disclosure may use any of the gene editing systems defined by the present disclosure. In some further alternative or additional embodiments, the methods of the present disclosure may use any of the cells or populations of cells defined by the present disclosure. In some further alternative or additional embodiments, the methods of the present disclosure may use any of the compositions defined by the present disclosure.

[0274] As provided herein, the present disclosure provides methods that allow for the genetic engineering of cells of the T lineage in vivo as well as ex vivo or in vitro to express the CAR T molecules of the present invention. When the engineering of cells is performed ex vivo or in vitro, the engineered cells are returned to the subject by adoptive transfer.

[0275] The term "adoptive transfer" as defined herein applies to any therapy consisting of the transfer of components of the immune system, specifically cells already capable of mounting a specific immune response. In such an option, targeted insertion of a nucleic acid sequence encoding a CAR T as disclosed herein is performed in cells of autologous or allogeneic origin, which are then administered to a subject, specifically by adoptive transfer.

[0276] In some embodiments, the cells expressing, containing, transduced or transfected with the nucleic acid molecules of the invention or any cassette provided by the invention can be autologous cells. The term "autologous" when referring to the source of cells refers to cells derived from or transferred from the same subject treated by the method of the invention. The term "allogeneic" when referring to the source of cells refers to cells derived from or transferred from a different subject of the same species, referred to herein as a donor.

[0277] In some embodiments of the therapeutic methods disclosed herein, a subject is administered at least one cell of T lineage genetically engineered with any vector or vehicle that expresses the CAR molecule and / or contains at least one nucleic acid cassette or cassette, or a population of cells comprising cells of T lineage that express the CAR molecule of the present disclosure. According to such embodiments, the genetic engineering of the cells is performed ex vivo or in vitro. In yet some further embodiments, such cells are of autologous or allogeneic origin.

[0278] In some further alternative embodiments, the genetic engineering of cells of T lineage is performed in vivo in the subject to be treated. In such cases, the subject to be treated by the therapeutic method disclosed herein is administered a nucleic acid molecule comprising at least one nucleic acid sequence encoding the CAR T molecule of the present disclosure, or any cassette, vector, or gene editing system comprising the same. As indicated above, the genetic editing of cells of T lineage to express the CAR molecule disclosed herein is performed in vivo in the subject to be treated. In some further embodiments, the suitable vector useful in such methods is any one of a viral vector, a non-viral vector, and a naked DNA vector.

[0279] It should be understood that any of the vectors (e.g., viral vectors) disclosed herein in relation to other aspects of the disclosure may also be applicable to genetic manipulation of cells of the T lineage, either ex vivo, in vitro, or alternatively in vivo in the subject to be treated.

[0280] Still further, as discussed herein, in some embodiments of the therapeutic methods of the present disclosure, the insertion of the nucleic acid sequence encoding the CAR into the genome of cells of the T lineage in the subject is mediated by a site-specific nuclease. Such a nuclease is at least one PEN. It should be understood that the use of the PEN discussed herein may be applicable to both in vivo or ex vivo / in vitro introduction of the nucleic acid sequence encoding the CAR into the genome of the T cells. In yet some further specific embodiments, the PEN comprises at least one CRISPR / Cas protein system. Thus, when the genetic engineering of T cells is performed in vivo, according to such embodiments, the method comprises administering to the treated subject at least one of the following: The method further comprises administering (a) at least one CRISPR / cas protein, or any nucleic acid molecule encoding said Cas protein, and (b) at least one nucleic acid sequence comprising at least one gRNA, or any nucleic acid sequence encoding a gRNA, that targets the insertion of the nucleic acid sequence encoding said CAR into a genomic sequence, or any kit, composition, or vehicle comprising at least one of (a) and (b). However, it should be understood that when the genetic engineering of cells of the T lineage is performed in vitro / ex vivo and the subject is administered a genetically engineered cell expressing a CAR molecule of the present disclosure, editing the cell (either autologous or allogeneic) is performed by contacting the cell with at least one CRISPR / cas protein and gRNA as discussed above.

[0281] Still further, in some embodiments, the therapeutic methods of the present disclosure are applicable to any pathological disorder, in particular disorders associated with expression of the BCMA protein in cells of the B lineage. In yet some further embodiments, the therapeutic methods may be applicable to any disorder associated with regulated expression, stability, and / or activity of the BCMA protein. In some particular embodiments, the disclosed methods are applicable to disorders associated with and / or characterized by overexpression of the BCMA protein.

[0282] Still further, in some embodiments, such disorder is at least one plasma cell pathology, at least one proliferative disorder, at least one deposition disorder, and / or at least one autoimmune disease, or any B cell mediated or related disorder.

[0283] In some embodiments, the disclosed methods are applicable to treating at least one plasma cell pathology. Plasma cell pathology, as used herein, refers to any disorder involving plasma cells. For example, multiple myeloma, myelomatosis, and myeloid plasmacytoma are bone marrow-based, post-germinal center B cell malignant disorders characterized by clonal proliferation of plasma cells associated with serum and / or urinary monoclonal proteinosis.

[0284] In some embodiments, the plasma cell pathology may include any one of multiple myeloma (MM), amyloidosis (AL), monoclonal gammopathy of undetermined significance (MGUS), pla...

Claims

1. 1. A chimeric antigen receptor (CAR) molecule comprising: (i) at least one target binding domain, wherein at least one of said target binding domains specifically recognizes and binds to B-cell maturation antigen (BCMA); and (ii) at least one hinge and at least one transmembrane domain derived from Cluster of Differentiation 8 alpha (CD8α) protein, wherein the hinge region of said domain comprises an amino acid sequence set forth in SEQ ID NO:9, and any fragments, derivatives, and variants thereof; (iii) at least one intracellular T cell signaling domain, said domain comprising at least one domain of a tumor necrosis factor (TNF) receptor family member, and optionally at least one domain of a T cell receptor (TCR) molecule; A chimeric antigen receptor molecule comprising:

2. 2. The CAR molecule of claim 1, wherein the at least one target binding domain comprises at least one adaptor component that recognizes and binds to (i) at least one target recognition element and / or (ii) at least one tagged target recognition element.

3. 3. The CAR molecule of claim 1 or 2, wherein the target recognition domain and / or element comprises at least one antibody specific for BCMA, or any antigen-binding fragment, portion, or chimera thereof.

4. 4. The CAR molecule of claim 3, wherein the antigen-binding fragment, portion, or chimera of the antibody comprises at least one of a single chain variable fragment (scFv) and / or a nanobody.

5. 5. The CAR molecule of claim 3 or 4, wherein the antibody specifically recognizes and binds to a BCMA protein or any fragment thereof, and wherein the antibody comprises an immunoglobulin heavy chain (HC) comprising the amino acid sequence set forth in SEQ ID NO: 3, and any derivatives and variants thereof, and an immunoglobulin light chain (LC) comprising the amino acid sequence set forth in SEQ ID NO: 5, and any derivatives and variants thereof.

6. 6. The CAR molecule of any one of claims 1 to 5, wherein the at least one target binding domain comprises an amino acid sequence as set forth in SEQ ID NO: 11, and any variants and derivatives thereof.

7. 7. The CAR molecule of any one of claims 1 to 6, wherein the hinge and transmembrane domains comprise an amino acid sequence as set forth in SEQ ID NO:6, and any variants and derivatives thereof.

8. The CAR molecule of any one of claims 1 to 7, wherein at least one of the at least one tumor necrosis factor (TNF) receptor family members is 4-1BB and the TCR molecule comprises a cluster of differentiation 3 (CD3) zeta chain.

9. 9. The CAR molecule of any one of claims 1 to 8, wherein the at least one intracellular T cell signaling domain comprises an amino acid sequence as set forth in SEQ ID NO: 12, and any derivatives and variants thereof.

10. 10. The CAR molecule of any one of claims 1 to 9, wherein the CAR comprises an amino acid sequence as set forth in SEQ ID NO: 1, and any variants and derivatives thereof.

11. 11. The CAR molecule of any one of claims 1 to 10, wherein expression of said CAR by at least one cell of a T lineage results in at least one of the following in vivo and / or in vitro / ex vivo settings: (i) increased specificity; (ii) reduced tonic signaling; (iii) reduced off-target activation; (iv) increased expression of activation markers in response to a specific stimulus; and (v) reduced expression of exhaustion markers in response to a specific stimulus.

12. A nucleic acid molecule comprising at least one nucleic acid sequence encoding at least one CAR molecule, or any cassette, vector, or vehicle comprising said nucleic acid molecule, wherein said CAR is (i) at least one target binding domain, wherein at least one of said target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge and at least one transmembrane domain derived from a CD8α protein, wherein the hinge region of said domain comprises an amino acid sequence as set forth in SEQ ID NO:9, and any derivatives and variants thereof; (iii) at least one intracellular T cell signaling domain, said domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule; A nucleic acid molecule, or any cassette, vector, or vehicle comprising:

13. The nucleic acid molecule of claim 12, wherein the CAR molecule is as defined by any one of claims 2 to 11.

14. 14. The nucleic acid molecule of claim 12 or 13, wherein the nucleic acid molecule is flanked at at least one of its 5' and 3' ends by at least one of: (i) homology arms for integration into a genomic target site by homologous recombination, and / or (ii) recognition sites for a site-specific nuclease, a site-specific integrase, or a site-specific recombinase.

15. 1. A gene editing system, comprising: (a) at least one nucleic acid molecule comprising at least one nucleic acid sequence encoding at least one CAR molecule, or any cassette, vector, or vehicle comprising said nucleic acid molecule, wherein said CAR is (i) at least one target binding domain, wherein at least one of the target binding domains specifically recognizes and binds BCMA; (ii) at least one hinge and at least one transmembrane domain derived from a CD8α protein, wherein the hinge region of said domain comprises an amino acid sequence set forth in SEQ ID NO:9, and any fragments, derivatives, and variants thereof; and (iii) at least one intracellular T cell signaling domain, said domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule; At least one nucleic acid molecule, or any cassette, vector, or vehicle, comprising: (b) at least one gene editing component, or a nucleic acid sequence encoding the gene editing component; A gene editing system comprising:

16. A genetically engineered cell of a T cell lineage expressing at least one CAR molecule, or any population of cells comprising at least one said genetically engineered cell, wherein said CAR is (i) at least one target binding domain, wherein at least one of said target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge and at least one transmembrane domain derived from a CD8α protein, wherein the hinge region of said domain comprises an amino acid sequence set forth in SEQ ID NO:9, and any fragments, derivatives, and variants thereof; (iii) at least one intracellular T cell signaling domain, said domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule; Any genetically engineered cell or population of cells, including

17. 17. The genetically engineered cell of claim 16, wherein the CAR molecule is as defined by any one of claims 1 to 11.

18. 18. The genetically engineered cell of claim 16 or 17, wherein the cell of the T lineage is at least one T cell and / or at least one NK T cell.

19. 1. A composition comprising at least one of at least one CAR molecule, any nucleic acid molecule comprising at least one nucleic acid sequence encoding said CAR molecule, or any cassette, vector, vehicle, or gene editing system comprising said nucleic acid molecule, and / or any genetically engineered cell of T lineage expressing said CAR, or a population of cells comprising at least one said genetically engineered cell of said T lineage, and any combination thereof, wherein said CAR is (i) at least one target binding domain, wherein at least one of said target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge and at least one transmembrane domain derived from a CD8α protein, wherein the hinge region of said domain comprises an amino acid sequence set forth in SEQ ID NO:9, and any fragments, derivatives, and variants thereof; (iii) at least one intracellular T cell signaling domain, said domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule; and optionally, said composition further comprises at least one of a pharma- ceutically acceptable carrier, diluent, excipient, and additive.

20. 20. The composition of claim 19, wherein the CAR molecule is as defined in any one of claims 1 to 11, the nucleic acid molecule is as defined in any one of claims 12 to 14, the gene editing system is as defined in claim 15, and the cell is as defined in any one of claims 16 to 18.

21. 1. A method for treating, preventing, ameliorating, inhibiting, or delaying the onset of an immune-related disorder in a mammalian subject, said method comprising administering to said subject an effective amount of (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one cassette, vector vehicle, or gene editing system comprising the nucleic acid molecule of (a); (c) at least one cell, or a population of cells, expressing the CAR; and (d) a composition comprising at least one of (a), (b), and (c). and administering at least one of The CAR is (i) at least one target binding domain, wherein at least one of the target binding domains specifically recognizes and binds to BCMA; and (ii) at least one hinge and at least one transmembrane domain derived from a CD8α protein, wherein the hinge region of said domain comprises an amino acid sequence set forth in SEQ ID NO:9, and any fragments, derivatives, and variants thereof; (iii) at least one intracellular T cell signaling domain, said domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule; and A method comprising:

22. 22. The method of claim 21 , wherein the at least one target binding domain comprises at least one adaptor component that recognizes and binds to (i) at least one target recognition element and / or (ii) at least one tagged target recognition element.

23. 23. The method of claim 21 or 22, wherein the target recognition domain and / or element comprises at least one antibody specific for BCMA, or any antigen-binding fragment, portion, or chimera thereof.

24. 24. The method of claim 23, wherein the antigen-binding fragment, portion, or chimera of the antibody comprises at least one of an scFv and / or a nanobody.

25. The method of claim 23 or 24, wherein the antibody specifically recognizes and binds to the BCMA protein, and the antibody comprises an immunoglobulin HC comprising the amino acid sequence set forth in SEQ ID NO: 3, and any derivatives and variants thereof, and an immunoglobulin LC comprising the amino acid sequence set forth in SEQ ID NO: 5, and any derivatives and variants thereof.

26. 26. The method of any one of claims 21 to 25, wherein the at least one target binding domain comprises the amino acid sequence represented by SEQ ID NO: 11, and any derivatives and variants thereof.

27. 27. The method of any one of claims 21 to 26, wherein the hinge and transmembrane domains comprise the amino acid sequence set forth by SEQ ID NO:6, and any derivatives and variants thereof.

28. 28. The method of any one of claims 21 to 27, wherein the at least one TNF receptor family member is 4-1BB and the TCR molecule comprises a CD3 zeta chain.

29. 29. The method of any one of claims 21 to 28, wherein the at least one intracellular T cell signaling domain comprises the amino acid sequence set forth by SEQ ID NO:

12.

30. 30. The method of any one of claims 21 to 29, wherein the CAR comprises the amino acid sequence set forth by SEQ ID NO: 1, or any variants and derivatives thereof.

31. 31. The method of any one of claims 21-30, wherein expression of the CAR by at least one cell of the T lineage of the subject results in at least one of the following in the subject: (i) increased specificity; (ii) reduced tonic signaling; (iii) reduced off-target activation; (iv) increased expression of activation markers in response to a specific stimulus; (v) reduced expression of exhaustion markers in response to a particular stimulus; (vi) increased survival; (vii) reduced relapse rate; and (viii) long-term effects.

32. 32. The method of any one of claims 21 to 31, wherein the nucleic acid molecule is as defined in any one of claims 12 to 14, the gene editing system is as defined in claim 15, the cell is as defined in any one of claims 16 to 18 and the composition is as defined in claim 19 or 20.

33. 33. The method of any one of claims 21 to 32, wherein said subject is administered at least one cell of said T lineage that expresses said CAR molecule and / or is genetically engineered with said at least one nucleic acid cassette or any vector or vehicle comprising said cassette, or a population of said cells.

34. 34. The method of claim 33, wherein the cells are from an autologous or allogeneic source.

35. 33. The method of any one of claims 21 to 32, wherein the subject is administered a nucleic acid vector comprising the at least one cassette, the vector being any one of a viral vector, a non-viral vector, and a naked DNA vector.

36. 36. The method of claim 35, wherein insertion of the nucleic acid sequence encoding the CAR into the genome of cells of the T lineage in the subject is mediated by a site-specific nuclease, the nuclease is at least one PEN, the PEN comprising at least one CRISPR / Cas protein system, and the method further comprises administering to the subject at least one of the following: (a) at least one CRISPR / cas protein, or any nucleic acid molecule encoding said Cas protein, and (b) at least one nucleic acid sequence comprising at least one gRNA that targets insertion of the nucleic acid sequence encoding the CAR into a genomic sequence; or any nucleic acid sequence encoding said gRNA, or any kit, composition, or vehicle comprising at least one of (a) and (b).

37. The method of any one of claims 21 to 36, wherein the immune-related disorder is a disorder associated with expression of the BCMA protein in cells of the B lineage.

38. 38. The method of claim 37, wherein the disorder is at least one of at least one proliferative disorder, and / or at least one autoimmune disease, a deposition disorder, or any B-cell mediated disorder.

39. 39. The method of claim 38, wherein the proliferative disorder is any B-cell malignancy.

40. 40. The method of claim 39, wherein the B cell malignancy is multiple myeloma (MM) and any related conditions.

41. 38. The method of claim 37, wherein the deposition disorder is amyloidosis and any associated conditions.

42. (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one cassette, vector vehicle, or gene editing system comprising the nucleic acid molecule of (a); (c) at least one cell, or a population of cells, expressing the CAR; and (d) a composition comprising at least one of (a), (b), and (c). in a method for treating, preventing, ameliorating, inhibiting, or delaying the onset of an immune-related disorder in a mammalian subject, wherein the CAR is (i) at least one target binding domain, wherein at least one of said target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge and at least one transmembrane domain derived from a CD8α protein, wherein the hinge region of said domain comprises an amino acid sequence set forth in SEQ ID NO:9, and any fragments, derivatives, and variants thereof; (iii) at least one intracellular T cell signaling domain, said domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule; and Including, use.

43. 43. The use of an effective amount according to claim 42, wherein the CAR is as defined in any one of claims 1 to 11, the nucleic acid molecule is as defined in any one of claims 12 to 14, the gene editing system is as defined in claim 15, the cell is as defined in any one of claims 16 to 18 and the composition is as defined in claim 19 or 20.

44. 1. A method for targeted activation of cells of the T lineage against target cells and / or tissues containing said target cells that express a BCMA protein, comprising: (a) at least one nucleic acid molecule encoding at least one CAR molecule; (b) at least one cassette, vector vehicle, or gene editing system comprising the nucleic acid molecule of (a); and (c) a composition comprising at least one of (a) and (b). and contacting said T lineage cells with an effective amount of at least one of (i) at least one target binding domain, wherein at least one of said target binding domains specifically recognizes and binds to BCMA; (ii) at least one hinge and at least one transmembrane domain derived from a CD8α protein, wherein the hinge region of said domain comprises an amino acid sequence set forth in SEQ ID NO:9, and any fragments, derivatives, and variants thereof; (iii) at least one intracellular T cell signaling domain, said domain comprising at least one domain of a TNF receptor family member, and optionally at least one domain of a TCR molecule; and A method comprising:

45. 45. The method of claim 44, wherein the step of contacting said T lineage cells with said at least one nucleic acid cassette is performed in vivo, in vitro, or ex vivo.

46. 46. ​​The method of claim 45, wherein contacting said cells of T lineage with said at least one nucleic acid cassette is performed in vivo in a subject suffering from at least one immune-related disorder, said method further comprising administering to said subject an effective amount of said nucleic acid cassette, a vector comprising said nucleic acid cassette, a gene editing system comprising said nucleic acid molecule, or any composition thereof.

47. 46. ​​The method of claim 45, wherein contacting said cells of T lineage with said at least one nucleic acid cassette is performed in vitro or ex vivo to obtain a genetically engineered cell or population of said cells of T lineage.

48. 48. The method of claim 47, wherein the method is for targeting and activating cells of the T lineage against target cells and / or tissues containing the BCMA protein expressing the target cells in a subject suffering from an immune-related disorder, the method further comprising the step of introducing the engineered cells into the subject.

49. 49. The method of claim 47 or 48, wherein the cells of the T lineage are from an autologous or allogeneic source.

50. 50. The method of any one of claims 46 to 49, wherein the disorder is at least one of at least one proliferative disorder, at least one deposition disorder, and / or at least one autoimmune disease.

51. 51. The method of any one of claims 44 to 50, wherein the CAR is as defined in any one of claims 1 to 11, the nucleic acid molecule is as defined in any one of claims 12 to 14, the gene editing system is as defined in claim 15, the cell is as defined in any one of claims 16 to 8 and the composition is as defined in claim 19 or 20.

Images