Virus-like particle-mediated circular RNA delivery

Abstract

The present invention relates to a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest. The present invention further relates to a method for producing a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest.

Description

[Technical field]

[0001] The present invention relates to a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest. The present invention further relates to a method for producing a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest. [Background technology]

[0002] RNA has been used for therapeutic intervention through various mechanistic pathways. There are approaches to inhibit gene expression, such as by applying siRNA or antisense RNA, but there are also multiple techniques to apply therapeutically active RNA to induce gene expression. This is currently being used successfully in clinical trials in the nearly countless vaccinations against the SARS-CoV-2 virus by inducing the expression of the spike protein of SARS-CoV-2.

[0003] The application of RNA, in contrast to DNA-based therapies, has the great advantage that the effects obtained are temporary, there is no risk of chromosomal DNA modification, and potentially harmful long-term effects can be avoided. Such negative effects can be completely eliminated, since RNA has a rather short half-life and cannot be integrated into chromosomal DNA. The drawback, however, is that RNA-mediated effects only occur for a few days. This seems sufficient to prepare an immune response, at least against new viral threats. Since RNase is very efficient at degrading RNA molecules in a fairly short time, it is rather difficult to obtain long-lasting effects, and RNA-based therapies must be applied repeatedly.

[0004] One approach to improve the stability of therapeutic RNA transcripts has been achieved by utilizing circular RNAs (circRNAs), which are covalently closed, single-stranded RNA molecules that can be generated in eukaryotic cells by backsplicing, a non-canonical RNA splicing mechanism. Initially, circRNAs were thought to play a role mainly in viruses, such as Hepatitis D virus and plant viroids, however, circRNAs have also been found in fungi, plants, insects, fish and mammals, supported by next-generation sequencing of RNA using high-throughput approaches.

[0005] Unlike linear mRNAs, circular RNAs (circRNAs) are highly stable due to their covalently closed ring structure that protects them from exonucleolytic degradation, and are currently being investigated in detail as new possibilities for therapeutic intervention.

[0006] A major hurdle for circRNA-based therapeutics to date is the delivery of biologically active circRNA molecules to the right cells, and thus to the right organs, with sufficiently high efficiency. Notably, in vivo circRNA delivery is problematic, but in vitro approaches, such as modification of T cells for CAR-T cell therapy, could also benefit dramatically if circRNA delivery could be improved while simultaneously keeping cytotoxic effects at an acceptable level.

[0007] Delivery of linear single-stranded RNA is possible through encapsulation in lipid nanoparticles. The clinical utility of mRNA vaccines delivered in lipid nanoparticles has been highlighted recently by their use in SARS-CoV-2 vaccines from Moderna (mRNA-1273) and Pfizer-BioNTech (BNT162b2). The lipid nanoparticles need to fulfill several functions: (i) to prevent the RNA drug from being induced by nucleases in physiological body fluids when applied; (ii) it must be modified to escape clearance by the mononuclear phagocytic system (MPS) and renal glomerular filtration, especially when applied systemically, (iii) it must be able to efficiently enter target cells, and (iv) it must escape endosomes once internalized. To accomplish these tasks with utmost efficiency, numerous chemical modifications have been investigated, each with their own advantages and disadvantages. For this reason, current mRNA vaccines still have certain limitations due to their inherent instability and suboptimal thermostability after encapsulation for in vivo administration, as well as potential immunogenic side effects. RNA-encapsulated lipid nanoparticles are highly complex systems. Drawbacks include the presence of alternative colloidal structures, the complexity of lipid physical states, and the possibility of supercooling melting that causes stability issues during storage or administration. Dilution or water removal of the sample can significantly alter the equilibrium between the various colloidal species and lipid physical states.

[0008] Recently, circRNA vaccines against SARS-CoV-2 and circRNAs expressing nanobodies or AEC2 decoys to neutralize SARS-CoV- have been developed (Liang Qu et al. (2021): Circular RNA Vaccines against SARS-CoV-2 and Emerging Variants.doi:https: / / doi.org / 10.1101 / 2021.03.16.435594). These circRNAs were also delivered by lipid nanoparticle encapsulation. The limitations of this packaging method, already discussed above for linear RNAs, also apply to circular RNAs.

[0009] Thus, there is an unmet need for the production of new vectors that are safe and efficient for the transfer of genetic material to subjects, such as mammals.

[0010] However, viruses have evolved strategies over millions of years to identify routes to efficiently enter the cytoplasm of target cells. We surprisingly discovered that circRNAs can be packaged into virus-like particles (VLPs). By incorporating a recruiting RNA motif into the molecule to be packaged, circRNAs, including coding and non-coding circRNAs, can be selectively packaged into VLPs. The recruiting RNA motif only becomes functional upon circularization, and the molecule to be packaged is packaged only in the circularized state. Surprisingly, these RNAs can also be packaged into the envelope of DNA viruses. These VLPs can deliver (therapeutic) circRNA molecules in vivo or in vitro. Summary of the Invention

[0011] In a first aspect, the present invention provides a method for the preparation of a nucleic acid sequence comprising, in order from 5' to 3': The first backsplicing intron sequence, The first part of the recruiting RNA motif, a nucleotide sequence of interest, a second portion of the recruiting RNA motif, and Second back-spliced ​​intron sequence A (linear) polynucleotide (which can be circularized) comprising: Here, the first portion of the recruit RNA motif and the second portion of the recruit RNA motif form a functional recruit RNA motif after circularization. In a second aspect, the present invention relates to a vector comprising the polynucleotide of the first aspect. In a third aspect, the present invention relates to an artificial circular RNA molecule comprising an RNA element of interest and a recruiting RNA motif. In a fourth aspect, the present invention provides a method for producing a composition comprising the steps of: (i) a polypeptide comprising a viral capsid protein, or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain, and (ii) an artificial circular RNA molecule comprising an RNA element of interest, preferably an artificial circular RNA molecule according to the third aspect. or a complex of (i) and (ii). In a fifth aspect, the present invention relates to a virus-like particle (VLP) comprising a complex according to the fourth aspect. In a sixth aspect, the present invention relates to a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest. In a seventh aspect, the present invention relates to a method for producing a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest, preferably as defined in the fifth or sixth aspect, (i) providing a cell; (ii) a cell, (iia) a polypeptide comprising a viral capsid protein, or a fragment or derivative thereof having a capsid protein function and at least one RNA-binding domain, a polynucleotide encoding said polypeptide, or a vector comprising said polynucleotide; and (iib) a polynucleotide according to the first aspect, a vector according to the second aspect, an artificial circular RNA molecule comprising an RNA element of interest, or an artificial circular RNA molecule according to the third aspect. introducing This results in the production of virus-like particles (VLPs) that contain artificial circular RNA molecules that contain the RNA element of interest. In an eighth aspect, the present invention relates to a method for generating a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest, preferably as defined in the fifth or sixth aspect, comprising the steps of: (i) providing a virus-like particle (VLP) comprising a viral capsid protein or a fragment or derivative of a capsid protein having a capsid protein function and a polypeptide comprising at least one RNA-binding domain; (ii) disassembling the VLPs; (iii) adding an artificial circular RNA molecule comprising an RNA element of interest or an artificial circular RNA molecule according to the third aspect; (iv) reassembling the disassembled VLPs; Thereby, virus-like particles (VLPs) are generated that contain artificial circular RNA molecules that contain the RNA element of interest. In a ninth aspect, the present invention relates to a virus-like particle (VLP) obtainable by a method according to the seventh or eighth aspect. In a tenth aspect, the present invention relates to a composition comprising a virus-like particle according to the fifth aspect, the sixth aspect or the ninth aspect. In an eleventh aspect, the present invention relates to a virus-like particle according to the fifth aspect, the sixth aspect or the ninth aspect, or a composition according to the tenth aspect, for use in medicine. In a twelfth aspect, the present invention relates to a virus-like particle according to the fifth, sixth or ninth aspect, or a composition according to the tenth aspect, for therapeutic use. In a thirteenth aspect, the present invention relates to a virus-like particle according to the fifth, sixth or ninth aspect, or a composition according to the tenth aspect, for use in vaccination. This summary of the invention does not describe all features of the invention.

[0012] Detailed Description of the Invention definition Before describing the present invention in detail below, it should be noted that the present invention is not limited to the specific methods, processes, and methods described herein. It should be understood that the present invention is not limited to the protocols and reagents, as these may vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0013] Preferably, the terms used herein are defined as set forth in the "Multilingual Glossary of Biotechnology Terms: (IUPAC Recommendations)" (Leuenberger, HGW, Nagel, B. and Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland).

[0014] Several documents are cited in the body of this specification. Each document cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank Accession Number sequence submissions, etc.), whether supra or infra, is incorporated herein by reference in its entirety. Nothing herein shall be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

[0015] The elements of the present invention are described below. Although these elements are described with specific embodiments, it is understood that they can be combined in any manner and in any number to create additional embodiments. The various described examples and preferred embodiments should not be construed as limiting the invention to only the explicitly described embodiments. The description should be understood to support and encompass embodiments combining the explicitly described embodiments with any number of the disclosed elements and / or preferred elements. Furthermore, unless the context dictates otherwise, any permutation and combination of all elements described in this application should be considered to be disclosed by the description of this application.

[0016] Throughout this specification and the claims which follow, unless the context clearly dictates otherwise, the word "comprise" and variations such as "comprises" and "comprising" are understood to mean the inclusion of a stated integer or step, or group of integers or steps, but not the exclusion of other integers or steps, or group of integers or steps. As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise.

[0017] The term "consisting essentially of" as used herein limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. In other words, the term "consisting essentially of" as used herein is generally interpreted to mean that a composition or formulation (a) necessarily contains the recited ingredients, and (b) may contain unrecited ingredients that do not materially affect the basic and novel characteristics of the composition. Similarly, when "consisting essentially of" is used in a process claim, the claim requires that the recited steps be performed, but may also include unrecited steps that do not affect the basic and novel characteristics of the process.

[0018] The term "about" as used in connection with a numerical value is meant to encompass numerical values ​​within a range having a lower limit of 5% less than the stated numerical value and an upper limit of 5% greater than the stated numerical value.

[0019] The terms "polypeptide" and "protein" are used interchangeably in the context of the present invention and refer to long peptide-linked chains of amino acids.

[0020] As used herein, the term "polypeptide fragment" or "protein fragment" refers to a polypeptide or protein that has, for example, an amino-terminal deletion, and / or a carboxy-terminal deletion, and / or an internal deletion compared to a full-length polypeptide or protein.

[0021] The term "virus" as used herein refers to a molecule that replicates only inside the living cells of another organism. It may also be grown in cell culture. Viruses can infect any type of life form, from animals and plants to microorganisms, including bacteria and archaea. When not inside an infected cell or in the process of infecting a cell, viruses exist in the form of independent particles. These virus particles, also called virions, are composed of two or three parts: (i) genetic material made of long nucleotides DNA or RNA that carry the genetic information, (ii) a protein shell called a capsid that surrounds and protects the genetic material, and sometimes (iii) a lipid envelope that surrounds the protein shell when outside the cell. The shape of these virus particles is simple helical and icosahedral in some virus species, but more complex in others. Thus, the term "virus" as used herein includes virus particles. The viruses described herein may be RNA viruses or DNA viruses. Preferably, The DNA virus is selected from the group consisting of papovavirus, papilloma virus, polyoma virus, adenovirus, and parvovirus virus, or The RNA virus is a retrovirus, a norovirus, or an orthomyxovirus. More preferably, The polyomavirus is Simian virus 40 (SV40), BK virus (BKV), JC virus (JCV), or MPy virus (MPyV); Parvoviruses are adeno-associated viruses (AAVs), Retroviruses are called lentiviruses. Norovirus is also known as Norwalk virus, or The orthomyxovirus is an influenza A or influenza B virus.

[0022] The term "enveloped virus" as used herein refers to a virus that has a viral envelope that surrounds a protective protein capsid. The envelope is usually derived from parts of the host cell membrane (phospholipids and proteins), but also contains some (viral) sugar structures such as glycoproteins and / or glycooligopeptides. Functionally, the viral envelope may help the virus enter the host cell and help it evade the host immune system. The (viral) sugar structures such as glycoproteins and / or glycooligopeptides on the surface of the envelope serve to recognize and bind to receptor sites on the host membrane. The viral envelope then fuses with the host membrane, allowing the capsid and viral genome to enter and infect the host.

[0023] As used herein, the term "virus-like particle (VLP)" refers to a viral virus-like structure composed of one or more capsid proteins capable of self-assembly. They mimic the shape and size of a virus but lack functional genetic material and are therefore unable to establish a productive infection cycle (including the production of progeny) within a host cell. The virus-like particles (VLPs) described herein can be RNA or DNA viral virus-like particles. Preferably, the virus-like particle of a DNA virus is selected from the group consisting of papovavirus-like particles, papillomavirus-like particles, polyomavirus-like particles, adenovirus-like particles, and parvovirus-like particles, or The virus-like particle of an RNA virus is a retrovirus-like particle, a norovirus-like particle, or an orthomyxovirus-like particle. More preferably, the polyomavirus-like particle is a Simian Virus 40 (SV40)-like particle, a BK virus (BKV)-like particle, a JC virus (JCV)-like particle, or an MPy virus (MPyV)-like particle; Parvovirus-like particles are adeno-associated virus (AAV)-like particles, The retrovirus-like particle is a lentivirus-like particle, the Norovirus-like particle is a Norwalk virus-like particle; or The orthomyxovirus-like particle is an influenza A or influenza B virus-like particle.

[0024] The term "capsid" as used here refers to the protein shell of a virus. It is composed of several oligomeric (repeated) structural subunits made of proteins called protomers. The observable three-dimensional form of the subunits, which may or may not correspond to individual proteins, is called a capsomer. The proteins that make up the capsid of a virus are called "capsid proteins" or "viral coat proteins (VCPs)".

[0025] The term "capsid protein" as used herein refers to a protein that constitutes a viral capsid. Thus, the function of a capsid protein is the formation of a viral capsid. Specifically, if one or more genes encoding the production of a capsid protein are provided and a sufficiently high concentration of capsid protein is achieved in a given volume, the capsid protein can be induced to self-assemble into a virus-like particle (VLP). The capsid protein may need to be processed for self-assembly. Processing (such as proteolytic processing) can be achieved by co-expression of a processing enzyme (such as a protease) or by inserting an artificial (novel) processing site into the capsid protein sequence. The artificial (novel) processing site may include a target site for a capsid or viral protease, or a self-processing site such as a ribosomal skipping site such as F2A (or 2A-like sequence) of foot and mouth disease virus (FMDV).

[0026] The term "fragment of a capsid protein having a capsid protein function" refers to a fragment derived from a native capsid protein that lacks one or more amino acids, such as, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids, compared to the native capsid protein, and has a capsid protein function. In particular, said fragment of a native capsid protein can still constitute / form a viral capsid or can still promote the constitution / formation of a viral capsid. In general, a fragment of an amino acid sequence contains fewer amino acids than the corresponding full-length sequence, and the amino acid sequence present is in the same sequential order as the full-length sequence. Thus, a fragment does not include internal insertions or deletions in the portion of the full-length sequence represented by the fragment.

[0027] The term "capsid protein derivative having capsid protein function" refers to a derivative of a natural capsid protein, which has one or more amino acids substituted, deleted, and / or added, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids, compared to the natural capsid protein, and has capsid protein function. In particular, said derivative of a natural capsid protein can still constitute / form a viral capsid or still promote the constitution / formation of a viral capsid. In contrast to a fragment, a derivative can contain internal insertions or deletions within the amino acids corresponding to the full-length sequence, or can have similarity to the full-length coding sequence.

[0028] The fragments or derivatives described herein are also referred to as variants. Preferably, the capsid protein has an amino acid sequence as set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. Alternatively, the capsid protein has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0029] Capsid proteins having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence according to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4 can be referred to as capsid protein variants. Such capsid protein variants can still constitute / form a viral capsid or can still promote the constitution / formation of a viral capsid. The Examples section, for example, provides sufficient information in this regard. The same applies to variants of SEQ ID NO:31.

[0030] The capsid protein of the virus described herein, or a fragment or derivative thereof having a capsid protein function, is linked / fused / associated with at least one RNA binding domain. As used herein, the term "RNA binding domain (also called aptamer binding protein (ABP))" refers to a structure, such as a peptide or polypeptide / protein, that can bind to a recruiting RNA motif (also called aptamer). RNA binding peptides or polypeptides / proteins show highly specific recognition of RNA targets by recognizing their sequence and structure. The specific binding of RNA binding peptides or polypeptides / proteins allows them to distinguish targets and regulate various cellular functions through controlling the generation, maturation, and life span of RNA transcripts.

[0031] Specifically, the term "RNA-binding domain (also called aptamer-binding protein (ABP))" as used herein refers to a viral capsid protein or capsid. The term "capsid" refers to one half of a binding pair that is linked / fused / associated to a viral capsid protein or a fragment or derivative thereof having capsid protein function, and is used to associate / contact an RNA element of interest with a viral capsid protein or a fragment or derivative thereof having capsid protein function via binding to the other half of the binding pair, i.e., a recruiting RNA motif (i.e., "corresponding motif") that is part of a circular RNA (circRNA) molecule that contains the RNA element of interest.

[0032] Preferably, the at least one RNA binding domain is selected from the group consisting of MS2 coat protein or an RNA binding section thereof, Ku protein or an RNA binding section thereof, Sm7 protein or an RNA binding section thereof, SfMu phage COM RNA binding protein or an RNA binding section thereof, and PP7 coat protein or an RNA binding section thereof.

[0033] The viral capsid protein, or a fragment or derivative thereof having capsid protein function, can be linked / fused / associated to at least one RNA binding domain via a linker.

[0034] The term "linker" as used herein refers to any structure that links a viral capsid protein, or a fragment or derivative thereof having a capsid protein function, with at least one RNA binding domain. The term "linker" includes, but is not limited to, chemical modifications, peptide linkers, chemical linkers, covalent bonds, or non-covalent bonds. Preferably, the bond is a covalent bond. More preferably, the linker is a flexible peptide linker with a sequence consisting mainly of a stretch of glycine and serine residues, but may contain additional amino acids such as threonine and alanine to maintain flexibility, and polar amino acids such as lysine and glutamic acid to improve solubility. The viral capsid protein, or a fragment or derivative thereof having a capsid protein function, and the RNA binding domain may also be present in the form of a protein fusion.

[0035] As used herein, the term "circular RNA (circRNA) molecule" refers to a type of single-stranded RNA that, unlike linear RNA, forms a covalently closed continuous loop. Specifically, in circular RNA, the 5' and 3' ends normally present in an RNA molecule are joined. Circular RNA (circRNA) molecules can be generated by non-sequential backsplicing, in which a downstream splice donor is linked to an upstream splice acceptor. Because circular RNA lacks the 5' and 3' ends, it is resistant to degradation by exonucleases and is more stable than most linear RNAs in cells.

[0036] In nature, circRNA biogenesis is mainly regulated by three different mechanisms: intron pairing-driven circularization, RNA-binding protein (RBP)-driven circularization, and lariat-driven circularization. CircRNAs sequester and absorb miRNAs, controlling their function. CircRNAs also interact with proteins to control their subcellular localization and activity. CircRNAs interact with RNA polymerase II (PolII) or U1 nucleolar ribonucleoprotein (snRNP) to promote the transcription of parent genes. CircRNAs play an important role in gene regulation by competing with the canonical splicing of pre-mRNAs. Interestingly, some circRNAs can encode proteins.

[0037] The circular RNA (circRNA) molecules described herein may be part of or contained within a virus-like particle (VLP). In particular, the circular RNA (circRNA) molecules described herein may be part of or contained within a virus-like particle (VLP). The molecules can be packaged into virus-like particles (VLPs), specifically artificial circular RNA (circRNA) molecules.

[0038] The circular RNA (circRNA) molecules described herein specifically comprise an RNA element of interest and / or a recruiting RNA motif that can bind / bind to at least one RNA-binding domain linked / fused / associated with a viral capsid protein or a fragment or derivative thereof having capsid protein function.

[0039] As used herein, the terms "recruit," "recruiting," or "recruitment" refer to attracting an element to another structure, e.g., using RNA-peptide or RNA-polypeptide / protein interactions. In this case, the RNA element of interest is recruited via the interaction of a recruiting RNA motif with an RNA-binding domain to a viral capsid protein, and thus, a circular RNA (circRNA) molecule containing the RNA element of interest is encapsidated / encapsulated within the capsid of a virus-like particle (VLP), as described herein.

[0040] As used herein, the term "recruiting RNA motif (also called aptamer)" refers to an element that exhibits high selectivity and specificity of affinity for a particular ligand or target. At the molecular level, the recruiting RNA motif / aptamer-ligand or recruiting RNA motif / aptamer-target interaction is mediated by non-covalent forces, such as electrostatic interactions, hydrophobic interactions, π-π orbital stacking, and / or hydrogen bonding interactions, among others.

[0041] In particular, the term "recruiting RNA motif (also called aptamer)" as used herein refers to a short, single-stranded RNA oligonucleotide (e.g., 25-70 bases) that can bind to a specific ligand or target via its 3D structure.

[0042] Specifically, the term "recruiting RNA motif (also called aptamer)" as used herein refers to one half of a binding pair used to recruit an RNA element of interest to a capsid protein to which the recruiting motif is bound, and the capsid protein is linked / fused / associated with the other half of the binding pair, an RNA binding domain (i.e., a "corresponding motif"). The recruiting RNA motif binds to the RNA binding domain, thus recruiting the RNA element of interest to a viral capsid protein or a fragment or derivative thereof having a capsid protein function. In other words, the recruiting RNA motif thus provides an association between the RNA element of interest and a viral capsid protein or a fragment or derivative thereof having a capsid protein function, thereby allowing the circular RNA (circRNA) molecule containing the RNA element of interest to be encapsidated / encapsulated into the capsid protein structure of a virus-like particle (VLP).

[0043] Preferably, the recruiting RNA motif is selected from the group consisting of an MS2 phage operator stem-loop, a telomerase Ku binding motif, a telomerase Sm7 binding motif, an SfMu phage COM stem-loop, and a PP7 phage operator stem-loop.

[0044] The RNA binding domain and the recruiting RNA motif may be a pair selected from the group above. More preferably, (i) at least one RNA-binding domain is an MS2 coat protein or an RNA-binding section thereof, and the recruiting RNA motif is an MS2 phage operator stem It is a loop. (ii) at least one RNA-binding domain is a Ku protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Ku-binding motif; (iii) at least one RNA-binding domain is an Sm7 protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Sm7-binding motif; (iv) at least one RNA-binding domain is an SfMu phage COM RNA-binding protein or an RNA-binding section thereof, and the recruiting RNA motif is an SfMu phage COM stem-loop; and / or (v) the at least one RNA-binding domain is a PP7 coat protein or an RNA-binding section thereof, and the recruiting RNA motif is a PP7 phage operator stem-loop.

[0045] For example, the coat protein of the RNA bacteriophage MS2 normally binds to a specific MS2 phage operator stem-loop structure in the viral RNA, and the coat protein of the RNA bacteriophage SfMu normally binds to a specific SfMu phage operator stem-loop structure in the viral RNA, to achieve genome encapsidation and translational repression of replicase synthesis.

[0046] Furthermore, the Ku protein normally binds to TLC1, the RNA portion of telomerase, and inhibition of Ku's ability to bind TLC1 reduces DNA repair by repairing telomeres.

[0047] Furthermore, in Saccharomyces cerevisiae, the telomerase RNA, TLC1, is normally associated with the Sm7 protein complex, which is required for stabilization of the predominant non-polyadenylated (poly(A)-) TLC1 isoform.

[0048] The term "RNA element of interest" as used herein refers to an RNA sequence. An RNA element of interest is of interest because it has a particular function or has a particular purpose. The function of the RNA element of interest is, for example, the inhibition of gene expression by application of antisense RNA. Alternatively, therapeutically active RNA may be applied to induce gene expression, for example to elicit an immune response. In one prominent example, the expression of the spike protein of SARS-CoV-2 is induced, eliciting an immune response against the SARS-CoV-2 virus.

[0049] A problem with RNA-based therapeutics so far has been the delivery of biologically active RNA molecules to the right cells, and therefore to the right organs, with a sufficiently high efficiency. In particular, the delivery of RNA in vivo is problematic, but if the delivery of RNA could be improved while keeping the cytotoxic effects at an acceptable level, in vitro approaches would also be significantly improved. Since RNases are highly efficient at degrading RNA molecules in a very short time, it is rather difficult to obtain long-term effects, necessitating repeated application of RNA-based therapeutics. A delivery mechanism that prevents the degradation of biologically active RNA molecules is highly desirable.

[0050] The aim of the present invention is to encapsidate / encapsulate an RNA element of interest within the virus-like particle (VLP) described herein, in particular within the capsid protein structure of the virus-like particle (VLP) described herein. In this way, the RNA element of interest is safely packaged and can be efficiently delivered to target cells, for example via the viral pathway. The RNA element of interest is further protected from exonuclease degradation, since it is part of a circular RNA (circRNA) molecule, which is a highly stable and covalently closed ring structure.

[0051] Preferably, the RNA element of interest is selected from the group consisting of coding RNA or non-coding RNA.More preferably, the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozyme.Thus, the RNA element of interest can code a product of interest in the form of a protein-coding RNA.The product of interest can be a protein of interest.The RNA of interest can be a non-coding RNA, for example, miRNA.Non-coding RNA is frequently used to silence the corresponding target gene.

[0052] As used herein, the term "heterologous RNA element of interest" refers to an RNA element that is derived from another natural source, e.g., another organism, or that has been removed from its natural context, such as by being fused to, attached to, or conjugated to another molecule, or that is not normally found in nature.

[0053] In particular, the term "heterologous RNA element of interest" as used herein refers to an RNA element that is not normally found in close association with a virus / virus-like particle (VLP) in nature.

[0054] In a preferred embodiment, the subject RNA elements described herein are heterologous RNA elements of interest.

[0055] When a viral capsid protein or a fragment or derivative thereof having capsid protein function is fused / associated with at least one RNA binding domain, and the at least one RNA binding domain binds / interacts with the recruiting RNA motif, the RNA element of interest comes into contact with the capsid protein, and thus a circular RNA (circRNA) molecule comprising the RNA element of interest is encapsidated / encapsulated within the virus-like particle capsid structure as described herein.

[0056] The term "binding" in the present invention preferably relates to specific binding. "Specific binding" means that a compound (e.g., an RNA binding domain, also called aptamer binding protein (ABP)) binds more strongly to a target (e.g., a recruiting RNA motif, also called aptamer) that is specific for it compared to binding to other targets. A compound binds more strongly to a first target than to a second target if the dissociation constant (Kd) of the compound binding to the first target is lower than the dissociation constant of the second target. Preferably, the dissociation constant (Kd) of the compound to the target that it specifically binds to is 10 times or more lower, preferably 20 times or more lower, more preferably 50 times or more lower, even more preferably 100 times, 200 times, 500 times or more lower than 1000 times lower than the dissociation constant (Kd) of the compound to the target that it does not specifically bind to.

[0057] The term "Kd" (usually measured in "mol / L" and sometimes abbreviated as "M") is intended to refer to the dissociation equilibrium constant of a particular interaction between a compound (e.g., a compound of the invention) and a target molecule.

[0058] Methods for determining the binding affinity of a compound, i.e., for determining the dissociation constant Kd, are known to those skilled in the art and can be selected from the above methods known in the art, such as surface plasmon resonance (SPR)-based techniques, biolayer interferometry (BLI), enzyme-linked immunosorbent assay (ELISA), flow cytometry, isothermal titration calorimetry (ITC), analytical ultracentrifugation, radioimmunoassay (RIA or IRMA), and enhanced chemiluminescence (ECL). Usually, the dissociation constant Kd is determined at 20°C, 25°C, 30°C, or 37°C.

[0059] Circular RNA molecules comprising an RNA element of interest and / or a recruiting RNA motif as described herein can be generated from a linear polynucleotide capable of circularization.

[0060] As used herein, the term "linear polynucleotide capable of circularization" (specifically in the context of covalent circularization) refers to a DNA or RNA polynucleotide that can form a circular structure in which the 5' and 3' ends, particularly the 5' and 3' ends of one of its exons, are covalently linked to each other.

[0061] Such circular structures can be achieved by backsplicing, such as protein-assisted backsplicing and autocatalytic backsplicing. Backsplicing requires that a linear polynucleotide contains 5' and 3' backsplicing intron sequences. Backsplicing generates a circular polynucleotide from a linear polynucleotide, particularly an exon of a linear polynucleotide, when a 5' backsplicing intron sequence is joined to an upstream 3' backsplicing intron sequence.

[0062] Thus, to allow for circularization, the linear polynucleotides described herein are specifically comprised, in 5' to 3' order: The first backsplicing intron sequence, The first part of the recruiting RNA motif, a nucleotide sequence of interest, a second portion of the recruiting RNA motif, and Contains a second back-spliced ​​intron sequence.

[0063] A linear polynucleotide capable of being circularized as described herein can be a DNA or RNA polynucleotide.

[0064] The backsplicing intron sequence is preferably an intron containing a splice site with short inverted repeats such as Alu elements to allow protein-assisted circularization of the exon. More preferably, the backsplicing intron sequence is from the human ZKSCAN1 gene. In humans, exons 2 and 3 of ZKSCAN1 are spliced ​​together to form a covalently linked 668nt circular RNA called circZKSCAN1 via protein-assisted backsplicing. The ZKSCAN1 intron is rearranged posttranscriptionally to circularize the heterologous single internal exon by a protein-assisted backsplicing reaction. Even more preferably, the first backsplicing intron sequence has a nucleotide sequence according to SEQ ID NO: 34 or a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto. and / or the second backsplicing intron sequence has a nucleotide sequence according to SEQ ID NO: 35 or is a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0065] Alternatively, the autocatalytic backsplicing intron sequence is preferably derived from a group I or group II intron. More preferably, the autocatalytic backsplicing intron sequence is derived from the group I intron T4 of the bacteriophage T4td gene. Since the intron is split and rearranged, post-transcription, the group I intron is spliced. The loop I splicing reaction circularizes the single internal exon. Even more preferably, the first autocatalytic backsplicing intron sequence has a nucleotide sequence according to SEQ ID NO: 43 or a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto. and / or the second backsplicing intron sequence has a nucleotide sequence according to SEQ ID NO: 44 or is a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0066] The term "protein-assisted backsplicing" as used herein refers to backsplicing controlled by splicing factors. circRNAs are generated by splicing pre-mRNAs in reverse order across exons. As a variation of linear splicing, protein-assisted backsplicing requires the assembly of a spliceosome. Two adjacent backspliced ​​intron sequences are required to generate circular RNA.

[0067] The term "autocatalytic backsplicing" as used herein refers to backsplicing in the absence of splicing factors. Preferably, circRNAs are generated from linear RNAs containing self-splicing group I or group II introns. Group I and group II introns are two types of RNA enzymes, ribozymes, that catalyze their own splicing by different mechanisms. Adjacent self-splicing group I and group II introns contained in linear RNA molecules can be obtained or derived from any organism, such as bacteria, bacteriophages, and eukaryotes. The group I intron of the phage T4 thymidylate synthase (td) gene is suitable for circularizing RNA. When the order of the td intron is swapped to be adjacent to any exon sequence, the exon is circularized by autocatalytic transesterification.

[0068] As used herein, the term "circular RNA (circRNA) molecule" may also refer to a type of single-stranded RNA that, unlike cellular linear RNA, is artificially designed to self-anneal into a stable non-covalent ring even in the absence of one or more RNA-binding proteins, such as cap-binding protein or polyA-binding protein.

[0069] The term "circularizable linear polynucleotide" as used herein (specifically in the context of non-covalent circularization) refers to a DNA or RNA (or mixed DNA and RNA) polynucleotide whose 5' and 3' ends can form associated circular structures in a non-covalent manner with high stability. For example, such non-covalent structures are formed when the RNA ends entwine together into highly stable pseudoknots, G-quadruplexes, or base triplets, similar to those observed in the RNA component (TR) of the telomerase ribonucleoprotein complex (consisting of TERT, TR, and cofactors) or the 3' end of the MALAT1 transcript. The difference with naturally occurring pseudoknots, G-quadruplexes, or base triplets is that both ends cooperate to form such structures (whereas in naturally occurring RNA, only a continuous internal stretch, or end, folds back on itself independently of the opposite end). Non-covalent structures can also be formed when the two ends are designed to fold into a chelating shape that binds to a common (linking) entity, such as an aptamer, or free nucleotide or other small molecule.

[0070] The circularization structure in the context of noncovalent RNA circles functions to prevent exposure of the 5' end of uncapped or uncapped synthetic or natural RNA (usually with the chemical structure 5'-monophosphate, 5'-diphosphate, or 5'-triphosphate) and, at the same time, to prevent exposure of the 3' end, with or without a polyA tail. Thus, the definition of having a stable, noncovalently closed circle is that such a circular RNA is not susceptible to either 5' or 3' exonucleases, whereas a linear polynucleotide in the same preparation would be digested.

[0071] Furthermore, the circular structure in the context of non-covalently bound RNA circles can function as a recruiting RNA motif (also called an aptamer). Although the 5' or 3' end itself does not bind to an RNA binding domain, the circular structure can be recognized and recruited to a nucleotide / protein interaction. The recruitment can then be further utilized for encapsidation as a virus-like particle (VLP). Nucleotide binding motifs for recruiting non-covalently closed circular RNA to VLPs can be obtained, for example, from proteins known to bind to RNA triple helices. Such protein domains can be found, for example, in the yeast ribosome binding protein Stm1p27, or in the splicing factors PSF, P54nrb, or U2AF6529. Nucleotide binding motifs for recruiting circular RNA with G-quadruplex closures can be found, for example, in the proteins AVEN, CNBP, DDX21, DDX3X, DHX36, FMRP, nucleolin, or G3BP1.

[0072] The term "nucleotide sequence of interest" as used herein refers to a DNA or RNA sequence. A DNA sequence can code for an RNA element or a protein. The RNA element or protein encoded by the DNA sequence is of interest because it has a specific function. If the nucleotide sequence of interest is an RNA sequence, the RNA sequence itself can exert a specific function as an RNA element or can code for a protein. The function of the RNA element is, for example, the inhibition of gene expression by application of antisense RNA. Alternatively, therapeutically active RNA can be applied to induce gene expression, for example, to elicit an immune response. In one prominent example, the expression of the spike protein of SARS-CoV-2 is induced, eliciting an immune response against the SARS-CoV-2 virus.

[0073] Preferably, the RNA element of interest is selected from the group consisting of coding RNA or non-coding RNA. More preferably, the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozyme. Thus, the RNA element of interest may code a product of interest. The product of interest may be a polypeptide of interest or a protein of interest. The RNA element of interest may be a non-coding RNA, such as miRNA or RNA complementary to miRNA. Non-coding RNA is frequently used to silence a corresponding target gene or to silence or improve the expression of a group of genes.

[0074] In the circularizable linear polynucleotides described herein, the recruitment RNA motif is divided into two parts, a "first part of the recruitment RNA motif" and a "second part of the recruitment motif," in a manner that does not have a significant recruitment function by itself. For example, the recruitment motif can be divided as follows:

[0075] [Table 1] TIFF2025506798000002.tif222164TIFF2025506798000003.tif204165

[0076] The first portion of the recruiting RNA motif and the second portion of the recruiting RNA motif form a functional recruiting RNA motif after circularization.

[0077] The term "recruitment RNA motif" is defined above. The term "functional recruitment RNA motif" as used herein refers to a recruitment RNA motif that can (specifically) bind to an RNA-binding domain. The term "RNA-binding domain" is also defined above. The advantage of this circularization approach is that the recruitment RNA motif is only functional after circularization, since it is completed by circularization. Thus, only circular RNA is packaged into virus-like particles (VLPs). This improves the quality of the circular RNA delivery approach, as described here.

[0078] The term "vector" as used herein refers to a structure for introducing genetic material into a cell. As used herein, the term "vector" includes viral vectors and plasmid vectors. Plasmids with specially constructed features are often used in laboratories for cloning purposes. These plasmids are generally non-conjugative, but may have more features, particularly multiple cloning sites, where multiple restriction enzyme cleavage sites allow for the insertion of transgene inserts. Plasmids may be used specifically as transcription vectors, and such plasmids may lack sequences important for protein expression. Plasmids used for protein expression are called expression vectors and contain elements for protein translation, such as ribosome binding sites, start codons, and stop codons. Viral vectors are generally genetically engineered viruses that carry viral DNA or RNA modified to be non-infectious, but also contain viral promoters and transgenes, allowing translation of the transgene via the viral promoter. However, viral vectors often lack infectious sequences, so helper viruses or packaging lines are required for large-scale transfection. Baculoviruses can be used as viral vectors.

[0079] Residues of two or more polypeptides or polynucleotides are said to "correspond" to each other if these residues occupy similar positions in the polypeptide or polynucleotide structure. It is well known in the art that similar positions of two or more polypeptides or polynucleotides can be determined by aligning the polypeptide or polynucleotide sequences based on the similarity of their amino acid or nucleotide sequences. Such alignment tools are well known to those skilled in the art and can be obtained, for example, on the World Wide Web, for example, ClustalW (www.ebi.ac.uk / clustalw) or Align (http: / / www.ebi.ac.uk / emboss / align / index.html), using standard settings, and include Align EMBOSS: needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 10.0, and others. 0.5 is preferable.

[0080] As used herein, the term "naturally-occurring," when applied to an object, refers to the fact that the object is found in nature. For example, a polypeptide or polynucleotide sequence that can be isolated from a natural source and is present in an organism (including viruses) that has not been intentionally modified by man in the laboratory is naturally-occurring.

[0081] As used herein, the term "artificial," when applied to an object, refers to the fact that the object does not exist in nature. For example, a polypeptide or polynucleotide sequence that can be isolated from a natural source, that has been intentionally modified by humans in a laboratory, and that is present in an organism (including a virus) is artificial. A polypeptide or polynucleotide sequence that has been generated by humans in a laboratory (e.g., chemically synthesized) is also artificial.

[0082] As used herein, the term "treatment", particularly "therapeutic treatment", refers to any therapy that improves the health and / or prolongs (increases) the lifespan of a subject suffering from a disease. The therapy can eliminate the disease in the subject, prevent or slow the progression of the disease in the subject, inhibit the progression of the disease in the subject, reduce the severity of symptoms in a subject suffering from a disease, and / or reduce recurrence in a subject currently suffering from or previously suffering from a disease. Preferably, the treatment is selected from the group consisting of gene therapy, cell therapy, cancer therapy, and treatment of a disease, such as an infectious disease caused by a bacterium or a virus, such as SARS-CoV-2.

[0083] The present invention relates to the use of the virus-like particles (VLPs) described herein as pharmaceuticals. The term "medicine" as used herein refers to a substance used in therapy, i.e., in the treatment, amelioration or prevention of a disease or disorder. In particular, the present invention relates to the virus-like particles (VLPs) used in therapy as described herein. Alternatively, the present invention relates to the virus-like particles (VLPs) used in vaccination as described herein. In this regard, it should be noted that the active ingredient is usually not the VLP itself, but the RNA element of interest that is part of the circular RNA molecule contained therein.

[0084] The term "vaccine" as used herein refers to an agent that can be used to induce protective immunity in a recipient, such as a human or animal. For a vaccine to be effective, it must induce immunity in a portion of the immunized population. This is because some individuals may not be able to mount a strong or protective immune response, or in some cases may not be able to mount an immune response at all. This inability may be due to the recipient's genetic background, or to an immunocompromised state (acquired or congenital) or immunosuppression (such as due to chemotherapy treatment or the use of immunosuppressants). Vaccine efficacy can be established in animal models.

[0085] The term "vaccination" as used herein means administering a vaccine to a recipient, such as a human or animal recipient, to induce specific immunity. In the context of the present invention, the recipient may be administered a virus-like particle (VLP) that further comprises an RNA element of interest. In one embodiment, the RNA element of interest is a sequence against which protective immunity is elicited.

[0086] As used herein, the terms "for administration" and "administered" are synonymous with "formulated for administration." In other words, a statement that an active compound is "for administration" should be understood to mean that the active compound is prepared and formulated in a dose such that it is in a state in which it can exert its therapeutic activity. In the context of the present invention, the virus-like particles (VLPs) described herein can be prepared for administration.

[0087] The term "therapeutically effective amount" or "therapeutic amount" is intended to mean an amount of a drug or pharmaceutical agent that elicits a biological or medical response in a tissue, system, animal, or human that is desired by a researcher, veterinarian, physician, or other clinician. The administration regimen using the virus-like particles (VLPs) described herein can be selected by a skilled physician according to a variety of factors, including the type, species, age, weight, BMI, sex, and condition of the subject; the severity of the condition to be treated; the potency of the compound selected to be administered, the route of administration, the purpose of administration, and the renal and hepatic function of the subject. In the context of the present invention, the virus-like particles (VLPs) described herein can be administered or prepared to be administered in a therapeutically effective / therapeutic amount.

[0088] Compositions, particularly pharmaceutical compositions, comprising the virus-like particles (VLPs) described herein can include one or more excipients, diluents, and / or carriers, all of which are preferably pharma- ceutically acceptable. As used herein, the term "pharmaceutical acceptable" means approved by a federal or state regulatory agency or listed in the United States Pharmacopoeia, the European Pharmacopoeia (Ph. Eur.), or other pharmacopoeias generally recognized for use in animals, particularly humans.

[0089] As used herein, the term "excipient" is intended to refer to all substances in a pharmaceutical composition other than the active ingredient, such as binders, lubricants, thickeners, surfactants, preservatives, emulsifiers, buffers, flavoring agents, coloring agents, etc.

[0090] As used herein, the term "diluent" refers to a diluent and / or thinning agent. Additionally, the term "diluent" includes a solution, a suspension (eg, a liquid or solid suspension) and / or a medium.

[0091] The term "carrier" as used herein refers to one or more compatible solid or liquid fillers suitable for administration, for example to humans. The term "carrier" refers to a natural or synthetic organic or inorganic component with which the active ingredient is combined to facilitate application of the active ingredient or penetration of the active ingredient into the intended site of action. Preferably, the carrier component is a sterile liquid such as water or oil, including those of mineral, animal, or vegetable origin (peanut oil, soybean oil, sesame oil, sunflower oil, etc.). Salt solutions, aqueous dextrose and glycerin solutions can also be used as aqueous carrier compounds. A carrier compound that improves or promotes skin penetration in topical applications is dimethyl sulfoxide (DMSO). Another preferred carrier consists of layered double hydroxide (LDH) nanoparticles. For example, such LDH nanoparticles are prepared by dissolving [Mg 3 Al(OH) 8 ](CH 3 CHOHCOO), which can be prepared, for example, by controlling the pH with NaOH at 45-65°C and CO2 and can be obtained by reaction of magnesium lactate trihydrate with aluminum lactate, protected from carbonic acid. Circular RNA can be inserted into LDH nanoparticles and administered as LDH nanoparticles or coadministered with VLPs.

[0092] Pharmaceutically acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical industry and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R Gennaro, ed., 1985). Examples of suitable carriers include, for example, magnesium carbonate, magnesium stearate, talc, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, low melting waxes, cocoa butter, etc. Examples of suitable diluents include ethanol, glycerol, water, etc.

[0093] Pharmaceutical carriers, diluents, and / or excipients can be selected taking into consideration the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions of the present invention can include any suitable binder, lubricant, suspending agent, coating agent, and / or solubilizing agent as, or in addition to, the carrier, excipient, or diluent. Examples of suitable binders include starch; gelatin; natural sugars such as glucose, lactose, sucrose, trehalose; corn sweeteners; natural and synthetic gums such as acacia, tragacanth, or sodium alginate; carboxymethylcellulose; and polyethylene glycol. Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like. Preservatives, stabilizers, dyes, and even flavorings can also be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid, p-hydroxybenzoic acid esters, and the like. Antioxidants and suspending agents may also be used.

[0094] As used herein, the term "subject" refers to any individual who may be administered a virus-like particle (VLP) as described herein. As used herein, the term "subject" refers to any individual who may benefit from treatment with a virus-like particle (VLP) as described herein. The subject may be a vertebrate, such as a human, dog, cat, sheep, goat, cow, horse, camel, pig, etc. It is particularly preferred that the "subject" is a human. As used herein, the terms "subject," "individual," or "patient" are used interchangeably. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0095] The present invention will now be described further. In the following text, the various aspects of the present invention are defined in more detail. Each aspect thus defined can be combined with other aspects, unless expressly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous can be combined with any other feature indicated as being preferred or advantageous, unless expressly indicated to the contrary.

[0096] The inventors have surprisingly found that circular RNAs (circRNAs) can be packaged into virus-like particles (VLPs). By incorporating a recruiting RNA motif into the molecule to be packaged, circRNAs, such as coding or non-coding circRNAs, can be selectively packaged into VLPs. The recruiting RNA motif only becomes functional upon circularization, and the molecule to be packaged is only packaged in a circularized state. Surprisingly, these RNAs can also be packaged into the envelope of DNA viruses. These VLPs can deliver (therapeutic) circRNA molecules in vivo or in vitro.

[0097] Thus, in a first aspect, the present invention provides a method for the preparation of a nucleic acid sequence comprising, in 5' to 3' order: The first backsplicing intron sequence, The first part of the recruiting RNA motif, a nucleotide sequence of interest, a second portion of the recruiting RNA motif, and Second back-spliced ​​intron sequence With respect to a (linear) polynucleotide (capable of circularization) comprising Here, the first portion of the recruit RNA motif and the second portion of the recruit RNA motif form a functional recruit RNA motif after circularization.

[0098] The (linear) polynucleotide (which can be circularized) can be a DNA or an RNA (or a mixed DNA and RNA) polynucleotide. Preferably, the (linear) polynucleotide is a DNA polynucleotide.

[0099] A (linear) polynucleotide (capable of circularization) can be a DNA or RNA (or mixed DNA and RNA) polynucleotide that can form a circular structure with its 5' and 3' ends covalently linked to each other. Alternatively, the (linear) (circularizable) polynucleotide may be a DNA or RNA (or mixed DNA and RNA) polynucleotide that can form a highly stable associated circular structure non-covalently linked at its 5' and 3' ends. Preferably, the (linear) (circularizable) polynucleotide is a DNA or RNA (or mixed DNA and RNA) polynucleotide that can form a circular structure with its 5' and 3' ends covalently linked to each other.

[0100] In particular, when a 5' backsplicing intron sequence is joined to an upstream 3' backsplicing intron sequence, a circular polynucleotide is generated from a linear polynucleotide, specifically an exon of a linear polynucleotide, by backsplicing.

[0101] The 5' and 3' ends, especially the 5' and 3' ends of one of the exons, can be covalently linked to each other by joining the first back-spliced ​​intron sequence to the second back-spliced ​​intron sequence. Thousands of circRNAs are known to be expressed in eukaryotic cells. Publicly available circRNA datasets and the corresponding back-spliced ​​intron sequences can be found, for example, in circBase (http: / / www.circbase.org / ).

[0102] To allow protein-assisted circularization of the exon, the back-splicing intron sequence is preferably an intron containing a splice site with short inverted repeats such as Alu elements. More preferably, the back-splicing intron sequence is from the ZKSCAN1 gene, for example the human ZKSCAN1 gene. The ZKSCAN1 gene belongs to the zinc finger family of genes. Even more preferably, the first back-splicing intron sequence has a nucleotide sequence as set forth in SEQ ID NO: 34 or has at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. , and / or the second backsplicing intron sequence has the nucleotide sequence set forth in SEQ ID NO: 35 or is a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0103] Alternatively, the autocatalytic backsplicing intron sequence is preferably derived from a group I or group II intron. More preferably, the autocatalytic backsplicing intron sequence is derived from the group I intron T4 of the bacteriophage T4td gene. The intron is split and rearranged so that after transcription, a single internal exon is circularized by a group I splicing reaction. Even more preferably, the first autocatalytic backsplicing intron sequence has a nucleotide sequence as set forth in SEQ ID NO: 43 or a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. and / or the second backsplicing intron sequence has the nucleotide sequence set forth in SEQ ID NO: 44 or is a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0104] The nucleotide sequence of interest can be a DNA sequence or an RNA sequence. A DNA sequence may code for an RNA element or a protein. The RNA element or protein encoded by the DNA sequence has a specific function and is therefore of interest. If the nucleotide sequence of interest is an RNA sequence, the RNA sequence itself may exert a specific function as an RNA element or may code for a protein. The function of the RNA element is, for example, the inhibition of gene expression by application of antisense RNA. Alternatively, therapeutically active RNA may be applied to induce gene expression, for example to elicit an immune response. In one prominent example, the expression of the spike protein of SARS-CoV-2 is induced, eliciting an immune response against the SARS-CoV-2 virus. Preferably, the RNA element of interest is selected from the group consisting of coding RNA or non-coding RNA. More preferably, the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozyme. Thus, the RNA element of interest is The RNA element of interest may be a non-coding RNA, such as miRNA. Non-coding RNA is often used to silence corresponding target genes.

[0105] In the (linear) polynucleotide (capable of circularization), the recruitment RNA motif is split into a first part of the recruitment RNA motif and a second part of the recruitment RNA motif, which parts no longer have a significant recruitment function by themselves. The first part of the recruitment RNA motif and the second part of the recruitment RNA motif form a functional recruitment RNA motif after circularization. Only the functional recruitment RNA motif can be (specifically) bound, preferably via a linker, to an RNA binding domain linked / fused / associated with a viral capsid protein or a fragment or derivative thereof with a capsid protein function, and thus can be encapsidated / encapsulated in a virus-like particle (VLP) as part of a circular RNA (circRNA) molecule, as described herein.

[0106] In one embodiment, the polynucleotide comprises an internal ribosome entry site (IRES) or N6-methyladenosine (m6a) for translation initiation between the first portion of the recruiting RNA motif and the nucleotide sequence of interest, which is particularly necessary when the nucleotide sequence of interest encodes a protein.

[0107] In a (further or additional) embodiment, the polynucleotide comprises a promoter at the 5' end and / or a polyA tail at the 3' end. This is particularly necessary if the nucleotide sequence of interest encodes a protein.

[0108] In a preferred embodiment, the circularization of a (linear) polynucleotide, in particular the circularization of one of the exons of a (linear) polynucleotide into a circular polynucleotide, can be achieved by protein-assisted backsplicing or autocatalytic backsplicing (see definition above).

[0109] In another preferred embodiment, the polynucleotide does not contain an in-frame stop codon to allow rolling circle translation after circularization. If a protease target site, ribosome shift or ribosome skipping sequence is incorporated into the open reading frame, multiple proteins can be translated by rolling circle translation. An example of a ribosome skipping sequence is the F2A (or 2A-like) sequence of foot and mouth disease virus (FMDV). An example of a ribosome shift sequence is a leaky tandem stop / start codon with the UGAUGA sequence.

[0110] In a more preferred embodiment, the recruitment RNA motif is selected from the group consisting of MS2 phage operator stem loop, telomerase Ku binding motif, telomerase Sm7 binding motif, SfMu phage COM stem loop, and PP7 phage operator stem loop. For example, the recruitment motif can be divided as follows:

[0111] [Table 2] TIFF2025506798000005.tif221163TIFF2025506798000006.tif203163

[0112] The (linear) polynucleotide (which can be circularized) preferably has a length of 100 to 50,000 nucleotides, more preferably 100 to 5,000 nucleotides, and even more preferably 100 to 2,000 nucleotides.

[0113] In a second aspect, the present invention relates to a vector comprising the polynucleotide of the first aspect.

[0114] In a third aspect, the present invention relates to an artificial circular RNA molecule comprising an RNA element of interest and a recruiting RNA motif.

[0115] An artificial circular RNA molecule comprising an RNA element of interest and a recruiting RNA motif may be generated from a (linear) polynucleotide (capable of circularization) according to the first embodiment.

[0116] An artificial circular RNA molecule is a type of single-stranded RNA that, unlike linear RNA, forms a continuous loop closed by covalent bonds. Alternatively, an artificial circular RNA molecule is a type of single-stranded RNA that, unlike linear RNA, forms a continuous loop closed by non-covalent bonds (see the first embodiment).

[0117] The RNA element of interest has a specific function or has a specific purpose, and therefore is of interest.The function of the RNA element of interest is, for example, the inhibition of gene expression by applying antisense RNA.Alternatively, therapeutically active RNA can be applied to induce gene expression, for example to induce immune response. The RNA element of interest may be a coding or a non-coding RNA element. Preferably, the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes.

[0118] The recruiting RNA motif is part of the artificial circular RNA molecule together with the target RNA element.Specifically, the recruiting RNA motif contained in the artificial circular RNA molecule can be (specifically) bound to the RNA binding domain that is linked / fused / associated with the capsid protein of the virus or its fragment or derivative with capsid protein function, preferably via a linker.In this way, the artificial circular RNA molecule can be encapsidated / encapsulated in the capsid protein structure of the virus-like particle.

[0119] Preferably, the recruitment RNA motif is selected from the group consisting of an MS2 phage operator stem loop, a telomerase Ku binding motif, a telomerase Sm7 binding motif, an SfMu phage COM stem loop, and a PP7 phage operator stem loop.

[0120] More preferably, the recruiting RNA motif has a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or a transcribed nucleotide sequence thereof) and a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0121] Recruitment RNA motifs having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or their transcribed nucleotide sequences) can be referred to as recruitment RNA motif variants. Such recruitment RNA motif variants are still capable of (specifically) binding to the RNA binding domain as described above. The Examples section, for example, provides ample information in this regard.

[0122] Specifically, the MS2 phage operator stem loop and the telomerase Ku binding motif The recruiting RNA motif selected from the group consisting of a telomerase Sm7 binding motif, an SfMu phage COM stem-loop, and a PP7 phage operator stem-loop is combined with a target RNA element selected from the group consisting of an shRNA, an miRNA, a protein-coding RNA, a pre-miRNA, a piRNA, an RNA complementary to another non-coding RNA, and a ribozyme that is part of or contained in an artificial circular RNA molecule.

[0123] As described above, the recruiting RNA motif contained in the artificial circular RNA molecule can be (specifically) bound, preferably via a linker, to an RNA-binding domain linked / fused / associated with a viral capsid protein or a fragment or derivative thereof having capsid protein function.

[0124] Preferably, the at least one RNA binding domain is selected from the group consisting of MS2 coat protein or an RNA binding section thereof, Ku protein or an RNA binding section thereof, Sm7 protein or an RNA binding section thereof, SfMu phage COM RNA binding protein or an RNA binding section thereof, and PP7 coat protein or an RNA binding section thereof.

[0125] More preferably, the at least one RNA binding domain has an amino acid sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, and amino acid sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0126] An RNA-binding domain having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, can be referred to as an RNA-binding domain variant. Such an RNA-binding domain variant can still (specifically) bind to the recruiting RNA motif as described above. The Examples section, for example, provides ample information in this regard.

[0127] In one preferred embodiment, (i) at least one RNA-binding domain (to which the recruitment RNA motif can bind) is an MS2 coat protein or an RNA-binding section thereof, and the recruitment RNA motif is an MS2 phage operator stem-loop; (ii) at least one RNA-binding domain (to which the recruiting RNA motif can bind) is a Ku protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Ku-binding motif; (iii) at least one RNA-binding domain (to which the recruiting RNA motif can bind) is an Sm7 protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Sm7-binding motif; (iv) at least one RNA-binding domain (to which the recruitment RNA motif can bind) is an SfMu phage COM RNA-binding protein or an RNA-binding section thereof, and the recruitment RNA motif is an SfMu phage COM stem-loop; and / or (v) at least one RNA-binding domain (to which the recruiting RNA motif can bind); ) is the PP7 coat protein or an RNA-binding section thereof, and the recruiting RNA motif is the PP7 phage operator stem-loop.

[0128] In a more preferred embodiment, at least one RNA-binding domain (to which a recruiting RNA motif can bind) has an amino acid sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16 and amino acid sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto; and / or The recruiting RNA motif has a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or a transcribed nucleotide sequence thereof) and a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0129] The artificial circular RNA molecule preferably has a length of 50 to 50,000 nucleotides, more preferably 50 to 5,000 nucleotides, and even more preferably 50 to 2,000 nucleotides.

[0130] In a fourth aspect, the present invention relates to a complex comprising or a complex of (i) and (ii): (i) a polypeptide comprising a viral capsid protein or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain (e.g., one, two, or three RNA binding domains); (ii) an (artificial) circular RNA molecule containing the RNA element of interest; Specifically, the circular RNA molecule is an artificial circular RNA molecule, preferably an artificial circular RNA molecule according to the third aspect.

[0131] In one embodiment, at least one RNA binding domain is linked / fused / associated, preferably via a linker, to a viral capsid protein or a fragment or derivative thereof having capsid protein function.

[0132] In a preferred embodiment, at least one RNA binding domain is linked / fused / associated, preferably via a linker, to the N-terminus and / or C-terminus of a viral capsid protein or a fragment or derivative thereof having capsid protein function.

[0133] Any linker can be used to link the viral capsid protein or a fragment or derivative thereof having a capsid protein function with at least one RNA binding domain. In an exemplary embodiment, the linker has an amino acid sequence according to SEQ ID NO:5.

[0134] Specifically, a polypeptide comprising a viral capsid protein or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain is present / produced as a fusion polypeptide. In particular, in a polypeptide comprising a viral capsid protein or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain, the viral capsid protein or capsid The polypeptide in which a functional fragment or derivative thereof is linked via a linker to at least one RNA binding domain is present / produced as a fusion polypeptide.

[0135] The at least one RNA binding domain can be a naturally occurring RNA binding domain or an artificial RNA binding domain.

[0136] Preferably, the at least one RNA binding domain is selected from the group consisting of MS2 coat protein or its RNA binding section, Ku protein or its RNA binding section, Sm7 protein or its RNA binding section, SfMu phage COM RNA binding protein or its RNA binding section, and PP7 coat protein or its RNA binding section. Thus, the polypeptide comprises a viral capsid protein, or a fragment or derivative thereof having a capsid protein function, and at least one RNA binding domain, and the at least one RNA binding domain is preferably selected from the group consisting of MS2 coat protein or its RNA binding section, Ku protein or its RNA binding section, Sm7 protein or its RNA binding section, SfMu phage COM RNA binding protein or its RNA binding section, and PP7 coat protein or its RNA binding section. The RNA binding domain can be linked to the viral capsid protein, or a fragment or derivative thereof having a capsid protein function, via a linker or without a linker.

[0137] As mentioned above, the (artificial) circular RNA molecule comprises the RNA element of interest. In one embodiment, the (artificial) circular RNA molecule comprising the RNA element of interest further comprises a recruiting RNA motif. The recruiting RNA motif contained in the artificial circular RNA molecule (specifically) binds to an RNA binding domain linked / fused / associated with a viral capsid protein or a fragment or derivative thereof having a capsid protein function. In this way, the artificial circular RNA molecule forms a complex with the capsid protein structure.

[0138] The RNA elements of interest are of interest because they have a specific function or serve a specific purpose. The function of the RNA elements of interest can be, for example, the inhibition of gene expression by application of antisense RNA. Alternatively, therapeutically active RNA can be applied to induce gene expression, for example to elicit an immune response.

[0139] The RNA element of interest may be a coding or a non-coding RNA element. Preferably, the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes.

[0140] Preferably, the recruitment RNA motif is selected from the group consisting of an MS2 phage operator stem loop, a telomerase Ku binding motif, a telomerase Sm7 binding motif, an SfMu phage COM stem loop, and a PP7 phage operator stem loop.

[0141] More preferably, the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozyme, and the recruiting RNA motif is selected from the group consisting of MS2 phage operator stem loop, telomerase Ku binding motif, telomerase Sm7 binding motif, SfMu phage COM stem loop, and PP7 phage operator stem loop.

[0142] In one preferred embodiment, (i) at least one RNA-binding domain in the polypeptide is an MS2 coat protein or an RNA-binding section thereof, and the recruiting RNA motif (to which the at least one RNA-binding domain binds) is an MS2 phage operator stem-loop; (ii) at least one RNA-binding domain contained in the polypeptide is a Ku protein or an RNA-binding section thereof, and the recruiting RNA motif (to which the at least one RNA-binding domain binds) is a telomerase Ku-binding motif; (iii) at least one RNA-binding domain in the polypeptide is an Sm7 protein or an RNA-binding section thereof, and the recruiting RNA motif (to which the at least one RNA-binding domain binds) is a telomerase Sm7-binding motif; (iv) at least one RNA-binding domain contained in the polypeptide is an SfMu phage COM RNA-binding protein or an RNA-binding section thereof, and the recruiting RNA motif (to which the at least one RNA-binding domain binds) is an SfMu phage COM stem-loop; and / or (v) at least one RNA-binding domain comprised in the polypeptide is a PP7 coat protein or an RNA-binding section thereof, and the recruiting RNA motif (to which the at least one RNA-binding domain binds) is a PP7 phage operator stem-loop.

[0143] In a more preferred embodiment, At least one RNA-binding domain has an amino acid sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, and amino acid sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto; and / or The RNA motif has a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or a transcribed nucleotide sequence thereof) and nucleotide sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0144] The virus can be a DNA virus or an RNA virus. In yet another embodiment, The DNA virus is selected from the group consisting of papovaviruses, papillomaviruses, polyomaviruses, adenoviruses, and parvoviruses, or The RNA virus is a retrovirus, a norovirus, or an orthomyxovirus.

[0145] In a preferred embodiment, The polyomavirus is Simian virus 40 (SV40), BK virus (BKV), JC virus (JCV), or MPy virus (MPyV); Parvoviruses include adeno-associated viruses (AAVs), Retroviruses include lentiviruses, Norovirus is also known as Norwalk virus or The orthomyxovirus is an influenza A or influenza B virus.

[0146] The capsid protein may be a capsid protein of an RNA or DNA virus. In another embodiment, the capsid protein of a DNA virus is selected from the group consisting of a papovavirus capsid protein, a papillomavirus capsid protein, a polyomavirus capsid protein, an adenovirus capsid protein, and a parvovirus capsid protein; or The capsid protein of an RNA virus is a lentiviral capsid protein.

[0147] In one preferred embodiment, (i) the parvovirus capsid protein is an adeno-associated virus capsid protein, preferably an AAV9 capsid protein; (ii) the polyomavirus capsid protein is an SV40 capsid protein, a BKV capsid protein, a JCV capsid protein, or an MPyV capsid protein; or (iii) The lentiviral capsid protein is a nucleocapsid (NC) protein, a matrix protein (MA), or a capsid protein (CA).

[0148] In a further preferred embodiment, (i) AAV9 capsid protein includes AAV9 VP1 capsid protein, AAV9 VP2 capsid protein, or AAV9VP3 capsid protein; (ii) the SV40 capsid protein is an SV40 VP1 capsid protein, an SV40 VP2 capsid protein, or an SV40VP3 capsid protein; (iii) the BKV capsid protein is a BKV VP1 capsid protein, a BKV VP2 capsid protein, or a BKV VP3 capsid protein; (iv) the JCV capsid protein is a JCV VP1 capsid protein, a JCV VP2 capsid protein, or a JCV VP3 capsid protein; or (v) the MPyV capsid protein is a MPyV VP1 capsid protein, a MPyV the VP2 capsid protein, or the MPyV VP3 capsid protein.

[0149] In a further preferred embodiment, The SV40 VP1 capsid protein has an amino acid sequence set forth in SEQ ID NO:1, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; The SV40 VP2 capsid protein has an amino acid sequence set forth in SEQ ID NO:2, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The SV40 VP2 capsid protein without the DNA binding domain (woDBD) has an amino acid sequence identical to that of SEQ ID NO:3, or at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or has an amino acid sequence with 99% sequence identity; The SV40 VP3 capsid protein has an amino acid sequence set forth in SEQ ID NO:4, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The nucleocapsid (NC) protein has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The matrix protein (MA) has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto; or The capsid protein (CA) has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0150] Capsid proteins having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequences according to SEQ ID NO: 1 to SEQ ID NO: 4, can be referred to as capsid protein variants. Such capsid protein variants can still constitute / form a viral capsid or can still promote the constitution / formation of a viral capsid. The Examples section, for example, provides sufficient information in this regard. The same applies to variants of SEQ ID NO: 31.

[0151] In a most preferred embodiment, the polypeptide comprising the viral capsid protein and at least one RNA binding domain has an amino acid sequence according to SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22 or SEQ ID NO: 24 or has an amino acid sequence comprised in the amino acid sequence according to SEQ ID NO: 33. Mutants are also included. Said mutants have 80% sequence identity to the above sequences, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0152] Specific combinations of DNA virus capsid proteins, or fragments or derivatives thereof having capsid protein function, linked / fused / associated with RNA binding domains are shown in Figure 3. For example, the SV40 VP2 capsid protein can be used in combination with the linkers shown and any of the RNA binding domains listed in this figure. For example, the SV40 VP3 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the BKV VP2 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the BKV VP3 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the JCV VP2 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the JCV VP3 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the MPyV VP2 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the MPyV VP3 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, an SV40 VP2 capsid protein without a DNA binding domain (woDBD) can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, an SV40 VP3 capsid protein without a DNA binding domain (woDBD) can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, a BKV VP2 capsid protein without a DNA binding domain (woDBD) can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, a BKV VP3 capsid protein without a DNA binding domain (woDBD) can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, a JCV VP2 capsid protein without a DNA binding domain (woDBD) can be used in combination with the linker shown and any of the RNA binding domains listed in this figure.For example, the JCV VP3 capsid protein without a DNA binding domain (woDBD) can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the MPyV VP2 capsid protein without a DNA binding domain (woDBD) can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the MPyV VP3 capsid protein without a DNA binding domain (woDBD) can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the SV40 VP1 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the BKV VP1 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the JCV VP1 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the MPyV VP1 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the AAV VP1 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the AAV VP2 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure. For example, the AAV VP3 capsid protein can be used in combination with the linker shown and any of the RNA binding domains listed in this figure.

[0153] In a fifth aspect, the present invention relates to a virus-like particle (VLP) comprising a complex according to the fourth aspect. The virus-like particle (VLP) may be a DNA or an RNA virus-like particle (VLP).

[0154] In one embodiment, the DNA virus-like particle is selected from the group consisting of papovavirus-like particles, papillomavirus-like particles, polyomavirus-like particles, adenovirus-like particles, and parvovirus-like particles; or The RNA virus-like particle is a retrovirus-like particle, a norovirus-like particle, or an orthomyxovirus-like particle.

[0155] In one preferred embodiment, the polyomavirus-like particle is a Simian Virus 40 (SV40)-like particle, a BK virus (BKV)-like particle, a JC virus (JCV)-like particle, or an MPy virus (MPyV)-like particle; Parvovirus-like particles are adeno-associated virus (AAV)-like particles, The retrovirus-like particle is a lentivirus-like particle, the Norovirus-like particle is a Norwalk virus-like particle; or The orthomyxovirus-like particle is an influenza A or influenza B virus-like particle.

[0156] In a fourth aspect of the present invention, the polypeptide as a component of the complex is described as comprising a viral capsid protein, or a fragment or derivative thereof with capsid protein function, and at least one RNA binding domain. The (artificial) circular RNA molecule as an additional component of the complex preferably comprises an RNA element of interest and a recruiting RNA motif. The recruiting RNA motif interacts / binds with at least one RNA binding domain. In this way, the (artificial) circular RNA molecule (comprising the RNA element of interest) is encapsidated / encapsulated in a virus-like particle (VLP).

[0157] In one specific embodiment, the virus-like particle is an SV40 virus-like particle that comprises, as part of a complex, a polypeptide comprising the SV40 VP1 capsid protein, or a fragment or derivative thereof, and at least one RNA binding domain.

[0158] In another specific embodiment, the virus-like particle is an SV40 virus-like particle that comprises, as part of a complex, a polypeptide comprising the SV40 VP2 capsid protein or a fragment or derivative thereof and at least one RNA binding domain. The SV40 virus-like particle that comprises the SV40 VP2 capsid protein or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises the SV40 capsid protein VP1 or the SV40 capsid proteins VP1 and VP3.

[0159] In another specific embodiment, the virus-like particle is an SV40 virus-like particle that comprises, as part of a complex, a polypeptide comprising the SV40 VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain. The SV40 virus-like particle that comprises the SV40 VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises the SV40 capsid protein VP1 or the SV40 capsid proteins VP1 and VP2.

[0160] In an alternative embodiment, the virus-like particle is an AAV virus-like particle that comprises, as part of a complex, a polypeptide comprising the AAV VP3 capsid protein, or a fragment or derivative thereof, and at least one RNA binding domain.

[0161] In another alternative embodiment, the virus-like particle is an AAV virus-like particle that comprises, as part of a complex, an AAV VP2 capsid protein or a fragment or derivative thereof and a polypeptide comprising at least one RNA binding domain. The AAV virus-like particle comprising a polypeptide comprising a protein or a fragment or derivative thereof and at least one RNA-binding domain preferably further comprises the AAV capsid protein VP3 or the AAV capsid proteins VP3 and VP1.

[0162] In another alternative embodiment, the virus-like particle is an AAV virus-like particle comprising, as part of a complex, a polypeptide comprising an AAV VP1 capsid protein or a fragment or derivative thereof and at least one RNA-binding domain. The AAV virus-like particle comprising a polypeptide comprising an AAV VP1 capsid protein or a fragment or derivative thereof and at least one RNA-binding domain preferably further comprises the AAV capsid protein VP3 or the AAV capsid proteins VP3 and VP2.

[0163] In an alternative embodiment, the virus-like particle is a lentivirus-like particle comprising, as part of a complex, a polypeptide comprising a nucleocapsid (NC) protein or a fragment or derivative thereof and at least one RNA binding domain. A lentivirus-like particle comprising a polypeptide comprising a nucleocapsid (NC) protein or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises a lentivirus matrix protein (MA) and / or capsid protein (CA).

[0164] In another alternative embodiment, the virus-like particle is a lentivirus-like particle comprising as part of a complex a polypeptide comprising a matrix protein (MA) or a fragment or derivative thereof and at least one RNA binding domain. A lentivirus-like particle comprising a polypeptide comprising a matrix protein (MA) or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises a lentiviral nucleocapsid (NC) protein and / or a capsid protein (CA).

[0165] In another alternative embodiment, the virus-like particle is a lentivirus-like particle comprising, as part of a complex, a polypeptide comprising a capsid protein (CA) or a fragment or derivative thereof and at least one RNA binding domain. A lentivirus-like particle comprising a polypeptide comprising a capsid protein (CA) or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises a lentiviral nucleocapsid (NC) protein and / or a matrix protein (MA).

[0166] In certain and alternative embodiments of the above, further (i) at least one RNA-binding domain is an MS2 coat protein or an RNA-binding section thereof, and the recruiting RNA motif is an MS2 phage operator stem-loop; (ii) at least one RNA-binding domain is a Ku protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Ku-binding motif; (iii) at least one RNA-binding domain is an Sm7 protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Sm7-binding motif; (iv) at least one RNA-binding domain is an SfMu phage COM RNA-binding protein or an RNA-binding section thereof, and the recruiting RNA motif is an SfMu phage COM stem-loop; or (v) at least one RNA-binding domain is a PP7 coat protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Sm7-binding motif; the RNA motif is a PP7 phage operator stem-loop; and / or Additionally, the RNA elements of interest include shRNA, miRNA, protein-coding RNA, prRNA, and It is preferably selected from the group consisting of e-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes.

[0167] In a sixth aspect, the present invention relates to a virus-like particle (VLP) comprising an (artificial) circular RNA molecule comprising an RNA element of interest.

[0168] Specifically, the circular RNA molecule is an artificial circular RNA molecule, preferably an artificial circular RNA molecule according to the third aspect.

[0169] In particular, the (artificial) circular RNA molecule contained in the virus-like particle (VLP) is encapsidated / encapsulated within the VLP.

[0170] In particular, the (encapsidated / encapsulated) (artificial) circular RNA molecule further comprises a recruiting RNA motif. Thus, more specifically, the (encapsidated / encapsulated) (artificial) circular RNA molecule comprises an RNA element of interest and a recruiting RNA motif. The RNA element of interest has a specific function or has a specific purpose and is therefore of interest. The function of the RNA element of interest is, for example, the inhibition of gene expression by application of antisense RNA. Alternatively, therapeutically active RNA may be applied to induce gene expression, for example to induce an immune response. The RNA element of interest may be a coding or non-coding RNA element.

[0171] Preferably, the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes.

[0172] Preferably, the recruitment RNA motif is selected from the group consisting of an MS2 phage operator stem loop, a telomerase Ku binding motif, a telomerase Sm7 binding motif, an SfMu phage COM stem loop, and a PP7 phage operator stem loop.

[0173] More preferably, the RNA molecule comprises a target RNA element selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozyme, and a recruiting RNA motif selected from the group consisting of MS2 phage operator stem loop, telomerase Ku binding motif, telomerase Sm7 binding motif, SfMu phage COM stem loop, and PP7 phage operator stem loop.

[0174] More specifically, the (encapsidated / encapsulated) (artificial) circular RNA molecule is bound via a recruiting RNA motif contained therein to at least one RNA binding domain which is further part of a polypeptide comprising a viral capsid protein or a fragment or derivative thereof having a capsid protein function. Even more specifically, the (encapsidated / encapsulated) (artificial) circular RNA molecule is bound via a recruiting RNA motif contained therein to at least one RNA binding domain linked / fused / associated with a viral capsid protein or a fragment or derivative thereof having a capsid protein function. A polypeptide comprising a viral capsid protein or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain is part of or is contained in a virus-like particle (VLP) as described above.

[0175] In one preferred embodiment, (i) at least one RNA-binding domain is a domain that binds to the MS2 coat protein or its RNA; the binding section and the recruiting RNA motif are the MS2 phage operator stem-loop; (ii) at least one RNA-binding domain is a Ku protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Ku-binding motif; (iii) at least one RNA-binding domain is an Sm7 protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Sm7-binding motif; (iv) at least one RNA-binding domain is an SfMu phage COM RNA-binding protein or an RNA-binding section thereof, and the recruiting RNA motif is an SfMu phage COM stem-loop; and / or (v) the at least one RNA-binding domain is a PP7 coat protein or an RNA-binding section thereof, and the recruiting RNA motif is a PP7 phage operator stem-loop.

[0176] In a more preferred embodiment, At least one RNA binding domain has an amino acid sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, and amino acid sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, and / or The RNA motif has a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or a transcribed nucleotide sequence thereof), and nucleotide sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0177] The virus-like particle (VLP) may be a DNA or an RNA virus-like particle (VLP). In one embodiment, the DNA virus-like particle is selected from the group consisting of papovavirus-like particles, papillomavirus-like particles, polyomavirus-like particles, adenovirus-like particles, and parvovirus-like particles; The RNA virus-like particle is a retrovirus-like particle, a norovirus-like particle, or an orthomyxovirus-like particle.

[0178] In one preferred embodiment, the polyomavirus-like particle is a Simian Virus 40 (SV40)-like particle, a BK virus (BKV)-like particle, a JC virus (JCV)-like particle, or an MPy virus (MPyV)-like particle; Parvovirus-like particles are adeno-associated virus (AAV)-like particles, The retrovirus-like particle is a lentivirus-like particle, the Norovirus-like particle is a Norwalk virus-like particle; or The orthomyxovirus-like particle is an influenza A or influenza B virus-like particle.

[0179] The capsid protein may be a capsid protein of an RNA virus or a DNA virus. In another embodiment, the capsid protein of the DNA virus is selected from the group consisting of a papovavirus capsid protein, a papillomavirus capsid protein, a polyomavirus capsid protein, an adenovirus capsid protein, and a parvovirus capsid protein, or The capsid protein of an RNA virus is a lentiviral capsid protein.

[0180] In one preferred embodiment, (i) the parvovirus capsid protein is an adeno-associated virus capsid protein, preferably an AAV9 capsid protein; (ii) the polyomavirus capsid protein is an SV40 capsid protein, a BKV capsid protein, a JCV capsid protein, or an MPyV capsid protein; or (iii) The lentiviral capsid protein is a nucleocapsid (NC) protein, a matrix protein (MA), or a capsid protein (CA).

[0181] In a further preferred embodiment, (i) AAV9 capsid protein includes AAV9 VP1 capsid protein, AAV9 VP2 capsid protein, or AAV9 VP3 capsid protein, (ii) the SV40 capsid protein is an SV40 VP1 capsid protein, an SV40 VP2 capsid protein, or an SV40 VP3 capsid protein; (iii) the BKV capsid protein is a BKV VP1 capsid protein, a BKV VP2 capsid protein, or a BKV VP3 capsid protein; (iv) the JCV capsid protein is a JCV VP1 capsid protein, a JCV VP2 capsid protein, or a JCV VP3 capsid protein; or (v) MPyV capsid protein includes MPyV VP1 capsid protein, MPyV the VP2 capsid protein, or the MPyV VP3 capsid protein.

[0182] In a further preferred embodiment, The SV40 VP1 capsid protein has an amino acid sequence set forth in SEQ ID NO:1, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; The SV40 VP2 capsid protein has an amino acid sequence set forth in SEQ ID NO:2, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The SV40 VP2 capsid protein without the DNA binding domain (woDBD) has an amino acid sequence of SEQ ID NO:3 or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; The SV40 VP3 capsid protein has an amino acid sequence as set forth in SEQ ID NO:4, or a sequence identical thereto at least 80%, preferably at least 85%, more preferably at least 90%, Most preferably, the amino acid sequence has at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity; The nucleocapsid (NC) protein has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The matrix protein (MA) has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto; or The capsid protein (CA) has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0183] Capsid proteins having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequences according to SEQ ID NO: 1 to SEQ ID NO: 4, can be referred to as capsid protein variants. Such capsid protein variants can still constitute / form a viral capsid or can still promote the constitution / formation of a viral capsid. The Examples section, for example, provides sufficient information in this regard. The same applies to variants of SEQ ID NO: 31.

[0184] In a most preferred embodiment, the polypeptide comprising the viral capsid protein and at least one RNA binding domain has an amino acid sequence according to SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22 or SEQ ID NO: 24 or has an amino acid sequence comprised in the amino acid sequence according to SEQ ID NO: 33. Mutants are also included. Said mutants have 80% sequence identity to the above sequences, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0185] Exemplary combinations of viral capsid proteins, or fragments or derivatives thereof having capsid protein function, fused to an RNA binding domain are shown in FIG.

[0186] As mentioned above, the viral capsid protein or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain are preferably part of a polypeptide. This polypeptide is part of or contained in a virus-like particle (VLP). The (artificial) circular RNA molecule is preferably a nucleic acid molecule that contains the RNA element of interest and the linker. It contains a root RNA motif. The recruit RNA motif interacts or binds with the RNA-binding domain. In this way, the (artificial) circular RNA molecule (containing the RNA element of interest) is encapsidated or encapsulated into a virus-like particle (VLP).

[0187] In one specific embodiment, the virus-like particle is an SV40 virus-like particle comprising a polypeptide comprising the SV40 VP1 capsid protein, or a fragment or derivative thereof, and at least one RNA binding domain.

[0188] In another specific embodiment, the virus-like particle is an SV40 virus-like particle comprising a polypeptide comprising an SV40 VP2 capsid protein or a fragment or derivative thereof and at least one RNA binding domain. The SV40 virus-like particle comprising a polypeptide comprising an SV40 VP2 capsid protein or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises the SV40 capsid protein VP1 or the SV40 capsid proteins VP1 and VP3.

[0189] In another specific embodiment, the virus-like particle is an SV40 virus-like particle comprising a polypeptide comprising an SV40 VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain. The SV40 virus-like particle comprising a polypeptide comprising an SV40 VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises the SV40 capsid protein VP1 or the SV40 capsid proteins VP1 and VP2.

[0190] In an alternative embodiment, the virus-like particle is an AAV virus-like particle comprising an AAV VP3 capsid protein, or a fragment or derivative thereof, and a polypeptide comprising at least one RNA binding domain.

[0191] In another alternative embodiment, the virus-like particle is an AAV virus-like particle comprising a polypeptide comprising an AAV VP2 capsid protein or a fragment or derivative thereof and at least one RNA-binding domain. The AAV virus-like particle comprising a polypeptide comprising an AAV VP2 capsid protein or a fragment or derivative thereof and at least one RNA-binding domain preferably further comprises an AAV capsid protein VP3 or an AAV capsid protein VP3 and VP1.

[0192] In another alternative embodiment, the virus-like particle is an AAV virus-like particle comprising a polypeptide comprising an AAV VP1 capsid protein or a fragment or derivative thereof and at least one RNA-binding domain. The AAV virus-like particle comprising a polypeptide comprising an AAV VP1 capsid protein or a fragment or derivative thereof and at least one RNA-binding domain preferably further comprises an AAV capsid protein VP3 or an AAV capsid protein VP3 and VP2.

[0193] In an alternative embodiment, the virus-like particle is a lentivirus-like particle comprising a polypeptide comprising a nucleocapsid (NC) protein or a fragment or derivative thereof and at least one RNA binding domain. The lentivirus-like particle comprising a polypeptide comprising a nucleocapsid (NC) protein or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises a lentivirus matrix protein (MA) and / or capsid protein (CA).

[0194] In another alternative embodiment, the virus-like particle is a lentivirus-like particle comprising a polypeptide comprising a matrix protein (MA) or a fragment or derivative thereof and at least one RNA binding domain. A lentivirus-like particle comprising a polypeptide comprising a polypeptide or derivative thereof and at least one RNA binding domain preferably further comprises a lentiviral nucleocapsid (NC) protein and / or a capsid protein (CA).

[0195] In another alternative embodiment, the virus-like particle is a lentivirus-like particle comprising a polypeptide comprising a capsid protein (CA) or a fragment or derivative thereof and at least one RNA binding domain. The lentivirus-like particle comprising a polypeptide comprising a capsid protein (CA) or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises a lentivirus nucleocapsid (NC) protein and / or a matrix protein (MA).

[0196] In certain and alternative embodiments of the above, further (i) at least one RNA-binding domain is an MS2 coat protein or an RNA-binding section thereof, and the recruiting RNA motif is an MS2 phage operator stem-loop; (ii) at least one RNA-binding domain is a Ku protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Ku-binding motif; (iii) at least one RNA-binding domain is an Sm7 protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Sm7-binding motif; (iv) at least one RNA-binding domain is an SfMu phage COM RNA-binding protein or an RNA-binding section thereof, and the recruiting RNA motif is an SfMu phage COM stem-loop; or (v) at least one RNA-binding domain is a PP7 coat protein or an RNA-binding section thereof, and the recruiting RNA motif is a PP7 phage operator stem-loop; and / or Furthermore, the RNA element of interest is preferably selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes.

[0197] In an alternative embodiment, a virus-like particle (VLP) comprises a complex according to the fourth aspect of the invention.

[0198] In a seventh aspect, the present invention relates to an (in vitro) method for generating a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest, preferably as defined in the fifth or sixth aspect, comprising the following steps: (i) providing a cell; (ii) a cell, (iia) a polypeptide comprising a viral capsid protein, or a fragment or derivative thereof having a capsid protein function and at least one RNA-binding domain, a polynucleotide encoding said polypeptide, or a vector comprising said polynucleotide; and (iib) a (linear) polynucleotide (capable of circularization) according to the first aspect, a vector according to the second aspect, an artificial circular RNA molecule comprising an RNA element of interest, or an artificial circular RNA molecule according to the third aspect, introducing This results in the production of virus-like particles (VLPs) that contain artificial circular RNA molecules that contain the RNA element of interest.

[0199] The introduction of the polypeptide into the cell in step (ii / iia) can be carried out via microinjection, electroporation or lipofection. The polynucleotide, preferably incorporated in a vector, for example an expression vector, can be introduced into the cell in step (ii / iia) via transfection, transformation, microinjection, electroporation or lipofection. The polynucleotide is then transcribed or transcribed and translated into its respective product in the cell. Those skilled in the art are well versed in molecular biology techniques such as transfection, transformation, microinjection, electroporation or lipofection for introducing a polypeptide or polynucleotide into a cell, and know how to carry out these techniques.

[0200] The introduction of the (linear) polynucleotide, preferably incorporated in a vector, into the cell in step (ii / iib) can be carried out by transfection, transformation, microinjection, electroporation or lipofection. The artificial circular RNA molecule can be introduced into the cell in step (ii / iib) accordingly.

[0201] As described above, in step (ii / iia) a polypeptide comprising a viral capsid protein, or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain is introduced into a cell.

[0202] In one embodiment, the at least one RNA binding domain is selected from the group consisting of MS2 coat protein or an RNA binding section thereof, Ku protein or an RNA binding section thereof, Sm7 protein or an RNA binding section thereof, SfMu phage COM RNA binding protein or an RNA binding section thereof, and PP7 coat protein or an RNA binding section thereof.

[0203] In a more preferred embodiment, at least one RNA binding domain has an amino acid sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, and amino acid sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0204] The capsid protein may be a capsid protein of an RNA virus or a DNA virus. In another embodiment, the capsid protein of the DNA virus is selected from the group consisting of a papovavirus capsid protein, a papillomavirus capsid protein, a polyomavirus capsid protein, an adenovirus capsid protein, and a parvovirus capsid protein, or the capsid protein of the RNA virus is a lentivirus capsid protein.

[0205] In one preferred embodiment, (i) the parvovirus capsid protein is an adeno-associated virus capsid protein, preferably an AAV9 capsid protein; (ii) the polyomavirus capsid protein is an SV40 capsid protein, a BKV capsid protein, a JCV capsid protein, or an MPyV capsid protein; (iii) The lentiviral capsid protein is a nucleocapsid (NC) protein, a matrix protein (MA), or a capsid protein (CA).

[0206] In another preferred embodiment, (i) AAV9 capsid protein includes AAV9 VP1 capsid protein, AAV9 VP2 capsid protein, or AAV9 VP3 capsid protein, (ii) the SV40 capsid protein is an SV40 VP1 capsid protein, an SV40 VP2 capsid protein, or an SV40 VP3 capsid protein; (iii) the BKV capsid protein is a BKV VP1 capsid protein, a BKV VP2 capsid protein, or a BKV VP3 capsid protein; (iv) the JCV capsid protein is a JCV VP1 capsid protein, a JCV VP2 capsid protein, or a JCV VP3 capsid protein; (v) MPyV capsid protein includes MPyV VP1 capsid protein, MPyV the VP2 capsid protein, or the MPyV VP3 capsid protein.

[0207] In an even more preferred embodiment, The SV40 VP1 capsid protein has an amino acid sequence set forth in SEQ ID NO:1, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The SV40 VP2 capsid protein has an amino acid sequence set forth in SEQ ID NO:2, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The SV40 VP2 capsid protein without the DNA binding domain (woDBD) has an amino acid sequence set forth in SEQ ID NO:3, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The SV40 VP3 capsid protein has an amino acid sequence set forth in SEQ ID NO:4, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The nucleocapsid (NC) protein has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or Matrix protein (MA) is an amino acid sequence that is at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99% identical thereto, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the The capsid protein (CA) has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0208] Capsid proteins having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequences set forth in SEQ ID NO: 1 to SEQ ID NO: 4, can be referred to as capsid protein variants. Such capsid protein variants can still constitute / form a viral capsid or can still promote the constitution / formation of a viral capsid. The Examples section, for example, provides sufficient information in this regard. The same applies to variants of SEQ ID NO: 31.

[0209] In a most preferred embodiment, the polypeptide comprising the viral capsid protein and at least one RNA binding domain has an amino acid sequence according to SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22 or SEQ ID NO: 24 or has an amino acid sequence comprised in the amino acid sequence according to SEQ ID NO: 33. Mutants are also included, said mutants having 80% sequence identity to the above sequences, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0210] Specific combinations of viral capsid proteins, or fragments or derivatives thereof having capsid protein functions, with RNA binding domains are shown in FIG.

[0211] As mentioned above, the artificial circular RNA molecule is introduced into the cell in step (ii / iib). In particular, the artificial circular RNA molecule comprises the RNA element of interest. More specifically, the artificial circular RNA molecule further comprises a recruiting RNA motif. Thus, more specifically, the artificial circular RNA molecule comprises the RNA element of interest and a recruiting RNA motif.

[0212] The RNA element of interest has a specific function or has a specific purpose and is therefore of interest. The function of the RNA element of interest is, for example, the inhibition of gene expression by application of antisense RNA. Alternatively, therapeutically active RNA can be applied to induce gene expression, for example to induce an immune response. The RNA element of interest can be a coding or non-coding RNA element.

[0213] Preferably, the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes.

[0214] Preferably, the recruiting RNA motif is selected from the group consisting of MS2 phage operator stem loop, telomerase Ku binding motif, telomerase Sm7 binding motif, SfMu phage COM stem loop, and PP7 phage operator stem loop. It is selected.

[0215] More preferably, the recruiting RNA motif has a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or a transcribed nucleotide sequence thereof) and a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0216] More preferably, the artificial circular RNA molecule comprises a target RNA element selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozyme, and the recruiting RNA motif is selected from the group consisting of MS2 phage operator stem loop, telomerase Ku binding motif, telomerase Sm7 binding motif, SfMu phage COM stem loop, and PP7 phage operator stem loop.

[0217] Even more preferably, the artificial circular RNA molecule comprises an RNA element of interest selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes, and the recruiting RNA motif has a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or a transcribed nucleotide sequence thereof) and a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.

[0218] Specifically, the RNA binding domain and the recruiting RNA motif may be a pair selected from the group above.

[0219] For further preferred embodiments of the artificial circular RNA molecule and the RNA-binding domain, see the third to sixth aspects of the present invention.

[0220] For further preferred embodiments of virus-like particles (VLPs), please see the fifth and sixth aspects of the invention.

[0221] During the formation of a virus-like particle (VLP) in a cell, the recruiting RNA motif specifically contained in the artificial circular RNA molecule binds to at least one RNA binding domain linked / fused / associated with a viral capsid protein or a fragment or derivative thereof having a capsid protein function. In this way, the artificial circular RNA molecule (and further the RNA element of interest contained therein) is encapsidated / encapsulated within the capsid structure of the virus-like particle (VLP).

[0222] In one example, the virus-like particle (VLP) of SV40 virus is generated, which contains the artificial circular RNA molecule.For this purpose, a polynucleotide that contains a nucleotide sequence that codes for a polypeptide that contains SV40 VP1 capsid protein, or a fragment or derivative thereof, and at least one RNA binding domain is introduced into a cell.The artificial circular RNA molecule that is introduced into a cell can be the RNA molecule defined above.

[0223] In another example, AAV virus virus-like particle (VLP) containing artificial circular RNA molecule is generated.For this purpose, a polynucleotide containing a nucleotide sequence encoding a polypeptide containing AAV VP3 capsid protein or its fragment or derivative and at least one RNA binding domain is introduced into a cell.The artificial circular RNA molecule introduced into a cell can be the RNA molecule defined above.

[0224] Additional (helper) elements may further be introduced into the cells that assist / promote the formation of virus-like particles (VLPs).

[0225] In one example, virus-like particles (VLPs) of the SV40 virus are generated that contain artificial circular RNA molecules.

[0226] In this process, in addition to a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the SV40 VP2 capsid protein or a fragment or derivative thereof and at least one RNA binding domain, A polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP1, or a polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP1 and a polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP3 are introduced into the cell.

[0227] Alternatively, in addition to a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the SV40 VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain, A polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP1, or a polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP1 and a polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP2 are introduced into the cell.

[0228] The polynucleotide may be included in a vector such as a viral vector or a plasmid vector. The nucleotide sequence encoding the capsid protein may be part of a single polynucleotide, e.g., a single vector. For example, a single polynucleotide, e.g., one that may be included in a single vector, may include a nucleotide sequence encoding a polypeptide comprising an SV40 VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain, as well as a nucleotide sequence encoding an SV40 VP1 capsid protein and / or a nucleotide sequence encoding an SV40 VP2 capsid protein.

[0229] In another example, AAV virus-like particles (VLPs) are generated that contain the artificial circular RNA molecules.

[0230] In this process, in addition to a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising an AAV VP2 capsid protein or a fragment or derivative thereof and at least one RNA binding domain, A polynucleotide comprising a nucleotide sequence encoding the AAV capsid protein VP3, or a polynucleotide comprising a nucleotide sequence encoding the AAV capsid protein VP3 and a polynucleotide comprising a nucleotide sequence encoding the AAV capsid protein VP1 are introduced into the cell.

[0231] Alternatively, the present invention includes a nucleotide sequence encoding a polypeptide comprising an AAV VP1 capsid protein or a fragment or derivative thereof and at least one RNA binding domain. In addition to the polynucleotides A polynucleotide comprising a nucleotide sequence encoding the AAV capsid protein VP3, or a polynucleotide comprising a nucleotide sequence encoding the AAV capsid protein VP3 and a polynucleotide comprising a nucleotide sequence encoding the AAV capsid protein VP2 are introduced into the cell.

[0232] The polynucleotide may be included in a vector such as a viral vector or a plasmid vector. The nucleotide sequence encoding the capsid protein may be part of a single polynucleotide, such as a single vector. For example, a single polynucleotide, such as one that may be included in a single vector, may include a nucleotide sequence encoding a polypeptide comprising an AAV VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain, as well as a nucleotide sequence encoding an AAV VP2 capsid protein and / or a nucleotide sequence encoding an AAV VP1 capsid protein.

[0233] When AAV viral virus-like particles (VLPs) containing (heterologous) RNA molecules are produced, it is preferred that additional helper elements are present, such as the adenovirus helper genes E4, E2a, VA, which further assist / facilitate the formation of the virus-like particle (VLP).

[0234] As yet another example, a lentiviral virus-like particle (VLP) containing an artificial circular RNA molecule is generated.For this purpose, a polynucleotide containing a nucleotide sequence encoding a polypeptide containing a nucleocapsid (NC) protein or a fragment or derivative thereof and at least one RNA binding domain is introduced into a cell.The artificial circular RNA molecule introduced into a cell may be the RNA molecule defined above.

[0235] Additional (helper) elements may further be introduced into the cells that assist / promote the formation of virus-like particles (VLPs).

[0236] In one example, lentiviral virus-like particles (VLPs) are generated that contain the artificial circular RNA molecules.

[0237] In this process, in addition to a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising a nucleocapsid (NC) protein or a fragment or derivative thereof and at least one RNA binding domain, A polynucleotide comprising a nucleotide sequence encoding the matrix protein (MA) and / or a polynucleotide comprising a nucleotide sequence encoding the capsid protein (CA) is introduced into the cell.

[0238] Alternatively, in addition to a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising a matrix protein (MA) protein or a fragment or derivative thereof and at least one RNA binding domain, A polynucleotide comprising a nucleotide sequence encoding the nucleocapsid (NC) protein and / or a polynucleotide comprising a nucleotide sequence encoding the capsid protein (CA) is introduced into the cell.

[0239] Alternatively, in addition to a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising a capsid protein (CA) or a fragment or derivative thereof and at least one RNA binding domain, A polynucleocapsid comprising a nucleotide sequence encoding the nucleocapsid (NC) protein. A polynucleotide comprising a nucleotide sequence encoding a tide and / or a matrix protein (MA) is introduced into the cell.

[0240] These additional capsid proteins aid / promote the formation of VLPs.

[0241] Additionally, cells can be transfected with the POL gene, which encodes the viral protease (PRO), reverse transcriptase (RT) with a non-functional integrase gene (IN), and the VSVG (ENV) gene, which encodes the viral surface glycoprotein (gp160) that is ultimately split into the surface protein gp120 (SU) and the transmembrane protein gp41 (TM).

[0242] The polynucleotide may be included in a vector such as a viral vector or a plasmid vector. The nucleotide sequence encoding the capsid protein may be part of a single polynucleotide, for example, a single vector. For example, a single polynucleotide, for example, one that may be included in a single vector, may include a nucleotide sequence encoding a nucleocapsid (NC) protein and at least one RNA binding domain, as well as a nucleotide sequence encoding a matrix protein (MA) and / or a nucleotide sequence encoding a capsid protein (CA).

[0243] In an eighth aspect, the present invention relates to an (in vitro) method for generating a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest, preferably as defined in the fifth or sixth aspect, comprising the steps of: (i) providing a virus-like particle (VLP) comprising a polypeptide comprising a capsid protein of a virus or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain, (ii) disassembling the VLPs; (iii) adding an artificial circular RNA molecule comprising an RNA element of interest or an artificial circular RNA molecule according to the third aspect; (iv) reassembling the disassembled VLPs; Thereby, virus-like particles (VLPs) are generated that contain artificial circular RNA molecules that contain the RNA element of interest.

[0244] The virus-like particle (VLP) provided in step (i) may be a DNA or an RNA virus-like particle (VLP).

[0245] In one embodiment, the DNA virus-like particle is selected from the group consisting of a papovavirus-like particle, a papillomavirus-like particle, a polyomavirus-like particle, an adenovirus-like particle, and a parvovirus-like particle, or The RNA virus-like particle is a retrovirus-like particle, a norovirus-like particle, or an orthomyxovirus-like particle.

[0246] In one preferred embodiment, the polyomavirus-like particle is a Simian Virus 40 (SV40)-like particle, a BK virus (BKV)-like particle, a JC virus (JCV)-like particle, or an MPy virus (MPyV)-like particle; Parvovirus-like particles are adeno-associated virus (AAV)-like particles, The retrovirus-like particle is a lentivirus-like particle, the Norovirus-like particle is a Norwalk virus-like particle; or The orthomyxovirus-like particle is an influenza A or influenza B virus-like particle.

[0247] The capsid protein can be that of an RNA virus or a DNA virus.

[0248] In another embodiment, the capsid protein of the DNA virus is selected from the group consisting of a papovavirus capsid protein, a papillomavirus capsid protein, a polyomavirus capsid protein, an adenovirus capsid protein, and a parvovirus capsid protein, or The capsid protein of an RNA virus is a lentiviral capsid protein.

[0249] In one preferred embodiment, (i) the parvovirus capsid protein is an adeno-associated virus capsid protein, preferably an AAV9 capsid protein; (ii) the polyomavirus capsid protein is an SV40 capsid protein, a BKV capsid protein, a JCV capsid protein, or an MPyV capsid protein; (iii) The lentiviral capsid protein is a nucleocapsid (NC) protein, a matrix protein (MA), or a capsid protein (CA).

[0250] In a further preferred embodiment, (i) the AAV9 capsid protein is an AAV9 VP1 capsid protein, an AAV9 VP2 capsid protein, or an AAV9 VP3 capsid protein; (ii) SV40 capsid protein is SV40 VP1 capsid protein, SV40 VP2 capsid protein, or SV40 VP3 capsid protein, (iii) the BKV capsid protein is a BKV VP1 capsid protein, a BKV VP2 capsid protein, or a BKV VP3 capsid protein; (iv) the JCV capsid protein is a JCV VP1 capsid protein, a JCV VP2 capsid protein, or a JCV VP3 capsid protein; (v) the MPyV capsid protein is an MPyV VP1 capsid protein, an MPyV VP2 capsid protein, or an MPyV VP3 capsid protein.

[0251] In a further preferred embodiment, The SV40 VP1 capsid protein has an amino acid sequence set forth in SEQ ID NO:1, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The SV40 VP2 capsid protein has an amino acid sequence set forth in SEQ ID NO:2, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The SV40 VP2 capsid protein without the DNA binding domain (woDBD) has an amino acid sequence set forth in SEQ ID NO:3, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The SV40 VP3 capsid protein has an amino acid sequence set forth in SEQ ID NO:4, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The nucleocapsid (NC) protein has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; or The matrix protein (MA) has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto; or The capsid protein (CA) has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0252] Capsid proteins having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequences according to SEQ ID NO: 1 to SEQ ID NO: 4, can be referred to as capsid protein variants. Such capsid protein variants can still constitute / form a viral capsid or can still promote the constitution / formation of a viral capsid. The Examples section, for example, provides sufficient information in this regard. The same applies to variants of SEQ ID NO: 31.

[0253] In yet another embodiment, the at least one RNA binding domain is selected from the group consisting of MS2 coat protein or an RNA binding section thereof, Ku protein or an RNA binding section thereof, Sm7 protein or an RNA binding section thereof, SfMu phage COM RNA binding protein or an RNA binding section thereof, and PP7 coat protein or an RNA binding section thereof.

[0254] In a preferred embodiment, the at least one RNA binding domain has an amino acid sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, and amino acid sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0255] In a most preferred embodiment, the capsid protein of the virus and at least one The polypeptide comprising the RNA binding domain has an amino acid sequence as set forth in SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, or SEQ ID NO: 24, or has an amino acid sequence contained in the amino acid sequence as set forth in SEQ ID NO: 33. Variants are also included, said variants having 80% sequence identity to the above sequences, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0256] Specific combinations of viral capsid proteins, or fragments or derivatives thereof having capsid protein functions, with RNA binding domains are shown in FIG.

[0257] In step (iii), an artificial circular RNA molecule is added. In particular, the artificial circular RNA molecule comprises the target RNA element. More specifically, the artificial circular RNA molecule further comprises a recruiting RNA motif. Thus, more specifically, the artificial circular RNA molecule comprises the target RNA element and a recruiting RNA motif.

[0258] The RNA element of interest has a specific function or has a specific purpose and is therefore of interest. The function of the RNA element of interest is, for example, the inhibition of gene expression by application of antisense RNA. Alternatively, therapeutically active RNA can be applied to induce gene expression, for example to induce an immune response. The RNA element of interest can be a coding or non-coding RNA element.

[0259] Preferably, the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes.

[0260] Preferably, the recruitment RNA motif is selected from the group consisting of an MS2 phage operator stem loop, a telomerase Ku binding motif, a telomerase Sm7 binding motif, an SfMu phage COM stem loop, and a PP7 phage operator stem loop.

[0261] More preferably, the recruiting RNA motif has a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or a transcribed nucleotide sequence thereof) and a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e. 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0262] More preferably, the artificial circular RNA molecule comprises a target RNA element selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozyme, and the recruiting RNA motif is selected from the group consisting of MS2 phage operator stem loop, telomerase Ku binding motif, telomerase Sm7 binding motif, SfMu phage COM stem loop, and PP7 phage operator stem loop.

[0263] Even more preferably, the artificial circular RNA molecule comprises an RNA element of interest selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozyme, and The RNA motif has a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or a transcribed nucleotide sequence thereof), and a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, i.e., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0264] For further preferred embodiments of the virus-like particles provided in step (i), please see the fifth and sixth aspects of the invention.

[0265] For further preferred embodiments of the artificial circular RNA molecule added in step (iii), please see the third to seventh aspects of the invention.

[0266] In one particular embodiment, the virus-like particle provided in step (i) is an SV40 virus-like particle comprising a polypeptide comprising the SV40 VP1 capsid protein, or a fragment or derivative thereof, and at least one RNA binding domain.

[0267] In another specific embodiment, the virus-like particle provided in step (i) is an SV40 virus-like particle comprising a polypeptide comprising the SV40 VP2 capsid protein or a fragment or derivative thereof and at least one RNA binding domain. The SV40 virus-like particle comprising a polypeptide comprising the SV40 VP2 capsid protein or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises the SV40 capsid protein VP1 or the SV40 capsid proteins VP1 and VP3.

[0268] In another specific embodiment, the virus-like particle provided in step (i) is an SV40 virus-like particle comprising a polypeptide comprising the SV40 VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain. The SV40 virus-like particle comprising a polypeptide comprising the SV40 VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain preferably further comprises the SV40 capsid protein VP1 or the SV40 capsid proteins VP1 and VP2.

[0269] In the above particular embodiment, further preferably (i) at least one RNA-binding domain contained in a polypeptide that is part of a VLP is an MS2 coat protein or an RNA-binding section thereof, and a recruiting RNA motif contained in the added artificial circular RNA molecule is an MS2 phage operator stem loop; (ii) at least one RNA-binding domain contained in the polypeptide that is part of the VLP is a Ku protein or an RNA-binding section thereof, and the recruiting RNA motif contained in the added artificial circular RNA molecule is a telomerase Ku-binding motif; (iii) at least one RNA-binding domain contained in a polypeptide that is part of the VLP is an Sm7 protein or an RNA-binding section thereof, and the recruiting RNA motif contained in the added artificial circular RNA molecule is a telomerase Sm7 binding motif; (iv) at least one RNA-binding domain contained in a polypeptide that is part of a VLP is an SfMu phage COM RNA-binding protein or an RNA-binding section thereof, and the recruiting RNA motif contained in the added artificial circular RNA molecule is an SfMu phage COM stem-loop; or (v) at least one RNA-binding domain contained in the polypeptide that is part of the VLP is a PP7 coat protein or an RNA-binding section thereof, and the recruiting RNA motif contained in the added artificial circular RNA molecule is a PP7 phage operator stem loop; and / or More preferably, the target RNA element contained in the added artificial circular RNA molecule is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozyme.

[0270] In a preferred embodiment, the virus-like particle (VLP) comprising a polypeptide comprising a viral capsid protein or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain as provided in (i) is (a) providing a cell; (b) produced by introducing into a cell a polypeptide comprising a viral capsid protein or a fragment or derivative thereof having capsid protein function and at least one RNA-binding domain, a polynucleotide encoding the polypeptide, or a vector comprising the polynucleotide.

[0271] The introduction of the polypeptide into the cell in step (b) can be carried out by microinjection, electroporation or lipofection. The polynucleotide, preferably incorporated in a vector, for example an expression vector, can be introduced into the cell in step (b) by transfection, transformation, microinjection, electroporation or lipofection. The polynucleotide is then transcribed in the cell or transcribed and translated into its respective product. Those skilled in the art are well aware of molecular biology techniques such as transfection, transformation, microinjection, electroporation or lipofection for introducing a polypeptide or polynucleotide into a cell, and know how to carry out these techniques.

[0272] In one example, a virus-like particle (VLP) of the SV40 virus containing an artificial circular RNA molecule is generated. To this end, a polynucleotide containing a nucleotide sequence encoding a polypeptide containing the SV40 VP1 capsid protein or a fragment or derivative thereof and at least one RNA binding domain is introduced into a cell.

[0273] Additional factors that aid / promote VLP formation may also be introduced into the cells.

[0274] In one example, virus-like particles (VLPs) of the SV40 virus are produced. In this process, in addition to a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the SV40 VP2 capsid protein or a fragment or derivative thereof and at least one RNA binding domain, A polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP1, or a polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP1 and a polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP3 are introduced into the cell.

[0275] Alternatively, in addition to a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the SV40 VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain, A polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP1, or a polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP1 A polynucleotide comprising a nucleotide sequence encoding the SV40 capsid protein VP2 is introduced into the cell.

[0276] The polynucleotide may be included in a vector such as a viral vector or a plasmid vector. The nucleotide sequence encoding the capsid protein may be part of a single polynucleotide, e.g., a single vector. For example, a single polynucleotide, e.g., one that may be included in a single vector, may include a nucleotide sequence encoding a polypeptide comprising an SV40 VP3 capsid protein or a fragment or derivative thereof and at least one RNA binding domain, as well as a nucleotide sequence encoding an SV40 VP1 capsid protein and / or a nucleotide sequence encoding an SV40 VP2 capsid protein.

[0277] In another preferred embodiment, the degradation in step (ii) is achieved by chemical means. In a further preferred embodiment, the chemical means is selected from the group consisting of treatment with a reducing agent, preferably dithiothreitol (DTT), N-acetylcysteine ​​(NALC), β-mercaptoethanol, tris(2-carboxyethyl)phosphine (TCEP), or thioredoxin.

[0278] In one example, a virus-like particle (VLP) of SV40 virus is generated, which comprises a polypeptide comprising a capsid protein of SV40 virus or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain, and an artificial circular RNA molecule comprising an RNA element of interest and a recruiting RNA motif. Thus, the virus-like particle (VLP) of SV40 virus comprising a polypeptide comprising a capsid protein of SV40 virus or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain is degraded with dithiothreitol (DTT) at a temperature of 35°C to 40°C, for example 37°C, for 15 to 30 minutes, for example 20 minutes. Specifically, a solution containing 10 mM to 20 mM, for example 15 mM, of dithiothreitol (DTT) can be used. Next, the solution containing the RNA element of interest and the artificial circular RNA molecule containing the recruiting RNA motif is added to a degraded virus-like particle (VLP) of SV40 virus containing a polypeptide containing the capsid protein of SV40 virus or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain. Incubation is performed for 30 minutes to 90 minutes, for example 60 minutes, at a temperature between 35°C and 40°C, for example 37°C. During this incubation period, the degraded virus-like particle (VLP) of SV40 virus containing a polypeptide containing the capsid protein of SV40 virus or a fragment or derivative thereof having a capsid protein function and at least one RNA binding domain is loaded with the RNA element of interest and the artificial circular RNA molecule containing the recruiting RNA motif. In general, any buffer that allows reconstitution can be used. In particular, the following loading buffer can be used: 10 mM ATP, 20 mM Hepes-KOH buffer (pH 7.9), 80 mM KCl, 40 mM NH 4 Cl, 10 mM MgCl 2, 16% glycerol, 0.08% NP-40. Reconstitution is then induced by adding a specific salt solution and incubating for 8-12 hours, for example overnight, at a temperature between 2-10 °C, for example 4 °C. In general, any buffer that allows dissociation can be used. In particular, the following reconstitution buffer can be used: 150 mM sodium acetate buffer pH 5.2, 3 mM CaCl 2 , 120 mM KCl, and 40 mM NH 4 Cl.

[0279] Upon reconstitution, at least one RNA-binding domain binds to the recruit RNA motif of the artificial circular RNA molecule, and thus the artificial circular RNA molecule (and the RNA element of interest contained therein) is encapsidated / encapsulated into the capsid structure of the SV40 virus-like particle.

[0280] Preferably, the cell referred to in the seventh and eighth aspects of the present invention is a eukaryotic cell. More preferably, the eukaryotic cell is a vertebrate cell, an arthropod cell, a yeast cell, or a fungal cell. Even more preferably, the vertebrate cell is a mammalian cell and the arthropod cell is an insect cell.

[0281] In a ninth aspect, the present invention relates to a virus-like particle (VLP) obtainable by a method according to the seventh or eighth aspect. The obtained virus-like particle is preferably a virus-like particle according to the fifth or sixth aspect of the invention.

[0282] In a tenth aspect, the present invention relates to a composition comprising a virus-like particle according to the fifth, sixth or ninth aspect.

[0283] Preferably, the composition is a pharmaceutical composition. The pharmaceutical composition can be administered systemically, for example parenterally. For example, the pharmaceutical composition can be in a form suitable for oral, nasal, or inhalation administration. The pharmaceutical composition can also be administered intravascularly, intravenously, intramuscularly, intrathecally, subcutaneously, or intraperitoneally.

[0284] The pharmaceutical composition may be administered in a single dose or multiple doses. The pharmaceutical composition is preferably administered in a therapeutically effective amount.

[0285] More preferably, the pharmaceutical composition comprises one or more pharma- ceutically acceptable excipients, diluents, and / or carriers.

[0286] In this regard, it should be noted that the active ingredient of the pharmaceutical composition is typically not the VLP itself but the RNA element of interest contained therein / that is part of it.

[0287] In an eleventh aspect, the present invention relates to a virus-like particle (VLP) according to the fifth, sixth or ninth aspect, or a composition according to the tenth aspect for use in medicine.

[0288] In this regard, it should be noted that the active ingredient is typically not the VLP itself but the RNA element of interest contained therein or which is part of it.

[0289] As mentioned above, the problem with RNA-based therapeutics to date is the delivery of biologically active RNA molecules to the right cells, and therefore to the right organs, with a sufficiently high efficiency. Since RNases are highly efficient at degrading RNA molecules in a very short time, it is rather difficult to obtain long-term effects, and RNA-based therapeutics must be applied repeatedly. A delivery mechanism that prevents the degradation of biologically active RNA molecules is highly desirable.

[0290] The present inventors have encapsidated / encapsulated the RNA element of interest within a virus-like particle (VLP), as described herein, and in particular within the capsid protein structure of the virus-like particle (VLP), as described herein.In this way, the RNA element of interest is safely packaged and can be efficiently delivered to target cells, for example, via the viral route.Then, within the cell / subject, the RNA element can perform its intended function.By using the artificial circular RNA molecule that contains the RNA element of interest, the RNA element of interest is specifically protected against exonuclease-mediated degradation.

[0291] The RNA element of interest may be a coding or non-coding RNA element. The RNA element of interest may be selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes. Preferably, the RNA element of interest is selected from the following: Thus, the RNA element of interest can code for a product of interest in the form of a protein-coding RNA. The product of interest can be a protein of interest. The RNA of interest can also be a non-coding RNA, such as miRNA. Non-coding RNA is frequently used to silence the corresponding target gene.

[0292] In a twelfth aspect, the present invention relates to a virus-like particle according to the fifth, sixth or ninth aspect, or a composition according to the tenth aspect, for use in therapy.

[0293] In this regard, it should be noted that the active ingredient is typically not the VLP itself but the RNA element of interest contained therein or which is part of it.

[0294] The present inventors have encapsidated / encapsulated the RNA element of interest within a virus-like particle (VLP), as described herein, and in particular within the capsid protein structure of the virus-like particle (VLP), as described herein.In this way, the RNA element of interest is safely packaged and can be efficiently delivered to target cells, for example, via the viral route.Then, within the cell / subject, the RNA element can perform its intended function.By using the artificial circular RNA molecule that contains the RNA element of interest, the RNA element of interest is specifically protected against exonuclease-mediated degradation.

[0295] The RNA element of interest may be a coding or non-coding RNA element. The RNA element of interest is preferably selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes. Thus, the RNA element of interest may encode a product of interest in the form of a protein-coding RNA. The product of interest may be a protein of interest. The RNA of interest may be a non-coding RNA, for example a miRNA. Non-coding RNA is frequently used to silence the corresponding target gene.

[0296] Preferably, the treatment is selected from the group consisting of gene therapy, cell therapy, cancer therapy, and treatment of a disease, such as an infectious disease caused by a bacterium or a virus, such as SARS-CoV-2.

[0297] More preferably, the cancer treatment includes one or more of the following: (i) tumor growth inhibition and / or tumor cell death, (ii) reduction in tumor markers, (iii) reduction in tumor pathology and metastasis, (iv) reduction in tumor burden as evidenced by imaging studies (e.g., CT, MRI, PET, etc.), and (v) reduction in tumor burden as evidenced by clinical assessment or self-report by the subject. Cancers include, among others, lung cancer, colon cancer, head and neck cancer, gastric cancer, urothelial cancer, breast cancer, cervical cancer, endometrial cancer, ovarian cancer, melanoma (skin cancer), pancreatic cancer, brain cancer, prostate cancer, thyroid cancer, kidney cancer, adrenal cancer, liver cancer, lymphoma (cancer of lymphocytes), or leukemia (blood cancer).

[0298] The twelfth aspect of the present invention can also be rephrased as follows: A method of treating a subject, the method comprising the step of administering to a subject (in need thereof) a virus-like particle according to the fifth, sixth or ninth aspect, or a composition according to the tenth aspect, thereby treating the subject.

[0299] Preferably, the treatment is selected from the group consisting of gene therapy, cell therapy, cancer therapy, and treatment of a disease, such as an infectious disease caused by a bacterium or a virus, such as SARS-CoV-2.

[0300] In a thirteenth aspect, the present invention relates to a virus-like particle according to the fifth, sixth or ninth aspect, or a composition according to the tenth aspect, for use in vaccination.

[0301] In this regard, it should be noted that the active ingredient is typically not the VLP itself but the RNA element of interest contained therein or which is part of it.

[0302] The present inventors have encapsidated / encapsulated the RNA element of interest within a virus-like particle (VLP), as described herein, and in particular within the capsid protein structure of the virus-like particle (VLP), as described herein.In this way, the RNA element of interest is safely packaged and can be efficiently delivered to target cells, for example, via the viral route.Then, within the cell / subject, the RNA element can perform its intended function.By using the artificial circular RNA molecule that contains the RNA element of interest, the RNA element of interest is specifically protected against exonuclease-mediated degradation.

[0303] The RNA element of interest may be a coding or non-coding RNA element. The RNA element of interest is preferably selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes. Thus, the RNA element of interest may encode a product of interest in the form of a protein-coding RNA. The product of interest may be a protein of interest. The RNA of interest may be a non-coding RNA, for example a miRNA. Non-coding RNA is frequently used to silence the corresponding target gene.

[0304] The thirteenth aspect of the present invention can also be rephrased as follows: A method of vaccinating a subject, the method comprising administering to a subject (in need thereof) a virus-like particle according to the fifth, sixth or ninth aspect, or a composition according to the tenth aspect, thereby vaccinating the subject.

[0305] In one example, an RNA element encoding the spike protein of SARS-CoV-2 or a portion thereof encapsidated / encapsulated into a virus-like particle (VLP) as described herein is administered to a subject for SARS-CoV-2 virus vaccination. Expression of the spike protein of SARS-CoV-2 or a portion thereof is induced in a cell / subject to elicit an immune response against the SARS-CoV-2 virus.

[0306] In a further aspect, the present invention relates to the use of a virus-like particle (VLP) according to the fifth, sixth or tenth aspect of the invention for the delivery of an artificial circular RNA molecule, for example to a cell / subject, the artificial circular RNA molecule comprising in particular an RNA element and a recruiting RNA motif.

[0307] Alternatively, in a further aspect, the present invention relates to a method for delivering an artificial circular RNA molecule, the method comprising: Introducing a virus-like particle (VLP) according to the fifth, sixth or tenth aspect of the invention into a cell / subject; or The method comprises administering a virus-like particle (VLP) according to the fifth, sixth or tenth aspect of the invention to a subject in need thereof.

[0308] The artificial circular RNA molecule specifically comprises an RNA element and a recruiting RNA motif.

[0309] It has been shown that a fusion of an RNA recruitment motif with SV40 VP3 is preferred. Thus, in all aspects of the invention described herein, combinations of this type are preferable.

[0310] In the context of the present invention, where a polynucleotide is defined by a DNA nucleotide sequence, it likewise includes a polynucleotide defined by an RNA nucleotide sequence, and vice versa.

[0311] Various modifications and alterations of the present invention will be apparent to those skilled in the art without departing from the scope of the present invention. Although the present invention has been described in connection with certain preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention will be apparent to those skilled in the relevant fields and are intended to be covered by the present invention. [Brief description of the drawings]

[0312] The following figures are merely illustrative of the invention and do not limit the scope of the invention as set forth in the appended claims. [Figure 1] Schematic diagram of an exemplary VLP in which circRNA is packaged. In the left part, lentivirus is used as an example. The circRNA is fused to an aptamer linked to a part of one or both of the nucleocapsid (NC) or matrix protein (MA) via an aptamer-binding protein (ABP) fused to the NC and / or MA. The packaging plasmid does not encode a functional integrase protein. In the right part, SV40 is used as an example. For recruitment, the circRNA is fused to an aptamer linked to a part of the internal capsid protein VP3 via an aptamer-binding protein (ABP) fused to VP3. VP3 binds to the internal surface of the major capsid protein VP1. [Diagram 2]The synthesized constructs are shown. The capsid expression constructs used in this study with fusions of capsid proteins and aptamer-binding proteins, and the cassettes encoding the circRNA molecules to be packaged are shown. A third generation lentiviral system was used for the generation of lentiviral VLPs. Packaging and envelope plasmids encoding components of the viral capsid and envelope were used, and modified envelopes containing aptamer-binding proteins (ABPs) fused to NC and / or MA were used. A third plasmid encoding circRNA was used. In this plasmid, an intron sequence of the human ZKSCAN1 gene was used to generate circRNA. The generated circRNA consists of: a strong IRES-a short reporter gene (e.g. GFP)-a stop and an aptamer. The highlight of circularization is that the aptamer becomes functional only by circularization, since it is completed by circularization. In this way, only the circRNA is packaged. [Diagram 3] 1 shows preferred combinations of capsid proteins or fragments or derivatives thereof fused to an RNA binding domain. [Figure 4] FIG. 1 is a schematic diagram of a method for loading SV40 particles with RNA in vitro. [Diagram 5] Real-time PCR strategy to analyze and distinguish linear and circular RNAs. (A) PCR design that can distinguish linear and circular RNAs; (B) PCR products obtained from circGFPr+circGFPf using splitCOM GFP as template. The aptamer functions after circularization. [Figure 6A] , [Figure 6B]Figure 6 shows detection of linear and circular RNA in SV40-derived VLPs by ddPCR. SV40-derived particles were generated in the presence of (A) "CircRNA COM" or (B) "CircRNA split COM" as described in Example 6. Absolute levels of linear and circular RNA were quantified by ddPCR using EvaGreen Digital PCR Supermix. EXAMPLES

[0313] The following examples are provided for illustrative purposes only and are not intended to limit the above invention in any way.

[0314] Example 1 Design and synthesis of synthetic nucleic acid molecules The amino acid sequences of LV GAG (SEQ ID NO:31), LV VSVG (SEQ ID NO:28), SV40 VP1 (SEQ ID NO:1), SV40 VP2 (SEQ ID NO:2), SV40 VP2 woDBD (SEQ ID NO:3), SV40 VP3 (SEQ ID NO:4), SfMu Com binding protein (SEQ ID NO:14), and peptide linker (GGGSGGGSGGGS; SEQ ID NO:5) were reverse translated and the nucleotide sequences were optimized by knocking out potential splice sites and RNA destabilizing sequence elements, optimized for improved RNA stability, and adapted to match the requirements of HEK293 cells (Homo sapiens) for codon usage. The nucleotide sequences were synthesized by GeneArt Gene Synthesis (Life technologies).

[0315] Two nucleotide constructs encoding circRNAs encoding GFP-HiBit (SEQ ID NO: 37+39) via protein-assisted backsplicing achieved by the ZKSCAN1 intron (SEQ ID NO: 34+35) and containing the SfMu Com stem-loop (SEQ ID NO: 13) were designed and synthesized by GeneArt Gene Synthesis (Life technologies). In one of the constructs (SEQ ID NO: 38), the SfMu Com stem-loop (SEQ ID NO: 13) was spitted, allowing the com stem-loop to function only after RNA circularization. In the other construct (SEQ ID NO: 36), the SfMu Com stem-loop (SEQ ID NO: 13) functioned independently of RNA circularization.

[0316] Example 2 Construction of expression plasmids The synthesized constructs were used to generate the constructs shown in Figure 2a, Figure 2b, and Figure 2c using standard cloning procedures. The nucleotide sequences of the generated constructs are set forth herein as SEQ ID NO: 17 (SV40 VP2-COM), SEQ ID NO: 19 (SV40 VP2 woDBD-COM), SEQ ID NO: 23 (SV40 COM-VP1), SEQ ID NO: 21 (SV40 VP3-COM), SEQ ID NO: 25 (SV40 VP1), SEQ ID NO: 32 (LV GAG-COM), SEQ ID NO: 27 (LV VSVG), SEQ ID NO: 29 (LV POL), SEQ ID NO: 38 (circRNA encoding GFP with splitCom), and SEQ ID NO: 36 (circRNA encoding GFP with Com). The sequences encode SV40 VP2-COM (SEQ ID NO: 18), SV40 VP2 woDBD-COM (SEQ ID NO: 20), SV40 COM-VP1 (SEQ ID NO: 24), SV40 VP3-COM (SEQ ID NO: 22), SV40 VP1 (SEQ ID NO: 26), LV GAG-COM (SEQ ID NO: 33), LV VSVG (SEQ ID NO: 28), LV POL (SEQ ID NO: 30), circRNA encoding GFP with splitCom, and circRNA encoding GFP with Com. The constructs are ligated into an expression vector, allowing transient transcription of the corresponding mRNA under the control of the CMV promoter and terminated with a polyadenylation signal. Here, the well-known signal of the SV40 virus was used. The general procedure for constructing expression plasmids is described in Sambrook, J., E. Fritsch, T. Maniatis: Cloning I / II / III, A Laboratory Manual New York: k / Cold Spring Harbor Laboratory Press, 1989, 2nd ed.

[0317] Example 3 Generation of circular RNA-loaded lentivirus-derived particles by transient transfection of HEK293 cells The constructs shown in Figure 2a were transfected into HEK293 cells using Effectene Transfection Reagent (Qiagen) according to the manufacturer's recommendations. More specifically, in two different experiments, the following constructs were transfected in the indicated ratios: Experiment #1: 'LV-g / p COM' (SEQ ID NO:29 and SEQ ID NO:32), 'VSVG' (SEQ ID NO:27), 'CircRNA COM' (SEQ ID NO:36) (1:1:1). Experiment #2: 'LV-g / p COM' (SEQ ID NO:29 and SEQ ID NO:32), 'VSVG' (SEQ ID NO:27), 'CircRNA splitCOM' (SEQ ID NO:38) (1:1:1). Lentivirus-derived particles were collected 48 hours after transfection by removing the supernatant, centrifugation (1,000xg for 10 minutes at room temperature) and filtration through a 0.45 μm pore size filter. The lentiviral particles were then cultured with target cells (e.g., HEK 293 cells) for 24 h under standard cell culture conditions, and GFP expression was monitored by flow cytometry or fluorescence microscopy.

[0318] Example 4 Generation of SV40-derived particles carrying circular RNA by in vitro encapsulation in insect cells Based on the construct shown in Figure 2b, Bac-to-Bac TM Baculovirus expression system (Gibco) and ExpiSf TM Baculoviruses were generated using the Gibco Expression System kit. Briefly, the various constructs were cloned into the pFastBac donor plasmid, which then contained the bacmid and helper plasmids and were transformed into pFastBac TM E. coli host strain DH10Bac, which allows for the generation of recombinant bacmids after transposition of expression constructs TM The resulting bacmid was then isolated and transformed into ExpiFectamine 100, which is used to rapidly and efficiently transfect insect cells to generate recombinant baculovirus. TMSf9 cells (derived from the armyworm Spodoptera frugiperda) were transfected using Sf transfection reagent. These recombinant baculoviruses were then titrated according to the manufacturer's recommendations and stored at -80 °C until further use. To induce expression of selected transgenes in insect cells, recombinant baculoviruses encoding the constructs shown in Figure 2b were used to transduce naive Sf9 cells in various combinations. Thus, a defined amount of baculovirus, indicated as multiplicity of infection (MOI), was used for infection. The following experiments were performed: Experiment #1: Infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5 combined with infection with a baculovirus encoding "SV40 VP2 COM" (SEQ ID NO: 17) at MOI 5. Experiment #2: Infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5 combined with infection with a baculovirus encoding "SV40 VP2 woDBD COM" (SEQ ID NO: 19) at MOI 5. Experiment #3: Infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5 combined with infection with a baculovirus encoding "SV40 VP3 COM" (SEQ ID NO: 21) at MOI 5. Experiment #4: Infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5 combined with infection with a baculovirus encoding "SV40 COM VP1" (SEQ ID NO: 23) at MOI 5. SV40-derived particles were prepared by infecting baculovirus-infected Sf48 cells 48 hours post-transfection. The cells were harvested by lysis with three freeze / thaw steps. Cell debris was then removed by centrifugation (3,200 × g for 10 min at room temperature) and SV40 particles were isolated using 20% ​​and 40% OptiPrep. TM Purification was performed by ultracentrifugation using gradients (Abbott). 20% and 40% OptiPrep TMA slightly diffuse band in the interphase between the concentrations was collected, and the resulting particles were either stored at -80 °C or directly used for the encapsulation of circular RNAs bearing com sequences in vitro. Thus, the circRNA constructs containing COM were applied as templates for in vitro transcription using a Hi-T7 RNA polymerase kit according to the manufacturer's recommendations, after which the initial linear RNA was circularized in vitro by the addition of T4 RNA ligase 2. The "disassembly and loading process" shown in Figure 4 is initiated by treating the SVV particles obtained in experiments #1, #2, #3 and #4 with DTT (15 mM) for 20 min at 37 °C, resulting in the disassembly of SV40 VLPs. Then, the particles were loaded with loading buffer (10 mM ATP, 20 mM Hepes-KOH buffer (pH 7.9), 80 mM KCl, 40 mM NH 4 Cl, 10 mM MgCl 2 Circular GFP-encoding “CircRNA COM” diluted in 100 mM NaCl, 16% glycerol, 0.08% NP-40 was added to the degraded SV40 protein and incubated for an additional 60 min at 37°C. Reassembly was performed in reassembly buffer (150 mM Sodium acetate buffer pH 5.2, 3mM CaCl 2 , 120 mM KCl, 40 mM NH 4 Cl) and incubation overnight at 4 °C. The mixture was then treated with Salt Active Nuclease (SAN, ArcticZymes) and kept at room temperature for 10 min. Chloroform was added to stop the reaction, and assembled particles were collected in the aqueous phase after centrifugation. The resulting particles were either stored at -80 °C or used directly to transduce target cells. Thus, isolated SV40-derived particles were incubated with target cells (e.g., HEK293 cells) using standard cell culture conditions for 24 h, and GFP expression was monitored by flow cytometry or fluorescence microscopy.

[0319] Example 5 Generation of circular RNA-loaded SV40-derived particles using a baculovirus / insect cell-based expression system Based on the constructs shown in Figure 2b and Figure 2c, Bac-to-Bac TM Baculovirus expression system (Gibco) and ExpiSf TM Baculoviruses were generated using the Gibco Expression System kit. Briefly, the various constructs were cloned into the pFastBac donor plasmid, which then contained the bacmid and helper plasmids and were transformed into pFastBac TM E. coli host strain DH10Bac, which allows for the generation of recombinant bacmids after transposition of expression constructs TM The resulting bacmid was then isolated and transformed into ExpiFectamine 100, which is used to rapidly and efficiently transfect insect cells to generate recombinant baculovirus. TM Transfection of Sf9 cells (Sf9 cells) using Sf transfection reagent The recombinant baculoviruses were then titrated according to the manufacturer's recommendations and stored at -80°C until further use. To induce expression of the selected transgenes in insect cells, recombinant baculoviruses encoding the constructs shown in Figure 2a and Figure 2c were used to transduce naïve Sf9 cells in various combinations. Thus, a defined amount of baculovirus, indicated as multiplicity of infection (MOI), was used for infection. The following experiments were performed: Experiment #1: Infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5 combined with infection with a baculovirus encoding "SV40 VP2 COM" (SEQ ID NO: 17) at MOI 5, and infection with a baculovirus encoding "CircRNA COM" (SEQ ID NO: 36) at MOI 5. Experiment #2: Infection with baculovirus encoding "SV40 VP1" (SEQ ID NO:25) at an MOI of 5 and "SV40 VP2 woDBD" at an MOI of 5. Infection with a baculovirus encoding the IL-11A polypeptide (SEQ ID NO: 19), and an MOI of Experiment #1: Combined infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5, combined with infection with a baculovirus encoding "SV40 VP3 COM" (SEQ ID NO: 21) at MOI 5, and combined infection with a baculovirus encoding "CircRNA COM" (SEQ ID NO: 36) at MOI 5. Experiment #2: Combined infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5, combined with infection with a baculovirus encoding "SV40 COM VP1" (SEQ ID NO: 235) at MOI 5, and combined infection with a baculovirus encoding "CircRNA COM" (SEQ ID NO: 36) at MOI 5. Experiment #3: Combined infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5, combined with infection with a baculovirus encoding "SV40 COM VP1" (SEQ ID NO: 235) at MOI 5, and combined infection with a baculovirus encoding "CircRNA COM" (SEQ ID NO: 36) at MOI 5. Experiment #5: Infection with a baculovirus encoding "SV40 VP1" at MOI 5 combined with infection with a baculovirus encoding "SV40 VP2 COM" (SEQ ID NO: 17) at MOI 5 and "CircRNA splitCOM" (SEQ ID NO: 38) at MOI 5. Experiment #6: Infection with a baculovirus encoding "SV40 VP1" at MOI 5 combined with infection with a baculovirus encoding "SV40 VP2 COM" (SEQ ID NO: 17) at MOI 5 and "CircRNA splitCOM" (SEQ ID NO: 38) at MOI 5. Experiment #1: Infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5 combined with infection with a baculovirus encoding "SV40 VP2 woDBD COM" (SEQ ID NO: 19) and "CircRNA splitCOM" (SEQ ID NO: 38) at MOI 5. Experiment #2: Infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5 combined with infection with a baculovirus encoding "SV40 VP3 COM" (SEQ ID NO: 21) and "CircRNA splitCOM" (SEQ ID NO: 38) at MOI 5. Experiment #3: Infection with a baculovirus encoding "SV40 VP1" (SEQ ID NO: 25) at MOI 5 combined with infection with a baculovirus encoding "SV40 COM VP1" (SEQ ID NO: 23) at MOI 5 and "CircRNA splitCOM" (SEQ ID NO: 38) at MOI 5. SV40-derived particles were harvested 48 h post-transfection by lysing baculovirus-infected Sf9 cells with three freeze / thaw steps. Cell debris was then removed by centrifugation (3,200 × g for 10 min at room temperature) and SV40 particles were isolated using 20% ​​and 40% OptiPrep™. TM Purification was performed by ultracentrifugation using gradients (Abbott). 20% and 40% OptiPrep TM A slightly diffuse band in the interphase between concentrations was collected, and the resulting particles were either stored at -80°C or used directly for transduction of target cells. Thus, isolated SV40-derived particles were incubated with target cells (e.g., HEK293 cells) using standard cell culture conditions for 24 h, and GFP expression was monitored by flow cytometry or fluorescence microscopy.

[0320] Example 6 Generation of circular RNA-loaded SV40-derived particles using a HEK293 cell-based expression system The constructs shown in Figure 2b and Figure 2c (driven by a CMV promoter) were transfected into HEK293 cells using Effectene Transfection Reagent (Qiagen) according to the manufacturer's recommendations. Thus, transfection mixes of different compositions were used for the generation of SV40-derived particles containing therapeutically active RNA. More specifically, in the following experiments, specific constructs were transfected at the indicated ratios. Experiment #1: "SV40 VP1" (SEQ ID NO: 25), "SV40 VP2 COM" (SEQ ID NO: 17), "CircRNA COM" (SEQ ID NO: 36) (1:1:1). Experiment #2: "SV40 VP1" (SEQ ID NO: 25), "SV40 VP2 woDBD COM" (SEQ ID NO: 19), "CircRNA COM" (SEQ ID NO: 36) (1:1:1). Experiment #3: "SV40 VP1" (SEQ ID NO: 25), "SV40 VP3 COM" (SEQ ID NO: 21), "CircRNA COM" (SEQ ID NO: 36) (1:1 :1). Experiment #4: "SV40 VP1" (SEQ ID NO: 25), "SV40 COM VP1" (SEQ ID NO: 23), "CircRNA COM" (SEQ ID NO: 36) (1:1:1). Experiment #5: "SV40 VP1" (SEQ ID NO: 25), "SV40 VP2 COM" (SEQ ID NO: 17), "CircRNA splitCOM" (SEQ ID NO: 38) (1:1:1). Experiment #6: "SV40 VP1" (SEQ ID NO: 25), "SV40 VP2 woDBD COM" (SEQ ID NO: 19), "CircRNA splitCOM" (SEQ ID NO: 38) (1:1:1). Experiment #7: "SV40 VP1" (SEQ ID NO: 25), "SV40 VP3 COM" (SEQ ID NO: 21), "CircRNA splitCOM" (SEQ ID NO: 38) (1:1:1). Experiment #8: "SV40 VP1" (SEQ ID NO:25), "SV40 COM VP1" (SEQ ID NO:23), "CircRNA splitCOM" (SEQ ID NO:38) (1:1:1). SV40-derived particles were harvested 48 hours post-transfection by lysing transfected HEK 293 cells with three freeze / thaw steps. Cell debris was then removed by centrifugation (10 min at room temperature, 3,200 x g) and SV40 particles were isolated by centrifugation with 20% and 40% OptiPrep. TM Purification was performed by ultracentrifugation using gradients (Abbott). 20% and 40% OptiPrep TM A slightly diffuse band in the interphase between concentrations was collected, and the resulting particles were either stored at -80°C or used directly for transduction of target cells. Thus, isolated SV40-derived particles were incubated with target cells (e.g., HEK293 cells) using standard cell culture conditions for 24 h, and GFP expression was monitored by flow cytometry or fluorescence microscopy.

[0321] Example 7 CircRNA analysis To measure the ratio of circular to linear RNA, primers circGFPr (GAAGTTCTGCGACTGCACAC; SEQ ID NO: 41) and circGFPf (GCATGGACGAGCTGTACAAG; SEQ ID NO: 40) rather than circGFPr (GAAGTTCTGCGACTGCACAC; SEQ ID NO: 41) and circIntronf (GTGTTAGCAGCACAGATCAC; SEQ ID NO: 42) were used to amplify a small fragment within the circRNA (176 bp fragment, specific for circular RNA) rather than a fragment containing the circ5Intron (194 bp fragment, specific for linear RNA) (Figure 5). The following PCR conditions were applied: 95 °C for 10 min, 95 °C for 15 s, 60 °C for 60 s, 40 cycles. To quantify the absolute copy numbers of linear and circular RNA, the same primer pair was used in EvaGreen Digital PCR Supermix (BIO-RAD) reactions according to the manufacturer's recommendations.

[0322] Sequence table: SEQ ID NO: 1 SV40 VP1 AS SEQ ID NO: 2 SV40 VP2 AS SEQ ID NO: 3 SV40 VP 2 woDBD AS SEQ ID NO: 4 SV40 VP3 AS SEQ ID NO: 5 Linker AS SEQ ID NO: 6 MS2 RNA DNA SEQ ID NO: 7 MS2 ABP AS SEQ ID NO: 8 KU RNA DNA SEQ ID NO: 9 KU ABP1 AS SEQ ID NO: 10 KU ABP2 AS SEQ ID NO: 11 Sm7 RNA DNA SEQ ID NO: 12 SMm7 ABP AS SEQ ID NO: 13 COM RNA DNA SEQ ID NO: 14 COM ABP AS SEQ ID NO: 15 PP7 RNA DNA SEQ ID NO: 16 PP7 ABP AS SEQ ID NO: 17 SV40 VP2-COM DNA SEQ ID NO: 18 SV40 VP2-COM AS SEQ ID NO: 19 SV40 VP2 woDBD-COM DNA SEQ ID NO: 20 SV40 VP2 woDBD-COM AS SEQ ID NO: 21 SV40 VP3-COM DNA SEQ ID NO: 22 SV40 VP3-COM AS SEQ ID NO: 23 SV40 COM-VP1 DNA SEQ ID NO: 24 SV40 COM-VP1 AS SEQ ID NO: 25 SV40 VP1 DNA SEQ ID NO: 26 SV40 VP1 AS SEQ ID NO: 27 VSVG DNA SEQ ID NO: 28 VSVG AS SEQ ID NO: 29 POL DNA SEQ ID NO: 30 POL AS SEQ ID NO: 31 GAG AS SEQ ID NO: 32 GAG COM DNA SEQ ID NO: 33 GAG COM AS SEQ ID NO: 34 Circ5 intron DNA SEQ ID NO: 35 circ3intron DNA SEQ ID NO: 36 CircRNA COM DNA SEQ ID NO: 37 GFP-HIBIT AS SEQ ID NO: 38 CircRNA splitCOM DNA SEQ ID NO: 39 GFP-HIBIT AS SEQ ID NO: 40 circGFPf DNA SEQ ID NO: 41 CircGFPr DNA SEQ ID NO: 42 circintronf DNA SEQ ID NO: 43 td circ5intron DNA SEQ ID NO: 44 td circ3intron DNA See above for SEQ ID NO:45 through SEQ ID NO:185. woDBD = no DNA binding domain AS = amino acid

[0323] Where a polynucleotide is defined above in terms of a DNA nucleotide sequence, a polynucleotide defined in terms of an RNA nucleotide sequence is likewise included, and vice versa.

Claims

1. A (linear) polynucleotide (capable of circularization), comprising, in 5' to 3' order: A first backsplicing intron sequence, A first portion of the recruiting RNA motif, a nucleotide sequence of interest, a second portion of the recruiting RNA motif, and a second backsplicing intron sequence, A polynucleotide, wherein the first portion of the recruit RNA motif and the second portion of the recruit RNA motif form a functional recruit RNA motif after circularization.

2. 2. The polynucleotide of claim 1, comprising an internal ribosome entry site (IRES) or an N6-methyladenosine (m6a) for translation initiation between the first portion of the recruiting RNA motif and the nucleotide sequence of interest.

3. 3. The polynucleotide of claim 1 or claim 2, comprising a promoter at the 5' end and / or a polyA tail at the 3' end.

4. 4. The polynucleotide of claim 1, wherein the backsplicing intron is a ZKSCAN1 intron.

5. 5. The polynucleotide of claim 1, wherein circularization of the (linear) polynucleotide into a circular polynucleotide is achievable by protein-assisted backsplicing or autocatalytic backsplicing.

6. 6. The polynucleotide of claim 1, which does not contain an in-frame stop codon to allow rolling circle translation after circularization.

7. 7. The polynucleotide of claim 1, wherein the recruitment RNA motif is selected from the group consisting of an MS2 phage operator stem loop, a telomerase Ku binding motif, a telomerase Sm7 binding motif, an SfMu phage COM stem loop, and a PP7 phage operator stem loop.

8. The polynucleotide of any one of claims 1 to 7, wherein the polynucleotide is a DNA or RNA polynucleotide.

9. A vector comprising the polynucleotide of any one of claims 1 to 8.

10. An artificial circular RNA molecule comprising an RNA element of interest and a recruiting RNA motif.

11. The artificial circular RNA molecule according to claim 10, wherein the recruitment RNA motif is selected from the group consisting of an MS2 phage operator stem loop, a telomerase Ku binding motif, a telomerase Sm7 binding motif, an SfMu phage COM stem loop, and a PP7 phage operator stem loop.

12. The artificial circular RNA molecule of claim 11, wherein the recruiting RNA motif has a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or a transcribed nucleotide sequence thereof), and a nucleotide sequence having at least 80% sequence identity thereto.

13. The artificial circular RNA molecule according to any one of claims 10 to 12, wherein the target RNA element is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes.

14. (i) a polypeptide comprising a viral capsid protein, or a fragment or derivative thereof having a capsid protein function, and at least one RNA binding domain; (ii) an artificial circular RNA molecule comprising an RNA element of interest, preferably an artificial circular RNA molecule according to any one of claims 10 to 13; A complex of.

15. The complex of claim 14 , wherein the artificial circular RNA molecule comprises a recruitment RNA motif.

16. The complex of claim 15, wherein the at least one RNA binding domain binds to the recruiting RNA motif.

17. 17. A complex according to any one of claims 14 to 16, wherein the at least one RNA binding domain is linked / fused / associated, preferably via a linker, to a viral capsid protein or a fragment or derivative thereof having capsid protein function.

18. The complex of claim 17, wherein the at least one RNA binding domain is linked / fused / associated, preferably via a linker, to the N-terminus and / or C-terminus of a viral capsid protein or a fragment or derivative thereof having capsid protein function.

19. 19. The complex of any one of claims 14 to 18, wherein the at least one RNA binding domain is a naturally occurring RNA binding domain or an artificial RNA binding domain.

20. 20. The complex of any one of claims 14 to 19, wherein the at least one RNA binding domain is selected from the group consisting of MS2 coat protein or an RNA binding section thereof, Ku protein or an RNA binding section thereof, Sm7 protein or an RNA binding section thereof, SfMu phage COM RNA binding protein or an RNA binding section thereof, and PP7 coat protein or an RNA binding section thereof.

21. 21. The complex of any one of claims 15 to 20, wherein the recruitment RNA motif is selected from the group consisting of an MS2 phage operator stem loop, a telomerase Ku binding motif, a telomerase Sm7 binding motif, an SfMu phage COM stem loop, and a PP7 phage operator stem loop.

22. (i) the at least one RNA-binding domain is an MS2 coat protein or an RNA-binding section thereof and the recruitment RNA motif is an MS2 phage operator stem-loop; (ii) the at least one RNA binding domain is a Ku protein or an RNA binding section thereof, and the recruiting RNA motif is a telomerase Ku binding motif; (iii) the at least one RNA-binding domain is an Sm7 protein or an RNA-binding section thereof, and the recruiting RNA motif is a telomerase Sm7-binding motif; - (iv) the at least one RNA-binding domain is an SfMu phage COM RNA-binding protein or an RNA-binding section thereof and the recruitment RNA motif is an SfMu phage COM stem-loop; and / or (v) the at least one RNA-binding domain is a PP7 coat protein or an RNA-binding section thereof and the recruitment RNA motif is a PP7 phage operator stem loop; A complex according to any one of claims 14 to 21.

23. 23. The complex of any one of claims 20 to 22, wherein the at least one RNA binding domain has an amino acid sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, and amino acid sequences having at least 80% sequence identity thereto.

24. 24. The complex of any one of claims 21 to 23, wherein the recruitment RNA motif has a nucleotide sequence selected from the group consisting of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 (or a transcribed nucleotide sequence thereof), and nucleotide sequences having at least 80% sequence identity thereto.

25. 25. The complex of any one of claims 14 to 24, wherein the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes.

26. 26. The complex of any one of claims 14 to 25, wherein the virus is a DNA virus or an RNA virus.

27. the DNA virus is selected from the group consisting of papovaviruses, papillomaviruses, polyomaviruses, adenoviruses, and parvoviruses; or 27. The complex of claim 26, wherein the RNA virus is a retrovirus, a norovirus, or an orthomyxovirus.

28. the polyomavirus is Simian Virus 40 (SV40), BK Virus (BKV), JC Virus (JCV), or MPy Virus (MPyV); the parvovirus is an adeno-associated virus (AAV); the retrovirus is a lentivirus, the Norovirus is a Norwalk virus; or 28. The conjugate of claim 27, wherein the orthomyxovirus is an influenza A or influenza B virus.

29. 29. The complex of any one of claims 14 to 28, wherein the capsid protein is a capsid protein of an RNA virus or a DNA virus.

30. the capsid protein of the DNA virus is selected from the group consisting of papovavirus capsid protein, papillomavirus capsid protein, polyomavirus capsid protein, adenovirus capsid protein, and parvovirus capsid protein; or 30. The complex of claim 29, wherein the RNA virus capsid protein is a lentivirus capsid protein.

31. (i) the parvovirus capsid protein is an adeno-associated virus capsid protein; , preferably AAV9 capsid protein, (ii) the polyomavirus capsid protein is an SV40 capsid protein, a BKV capsid protein, a JCV capsid protein, or an MPyV capsid protein; or (iii) the lentiviral capsid protein is a nucleocapsid (NC) protein, a matrix protein (MA) or a capsid protein (CA); The complex of claim 30.

32. (i) the AAV9 capsid protein is an AAV9 VP1 capsid protein, an AAV9 VP2 capsid protein, or an AAV9 VP3 capsid protein; (ii) the SV40 capsid protein is an SV40 VP1 capsid protein, an SV40 VP2 capsid protein, or an SV40 VP3 capsid protein; (iii) the BKV capsid protein is a BKV VP1 capsid protein, a BKV VP2 capsid protein, or a BKV VP3 capsid protein; (iv) the JCV capsid protein is JCV VP1 capsid protein, JCV 32. The complex of claim 31 , wherein (v) the MPyV capsid protein is a MPyV VP1 capsid protein, a MPyV VP2 capsid protein, or a JCV VP3 capsid protein; or (v) the MPyV capsid protein is a MPyV VP1 capsid protein, a MPyV VP2 capsid protein, or a MPyV VP3 capsid protein.

33. The SV40 VP1 capsid protein has an amino acid sequence of SEQ ID NO:1, or an amino acid sequence having at least 80% sequence identity thereto; The SV40 VP2 capsid protein has an amino acid sequence of SEQ ID NO:2, or an amino acid sequence having at least 80% sequence identity thereto; The SV40 VP2 capsid protein without the DNA binding domain (woDBD) has an amino acid sequence of SEQ ID NO:3 or an amino acid sequence having at least 80% sequence identity thereto; The SV40 VP3 capsid protein has an amino acid sequence of SEQ ID NO:4, or an amino acid sequence having at least 80% sequence identity thereto; The nucleocapsid (NC) protein has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80% sequence identity thereto; The matrix protein (MA) has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31, or an amino acid sequence having at least 80% sequence identity thereto; or The complex of claim 31 or claim 32, wherein the capsid protein (CA) has an amino acid sequence contained in the amino acid sequence set forth in SEQ ID NO: 31 or an amino acid sequence having at least 80% sequence identity thereto.

34. 34. A virus-like particle (VLP) comprising a complex according to any one of claims 14 to 33.

35. A virus-like particle (VLP) comprising an artificial circular RNA molecule that contains an RNA element of interest.

36. The VLP of claim 35, wherein the artificial circular RNA molecule is encapsidated within the VLP.

37. The VLP of claim 35 or claim 36, wherein the VLP comprises a complex described in any one of claims 14 to 33.

38. 38. The VLP of any one of claims 34 to 37, wherein the VLP is a DNA or RNA VLP.

39. the DNA VLP is a VLP of a virus selected from the group consisting of papovavirus, papillomavirus, polyomavirus, adenovirus, and parvovirus; or The RNA VLP is a retrovirus, a norovirus, or an orthomyxovirus VLP; 39. The VLP of claim 38.

40. the polyomavirus is Simian Virus 40 (SV40), BK Virus (BKV), JC Virus (JCV), or MPy Virus (MPyV); the parvovirus is an adeno-associated virus (AAV); the retrovirus is a lentivirus, the Norovirus is a Norwalk virus; or 40. The VLP of claim 39, wherein the orthomyxovirus is an influenza A or influenza B virus.

41. A method for producing a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest, preferably as defined in any one of claims 34 to 40, comprising the steps of: (i) providing a cell; and (ii) administering to a cell: (iia) a polypeptide comprising a viral capsid protein, or a fragment or derivative thereof having a capsid protein function and at least one RNA-binding domain, a polynucleotide encoding said polypeptide, or a vector comprising said polynucleotide; and (iib) A polynucleotide according to any one of claims 1 to 8, a vector according to claim 9, an artificial circular RNA molecule comprising an RNA element of interest, or an artificial circular RNA molecule according to any one of claims 10 to 13. introducing Thereby generating said virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest.

42. A method for producing a virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest, preferably as defined in any one of claims 34 to 40, comprising the steps of: (i) providing a virus-like particle (VLP) comprising a viral capsid protein or a fragment or derivative thereof having a capsid protein function and a polypeptide comprising at least one RNA binding domain; (ii) disassembling the VLPs; (iii) adding an artificial circular RNA molecule comprising an RNA element of interest or an artificial circular RNA molecule according to any one of claims 10 to 13; (iv) reassembling the disassembled VLPs; thereby generating said virus-like particle (VLP) comprising an artificial circular RNA molecule comprising an RNA element of interest; The method includes:

43. The virus-like particle (VLP) provided in (i) comprising a polypeptide comprising a viral capsid protein and at least one RNA binding domain, (a) providing a cell; (b) produced by introducing into a cell a polypeptide comprising a viral capsid protein or a fragment or derivative thereof having a capsid protein function and at least one RNA-binding domain, a polynucleotide encoding said polypeptide, or a vector comprising said polynucleotide; 43. The method of claim 42.

44. 44. The method of claim 42 or claim 43, wherein the decomposition is achieved by chemical means.

45. 45. The method of claim 44, wherein the chemical means is selected from the group consisting of treatment with a reducing agent, preferably dithiothreitol (DTT), N-acetylcysteine ​​(NALC), β-mercaptoethanol, tris(2-carboxyethyl)phosphine (TCEP), or thioredoxin.

46. 46. ​​The method of any one of claims 41 to 45, wherein the cell is a eukaryotic cell.

47. 47. The method of claim 46, wherein the eukaryotic cell is a vertebrate cell, an arthropod cell, a yeast cell, or a fungal cell.

48. 48. The method of claim 47, wherein the vertebrate cell is a mammalian cell or the arthropod cell is an insect cell.

49. 49. The method of any one of claims 41 to 48, wherein the RNA element of interest is selected from the group consisting of shRNA, miRNA, protein-coding RNA, pre-miRNA, piRNA, RNA complementary to other non-coding RNA, and ribozymes.

50. 50. A virus-like particle (VLP) obtainable by the method of any one of claims 41 to 49.

51. 51. A composition comprising a virus-like particle according to any one of claims 34 to 40 or claim 50.

52. 52. The composition of claim 51, which is a pharmaceutical composition.

53. 53. The composition of claim 52, wherein the pharmaceutical composition comprises one or more pharma- ceutically acceptable carriers.

54. 54. A virus-like particle according to any one of claims 34 to 40 or claim 50 or a composition according to any one of claims 51 to 53 for use in medicine.

55. 54. A virus-like particle according to any one of claims 34 to 40 or claim 50 or a composition according to any one of claims 51 to 53 for use in therapy.

56. 54. A virus-like particle according to any one of claims 34 to 40 or claim 50 or a composition according to any one of claims 51 to 53 for use in vaccination.

Images