Compositions and methods for treating FUS-associated diseases
Patent Information
- Application Number
- JP2024545791
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-02-02
- Filing Date
- 2023-02-02
- Publication Date
- 2025-12-10
AI Technical Summary
The prior art is difficult to effectively treat diseases such as ALS and FTLD caused by FUS gene mutations, and there is a lack of treatment methods that can effectively slow down the progress of the disease.
Anti-infection nucleic acid (AON) targeting pre-FUS messenger RNA is used to bind to pre-FUS messenger RNA through specific nucleobase sequences, inhibit the expression of the FUS gene, and regulate FUS transcription by initiating an alternative shear mechanism.
By reducing the expression of FUS protein, it can effectively slow the progression of FUS-related diseases, improve the quality of life of patients, and provide a potential treatment to alleviate the symptoms of the disease.
Smart Images

Figure 00000039_0000 
Figure 00000039_0001 
Figure 00000040_0000
Abstract
Description
[Technical field]
[0001] Technical Field The present invention relates to antisense oligonucleotides (AONs) for reducing the expression of the FUS gene, which encodes the FUS RNA-binding protein (also known as Fused in Sarcoma). The present invention provides methods for treating, preventing, or alleviating the effects of diseases associated with pathogenic variations in FUS, FUS proteinopathy, or high FUS expression by administration of AONs and therapeutic compositions comprising AONs targeted to FUS. Pathogenic variations in the FUS gene have been found in a subset of patients with amyotrophic lateral sclerosis (ALS) and in rare cases of frontotemporal lobar degeneration (FTLD). The present invention can be used to treat, prevent, or alleviate the effects of FUS-ALS or FUS-FTLD or in sporadic ALS. [Background technology]
[0002] Background technology The following background art discussion is intended merely to facilitate an understanding of the present invention. This discussion is not an admission or acknowledgement that any of the material mentioned is or was part of common general knowledge as of the priority date of this application.
[0003] FUS
[0004] FUS encodes a ubiquitously expressed 526 amino acid protein that belongs to the FET family of RNA-binding proteins. FUS is primarily localized in the nucleus under normal physiological conditions, but translocates to the cytoplasm and functions in nucleocytoplasmic transport. FUS functions in a diverse range of cellular processes, such as transcription, pre-mRNA splicing, RNA transport and translational regulation. FUS also participates in DNA repair mechanisms, including both homologous recombination during DNA double-strand break repair and homologous recombination in nonhomologous end joining. In addition, FUS plays a role in the formation of paraspeckles and stress granules, which provide cellular defense against various types of stress.
[0005] Up to 10% of individuals affected with amyotrophic lateral sclerosis (ALS) have at least one other affected family member and are defined as having familial ALS (fALS); almost all of these cases are found to be inherited in an autosomal dominant manner. The remaining 90-95% of ALS cases occur in people with no previous family history, and these individuals are said to have sporadic ALS (sALS). Pathogenic variants in FUS are responsible for approximately 5% of fALS cases and less than 1% of sALS cases.
[0006] Currently, over 50 autosomal dominant FUS variants have been identified in ALS patients. The majority are missense mutations, but in rare cases, insertions, deletions, splicing and nonsense mutations have been reported. Many of the pathogenic variants are clustered within the nuclear localization signal, leading to redistribution of FUS to the cytoplasm. Others occur in the prion-like domain and 3'UTR, glycine- and arginine-rich regions. Variants within some regions appear to increase the tendency of the protein to form solid aggregates, indicating different pathological mechanisms operative in FUS-associated ALS.
[0007] FUS is autoregulated to repress the expression of exon 7, with one mechanism involving the protein binding to its own pre-mRNA. A frameshift in a splice variant that skips exon 7 results in a premature stop codon that causes the transcript to be subject to nonsense-mediated decay. In FUS-ALS and FUS-frontotemporal lobar degeneration (FTLD), cytoplasmic mislocalization of FUS may impair autoregulation and cause overexpression. There is some evidence that FUS cytoplasmic mislocalization may also occur in ALS cases without FUS mutations.
[0008] Impaired cellular function could also be a direct consequence of pathogenic FUS variants that have been reported to cause splicing defects, DNA damage and impair FUS autoregulation. In addition, there are indications that the disease transmission mechanism in FUS-ALS may be mediated by its prion-like protein domain.
[0009] The extent to which loss- or gain-of-function mechanisms contribute to disease in FUS-ALS remains a matter of debate. The FUS loss-of-function theory posits that the redistribution of FUS into the pathological cytoplasm renders it unable to carry out its functions in the nucleus. Evidence from mouse models suggests that loss of FUS is insufficient to cause ALS. However, this finding was contradicted when using a Drosophila Fus knockdown model, in which knockdown of the FUS orthologue Cabeza resulted in neuronal degeneration and motor defects.
[0010] There is strong evidence for a gain-of-function mechanism operating in FUS-ALS. Transgenic mouse models overexpressing wild-type human FUS have been reported to have a malignant phenotype of motor neuron degeneration and evidence of FUS accumulation in the cytoplasm. There is debate as to whether toxicity is primarily mediated directly by FUS aggregates or through an increase in soluble FUS in the cytoplasm following its redistribution. Cytoplasmic FUS distribution also alters stress granule dynamics. The aggregating nature of FUS is not purely pathological but is important in normal cellular function. Some have proposed that FUS aggregation may be a compensatory mechanism that protects cells from a potentially toxic increase in soluble cytoplasmic FUS.
[0011] FUS variants are associated with early-onset and juvenile ALS, which manifests as relentlessly progressive muscle atrophy and weakness, with effects on respiratory muscles that limit survival in most cases to less than three years after disease onset. Current treatment options are based on symptom management and respiratory support, with the only approved drug therapy extending survival by only a few months or providing only modest benefit in some patients. There are no effective treatments that slow or stop disease progression.
[0012] Due to strong evidence of gain of function toxicity caused by FUS aggregation, overexpression or cytoplasmic mislocalization, knockdown of FUS may have therapeutic potential in treating patients with pathogenic FUS mutations, high FUS expression or FUS proteinopathy. Several patients have received investigational FUS-targeted AONs on the basis of rescue use in treatment (ION363), which is currently undergoing Phase 3 clinical trials (NCT04768972). The present invention includes AONs that utilize a different mechanism of action and a different chemical composition than the AONs being tested in NCT04768972.
[0013] FUS proteinopathy
[0014] Reducing FUS expression has application in the prevention and treatment of diseases associated with FUS proteinopathy (or high FUS expression), including FUS-ALS and FUS-FTLD and sporadic ALS.Reducing FUS expression can also have application in the prevention and treatment of other neurological conditions in patients with pathogenic FUS mutations, including frontotemporal dementia.
[0015] Reducing FUS expression may have applications in the prevention and treatment of other neurological conditions associated with FUS proteinopathies (or high FUS expression), such as chronic traumatic encephalopathy (CTE), Huntington's disease (HD), spinocerebellar ataxia type 1 (SCA1), spinocerebellar degeneration type 3 (SCA3), and polyglutamine repeat disorders, such as neuronal intranuclear inclusion disease (NIIBD). Reducing FUS expression may also have applications in the prevention and treatment of other neurological conditions or muscle disorders, such as frontotemporal dementia (FTD), Alzheimer's disease (AD), essential tremor (ET), Parkinson's disease (PD), inclusion body myopathy (IBMY), inclusion body myositis (IBM), corticobasal degeneration (CBD), and supranuclear palsy (PSP).
[0016] Despite a significant amount of research, there remains a need to develop and identify effective treatments for neurological conditions such as ALS.
[0017] It is against this background that the present invention has been developed, and in particular, the aim of the present invention is to provide a means for alleviating FUS proteinopathy in diseases associated with FUS proteinopathy or high FUS expression. Summary of the Invention [Means for solving the problem]
[0018] Summary of the Invention The present invention is directed to compounds, particularly AONs, targeted to nucleic acids encoding FUS.Embodiments of the present invention relate to AONs capable of binding to FUS pre-mRNA.
[0019] Generally, according to a first aspect of the present invention, there is provided an antisense oligonucleotide targeted to a nucleic acid molecule encoding a FUS pre-mRNA, the antisense oligonucleotide having (a) a nucleobase sequence selected from the list consisting of SEQ ID NOs: 1-30 or a variant thereof; or (b) a nucleobase sequence that is complementary to at least one or more contiguous nucleobases in the target FUS pre-mRNA or a variant thereof to which SEQ ID NOs: 1-30 also binds, the antisense oligonucleotide inhibiting expression of the FUS gene, and the antisense oligonucleotide being substantially isolated or purified.
[0020] In a preferred embodiment, the antisense oligonucleotide inhibits expression of FUS. In a further embodiment, the antisense oligonucleotide binds to exon 2, 3, 4, 5, 6 or 7 on FUS. In a further embodiment, the antisense oligonucleotide induces alternative splicing of the FUS pre-mRNA via exon skipping. Preferably, the exon is exon 7. In a further embodiment, the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer. In a further embodiment, the antisense oligonucleotide is a peptide-phosphorodiamidate morpholino oligomer conjugate. In a further embodiment, the antisense oligonucleotide is selected from the list consisting of SEQ ID NOs: 22-27 and 30. In a further embodiment, the antisense oligonucleotide is SEQ ID NO: 30.
[0021] In a further aspect, the present invention is a method for inducing alternative splicing of FUS pre-mRNA, the method comprising the steps of: (a) providing one or more antisense oligonucleotides according to the first aspect of the present invention; and (b) binding the oligomer to a target nucleic acid site.
[0022] In a further aspect, the present invention is a composition for treating, preventing or alleviating the effects of a disease associated with FUS proteinopathy, high FUS expression or FUS mutations, comprising: (a) one or more antisense oligonucleotides according to the first aspect of the present invention; and (b) one or more therapeutically acceptable carriers and / or diluents.
[0023] In a further aspect, the present invention is a pharmaceutical composition for treating, preventing or alleviating the effects of a disease associated with FUS proteinopathy, high FUS expression or FUS mutations, comprising: (a) one or more antisense oligonucleotides according to the first aspect of the present invention; and (b) one or more pharma- ceutical acceptable carriers and / or diluents.
[0024] In a preferred embodiment, the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of ALS, FTLD, CTE, HD, SCA1, SCA3 and NIIBD. In another embodiment, the disease associated with FUS proteinopathy or FUS mutation is selected from the group consisting of FTD, AD, ET, PD, IBMY, IBM, CBD, PSP.
[0025] In a further aspect, the present invention is a method for treating, preventing or alleviating the effects of disease associated with FUS proteinopathy, high FUS expression or FUS mutation, comprising administering an effective amount of the pharmaceutical composition of the present invention to a subject.In a preferred embodiment, the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of ALS, FTLD, CTE, HD, SCA1, SCA3 and NIIBD.Preferably, the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of ALS and FTLD.More preferably, the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of FUS-ALS and FUS-FTLD.
[0026] In a further embodiment, the present invention is a method for treating, preventing or alleviating the effects of disease associated with FUS proteinopathy, high FUS expression or FUS mutation in a patient identified by biomarker, comprising the steps of testing a subject for the presence of a biomarker associated with disease associated with FUS proteinopathy, high FUS expression or FUS mutation to identify a patient who may respond to FUS suppression; and if the subject is found to express the biomarker, administering to the subject an effective amount of the pharmaceutical composition of the present invention.Preferably, the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of ALS, FTLD, CTE, HD, SCA1, SCA3 and NIIBD.Preferably, the biomarker is a FUS mutation or other genetic marker that can stratify patients.
[0027] In a further aspect, the present invention is a method for reducing expression of FUS in a subject and / or reducing overexpression of FUS caused by autoregulation in a subject, comprising the step of administering to the subject an effective amount of a pharmaceutical composition of the present invention.
[0028] In a further aspect, the present invention relates to (a) a method for reducing expression of FUS in a subject; and / or (b) a method for reducing overexpression of FUS caused by autoregulation in a subject, the method comprising administering to a subject an effective amount of a pharmaceutical composition comprising: (i) one or more antisense oligonucleotides according to the first aspect of the present invention; and (ii) one or more pharma- ceutically acceptable carriers and / or diluents.
[0029] In a further aspect, the present invention is an expression vector comprising one or more antisense oligonucleotides according to the first aspect of the invention.
[0030] In a further aspect, the present invention is a cell comprising an antisense oligonucleotide according to the first aspect of the invention.
[0031] In a further aspect, the present invention is the use of an antisense oligonucleotide according to the first aspect of the invention for the manufacture of a medicament for treating, preventing or alleviating the effects of a disease associated with a FUS proteinopathy, high FUS expression or a FUS mutation.
[0032] In a further aspect, the present invention is the use of an antisense oligonucleotide according to the first aspect of the present invention for treating, preventing or alleviating the effects of a disease associated with FUS proteinopathy, high FUS expression or FUS mutation.Preferably, the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of ALS, FTLD, CTE, HD, SCA1, SCA3 and NIIBD.
[0033] In a further aspect, the present invention relates to a kit for treating, preventing or alleviating the effects of a disease associated with FUS proteinopathy, high FUS expression or FUS mutations in a subject, comprising at least an antisense oligonucleotide according to the first aspect of the invention packaged in a suitable container together with instructions for its use.
[0034] Further features of the present invention are described in more detail in the following description of several non-limiting embodiments thereof, which description is included solely for purposes of illustrating the present invention and should not be understood as a limitation on the broad summary, disclosure or description of the invention set forth above.
[0035] The following description is provided with reference to the accompanying drawings, in which: [Brief description of the drawings]
[0036] [Figure 1]FIG. 1 shows analysis of FUS transcripts via RT-PCR and agarose gel electrophoresis following transfection with 2'-O-methyl AONs targeting exons 3 and 4 of FUS in human fibroblasts, as well as Sanger sequencing results identifying transcripts produced following transfection with AON8 (SEQ ID NO:8).
[0037] [Diagram 2] FIG. 2 shows analysis of FUS transcripts via RT-PCR and agarose gel electrophoresis following transfection with 2′-O-methyl AONs targeting exons 5 and 6 of FUS in human fibroblasts.
[0038] [Diagram 3] FIG. 3 shows analysis of FUS transcripts via RT-PCR and agarose gel electrophoresis following transfection with an AON targeting exon 7 of FUS in human fibroblasts, as well as Sanger sequencing results identifying transcripts produced following transfection with AON26 (sequence number 26).
[0039] [Figure 4] FIG. 4 shows analysis of FUS transcripts via RT-PCR and agarose gel electrophoresis and Western blot of FUS protein analysis following transfection with PMO AONs targeting exons 4, 5 and 7 of FUS (sequence numbers 28, 29 and 30) in human fibroblasts.
[0040] [Diagram 5] FIG. 5 shows representative FUS transcript analysis via RT-PCR and agarose gel electrophoresis and Western blot of FUS protein analysis following transfection with a PMO AON (SEQ ID NO: 30) targeting exon 7 of FUS in human fibroblasts, as well as densitometric protein analysis results from three experiments.
[0041] [Figure 6] Figure 6 shows the analysis of representative FUS transcripts with and without the addition of cycloheximide via RT-PCR and agarose gel electrophoresis of FUS protein analysis and representative Western blots 5 days after transfection with PMO AON30 (SEQ ID NO: 30) targeting exon 7 of FUS in SH-SY5Y cells, as well as the analysis of densitometric RNA and protein analysis results from three experiments. *** indicates p-value <0.01. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0042] Detailed Description The present invention provides preventative or therapeutic methods for mitigating or slowing further progression of symptoms of FUS proteinopathy or diseases associated with high FUS expression (including diseases with pathogenic FUS mutations or aggregation such as ALS, FTLD, CTE, HD, SCA1, SCA3 and NIIBD) using AON therapy. More specifically, the present invention provides isolated or purified AONs targeted to a nucleic acid molecule encoding a FUS pre-mRNA, the AON having a nucleobase sequence that is (a) a nucleobase sequence selected from the list comprising SEQ ID NO:1 to SEQ ID NO:30, inclusive, or variants thereof, or (b) a sequence that is complementary to at least one or more contiguous nucleobases in the target FUS pre-mRNA to which SEQ ID NO:1 to SEQ ID NO:30, inclusive, or variants thereof, inclusive, binds as well, and (c) the AON inhibits expression of human FUS.
[0043] For convenience, the following section generally outlines the various meanings of terms used herein. Following this discussion, general aspects relating to the compositions, pharmaceutical uses and methods of the present invention are discussed, followed by specific examples that demonstrate the properties of various embodiments of the present invention and how they can be employed.
[0044] 1.Definition The meanings of certain terms and phrases used in the specification, examples, and appended claims are provided below. In the event of an apparent discrepancy between a term's usage in the art and its definition provided herein, the definition provided herein shall control.
[0045] Those skilled in the art will understand that the invention described herein tolerates variations and modifications other than those specifically described. The present invention includes all such variations and modifications. The present invention also includes all of the steps, features, formulations and compounds referred to or shown herein, individually or collectively, and any and all combinations of steps or features or any two or more thereof.
[0046] Each document, reference, patent application or patent cited in this specification is expressly incorporated herein by reference in its entirety, meaning that it should be read and considered by the reader as part of the specification. It is only for the sake of brevity that the documents, references, patent applications or patents cited in this specification are not repeated in this specification. However, neither the cited materials nor the information contained therein should be understood as common general knowledge.
[0047] Manufacturers' instructions, descriptions, product specifications, and product sheets for any products described in this specification or in any document incorporated by reference herein are hereby incorporated by reference and may be employed in the practice of this invention.
[0048] The present invention is not intended to be limited in scope by any of the specific embodiments described herein. These embodiments are intended for illustrative purposes only. Functionally equivalent products, formulations and methods are clearly within the scope of the invention described herein.
[0049] Except in the case of functional examples or unless otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood to be modified in all instances by the term "about." When used in connection with percentages, the term "about" can mean ±1%.
[0050] The invention described herein may include one or more ranges of values (e.g., size, concentration, etc.). A range of values is understood to include all values within the range, including the values that define the range, and the values adjacent to the range that produce the same or substantially the same results as the values that immediately adjacent to the values that define the boundaries of the range. For example, those skilled in the art will understand that a 10% variation in the upper or lower limit of a range may be entirely appropriate and is encompassed by the present invention. More specifically, the variation in the upper or lower limit of a range will be 5% or as generally recognized in the art, whichever is greater.
[0051] In this application, the use of the singular includes the plural unless specifically stated otherwise. In this application, the use of "or" means "and / or" unless specifically stated otherwise. Furthermore, the use of the term "including" as well as other forms such as "includes" and "included" is non-limiting. Also, terms such as "element" or "component" encompass both elements and components that contain one unit and elements and components that contain more than one subunit, unless specifically stated otherwise. Also, the use of the term "moiety" may include a portion of a moiety or the entirety of a moiety.
[0052] Throughout this specification, unless the context requires otherwise, the words "comprise" or variations such as "comprises" or "comprising" will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.
[0053] The term "administering" as used herein refers to placing a composition in a subject by a method or route that results in at least partial localization of the composition at its desired site of action so that the desired effect occurs.The compounds or compositions described herein may be administered by any suitable route known in the art, including oral or parenteral routes, including, but not limited to, intrathecal, intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration.
[0054] Other definitions of selected terms used herein can be found within the detailed description of the invention and are applicable throughout. Unless otherwise defined, all other scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0055] Features of the present invention will now be discussed with reference to the following non-limiting descriptions and examples.
[0056] 2. Embodiment Embodiments of the present invention generally relate to improved antisense compounds specifically designed to suppress expression of FUS, including wild-type FUS and any pathogenic variants, and methods or uses thereof. Mislocalization of FUS to the cytoplasm is implicated in FUS proteinopathies or diseases associated with high FUS expression, such as ALS and FTLD.
[0057] Without being bound by theory, the present invention is based on the understanding that suppressing the expression of FUS in patients suffering from diseases associated with pathogenic FUS mutations, high FUS expression, or FUS proteinopathy may have the effect of slowing down the progression of symptoms and / or improving the survival of these patients. This is because the expression of FUS pathogenic variants is associated with several neurological conditions, such as ALS and FTLD. Therefore, knockdown of FUS may have therapeutic potential in treating patients with pathogenic FUS mutations, high FUS expression, or FUS proteinopathy, such as ALS and FTLD. Patients who may benefit from this treatment may have mutations in the FUS gene or misfolding in the FUS protein. However, patients who do not exhibit FUS mutations or misfolding may also respond to treatment that suppresses the FUS gene.
[0058] A. Antisense Oligonucleotides The invention provides one or more isolated or purified AONs that target a nucleic acid molecule encoding FUS pre-mRNA, the AONs having a nucleobase sequence selected from the list comprising SEQ ID NO:1 to SEQ ID NO:30 (as set forth in Table 1 below), inclusive, and wherein the AONs inhibit expression of human FUS. Preferably, the AONs are phosphorodiamidate morpholino oligomers.
[0059] More generally, the invention relates to an isolated or purified antisense oligonucleotide targeted to a nucleic acid molecule encoding a FUS pre-mRNA, the AON comprising: a. a nucleic acid sequence selected from the list including SEQ ID NO: 1 to SEQ ID NO: 30, inclusive; or b. Nucleic acid base sequences that are complementary to at least one or more consecutive nucleic acid bases in the target FUS pre-mRNA to which SEQ ID NO:1 to SEQ ID NO:30, inclusive, also bind. having c. The AON provides an AON that inhibits the expression of human FUS.
[0060] Preferably, the AON is a phosphorodiamidate morpholino oligomer.
[0061] [Table 1-1] [Table 1-2] The reference point (0) is set at the first base of the 5' and 3' splice sites; thus, "+" refers to a nucleotide bond within an exon and "-" indicates a nucleotide bond within an intron.
[0062] In any of the AONs of the invention, uracil (U) in the sequences provided herein may be replaced with thymine (T). Further, in any of the AONs of the invention, thymine (T) in the sequences provided herein may be replaced with uracil (U). [Table 2]
[0063] Certain AONs of the invention are designed to complement suitable sequences in the human FUS pre-mRNA within exons 2, 3, 4, 5, 6 and 7. In a preferred embodiment, the AONs of the invention are designed to complement suitable sequences in exon 7 of the human FUS pre-mRNA and induce exon skipping. Most preferably, the AONs of the invention are targeted to exon 7. Most preferably, the AONs are selected from the group consisting of SEQ ID NOs: 22-27 and 30.
[0064] In another preferred embodiment, the AON of the invention is designed to complement a suitable sequence within exon 4. In one embodiment, the AON is SEQ ID NO:28.
[0065] In another preferred embodiment, the AON of the invention is designed to complement a suitable sequence within exon 5. In one embodiment, the AON is SEQ ID NO:29.
[0066] In another preferred embodiment, the AON of the invention is designed to complement a suitable sequence within exon 7. In one embodiment, the AON is SEQ ID NO:30.
[0067] The terms "antisense oligomer" and "antisense compound" and "antisense oligonucleotide" or "AON" are used interchangeably and refer to a linear sequence of cyclic subunits, each carrying a base-pairing moiety linked by an intersubunit bond, which hybridizes to a target sequence in a nucleic acid (typically RNA) by Watson-Crick base pairing to form a nucleic acid:oligomer heteroduplex within the target sequence. The cyclic subunits are based on ribose or another pentose sugar, or in a preferred embodiment, on a morpholino group (see description of morpholino oligomers below). The oligomer may have exact or near sequence complementarity to the target sequence; variations in sequence near the ends of the oligomer are generally preferred over variations in the interior. Also contemplated are peptide nucleic acids (PNAs), locked nucleic acids (LNAs), and 2'-O-methyl oligonucleotides, among other antisense agents known in the art.
[0068] The term "oligonucleotide" includes polynucleotides such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), where RNA is prepared or obtained by transcription of a DNA template. According to the present invention, nucleic acids can exist as single- or double-stranded, linear or covalently closed circular molecules.
[0069] "Isolated" refers to a material that is substantially or essentially free from components that normally accompany it in its natural state. For example, "isolated polynucleotide" or "isolated oligonucleotide" as used herein may refer to a polynucleotide that is purified or removed from the sequences that are on either side of it in its natural state, for example, a DNA fragment that is removed from the sequences that flank the fragment in the genome. When the term "isolating" refers to a cell, it refers to the purification of the cell (e.g., fibroblast, lymphoblast) from the source subject (e.g., a subject with a polynucleotide repeat disease). In the context of mRNA or protein, "isolating" refers to the recovery of the mRNA or protein from the source, e.g., a cell.
[0070] An AON can be said to be "directed to" or "targeted against" the target sequence to which it hybridizes. In certain embodiments, the target sequence includes a region that includes the polyadenylation site and surrounding regions. The target sequence is typically a region that includes the AUG start codon of an mRNA, a translation suppressor oligomer, or a splice site, splice suppressor oligomer (SSO), of a pre-processed mRNA. In the case of a splice site, the target sequence can include an mRNA sequence that has from 1 to about 25 base pairs at its 5' end downstream of the normal splice acceptor junction in the pre-processed mRNA. A preferred target sequence is any region of a pre-processed mRNA that includes the splice site or is entirely contained within an exon coding sequence, or spans the splice acceptor or donor site. An oligomer is more generally said to be "targeted against" a biologically relevant target, such as a protein, virus, or bacterium, when it is targeted to the target nucleic acid in the manner described above.
[0071] "Sufficient length" or "sufficient sequence complementarity" as used herein refers to an AON being complementary to at least one, more typically 1-30 contiguous nucleobases in a target FUS pre-mRNA. In some embodiments, an antisense having sufficient length includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleobases in a target FUS pre-mRNA. In other embodiments, an antisense having sufficient length includes at least 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleobases in a target FUS pre-mRNA. Preferably, the oligonucleotide having sufficient length is about 10 to about 50 nucleotides in length, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, and 40 nucleotides in length, or more. In one embodiment, the oligonucleotide having sufficient length is 10 to about 30 nucleotides in length. In another embodiment, the oligonucleotide having sufficient length is 15 to about 25 nucleotides in length. In yet another embodiment, the oligonucleotide having sufficient length is 20 to 30, or 20 to 50 nucleotides in length. In yet another embodiment, the oligonucleotide having sufficient length is 22 to 28, 25 to 28, 24 to 29, or 25 to 30 nucleotides in length.
[0072] In certain embodiments, the AON has sufficient sequence complementarity with the target RNA to block a region of the target RNA (e.g., pre-mRNA) in an effective manner. In some embodiments, such blocking of the FUS pre-mRNA serves to induce exon skipping. In some embodiments, the target RNA is a target pre-mRNA (e.g., FUS gene pre-mRNA).
[0073] The terms "complementary" or "complementarity" as used herein are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, the sequence 5'-AGT-3' is complementary to the sequence '-TCA-5'. Complementarity may be "partial," in which only a portion of the bases of the nucleic acids match according to the base-pairing rules; or there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. Thus, a "complementary" sequence, as used herein, refers to an oligonucleotide sequence having some complementarity to a target RNA or DNA sequence.
[0074] For the purposes of this invention, the complement of a nucleotide sequence is a nucleotide sequence that would be capable of forming a double-stranded DNA or RNA molecule having the represented nucleotide sequence and further, a nucleotide sequence that can be derived from the represented nucleotide sequence by replacing a nucleotide by its complementary nucleotide according to Chargaff's rules (A<>T;G<>C;A<>U) and reading in the 5' to 3' direction, i.e., in the reverse direction of the represented nucleotide sequence. It also includes synthetic analogs of DNA / RNA (e.g., 2'F-ANA oligos).
[0075] The term "homology" or "identity" refers to the degree of complementarity. There may be partial homology or complete sequence identity between an oligonucleotide sequence and the complementary sequence of a target RNA or DNA. A partially identical sequence is an oligonucleotide that at least partially hybridizes to a target RNA or DNA, resulting in the formation of a partial heteroduplex and partial or total degradation of the target RNA or DNA. A completely identical sequence is an oligonucleotide that completely hybridizes to a target RNA or DNA, resulting in the formation of a complete heteroduplex and partial or total degradation of the target RNA or DNA.
[0076] In certain embodiments, the AON may be 100% complementary to the target sequence, or may contain mismatches, e.g., to accommodate variants, so long as the heteroduplex formed between the oligonucleotide and the target sequence is stable enough to withstand the action of cellular nucleases and other degradation modes that may occur in vivo. Thus, certain oligonucleotides may have about or at least about 70% sequence complementarity, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity between the oligonucleotide and the target sequence.
[0077] Mismatches, if present, are typically less unstable toward the terminal regions of the hybrid duplex compared to the central region. The number of mismatches tolerated is expected to depend on the length of the oligonucleotide, the percentage of G:C base pairs in the duplex, and the position of the mismatch in the duplex, according to well-understood principles of duplex stability. Such AONs are not necessarily 100% complementary to the target sequence, but are effective for stably and specifically binding to the target sequence, so that the cleavage factor binding to the target pre-RNA is modulated.
[0078] The stability of the duplex formed between the AON and the target sequence is a correlation between the binding Tm and the susceptibility of the duplex to cleavage by cellular enzymes. The Tm of an oligonucleotide to a complementary sequence RNA can be measured by conventional methods, for example, as described by Hames et al., Nucleic Acid Hybridization, IRL Press, (1985), 107-108, or as described by Miyada CG and Wallace RB, (1987), Methods Enzymol. 154, 94-107. In certain embodiments, the AON may have a binding Tm to a complementary sequence RNA above body temperature, preferably above about 45°C or 50°C. Also included are Tms in the range of 60-80°C or higher.
[0079] Further examples of variants include AONs having about or at least about 70% sequence identity or homology over the entire length of any of SEQ ID NOs: 1-30, e.g., AONs having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity or homology.
[0080] In a preferred embodiment, the AONs of the invention are designed to complement suitable sequences within exons 4, 5 or 7 of the human FUS pre-mRNA and induce exon skipping.
[0081] In another preferred embodiment, the AONs of the invention are designed to complement the preferred sequences within exon 7.
[0082] Preferably, an AON is provided that can bind to a selected target site to induce exon skipping in the FUS gene transcript or a portion thereof. In one embodiment, the AON induces exon skipping in the FUS gene transcript of exon 2, 3, 4, 5, 6 or 7. Most preferably, the AON induces exon skipping of exon 7.
[0083] The AON is preferably selected from those provided in Table 1. For example, the AON for use in the present invention is selected from the list comprising SEQ ID NOs: 1 to 30. Most preferably, the AON is selected from the list comprising SEQ ID NOs: 22 to 27 and 30.
[0084] B.How to use The present invention further provides a method for inhibiting expression of FUS, comprising the steps of: (a) providing one or more of the AONs described herein; and (b) binding the oligomer(s) to the target nucleic acid site The present invention provides a method comprising:
[0085] More specifically, the AON may be selected from those set forth in Table 1. The sequence is preferably selected from the group consisting of any one or more of SEQ ID NOs: 1-30, and combinations or cocktails thereof, including sequences capable of hybridizing to such sequences under stringent hybridization conditions, sequences complementary thereto, sequences containing modified bases, modified backbones, and functional truncations or extensions thereof that have or modulate RNA processing activity in the FUS gene transcript.
[0086] Preferably, the AON used in the present invention is selected from the list comprising SEQ ID NOs: 22-27 and 30. Most preferably, the AON is selected from the list comprising SEQ ID NO:30.
[0087] In a preferred embodiment, the AON used in the method of the present invention induces alternative splicing of FUS pre-mRNA. In one aspect, the AON induces alternative splicing through inducing exon skipping in FUS pre-mRNA. Preferably, the AON induces skipping of exon 2, 3, 4, 5, 6 or 7. Most preferably, the AON induces skipping of exon 7. In another embodiment, the AON can reduce the expression of FUS by some other mechanism.
[0088] (1) A therapeutic strategy combining AONs (SEQ ID NOs: 1-30) designed to reduce FUS expression reduces the effects of FUS overexpression in the cytoplasm. In one aspect, the present invention aims to provide a means for alleviating FUS proteinopathy or high FUS expression in a subject suffering from a disease associated with FUS proteinopathy or high FUS expression.
[0089] Target Sequences and Selective Hybridization An oligomer and a DNA, cDNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms used to indicate a sufficient degree of complementarity or pairing between an oligomer and a DNA, cDNA or RNA target so that stable and specific binding occurs. It is understood in the art that the sequence of an AON does not necessarily have to be 100% complementary to that of its target sequence to be specifically hybridizable. An AON is specifically hybridizable when there is a sufficient degree of complementarity to avoid non-specific binding of the AON to non-target sequences under conditions where the binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA product and where specific binding is desired, i.e., in the case of in vivo assays or therapeutic treatments, under physiological conditions, and in the case of in vitro assays, under the conditions under which the assay is performed.
[0090] Selective hybridization may be under low, medium or high stringency conditions, but is preferably under high stringency. Those skilled in the art recognize that the stringency of hybridization is influenced by conditions such as salt concentration, temperature, or organic solvents, in addition to base composition, length of complementary strands, and number of nucleotide base mismatches between hybridizing nucleic acids. Stringent temperature conditions generally include temperatures above 30°C, typically above 37°C, preferably above 45°C, preferably at least 50°C, typically 60°C to 80°C or higher. Stringent salt conditions are usually less than 1000 mM, typically less than 500 mM, preferably less than 200 mM. However, the combination of parameters is more important than the measure of any single parameter. An example of stringent hybridization conditions is 65° C. and 0.1×SSC (1×SSC=0.15 M NaCl, 0.015 M sodium citrate pH 7.0). Thus, the AONs of the invention may comprise oligomers that selectively hybridize to the sequences provided in Table 1 or Table 2.
[0091] Tm is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide at a given ionic strength and pH. Such hybridization can occur when the AON has "near" or "substantial" complementarity to the target sequence, as well as exact complementarity.
[0092] Typically, selective hybridization occurs when there is at least about 55% identity with the nucleotide of antisense oligomer over a stretch of at least about 14 nucleotides, preferably at least about 65%, more preferably at least about 75%, and most preferably at least about 90%, 95%, 98% or 99% identity.The length of homology comparison can be over a longer stretch as described, and in certain embodiments, often over a stretch of at least about 9 nucleotides, generally at least 12 nucleotides, more generally at least about 20 nucleotides, and often over at least about 21, 22, 23 or 24 nucleotides, at least about 25, 26, 27 or 28 nucleotides, at least about 29, 30, 31 or 32 nucleotides, at least about 36 or more nucleotides.
[0093] Thus, in some embodiments, the AON sequence of the present invention has preferably at least 75%, more preferably at least 85%, more preferably at least 86, 87, 88, 89 or 90% homology with the sequence shown in the sequence listing herein. More preferably, there is at least 91, 92, 93, 94 or 95%, more preferably at least 96, 97, 98% or 99% homology. Generally, the shorter the length of the antisense oligomer, the greater the homology required to achieve selective hybridization. As a result, when the AON of the present invention is composed of less than about 30 nucleotides, the percentage of identity is preferably greater than 75%, preferably greater than 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95%, 96, 97, 98% or 99% compared to the AON described in the sequence listing herein. Nucleotide homology comparisons can be performed by sequence comparison programs such as the GCG Wisconsin Bestfit program or GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395). In this way, sequences of similar or substantially different length to those cited herein can be compared by inserting gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.
[0094] The AON of the present invention may have regions with reduced homology to the target sequence and regions with exact homology to the target sequence. It is not necessary that the oligomer has exact homology over its entire length. For example, the oligomer may have a continuous stretch of at least 4 or 5 bases identical to the target sequence, preferably a continuous stretch of at least 6 or 7 bases identical to the target sequence, more preferably a continuous stretch of at least 8 or 9 bases identical to the target sequence. The oligomer may have a stretch of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 bases identical to the target sequence. The remaining stretches of the oligomer sequence may be intermittently identical to the target sequence; for example, the remaining sequence may have identical bases followed by non-identical bases followed by identical bases. Alternatively (or similarly), the oligomeric sequence may have several stretches of identical sequence (e.g., 3, 4, 5 or 6 bases) interspersed with stretches of less than perfect homology. Such sequence mismatches preferably result in little or no loss of cleavage modification activity.
[0095] Physiological Responses In one embodiment, the method of the present invention induces a physiological response in a subject. Preferably, the method reduces the expression of FUS.
[0096] The term "modulate" or "modulates" includes "increasing" or "decreasing" one or more quantifiable parameters, as appropriate, by a defined amount and / or a statistically significant amount. The terms "increase" or "increasing," "enhance" or "enhancement," or "stimulate" or "stimulating" generally refer to the ability of one or more AONs or compositions to produce or cause a greater physiological response (i.e., a downstream effect) in a cell or subject compared to the response caused by either no AON or a control compound.
[0097] "Enhance" or "enhancement", or "increase" or "increasing", or "stimulate" or "stimulating" generally refers to the ability of one or more antisense compounds or compositions to produce or cause a greater physiological response (i.e., downstream effect) in a cell or subject compared to the response caused by either no antisense compound or a control compound.The amount of "increase" or "enhancement" is typically a "statistically significant" amount, and can include an increase of 1.1, 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or even higher (e.g., 500, 1000-fold) (including all integers and decimals between and greater than 1), for example, 1.5, 1.6, 1.7, 1.8, etc.) than the amount caused by no antisense compound (absence of drug) or a control compound.
[0098] The term "reducing" or "reducing" generally refers to the ability of one or more AONs or compositions to produce or cause a reduced physiological response (i.e., downstream effect) in a cell or subject, compared to the response caused by either no AON or a control compound. The term "reducing" or "inhibiting" may generally refer to the ability of one or more antisense compounds of the present invention to "reducing" a relevant physiological or cellular response, such as a symptom of a disease or condition described herein, as measured according to techniques conventional in the diagnostic field. A relevant physiological or cellular response (in vivo or in vitro) will be apparent to one skilled in the art and may include a reduction in the symptoms or pathology of a FUS-related condition. A "reduction" in response can be statistically significant as compared to the response produced without the antisense compound or with a control composition and can include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% reduction, including all integers therebetween.
[0099] The relevant physiological or cellular response (in vivo or in vitro) is clear to those skilled in the art and can include a reduction in the amount of FUS expression. An "increased" or "enhanced" amount is typically a statistically significant amount and can include an increase of 1.1, 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more times (e.g., 500, 1000 times) (including all integers and decimals between and greater than 1, e.g., 1.5, 1.6, 1.7, 1.8) of the amount produced without AON (absence of drug) or by a control compound. The term "reduce" or "inhibit" may generally relate to the ability of one or more AONs or compositions to "reduce" the relevant physiological or cellular response, e.g., the symptoms of a disease or condition described herein, when measured according to techniques conventional in the diagnostic field. The relevant physiological or cellular responses (in vivo or in vitro) will be apparent to those skilled in the art and may include a reduction in the symptoms or pathology of a disease associated with FUS proteinopathy or high FUS expression, such as ALS or FTLD. A "reducing" response may be statistically significant compared to the response produced by no AON or a control composition and may include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% reduction, including all integers therebetween.
[0100] Modified AON In some embodiments, AONs have the chemical composition of naturally occurring nucleic acid molecules, i.e., they contain no modified or substituted bases, sugars, or intersubunit linkages.
[0101] In a preferred embodiment, the AON of the present invention is a non-naturally occurring nucleic acid molecule, or an "oligonucleotide analog". For example, a non-naturally occurring nucleic acid may contain one or more non-natural bases, sugars, and / or intersubunit linkages, e.g., modified or substituted bases, sugars, and / or linkages, compared to those found in naturally occurring nucleic acid molecules. Exemplary modifications are described below. In some embodiments, a non-naturally occurring nucleic acid contains more than one type of modification, e.g., sugar and base modifications, sugar and linkage modifications, base and linkage modifications, or base, sugar, and linkage modifications. For example, in some embodiments, the AON contains a non-natural (e.g., modified or substituted) base. In some embodiments, the AON contains a non-natural (e.g., modified or substituted) sugar. In some embodiments, the AON contains a non-natural (e.g., modified or substituted) intersubunit linkage. In some embodiments, the AON contains more than one type of modification or substitution, e.g., non-natural bases and / or non-natural sugars, and / or non-natural intersubunit linkages.
[0102] Thus, non-naturally occurring AONs include (i) modified backbone structures, such as backbones other than the standard phosphodiester bond found in naturally occurring oligonucleotides and polynucleotides, and / or (ii) modified sugar moieties, such as morpholino moieties instead of ribose or deoxyribose moieties. Oligonucleotide analogs support bases that can hydrogen bond to standard polynucleotide bases by Watson-Crick base pairing, where the analog backbone presents bases in a manner that allows such hydrogen bonding in a sequence-specific manner between the oligonucleotide analog molecule and the bases in standard polynucleotides (e.g., single-stranded RNA or single-stranded DNA).Preferred analogs have substantially uncharged phosphorus-containing backbones.
[0103] One method for producing AONs is methylation of the 2' hydroxyribose position, and incorporation of a phosphorothioate backbone produces molecules that superficially resemble RNA but are much more resistant to nuclease degradation, although those of skill in the art will recognize other forms of suitable backbones that can be used for purposes of the present invention.
[0104] To avoid degradation of pre-mRNA during duplex formation with antisense oligomers, the AONs used in the present method can be adapted to minimize or prevent cleavage by endogenous RNase H. Antisense molecules that do not activate RNase H can be made according to known techniques (see, for example, U.S. Patent No. 5,149,797). Such antisense molecules may be deoxyribonucleotide or ribonucleotide sequences and simply contain any structural modifications that sterically hinder or prevent RNase H binding to duplex molecules that contain the oligonucleotide as a member, without such structural modifications substantially preventing or disrupting duplex formation. Since the portions of the oligonucleotides involved in duplex formation are substantially different from the portions involved in RNase H binding to them, a large number of antisense molecules are available that do not activate RNase H. This property is highly desirable, since treatment of RNA with unmethylated oligomers, either in cells or in crude extracts containing RNase H, results in degradation of pre-mRNA:AON duplexes. Any form of modified AON that can bypass or not induce such degradation can be used in the methods of the invention. Nuclease resistance can be achieved by modifying the AON of the invention to include partially unsaturated aliphatic hydrocarbon chains and one or more polar or charged groups, such as carboxylic acid groups, ester groups, and alcohol groups.
[0105] An example of an AON that is not cleaved by cellular RNase H when duplexed with RNA is a 2'-O-methyl derivative. Such 2'-O-methyl-oligoribonucleotides are stable in cellular environments and animal tissues, and their duplexes with RNA have higher Tm values than their ribo or deoxyribo counterparts. Alternatively, the nuclease-resistant AON of the present invention may have at least one of the last 3'-terminal nucleotides fluorinated. As a further alternative, the nuclease-resistant AON of the present invention has phosphorothioate bonds linking at least two of the last 3'-terminal nucleotide bases, and preferably has phosphorothioate bonds linking the last four 3'-terminal nucleotide bases.
[0106] Reduced RNA cleavage can also be achieved with alternative oligonucleotide chemistries (see, e.g., U.S. Patent No. 5,149,797). For example, AONs can be synthesized using a variety of oligonucleotide chemistries, including phosphoramidate or phosphorodiamidate morpholino oligomers (PMOs); PMO-X; PPMOs; peptide nucleic acids (PNAs); thiophosphoramidate morpholino oligomers (TMOs); locked nucleic acids (LNAs) and derivatives such as alpha-L-LNA; 2'-amino LNA; 4'-methyl LNA and 4'-O-methyl LNA; ethylene-bridged nucleic acids (ENAs) and derivatives thereof; phosphorothioate oligomers; tricyclo-DNA oligomers (tcDNA); tricyclophosphatase oligomers (TMOs); and thiophosphoric acid oligomers (TPAs). The PMOs may be selected from the list including: holothioate oligomers; 2'O-methyl modified oligomers (2'-Ome); 2'-O-methoxyethyl (2'-MOE); 2'-fluoro, 2'-fluoroarabino (FANA); unlocked nucleic acid (UNA); hexitol nucleic acid (HNA); cyclohexenyl nucleic acid (CeNA); 2'-amino (2'-NH2); 2'-O-ethyleneamine, or any combination of the above as mixmers or as gapmers. The major benefit of PMOs is their increased safety profile. Due to the neutral charge of PMOs, they are less susceptible to protein interactions, reducing platelet activation and immune activation. This also reduces degradation by nucleases. They have also been used safely in DMD patients for more than 5 years.
[0107] In one embodiment, the modified AON of the present invention may be conjugated to a peptide. Preferably, the AON is a PPMO, i.e., a PMO oligonucleotide chemically conjugated to a peptide moiety via amide, maleimide or click chemistry (preferably using copper-free click chemistry, e.g., using copper-free click chemistry via a cyclooctyne bond), and includes a suitable linker, e.g., a cleavable or pH-sensitive linker. The peptide moiety may be attached via either the 3' or 5' end. Most preferably, the peptide moiety is a peptide that can improve the ability of the AON to penetrate the cell and reach the nucleus. For example, the peptide moiety may be a peptide selected from a library of arginine-rich peptides, cationic peptides and / or peptides derived from the genomes of biologically diverse microorganisms (Hoffman et al., Sci Rep, 8, 1, 12538). The peptide may or may not contain unnatural amino acids and / or chemically modified amino acids.
[0108] Cell-penetrating peptides have been added to phosphorodiamidate morpholino oligomers to enhance intracellular uptake and nuclear localization. As shown in Jearawiriyapaisarn et al. (2008), Mol. Ther., 16(9), 1624-1629, various cell-penetrating peptides have been shown to affect uptake efficiency and target tissue specificity. The terms "cell-penetrating peptide" and "CPP" are used interchangeably and refer to cationic cell-penetrating peptides, which are also referred to as transport peptides, carrier peptides, or peptide transduction domains. As shown herein, the peptides have the ability to induce cell penetration in 100% of the cells of a given cell culture population, and when administered systemically, allow the transfer of macromolecules in multiple tissues in vivo. Peptides can also enhance intracellular uptake after local delivery to tissues or organs.
[0109] To further improve delivery efficacy, the modified nucleotides described above are often conjugated to the sugar or nucleobase moiety with fatty acids / lipids / cholesterol / amino acids / carbohydrates / polysaccharides / nanoparticles, etc. These conjugated nucleotide derivatives can also be used to construct AONs to induce exon skipping. Alternative splicing induced by antisense oligomers of human FUS gene transcripts can use oligoribonucleotides, PNA, 2'-Ome or 2'-MOE modified bases in a phosphorothioate backbone. 2'-Ome AONs are used in oligo design for their efficient uptake in vitro when delivered as cationic lipoplexes, but these compounds are susceptible to nuclease degradation and are not considered ideal for in vivo or clinical applications. When alternative chemistry is used to generate the AONs of the present invention, the uracil (U) in the sequences provided herein may be replaced with thymine (T).
[0110] For example, such an antisense molecule may be an oligonucleotide in which at least one or all of the phosphate residues forming the bridge between nucleotides are modified phosphates, such as methyl phosphonates, methyl phosphorothioates, phosphoromorpholidates, phosphoropiperazidates and phosphoramidates. For example, every other phosphate residue forming the bridge between nucleotides may be modified as described. In another non-limiting example, such an antisense molecule is a molecule in which at least one or all of the nucleotides contain a 2' lower alkyl moiety (e.g., Ci-C4, straight or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl). For example, every other nucleotide may be modified as described.
[0111] Specific examples of AONs useful in the present invention include oligonucleotides containing modified backbones or non-natural intersubunit linkages.
[0112] Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Modified oligonucleotides that do not have a phosphorus atom in the internucleoside backbone can also be considered to be oligonucleosides.
[0113] In other antisense molecules, both the sugar and the internucleoside linkages, i.e., the backbone of the nucleotide units, are replaced with novel groups. The base units are maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is called a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the oligonucleotide is replaced with an amide-containing backbone, specifically an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly linked to the aza nitrogen atoms of the amide portion of the backbone.
[0114] Modified oligonucleotides may also contain one or more substituted sugar moieties.Oligonucleotides may also contain modified or substituted nucleic acid bases (often referred to simply as "bases" in the art).Oligonucleotides containing modified or substituted bases include those in which one or more of the purine or pyrimidine bases most commonly found in nucleic acids are replaced with less common or unnatural bases.
[0115] Purine bases contain a pyrimidine ring fused to an imidazole ring; adenine and guanine are the two most commonly found purine nucleobases in nucleic acids. These may be substituted with other naturally occurring purines, including, but not limited to, N6-methyladenine, N2-methylguanine, hypoxanthine, and 7-methylguanine.
[0116] Pyrimidine base comprises a 6-membered pyrimidine ring; cytosine, uracil and thymine are the most commonly found pyrimidine bases in nucleic acid. They may be replaced with other naturally occurring pyrimidines, including but not limited to 5-methylcytosine, 5-hydroxymethylcytosine, pseudouracil and 4-thiouracil. In one embodiment, the oligonucleotide described herein contains thymine base instead of uracil.
[0117] Other modified or substituted bases include, but are not limited to, 2,6-diaminopurine, orotic acid, agmatidine, lysidine, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), G-clamps and derivatives thereof, 5-substituted pyrimidines (e.g., 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or its derivatives; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2-aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), pseudouracil, or its derivatives; and degenerate or universal bases, non-existent bases such as 2,6-difluorotoluene or abasic sites (e.g. 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives with ring oxygen replaced by nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in U.S. Patent No. 6,683,173 (Epoch Biosciences). cPent-G, cPent-AP and Pr-AP have been shown to reduce immunostimulatory effects when incorporated into siRNA (Peacock H. et al. J. Am. Chem. Soc. 2011, 133, 9200). Pseudouracil is a naturally occurring isomeric version of uracil, which is a C-glycoside rather than the regular N-glycoside as in the case of uridine. Synthetic mRNAs containing pseudouridine may have improved safety profiles compared to mPvNAs containing uridine (see WO2009127230).
[0118] Certain modified or substituted nucleobases are particularly useful for increasing the binding affinity of the AONs of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C and are currently the preferred base substitution, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.
[0119] In some embodiments, modified or substituted nucleobases are useful for facilitating the purification of AONs.For example, in certain embodiments, AONs may contain three or more (e.g., 3, 4, 5, 6 or more) consecutive guanine bases.In certain AONs, a series of three or more consecutive guanine bases may cause oligonucleotide aggregation, complicating purification.In such AONs, one or more consecutive guanines may be replaced with inosine.Replacing one or more guanines in a series of three or more consecutive guanine bases with inosine can reduce the aggregation of AONs, thereby facilitating purification.
[0120] In one embodiment, another modification of the AON includes chemically linking one or more moieties or conjugates to the oligonucleotide that enhance the activity, cellular distribution or intracellular uptake of the oligonucleotide. Such moieties include, but are not limited to, lipid moieties, such as cholesterol moieties, cholic acid, thioethers, such as hexyl-5-tritylthiol, thiocholesterol, aliphatic chains, such as dodecanediol or undecyl residues, phospholipids, such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-26lycerol-3-H-phosphonate, polyamines or polyethylene glycol chains, or adamantane acetic acid, palmityl moieties, or octadecylamine or hexylaminocarbonyloxycholesterol moieties.
[0121] Not all positions in a given compound need to be uniformly modified, and indeed more than one of the modifications described above may be incorporated into a single compound, or even into a single nucleoside in an oligonucleotide.The present invention also includes AONs that are chimeric compounds.A "chimeric" antisense compound or "chimera" in the context of this invention is an antisense molecule, specifically an oligonucleotide, that contains two or more chemically distinct regions, each composed of at least one monomeric unit, i.e., in the case of oligonucleotide compounds, nucleotides.These oligonucleotides typically contain at least one region that is modified to confer increased resistance to nuclease degradation, increased intracellular uptake, and an additional region for increased binding affinity to target nucleic acid.
[0122] The antisense molecule used according to the present invention can be conveniently and conventionally produced by well-known solid phase synthesis technology.The equipment for such synthesis is sold by several vendors, including, for example, Applied Biosystems (Foster City, Calif.).One method for synthesizing oligonucleotides on modified solid support is described in U.S. Patent No. 4,458,066.
[0123] In another non-limiting example, such an AON is a molecule in which at least one, or all, of the nucleotides contain a 2' lower alkyl moiety (e.g., C1-C4 straight or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl, etc.). For example, every other nucleotide may be modified as described.
[0124] While the AONs described above are preferred forms of AONs of the invention, the invention includes other oligomeric antisense molecules, including but not limited to oligomeric mimetics, as described below.
[0125] Another preferred chemical entity is phosphorodiamidate morpholino oligomer (PMO) oligomeric compound, which is not degraded by any known nuclease or protease.These compounds are uncharged, do not activate RNase H activity when bound to RNA strands, and have been shown to exert persistent modulation of cleavage factor binding after in vivo administration (Summerton and Weller, Antisense Nucleic Acid Drug Development, 1997; 7, 187-197).Preferably, the AON of the present invention is phosphorodiamidate morpholino oligomer.
[0126] Modified oligomers may also contain one or more substituted sugar moieties. Oligomers may also include modifications or substitutions of nucleobases (often referred to in the art simply as "bases"). Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions, even more specifically when combined with 2'-O-methoxyethyl sugar modifications, have been shown to increase the stability of nucleic acid duplexes by 0.6-1.2°C. In one embodiment, at least one pyrimidine base of the oligonucleotide comprises a 5-substituted pyrimidine base, where the pyrimidine base is selected from the group consisting of cytosine, thymine, and uracil. In one embodiment, the 5-substituted pyrimidine base is 5-methylcytosine. In another embodiment, at least one purine base of the oligonucleotide comprises an N-2, N-6 substituted purine base. In one embodiment, the N-2, N-6 substituted purine base is 2,6-diaminopurine.
[0127] In one embodiment, the AON comprises one or more 5-methylcytosine substitutions, either alone or in combination with another modification, such as a 2'-O-methoxyethyl sugar modification, hi yet another embodiment, the AON comprises one or more 2,6-diaminopurine substitutions, either alone or in combination with another modification.
[0128] In some embodiments, the AON is chemically linked to one or more moieties, such as polyethylene glycol moieties or conjugates, such as arginine-rich cell-penetrating peptides, that enhance the activity, cellular distribution, or intracellular uptake of the AON. In one exemplary embodiment, an arginine-rich polypeptide is covalently coupled to the 3' or 5' end of the antisense compound at its N- or C-terminal residue. In another exemplary embodiment, the antisense compound is also comprised of morpholino subunits and a phosphorus-containing intersubunit linkage that connects the morpholino nitrogen of one subunit to the 5' exocyclic carbon of an adjacent subunit.
[0129] In another aspect, the invention provides expression vectors that incorporate the AONs described above, such as the AONs of SEQ ID NOs: 1 to 30. In some embodiments, the expression vector is a modified retroviral or non-retroviral vector, such as an adeno-associated viral vector.
[0130] Assays for measuring the activity of AONs The activity of AON and its variants can be assayed according to conventional techniques in the art.For example, the form and expression level of the isoforms of the RNA and protein investigated can be evaluated by any of a variety of well-known methods for detecting the isoforms and / or expression of transcribed nucleic acid or protein.Non-limiting examples of such methods include RT-PCR of RNA isoforms followed by size separation of PCR products, nucleic acid hybridization methods such as Northern blot and / or nucleic acid array; fluorescent in situ hybridization for detecting RNA transcripts inside cells; nucleic acid amplification methods; immunological methods for detecting proteins; protein purification methods; and protein function or activity assays.
[0131] RNA expression levels can be assessed by preparing RNA / cDNA (i.e., transcribed polynucleotides) from cells, tissues, or organisms, and then hybridizing the RNA / cDNA with a reference polynucleotide that is the complement of the nucleic acid to be assayed or a fragment thereof. The cDNA may be amplified, if necessary, using any of a variety of polymerase chain reaction or in vitro transcription methods prior to hybridization with the complementary polynucleotide; preferably, the cDNA is not amplified. The expression of one or more transcripts can also be detected using quantitative PCR to assess the level of expression of the transcripts.
[0132] Methods for Producing AONs The AONs used according to the present invention can be conveniently produced through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by a number of vendors, including, for example, Applied Biosystems (Foster City, Calif.). One method for synthesizing oligomers on modified solid supports is described in U.S. Pat. No. 4,458,066.
[0133] Any other means for such synthesis known in the art can be used in addition or alternatively.It is well known to use similar techniques to prepare oligomers such as phosphorothioates and alkylated derivatives.In one such automated embodiment, diethyl phosphoramidite is used as starting material and can be synthesized as described by Beaucage, et al., (1981) Tetrahedron Letters, 22:1859-1862.
[0134] The AONs of the present invention are synthesized in vitro and do not include antisense compositions of biological origin, nor genetic vector constructs designed to direct the synthesis of antisense oligomers in vivo. The molecules of the present invention may also be mixed with, encapsulated with, conjugated to, or otherwise associated with other molecules, molecular structures, or mixtures of compounds to aid in uptake, distribution, and / or absorption, such as, for example, liposomes, receptor-targeting molecules, oral, rectal, topical formulations, or other formulations.
[0135] vector Also included are vector delivery systems capable of expressing the oligomeric FUS-targeting sequences of the invention, such as vectors expressing polynucleotide sequences comprising any one or more of SEQ ID NOs: 1-30 described herein.
[0136] "Vector" or "nucleic acid construct" refers to a polynucleotide molecule, preferably a DNA molecule, such as one derived from a plasmid, bacteriophage, yeast or virus, into which a polynucleotide can be inserted or cloned. The vector preferably contains one or more unique restriction sites and is capable of autonomous replication in a defined host cell, such as a target cell or tissue or a precursor cell or tissue thereof, or is capable of integration into the genome of a defined host such that the cloned sequence can be replicated.
[0137] Thus, the vector may be an autonomously replicating vector, i.e. a vector that exists as an extrachromosomal entity and its replication is independent of chromosomal replication, such as a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for ensuring self-replication. Alternatively, the vector may be one that, when introduced into a host cell, is integrated into the genome and replicates together with the chromosome(s) into which it is integrated.
[0138] C. Treatment Method The AONs of the present invention can also be used as prophylactic or therapeutic agents that can be utilized for the purpose of treating diseases. Thus, in one embodiment, the present invention provides AONs that bind to a selected target in the FUS pre-mRNA and reduce the expression of FUS as described herein, in a therapeutically effective amount, mixed with a pharma- ceutically acceptable carrier, diluent, or excipient.
[0139] FUS is produced in the cytoplasm and imported into the nucleus. The AONs of the invention can result in the reduction of FUS, thereby reducing pathologies associated with FUS aggregation, overexpression, mislocalization, or pathogenic FUS variants.
[0140] An "effective amount" or "therapeutically effective amount" refers to an amount of a therapeutic compound, such as an antisense oligomer, administered to a mammalian subject, either in a single dose or as part of a series, effective to produce the desired therapeutic effect.
[0141] The present invention therefore provides a pharmaceutical, prophylactic or therapeutic composition for treating, preventing or ameliorating the effects of a FUS proteinopathy or a disease associated with high FUS expression, comprising: a) one or more AONs described herein, and b) one or more pharma- ceutically acceptable carriers and / or diluents; A composition comprising:
[0142] Preferably, the FUS proteinopathy or disease associated with high FUS expression is FUS-ALS or FUS-FTLD.
[0143] Also provided are methods for treating, preventing, or ameliorating the effects of a FUS proteinopathy or a disease associated with high FUS expression, comprising administering to a subject an effective amount of one or more AONs or a pharmaceutical composition comprising one or more AONs described herein.
[0144] The present invention provides a method for treating, preventing, or alleviating the effects of a FUS proteinopathy or a disease associated with high FUS expression, comprising administering to a subject an effective amount of one or more AONs or a pharmaceutical composition comprising one or more AONs described herein.
[0145] Also provided are methods for treating, preventing, or ameliorating the effects of ALS, comprising administering to a subject an effective amount of one or more AONs described herein or a pharmaceutical composition comprising one or more AONs.
[0146] The methods of the invention can be administered in combination with additional treatments to treat, prevent, or slow the progression of diseases and symptoms associated with FUS proteinopathy or high FUS expression, which may include AONs directed to other targets associated with FUS proteinopathy or diseases associated with high FUS expression.
[0147] In further embodiments, genetic biomarkers or other biomarkers can be used to identify patients who are most likely to respond well to FUS suppression via the AON of the present invention.Structural variants of genes related to the risk of ALS disease have been identified in the ALS gene and surrounding gene regions.These variants can be used as genetic biomarkers to identify patients who may respond to the method of the present invention.Non-genetic biomarkers can also be used to identify patients who may respond to the method of the present invention.
[0148] The present invention provides a method for treating, preventing, or ameliorating the effects of FUS-ALS or FUS-FTLD in a subject identified by a biomarker, comprising: a) testing subjects for the presence of biomarkers associated with ALS to identify patients who are likely to respond to FUS inhibition; and b) if the subject is found to express the biomarker, administering to the subject an effective amount of one or more AONs described herein or a pharmaceutical composition comprising one or more AONs. The present invention provides a method comprising:
[0149] Also provided herein is the use of the purified and isolated AONs described herein to treat, prevent, or ameliorate the effects of a FUS proteinopathy or a disease associated with high FUS expression.
[0150] Also provided herein are uses of the purified and isolated AONs described herein to treat, prevent, or ameliorate the effects of FUS-ALS or FUS-FTLD.
[0151] Preferably, the AONs used in the present invention are selected from the list of AONs provided in Table 1, or more preferably, selected from SEQ ID NOs: 22-27 and 30.
[0152] The present invention also provides a method of treatment comprising a combination of AONs (SEQ ID NO: 1-SEQ ID NO: 30) designed to (1) reduce FUS expression and reduce the effects of FUS overexpression in the cytoplasm. In one embodiment, the present invention aims to provide a means for alleviating FUS proteinopathy or high FUS expression in subjects suffering from a disease associated with FUS.
[0153] The composition may contain about 1 nM to 1000 μM of each of the desired antisense oligomer(s) of the present invention. Preferably, the composition may contain about 1 μM to 500 μM, 10 μM to 500 μM, 50 μM to 750 μM, 10 μM to 500 μM, 1 μM to 100 μM, 1 μM to 50 μM, preferably 25 μM to 100 μM of each of the antisense oligomer(s) of the present invention. The composition may also preferably contain about 1 nM to 500 nM, 10 nM to 500 nM, 50 nM to 750 nM, 10 nM to 500 nM, 1 nM to 100 nM, 1 nM to 50 nM, most preferably 50 nM to 100 nM of each of the antisense oligomer(s) of the present invention.
[0154] The compositions may contain about 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 20 nM, 50 nM, 75 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM or 1000 nM of each of the desired antisense oligomer(s) of the invention.
[0155] The present invention further provides one or more AONs adapted to be useful in the prophylactic or therapeutic treatment, prevention or alleviation of symptoms of a disease or condition associated with FUS proteinopathy or high FUS expression, in a form suitable for delivery to a subject.
[0156] The phrase "pharmaceutical acceptable" refers to molecular entities and compositions that are physiologically acceptable and typically do not cause allergic or similarly undesirable reactions, such as stomach upset, when administered to a subject. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a compound is administered. Such pharmaceutical carriers may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. As carriers, particularly for injectable solutions, preferably water or saline solution and aqueous dextrose and glycerol solutions are employed. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, PA, (1990).
[0157] The pharmaceutical composition comprising one or more AONs can be administered to the subject within the scope of treatment regimen.For example, the pharmaceutical composition can be administered hourly, 3 times daily, twice daily, once daily, once every 2 days, once every 3 days, once weekly, once every 2 weeks, once monthly, once every 2 months, once every 6 months, and once yearly.The suitable regimen can be determined by those skilled in the art based on the nature of the condition to be treated.
[0158] D. Pharmaceutical manufacturing In one embodiment, the present invention provides the use of AONs that bind to selected targets in FUS RNA for the manufacture of medicaments for treating, preventing or alleviating the effects of diseases associated with FUS proteinopathy or high FUS expression.Therefore, the use of one or more AONs described herein for the manufacture of medicaments for treating, preventing or alleviating the effects of diseases associated with FUS proteinopathy or high FUS expression is provided.Preferably, the disease is FUS-ALS or FUS-FTLD.
[0159] The present invention provides the use of an antisense oligonucleotide purified and isolated as described herein for the manufacture of a medicament for treating, preventing, or ameliorating the effects of a disease associated with a FUS proteinopathy or a disease associated with high FUS expression.
[0160] The present invention also provides the use of an antisense oligonucleotide purified and isolated as described herein for the manufacture of a medicament for treating, preventing, or ameliorating the effects of FUS-ALS or FUS-FTLD.
[0161] Also provided is the use of one or more AONs described herein for the manufacture of a medicament for treating, preventing, or ameliorating the effects of a FUS proteinopathy or a disease associated with high FUS expression in a subject expressing a biomarker associated with a patient likely to respond to FUS inhibition.
[0162] Preferably, the AON used to manufacture the medicament is selected from the list of AONs provided in Table 1, or more preferably, selected from SEQ ID NOs: 22-27 and 30.
[0163] E. Pharmaceutical Compositions In one aspect of the present invention, pharmaceutical compositions are provided that contain a therapeutically effective amount of one or more AONs of the present invention together with pharma- ceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants, and / or carriers. Such compositions contain diluents of various buffer contents (e.g., Tris HCl, acetate, phosphate), pH and ionic strength, as well as additives such as detergents and solubilizers (e.g., Tween® 80, Polysorbate 80), antioxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking agents (e.g., lactose, mannitol). Materials may be incorporated into microparticle preparations of polymeric compounds, such as polylactic acid, polyglycolic acid, or may be incorporated into liposomes. Hyaluronic acid may also be used. Such compositions may affect the systemic condition, stability, release rate in vivo, and clearance rate in vivo of proteins and derivatives present. See, e.g., Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435-1712, which is incorporated herein by reference. The compositions may be prepared in liquid form or may be in the form of a dry powder, e.g., lyophilized.
[0164] It is understood that the pharmaceutical composition provided by the present invention can be administered by any means known in the art.Preferably, the pharmaceutical composition for administration is administered by injection, orally, topically, or by pulmonary or nasal route.AON is more preferably delivered by intrathecal, intravenous, intraarterial, intraperitoneal, intramuscular or subcutaneous administration route.The appropriate route can be determined by those skilled in the art as appropriate for the condition of the subject under treatment.Vascular or extravascular circulation, blood or lymphatic system, and cerebrospinal fluid are some non-limiting sites where AON can be introduced.Direct CNS delivery can be adopted, for example, intraventricular or intrathecal administration can be used as administration route.
[0165] Formulations for topical administration include those in which the oligomer of the present disclosure is mixed with topical delivery agents such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.Lipids and liposomes include neutral (e.g., dioleoyl phosphatidyl DOPE ethanolamine, dimyristoyl phosphatidyl choline DMPC, distearolyphosphatidyl choline), negative (e.g., dimyristoyl phosphatidyl glycerol DMPG) and cationic (e.g., dioleoyl tetramethylaminopropyl DOTAP and dioleoyl phosphatidyl ethanolamine DOTMA).For topical or other administration, the oligomer of the present disclosure may be encapsulated in or complexed with liposomes, particularly with cationic liposomes.Alternatively, the oligomer may be complexed with lipids, particularly with cationic lipids. Fatty acids and esters, their pharma- ceutical acceptable salts, and their uses are further described in U.S. Patent No. 6,287,860, filed May 20, 1999, and / or U.S. patent application Ser. No. 09 / 315,298.
[0166] In certain embodiments, the AONs of the present disclosure can be delivered by transdermal methods (e.g., via incorporating the AONs in an emulsion, which is optionally packaged in a liposome). Such transdermal and emulsion / liposome-mediated delivery methods have been described in the art for delivery of AONs, for example, in U.S. Patent No. 6,965,025.
[0167] The AONs described herein can also be delivered via implantable devices. The design of such devices is an art-recognized process, for example, using synthetic implant designs, for example, as described in U.S. Patent No. 6,969,400.
[0168] Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or mini-tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable. Oral formulations are those in which the oligomers of the present disclosure are administered in combination with one or more penetration enhancers, surfactants and chelating agents. Surfactants include fatty acids and / or their esters or salts, bile acids and / or their salts. Bile acids / salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860. In some embodiments, the present disclosure provides combinations of penetration enhancers, such as fatty acids / salts in combination with bile acids / salts. Exemplary combinations are sodium salts of lauric acid, capric acid and UDCA. Additional penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. The oligomers of the present disclosure may be delivered orally in granular form, including spray-dried particles, or may be complexed to form microparticles or nanoparticles. Oligomer complexing agents and their uses are further described in U.S. Patent No. 6,287,860. Oral formulations for oligomers and their preparations are described in detail in U.S. Patent No. 6,887,906, filed May 20, 1999, 09 / 315,298 and / or U.S. Patent No. 20030027780.
[0169] Compositions and formulations for parenteral, intrathecal, or intraventricular administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other suitable additives, including but not limited to penetration enhancers, carrier compounds and other pharma- ceutically acceptable carriers or excipients.
[0170] Delivery of therapeutically useful amounts of AONs can be achieved by previously published methods. For example, intracellular delivery of AONs can be via a composition comprising an admixture of AONs with an effective amount of a block copolymer. An example of this method is described in US patent application US20040248833. Other methods of delivery of AONs to the nucleus are described in Mann CJ et al. (2001) Proc, Natl. Acad. Science, 98(1) 42-47, and Gebski et al. (2003) Human Molecular Genetics, 12(15): 1801-1811. Methods for introducing nucleic acid molecules into cells by expression vectors, either as naked DNA or complexed to lipid carriers, are described in US6,806,084.
[0171] In certain embodiments, the AONs of the present invention and therapeutic compositions comprising same can be delivered by transdermal methods (e.g., by incorporating the AONs, for example, in an emulsion, such AONs being optionally packaged in liposomes). Such transdermal and emulsion / liposome-mediated delivery methods have been described in the art for delivery of AONs, for example, in U.S. Patent No. 6,965,025.
[0172] It may be desirable to deliver AON in colloidal dispersion system.Colloidal dispersion system includes macromolecule complex, nanocapsule, microsphere, bead, and lipid-based system including oil-in-water emulsion, micelle, mixed micelle, and liposome or liposome formulation.These colloidal dispersion systems can be used to prepare therapeutic pharmaceutical composition.
[0173] Liposomes are artificial membrane vesicles that are useful as delivery vehicles in vitro and in vivo. These formulations may have net cationic, anionic, or neutral charge characteristics, making them useful for in vitro, in vivo, and ex vivo delivery methods. It has been shown that large unilamellar vesicles can encapsulate a substantial percentage of aqueous buffer containing large macromolecules. RNA and DNA can be encapsulated within the aqueous interior and delivered to cells in a biologically active form (Fraley, et al., 1981, Trends Biochem. Sci., 6, 77).
[0174] For liposomes to be efficient gene transfer vehicles, the following characteristics should be present: (1) high efficiency encapsulation of the AON of interest without compromising its biological activity; (2) preferential and substantial binding to target cells compared to non-target cells; (3) high efficiency delivery of the aqueous contents of the vesicles to the cytoplasm of target cells; and (4) accurate and effective expression of genetic information (Mannino, et al., 1988 Biotechniques, 6, 682). The composition of liposomes is usually a combination of phospholipids, especially high phase transition temperature phospholipids, usually with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical properties of liposomes depend on pH, ionic strength, and the presence of divalent cations. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form stable complexes. Liposomes that are pH sensitive or negatively charged are believed to take up DNA rather than complex with it. Both cationic and non-cationic liposomes have been used to deliver DNA into cells.
[0175] Liposomes also include "sterically stabilized" liposomes, which term, as used herein, refers to liposomes that contain one or more specialized lipids that, when incorporated into liposomes, provide enhanced circulation lifespan compared to liposomes that lack such specialized lipids.Examples of sterically stabilized liposomes are those in which a portion of the vesicle-forming lipid portion of the liposome contains one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties.Liposomes and their uses are further described in US6,287,860.
[0176] AONs can be introduced into cells using art-recognized techniques (e.g., transfection, electroporation, fusion, liposomes, colloidal polymer particles, and viral and non-viral vectors, as well as other means known in the art). The delivery method selected depends at least on the cells to be treated and the location of the cells, and will be clear to those skilled in the art. For example, localization can be achieved by liposomes with specific markers on the surface to direct the liposomes, direct injection into tissues containing target cells, uptake mediated by specific receptors, etc.
[0177] As is known in the art, AONs can be delivered using methods including, for example, liposome-mediated uptake, lipid conjugates, polylysine-mediated uptake, nanoparticle-mediated uptake, and receptor-mediated endocytosis, as well as additional non-endocytic delivery modalities such as microinjection, permeabilization (e.g., streptolysin-O permeabilization, anionic peptide permeabilization), electroporation, and a variety of non-invasive non-endocytic delivery methods known in the art (see Dokka and Rojanasakul, Advanced Drug Delivery Reviews 44, 35-49, incorporated by reference in its entirety).
[0178] The AON may also be combined with other pharma- ceutically acceptable carriers or diluents to produce pharmaceutical compositions.Suitable carriers and diluents include isotonic saline, such as phosphate-buffered saline.The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral, or transdermal administration.
[0179] The described routes of administration are intended merely as a guide; a skilled artisan can readily determine the optimum route of administration and any dosage for any particular animal and condition.
[0180] Several approaches have been attempted to introduce functional new genetic material into cells both in vitro and in vivo (Friedmann (1989) Science, 244, 1275-1280). These approaches include incorporation of the gene to be expressed into modified retroviruses (Friedmann (1989) supra; Rosenberg (1991) Cancer Research 51(18), suppl.: 5074S-5079S); incorporation into nonretroviral vectors (Rosenfeld, et al. (1992) Cell, 68, 143-155; Rosenfeld, et al. (1991) Science, 252, 431-434); or delivery of the transgene linked to a heterologous promoter-enhancer element via liposomes (Friedmann (1989) supra; Brigham, et al. (1989) Am. J. Med. Sci., 298, 278-281; Nabel, et al. (1990) Science, 249, 1285-1288; Hazinski, et al. (1991) Am. J. Resp. Cell Molec. Biol., 4:206-209; and Wang and Huang (1987) Proc. Natl. Acad. Sci. (USA), 84, 7851-7855); coupling to ligand-specific cation-based transport systems (Wu and Wu (1988) J. Biol. Chem., 263, 14621-14624) or the use of naked DNA, expression vectors (Nabel et al. (1990), supra; Wolff et al. (1990) Science, 247, 1465-1468). Direct injection of a transgene into a tissue results in only localized expression (Rosenfeld (1992) supra; Rosenfeld et al. (1991) supra; Brigham et al. (1989) supra; Nabel (1990) supra; and Hazinski et al. (1991) supra).Brigham et al. group ((1989) Am. J. Med. Sci. 298, 278-281 and Clinical Research (1991) 39 (abstract)) reported in vivo transfection of mouse lungs alone after either intravenous or intratracheal administration of DNA-liposome complexes. Examples of review articles on human gene therapy procedures are Anderson, (1992) Science 256, 808-813; Barteau et al. (2008), Curr Gene Ther., 8(5), 313-23; Mueller et al. (2008). Clin Rev Allergy Immunol., 35(3), 164-78; Li et al. (2006) Gene Ther., 13(18), 1313-9; Simoes et al. (2005) Expert Opin Drug Deliv., 2(2), 237-54.
[0181] The AONs of the invention encompass any pharma- ceutically acceptable salts, esters, or salts of such esters, or any other compounds capable of providing (directly or indirectly) biologically active metabolites or residues thereof upon administration to an animal, including a human. Thus, by way of example, the present disclosure is also directed to prodrugs and pharma- ceutically acceptable salts of the compounds of the invention, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents.
[0182] The term "pharmaceutical acceptable salt" refers to physiologically and pharma- ceutical acceptable salts of compounds of the present invention: that is, salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. In the case of oligomers, preferred examples of pharma- ceutically acceptable salts include, but are not limited to, (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, and the like; (b) acid addition salts formed with inorganic acids such as, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chloride, bromide, and iodine. The pharmaceutical compositions of the present invention can be administered in several ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration may be local (including ocular and mucosal, as well as rectal delivery), pulmonary, for example, by inhalation or insufflation of powder or aerosol (such as by nebulizer, intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, for example, intrathecal or intraventricular administration. For oral administration, oligomers having at least one 2'-O-methoxyethyl modification are believed to be particularly useful. Preferably, AONs are delivered via subcutaneous or intravenous routes.
[0183] The pharmaceutical preparation of the present invention can be conveniently provided in unit dosage form, and it can be prepared according to conventional techniques well known in the pharmaceutical industry.Such techniques include the step of bringing active ingredient into association with pharmaceutical carrier(s) or excipient(s).Generally, the preparation is prepared by bringing active ingredient into association uniformly and intimately with liquid carrier or finely divided solid carrier or both, and then shaping the product as necessary.
[0184] The following examples are to be construed as merely illustrative, and not limiting of the remainder of the disclosure in any way. These examples are included solely for the purpose of illustrating the present invention. They should not be construed as limitations on the broad summary, disclosure or description of the invention detailed above. Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. In the preceding and following examples, all temperatures are set forth in uncorrected degrees Celsius; all parts and percentages are by weight unless otherwise specified. EXAMPLES
[0185] Example 1 AO Design Splice switching AONs targeting exons 2, 3, 4, 5, 6 and 7 were designed to bind to intra-exonic splice sites and intra-exonic splicing enhancer binding sites as predicted by online splice prediction tools. Skipping any of these exons would result in a shift in the reading frame of the transcript, resulting in a premature stop codon in the following exon. Transcripts with premature stop codons are known to decay via nonsense-mediated decay, an RNA surveillance mechanism that operates in all eukaryotic cells. Table 1 lists the sequences, gene coordinates, and sequence numbers for the AONs.
[0186] The AONs had 2'-O-methyl sugar modifications and phosphorothioate (PS) backbone chemical structures. The nomenclature of the AONs was based on that described by Mann et al. (The Journal of Gene Medicine, 2002. 4(6): p. 644-654), which includes the species, gene, exon number, acceptor or donor targeting, and annealing coordinates, where "-" indicates the location of the intron and "+" identifies the location of the exon from the splice site, as described herein.
[0187] AONs with 2'-O-methyl modifications and PS backbones were ordered from TriLink Biotechnologies, Inc. (San Diego, CA, USA) or ChemGenes Corporation (Wilmington, MA, USA). Phosphorodiamidate morpholino oligomers (PMOs) were ordered from Genetools LLC (Philomath, OR, USA).
[0188] Example 2 AO screening and optimization After transfection with 2'-O-methyl AONs, RT-PCR analysis of FUS transcripts was performed. The levels of FUS knockdown or exon skipping after AON transfection were compared to those of control treated and untreated samples. Control sequences included an AON targeting an unrelated gene, SMN: Control AON1 (SEQ ID NO: 31: CACCUUCCUUCUUUUGAUU), a scrambled sequence: Control AON4 (SEQ ID NO: 34: CCUCUUACCUCAGUUACAAUUUAUA), and negative control oligos with GeneTools control sequences: Control AON2 (SEQ ID NO: 32: GGAUGUCCUGAGUCUAGACCCUCCG) and Control AON3 (SEQ ID NO: 33: GGATGTCCTGAGTCTAGACCCTCCG).
[0189] material and method
[0190] Transfection of fibroblasts
[0191] Normal human dermal fibroblasts were propagated prior to transfection according to established techniques by seeding 15,000 cells into 24-well plates in 10% FBS DMEM and incubating for 24 hours at 37° C. All AONs were transfected using Lipofectamine 3000 (3 μl per ml transfection volume) (Life Technologies, Melbourne, Australia) according to the manufacturer's protocol, and AON-transfected cells were incubated for 24 hours.
[0192] Transcript analysis
[0193] RNA was extracted using the MagMAX-96 total RNA isolation kit with DNase treatment (Life Technologies) according to the manufacturer's instructions. RT-PCR was performed using the One-step Superscript III RT-PCR kit with Platinum Taq polymerase (Life Technologies) according to the manufacturer's instructions. Products were amplified across exons 1-5, 1-6, 1-8 or 6-10 of FUS. Primer sequences can be found in Table 2. Where applicable, results were normalized to transcript levels of an unrelated housekeeping control gene (TBP) amplified across exons 2-3.
[0194] PCR products were fractionated on 2% agarose gels in Tris-acetate-EDTA buffer and images were acquired with a gel documentation system (Vilber Lourmat, Eberhardzell, Germany). Densitometric analysis was performed using Image J. The percentage of transcript knockdown was determined by normalization to housekeeping genes and comparison with control treated or untreated samples.
[0195] Two AONs targeting exon 2, AON1 and 2 (SEQ ID NO:1 and 2), were tested at concentrations of 50 and 25 nM. FUS transcripts were amplified by RT-PCR from exons 1-6. No exon 2 skipping or transcript knockdown was observed. AONs targeting exon 3, AON3-5 (SEQ ID NO:3, 4 and 5) and four AON6-9 (SEQ ID NO:6, 7, 8 and 9), were first tested at concentrations of 200 and 50 nM in human fibroblast cell lines using Lipofectamine 3000 for transfection. RNA was collected after 24 hours of incubation and amplified from exons 1-5. Some exon 3 skipping was observed with AON3 and 5, and some exon 4 skipping was observed with AON7 and 9. After transfection with AON8, there was a complete knockdown of the full-length transcript. In a second experiment, concentrations of 50 nM and 10 nM were used, and similar patterns of knockdown and exon skipping were seen (Fig. 1a). In cells transfected with AON8 (SEQ ID NO: 8), using a forward primer in exon 1 and a reverse primer in exon 6 or 8, FUS transcripts with both exons 4 and 5 skipped together were detected, as well as FUS transcripts with exons 3, 4, and 5 skipped, and FUS transcripts with exons 3, 4, 5, and 7 skipped (Fig. 1b). This was confirmed by Sanger sequencing (Fig. 1c). Skipping exons 3, 4, or 5 alone, or all three together, would result in out-of-frame transcripts, while skipping only exons 4 and 5 together would leave the reading frame intact and may prevent the transcript from being degraded via the NMD pathway.
[0196] Several AONs targeting exons 5 and 6 were screened with FUS transcripts amplified by RT-PCR from exons 1-8. Five AONs targeting exon 5 (SEQ ID NO: 10, 11, 12, 13, and 14) were tested at concentrations of 50 and 25 nM. Several AONs targeting exon 5 (SEQ ID NO: 11, 12, and 13) caused skipping of exon 5 (Figure 2a). Several brighter bands were evident on the gel, with sizes consistent with exons 5 and 4 or exons 5 and 6 being skipped together. Cells treated with AON11 (SEQ ID NO: 11) had the greatest FUS knockdown, and skipping of exon 5, as well as fewer multiple skipped bands than cells treated with AON12 and 13. This multiple exon skipping is undesirable, as skipping of exons 5 and 4 or 5 and 6 would leave the reading frame of the transcript intact, resulting in a product that is not expected to be degraded via the NMD pathway.
[0197] The AON11 sequence was microwalked 5 bases upstream and downstream (SEQ ID NO: 15 and 16) and tested in two experiments at a range of concentrations from 200 nM to 3 nM. Cells treated with AON16 (SEQ ID NO: 16) showed the greatest knockdown of the full-length transcript. Some skipping of exon 5 was evident for all three AONs. A bright band indicated some skipping of exons 4 and 5 was seen for cells treated with AON11, and a bright band indicating skipping of exons 5 and 6 was seen for AON16. Cells treated with AON16 produced the greatest knockdown of the full-length transcript (Figure 2b).
[0198] Five AONs targeting exon 6, AON17-21 (SEQ ID NOs: 17, 18, 19, 20 and 21), were tested at concentrations of 50 and 25 nM (Figure 2a). AON17 and 18 did not cause exon skipping or transcript knockdown. AON19 caused a variety of multiple exon skipping, with bands detected that were consistent in size with products of exon 5, exon 5+7, exon 5+6, exon 4+5+6, exon 4+5+6+7, exon 3+4+5+6 and exon 3+4+5+6+7 skipping, but no evidence of exon 6 skipping alone. AON20 induced exon 6 skipping, with bright bands also clearly consistent with exon 6+7 skipping. AON21 caused exon skipping, with bands detected that were consistent in size with exon 6, exon 5+6 and exon 6+7 skipping. The multiple exon skipping produced by the AON targeting exon 6 is undesirable because several of these transcripts, including those in which exons 5+6, 5+7, 6+7 and 3+4+5+6 are skipped, leave the reading frame of the transcript intact and would not be expected to be disrupted via NMD.
[0199] Two FUS exon 7-targeting AONs, AON22 and 23 (SEQ ID NO: 22 and 23), were tested first. They were tested in three separate experiments at a range of concentrations down to 1 nm. Both AONs were able to induce exon 7 skipping, with approximately 37% and 36% of transcripts showing exon 7 skipping when treated with AON22 and AON23 at a concentration of 50 nM (Figure 3a). Some exon 7 skipping was also seen in some of the control samples. This was not unexpected, since exon 7 skipping is a mechanism by which FUS is autoregulated. AON22 and 23 were also tested in combination, but the skipping efficiency did not improve (Figure 3a).
[0200] AON22 and 23 were microwalked 5 bases upstream and downstream to obtain AON24-27 (sequence numbers 24, 25, 26 and 27). These were tested in two experiments. A representative gel image can be seen in Figure 3b. The top 4 candidates selected from both experiments were tested in a wider concentration range in a third experiment (Figure 3c). AON26 induced the greatest exon 7 skipping, in about 68% of the total transcript detected at a concentration of 100 nM. Exon 7 skipping was confirmed via Sanger sequencing of DNA extracted and amplified from the lower band in the agarose gel (Figure 3d).
[0201] Example 3 Screening of PMOs AON8 (targeting exon 4), AON16 (targeting exon 5 targeted) and AON26 (targeting exon 7) were synthesized as PMOs to yield AON28, 29 and 30 (SEQ ID NOs: 28, 29 and 30). AON28 was tested in two experiments. Fibroblasts were transfected by nucleofection at concentrations of 100 and 50 μM (concentration in nucleofection) and cells were harvested after 12, 24 and 72 hours of incubation. FUS transcripts were amplified by RT-PCR from exons 1-8 (FIG. 4a). The same pattern of exon skipping was seen as caused by the 2'-O-methyl PS AON (AON8). The most intense bands 12 hours after transfection at the highest concentration were for transcripts skipping exons 3, 4, 5 and 7. At lower concentrations, the bands with skipped exons 4 and 5 became more prominent. This also increased over time at both concentrations (Figure 4a). Western blots using anti-FUS / TLS antibody (4h11) (Santa Cruz Biotechnology) and anti-β-actin antibody A5441 (sigma-aldrich) as housekeeping proteins were used to analyze the levels of FUS protein for samples collected 3 days after transfection. After transfection with AON28, there was no reduction in protein levels compared to cells treated with the control (Figure 4c).
[0202] Fibroblasts were transfected with the PMO AON29 (SEQ ID NO:29) targeting exon 5 and the PMO AON30 (SEQ ID NO:30) targeting exon 7 at 100 μM and 25 μM via nucleofection and harvested after 1, 3 and 5 days of incubation. FUS transcripts were amplified by RT-PCR from exons 1-8 (Figure 4b). Cells treated with AON29 showed knockdown of the full-length transcript at 100 μM but not at 25 μM. In contrast to what was seen with the 2'-O-methyl version of this AON sequence, at 24 hours the major skipped bands evident on the gel were for transcripts in which exons 4 and 5 were skipped, whereas the band corresponding to transcripts in which only exon 5 was skipped was extremely faint. AON29 did not reduce FUS protein levels to a greater extent (Figure 4d). Cells treated with AON30 showed reduction of the full-length transcript at both concentrations. Although the knockdown was greater than that seen with the 2'-O-methyl version of the sequence, the transcript with exon 7 skipped was not evident on the gel (Figure 4b). This could occur if the transcript is degraded very efficiently. Western blots showed that AON30 led to a large reduction in FUS protein (Figure 4d).
[0203] Example 4 Further testing of PMO (AON30) targeting lead exon 7 AON30 (SEQ ID NO: 30) was tested in three independent experiments in human fibroblasts. FUS transcripts were amplified by RT-PCR from exons 6-10, and FUS levels were reduced compared to controls. In Figure 5a a representative gel image can be seen. FUS protein was quantified by Western blot, and FUS protein levels were reduced to 13% of control levels 5 days after transfection at 100 μM (p=0.0018) and 26% after 5 days after transfection at 50 μM (p=0.012). In Figure 5b a representative Western blot can be seen, and in Figure 5c a densitometric analysis from three experiments can be seen.
[0204] AON30 was tested in neuronal-like SH-SY5Y cells in three independent experiments. Cells were transfected at concentrations of 25 and 5 μM (concentration at the tip during electroporation) via electroporation using the Neon transfection system (Thermo Fisher Scientific). RNA and protein were analyzed after 5 days of incubation. FUS RNA expression was almost completely suppressed, at 3.8% of control levels at a concentration of 25 μM and 11% at a concentration of 5 μM. In Figure 6a a representative gel image can be seen, and in Figure 6c a densitometric analysis from three experiments can be seen. With the addition of cycloheximide (50 μg / ml) for the final 6 hours of incubation, transcripts with skipped exon 7 became visible on the gel, indicating that these transcripts are degraded by NMD during translation. Protein levels were measured by Western blot and were at 12% and 17% of control levels after 5 days (Figure 6b, c).
Claims
1. An antisense oligonucleotide targeted to a nucleic acid molecule encoding a FUS pre-mRNA, said antisense oligonucleotide having a nucleobase sequence selected from the list consisting of SEQ ID NOs: 1-30 or variants thereof; or a nucleobase sequence that is complementary to at least one or more contiguous nucleobases in a target FUS pre-mRNA or variant thereof to which SEQ ID NOs: 1-30 also binds, said antisense oligonucleotide inhibiting expression of said FUS gene, and said antisense oligonucleotide being substantially isolated or purified.
2. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide inhibits expression of FUS.
3. The antisense oligonucleotide of claim 1 , which binds to exon 2, 3, 4, 5, 6 or 7 on FUS.
4. The antisense oligonucleotide of claim 1, which induces alternative splicing of FUS pre-mRNA via exon skipping.
5. The antisense oligonucleotide of claim 4, wherein the exon is exon 7.
6. 2. The antisense oligonucleotide of claim 1, which is a phosphorodiamidate morpholino oligomer.
7. 7. The antisense oligonucleotide of claim 6, which is a peptide-phosphorodiamidate morpholino oligomer conjugate.
8. The antisense oligonucleotide of claim 1, selected from the list consisting of SEQ ID NOs: 22-27 and 30.
9. The antisense oligonucleotide of claim 8, which is SEQ ID NO:
30.
10. 10. A method for inducing alternative splicing of FUS pre-mRNA, comprising the steps of providing one or more of the antisense oligonucleotides of any one of claims 1 to 9; and allowing the oligomers to bind to a target nucleic acid site.
11. A composition for treating, preventing, or alleviating the effects of a disease associated with FUS proteinopathy, high FUS expression, or FUS mutations, comprising one or more antisense oligonucleotides described in any one of claims 1 to 9; and one or more therapeutically acceptable carriers and / or diluents.
12. A pharmaceutical composition for treating, preventing, or alleviating the effects of a disease associated with FUS proteinopathy, high FUS expression, or FUS mutations, comprising one or more antisense oligonucleotides described in any one of claims 1 to 9; and one or more pharmaceutically acceptable carriers and / or diluents.
13. 13. The pharmaceutical composition of claim 12, wherein the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of ALS, FTLD, CTE, HD, SCA1, SCA3 and NIIBD.
14. 13. The pharmaceutical composition of claim 12, wherein the disease is selected from the group consisting of FTD, AD, ET, PD, IBMY, IBM, CBD, and PSP.
15. 13. The pharmaceutical composition of claim 12, wherein the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of ALS and FTLD.
16. 16. The pharmaceutical composition of claim 15, wherein the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of FUS-ALS and FUS-FTLD.
17. 13. The pharmaceutical composition of claim 12, for use in a method for treating, preventing, or alleviating the effects of a disease associated with FUS proteinopathy, high FUS expression, or FUS mutation in a patient identified by a biomarker, the method comprising testing a subject for the presence of a biomarker associated with a disease associated with FUS proteinopathy, high FUS expression, or FUS mutation to identify patients who are likely to respond to FUS inhibition, wherein the composition is administered to the subject found to express the biomarker.
18. 18. The pharmaceutical composition of claim 17, wherein the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of ALS, FTLD, CTE, HD, SCA1, SCA3 and NIIBD.
19. 19. The pharmaceutical composition of claim 18, wherein the biomarker is a FUS mutation or other genetic marker capable of stratifying patients.
20. The pharmaceutical composition according to claim 12 for reducing the expression of FUS in a subject and / or reducing the overexpression of FUS caused by autoregulation in a subject.
21. A pharmaceutical composition for reducing the expression of FUS in a subject; and / or reducing overexpression of FUS caused by autoregulation in a subject, the pharmaceutical composition comprising one or more antisense oligonucleotides described in any one of claims 1 to 9; and one or more pharmaceutically acceptable carriers and / or diluents.
22. An expression vector comprising one or more antisense oligonucleotides according to any one of claims 1 to 9.
23. A cell comprising the antisense oligonucleotide of any one of claims 1 to 9.
24. Use of an antisense oligonucleotide according to any one of claims 1 to 9 for the manufacture of a medicament for treating, preventing or alleviating the effects of a disease associated with a FUS proteinopathy, high FUS expression or a FUS mutation.
25. A composition for treating, preventing, or alleviating the effects of a disease associated with FUS proteinopathy, high FUS expression, or FUS mutations, comprising an antisense oligonucleotide according to any one of claims 1 to 9.
26. 25. The use of claim 24, wherein the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of ALS, FTD, FTLD, CTE, HD, SCA1, SCA3 and NIIBD.
27. The composition described in claim 25, wherein the disease associated with FUS proteinopathy, high FUS expression or FUS mutation is selected from the group consisting of ALS, FTD, FTLD, CTE, HD, SCA1, SCA3 and NIIBD.
28. 10. A kit for treating, preventing, or alleviating the effects of a disease associated with FUS proteinopathy, high FUS expression, or FUS mutation in a subject, comprising at least an antisense oligonucleotide according to any one of claims 1 to 9 packaged in a suitable container together with instructions for its use.