Antisense oligonucleotides

Abstract

The present invention relates to antisense oligonucleotides that reduce the expression of A1CF, as well as conjugates, salts and pharmaceutical compositions thereof.The present invention also relates to the use of such antisense oligonucleotides, conjugates, salts and pharmaceutical compositions in methods for reducing A1CF expression, and in medical uses and methods for treating disease, particularly Hepatitis B virus (HBV) infection.

Description

[Technical Field]

[0001] The present invention relates to antisense oligonucleotides that reduce the expression of A1CF, as well as conjugates, salts, and pharmaceutical compositions thereof. The present invention also relates to the use of such antisense oligonucleotides, conjugates, salts, and pharmaceutical compositions in methods for reducing A1CF expression and in medical uses and methods for treating diseases, particularly hepatitis B virus (HBV) infection. [Background technology]

[0002] Hepatitis B is an infectious disease caused by the hepatitis B virus (HBV), a small, hepatotropic virus that replicates via reverse transcription. Chronic HBV infection is a significant risk factor for severe liver diseases such as cirrhosis and hepatocellular carcinoma. Current treatments for chronic HBV infection are based on the administration of pegylated type 1 interferons or nucleoside(t)ide analogs, such as lamivudine, adefovir, entecavir, tenofovir disoproxil, and tenofovir alafenamide, which target the viral polymerase, a multifunctional reverse transcriptase. Successful treatment is usually measured as the disappearance of hepatitis B surface antigen (HBsAg). However, complete HBsAg clearance is rarely achieved because hepatitis B viral DNA persists in the body after infection.

[0003] HBV persistence is mediated by an episomal form of the HBV genome that is stably maintained in the nucleus. This episomal form is called "covalently closed circular DNA" (cccDNA). HBV is an imperfect double-stranded circular DNA virus. After HBV infects a cell, the circular DNA is transported to the nucleus and repaired to cccDNA by DNA polymerase. cccDNA serves as a template for all HBV transcripts, including pregenomic RNA (pgRNA). pgRNA serves as a template for HBV genomic DNA and is therefore a viral replication intermediate critical for viral replication. The presence of several copies of cccDNA may be sufficient to reinitiate late-stage HBV infection. Current treatments for HBV do not target cccDNA. However, clearance of cccDNA may be necessary for cure of chronic HBV infection (reviewed by Nassal, Gut. 2015 Dec;64(12):1972-84. doi:10.1136 / gutjnl-2015-309809).

[0004] A1CF (APOBEC1 complementation factor) is a component of the apolipoprotein B mRNA editing enzyme complex, responsible for post-transcriptional editing of apolipoprotein B mRNA by converting the CAA codon to a UAA codon for Gln termination. The introduction of a stop codon into apolipoprotein B mRNA alters lipid metabolism in the gastrointestinal tract. The editing enzyme complex contains a minimal core consisting of the cytidine deaminase APOBEC1 (apolipoprotein B mRNA editing enzyme catalytic subunit 1) and a complementation factor encoded by the A1CF gene. The A1CF protein possesses three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It binds to apolipoprotein B mRNA, likely to dock the catalytic subunit APOBEC1 to the mRNA, allowing it to deaminate its target cytosine (Chester et al., EMBO J. 2003 Aug 1;22(15):3971-82).

[0005] Most reports on the apolipoprotein B mRNA-editing enzyme complex have focused on the cytidine deaminase APOBEC1 rather than the APOBEC1 cofactor, which has been shown to not only edit apolipoprotein B mRNA but also viral genomes, including HBV.

[0006] In a mouse model of HBV replication, Renard et al. showed that mouse APOBEC1 edited HBV in vivo (Renard et al., J Mol Biol. 2010 Jul 16;400(3):323-34. doi:10.1016 / j.jmb.2010.05.029). In contrast, rat APOBEC1 did not inhibit HBV DNA production (Rosler et al., Hepatology. 2005 Aug;42(2):301-9).

[0007] Gonzalez et al. demonstrated that human APOBEC1 edits HBV DNA. In cells co-transfected with HBV and human APOBEC1, several G-to-A hypermutations were identified in the HBV genome. Furthermore, the presence of human APOBEC1 affected HBV DNA replication. Specifically, increased APOBEC1 expression was shown to decrease HBV DNA levels (Gonzalez et al., Retrovirology. 2009 Oct 21;6:96. doi:10.1186 / 1742-4690-6-96).

[0008] To our knowledge, A1CF has never been identified as a cccDNA-dependent factor for cccDNA stability and maintenance, nor have molecules that inhibit A1CF been suggested as cccDNA-destabilizing agents for the treatment of HBV infection.

[0009] Furthermore, to our knowledge, the only disclosure of oligonucleotides potentially relevant to regulating A1CF expression is suggested in WO 2016 / 142948. However, WO 2016 / 142948 relates to altering the splicing of a number of listed targets, including A1CF, to create alternative splice variants. However, the oligonucleotides are decoy oligonucleotides that encode splicing factor binding sites and therefore do not bind to the target itself. WO 2016 / 142948 also mentions a list of treatments, including cancer, inflammation, immunological disorders, neurodegeneration, Alzheimer's disease, Parkinson's disease, and viral infections (HIV, HSV, HBV). However, there are no specific examples of oligonucleotides targeting A1CF or their use in HBV. Summary of the Invention

[0010] HBV cccDNA in infected hepatocytes is involved in persistent chronic infection and reactivation, serving as the template for all viral subgenomic transcripts and pregenomic RNA (pgRNA), ensuring both newly synthesized viral progeny and cccDNA pool replenishment via intracellular nucleocapsid recycling. A1CF is involved in cccDNA stability. Inhibiting A1CF leads to cccDNA destabilization in HBV-infected subjects, which in turn opens the door to a complete cure for chronically infected HBV patients.

[0011] Therefore, the present invention relates to antisense oligonucleotides that can reduce the expression of A1CF. Reduction of A1CF expression can reduce cccDNA levels, which may be useful in treating HBV infection, especially chronic HBV infection.

[0012] The present invention provides an antisense oligonucleotide having a length of 12 to 30 nucleotides, comprising a contiguous nucleotide sequence having a length of 12 to 30 nucleotides, wherein the contiguous nucleotide sequence is capable of binding to a target sequence in apolipoprotein B-mRNA editing enzyme catalytic subunit 1 (APOBEC1) complementation factor (A1CF) mRNA, and the target sequence is the following sequence: GCCUAUCUGAGAAACUUUU (SEQ ID NO: 32) (positions 2181 to 2199 of SEQ ID NO: 45), GAGAAAAACCUAUAAUGCCU (SEQ ID NO: 42) (positions 6951 to 6970 of SEQ ID NO: 45), AAGUAAAAUUAACAUGUCCA (SEQ ID NO: 43) (positions 16970 to 16989 of SEQ ID NO: 45), AAACACCACAAUCUUAAAAC (SEQ ID NO: 39) (positions 26358 to 26377 of SEQ ID NO: 45), A sequence of at least 17 consecutive nucleotides within either CAGGUAUAUAACAAGUUCA (SEQ ID NO: 34) (positions 38053 to 38071 of SEQ ID NO: 45) and AGACACACAAAACUCUAU (SEQ ID NO: 44) (positions 78973 to 78990 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0013] In some embodiments, the target sequence is the following sequence: GAAAAACCUAUAAUGCCU (SEQ ID NO: 31) (positions 6953 to 6970 of SEQ ID NO: 45), GCCUAUCUGAGAAACUUUU (SEQ ID NO: 32) (positions 2181 to 2199 of SEQ ID NO: 45), AAGUAAAAUUAACAUGUCC (SEQ ID NO: 33) (positions 16970 to 16988 of SEQ ID NO: 45), CAGGUAUAUAACAAGUUCA (SEQ ID NO: 34) (positions 38053 to 38071 of SEQ ID NO: 45), AGACACACAAAACUCUA (SEQ ID NO: 35) (positions 78973 to 78989 of SEQ ID NO: 45), AGAAAAACCUAUAAUGC (SEQ ID NO: 36) (positions 6952 to 6968 of SEQ ID NO: 45), GAAAAACCUAUAAUGCC (SEQ ID NO: 37) (positions 6953 to 6969 of SEQ ID NO: 45), GUAAAAUUAACAUGUCCA (SEQ ID NO: 38) (positions 16972 to 16989 of SEQ ID NO: 45), AAACACCACAAUCUUAAAAC (SEQ ID NO: 39) (positions 26358 to 26377 of SEQ ID NO: 45), GACACACAAAACUCUAU (SEQ ID NO: 40) (positions 78974 to 78990 of SEQ ID NO: 45), and GAGAAAAACCUAUAAUGC (SEQ ID NO: 41) (positions 6951 to 6968 of SEQ ID NO: 45).

[0014] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of the following sequences: AGGCATTATAGGTTTTTE (SEQ ID NO: 1), AAAAGTTTCTCAGATAGGE (SEQ ID NO: 2), GGACATGTTAATTTTACTT (SEQ ID NO: 3), TGAACTTGTTATATACETG (SEQ ID NO: 4), TAGAGTTTTGTGTGTET (SEQ ID NO: 5), GEATTATAGGTTTTTET (SEQ ID NO: 6), GGCATTATAGGTTTTTE (SEQ ID NO: 7), GGEATTATAGGTTTTTE (SEQ ID NO: 8), TGGACAUGTTAATTTTAE (SEQ ID NO: 9), GGACATGUTAATTTTACTT (SEQ ID NO: 10), GTTTTAAGATTGTGGTGTTT (SEQ ID NO: 11), TAGAGTTTUGTGTGTET (SEQ ID NO: 12), TAGAGTTTTGTGUGTET (SEQ ID NO: 13), ATAGAFTTTTGTGTGTE (SEQ ID NO: 14), AAAAFTTTCTCAGATAGGE (SEQ ID NO: 15), AAAAGTTTCTCAFATAGGE (SEQ ID NO: 16), AAAAGTTUCTCAGATAGGE (SEQ ID NO: 17), AGGCATTATAGGUTTTTE (SEQ ID NO: 18), AGGCAUTATAGGTTTTTE (SEQ ID NO: 19), GEATTATAGGTTTTTCTE (SEQ ID NO: 20), GEATTATAGGTTTTUCTE (SEQ ID NO: 21), GEATTATAGGTTTUTCTE (SEQ ID NO: 22), GEATTATAGGTTUTTCTE (SEQ ID NO: 23), GEATTATAGGTTUTTET (SEQ ID NO: 24), GEATTATAGGTUTTTET (SEQ ID NO: 25), GEATTATAGGUTTTTCTE (SEQ ID NO: 26), GEATTATAGGUTTTTET (SEQ ID NO: 27), GEATTAUAGGTTTTTET (SEQ ID NO: 28), GEATUATAGGTTTTTET (SEQ ID NO: 29) and GEAUTATAGGTTTTTET (SEQ ID NO: 30).

[0015] In some embodiments, the antisense oligonucleotide is selected from the group consisting of Compound Nos. 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, 5_2, 6_1, 7_1, 7_2, 8_1, 2_2, 9_1, 10_1, 11_1, 4_3, 12_1, 5_3, 13_1, 14_1, 15_1, 16_1, 16_2, 16_3, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, 2_12, 17_1, 18_1, 19_1, 20_1, 20_2, 20_3, 20_4, 20_5, 20_6, 6_2, 6_3, 6_4, 6_5, 6_6, 6_7, 6_8, 6_9, 6_10, 6_11, 6_12, 21_1, 22_1, 23_1, 24_1, 25_1, 25_2, 26_1, 27_1, 27_2, 28_1, 29_1, 30_1, 11_2 and 11_3.

[0016] The present invention also provides an antisense oligonucleotide conjugate comprising an antisense oligonucleotide of the invention covalently attached to at least one conjugate moiety.

[0017] In some embodiments, the antisense oligonucleotide conjugate is selected from the group consisting of conjugate numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, 5_2, 6_1, 7_1, 7_2, 8_1, 2_2, 9_1, 10_1, 11_1, 4_3, 12_1, 5_3, 13_1, 14_1, 15_1, 16_1, 16_2, 16_3, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, Includes or consists of any one of 2_12, 17_1, 18_1, 19_1, 20_1, 20_2, 20_3, 20_4, 20_5, 20_6, 6_2, 6_3, 6_4, 6_5, 6_6, 6_7, 6_8, 6_9, 6_10, 6_11, 6_12, 21_1, 22_1, 23_1, 24_1, 25_1, 25_2, 26_1, 27_1, 27_2, 28_1, 29_1, 30_1, 11_2 and 11_3.

[0018] The present invention also provides an antisense oligonucleotide conjugate selected from the group consisting of: (a) Conjugate number 1_1 shown in Figure 1 ; (b) Conjugate number 2_1 shown in Figure 2 ; (c) Conjugate number 3_1 shown in Figure 3 ; (d) Conjugate number 4_1 shown in Figure 4 ; (e) Conjugate number 4_2 shown in Figure 5 ; (f) Conjugate number 5_1 shown in Figure 6 ; (g) Conjugate No. 5_2 shown in Figure 7 .

[0019] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is SEQ ID NO: 32. In some such embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 2, 15, 16, or 17. In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 2_1, 2_2, 15_1, 16_1, 16_2, 16_3, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, 2_12, and 17_1. In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of conjugate numbers 2_1, 2_2, 15_1, 16_1, 16_2, 16_3, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, 2_12 and 17_1.

[0020] In some embodiments of the antisense oligonucleotides or antisense oligonucleotide conjugates of the invention, the target sequence is selected from SEQ ID NOs: 31, 36, 37, and 41. In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 6, 7, 8, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30. In some embodiments, the antisense oligonucleotide comprises or consists of any one of compound numbers 1_1, 6_1, 7_1, 7_2, 8_1, 18_1, 10_1, 20_1, 20_2, 20_3, 20_4, 20_5, 20_6, 6_2, 6_3, 6_4, 6_5, 6_6, 6_7, 6_8, 6_9, 6_10, 6_11, 6_12, 21_1, 22_1, 23_1, 24_1, 25_1, 25_2, 26_1, 27_1, 27_2, 28_1, 29_1, and 30_1. In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of conjugate numbers 1_1, 6_1, 7_1, 7_2, 8_1, 18_1, 10_1, 20_1, 20_2, 20_3, 20_4, 20_5, 20_6, 6_2, 6_3, 6_4, 6_5, 6_6, 6_7, 6_8, 6_9, 6_10, 6_11, 6_12, 21_1, 22_1, 23_1, 24_1, 25_1, 25_2, 26_1, 27_1, 27_2, 28_1, 29_1, and 30_1.

[0021] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is SEQ ID NO: 33 or SEQ ID NO: 38. In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 3, 9, or 10. In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 3_1, 9_1, and 10_1. In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of Conjugate Nos. 3_1, 9_1, or 10_1.

[0022] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is SEQ ID NO: 39. In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to SEQ ID NO: 11. In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 11_1, 11_2, or 11_3. In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of Conjugate Nos. 11_1, 11_2, or 11_3.

[0023] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is SEQ ID NO: 34. In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to SEQ ID NO: 4. In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 4_1, 4_2, or 4_3. In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of Conjugate Nos. 4_1, 4_2, or 4_3.

[0024] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is SEQ ID NO: 35 or SEQ ID NO: 40. In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 5, 12, 13, or 14. In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 5_1, 5_2, 12_1, 5_3, 13_1, or 14_1. In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of Conjugate Nos. 5_1, 5_2, 12_1, 5_3, 13_1, or 14_1.

[0025] The present invention also provides pharmaceutical compositions comprising an antisense oligonucleotide or antisense oligonucleotide conjugate of the invention and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0026] The present invention also provides an in vitro or in vivo method for reducing A1CF expression in target cells, comprising administering to the target cells an effective amount of an antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention or a pharmaceutical composition of the present invention.

[0027] The present invention also provides a method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a therapeutically or prophylactically effective amount of an antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, or a pharmaceutical composition of the invention.

[0028] The present invention also provides the antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention, or the pharmaceutical composition of the present invention, for use in treating or preventing a disease in a subject.

[0029] The present invention also provides the use of an antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention, or a pharmaceutical composition of the present invention, for the preparation of a medicament for the treatment or prevention of a disease in a subject.

[0030] In some embodiments, the disease is HBV infection. In preferred embodiments, the disease is chronic HBV infection. [Brief explanation of the drawings]

[0031] [Figure 1] FIG. 1 shows the chemical structure of conjugate No. 1_1 (corresponding to SEQ ID NO: 1 and compound No. 1_1). [Figure 2] FIG. 2 shows the chemical structure of conjugate No. 2_1 (corresponding to SEQ ID NO: 2 and compound No. 2_1). [Figure 3] FIG. 3 shows the chemical structure of conjugate No. 3_1 (corresponding to SEQ ID NO: 3 and compound No. 3_1). [Figure 4]FIG. 4 shows the chemical structure of conjugate No. 4_1 (corresponding to SEQ ID NO: 4 and compound No. 4_1). [Figure 5] FIG. 5 shows the chemical structure of conjugate No. 4_2 (corresponding to SEQ ID NO: 4 and compound No. 4_2). [Figure 6] FIG. 6 shows the chemical structure of conjugate No. 5_1 (corresponding to SEQ ID NO: 5 and compound No. 5_1). [Figure 7] FIG. 7 shows the chemical structure of conjugate No. 5_2 (corresponding to SEQ ID NO: 5 and compound No. 5_2). [Figure 8] Figure 8 shows the chemical structure of the aminohexyl-conjugated tri(N-acetyl-galactosamine) (HELM annotation [5gn2c6]), which is the GalNAc moiety in each of the antisense oligonucleotide conjugates shown in Table 5. The wavy line indicates the covalent bond by which the GalNAc moiety is attached to the linker or antisense oligonucleotide.

[0032] The chemical diagram shows the protonated form of antisense oligonucleotide, and it is understood that each hydrogen atom on the sulfur atom in the phosphorothioate internucleoside bond can be independently present or absent.It is understood that the presence of protons depends on the acidity of the molecule's environment.In salt form, one or more hydrogen atoms can be replaced with, for example, cations, such as metal cations (e.g., sodium cations or potassium cations).Protonated phosphorothioates exist in tautomeric forms. DETAILED DESCRIPTION OF THE INVENTION

[0033] Unless otherwise stated, all ranges are inclusive of the starting and ending values.

[0034] Each reference herein to a SEQ ID NO (Sequence Identifier Number) refers to the sequence represented by that SEQ ID NO. Each reference herein to a Compound Number (Compound Identification Number) refers to the compound represented by that Compound Number. Each reference herein to a Conjugate Number (Conjugate Identifier Number) refers to the conjugate represented by that Conjugate Number.

[0035] The present invention provides an antisense oligonucleotide having a length of 12 to 30 nucleotides, comprising a contiguous nucleotide sequence having a length of 12 to 30 nucleotides, wherein the contiguous nucleotide sequence is capable of binding to a target sequence in apolipoprotein B-mRNA editing enzyme catalytic subunit 1 (APOBEC1) complementation factor (A1CF) mRNA, and the target sequence is the following sequence: GCCUAUCUGAGAAACUUUU (SEQ ID NO: 32) (positions 2181 to 2199 of SEQ ID NO: 45), GAGAAAAACCUAUAAUGCCU (SEQ ID NO: 42) (positions 6951 to 6970 of SEQ ID NO: 45), AAGUAAAAUUAACAUGUCCA (SEQ ID NO: 43) (positions 16970 to 16989 of SEQ ID NO: 45), AAACACCACAAUCUUAAAAC (SEQ ID NO: 39) (positions 26358 to 26377 of SEQ ID NO: 45), A sequence of at least 17 consecutive nucleotides within either CAGGUAUAUAACAAGUUCA (SEQ ID NO: 34) (positions 38053 to 38071 of SEQ ID NO: 45) and AGACACACAAAACUCUAU (SEQ ID NO: 44) (positions 78973 to 78990 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0036] Oligonucleotides As used herein, the term "oligonucleotide" is defined as a molecule containing two or more covalently linked nucleosides, as generally understood by those skilled in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers.

[0037] Oligonucleotide is usually produced in laboratory by solid phase chemical synthesis and then purified and isolated.When referring to the sequence of oligonucleotide, it refers to the sequence or order of the nucleic acid base moiety of covalently linked nucleotide or nucleoside, or its modification.The oligonucleotide of the present invention is artificial, is chemically synthesized, and is usually purified or isolated.

[0038] Nucleotides and Nucleosides Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and in the present invention, include both naturally occurring and non-naturally occurring nucleotides and nucleosides.Naturally, nucleotides, such as DNA and RNA nucleotides, contain a ribose sugar moiety, a nucleic acid base moiety, and one or more phosphate groups.One or more phosphate groups are not present in nucleosides.Nucleosides and nucleotides can also be referred to interchangeably as "units" or "monomers."

[0039] Nucleic acid bases The term "nucleobase" includes purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds during nucleic acid hybridization.In the context of the present invention, the term "nucleobase" also encompasses modified nucleobases that may differ from naturally occurring nucleobases but are functional during nucleic acid hybridization.In this context, "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants.Such variants are described, for example, in Hirao et al., 2012, Accounts of Chemical Research, 45, 2055-2065 and Bergstrom, 2009, Curr.Protoc.Nucleic Acid Chem., 37, 1.4.1-1.4.32.

[0040] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, e.g., a substituted purine or substituted pyrimidine, e.g., a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 7-deaza-8-azaguanine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0041] Nucleobase moieties can be represented by the letter code for each corresponding nucleobase, for example, A, T, G, C, or U, and each letter can optionally include a modified nucleobase of equivalent function. For example, in the exemplified oligonucleotide, the nucleobase moiety is selected from A, T, G, C, 5-methylcytosine, and 7-deaza-8-azaguanine. Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides can be used. 5-methylcytosine can be represented as "E". 7-deaza-8-azaguanine can be represented as "F".

[0042] antisense oligonucleotides The oligonucleotide is an antisense oligonucleotide.

[0043] As used herein, the term " antisense oligonucleotide " is defined as the oligonucleotide that can regulate the expression of target gene by hybridizing with target nucleic acid, particularly the continuous sequence on target nucleic acid.Antisense oligonucleotide is not essentially double-stranded, and therefore is not siRNA or shRNA.In some embodiments, antisense oligonucleotide is single-stranded antisense oligonucleotide.It is understood that the single-stranded oligonucleotide of the present invention can form hairpin or intermolecular duplex structure (the duplex between two molecules of the same oligonucleotide), as long as the degree of complementarity between itself or itself is less than about 50% over the entire length of oligonucleotide.

[0044] In some embodiments, the antisense oligonucleotides of the present invention do not comprise RNA nucleosides.

[0045] The term "antisense oligonucleotide" may be abbreviated herein as "ASO."

[0046] Antisense oligonucleotide length The antisense oligonucleotides of the present invention are 12 to 30 nucleotides in length. In some embodiments, the antisense oligonucleotides are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the antisense oligonucleotides are 15 to 25 nucleotides in length, for example, 15 to 24, 23, 22, 21, or 20 nucleotides in length. In some embodiments, the antisense oligonucleotides are 16 to 25 nucleotides in length, for example, 16 to 24, 23, 22, 21, or 20 nucleotides in length. In some embodiments, the antisense oligonucleotides are 17 to 25 nucleotides in length, for example, 17 to 24, 23, 22, 21, or 20 nucleotides in length. In some embodiments, the antisense oligonucleotides are 17, 18, 19, or 20 nucleotides in length. In some embodiments, the antisense oligonucleotides are 17 nucleotides in length. In some embodiments, the antisense oligonucleotide is 18 nucleotides in length. In some embodiments, the antisense oligonucleotide is 19 nucleotides in length. In some embodiments, the antisense oligonucleotide is 20 nucleotides in length.

[0047] Contiguous nucleotide sequence The term "contiguous nucleotide sequence" refers to the region of the antisense oligonucleotide that binds to A1CF mRNA. In other words, it is the contiguous nucleotide sequence that mediates the binding of the antisense oligonucleotide of the present invention to A1CF mRNA. The contiguous nucleotide sequence mediates the binding of the antisense oligonucleotide of the present invention to the target sequence in A1CF mRNA. Thus, the contiguous nucleotide sequence is complementary to the target sequence, and in some cases, is completely complementary. The term "contiguous nucleotide sequence" is used interchangeably with the term "contiguous nucleic acid base sequence" herein.

[0048] In some embodiments, antisense oligonucleotides comprise a contiguous nucleotide sequence, and optionally a nucleotide linker sequence that can be used to attach additional nucleotide(s), such as a functional group (e.g., a conjugate group), to the contiguous nucleotide sequence. The nucleotide linker sequence may or may not be complementary to the target nucleic acid.

[0049] Length of the contiguous nucleotide sequence It is understood that the contiguous nucleotide sequence of an antisense oligonucleotide cannot be longer than the antisense oligonucleotide itself, and that the antisense oligonucleotide cannot be shorter than the contiguous nucleotide sequence.

[0050] The contiguous nucleotide sequence of the antisense oligonucleotide of the present invention is 12 to 30 nucleotides in length. In some embodiments, the contiguous nucleotide sequence is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the contiguous nucleotide sequence is 15 to 25 nucleotides in length, for example, 15 to 24, 23, 22, 21, or 20 nucleotides in length. In some embodiments, the contiguous nucleotide sequence is 16 to 25 nucleotides in length, for example, 16 to 24, 23, 22, 21, or 20 nucleotides in length. In some embodiments, the contiguous nucleotide sequence is 17 to 25 nucleotides in length, for example, 17 to 24, 23, 22, 21, or 20 nucleotides in length. In some embodiments, the contiguous nucleotide sequence is 17, 18, 19, or 20 nucleotides in length. In some embodiments, the contiguous nucleotide sequence is 17 nucleotides in length. In some embodiments, the contiguous nucleotide sequence is 18 nucleotides in length. In some embodiments, the contiguous nucleotide sequence is 19 nucleotides in length. In some embodiments, the contiguous nucleotide sequence is 20 nucleotides in length.

[0051] In some embodiments, the antisense oligonucleotide consists of a contiguous nucleotide sequence. In some embodiments, the contiguous nucleotide sequence is the same length as the antisense oligonucleotide. In some embodiments, the antisense oligonucleotide is a contiguous nucleotide sequence. In some embodiments, all nucleosides of the antisense oligonucleotide constitute a contiguous nucleotide sequence. In some embodiments, the terms "antisense oligonucleotide" and "contiguous nucleotide sequence" are interchangeable.

[0052] A1CF mRNA The contiguous nucleotide sequence of the antisense oligonucleotide of the present invention is capable of binding to a target sequence in the A1CF mRNA.

[0053] The term "A1CF mRNA" refers to an RNA molecule transcribed from the A1CF gene. In other words, A1CF mRNA is an mRNA encoded by the A1CF gene. The human A1CF gene is located at positions 50,799,409 to 50,885,675 on the opposite strand of chromosome 10 (genome build GRCh38.p13, Ensembl ID ENSG00000148584). In some embodiments, the A1CF gene may comprise the human A1CF genomic sequence according to NCBI reference sequence NG_029916.1. The sense strand of the DNA sequence of the human A1CF gene is set forth herein as SEQ ID NO: 45.

[0054] The A1CF gene is transcribed into pre-mRNA. Thus, in some embodiments, the A1CF mRNA is human A1CF pre-mRNA. The sequence of the A1CF pre-mRNA is herein considered to correspond to SEQ ID NO: 45 (the DNA sequence of the sense strand of the human A1CF gene). As is well known in the art, each thymine nucleobase in a DNA sequence is replaced with a uracil nucleobase in the corresponding RNA sequence. Thus, the A1CF pre-mRNA sequence corresponds to SEQ ID NO: 45, in which each thymine nucleobase is replaced with a uracil nucleobase. Thus, reference to SEQ ID NO: 45 herein can refer to the gene DNA sequence (including thymine) or the pre-mRNA RNA sequence (in which each thymine is replaced with uracil). The positions in the tables herein refer to the positions in the human A1CF gene / pre-mRNA (i.e., SEQ ID NO: 45). Reference to the A1CF gene sequence also encompasses reference to the A1CF pre-mRNA sequence corresponding to the A1CF gene sequence. Thus, the A1CF mRNA can be the mRNA sequence encoded by SEQ ID NO: 45.

[0055] Human A1CF pre-mRNA can be alternatively spliced ​​into any of 10 variant transcripts, eight of which contain an open reading frame that can be translated into protein. These spliced ​​mRNAs are sometimes referred to herein as "mature mRNAs." Thus, in some embodiments, the A1CF mRNA is human A1CF mature mRNA. The NCBI reference sequences of the human A1CF gene / pre-mRNA and eight protein-coding mature mRNA variants from the NCBI database (ncbi.nlm.nih.gov) are listed below in Table 1, along with their corresponding sequence numbers. [Table 1]

[0056] Thus, in some embodiments, the A1CF mRNA comprises a sequence selected from the group consisting of SEQ ID NOs: 45, 46, 47, 48, 49, 50, 51, 52, and 53. Thus, in some embodiments, the A1CF mRNA consists of a sequence selected from the group consisting of SEQ ID NOs: 45, 46, 47, 48, 49, 50, 51, 52, and 53. In some embodiments, the A1CF mRNA comprises SEQ ID NO: 45. In some embodiments, the A1CF mRNA consists of SEQ ID NO: 45.

[0057] SEQ ID NO: 45 is provided herein as a reference sequence, and it is understood that the target nucleic acid may be a variant of SEQ ID NO: 45, such as a naturally occurring variant, for example, an allelic variant containing one or more polymorphisms in the human A1CF sequence. The term "naturally occurring variant" refers to a variant of the A1CF gene or transcript that originates from the same locus as the A1CF mRNA but may differ due to, for example, the degeneracy of the genetic code, which causes multiple codons to encode the same amino acid, or alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants. Based on the presence of a sufficiently complementary sequence to the oligonucleotide, the oligonucleotide of the present invention can therefore target the A1CF mRNA and its naturally occurring variants.

[0058] Thus, in some embodiments, A1CF mRNA comprises or consists of a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% (i.e., total) sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 45, 46, 47, 48, 49, 50, 51, 52, and 53. In some embodiments, A1CF mRNA comprises or consists of a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% (i.e., total) sequence identity to a sequence according to SEQ ID NO: 45.

[0059] Binding to A1CF mRNA The contiguous nucleotide sequence of the antisense oligonucleotide of the present invention is capable of binding to a target sequence in the A1CF mRNA.

[0060] The terms "capable of binding," "bind," and "can bind" are interchangeable herein. The term "capable of binding" means that a contiguous nucleotide sequence can associate with a target sequence in the A1CF mRNA. This is achieved by complementary base pairing, as described herein. The contiguous nucleotide sequence need not bind to the entire target sequence. Similarly, the entire contiguous nucleotide sequence need not bind to the target sequence. It is sufficient that at least a portion of the contiguous nucleotide sequence can bind to at least a portion of the target sequence, thereby associating the antisense oligonucleotide with the A1CF mRNA. Thus, in some embodiments, at least a portion of the contiguous nucleotide sequence can bind to at least a portion of the target sequence.

[0061] Therefore, the contiguous nucleotide sequence mediates the binding of antisense oligonucleotide to A1CF mRNA.Therefore, in some embodiments, antisense oligonucleotide can bind to target sequence in A1CF mRNA.In some embodiments, antisense oligonucleotide conjugate can bind to target sequence in A1CF mRNA.

[0062] Target sequence The contiguous nucleotide sequence of the antisense oligonucleotide of the present invention is capable of binding to a target sequence in the A1CF mRNA.

[0063] The term "target sequence" refers to a contiguous nucleotide sequence or a region of the A1CF mRNA to which an antisense oligonucleotide binds. The term "target sequence" is interchangeable with the terms "target site," "target nucleic acid," "target site sequence," "target nucleic acid sequence," and "target site nucleic acid sequence."

[0064] The target sequences to which the contiguous nucleotide sequences or antisense oligonucleotides of the present invention can bind are located in six regions in the A1CF mRNA sequence. These regions are located at positions 2181-2199, 6951-6970, 16970-16989, 26358-26377, 38053-38071, and 78973-78990 of the A1CF gene / pre-mRNA sequence (SEQ ID NO: 45). In some embodiments, these regions are target sequences to which the contiguous nucleotide sequences or antisense oligonucleotides of the present invention can bind.

[0065] In some embodiments, the continuous nucleotide sequence of the antisense oligonucleotide of the present invention can bind to shorter target sequences within these regions.In particular, within the target sequence of 6951-6970, there are at least four target sequences: 6951-6968, 6952-6968, 6953-6969 and 6953-6970; within the target sequence of 16970-16988, there are at least two target sequences: 16970-16988 and 16972-16989; within the target sequence of 78973-78990, there are at least two target sequences: 78973-78989 and 78974-78990.All of these target sequences are shown in Table 2 below. [Table 2]

[0066] Thus, the target sequence for the antisense oligonucleotides of the present invention is a sequence of at least 17 consecutive nucleotides of any of the following sequences: GCCUAUCUGAGAAACUUUU (SEQ ID NO: 32) (positions 2181 to 2199 of SEQ ID NO: 45), GAGAAAAACCUAUAAUGCCU (SEQ ID NO: 42) (positions 6951 to 6970 of SEQ ID NO: 45), AAGUAAAAUUAACAUGUCCA (SEQ ID NO: 43) (positions 16970 to 16989 of SEQ ID NO: 45), AAACACCACAAUCUUAAAAC (SEQ ID NO: 39) (positions 26358 to 26377 of SEQ ID NO: 45), CAGGUAUAUAACAAGUUCA (SEQ ID NO: 34) (positions 38053 to 38071 of SEQ ID NO: 45), and AGACACACAAAACUCUAU (SEQ ID NO: 44) (positions 78973 to 78990 of SEQ ID NO: 45).

[0067] In some embodiments, the target sequence is a sequence of at least 18, 19, or 20 contiguous nucleotides of any of SEQ ID NO:32, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:39, SEQ ID NO:34, or SEQ ID NO:44. In some embodiments, the target sequence is a sequence of 17, 18, 19, or 20 contiguous nucleotides of any of SEQ ID NO:32, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:39, SEQ ID NO:34, or SEQ ID NO:44.

[0068] In some embodiments, the target sequence is the following sequence: GAAAAACCUAUAAUGCCU (SEQ ID NO: 31) (positions 6953 to 6970 of SEQ ID NO: 45), GCCUAUCUGAGAAACUUUU (SEQ ID NO: 32) (positions 2181 to 2199 of SEQ ID NO: 45), AAGUAAAAUUAACAUGUCC (SEQ ID NO: 33) (positions 16970 to 16988 of SEQ ID NO: 45), CAGGUAUAUAACAAGUUCA (SEQ ID NO: 34) (positions 38053 to 38071 of SEQ ID NO: 45), AGACACACAAAACUCUA (SEQ ID NO: 35) (positions 78973 to 78989 of SEQ ID NO: 45), AGAAAAACCUAUAAUGC (SEQ ID NO: 36) (positions 6952 to 6968 of SEQ ID NO: 45), GAAAAACCUAUAAUGCC (SEQ ID NO: 37) (positions 6953 to 6969 of SEQ ID NO: 45), GUAAAAUUAACAUGUCCA (SEQ ID NO: 38) (positions 16972 to 16989 of SEQ ID NO: 45), AAACACCACAAUCUUAAAAC (SEQ ID NO: 39) (positions 26358 to 26377 of SEQ ID NO: 45), GACACACAAAACUCUAU (SEQ ID NO: 40) (positions 78974 to 78990 of SEQ ID NO: 45), and GAGAAAAACCUAUAAUGC (SEQ ID NO: 41) (positions 6951 to 6968 of SEQ ID NO: 45).

[0069] In some embodiments, the target sequence is selected from SEQ ID NOs: 31, 32, 33, 34, 35, 36, 37, 38, 39, and 40. In some embodiments, the target sequence is selected from SEQ ID NOs: 31, 32, 33, 34, and 35.

[0070] In some embodiments, the target sequence is SEQ ID NO: 31. In some embodiments, the target sequence is SEQ ID NO: 32. In some embodiments, the target sequence is SEQ ID NO: 33. In some embodiments, the target sequence is SEQ ID NO: 34. In some embodiments, the target sequence is SEQ ID NO: 35. In some embodiments, the target sequence is SEQ ID NO: 36. In some embodiments, the target sequence is SEQ ID NO: 37. In some embodiments, the target sequence is SEQ ID NO: 38. In some embodiments, the target sequence is SEQ ID NO: 39. In some embodiments, the target sequence is SEQ ID NO: 40. In some embodiments, the target sequence is SEQ ID NO: 41.

[0071] Decreased A1CF expression The antisense oligonucleotides of the present invention can reduce A1CF expression.

[0072] The term "A1CF expression" refers to how much gene product is produced from the A1CF gene. In some embodiments, A1CF expression is the amount of A1CF mRNA produced from the A1CF gene (i.e., the amount of A1CF mRNA expressed). The amount of expressed A1CF mRNA can be determined by techniques known in the art, such as quantitative PCR or Northern blotting. In some embodiments, A1CF expression is the amount of A1CF protein produced from the A1CF gene (i.e., the amount of expressed A1CF protein). The amount of expressed A1CF protein can be determined by techniques known in the art, such as Western blotting.

[0073] As used herein, the term "reduced expression" refers to the overall ability of an oligonucleotide to inhibit the amount or activity of A1CF in target cells. Reduction in activity can be determined by measuring the level of A1CF pre-mRNA or A1CF mRNA. Thus, reduction in expression can be determined in vitro or in vivo.

[0074] The terms "reduce" or "reducing" may also be referred to as downregulating, inhibiting, suppressing, lessening, or lowering the expression of A1CF, such as A1CF pre-mRNA.

[0075] Reduction of expression can occur by degradation of pre-mRNA or mRNA (eg, using RNase H recruiting oligonucleotides, such as gapmers).

[0076] The effect of antisense oligonucleotide on A1CF expression can be evaluated by exposing cells to the antisense oligonucleotide of the present invention, for example, by transfecting cells with the antisense oligonucleotide of the present invention, and then determining the A1CF expression level.Therefore, in some embodiments, antisense oligonucleotide can reduce A1CF expression in cells.In some embodiments, antisense oligonucleotide can reduce A1CF expression in cells that express A1CF.In some embodiments, A1CF expression is the amount of A1CF mRNA expressed in cells.In some embodiments, A1CF expression is the amount of A1CF protein expressed in cells.

[0077] In some embodiments, the antisense oligonucleotides can reduce A1CF expression by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% (i.e., completely eliminate A1CF expression).

[0078] Those skilled in the art will recognize that quantifying any biological parameter requires comparison with a control.Typically, the reduction of expression is determined by comparing the reduction of activity caused by administering an effective amount of antisense oligonucleotide to target cells, and comparing this level with the reference level (control experiment) obtained from target cells that are not administered with antisense oligonucleotide, or with a known reference level (for example, the expression level before administering an effective amount of antisense oligonucleotide, or a predetermined or other known expression level).For example, the control experiment can be animals or humans, or target cells, that are treated with saline composition or reference oligonucleotide (often scrambled control).In some embodiments, the control is the cell that is not exposed to antisense oligonucleotide.

[0079] In some embodiments, the antisense oligonucleotides can reduce A1CF expression compared to a control, ie, reduce A1CF expression by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% compared to a control (i.e., completely eliminate A1CF expression).

[0080] Reduction of HBV nucleic acid The antisense oligonucleotides of the present invention are useful for treating or preventing HBV infection as described herein. Thus, in some embodiments, the cell is infected with HBV. In some embodiments, the cell is a hepatocyte.

[0081] HBV-infected cells may contain or be associated with various HBV nucleic acids (i.e., nucleic acids present in the cells due to HBV infection), including intracellular HBV DNA, secreted HBV DNA, pregenomic RNA (pgRNA), and covalently closed circular DNA (cccDNA).

[0082] The antisense oligonucleotides and antisense oligonucleotide conjugates of the present invention can reduce any or all of these types of HBV nucleic acids. In other words, treating HBV-infected cells with the antisense oligonucleotides or antisense oligonucleotide conjugates of the present invention can reduce any or all of these types of HBV nucleic acids.

[0083] The levels (and therefore the degree of reduction) of these types of HBV nucleic acids can be determined by techniques known in the art and described herein, such as quantitative PCR. It will be understood that the reduction of these types of HBV nucleic acids is determined relative to a control. In some embodiments, the control is cells that have not been exposed to the antisense oligonucleotide.

[0084] Reduction of HBV DNA Cells infected with HBV may contain intracellular HBV DNA, which is the HBV genome. The intracellular HBV DNA may be contained in live virus that can replicate within the cell, or in dead virus.

[0085] Cells infected with HBV can secrete HBV DNA into the environment. For cultured cells, the environment can be the culture medium. For in vivo cells, the environment can be the extracellular environment, such as serum. Secreted HBV DNA can be contained in live virus. Secreted HBV DNA can be contained in dead virus.

[0086] Thus, in some embodiments, the antisense oligonucleotides can reduce total intracellular HBV DNA in cells by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%.

[0087] In some embodiments, the antisense oligonucleotides can reduce total intracellular HBV DNA in cells compared to a control, ie, the antisense oligonucleotides can reduce total intracellular HBV DNA in cells by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% compared to a control.

[0088] In some embodiments, the antisense oligonucleotides can reduce the amount of HBV DNA secreted by cells, ie, by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%.

[0089] In some embodiments, the antisense oligonucleotides can reduce the amount of HBV DNA secreted by cells compared to a control, hi some embodiments, the antisense oligonucleotides can reduce the amount of HBV DNA secreted by cells by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% compared to a control.

[0090] Reduction of cccDNA Covalently closed circular DNA (cccDNA) is an episomal form of the HBV genome that is stably maintained in the nucleus. After HBV infects a cell, the circular DNA genome is imported into the nucleus and repaired to cccDNA by DNA polymerase. cccDNA serves as a template for all HBV transcripts. cccDNA is required for productive infection and is involved in viral persistence during the natural history of chronic HBV infection (Locarnini & Zoulim, 2010 Antivir Ther. 15 Suppl 3:3-14. doi:10.3851 / IMP1619). cccDNA acts as a viral reservoir and a source of viral rebound after treatment cessation, necessitating long-term, sometimes lifelong, treatment. Therefore, there is a strong need for novel therapies that can bring complete cure, defined by the degradation or elimination of HBV cccDNA, to the majority of CHB patients.

[0091] In some embodiments, the antisense oligonucleotides can reduce the amount of cccDNA in a cell. In some embodiments, the antisense oligonucleotides can reduce the amount of cccDNA in a cell by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%.

[0092] In some embodiments, the antisense oligonucleotides can reduce the amount of cccDNA in a cell compared to a control, hi some embodiments, the antisense oligonucleotides can reduce the amount of cccDNA in a cell by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% compared to a control.

[0093] Decrease in pgRNA Pregenomic RNA (pgRNA) is an RNA molecule transcribed from cccDNA that serves as a template for reverse transcription of HBV genomic DNA. Thus, pgRNA is a key intermediate in HBV replication.

[0094] In some embodiments, the antisense oligonucleotide can reduce the amount of pgRNA in a cell. In some embodiments, the antisense oligonucleotide can reduce the amount of pgRNA in a cell by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%.

[0095] In some embodiments, the antisense oligonucleotide can reduce the amount of pgRNA in a cell compared to a control. In some embodiments, the antisense oligonucleotide can reduce the amount of pgRNA in a cell by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% compared to a control.

[0096] RNase H activity and recruitment Ribonuclease H (RNase H) refers to a family of endonucleases that cleave the RNA component of an RNA / DNA duplex. Recruitment of RNase H to an RNA target sequence by an antisense oligonucleotide, followed by RNase H-mediated degradation of the RNA target, is thought to be one mechanism by which antisense oligonucleotides mediate inhibition of the RNA target.

[0097] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when duplexed with a complementary RNA molecule. WO 01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. Typically, an oligonucleotide is considered to be capable of recruiting RNase H if, when provided with a complementary target nucleic acid sequence, it has an initial rate measured in pmol / l / min that is at least 5%, e.g., at least 10%, at least 20%, or more than 20% of the initial rate determined using the methodology provided in Examples 91-95 of WO 01 / 23613 (incorporated herein by reference), using an oligonucleotide that has the same base sequence as the modified oligonucleotide being tested but contains only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide. Recombinant RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland, for use in determining RNase H activity.

[0098] DNA oligonucleotides are known to effectively recruit RNase H, as are gapmer oligonucleotides that contain regions of DNA nucleosides (typically at least 5 or 6 contiguous DNA nucleosides) flanked on the 5' and 3' sides by regions containing 2' sugar-modified nucleosides, typically high-affinity 2' sugar-modified nucleosides, such as 2'-O-MOE and / or LNA. In some embodiments, the antisense oligonucleotides of the invention are gapmers.

[0099] In order to effectively promote steric blocking, pre-mRNA degradation is undesirable, and therefore it is preferable to avoid RNase H degradation of target.Therefore, in some embodiments, the antisense oligonucleotide of the present invention is not an RNase H recruitment gapmer oligonucleotide.RNase H recruitment can be avoided by limiting the number of consecutive DNA nucleotides in oligonucleotide.Therefore, mixer and termer designs can be used.

[0100] In some embodiments, the antisense oligonucleotide is capable of recruiting RNase H. In some embodiments, the antisense oligonucleotide has RNase H activity. In other words, when the antisense oligonucleotide binds to (i.e., hybridizes with) at least a portion of the target sequence on the A1CF mRNA, RNAse H is recruited, resulting in cleavage of the A1CF mRNA by RNase H, thereby resulting in a decrease in A1CF expression.

[0101] Nuclease-mediated degradation refers to an oligonucleotide that, when duplexed with a complementary nucleotide sequence, is capable of mediating the degradation of such sequence.

[0102] In some embodiments, oligonucleotides may function through nuclease-mediated degradation of target nucleic acids, and the oligonucleotides of the invention are capable of recruiting nucleases, particularly endonucleases, preferably endoribonucleases (RNases), such as RNase H. Examples of oligonucleotide designs that act via a nuclease-mediated mechanism are oligonucleotides that typically include a region of at least five or six consecutive DNA nucleosides, flanked on one or both sides by affinity-enhancing nucleosides, e.g., gapmers.

[0103] Complementarity In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide of the present invention is complementary to a target sequence in the A1CF mRNA. In some embodiments, the antisense oligonucleotide of the present invention is complementary to a target sequence in the A1CF mRNA.

[0104] The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are cytosine-guanine (CG) and adenine-thymine / uracil (AT / U).

[0105] It is understood that oligonucleotides may contain nucleosides with modified nucleobases. For example, 5-methylcytosine (E) may be used instead of cytosine, and 7-deaza-8-azaguanine (F) may be used instead of guanine. Thus, the term "complementarity" encompasses Watson-Crick base pairing between unmodified and modified nucleobases (see, e.g., Hirao et al., 2012, Accounts of Chemical Research, 45, 2055 and Bergstrom, 2009, Curr. Protoc. Nucleic Acid Chem., 37, 1.4.1). In particular, Watson-Crick base pairing encompasses EG, CF, and EF base pairs.

[0106] The term "% complementary," as used herein, refers to the proportion (in percent) of nucleotides of a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that are complementary to a reference sequence (e.g., a target sequence) across the contiguous nucleotide sequence. Thus, the percentage of complementarity is calculated by counting the number of aligned nucleobases that are complementary (i.e., form Watson-Crick base pairs) between two sequences (when aligned with the contiguous nucleotide sequence from 5'-3' and 3'-5' of the target sequence), dividing that number by the total number of nucleotides in the contiguous nucleotide sequence, and multiplying by 100. In such a comparison, nucleobases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not allowed in calculating the percent complementarity of a contiguous nucleotide sequence. It will be understood that in determining complementarity, chemical modifications of a nucleobase are disregarded so long as the nucleobase retains the functional ability to form Watson-Crick base pairs (e.g., 5'-methylcytosine is considered to be identical to cytosine, and 7-deaza-8-azaguanine is considered to be identical to guanine for purposes of calculating % complementarity).

[0107] The term "complementary" (such as in the phrase "a contiguous nucleotide sequence is complementary to a target sequence") does not require 100% complementarity. Rather, in the present invention, the term "complementary" requires that the contiguous nucleotide sequence is at least 75% complementary, at least 80% complementary, at least 85% complementary, at least 90% complementary, at least 95% complementary, or 100% complementary to the target sequence (e.g., a target sequence selected from SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, and SEQ ID NO:41). In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence is at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target sequence.

[0108] The term "fully complementary" refers to 100% complementarity. In some embodiments, a contiguous nucleotide sequence is perfectly complementary to a target sequence.

[0109] In some embodiments, a contiguous nucleotide sequence within an antisense oligonucleotide of the invention may contain one, two, three or more mismatches, where a mismatch is a nucleotide within the contiguous nucleotide sequence that does not base pair with its target.

[0110] In some embodiments, the contiguous nucleotide sequence is complementary to a target sequence selected from the group consisting of SEQ ID NOs: 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 and 41.

[0111] In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 31. In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 32. In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 33. In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 35. In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 36. In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 37. In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 38. In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 39. In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 40. In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 41.

[0112] In some embodiments, the contiguous nucleotide sequence is complementary to a target sequence within the sequence of SEQ ID NO: 32 (positions 2181-2199 of the A1CF gene / pre-mRNA shown in SEQ ID NO: 45). In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 32. In some embodiments, the contiguous nucleotide sequence is at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 32. In some embodiments, the contiguous nucleotide sequence is 100% complementary to SEQ ID NO: 32.

[0113] In some embodiments, the contiguous nucleotide sequence is complementary to a target sequence within the sequence of SEQ ID NO: 42 (positions 6951-6970 of the A1CF gene / pre-mRNA set forth in SEQ ID NO: 45). In some embodiments, the contiguous nucleotide sequence is complementary to a target sequence selected from the group consisting of SEQ ID NOs: 31, 36, 37, and 41. In some embodiments, the contiguous nucleotide sequence is at least 90%, at least 95%, or 100% complementary to a target sequence selected from the group consisting of SEQ ID NOs: 31, 36, 37, and 41. In some embodiments, the contiguous nucleotide sequence is 100% complementary to a target sequence selected from the group consisting of SEQ ID NOs: 31, 36, 37, and 41.

[0114] In some embodiments, the contiguous nucleotide sequence is complementary to a target sequence within the sequence of SEQ ID NO:43 (positions 16970-16989 of the A1CF gene / pre-mRNA shown in SEQ ID NO:45). In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO:33 or SEQ ID NO:38. In some embodiments, the contiguous nucleotide sequence is at least 90%, at least 95%, or 100% complementary to SEQ ID NO:33 or SEQ ID NO:38. In some embodiments, the contiguous nucleotide sequence is 100% complementary to SEQ ID NO:33 or SEQ ID NO:38.

[0115] In some embodiments, the contiguous nucleotide sequence is complementary to a target sequence within the sequence of SEQ ID NO:39 (positions 26358-26377 of the A1CF gene / pre-mRNA shown in SEQ ID NO:45). In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO:39. In some embodiments, the contiguous nucleotide sequence is at least 90%, at least 95%, or 100% complementary to SEQ ID NO:39. In some embodiments, the contiguous nucleotide sequence is 100% complementary to SEQ ID NO:39.

[0116] In some embodiments, the contiguous nucleotide sequence is complementary to a target sequence within the sequence of SEQ ID NO: 34 (positions 38053-38071 of the A1CF gene / pre-mRNA shown in SEQ ID NO: 45). In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO: 34. In some embodiments, the contiguous nucleotide sequence is at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 34. In some embodiments, the contiguous nucleotide sequence is 100% complementary to SEQ ID NO: 34.

[0117] In some embodiments, the contiguous nucleotide sequence is complementary to a target sequence within the sequence of SEQ ID NO:44 (positions 78973-78990 of the A1CF gene / pre-mRNA set forth in SEQ ID NO:45). In some embodiments, the contiguous nucleotide sequence is complementary to SEQ ID NO:35 or SEQ ID NO:40. In some embodiments, the contiguous nucleotide sequence is at least 90%, at least 95%, or 100% complementary to SEQ ID NO:35 or SEQ ID NO:40. In some embodiments, the contiguous nucleotide sequence is 100% complementary to SEQ ID NO:35 or SEQ ID NO:40.

[0118] Hybridization As used herein, the term "hybridize" or "hybridizing" should be understood as two nucleic acid strands (e.g., a continuous nucleotide sequence and a target sequence) forming hydrogen bonds between base pairs on opposing strands, thereby forming a duplex. The affinity of the binding between the two nucleic acid strands is the strength of hybridization. This is often measured by the melting temperature (T), which is defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. m ) in physiological conditions, T m is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔG° more accurately represents binding affinity, ΔG° = -RTln(K d) to calculate the dissociation constant (K d ), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between an oligonucleotide and a target nucleic acid reflects the strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction in an aqueous solution with a concentration of 1M, a pH of 7, and a temperature of 37°C. The hybridization of an oligonucleotide to a target nucleic acid is a spontaneous reaction, and the ΔG° in the case of a spontaneous reaction is less than zero. ΔG° can be experimentally measured, for example, by using isothermal titration calorimetry (ITC) as described, for example, in Hansen et al., 1965, Chem.Comm.36-38 and Holdgate et al., 2005, Drug Discovery Today. Those skilled in the art will know that commercially available devices are available for measuring ΔG°. ΔG° can be estimated numerically using the nearest neighbor model described in SantaLucia, 1998, Proc Natl Acad Sci USA. 95:1460-1465, using appropriately derived thermodynamic parameters described in Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405.

[0119] In some embodiments, the antisense oligonucleotides of the invention hybridize to a target nucleic acid with an estimated ΔG° value of less than −10 kcal for oligonucleotides 12 to 30 nucleotides in length.

[0120] In some embodiments, the degree or strength of hybridization is measured by the Gibbs free energy ΔG° under standard conditions. An oligonucleotide may hybridize to a target nucleic acid with an estimated ΔG° value in the range of less than -10 kcal for an oligonucleotide 8 to 30 nucleotides in length, e.g., less than -15 kcal, e.g., less than -20 kcal, and e.g., less than -25 kcal. In some embodiments, an oligonucleotide hybridizes to a target nucleic acid with an estimated ΔG° value of -10 to -60 kcal, e.g., -12 to -40 kcal, e.g., -15 to -30 kcal, or -16 to -27 kcal, e.g., -18 to -25 kcal.

[0121] array As used herein, the term "sequence" refers to the order of nucleobases in a nucleic acid, such as an antisense oligonucleotide or a consecutive nucleotide sequence. When used to refer to a consecutive nucleotide sequence, antisense oligonucleotide, or antisense oligonucleotide conjugate of the present invention, the term "sequence" does not limit the type of sugar moiety of the nucleic acid, nor does it limit the type of internucleoside linkage of the nucleic acid. Thus, a given sequence of a consecutive nucleotide sequence, antisense oligonucleotide, or antisense oligonucleotide conjugate may contain any type of nucleoside sugar moiety (e.g., RNA, DNA, LNA, 2'-O-methyl-RNA, MOE-RNA, as described herein) in any combination, and may contain any type of internucleoside linkage (e.g., phosphodiester, phosphorothioate, phosphorodithioate, as described herein).

[0122] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of the following sequences: AGGCATTATAGGTTTTTE (SEQ ID NO: 1), AAAAGTTTCTCAGATAGGE (SEQ ID NO: 2), GGACATGTTAATTTTACTT (SEQ ID NO: 3), TGAACTTGTTATATACETG (SEQ ID NO: 4), TAGAGTTTTGTGTGTET (SEQ ID NO: 5), GEATTATAGGTTTTTET (SEQ ID NO: 6), GGCATTATAGGTTTTTE (SEQ ID NO: 7), GGEATTATAGGTTTTTE (SEQ ID NO: 8), TGGACAUGTTAATTTTAE (SEQ ID NO: 9), GGACATGUTAATTTTACTT (SEQ ID NO: 10), GTTTTAAGATTGTGGTGTTT (SEQ ID NO: 11), TAGAGTTTUGTGTGTET (SEQ ID NO: 12), TAGAGTTTTGTGUGTET (SEQ ID NO: 13), ATAGAFTTTTGTGTGTE (SEQ ID NO: 14), AAAAFTTTCTCAGATAGGE (SEQ ID NO: 15), AAAAGTTTCTCAFATAGGE (SEQ ID NO: 16), AAAAGTTUCTCAGATAGGE (SEQ ID NO: 17), AGGCATTATAGGUTTTTE (SEQ ID NO: 18), AGGCAUTATAGGTTTTTE (SEQ ID NO: 19), GEATTATAGGTTTTTCTE (SEQ ID NO: 20), GEATTATAGGTTTTUCTE (SEQ ID NO: 21), GEATTATAGGTTTUTCTE (SEQ ID NO: 22), GEATTATAGGTTUTTCTE (SEQ ID NO: 23), GEATTATAGGTTUTTET (SEQ ID NO: 24), GEATTATAGGTUTTTET (SEQ ID NO: 25), GEATTATAGGUTTTTCTE (SEQ ID NO: 26), GEATTATAGGUTTTTET (SEQ ID NO: 27), GEATTAUAGGTTTTTET (SEQ ID NO: 28), GEATUATAGGTTTTTET (SEQ ID NO: 29) and GEAUTATAGGTTTTTET (SEQ ID NO: 30).

[0123] In some embodiments, the sequence of the antisense oligonucleotide comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30. In some embodiments, the sequence of the antisense oligonucleotide consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30. In some embodiments, the sequence of the contiguous nucleotide sequence comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30. In some embodiments, the sequence of the contiguous nucleotide sequence consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30.

[0124] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 90%, at least 95% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30. In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30.

[0125] In some embodiments, the sequence of the antisense oligonucleotide comprises a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30. In some embodiments, the sequence of the antisense oligonucleotide consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30. In some embodiments, the sequence of the contiguous nucleotide sequence comprises a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30.In some embodiments, the sequence of the contiguous nucleotide sequence consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity with any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30.

[0126] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 and 14.

[0127] In some embodiments, the sequence of the antisense oligonucleotide comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14. In some embodiments, the sequence of the antisense oligonucleotide consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14. In some embodiments, the sequence of the contiguous nucleotide sequence comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14. In some embodiments, the sequence of the contiguous nucleotide sequence consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14.

[0128] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 and 14. In some embodiments, the sequence of the antisense oligonucleotide comprises a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14. In some embodiments, the sequence of the antisense oligonucleotide consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14. In some embodiments, the sequence of the contiguous nucleotide sequence comprises a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 and 14.In some embodiments, the sequence of the contiguous nucleotide sequence consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 and 14.

[0129] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, and 5.

[0130] In some embodiments, the sequence of the antisense oligonucleotide comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, and 5. In some embodiments, the sequence of the antisense oligonucleotide consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, and 5. In some embodiments, the sequence of the contiguous nucleotide sequence comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, and 5. In some embodiments, the sequence of the contiguous nucleotide sequence consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 2, 3, 4, and 5.

[0131] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, and 5. In some embodiments, the sequence of the antisense oligonucleotide comprises a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, and 5. In some embodiments, the sequence of the antisense oligonucleotide consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, and 5. In some embodiments, the sequence of the contiguous nucleotide sequence comprises a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, and 5.In some embodiments, the sequence of the contiguous nucleotide sequence consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 2, 3, 4, and 5.

[0132] identity As used herein, the term "identity" refers to the proportion of nucleotides (expressed as a percentage) of a contiguous nucleotide sequence within a nucleic acid molecule (e.g., an oligonucleotide) that are identical to a reference sequence (e.g., a target sequence) over the contiguous nucleotide sequence.

[0133] Thus, the percentage of identity is calculated by counting the number of aligned nucleobases that are identical (matched) between two sequences (in a contiguous nucleotide sequence and in a reference sequence), dividing that number by the total number of nucleotides in the contiguous nucleotide sequence, and multiplying by 100. Thus, percentage identity = (number of matches × 100) / length of the aligned region (e.g., contiguous nucleotide sequence). Insertions and deletions are not allowed in calculating the percentage identity of a contiguous nucleotide sequence. It will be understood that chemical modifications of nucleobases are disregarded when determining identity, so long as the nucleobase retains its functional ability to form Watson-Crick base pairs (e.g., 5-methylcytosine is considered identical to cytosine, and 7-deaza-8-azaguanine is considered identical to guanine for purposes of calculating percent identity).

[0134] sugar modification In some embodiments, the antisense oligonucleotides of the present invention comprise one or more sugar-modified nucleosides. In other words, the antisense oligonucleotides of the present invention can comprise one or more nucleosides having a modified sugar moiety, i.e., a modification of the sugar moiety compared to the ribose sugar moiety found in DNA and RNA.

[0135] Numerous nucleosides with modifications in the ribose sugar moiety have been created primarily for the purpose of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0136] Such modifications include those in which the ribose ring structure has been modified, for example, by replacing it with a hexose ring (HNA), or a bicyclic ring, typically having a biradical bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring, typically lacking a bond between the C2 and C3 carbons (e.g., UNA). Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO 2011 / 017521) or tricyclic nucleic acids (WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety has been replaced with a non-sugar moiety, for example, in the case of peptide nucleic acids (PNAs) or morpholino nucleic acids.

[0137] Sugar modifications also include modifications made by changing the substituent on the ribose ring to a group other than hydrogen or to the 2'-OH group naturally occurring in DNA and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' position.

[0138] In some embodiments, the sugar-modified nucleosides are independently selected from the group consisting of 2'-O-methyl-RNA, 2'-O-methoxyethyl-RNA (MOE-RNA), and LNA nucleosides.

[0139] In some embodiments, each nucleotide in an antisense oligonucleotide of the invention that does not contain a sugar-modified nucleoside comprises a DNA nucleoside.

[0140] 2' sugar-modified nucleosides A 2' sugar modified nucleoside is a nucleoside having a substituent other than H or -OH at the 2' position (2' substituted nucleoside), or a nucleoside containing a 2' linked biradical that can form a bridge between the 2' carbon and a second carbon of the ribose ring, such as an LNA (2'-4' biradical bridge) nucleoside.

[0141] In fact, much attention has been paid to the development of 2' sugar-substituted nucleosides, and many 2'-substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars can confer improved binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2'-substituted modified nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA (2'OMe), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development 2000, 3(2), 203-213 and Deleavy and Damha, Chemistry and Biology 2012, 19, 937. Below are examples of some 2'-substituted modified nucleosides. [ka] [ka]

[0142] In some embodiments, the antisense oligonucleotides comprise one or more 2' sugar-modified nucleosides.

[0143] In some embodiments, the antisense oligonucleotides of the invention comprise one or more 2'-O-methyl-RNA nucleosides.

[0144] In some embodiments, the antisense oligonucleotides of the invention comprise one or more 2'-O-methoxyethyl-RNA (MOE-RNA) nucleosides.

[0145] Locked nucleic acid nucleosides (LNA nucleosides) In some embodiments, the antisense oligonucleotide comprises one or more LNA nucleosides.

[0146] An "LNA nucleoside" is a 2'-modified nucleoside containing a biradical (also referred to as a "2'-4' bridge") linking C2' and C4' of the ribose sugar ring of the nucleoside, restricting or locking the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs). Locking the conformation of the ribose is associated with improved hybridization affinity (duplex stabilization) when LNAs are incorporated into oligonucleotides of complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0147] Non-limiting exemplary LNA nucleosides include those described in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al. al., Bioorganic & Med. Chem. Lett., 12, 73-76; Seth et al., J. Org. Chem., 2010, Vol 75(5) pp. 1569-81; Mitsuoka et al., Nucleic Acids Research, 2009, 37(4), 1225-1238; and Wan and Seth, J. Medical Chemistry, 2016, 59, 9645-9667.

[0148] Further non-limiting exemplary LNA nucleosides are disclosed in Scheme 1. Scheme 1: [ka] [ka] [ka]

[0149] Particular LNA nucleosides are beta-D-oxy-LNA, 6'-methyl-beta-D-oxyLNA, such as (S)-6'-methyl-beta-D-oxy-LNA (ScET) and ENA.

[0150] In some embodiments, the antisense oligonucleotide comprises one or more LNA beta-D-oxy-LNA nucleosides.

[0151] Modified internucleoside linkages In some embodiments, the antisense oligonucleotides of the invention may contain one or more modified internucleoside linkages.

[0152] The term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) bond that covalently joins two nucleosides to one another as commonly understood by those skilled in the art.

[0153] In some embodiments, all internucleoside linkages in the antisense oligonucleotide are modified internucleoside linkages.

[0154] In some embodiments, each modified internucleoside bond is independently selected from the group consisting of phosphorothioate internucleoside bond and phosphorodithioate internucleoside bond.Phosphorothioate internucleoside bond and phosphorodithioate internucleoside bond are useful because they can make antisense oligonucleotide more resistant to nuclease degradation.In phosphorothioate internucleoside bond, compared with naturally occurring phosphodiester internucleoside bond, one of the oxygen atoms of the phosphate group that is not bonded to the carbon of nucleoside sugar moiety is replaced with sulfur atom.In phosphorodithioate internucleoside bond, two oxygen atoms of the phosphate group that is not bonded to the carbon of nucleoside sugar moiety are each replaced with sulfur atom. Thus, where a phosphodiester bond can be represented by the formula -OP(O)2-O-, a phosphorothioate internucleoside linkage can be represented by the formula -OP(O,S)-O-, and a phosphorodithioate internucleoside linkage can be represented by the formula -OP(S)2-O-.

[0155] Areas D' and D" The antisense oligonucleotides of the invention, in some embodiments, can comprise or consist of a contiguous nucleotide sequence of the oligonucleotide that is complementary to a target nucleic acid, as well as additional 5' and / or 3' nucleosides. The additional 5' and / or 3' nucleosides can be complementary, e.g., fully complementary, to the target nucleic acid, or can be complementary, e.g., not fully complementary. Such additional 5' and / or 3' nucleosides can be referred to herein as regions D' and D".

[0156] The addition of region D' or D" can be used for the purpose of linking a contiguous nucleotide sequence, such as a mixmer or totalmer, to a conjugate moiety or another functional group. When used to link a conjugate moiety to a conjugate moiety, the addition of region D' or D" can serve as a biocleavable linker. Alternatively, the addition of region D' or D" can be used to provide exonuclease protection or to facilitate synthesis or manufacturing.

[0157] Region D' or D" can independently comprise or consist of 1, 2, 3, 4, or 5 additional nucleotides, which may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides such as DNA or RNA, or base-modified versions thereof. The D' or D" region can serve as a nuclease-sensitive, biocleavable linker (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are joined by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D" are disclosed in WO 2014 / 076195, which include, by way of example, phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in polyoligonucleotide constructs is disclosed in WO 2015 / 113922, where they are used to join multiple antisense constructs within a single oligonucleotide.

[0158] In one embodiment, the antisense oligonucleotide of the invention comprises, in addition to the contiguous nucleotide sequence, regions D' and / or D".

[0159] In some embodiments, the internucleoside linkage located between region D' or D" and the contiguous nucleotide sequence is a phosphodiester bond.

[0160] compound The term "compound" is used herein to refer to the combination of sequence (i.e., the order of nucleobases), sugar moieties and internucleoside linkages in a given nucleic acid, such as the antisense oligonucleotide of the present invention.For a given compound, the type of nucleobase, sugar moiety and internucleoside linkage of each nucleotide are specified.Therefore, the order of sugar moieties and internucleoside linkages is also specified in a given compound.However, unless otherwise indicated, a compound can contain other elements in addition to a specific sequence, sugar moiety and internucleoside linkage.

[0161] In some embodiments, the term "antisense oligonucleotide" is interchangeable with the term "compound." In other words, in some embodiments, an antisense oligonucleotide of the invention is a compound of the invention, and vice versa.

[0162] Particular compounds are referred to herein using compound identification numbers (Compound Numbers) of the form X_Y, where X and Y are each numbers. For each Compound Number, X is the number of the SEQ ID NO: corresponding to the compound's sequence. For example, a compound designated Compound Number 2_1 has the same nucleobase sequence as SEQ ID NO:2.

[0163] In some embodiments, the antisense oligonucleotide is selected from the group consisting of Compound Nos. 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, 5_2, 6_1, 7_1, 7_2, 8_1, 2_2, 9_1, 10_1, 11_1, 4_3, 12_1, 5_3, 13_1, 14_1, 15_1, 16_1, 16_2, 16_3, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, Includes any one of 2_12, 17_1, 18_1, 19_1, 20_1, 20_2, 20_3, 20_4, 20_5, 20_6, 6_2, 6_3, 6_4, 6_5, 6_6, 6_7, 6_8, 6_9, 6_10, 6_11, 6_12, 21_1, 22_1, 23_1, 24_1, 25_1, 25_2, 26_1, 27_1, 27_2, 28_1, 29_1, 30_1, 11_2 and 11_3. In some embodiments, the antisense oligonucleotide is selected from the group consisting of Compound Nos. 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, 5_2, 6_1, 7_1, 7_2, 8_1, 2_2, 9_1, 10_1, 11_1, 4_3, 12_1, 5_3, 13_1, 14_1, 15_1, 16_1, 16_2, 16_3, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, Consists of any one of 2_12, 17_1, 18_1, 19_1, 20_1, 20_2, 20_3, 20_4, 20_5, 20_6, 6_2, 6_3, 6_4, 6_5, 6_6, 6_7, 6_8, 6_9, 6_10, 6_11, 6_12, 21_1, 22_1, 23_1, 24_1, 25_1, 25_2, 26_1, 27_1, 27_2, 28_1, 29_1, 30_1, 11_2 and 11_3.

[0164] In some embodiments, the antisense oligonucleotide comprises any one of compound numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, 5_2, 6_1, 7_1, 7_2, 8_1, 2_2, 9_1, 10_1, 11_1, 4_3, 12_1, 5_3, 13_1, and 14_1. In some embodiments, the antisense oligonucleotide consists of any one of compound numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, 5_2, 6_1, 7_1, 7_2, 8_1, 2_2, 9_1, 10_1, 11_1, 4_3, 12_1, 5_3, 13_1, and 14_1.

[0165] In some embodiments, the antisense oligonucleotide comprises or consists of any one of compound numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, and 5_2. In some embodiments, the antisense oligonucleotide comprises any one of compound numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, and 5_2. In some embodiments, the antisense oligonucleotide consists of any one of compound numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, and 5_2.

[0166] The present invention also provides an antisense oligonucleotide comprising or consisting of a compound selected from: (a)[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO. 1, compound number 1_1), (b)[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_1), (c)[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(SEQ ID NO: 3, Compound No. 3_1), (d)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G)(SEQ ID NO: 4, Compound No. 4_1), (e)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(SEQ ID NO: 4, Compound No. 4_2), (f)[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(SEQ ID NO: 5, Compound No. 5_1), (g)[LR](T)[PS2].[LR](A)[sP].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(SEQ ID NO: 5, Compound No. 5_2), (h)[LR](G)[sP].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[sP].[LR](T)(SEQ ID NO: 6, Compound No. 6_1), (i) [MOE](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[MOE](T)[sP].[MOE](T)[sP].[MOE]([5meC]) (SEQ ID NO: 7, Compound No. 7_1), (j) [LR](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO: 7, Compound No. 7_2), (k) [MOE](G)[sP].[MOE](G)[sP].[MOE]([5meC])[sP].[LR](A)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2].[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC]) (SEQ ID NO: 8, Compound No. 8_1), (l) [LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_2), (m)[LR](T)[PS2].[LR](G)[sP].[dR](G)[sP].[LR](A)[sP].[dR](C)[sP].[dR](A)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](A)[PS2].[LR]([5meC])(SEQ ID NO: 9, Compound No. 9_1), (n)[LR](G)[PS2].[LR](G)[PS2].[dR](A)[sP].[dR](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[mR](U)[sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(SEQ ID NO: 10, Compound No. 10_1), (o)[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T)(SEQ ID NO: 11, Compound No. 11_1), (p)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(SEQ ID NO:4, Compound No. 4_3), (q)[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(SEQ ID NO:12, Compound No. 12_1), (r)[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T)(SEQ ID NO:5, Compound No. 5_3), (s)[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T)(SEQ ID NO:13, Compound No. 13_1), (t)[LR](A)[PS2].[LR](T)[sP].[LR](A)[sP].[LR](G)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 14, Compound No. 14_1), (u)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 15, Compound No. 15_1), (v)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 16, Compound No. 16_1), (w)[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 16, Compound No. 16_2), (x)[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 16, Compound No. 16_3), (y)[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_3), (z)[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO:2, Compound No. 2_4), (aa)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO:2, Compound No. 2_5), (ab)[LR](A)[PS2].[MOE](A)[sP].[MOE](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO:2, Compound No. 2_6), (ac)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_7), (ad)[MOE](A)[sP].[MOE](A)[sP].[LR](A)[PS2].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 2, Compound No. 2_8), (ae)[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[sP].[MOE]([5meC])(SEQ ID NO: 2, Compound No. 2_9), (af)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_10), (ag)[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 2, Compound No. 2_11), (ah)[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 2, Compound No. 2_12), (ai)[MOE](A)[sP].[MOE](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 17, Compound No. 17_1), (aj)[LR](A)[PS2].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 18, Compound No. 18_1), (ak)[LR](A)[PS2].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[mR](U)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 19, Compound No. 19_1), (al)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 20, Compound No. 20_1), (am)[LR](G)[PS2].[LR]([5meC])[sP].[mR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 20, Compound No. 20_2), (an)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 20, Compound No. 20_3), (ao)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5 - methylcytosine])(SEQ ID NO: 20, Compound No. 20_4), (ap)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[MOE]([5 - methylcytosine])(SEQ ID NO: 20, Compound No. 20_5), (aq)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[mR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5 - methylcytosine])(SEQ ID NO: 20, Compound No. 20_6), (ar)[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_2), (as)[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_3), (at)[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_4), (au)[LR](G)[PS2].[LR]([5meC])[sP].[mR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_5), (av)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_6), (aw)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_7), (ax)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[mR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_8), (ay)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[MOE](T)(SEQ ID NO: 6, Compound No. 6_9), (az)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 6, Compound No. 6_10), (ba)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])[PS2].[MOE](T) (SEQ ID NO: 6, Compound No. 6_11), (bb)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 6, Compound No. 6_12), (bc)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 21, Compound No. 21_1), (bd)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 22, Compound No. 22_1), (be)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 23, Compound No. 23_1), (bf)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 24, Compound No. 24_1), (bg)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5 - methylcytosine])[PS2].[LR](T)(SEQ ID NO: 25, Compound No. 25_1), (bh)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5 - methylcytosine])[PS2].[LR](T)(SEQ ID NO: 25, Compound No. 25_2), (bi)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5 - methylcytosine])(SEQ ID NO: 26, Compound No. 26_1), (bj)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5 - methylcytosine])[PS2].[LR](T)(SEQ ID NO: 27, Compound No. 27_1), (bk)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 27, Compound No. 27_2), (bl)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[mR](U)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 28, Compound No. 28_1), (bm)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[mR](U)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 29, Compound No. 29_1), (bn)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[mR](U)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 30, Compound No. 30_1), (bo)[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[ dR](A)[sP].[dR](A)[sP].[mR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T )[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP] .[dR](G)[sP].[LR](T)[sP].[LR](T)[sP].[LR](T) (SEQ ID NO: 11, compound NO: 11_2), and (bp)[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP]. [dR](A)[sP].[dR](A)[sP].[mR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP ].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, compound NO: 11_3), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides).

[0167] The present invention also provides an antisense oligonucleotide comprising or consisting of a compound selected from: (a)[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO. 1, compound number 1_1), (b)[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[ dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR ](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, compound NO: 2_1), (c)[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(SEQ ID NO: 3, Compound No. 3_1), (d)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G)(SEQ ID NO: 4, Compound No. 4_1), (e)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(SEQ ID NO: 4, Compound No. 4_2), (f)[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(SEQ ID NO: 5, Compound No. 5_1), (g)[LR](T)[PS2].[LR](A)[sP].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(SEQ ID NO: 5, Compound No. 5_2), (h)[LR](G)[sP].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[sP].[LR](T)(SEQ ID NO: 6, Compound No. 6_1), (i)[MOE](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[MOE](T)[sP].[MOE](T)[sP].[MOE]([5meC])(SEQ ID NO: 7, Compound No. 7_1), (j)[LR](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])(SEQ ID NO: 7, Compound No. 7_2), (k)[MOE](G)[sP].[MOE](G)[sP].[MOE]([5meC])[sP].[LR](A)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2].[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC])(SEQ ID NO: 8, Compound No. 8_1), (l)[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_2), (m)[LR](T)[PS2].[LR](G)[sP].[dR](G)[sP].[LR](A)[sP].[dR](C)[sP].[dR](A)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](A)[PS2].[LR]([5meC])(SEQ ID NO: 9, Compound No. 9_1), (n)[LR](G)[PS2].[LR](G)[PS2].[dR](A)[sP].[dR](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[mR](U)[sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(SEQ ID NO: 10, Compound No. 10_1), (o)[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T)(SEQ ID NO: 11, Compound No. 11_1), (p)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(SEQ ID NO: 4, Compound No. 4_3), (q)[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(SEQ ID NO: 12, Compound No. 12_1), (r)[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T)(SEQ ID NO: 5, Compound No. 5_3), (s)[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T)(SEQ ID NO: 13, Compound No. 13_1), and (t)[LR](A)[PS2].[LR](T)[sP].[LR](A)[sP].[LR](G)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 14, Compound No. 14_1), (wherein, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides).

[0168] The present invention also provides an antisense oligonucleotide comprising or consisting of a compound selected from: (a)[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO. 1, compound number 1_1), (b)[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_1), (c)[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(SEQ ID NO: 3, Compound No. 3_1), (d)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G)(SEQ ID NO: 4, Compound No. 4_1), (e)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR](A)[sP].[dR](C)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[ dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR ](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(SEQ ID NO: 4, compound NO: 4_2), (f)[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[d R] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [MOE] ([5meC]) [sP]. (g)[LR](T)[PS2].[LR](A)[sP].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[ dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, compound NO: 5_2), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides).

[0169] The present invention also provides antisense oligonucleotides selected from the antisense oligonucleotides represented by the HELM string in Table 4 herein.

[0170] Conjugates The present invention provides an antisense oligonucleotide conjugate comprising an antisense oligonucleotide of the present invention covalently linked to at least one conjugate moiety, or in other words, an antisense oligonucleotide covalently linked to at least one conjugate moiety.

[0171] The term "antisense oligonucleotide conjugate" is used herein interchangeably with the terms "conjugate" and "conjugate of the present invention." The term "conjugate moiety" refers to a non-nucleotide moiety that can be covalently linked to the antisense oligonucleotide of the present invention. Thus, as used herein, the term "conjugate" refers to the antisense oligonucleotide of the present invention that is covalently linked to a non-nucleotide moiety (conjugate moiety).

[0172] Oligonucleotide conjugates and their synthesis are also reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103.

[0173] In some embodiments, at least one conjugate moiety is covalently attached to the 5' end of the antisense oligonucleotide.

[0174] Conjugate moiety In some embodiments, the conjugate moiety (i.e., the non-nucleotide moiety) is selected from the group consisting of a carbohydrate (e.g., GalNAc), a cell surface receptor ligand, a drug substance, a hormone, a lipophile, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0175] In some embodiments, the conjugate moiety can bind to an asialoglycoprotein receptor, such as the human asialoglycoprotein receptor (ASGPR). For example, the conjugate moiety may comprise at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine.

[0176] In some embodiments, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc). In some embodiments, the conjugate moiety is an N-acetylgalactosamine (GalNAc) conjugate moiety. Thus, the antisense oligonucleotide of the present invention can be conjugated to at least one conjugate moiety that comprises at least one N-acetylgalactosamine (GalNAc) moiety, for example, at least one conjugate moiety that comprises at least one N-acetylgalactosamine (GalNAc) moiety described below.

[0177] In some embodiments, the conjugate moiety is at least divalent, for example, divalent, trivalent or tetravalent GalNAc.In a preferred embodiment, the conjugate moiety is trivalent GalNAc.Trivalent N-acetylgalactosamine conjugate moiety is suitable for binding to ASGPR, for example, see WO2014 / 076196, WO2014 / 207232 and WO2014 / 179620.Such conjugate moiety is useful for enhancing the uptake of oligonucleotide into the liver.As used herein, the term "trivalent GalNAc" refers to a residue that comprises three N-acetylgalactosamine moieties, that is, preferably three moieties of the following formula: [ka]

[0178] In some embodiments, the GalNAc conjugate moiety is an aminohexyl-conjugated tri(N-acetyl-galactosamine), as shown below and in FIG. [ka]

[0179] The trivalent N-acetylgalactosamine (GalNAc) in Figure 8 (and shown above) is also referred to herein as "5gn2c6."

[0180] "Aminohexyl-conjugated tri(N-acetyl-galactosamine)" is sometimes referred to as "-hexylene-NH-tri(N-acetyl-galactosamine)."

[0181] In some embodiments, the conjugate moiety is covalently attached to the antisense oligonucleotide via a phosphodiester bond. In some embodiments, the conjugate moiety is covalently attached to the linker via a phosphodiester bond. In some embodiments, a GalNAc conjugate moiety such as that shown in Figure 8 is covalently attached to the antisense oligonucleotide via a phosphodiester bond. In some embodiments, a GalNAc conjugate moiety such as that shown in Figure 8 is covalently attached to the linker via a phosphodiester bond.

[0182] Linker In some embodiments of the antisense oligonucleotide conjugate of the present invention, the conjugate moiety is covalently linked to the antisense oligonucleotide via a linker. Thus, in some embodiments, the conjugate comprises a linker. In some embodiments, the conjugate comprises a linker located between the antisense oligonucleotide and the conjugate moiety.

[0183] In some embodiments of the antisense oligonucleotide conjugates of the invention, the conjugate moiety is covalently attached to the antisense oligonucleotide via a linker nucleoside sequence. The linker nucleoside sequence may be referred to herein as region D' or region D".

[0184] In some embodiments, the linker nucleoside sequence comprises or consists of 1 to 10 linked nucleosides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides, e.g., 2 to 6 linked nucleosides, e.g., 2 to 5 linked nucleosides, e.g., 2 to 4 linked nucleosides. In some embodiments, the linker nucleoside sequence is 2 nucleosides in length. In some embodiments, the linker comprises two linked nucleosides. In some embodiments, the linker consists of two linked nucleosides.

[0185] In some embodiments, the linker nucleoside sequence comprises DNA nucleosides. In some embodiments, the linker nucleoside sequence consists of DNA nucleosides. In other words, in some embodiments, all nucleosides in the linker nucleoside sequence are DNA nucleosides.

[0186] In some embodiments, the nucleosides of the linker nucleoside sequence are linked via phosphodiester internucleoside linkages. In some embodiments, the linker is linked to the antisense oligonucleotide via a phosphodiester internucleoside linkage. In some embodiments, the linker is linked to the conjugate moiety via a phosphodiester linkage.

[0187] As used herein, the terms "phosphodiester internucleoside linkage" and "phosphodiester bond" refer to the same chemical structure known in the art, in which a first chemical entity is linked to a second chemical entity via an intermediate phosphate group. The term "phosphodiester internucleoside linkage" is particularly used when the linked first and second chemical entities are nucleosides, such as the nucleosides of the antisense oligonucleotides of the present invention. As known in the art, phosphodiester internucleoside linkages are naturally occurring internucleosides in naturally occurring nucleic acids, such as genomic DNA. The term "phosphodiester bond" is used, particularly in the context of the present invention, to refer to the covalent attachment of a conjugate moiety to a linker, such as the antisense oligonucleotide or nucleoside linker sequence of the present invention, because the conjugate moiety is not a nucleoside, and therefore the term "phosphodiester internucleoside linkage" is not appropriate. A phosphodiester internucleoside linkage / phosphodiester bond can be represented by the following structure: [ka] or in protonated form, [ka] A first chemical entity and a second chemical entity are attached at positions 1 and 2, respectively.

[0188] In some embodiments, the conjugate moiety is attached at position 1 and the antisense oligonucleotide of the invention is attached at position 2. In some embodiments, the conjugate moiety is attached at position 1 and the linker is attached at position 2. In some embodiments, the linker is attached at position 1 and the antisense oligonucleotide of the invention is attached at position 2.

[0189] In some embodiments, the physiologically labile linker comprises or consists of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein there is a phosphodiester bond between the two DNA nucleosides and at least one additional phosphodiester is present at the 5' or 3' end of the dinucleotide that links the oligonucleotide of the nucleic acid molecule to the dinucleotide or that links the conjugate moiety to the dinucleotide. For example, the linker can be a CA dinucleotide. In some embodiments, the physiologically labile linker comprises or consists of the sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, or GGG, wherein there are phosphodiester bonds between the DNA nucleosides and, potentially, an additional phosphodiester bond at the 5' or 3' end of the trinucleotide. Biocleavable linkers comprising phosphodiesters are described in more detail in WO 2014 / 076195 (incorporated herein by reference). In conjugate compounds having biocleavable linkers, when compared to a standard, at least about 50% of the conjugated moieties are cleaved from the oligonucleotide, for example, at least about 60% are cleaved, for example, at least about 70% are cleaved, for example, at least about 80% are cleaved, for example, at least about 85% are cleaved, for example, at least about 90% are cleaved, for example, at least about 95% of the conjugated moieties are cleaved from the oligonucleotide.

[0190] In some embodiments, the linker nucleoside sequence is CA. In other words, in some embodiments, the sequence of the linker nucleoside sequence is CA. In some embodiments, the linker nucleotide sequence is 5'-CA-3'. In some embodiments, the linker nucleoside sequence is the dinucleotide CA, where the C nucleoside is linked to the conjugate moiety by a phosphodiester bond, the C nucleoside is linked to the A nucleoside by a phosphodiester internucleoside bond, and the A nucleoside is linked to the 5' nucleoside of the antisense oligonucleotide of the present invention by a phosphodiester internucleoside bond.

[0191] In some embodiments, the linker is a biocleavable linker. A biocleavable linker comprises or consists of a physiologically labile bond that is cleavable under conditions normally encountered or similar to those encountered in a mammalian body. Conditions under which a physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidizing or reducing conditions or oxidizing or reducing agents, and salt concentrations similar to those found or encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activities normally present in mammalian cells, such as proteolytic or hydrolytic enzymes or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In some embodiments, the nuclease-sensitive linker comprises one to five nucleosides, such as DNA nucleosides containing at least two consecutive phosphodiester bonds. Phosphodiester-containing biocleavable linkers are described in more detail in WO 2014 / 076195.

[0192] Exemplary Conjugates of the Invention The term "conjugate" can be used herein to refer to the combination of sequence (i.e., the order of nucleobase), sugar moiety, internucleoside bond and conjugate moiety in a given antisense oligonucleotide conjugate of the present invention.For a given conjugate, the nucleobase, sugar moiety type and internucleoside bond of each nucleotide in the antisense oligonucleotide of the conjugate are specified.Therefore, the order of sugar moiety and internucleoside bond is also specified in a given conjugate.However, unless otherwise indicated, a conjugate can include other elements in addition to specific sequence, sugar moiety, internucleoside bond and conjugate moiety.

[0193] Specific conjugates are referred to herein using conjugate identification numbers (conjugate numbers) of the form X_Y, where X and Y are each numbers. For each conjugate number, X is the number of the sequence number corresponding to the sequence of the antisense oligonucleotide component of the conjugate. For example, a conjugate designated as conjugate number 2_1 has the same nucleobase sequence as sequence number 2 (and the same nucleobase sequence as compound number 2_1).

[0194] In some embodiments, the antisense oligonucleotide conjugates of the invention are selected from the group consisting of conjugate numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, 5_2, 6_1, 7_1, 7_2, 8_1, 2_2, 9_1, 10_1, 11_1, 4_3, 12_1, 5_3, 13_1, 14_1, 15_1, 16_1, 16_2, 16_3, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, 2_12, 2_13, 2_14, 2_15, 2_16, 2_17, 2_18, 2_19, 2_20, 2_21, 2_22, 2_23, 2_24, 2_25, 2_26, 2_27, 2_28, 2_29, 2_30, 2_31, 2_32, 2_33, 2_34, 2_35, 2_36, 2_37, 2_38, 2_39, 2_40, 2_41, 2_42, 2_43, 2_44, 2_45, 2_46, 2_47, 2_48, 2_49, 2_50, 2_51, 2_52, 2_53, 2_54, 2_55, 2_56, 2_57, 2_58, 2_59, 2_60, 2_61, 2_62, 2 Includes any one of 10, 2_11, 2_12, 17_1, 18_1, 19_1, 20_1, 20_2, 20_3, 20_4, 20_5, 20_6, 6_2, 6_3, 6_4, 6_5, 6_6, 6_7, 6_8, 6_9, 6_10, 6_11, 6_12, 21_1, 22_1, 23_1, 24_1, 25_1, 25_2, 26_1, 27_1, 27_2, 28_1, 29_1, 30_1, 11_2 and 11_3. In some embodiments, the antisense oligonucleotide conjugates of the invention are selected from the group consisting of conjugate numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, 5_2, 6_1, 7_1, 7_2, 8_1, 2_2, 9_1, 10_1, 11_1, 4_3, 12_1, 5_3, 13_1, 14_1, 15_1, 16_1, 16_2, 16_3, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_1 It consists of any one of 0, 2_11, 2_12, 17_1, 18_1, 19_1, 20_1, 20_2, 20_3, 20_4, 20_5, 20_6, 6_2, 6_3, 6_4, 6_5, 6_6, 6_7, 6_8, 6_9, 6_10, 6_11, 6_12, 21_1, 22_1, 23_1, 24_1, 25_1, 25_2, 26_1, 27_1, 27_2, 28_1, 29_1, 30_1, 11_2 and 11_3.

[0195] In some embodiments, the antisense oligonucleotide conjugates of the present invention comprise any one of conjugate numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, 5_2, 6_1, 7_1, 7_2, 8_1, 2_2, 9_1, 10_1, 11_1, 4_3, 12_1, 5_3, 13_1, and 14_1. In some embodiments, the antisense oligonucleotide conjugates of the present invention consist of any one of conjugate numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, 5_2, 6_1, 7_1, 7_2, 8_1, 2_2, 9_1, 10_1, 11_1, 4_3, 12_1, 5_3, 13_1, and 14_1.

[0196] In some embodiments, the antisense oligonucleotide conjugate of the present invention comprises or consists of any one of conjugate numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, and 5_2. In some embodiments, the antisense oligonucleotide conjugate of the present invention comprises any one of conjugate numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, and 5_2. In some embodiments, the antisense oligonucleotide conjugate of the present invention consists of any one of conjugate numbers 1_1, 2_1, 3_1, 4_1, 4_2, 5_1, and 5_2.

[0197] The present invention provides an antisense oligonucleotide conjugate selected from: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[d R](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP] .[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO: 1, Compound No. 1_1, Conjugate No. 1_1), (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(Opportunity 2; (c)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR] (C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP]. ](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP]. R](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(Open-Offset 3; (d)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR]( A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T )[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C) [sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G)(free solvent 4; (e)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR] (A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C )[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(Allocation number 4, compound number 4_2, コンジュゲート number 4_2), (f)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP ].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP]. [dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(Allocation number 5, compound number 5_1, コンジュゲート number 5_1), (g)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[sP].[dR](G)[sP] .[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T )[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[ dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(Allocation number 5, compound number 5_2, コンジュゲート number 5_2), (h)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[LR](T)[sP].[LR]([5meC])[sP].[LR](T)(Allocation number 6, compound number 6_1, コンジュゲート number 6_1), (i)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR](G)[sP].[dR](C)[sP] .[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ MOE](T)[sP].[MOE](T)[sP].[MOE]([5meC])(Allocation number 7, compound number 7_1, コンジュゲート number 7_1), (j)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])(Layout No. 7, Compound No. 7_2, Conjugate No. 7_2), (k)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[MOE](G)[sP].[MOE]([5meC] )[sP].[LR](A)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR ](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2] .[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC])(Allocation number 8, compound number 8_1, コンジュゲート number 8_1), (l)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC])(Allocation number 2, compound number 2_2, コンジュゲート number 2_2), (m)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[dR](G)[sP].[ LR](A)[sP].[dR](C)[sP].[dR](A)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP] .[LR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[s P].[dR](T)[sP].[LR](A)[PS2].[LR]([5meC])(Allocation number 9, compound number 9_1, コンジュゲート number 9_1), (n)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR](G)[PS2].[dR](A)[sP].[dR ](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[mR](U)[sP].[dR](T)[sP].[mR] (A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR] (A)[sP]..[dR](C)[sP].[LR](T)[PS2].[LR](T) (o)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[ sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP] .[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP]. R](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T)(R](G)[sP].[LR](T)[sP]. (p)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR] (A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C )[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(free radical 4; (q)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP] .[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U) [sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 12, Compound No. 12_1, Conjugate No. 12_1), (r)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP ].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR] (T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T) (SEQ ID NO: 5, Compound No. 5_3, Conjugate No. 5_3), (s)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP ].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T) (SEQ ID NO: 13, Compound No. 13_1, Conjugate No. 13_1), (t)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](T)[sP].[LR](A)[sP]. [LR](G)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP] dR](G)[sP].[LR](T)[PS2].[LR]([5meC])(free radical 14; (u)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A )[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(free radical 15; (v)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A )[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[s P].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(free radical complex 16; (w)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 16, Compound No. 16_2, Conjugate No. 16_2), (x)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 16, Compound No. 16_3, Conjugate No. 16_3), (y)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_3, Conjugate No. 2_3), (z)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(free radical 2; (aa)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR] (A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(free radical 2; (ab)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[MOE](A)[sP].[MOE](A)[sP].[dR ](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC])(free solvent 2; (ac)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO:2, Compound No. 2_7, Conjugate No. 2_7), (ad)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[MOE](A)[sP].[LR](A)[PS2].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO:2, Compound No. 2_8, Conjugate No. 2_8), (ae)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[sP].[MOE]([5meC])(SEQ ID NO:2, Compound No. 2_9, Conjugate No. 2_9), (af)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR] (A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T )[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(free radical 2; (ag)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR] (A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T )[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[ sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(Free-layer 2; (ah)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR] (A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T )[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[ sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(open-base 2; (ai)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[MOE](A)[sP].[LR](A)[sP].[dR] (A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](C)[sP].[dR](T )[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[ sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(Allocation number 17, compound number 17_1, コンジュゲート number 17_1), (aj)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](G)[sP].[dR](G)[sP].[ dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP]. [dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP] .[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 18, compound number 18_1, コンジュゲート number 18_1), (ak)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](G)[sP].[dR](G)[sP].[ dR](C)[sP].[LR](A)[sP].[mR](U)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP]. [dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP] .[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 19, compound number 19_1, コンジュゲート number 19_1), (al)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 20, compound number 20_1, コンジュゲート number 20_1), (am)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[mR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 20, compound number 20_2, コンジュゲート number 20_2), (an)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 20, compound number 20_3, コンジュゲート number 20_3), (ao)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 20, compound number 20_4, コンジュゲート number 20_4), (ap)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[MOE]([5meC])(Allocation number 20, compound number 20_5, コンジュゲート number 20_5), (aq)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[mR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 20, compound number 20_6, コンジュゲート number 20_6), (ar)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[d R](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_2, コンジュゲート number 6_2), (as)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[d R](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_3, コンジュゲート number 6_3), (at)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[m R](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_4, コンジュゲート number 6_4), (au)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[mR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[d R](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_5, コンジュゲート number 6_5), (av)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[d R](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_6, コンジュゲート number 6_6), (aw)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[m R](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_7, コンジュゲート number 6_7), (ax)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[d R](G)[sP].[mR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_8, コンジュゲート number 6_8), (ay)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR]([5meC])[PS2].[dR]( A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[d R](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP] .[LR](T)[sP].[LR]([5meC])[PS2].[MOE](T)(Allocation number 6, compound number 6_9, コンジュゲート number 6_9), (az)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[PS2].[MOE]([5meC])[sP].[MOE](T)(Allocation number 6, compound number 6_10, コンジュゲート number 6_10), (ba)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[PS2].[LR]([5meC])[PS2].[MOE](T)(Allocation number 6, compound number 6_11, コンジュゲート number 6_11), (bb)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2].[ LR](T)[PS2].[MOE]([5meC])[sP].[MOE](T)(Allocation number 6, compound number 6_12, コンジュゲート number 6_12), (bc)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 21, compound number 21_1, コンジュゲート number 21_1), (bd)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 22, compound number 22_1, コンジュゲート number 22_1), (be)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 23, compound number 23_1, コンジュゲート number 23_1), (bf)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[LR](T)[sP].[ LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 24, compound number 24_1, コンジュゲート number 24_1), (bg)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[LR](T)[sP].[ dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 25, compound number 25_1, コンジュゲート number 25_1), (bh)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 25, compound number 25_2, コンジュゲート number 25_2), (bi)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[mR](U)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 26, compound number 26_1, コンジュゲート number 26_1), (bj)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 27, compound number 27_1, コンジュゲート number 27_1), (bk)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 27, compound number 27_2, コンジュゲート number 27_2), (bl)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[mR](U)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 28, compound number 28_1, コンジュゲート number 28_1), (bm)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[mR](U)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 29, compound number 29_1, コンジュゲート number 29_1), (bn)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[mR](U)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 30, compound number 30_1, コンジュゲート number 30_1), (bo)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T) [sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[mR](G)[sP].[dR](A)[sP].[dR](T)[sP] .[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR ](G)[sP].[LR](T)[sP].[LR](T)[sP].[LR](T)(Allocation number 11, compound number 11_2, コンジュゲート number 11_2), および (bp)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T) [sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[mR](G)[sP].[dR](A)[sP].[dR](T)[sP ].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, Compound No. 11_3, Conjugate No. 11_3), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides; P represents a phosphodiester internucleoside linkage between the preceding and succeeding nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in Figure 8).

[0198] The present invention also provides an antisense oligonucleotide conjugate selected from: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[d R](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP] .[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO: 1, Compound No. 1_1, Conjugate No. 1_1), (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_1, Conjugate No. 2_1), (c)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR] (C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP]. ](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP]. R](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(Open-Offset 3; (d)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR]( A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T )[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C) [sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G)(free solvent 4; (e)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR] (A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C )[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(Opportunity 4; (f)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP ].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP]. [dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(Allocation number 5, compound number 5_1, コンジュゲート number 5_1), (g)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[sP].[dR](G)[sP] .[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T )[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[ dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(Allocation number 5, compound number 5_2, コンジュゲート number 5_2), (h)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[LR](T)[sP].[LR]([5meC])[sP].[LR](T)(Allocation number 6, compound number 6_1, コンジュゲート number 6_1), (i)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR](G)[sP].[dR](C)[sP] .[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ MOE](T)[sP].[MOE](T)[sP].[MOE]([5meC])(Allocation number 7, compound number 7_1, コンジュゲート number 7_1), (j)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])(Layout No. 7, Compound No. 7_2, Conjugate No. 7_2), (k)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[MOE](G)[sP].[MOE]([5meC] )[sP].[LR](A)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR ](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2] .[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC])(Allocation number 8, compound number 8_1, コンジュゲート number 8_1), (l)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC])(Allocation number 2, compound number 2_2, コンジュゲート number 2_2), (m)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[dR](G)[sP].[ LR](A)[sP].[dR](C)[sP].[dR](A)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP] .[LR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[s P].[dR](T)[sP].[LR](A)[PS2].[LR]([5meC])(Allocation number 9, compound number 9_1, コンジュゲート number 9_1), (n)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR](G)[PS2].[dR](A)[sP].[dR ](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[mR](U)[sP].[dR](T)[sP].[mR] (A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR] (A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(Allocation number 10, compound number 10_1, コンジュゲート number 10_1), (o)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[ sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP] .[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[d R](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T)(Allocation number 11, compound number 11_1, コンジュゲート number 11_1), (p)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR] (A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C )[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(Allocation number 4, compound number 4_3, コンジュゲート number 4_3), (q)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP ].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR]( U)[sP].[dR](G)[sP].[dR](T)[sP].[dR][sP].[dR](T)[sP].[dR](G)[sP].[dR ](T)[sP].[MOE]([5meC])[sP].[MOE](T)(Allocation number 12, compound number 12_1, コンジュゲート number 12_1), (r)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP ].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR] (T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T) (SEQ ID NO: 5, Compound No. 5_3, Conjugate No. 5_3), (s)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP] .[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T) [sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T) (SEQ ID NO: 13, Compound No. 13_1, Conjugate No. 13_1), and (t)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](T)[sP].[LR](A)[sP].[LR](G)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP]. [dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP]. [dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 14, Compound No. 14_1, Conjugate No. 14_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides; P represents a phosphodiester internucleoside linkage between the preceding nucleoside or moiety and the succeeding nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in Figure 8).

[0199] The present invention also provides an antisense oligonucleotide conjugate selected from: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[d R](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP] [dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[ sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])(free radical 1; (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(Opportunity 2; (c)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR] (C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP]. ](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP]. R](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(Open-Offset 3; (d)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR]( A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T )[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C) [sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G)(Allocation number 4, compound number 4_1, コンジュゲート number 4_1), (e)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR] (A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C )[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(Allocation number 4, compound number 4_2, コンジュゲート number 4_2), (f)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[PS2].[dR](G)[s P].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR ](T)[sP].[dR](G)[sP].[dR](T)[sP].[sP].[dR](T)[sP].[dR](G)[sP].[dR] (T)[sP].[MOE]([5meC])[sP].[MOE](T)(Allocation number 5, compound number 5_1, コンジュゲート number 5_1), および (g)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[sP].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR ](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, Compound No. 5_2, Conjugate No. 5_2), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides; P represents a phosphodiester internucleoside linkage between the preceding nucleoside or moiety and the succeeding nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in Figure 8).

[0200] The present invention also provides an antisense oligonucleotide conjugate selected from the antisense oligonucleotide conjugates represented by the HELM string in Table 5 herein.

[0201] The present invention also provides an antisense oligonucleotide conjugate selected from the group consisting of: (a) Conjugate number 1_1 shown in Figure 1 ; (b) Conjugate number 2_1 shown in Figure 2 ; (c) Conjugate number 3_1 shown in Figure 3 ; (d) Conjugate number 4_1 shown in Figure 4 ; (e) Conjugate number 4_2 shown in Figure 5 ; (f) Conjugate number 5_1 shown in Figure 6 ; (g) Conjugate No. 5_2 shown in Figure 7 .

[0202] Target A1CF 2181~2199 The antisense oligonucleotides or antisense oligonucleotide conjugates of the invention can bind to a target sequence within the region defined by positions 2181-2199 of the A1CF pre-mRNA (SEQ ID NO: 45).

[0203] Accordingly, the present invention provides an antisense oligonucleotide of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of 12 to 30 nucleotides in length, wherein the contiguous nucleotide sequence is capable of binding to a target sequence in A1CF mRNA, and the target sequence is A sequence of at least 17 consecutive nucleotides within GCCUAUCUGAGAAACUUUU (SEQ ID NO: 32) (positions 2181 to 2199 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0204] The present invention also provides an antisense oligonucleotide conjugate comprising an antisense oligonucleotide covalently attached to at least one conjugate moiety, wherein the antisense oligonucleotide is an antisense oligonucleotide of 12-30 nucleotides in length comprising a contiguous nucleotide sequence of 12-30 nucleotides in length, the contiguous nucleotide sequence being capable of binding to a target sequence in A1CF mRNA, the target sequence being A sequence of at least 17 consecutive nucleotides within GCCUAUCUGAGAAACUUUU (SEQ ID NO: 32) (positions 2181 to 2199 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0205] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is a sequence of 17, 18, 19, or 20 consecutive nucleotides within SEQ ID NO:32.

[0206] In some embodiments, the target sequence is SEQ ID NO:32.

[0207] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of the following sequences: AAAAGTTTCTCAGATAGGE (SEQ ID NO: 2), AAAAFTTTCTCAGATAGGE (SEQ ID NO: 15), AAAAGTTTCTCAFATAGGE (SEQ ID NO: 16), and AAAAGTTUCTCAGATAGGE (SEQ ID NO: 17).

[0208] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 2, 15, 16 or 17.

[0209] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to SEQ ID NO:2.

[0210] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:2.

[0211] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence consists of SEQ ID NO: 2. In some embodiments, the sequence of the contiguous nucleotide sequence consists of SEQ ID NO: 2. In some embodiments, the sequence of the antisense oligonucleotide consists of SEQ ID NO: 2.

[0212] In some embodiments, the antisense oligonucleotide comprises or consists of any one of compound numbers 2_1, 2_2, 15_1, 16_1, 16_2, 16_3, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, 2_12, and 17_1.

[0213] In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 2_1, 2_2, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, and 2_12.

[0214] In some embodiments, the antisense oligonucleotide comprises or consists of Compound No. 2_1 or Compound No. 2_2.

[0215] In some embodiments, the antisense oligonucleotide comprises or consists of Compound No. 2_1.

[0216] The present invention provides antisense oligonucleotides comprising or consisting of a compound selected from: (a)[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[ dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR ](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, compound NO: 2_1), (b)[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR](A)[sP].[LR](G)[s P].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP]. [dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR ](A)[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, compound NO: 2_2), (c)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 16, Compound No. 15_1), (d)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 17, Compound No. 16_1), (e)[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 17, Compound No. 16_2), (f)[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 17, Compound No. 16_3), (g)[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_3), (h)[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_4), (i) [LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_5), (j) [LR](A)[PS2].[MOE](A)[sP].[MOE](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 2, Compound No. 2_6), (k) [LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_7), (l)[MOE](A)[sP].[MOE](A)[sP].[LR](A)[PS2].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID No. 2, Compound No. 2_8), (m)[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[sP].[MOE]([5meC])(SEQ ID No. 2, Compound No. 2_9), (n)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID No. 2, Compound No. 2_10), (o)[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP] .[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T)[sP].[d R](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR]( A) [sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO. 2, compound number 2_11), (p)[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP] .[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR ](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A) [sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 2, compound NO: 2_12), and (q)[MOE](A)[sP].[MOE](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](C)[sP].[dR] (T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 18, Compound No. 17_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides).

[0217] In some embodiments, the antisense oligonucleotide comprises or consists of a compound selected from the following: (a)[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP] .[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[d R](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR]( A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, compound NO: 2_1), and (b)[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR](A)[sP].[LR](G)[s P].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP]. [dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR ](A)[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound NO: 2_2).

[0218] In some embodiments, the antisense oligonucleotide comprises or consists of the following compound: [LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP]. [dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[d R](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, compound NO: 2_1).

[0219] In some embodiments, the antisense oligonucleotide comprises the following compound: [LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP]. [dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[d R](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, compound NO: 2_1).

[0220] In some embodiments, the antisense oligonucleotide consists of the following compound: [LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP]. [dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[d R](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, compound NO: 2_1).

[0221] In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of conjugate numbers 2_1, 2_2, 15_1, 16_1, 16_2, 16_3, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, 2_12 and 17_1.

[0222] In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of conjugate numbers 2_1, 2_2, 2_3, 2_4, 2_5, 2_6, 2_7, 2_8, 2_9, 2_10, 2_11, and 2_12.

[0223] In some embodiments, the antisense oligonucleotide conjugate comprises or consists of conjugate No. 2_1 or conjugate No. 2_2.

[0224] In some embodiments, the antisense oligonucleotide conjugate comprises or consists of conjugate No. 2_1.

[0225] The present invention provides an antisense oligonucleotide conjugate selected from: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(Opportunity 2; (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A ). (c)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A )[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(free radical 15; (d)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 16, Compound No. 16_1, Conjugate No. 16_1), (e)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 16, Compound No. 16_2, Conjugate No. 16_2), (f)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 16, Compound No. 16_3, Conjugate No. 16_3), (g)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC])(free radical 2; (h)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(Opportunity 2; (i)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR] (A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(free radical 2; (j)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[MOE](A)[sP].[MOE](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO:2, Compound No. 2_6, Conjugate No. 2_6), (k)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO:2, Compound No. 2_7, Conjugate No. 2_7), (l)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[MOE](A)[sP].[LR](A)[PS2].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO:2, Compound No. 2_8, Conjugate No. 2_8), (m)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR] (A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[LR](G)[sP].[LR](G)[sP].[MOE]([5meC])(Open core 2; (n)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR]( A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T )[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(free radical 2; (o)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR]( A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T) [sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[ sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(Free-layer 2; (p)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR]( A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[ sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 2, Compound No. 2_12, Conjugate No. 2_12), and (q)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[MOE](A)[sP].[LR](A)[sP].[dR]( A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](C)[sP].[dR](T) [sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 17, Compound No. 17_1, Conjugate No. 17_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides; P represents a phosphodiester internucleoside linkage between the preceding nucleoside or moiety and the succeeding nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in Figure 8).

[0226] In some embodiments, the antisense oligonucleotide conjugate is selected from the following: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR]( A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T) [sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_1, Conjugate No. 2_1), and (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR] (A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR]( T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_2, Conjugate No. 2_2).

[0227] In some embodiments, the antisense oligonucleotide conjugate is: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A) [sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T) [sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_1, Conjugate No. 2_1).

[0228] The present invention provides an antisense oligonucleotide conjugate, conjugate number 2_1, shown in FIG.

[0229] Targeting A1CF 6951-6970 The antisense oligonucleotides or antisense oligonucleotide conjugates of the invention can bind to a target sequence within the region defined by positions 6951 to 6970 of the A1CF pre-mRNA (SEQ ID NO: 45).

[0230] Accordingly, the present invention provides an antisense oligonucleotide of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of 12 to 30 nucleotides in length, wherein the contiguous nucleotide sequence is capable of binding to a target sequence in A1CF mRNA, and the target sequence is A sequence of at least 17 consecutive nucleotides within GAGAAAAACCUAUAAUGCCU (SEQ ID NO: 42) (positions 6951 to 6970 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0231] The present invention also provides an antisense oligonucleotide conjugate comprising an antisense oligonucleotide covalently attached to at least one conjugate moiety, wherein the antisense oligonucleotide is an antisense oligonucleotide of 12-30 nucleotides in length comprising a contiguous nucleotide sequence of 12-30 nucleotides in length, the contiguous nucleotide sequence being capable of binding to a target sequence in A1CF mRNA, the target sequence being A sequence of at least 17 consecutive nucleotides within GAGAAAAACCUAUAAUGCCU (SEQ ID NO: 42) (positions 6951 to 6970 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0232] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is a sequence of 17, 18, 19, or 20 consecutive nucleotides within SEQ ID NO:42.

[0233] In some embodiments, the target sequence is the following sequence: GAAAAACCUAUAAUGCCU (SEQ ID NO: 31) (positions 6953 to 6970 of SEQ ID NO: 45), AGAAAAACCUAUAAUGC (SEQ ID NO: 36) (positions 6952 to 6968 of SEQ ID NO: 45), GAAAAACCUAUAAUGCC (SEQ ID NO: 37) (positions 6953 to 6969 of SEQ ID NO: 45), and GAGAAAAACCUAUAAUGC (SEQ ID NO: 41) (positions 6951 to 6968 of SEQ ID NO: 45).

[0234] In some embodiments, the target sequence is selected from SEQ ID NOs: 31, 36, and 37.

[0235] In some embodiments, the target sequence is SEQ ID NO:31.

[0236] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of the following sequences: AGGCATTATAGGTTTTTE (SEQ ID NO: 1), GEATTATAGGTTTTTET (SEQ ID NO: 6), GGCATTATAGGTTTTTE (SEQ ID NO: 7), GGEATTATAGGTTTTTE (SEQ ID NO: 8), AGGCATTATAGGUTTTTE (SEQ ID NO: 18), AGGCAUTATAGGTTTTTE (SEQ ID NO: 19), GEATTATAGGTTTTTCTE (SEQ ID NO: 20), GEATTATAGGTTTTUCTE (SEQ ID NO: 21), GEATTATAGGTTTUTCTE (SEQ ID NO: 22), GEATTATAGGTTUTTCTE (SEQ ID NO: 23), GEATTATAGGTTUTTET (SEQ ID NO: 24), GEATTATAGGTUTTTET (SEQ ID NO: 25), GEATTATAGGUTTTTCTE (SEQ ID NO: 26), GEATTATAGGUTTTTET (SEQ ID NO: 27), GEATTAUAGGTTTTTET (SEQ ID NO: 28), GEATUATAGGTTTTTET (SEQ ID NO: 29) and GEAUTATAGGTTTTTET (SEQ ID NO: 30).

[0237] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 6, 7, 8, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30.

[0238] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of SEQ ID NOs: 1, 6, 7, or 8.

[0239] In some embodiments, the sequence of the antisense oligonucleotide and / or contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 1, 6, 7 or 8.

[0240] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to SEQ ID NO:1.

[0241] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:1.

[0242] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence consists of SEQ ID NO: 1. In some embodiments, the sequence of the contiguous nucleotide sequence consists of SEQ ID NO: 1. In some embodiments, the sequence of the antisense oligonucleotide consists of SEQ ID NO: 1.

[0243] In some embodiments, the antisense oligonucleotide comprises or consists of any one of compound numbers 1_1, 6_1, 7_1, 7_2, 8_1, 18_1, 19_1, 20_1, 20_2, 20_3, 20_4, 20_5, 20_6, 6_2, 6_3, 6_4, 6_5, 6_6, 6_7, 6_8, 6_9, 6_10, 6_11, 6_12, 21_1, 22_1, 23_1, 24_1, 25_1, 25_2, 26_1, 27_1, 27_2, 28_1, 29_1, and 30_1.

[0244] In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 1_1, 6_1, 7_1, 7_2, and 8_1.

[0245] In some embodiments, the antisense oligonucleotide comprises Compound No. 1_1. In some embodiments, the antisense oligonucleotide consists of Compound No. 1_1.

[0246] The present invention provides antisense oligonucleotides comprising or consisting of a compound selected from: (a)[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO. 1, compound number 1_1), (b)[LR](G)[sP].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP . (c)[MOE](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[d R](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[MOE](T)[sP].[MOE](T)[sP].[MOE]([5meC]) (SEQ ID NO. 7, compound number 7_1), (d)[LR](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])(SEQ ID NO: 7, Compound No. 7_2), (e)[MOE](G)[sP].[MOE](G)[sP].[MOE]([5meC])[sP].[LR](A)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2].[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC])(SEQ ID NO: 8, Compound No. 8_1), (f)[MOE](A)[sP].[MOE](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 17, Compound No. 17_1), (g)[LR](A)[PS2].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 18, Compound No. 18_1), (h)[LR](A)[PS2].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[mR](U)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 19, Compound No. 19_1), (i)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 20, Compound No. 20_1), (j)[LR](G)[PS2].[LR]([5meC])[sP].[mR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 20, Compound No. 20_2), (k)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 20, Compound No. 20_3), (l)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 20, Compound No. 20_4), (m)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[MOE]([5meC]) (SEQ ID NO: 20, Compound No. 20_5), (aq)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[mR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 20, Compound No. 20_6), (n)[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_2), (o)[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_3), (p)[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_4), (q)[LR](G)[PS2].[LR]([5meC])[sP].[mR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_5), (r)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_6), (s)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_7), (t)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[mR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_8), (u)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[MOE](T)(SEQ ID NO: 6, Compound No. 6_9), (v)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[MOE]([5meC])[sP].[MOE](T)(SEQ ID NO: 6, Compound No. 6_10), (w)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])[PS2].[MOE](T)(SEQ ID NO: 6, Compound No. 6_11), (x)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC])[sP].[MOE](T)(SEQ ID NO: 6, Compound No. 6_12), (y)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 21, Compound No. 21_1), (z)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 22, Compound No. 22_1), (aa)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 23, Compound No. 23_1), (ab)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 24, Compound No. 24_1), (ac)[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 25, Compound No. 25_1), (bh)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 25, Compound No. 25_2), (ad)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 26, Compound No. 26_1), (ae)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5 - methylcytosine])[PS2].[LR](T)(SEQ ID NO: 27, Compound No. 27_1), (af)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5 - methylcytosine])[PS2].[LR](T)(SEQ ID NO: 27, Compound No. 27_2), (ag)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[mR](U)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5 - methylcytosine])[PS2].[LR](T)(SEQ ID NO: 28, Compound No. 28_1), (ah)[LR](G)[PS2].[LR]([5 - methylcytosine])[sP].[dR](A)[sP].[dR](T)[sP].[mR](U)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5 - methylcytosine])[PS2].[LR](T)(SEQ ID NO: 29, Compound No. 29_1), (ai)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[mR](U)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP] .[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 30, compound NO: 30_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides).

[0247] In some embodiments, the antisense oligonucleotide comprises or consists of a compound selected from the following: (a)[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO. 1, compound number 1_1), (b)[LR](G)[sP].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP . (c)[MOE](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[d R](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[MOE](T)[sP].[MOE](T)[sP].[MOE]([5meC]) (SEQ ID NO. 7, compound number 7_1), (d)[LR](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[d and (e)[MOE](G)[sP].[MOE](G)[sP].[MOE]([5meC])[sP].[LR](A)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP .

[0248] In some embodiments, the antisense oligonucleotide comprises the following compound: [LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[ sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO: 1, compound number 1_1)

[0249] In some embodiments, the antisense oligonucleotide consists of the following compound: [LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[s P].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR][(T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO: 1, compound NO: 1_1).

[0250] In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of conjugate numbers 1_1, 6_1, 7_1, 7_2, 8_1, 18_1, 19_1, 20_1, 20_2, 20_3, 20_4, 20_5, 20_6, 6_2, 6_3, 6_4, 6_5, 6_6, 6_7, 6_8, 6_9, 6_10, 6_11, 6_12, 21_1, 22_1, 23_1, 24_1, 25_1, 25_2, 26_1, 27_1, 27_2, 28_1, 29_1, and 30_1.

[0251] In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of conjugate numbers 1_1, 6_1, 7_1, 7_2, 8_1.

[0252] In some embodiments, the antisense oligonucleotide conjugate comprises conjugate number 1_1. In some embodiments, the antisense oligonucleotide conjugate consists of conjugate number 1_1.

[0253] The present invention provides an antisense oligonucleotide conjugate selected from: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[d R](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP] .[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[ sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])(Allocation number 1, compound number 1_1, コンジュゲート number 1_1), (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[LR](T)[sP].[LR]([5meC])[sP].[LR](T)(Allocation number 6, compound number 6_1, コンジュゲート number 6_1), (c)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR](G)[sP].[dR](C)[sP] .[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ MOE](T)[sP].[MOE](T)[sP].[MOE]([5meC])(Allocation number 7, compound number 7_1, コンジュゲート number 7_1), (d)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])(Layout No. 7, Compound No. 7_2, Conjugate No. 7_2), (e)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[MOE](G)[sP].[MOE]([5meC] )[sP].[LR](A)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR ](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2] .[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC])(Allocation number 8, compound number 8_1, コンジュゲート number 8_1), (f)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](G)[sP].[dR](G)[sP].[d R](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[ dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP] .[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 18, compound number 18_1, コンジュゲート number 18_1), (g)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](G)[sP].[dR](G)[sP].[d R](C)[sP].[LR](A)[sP].[mR](U)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[ dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP] .[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 19, compound number 19_1, コンジュゲート number 19_1), (h)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 20, compound number 20_1, コンジュゲート number 20_1), (i)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[mR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 20, compound number 20_2, コンジュゲート number 20_2), (j)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 20, compound number 20_3, コンジュゲート number 20_3), (k)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 20, compound number 20_4, コンジュゲート number 20_4), (l)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP] .[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP] .[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP] .[dR](C)[sP].[LR](T)[PS2].[MOE]([5meC])(Allocation number 20, compound number 20_5, コンジュゲート number 20_5), (m)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[mR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 20, compound number 20_6, コンジュゲート number 20_6), (n)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP] .[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_2, コンジュゲート number 6_2), (o)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP] .[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_3, コンジュゲート number 6_3), (p)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP] .[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_4, コンジュゲート number 6_4), (q)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[mR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP] .[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_5, コンジュゲート number 6_5), (r)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP] .[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_6, コンジュゲート number 6_6), (s)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP] .[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_7, コンジュゲート number 6_7), (t)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR ](G)[sP].[mR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP] .[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 6, compound number 6_8, コンジュゲート number 6_8), (u)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A )[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP] .[LR](T)[sP].[LR]([5meC])[PS2].[MOE](T)(Allocation number 6, compound number 6_9, コンジュゲート number 6_9), (v)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[PS2].[MOE]([5meC])[sP].[MOE](T)(Allocation number 6, compound number 6_10, コンジュゲート number 6_10), (w)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[PS2].[LR]([5meC])[PS2].[MOE](T)(Allocation number 6, compound number 6_11, コンジュゲート number 6_11), (x)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR]( G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2].[ LR](T)[PS2].[MOE]([5meC])[sP].[MOE](T)(Allocation number 6, compound number 6_12, コンジュゲート number 6_12), (y)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 21, compound number 21_1, コンジュゲート number 21_1), (z)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 22, compound number 22_1, コンジュゲート number 22_1), (aa)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 23, compound number 23_1, コンジュゲート number 23_1), (ab)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[LR](T)[sP].[ LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 24, compound number 24_1, コンジュゲート number 24_1), (ac)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[LR](T)[sP].[ dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 25, compound number 25_1, コンジュゲート number 25_1), (ad)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 25, compound number 25_2, コンジュゲート number 25_2), (ae)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP ].[dR](G)[sP].[mR](U)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP ].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(Allocation number 26, compound number 26_1, コンジュゲート number 26_1), (af)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 27, compound number 27_1, コンジュゲート number 27_1), (ag)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(Allocation number 27, compound number 27_2, コンジュゲート number 27_2), (ah)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[mR](U)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 28, Compound No. 28_1, Conjugate No. 28_1), (ai)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[mR](U)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR]( G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 29, Compound No. 29_1, Conjugate No. 29_1), and (aj)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A) [sP].[mR](U)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 30, Compound No. 30_1, Conjugate No. 30_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides; P represents a phosphodiester internucleoside linkage between the preceding and succeeding nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in Figure 8).

[0254] In some embodiments, the antisense oligonucleotide conjugate is selected from the following: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[d R](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP] .[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[ sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])(Allocation number 1, compound number 1_1, コンジュゲート number 1_1), (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR]([5meC])[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR ](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP ].[LR](T)[sP].[LR]([5meC])[sP].[LR](T)(Allocation number 6, compound number 6_1, コンジュゲート number 6_1), (c)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[LR](G)[sP].[dR](C)[sP] .[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A )[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[ MOE](T)[sP].[MOE](T)[sP].[MOE]([5meC])(Allocation number 7, compound number 7_1, コンジュゲート number 7_1), (d)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[dR](C)[sP]. [LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A) [sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO: 7, Compound No. 7_2, Conjugate No. 7_2), and (e)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](G)[sP].[MOE](G)[sP].[MOE]([5meC] )[sP].[LR](A)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR ](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2].[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC]) (SEQ ID NO: 8, Compound No. 8_1, Conjugate No. 8_1).

[0255] In some embodiments, the antisense oligonucleotide conjugate comprises: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR] (C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[ dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO: 1, Compound No. 1_1, Conjugate No. 1_1).

[0256] In some embodiments, the antisense oligonucleotide conjugate consists of: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR] (C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[ dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC]) (SEQ ID NO: 1, Compound No. 1_1, Conjugate No. 1_1).

[0257] The present invention provides an antisense oligonucleotide conjugate having conjugate number 1_1 shown in FIG.

[0258] Targeting A1CF 16970-16989 The antisense oligonucleotides or antisense oligonucleotide conjugates of the invention can bind to target sequences within the region defined by positions 16970 to 16989 of the A1CF pre-mRNA (SEQ ID NO: 45).

[0259] Accordingly, the present invention provides an antisense oligonucleotide of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of 12 to 30 nucleotides in length, wherein the contiguous nucleotide sequence is capable of binding to a target sequence in A1CF mRNA, and the target sequence is A sequence of at least 17 consecutive nucleotides within AAGUAAAAUUAACAUGUCCA (SEQ ID NO: 43) (positions 16970 to 16989 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0260] The present invention also provides an antisense oligonucleotide conjugate comprising an antisense oligonucleotide covalently attached to at least one conjugate moiety, wherein the antisense oligonucleotide is an antisense oligonucleotide of 12-30 nucleotides in length comprising a contiguous nucleotide sequence of 12-30 nucleotides in length, the contiguous nucleotide sequence being capable of binding to a target sequence in A1CF mRNA, the target sequence being A sequence of at least 17 consecutive nucleotides within AAGUAAAAUUAACAUGUCCA (SEQ ID NO: 43) (positions 16970 to 16989 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0261] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is a sequence of 17, 18, 19, or 20 consecutive nucleotides within SEQ ID NO:43.

[0262] In some embodiments, the target sequence is AAGUAAAAUUAACAUGUCC (SEQ ID NO: 33) (positions 16970 to 16988 of SEQ ID NO: 45), or GUAAAAUUAACAUGUCCA (SEQ ID NO: 38) (positions 16972 to 16989 of SEQ ID NO: 45).

[0263] In some embodiments, the target sequence is SEQ ID NO:33.

[0264] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of the following sequences: GGACATGTTAATTTTACTT (SEQ ID NO: 3), TGGACAUGTTAATTTTAE (SEQ ID NO: 9), and GGACATGUTAATTTTACTT (SEQ ID NO: 10).

[0265] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 3, 9, or 10.

[0266] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to SEQ ID NO:3.

[0267] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:3.

[0268] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence consists of SEQ ID NO: 3. In some embodiments, the sequence of the contiguous nucleotide sequence consists of SEQ ID NO: 3. In some embodiments, the sequence of the antisense oligonucleotide consists of SEQ ID NO: 3.

[0269] In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 3_1, 9_1, and 10_1.

[0270] In some embodiments, the antisense oligonucleotide comprises Compound No. 3_1. In some embodiments, the antisense oligonucleotide consists of Compound No. 3_1.

[0271] The present invention provides antisense oligonucleotides comprising or consisting of a compound selected from: (a)[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR](C)[sP].[dR](A)[sP ].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP] .[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO. 3, compound number 3_1) (b)[LR](T)[PS2].[LR](G)[sP].[dR](G)[sP].[LR](A)[sP].[dR](C)[sP].[dR](A)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[ [dR] (c)[LR](G)[PS2].[LR](G)[PS2].[dR](A)[sP].[dR](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[mR](U)[sP].[dR](T)[sP].[ mR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 10, Compound No. 10_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides).

[0272] In some embodiments, the antisense oligonucleotide comprises the following compound: [LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR](C)[sP].[dR](A)[sP]. [dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP]. [dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 3, compound NO: 3_1).

[0273] In some embodiments, the antisense oligonucleotide consists of the following compound: [LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR](C)[sP].[dR](A)[sP]. [dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP]. [dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 3, compound NO: 3_1).

[0274] In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of conjugate numbers 3_1, 9_1, or 10_1.

[0275] In some embodiments, the antisense oligonucleotide conjugate comprises conjugate number 3_1. In some embodiments, the antisense oligonucleotide conjugate consists of conjugate number 3_1.

[0276] The present invention provides an antisense oligonucleotide conjugate selected from: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR] (C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR ](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 3, Compound No. 3_1, Conjugate No. 3_1), (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[dR](G)[sP].[L R](A)[sP].[dR](C)[sP].[dR](A)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[ LR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](A)[PS2].[LR]([5meC]) (SEQ ID NO: 9, Compound No. 9_1, Conjugate No. 9_1), and (c)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR](G)[PS2].[dR](A)[sP].[dR ](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[mR](U)[sP].[dR](T)[sP].[mR] (A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 10, Compound No. 10_1, Conjugate No. 10_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides; P represents a phosphodiester internucleoside linkage between the preceding nucleoside or moiety and the succeeding nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in Figure 8).

[0277] In some embodiments, the antisense oligonucleotide conjugate comprises: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR](C )[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR]( A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 3, Compound No. 3_1, Conjugate No. 3_1).

[0278] In some embodiments, the antisense oligonucleotide conjugate consists of: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR](C )[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR]( A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 3, Compound No. 3_1, Conjugate No. 3_1).

[0279] The present invention provides an antisense oligonucleotide conjugate, conjugate number 3_1, shown in FIG.

[0280] Targeting A1CF 26358-26377 The antisense oligonucleotides or antisense oligonucleotide conjugates of the invention can bind to a target sequence within the region defined by positions 26358 to 26377 of the A1CF pre-mRNA (SEQ ID NO: 45).

[0281] Accordingly, the present invention provides an antisense oligonucleotide of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of 12 to 30 nucleotides in length, wherein the contiguous nucleotide sequence is capable of binding to a target sequence in A1CF mRNA, and the target sequence is A sequence of at least 17 consecutive nucleotides within AAACACCACAAUCUUAAAAC (SEQ ID NO: 39) (positions 26358 to 26377 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0282] The present invention also provides an antisense oligonucleotide conjugate comprising an antisense oligonucleotide covalently attached to at least one conjugate moiety, wherein the antisense oligonucleotide is an antisense oligonucleotide of 12-30 nucleotides in length comprising a contiguous nucleotide sequence of 12-30 nucleotides in length, the contiguous nucleotide sequence being capable of binding to a target sequence in A1CF mRNA, the target sequence being A sequence of at least 17 consecutive nucleotides within AAACACCACAAUCUUAAAAC (SEQ ID NO: 39) (positions 26358 to 26377 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0283] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is a sequence of 17, 18, 19, or 20 consecutive nucleotides within SEQ ID NO:39.

[0284] In some embodiments, the target sequence is AAACACCACAAUCUUAAAAC (SEQ ID NO: 40) (positions 26358 to 26377 of SEQ ID NO: 45).

[0285] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to GTTTTAAGATTGTGGTGTTT (SEQ ID NO: 11).

[0286] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:11.

[0287] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence consists of SEQ ID NO: 11. In some embodiments, the sequence of the contiguous nucleotide sequence consists of SEQ ID NO: 11. In some embodiments, the sequence of the antisense oligonucleotide consists of SEQ ID NO: 11.

[0288] In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 11_1, 11_2, or 11_3.

[0289] In some embodiments, the antisense oligonucleotide comprises Compound No. 11_1. In some embodiments, the antisense oligonucleotide consists of Compound No. 11_1.

[0290] The present invention provides antisense oligonucleotides comprising or consisting of a compound selected from: (a)[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[ mR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T )[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP ].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, compound NO: 11_1), (b)[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[d R](A)[sP].[dR](A)[sP].[mR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T) [sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP]. [dR](G)[sP].[LR](T)[sP].[LR](T)[sP].[LR](T) (SEQ ID NO: 11, compound NO: 11_2), and (c)[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[ dR](A)[sP].[dR](A)[sP].[mR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T )[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP ].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, compound NO: 11_3), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (G) is a nucleoside containing a guanine nucleobase; [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides).

[0291] In some embodiments, the antisense oligonucleotide comprises the following compound: [LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](G) [sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR]( G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (fold sequence number 11, compound number 11_1).

[0292] In some embodiments, the antisense oligonucleotide consists of the following compound: [LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR ](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T) [sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP] .[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (double sequence number 11, compound number 11_1).

[0293] In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of conjugate numbers 11_1, 11_2, or 11_3.

[0294] In some embodiments, the antisense oligonucleotide conjugate comprises conjugate number 11_1.

[0295] In some embodiments, the antisense oligonucleotide conjugate consists of conjugate number 11_1.

[0296] The present invention provides an antisense oligonucleotide conjugate selected from: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[ sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP] .[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, Compound No. 11_1, Conjugate No. 11_1), (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[ sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[mR](G)[sP].[dR](A)[sP].[dR](T)[sP]. [dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[sP].[LR](T) (SEQ ID NO: 11, Compound No. 11_2, Conjugate No. 11_2), and (c)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[ sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[mR](G)[sP].[dR](A)[sP].[dR](T)[sP] .[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, Compound No. 11_3, Conjugate No. 11_3), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides; P represents a phosphodiester internucleoside linkage between the preceding and succeeding nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in Figure 8).

[0297] In some embodiments, the antisense oligonucleotide conjugate comprises: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP ].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP]. [dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, Compound No. 11_1, Conjugate No. 11_1).

[0298] In some embodiments, the antisense oligonucleotide conjugate consists of: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP ].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP]. [dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, Compound No. 11_1, Conjugate No. 11_1).

[0299] Targeting A1CF 38053-38071 The antisense oligonucleotides or antisense oligonucleotide conjugates of the invention can bind to a target sequence within the region defined by positions 38053 to 38071 of the A1CF pre-mRNA (SEQ ID NO: 45).

[0300] Accordingly, the present invention provides an antisense oligonucleotide of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of 12 to 30 nucleotides in length, wherein the contiguous nucleotide sequence is capable of binding to a target sequence in A1CF mRNA, and the target sequence is A sequence of at least 17 consecutive nucleotides within CAGGUAUAUAACAAGUUCA (SEQ ID NO: 34) (positions 38053 to 38071 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0301] The present invention also provides an antisense oligonucleotide conjugate comprising an antisense oligonucleotide covalently attached to at least one conjugate moiety, wherein the antisense oligonucleotide is an antisense oligonucleotide of 12-30 nucleotides in length comprising a contiguous nucleotide sequence of 12-30 nucleotides in length, the contiguous nucleotide sequence being capable of binding to a target sequence in A1CF mRNA, the target sequence being A sequence of at least 17 consecutive nucleotides within CAGGUAUAUAACAAGUUCA (SEQ ID NO: 34) (positions 38053 to 38071 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0302] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is a sequence of 17, 18, 19, or 20 consecutive nucleotides within SEQ ID NO:34.

[0303] In some embodiments, the target sequence is CAGGUAUAUAACAAGUUCA (SEQ ID NO: 34) (positions 38053 to 38071 of SEQ ID NO: 45).

[0304] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to TGAACTTGTTATATACETG (SEQ ID NO: 4).

[0305] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:4.

[0306] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises SEQ ID NO: 4. In some embodiments, the sequence of the contiguous nucleotide sequence consists of SEQ ID NO: 4. In some embodiments, the sequence of the antisense consists of SEQ ID NO: 4.

[0307] In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 4_1, 4_2, or 4_3.

[0308] In some embodiments, the antisense oligonucleotide comprises Compound No. 4_1. In some embodiments, the antisense oligonucleotide consists of Compound No. 4_1.

[0309] In some embodiments, the antisense oligonucleotide comprises Compound No. 4_2. In some embodiments, the antisense oligonucleotide consists of Compound No. 4_2.

[0310] The present invention provides antisense oligonucleotides comprising or consisting of a compound selected from: (a)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[ dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR] (C)[sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G) (SEQ ID NO. 4, compound number 4_1), (b)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR](A)[sP].[dR](C)[sP] .[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[d R] (A) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (C) [sP]. (c)[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP ].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[ dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR ](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G) (SEQ ID NO. 4, compound number 4_3), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides).

[0311] In some embodiments, the antisense oligonucleotide comprises: [LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[ dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR ](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, compound NO: 4_1).

[0312] In some embodiments, the antisense oligonucleotide consists of: [LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[ dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR ] (A) [sP].

[0313] In some embodiments, the antisense oligonucleotide comprises: [LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR](A)[sP].[dR](C)[sP]. [dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[d R](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, compound NO: 4_2).

[0314] In some embodiments, the antisense oligonucleotide consists of: [LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR](A)[sP].[dR](C)[sP]. [dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[d R](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, compound NO: 4_2).

[0315] In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of conjugate numbers 4_1, 4_2, or 4_3.

[0316] In some embodiments, the antisense oligonucleotide conjugate comprises conjugate number 4_1. In some embodiments, the antisense oligonucleotide conjugate consists of conjugate number 4_1.

[0317] In some embodiments, the antisense oligonucleotide conjugate comprises conjugate number 4_2. In some embodiments, the antisense oligonucleotide conjugate consists of conjugate number 4_2.

[0318] The present invention provides an antisense oligonucleotide conjugate selected from: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR]( A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T )[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, Compound No. 4_1, Conjugate No. 4_1), (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR]( A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T) [sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, Compound No. 4_2, Conjugate No. 4_2), and (c)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR] (A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, Compound No. 4_3, Conjugate No. 4_3), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (G) is a nucleoside containing a guanine nucleobase; [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides; P represents a phosphodiester internucleoside linkage between the preceding and succeeding nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in Figure 8).

[0319] In some embodiments, the antisense oligonucleotide conjugate comprises: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP]. [dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, Compound No. 4_1, Conjugate No. 4_1).

[0320] In some embodiments, the antisense oligonucleotide conjugate consists of: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP]. [dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, Compound No. 4_1, Conjugate No. 4_1).

[0321] In some embodiments, the antisense oligonucleotide conjugate comprises: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR](A) [sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T) [sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, Compound No. 4_2, Conjugate No. 4_2).

[0322] In some embodiments, the antisense oligonucleotide conjugate consists of: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR](A) [sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T) [sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, Compound No. 4_2, Conjugate No. 4_2).

[0323] The present invention provides an antisense oligonucleotide conjugate, conjugate number 4_1, shown in FIG.

[0324] The present invention provides an antisense oligonucleotide conjugate, conjugate number 4_2, shown in FIG.

[0325] Targeting A1CF 78973-78990 The antisense oligonucleotides or antisense oligonucleotide conjugates of the invention can bind to a target sequence within the region defined by positions 78973 to 78990 of the A1CF pre-mRNA (SEQ ID NO: 45).

[0326] Accordingly, the present invention provides an antisense oligonucleotide of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of 12 to 30 nucleotides in length, wherein the contiguous nucleotide sequence is capable of binding to a target sequence in A1CF mRNA, and the target sequence is A sequence of at least 17 consecutive nucleotides within AGACACACAAAACUCUAU (SEQ ID NO: 44) (positions 78973 to 78990 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0327] The present invention also provides an antisense oligonucleotide conjugate comprising an antisense oligonucleotide covalently attached to at least one conjugate moiety, wherein the antisense oligonucleotide is an antisense oligonucleotide of 12-30 nucleotides in length comprising a contiguous nucleotide sequence of 12-30 nucleotides in length, the contiguous nucleotide sequence being capable of binding to a target sequence in A1CF mRNA, the target sequence being A sequence of at least 17 consecutive nucleotides within AGACACACAAAACUCUAU (SEQ ID NO: 44) (positions 78973 to 78990 of SEQ ID NO: 45), Antisense oligonucleotides are provided, which can reduce A1CF expression.

[0328] In some embodiments of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention, the target sequence is a sequence of 17, 18, 19, or 20 consecutive nucleotides within SEQ ID NO:44.

[0329] In some embodiments, the target sequence is AGACACACAAAACUCUA (SEQ ID NO: 35) (positions 78973 to 78989 of SEQ ID NO: 45), or GACACACAAAACUCUAU (SEQ ID NO: 40) (positions 78974 to 78990 of SEQ ID NO: 45).

[0330] In some embodiments, the target sequence is AGACACACAAAACUCUA (SEQ ID NO: 35) (positions 78973 to 78989 of SEQ ID NO: 45).

[0331] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to any one of the following sequences: TAGAGTTTTGTGTGTET (SEQ ID NO: 5), TAGAGTTTUGTGTGTET (SEQ ID NO: 12), TAGAGTTTTGTGUGTET (SEQ ID NO: 13), and ATAGAFTTTTGTGTGTE (SEQ ID NO: 14).

[0332] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to any one of SEQ ID NOs: 5, 12, 13 or 14.

[0333] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80% identity to SEQ ID NO:5.

[0334] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO:5.

[0335] In some embodiments, the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises SEQ ID NO: 5. In some embodiments, the sequence of the contiguous nucleotide sequence consists of SEQ ID NO: 5. In some embodiments, the sequence of the antisense consists of SEQ ID NO: 5.

[0336] In some embodiments, the antisense oligonucleotide comprises or consists of any one of Compound Nos. 5_1, 5_2, 12_1, 5_3, 13_1, or 14_1.

[0337] In some embodiments, the antisense oligonucleotide comprises Compound No. 5_1. In some embodiments, the antisense oligonucleotide consists of Compound No. 5_1.

[0338] In some embodiments, the antisense oligonucleotide comprises Compound No. 5_2. In some embodiments, the antisense oligonucleotide consists of Compound No. 5_2.

[0339] The present invention provides antisense oligonucleotides comprising or consisting of a compound selected from: (a)[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[ dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, compound NO: 5_1), (b)[LR](T)[PS2].[LR](A)[sP].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[ dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, compound NO: 5_2), (c)[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 12, Compound No. 12_1), (d)[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T) (SEQ ID NO: 5, Compound No. 5_3), (e)[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T) (SEQ ID NO: 13, Compound No. 13_1), and (f)[LR](A)[PS2].[LR](T)[sP].[LR](A)[sP].[LR](G)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 14, Compound No. 14_1), (wherein, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides).

[0340] In some embodiments, the antisense oligonucleotide comprises the following compound: [LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[d R](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, compound NO: 5_1).

[0341] In some embodiments, the antisense oligonucleotide consists of the following compound: [LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[d R](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, compound NO: 5_1).

[0342] In some embodiments, the antisense oligonucleotide comprises the following compound: [LR](T)[PS2].[LR](A)[sP].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR ](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, compound NO: 5_2).

[0343] In some embodiments, the antisense oligonucleotide consists of the following compound: [LR](T)[PS2].[LR](A)[sP].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR ](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, compound NO: 5_2).

[0344] In some embodiments, the antisense oligonucleotide conjugate comprises or consists of any one of conjugate numbers 5_1, 5_2, 12_1, 5_3, 13_1, or 14_1.

[0345] In some embodiments, the antisense oligonucleotide conjugate comprises conjugate number 5_1. In some embodiments, the antisense oligonucleotide conjugate consists of conjugate number 5_1.

[0346] In some embodiments, the antisense oligonucleotide conjugate comprises conjugate number 5_2. In some embodiments, the antisense oligonucleotide conjugate consists of conjugate number 5_2.

[0347] The present invention provides an antisense oligonucleotide conjugate selected from: (a)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[PS2].[dR](G)[ sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[d R](T)[sP].[dR](G)[sP].[dR](T)[sP].[sP].[dR](T)[sP].[dR](G)[sP].[d R](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, compound number 5_1, conjugate number 5_1), (b)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[sP].[dR](G)[sP] .[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T )[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[ dR](T)[sP].[MOE]([5meC])[sP].[MOE](T)(Allocation number 5, compound number 5_2, コンジュゲート number 5_2), (c)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP] .[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U) [sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR ](T)[sP].[MOE]([5meC])[sP].[MOE](T)(Allocation number 12, compound number 12_1, コンジュゲート number 12_1), (d)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP ].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR] (T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP]. [dR](T)[sP].[LR]([5meC])[PS2].[MOE](T)(Allocation number 5, compound number 5_3, コンジュゲート number 5_3), (e)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP] .[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T) [sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T) (SEQ ID NO: 13, Compound No. 13_1, Conjugate No. 13_1), and (f)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](T)[sP].[LR](A)[sP]. [LR](G)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR]( T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 14, Compound No. 14_1, Conjugate No. 14_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase; ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase, ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase, (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase, [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and following nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and following nucleosides; P represents a phosphodiester internucleoside linkage between the preceding nucleoside or moiety and the succeeding nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in Figure 8).

[0348] In some embodiments, the antisense oligonucleotide comprises: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP]. [dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T) [sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[ dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID No. 5, Compound No. 5_1, Conjugate No. 5_1).

[0349] In some embodiments, the antisense oligonucleotide consists of: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP]. [dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T) [sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[ dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID No. 5, Compound No. 5_1, Conjugate No. 5_1).

[0350] In some embodiments, the antisense oligonucleotide comprises: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[sP].[dR](G)[sP].[ dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T) [sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[ dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID No. 5, Compound No. 5_2, Conjugate No. 5_2).

[0351] In some embodiments, the antisense oligonucleotide consists of: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](A)[sP].[dR](G)[sP].[ dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T) [sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[ dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID No. 5, Compound No. 5_2, Conjugate No. 5_2).

[0352] The present invention provides an antisense oligonucleotide conjugate, conjugate number 5_1, shown in FIG.

[0353] The present invention provides an antisense oligonucleotide conjugate, conjugate number 5_2, shown in FIG.

[0354] Pharmaceutically acceptable salts In some embodiments, the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention is in the form of a pharmaceutically acceptable salt.

[0355] As used herein, the term "salt" conforms to its commonly known meaning, i.e., an ionic assembly of anions and cations.

[0356] The term "pharmaceutically acceptable salt" refers to a salt that retains the biological effectiveness and properties of the free base or free acid, without being biologically or otherwise undesirable. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, especially hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and N-acetylcysteine. In addition, these salts can be prepared by adding an inorganic or organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, and polyamine resin salts.The compounds of the present invention may also exist in zwitterionic form.Particularly preferred pharmaceutically acceptable salts of compounds of formula (I) are salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and methanesulfonic acid.

[0357] In some embodiments, the antisense oligonucleotide is in the form of a pharmaceutically acceptable salt. In some embodiments, the antisense oligonucleotide conjugate is in the form of a pharmaceutically acceptable salt.

[0358] In some embodiments, the pharmaceutically acceptable salt is a sodium salt or a potassium salt. In some embodiments, the antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention is in the form of a sodium salt. In some embodiments, the antisense oligonucleotide of the present invention is in the form of a sodium salt. In some embodiments, the antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention is in the form of a potassium salt. In some embodiments, the antisense oligonucleotide of the present invention is in the form of a potassium salt. In some embodiments, the antisense oligonucleotide of the present invention is in the form of a potassium salt.

[0359] Delivery of antisense oligonucleotides In some embodiments, the antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention is encapsulated in lipid-based delivery vehicle, covalently linked to dendrimer, or encapsulated in dendrimer, or conjugated to aptamer.This can be for the purpose of delivering the antisense oligonucleotide of the present invention to targeted cells and / or improving the pharmacokinetics of antisense oligonucleotide.Examples of lipid-based delivery vehicle include oil-in-water emulsion, micelles, liposomes and lipid nanoparticles.

[0360] In some embodiments, the antisense oligonucleotide is encapsulated in a lipid-based delivery vehicle. In some embodiments, the antisense oligonucleotide is covalently linked to a dendrimer. In some embodiments, the antisense oligonucleotide is encapsulated in a dendrimer. In some embodiments, the antisense oligonucleotide is conjugated to an aptamer.

[0361] In some embodiments, the antisense oligonucleotide conjugate is encapsulated in a lipid-based delivery vehicle. In some embodiments, the antisense oligonucleotide conjugate is covalently linked to a dendrimer. In some embodiments, the antisense oligonucleotide conjugate is encapsulated in a dendrimer. In some embodiments, the antisense oligonucleotide conjugate is conjugated to an aptamer.

[0362] Pharmaceutical Composition The present invention provides pharmaceutical compositions comprising an antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant. In some embodiments, the pharmaceutical composition comprises an aqueous diluent or solvent. In some embodiments, the aqueous diluent or solvent is phosphate buffered saline. In some embodiments, the aqueous diluent or solvent is sterile.

[0363] The present invention provides a pharmaceutical composition comprising an antisense oligonucleotide of the present invention and a pharmaceutically acceptable salt. In some embodiments, the salt comprises a metal cation. In some embodiments, the pharmaceutically acceptable salt is selected from the group consisting of sodium salt, potassium salt and ammonium salt.

[0364] The present invention also provides a pharmaceutical solution of the antisense oligonucleotide of the present invention or a conjugate thereof, comprising the antisense oligonucleotide of the present invention or a conjugate thereof and a pharmaceutically acceptable solvent such as physiological saline.

[0365] The present invention also provides the antisense oligonucleotides or conjugates thereof of the present invention in solid powder form, such as in the form of a lyophilized powder.

[0366] Methods for reducing A1CF expression The present invention provides an in vitro method for reducing A1CF expression in target cells, the method comprising administering to the target cells an effective amount of an antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention, or a pharmaceutical composition of the present invention.

[0367] The present invention provides an in vivo method for reducing A1CF expression in target cells, the method comprising administering to the target cells an effective amount of an antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention or a pharmaceutical composition of the present invention.

[0368] In some embodiments, the target cell is an animal cell, preferably a mammalian cell such as a mouse cell, a rat cell, a hamster cell, or a monkey cell. Most preferably, the target cell is a human cell.

[0369] In some embodiments, the target cells are hepatocytes.

[0370] In some embodiments, the target cell is infected with HBV. In some embodiments, the target cell is infected with HBV. In some embodiments, the target cell may contain HBV cccDNA. In some embodiments, the target cell contains A1CF pre-mRNA (such as SEQ ID NO: 45), mature mRNA (such as any of SEQ ID NOs: 47-54) and HBV cccDNA.

[0371] In some embodiments, the target cells are primary human hepatocytes infected with HBV, either derived from an HBV-infected individual or from an HBV-infected mouse with a humanized liver (PhoenixBio, PXB mouse).

[0372] In some embodiments of the in vivo methods of the invention, the target cell is part of a subject suffering from an HBV infection, e.g., a chronic HBV infection. In some embodiments of the in vitro methods of the invention, the target cell is derived from a subject suffering from an HBV infection, e.g., a chronic HBV infection.

[0373] In some embodiments of this method, A1CF expression is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% compared to a control.In some embodiments, the control is a cell that has not been exposed to antisense oligonucleotide or antisense oligonucleotide conjugate.In some embodiments, A1CF expression is the amount of A1CF mRNA expressed by target cells.

[0374] Treatment, prevention and medical uses The present invention provides a method for treating a disease, comprising administering to a subject suffering from the disease a therapeutically effective amount of an antisense oligonucleotide, antisense oligonucleotide conjugate, or pharmaceutical composition of the present invention.

[0375] The present invention provides a method for treating a disease, comprising administering to a subject suffering from the disease a therapeutically effective amount of an antisense oligonucleotide of the present invention.The present invention provides a method for treating a disease, comprising administering to a subject suffering from the disease a therapeutically effective amount of an antisense oligonucleotide conjugate of the present invention.The present invention provides a method for treating a disease, comprising administering to a subject suffering from the disease a therapeutically effective amount of a pharmaceutical composition of the present invention.

[0376] The present invention provides a method for preventing a disease, comprising administering a prophylactically effective amount of an antisense oligonucleotide, an antisense oligonucleotide conjugate, or a pharmaceutical composition of the invention to a subject susceptible to the disease.

[0377] The present invention provides a method for preventing disease, comprising administering a prophylactically effective amount of an antisense oligonucleotide of the present invention to a subject susceptible to the disease. The present invention provides a method for preventing disease, comprising administering a prophylactically effective amount of an antisense oligonucleotide conjugate of the present invention to a subject susceptible to the disease. The present invention provides a method for preventing disease, comprising administering a prophylactically effective amount of a pharmaceutical composition of the present invention to a subject susceptible to the disease.

[0378] The present invention provides an antisense oligonucleotide, antisense oligonucleotide conjugate, or pharmaceutical composition of the present invention for use in treating a disease in a subject.

[0379] The present invention provides an antisense oligonucleotide of the present invention for use in treating a disease in a subject.The present invention also provides an antisense oligonucleotide conjugate of the present invention for use in treating a disease in a subject.The present invention also provides a pharmaceutical composition of the present invention for use in treating a disease in a subject.

[0380] The present invention provides an antisense oligonucleotide, an antisense oligonucleotide conjugate, or a pharmaceutical composition of the present invention for use in preventing a disease in a subject.

[0381] The present invention provides an antisense oligonucleotide of the present invention for use in preventing disease in a subject.The present invention provides an antisense oligonucleotide conjugate of the present invention for use in preventing disease in a subject.The present invention provides a pharmaceutical composition of the present invention for use in preventing disease in a subject.

[0382] The invention provides the use of an antisense oligonucleotide, antisense oligonucleotide conjugate or pharmaceutical composition of the invention for the preparation of a medicament for the treatment of a disease in a subject.

[0383] The present invention provides use of an antisense oligonucleotide of the present invention for the preparation of a medicament for the treatment of a disease in a subject.The present invention provides use of an antisense oligonucleotide conjugate of the present invention for the preparation of a medicament for the treatment of a disease in a subject.The present invention provides use of a pharmaceutical composition of the present invention for the preparation of a medicament for the treatment of a disease in a subject.

[0384] The invention provides the use of an antisense oligonucleotide, antisense oligonucleotide conjugate or pharmaceutical composition of the invention for the preparation of a medicament for the prevention of a disease in a subject.

[0385] The present invention provides use of an antisense oligonucleotide of the present invention for the preparation of a medicament for the prevention of a disease in a subject.The present invention provides use of an antisense oligonucleotide of the present invention for the preparation of a medicament for the prevention of a disease in a subject.The present invention provides use of a pharmaceutical composition of the present invention for the preparation of a medicament for the prevention of a disease in a subject.

[0386] As used herein, the terms "treating," "treatment," and "treatment" refer to both the treatment of an existing disease (e.g., a disease or disorder referred to herein) or the prevention of disease, i.e., prophylaxis. It will therefore be recognized that the treatment referred to herein may, in some embodiments, be prophylactic. Prophylaxis can be understood as preventing HBV infection from converting to chronic HBV infection, or preventing serious liver diseases such as cirrhosis and hepatocellular carcinoma due to chronic HBV infection.

[0387] As used herein, the terms "preventing," "prevention," or "preventing" refer to prophylactic treatment, i.e., measures or measures whose purpose is to prevent rather than cure a disease. Prevention means that the desired pharmacological and / or physiological effect is obtained prophylactically, in terms of completely or partially preventing a disease or its symptoms. Thus, "preventing HBV infection" as used herein includes preventing the occurrence of HBV infection in a subject and preventing the occurrence of symptoms of HBV infection. The present invention particularly contemplates the prevention of HBV infection in children of mothers infected with HBV. It also contemplates preventing acute HBV infection from transforming into chronic HBV infection.

[0388] The present invention provides an antisense oligonucleotide of the present invention, an antisense oligonucleotide conjugate of the present invention, or a pharmaceutical composition of the present invention for use as a pharmaceutical.The present invention provides an antisense oligonucleotide of the present invention, an antisense oligonucleotide conjugate of the present invention, or a pharmaceutical composition of the present invention for use in therapy.The present invention provides an antisense oligonucleotide of the present invention, an antisense oligonucleotide conjugate of the present invention, or a pharmaceutical composition of the present invention for preparing a pharmaceutical.

[0389] disease In some embodiments, the disease is an HBV infection. In some embodiments, the HBV infection is a chronic HBV infection.

[0390] The terms "hepatitis B virus infection" or "HBV infection" are commonly known in the art and refer to an infectious disease caused by hepatitis B virus (HBV) and affecting the liver. HBV infection can be acute or chronic. Chronic hepatitis B virus (CHB) infection is a global disease burden affecting 248 million people worldwide. Approximately 686,000 deaths per year are attributed to HBV-related end-stage liver disease and hepatocellular carcinoma (HCC) (GBD 2013; Schweitzer et al., 2015). WHO predicted that without further intervention, the number of CHB-infected individuals will remain at their current high level over the next 40 to 50 years, with a cumulative 20 million deaths between 2015 and 2030 (WHO, 2016). CHB infection is not a homogeneous disease with distinct clinical manifestations. Infected individuals progress through several stages of CHB-related liver disease over their lifetime. These stages also form the basis for standard of care (SOC) treatment. Current guidelines recommend treating only select individuals infected with CHB based on three criteria: serum ALT level, HBV DNA level, and liver disease severity (EASL, 2017). This recommendation is due to the fact that SOC, namely, nucleosid(ate) analogs (NAs) and pegylated interferon-α (PEG-IFN), are not curative and must be administered for extended periods, thereby increasing safety risks. PEG-IFN can only be administered to a small subset of CHB patients due to its various side effects. NAs effectively suppress HBV DNA replication; however, they have very limited or no effect on other viral markers. Two hallmarks of HBV infection, hepatitis B surface antigen (HBsAg) and covalently closed circular DNA (cccDNA), are the primary targets of new drugs aimed at curing HBV.In the plasma of CHB patients, HBsAg subviral (empty) particles outnumber HBV virions by 103-105 times (Ganem & Prince, 2014), and this excess is thought to contribute to the immunopathogenesis of the disease, including in individuals who fail to develop neutralizing anti-HBs antibodies, a serological marker observed after resolution of acute HBV.

[0391] In some embodiments, the disease is associated with HBV infection. In some embodiments, the disease is liver disease. In some embodiments, the disease is cirrhosis. In some embodiments, the disease is hepatocellular carcinoma.

[0392] subject For the purposes of the present invention, a "subject" or "patient" may be a vertebrate. In the context of the present invention, the term "subject" includes both humans and other animals, particularly mammals, and other organisms. Thus, the means and methods provided herein are applicable to both human therapy and veterinary use. Thus, as used herein, a subject may be an animal such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, bovine species, horse, camel, or primate. Preferably, the subject is a mammal. More preferably, the subject is a human. In some embodiments, the subject is suffering from a disease referred to herein, such as HBV infection. In some embodiments, the subject is susceptible to the disease.

[0393] Administration The antisense oligonucleotides of the invention, the antisense oligonucleotide conjugates of the invention, or the pharmaceutical compositions of the invention may be administered topically (to the skin, by inhalation, to the eye or ear, etc.), enterally (orally or through the digestive tract, etc.), or parenterally (intravenously, subcutaneously, intramuscularly, intracerebrally, intraventricularly or intrathecally, etc.).

[0394] In a preferred embodiment, the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention, or the pharmaceutical composition of the present invention is administered parenterally, including intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, intrathecal or intracranial, for example, intracerebral or intraventricular administration. In one embodiment, the antisense oligonucleotide of the present invention is administered intracerebrally or intraventricularly. In another embodiment, the antisense oligonucleotide of the present invention is administered intrathecally.

[0395] The present invention also provides the use of the described antisense oligonucleotide of the invention or the pharmaceutical composition of the invention for the preparation of a medicament in a dosage form for intrathecal administration.

[0396] The present invention also provides the use of the described antisense oligonucleotide of the invention or the pharmaceutical composition of the invention for the preparation of a medicament in a dosage form for intracerebroventricular administration.

[0397] In some embodiments, the antisense oligonucleotide, antisense oligonucleotide conjugate or pharmaceutical composition of the invention is used in a combination treatment with another therapeutic agent.

[0398] Sequence Listing The sequence listing submitted with this application is incorporated herein by reference. In the event of any discrepancy between the sequence listing and the specification or drawings, the information disclosed in the specification (including the drawings) shall be presumed to be correct.

[0399] HELM notation The antisense oligonucleotides (compounds) of the invention and the antisense oligonucleotide conjugates (conjugates) of the invention are depicted herein using the Hierarchical Editing Language for Macromolecules (HELM) notation.

[0400] HELM is a notation format designed to depict the structure of macromolecules. Full details of the HELM notation can be found at www.pistoiaalliance.org / helm-tools / , Zhang et al. J. Chem. Inf. Model. 2012, 52, 2796-2806 (which originally described HELM notation), and Milton et al. J. Chem Inf. Model. 2017, 57, 1233-1239 (which describes HELM version 2.0).

[0401] Briefly, a macromolecule is represented as a "HELM string" and divided into sections. The first section lists the molecules contained in the macromolecule. The second section lists the connections between molecules within the macromolecule. One or more dollar signs $ mark the end of a section of the HELM string.

[0402] The compounds of the present invention are represented by HELM strings consisting of a single first section that defines an oligonucleotide.

[0403] The conjugates of the present invention are represented by HELM strings consisting of two sections: a first section defining the oligonucleotide (including the 5' CA dinucleotide linker) and the conjugate moiety, and a second section defining the linkage between the oligonucleotide and the conjugate moiety. The third, fourth, and fifth sections (which may be used in HELM strings for more complex macromolecules) are not used in the HELM strings herein.

[0404] Each molecule listed in the first section of the HELM column is given an identifier (e.g., "RNA1" for nucleic acids, "PEPTIDE1" for amino acid sequences, "CHEM1" for chemical structures), and the structure of the molecule is defined by the notation in brackets {} immediately following the identifier. The HELM notation used to define the structure of each molecule in brackets {} in the first section of the HELM column for compounds and conjugates of the invention is as follows: [LR](G) is a β-D-oxy-LNA guanine nucleoside; [LR](T) is beta-D-oxy-LNA thymine nucleoside; [LR](A) is a beta-D-oxy-LNA adenine nucleoside; [LR] ([5meC]) is beta-D-oxy-LNA 5-methylcytosine nucleoside; [dR](G) is a DNA guanine nucleoside; [dR](T) is a DNA thymine nucleoside; [dR](A) is a DNA adenine nucleoside; [dR]([C]) is a DNA cytosine nucleoside, [mR](G) is a 2'-O-methyl RNA guanine nucleoside; [mR](U) is 2'-O-methyl RNA uracil nucleoside; [mR](A) is 2'-O-methyl RNA adenine nucleoside; [mR] ([C] is a 2'-O-methyl RNA cytosine nucleoside, [sP] is a phosphorothioate internucleoside linkage; [PS2] is a phosphorodithioate internucleoside linkage, [MOE](G) is a 2'-MOE RNA guanine nucleoside; [MOE](T) is 2'-MOE RNA thymine nucleoside; [MOE](A) is 2'-MOE ethyl RNA adenine nucleoside; [MOE] ([5meC]) is 2'-MOE RNA 5-methylcytosine nucleoside; [dR]([PPG]) is a DNA 7-deaza-8-azaguanine nucleoside; [P] is a phosphodiester internucleoside linkage, Used to define nucleosides, [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in FIG.

[0405] As mentioned above, in the context of the present invention, the second section is only used in the HELM string representing the conjugate of the present invention. This second section lists the connections between the molecules listed in the first section. Each pair of molecules to be linked is defined by listing their identifiers, and then the attachment points between them (i.e., the points at which the covalent bond exists between the molecules) are defined.

[0406] In the HELM strings representing the conjugates of the present invention, there is a single linkage (between the conjugate moiety and the oligonucleotide). This single connection is represented in all HELM strings herein as follows: CHEM1, RNA1, 1:R2-1:R1.

[0407] This shows that the conjugate moiety (CHEM1) is attached to the oligonucleotide (RNA1) by a covalent bond between the R2 attachment point of the first monomer of CHEM1 (which is the entire conjugate moiety shown in Figure 8) (designated "1:R2") and the R1 attachment point of the first monomer of RNA1 (designated "1:R1").

[0408] HELM notation example For example, compound number 1_1 is represented by the following HELM string (shown in Table 4):

[0409] RNA1{[LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[d R](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])}$$$$V2.0

[0410] This HELM string consists of a single section listing the oligonucleotide with compound number 1_1. The initial "RNA1" indicates that the molecule is a nucleic acid (oligonucleotide). The structure of the oligonucleotide is shown using HELM notation in brackets {} following RNA1. "$$$$" indicates the end of the section, and the entire HELM string. "V2.0" indicates that HELM version 2.0 is being used.

[0411] As another example, conjugate number 1_1 is represented by the following HELM string (shown in Table 5): CHEM1{[5gn2c6]}|RNA1{P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR]([5meC])[sP] .[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[s P].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T) [sP].[LR](T)[sP].[LR]([5meC])[sP].[LR](T)}$CHEM1,RNA1,1:R2-1:R1$$$V2.0

[0412] This HELM string consists of two sections. The first section lists the two molecules that make up the antisense oligonucleotide conjugate with conjugate number 1_1: the conjugate moiety (with identifier CHEM1) and the oligonucleotide (with identifier RNA1). The conjugate moiety is defined in brackets {} immediately after CHEM1, and the oligonucleotide (including the CA dinucleotide linker) is defined in brackets {} after RNA1. The "$" indicates the end of the first section. The second section defines how CHEM1 and RNA1 are connected to each other. "CHEM1,RNA1,1:R2-1:R1" indicates that the R2 attachment point of the conjugate moiety (1:R2) is attached to the R1 attachment point of the first monomer of the oligonucleotide (in this case, the phosphate group [P]). The "$$$" indicates the end of the second section and the entire HELM string. "V2.0" again indicates that HELM version 2.0 is being used.

[0413] Simplified HELM notation A simplified HELM notation is also used herein to represent compounds and conjugates of the present invention in a more readable format than typical HELM strings. In this simplified notation, the second section (which lists the linkages between molecules) is omitted. In each HELM string herein representing a conjugate of the present invention, the linkage between the conjugate moiety and the oligonucleotide is a phosphodiester bond between the conjugate moiety and the 5' nucleoside of the depicted oligonucleotide. The "CHEM1" and "RNA1" identifiers and associated brackets {}, section closing $, and HELM version number are also omitted in the simplified HELM notation.

[0414] For example, compound number 1_1 is represented herein in the abbreviated HELM notation as follows: [LR](A)[sP].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP]. [dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])

[0415] For example, conjugate number 1_1 is represented herein in the abbreviated HELM notation as follows: [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[sP].[LR](G)[sP].[dR](G)[s P].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP ].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP] .[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])

[0416] In all simplified HELM strings herein, [5gn2c6]P represents the conjugate moiety shown in Figure 8 attached by a phosphodiester bond to the oligonucleotide represented by the remainder of the HELM string.

[0417] It will be understood that a simplified HELM string represents the same molecule as the corresponding full HELM string. Thus, a simplified HELM string for a given compound or conjugate is interchangeable with the full HELM string for that compound or conjugate (shown in Tables 4 and 5 herein).

[0418] All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the claimed invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in molecular biology, biochemistry, cell biology, virology, or related fields are intended to be within the scope of the following claims. [Example]

[0419] Example 1 - Antisense Oligonucleotide Sequences, Compounds and Conjugates Sixty-eight antisense oligonucleotides (compounds) targeting A1CF mRNA were synthesized. Conjugated forms of these 68 antisense oligonucleotides were also synthesized, in which an aminohexyl-conjugated tri(N-acetyl-galactosamine) conjugate moiety (shown in Figure 8) was covalently attached to the 5' end of each antisense oligonucleotide via a CA dinucleotide linker.

[0420] Oligonucleotide synthesis Oligonucleotide synthesis is generally known in the art.The antisense oligonucleotide and conjugate of the present invention can be synthesized by any such method known in the art.The following is the protocol that can be applied.The oligonucleotide of the present invention may be produced by the method that is slightly different in terms of the device, support and concentration used.

[0421] Oligonucleotides are synthesized on a uridine universal support using the phosphoramidite approach of Mermade 192 on a 1 μmol scale. At the end of synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia at 60 °C for 5–16 h. The oligonucleotides are purified by reverse-phase HPLC (RP-HPLC), ion-exchange chromatography, or solid-phase extraction, characterized by UPLC, and their molecular weights are further confirmed by ESI-MS.

[0422] Oligonucleotide extension: Coupling of β-cyanoethyl phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), or LNA-T) is carried out using 0.1 M of the 5'-O-DMT-protected amidite in acetonitrile and a solution of DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as the activator. In the final cycle, a phosphoramidite bearing the desired modification, such as a C6 linker for attaching a conjugate group, or such a conjugate group, can be used. Thiolation to introduce a phosphorothioate bond is carried out using hydrogenated xanthan gum (0.01 M in acetonitrile / pyridine 9:1). Phosphodiester bonds can be introduced using 0.02 M iodine in THF / pyridine / water 7:2:1. The remaining reagents are those typically used in oligonucleotide synthesis.

[0423] For post-solid-phase synthesis conjugation, commercially available C6 amino linker phosphoramidites can be used in the final cycle of solid-phase synthesis, and after deprotection and cleavage from the solid support, the amino-linked, deprotected oligonucleotide is isolated. The conjugate is introduced by functional group activation using standard synthetic methods.

[0424] Purification by RP-HPLC: The crude compound is purified by preparative RP-HPLC on a Phenomenex Jupiter® C18 10 μm 150 × 10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile are used as buffers at a flow rate of 5 mL / min. The collected fractions are lyophilized to give the purified compound, typically as a white solid.

[0425] Abbreviation: DCI: 4,5-dicyanoimidazole DCM: dichloromethane DMF: dimethylformamide DMT: 4,4'-dimethoxytrityl THF: tetrahydrofuran Bz: benzoyl Ibu: Isobutyryl RP-HPLC: reversed-phase high-performance liquid chromatography

[0426] Table of Sequences, Compounds and Conjugates Table 3 below shows the sequences of antisense oligonucleotides (ASOs) with reference to the corresponding target sequence of A1CF mRNA, along with the sugar moieties and internucleoside linkage patterns therein. The codes used in Table 3 are as follows: Nucleobase code: A = adenine, C = cytosine, E = 5-methylcytosine, F = 7-deaza-8-azaguanine, G = guanine, T = thymine, U = uracil Sugar codes: D = DNA, L = LNA, M = 2'-O-methoxyethyl-RNA (MOE), O = 2'-O-methyl-RNA Internucleoside linkage code: S = phosphorothioate, 2 = phosphorodithioate

[0427] Table 4 below shows compounds using HELM strings. Similarly, Table 5 below shows conjugates using HELM strings. Details on how to read HELM strings can be found at www.pistoiaalliance.org / helm-tools / and Zhang et al. J. Chem. Inf. Model. 2012, 52, 2796-2806.

[0428] HELM annotation keys: RNA1 is an identifier for the oligonucleotide portion of the compound or conjugate, the oligonucleotide being defined in brackets {} after the first instance of "RNA1", and the second instance of "RNA1" in each conjugate string defines the position of the linkage between the oligonucleotide and the conjugate portion; CHEM1 is an identifier for the conjugate moiety of the conjugate, the conjugate moiety being defined in brackets {} after the first instance of "CHEM1", and the second instance of "CHEM1" in each conjugate string defines the position of the linkage between the oligonucleotide and the conjugate moiety; one or more $ marks the end of a section of a HELM string, the first section of the HELM string defining the oligonucleotide sequence (including sugar moieties and internucleoside linkages), and the second sec...

Claims

1. 1. An antisense oligonucleotide having a length of 12 to 30 nucleotides, comprising a contiguous nucleotide sequence having a length of 12 to 30 nucleotides, said contiguous nucleotide sequence being capable of binding to a target sequence in apolipoprotein B-mRNA editing enzyme catalytic subunit 1 (APOBEC1) complementation factor (A1CF) mRNA, said target sequence having the following sequence: GCCUAUCUGAGAAACUUUU (SEQ ID NO: 32) (positions 2181 to 2199 of SEQ ID NO: 45), GAGAAAACCUAUAAUGCCU (SEQ ID NO: 42) (positions 6951 to 6970 of SEQ ID NO: 45), AAGUAAAAUAAACAUGUCCA (SEQ ID NO: 43) (positions 16970 to 16989 of SEQ ID NO: 45), AAACACCACAAUCUUAAAAC (SEQ ID NO: 39) (positions 26358 to 26377 of SEQ ID NO: 45), A sequence of at least 17 consecutive nucleotides within either CAGGUAUAUAACAAGUUCA (SEQ ID NO:34) (positions 38053-38071 of SEQ ID NO:45) or AGACACACAAAACUCUAU (SEQ ID NO:44) (positions 78973-78990 of SEQ ID NO:45); An antisense oligonucleotide, wherein the antisense oligonucleotide is capable of reducing A1CF expression.

2. The antisense oligonucleotide of claim 1, wherein the target sequence is GCCUAUCUGAGAAACUUUU (SEQ ID NO: 32) (positions 2181-2199 of SEQ ID NO: 45) or AAGUAAAAUUAACAUGUCC (SEQ ID NO: 33) (positions 16970-16988 of SEQ ID NO: 45).

3. 3. The antisense oligonucleotide of claim 1 or 2, wherein the antisense oligonucleotide is capable of reducing A1CF expression in cells infected with Hepatitis B virus (HBV).

4. The antisense oligonucleotide of claim 3, wherein the antisense oligonucleotide is capable of reducing total intracellular HBV DNA in the cell compared to a control.

5. 5. The antisense oligonucleotide of claim 3 or 4, wherein the antisense oligonucleotide is capable of reducing the amount of HBV DNA secreted by the cell compared to a control.

6. The antisense oligonucleotide of any one of claims 3 to 5, wherein the antisense oligonucleotide is capable of reducing the amount of covalently closed circular DNA (cccDNA) in the cell compared to a control.

7. The antisense oligonucleotide of any one of claims 3 to 6, wherein the antisense oligonucleotide is capable of reducing the amount of pregenomic RNA (pgRNA) in the cell compared to a control.

8. The antisense oligonucleotide of any one of claims 1 to 7, wherein the antisense oligonucleotide is capable of recruiting RNase H.

9. The antisense oligonucleotide according to any one of claims 1 to 8, wherein the antisense oligonucleotide is a single-stranded antisense oligonucleotide.

10. The antisense oligonucleotide of any one of claims 1 to 9, wherein the contiguous nucleotide sequence is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to the target sequence.

11. The antisense oligonucleotide of any one of claims 1 to 10, wherein the antisense oligonucleotide is 17, 18, 19 or 20 nucleotides in length.

12. The antisense oligonucleotide of any one of claims 1 to 11, wherein the contiguous nucleotide sequence is 17, 18, 19 or 20 nucleotides in length.

13. The antisense oligonucleotide according to any one of claims 1 to 12, wherein the antisense oligonucleotide consists of the contiguous nucleotide sequence.

14. The antisense oligonucleotide according to any one of claims 1 to 13, wherein the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95% or 100% identity to AAAAGTTTCTCAGATAGGE (SEQ ID NO: 2) or GGACATGTTAATTTTAACTT (SEQ ID NO: 3).

15. The antisense oligonucleotide of any one of claims 1 to 14, wherein the antisense oligonucleotide comprises one or more sugar-modified nucleosides.

16. 16. The antisense oligonucleotide of claim 15, wherein the one or more sugar-modified nucleosides are independently selected from the group consisting of 2'-O-methyl-RNA, 2'-O-methoxyethyl-RNA (MOE-RNA) and LNA nucleosides.

17. 17. The antisense oligonucleotide of claim 15 or 16, wherein each nucleotide in the antisense oligonucleotide that does not contain a sugar-modified nucleoside comprises a DNA nucleoside.

18. The antisense oligonucleotide of any one of claims 1 to 17, wherein the antisense oligonucleotide comprises one or more modified internucleoside linkages.

19. 20. The antisense oligonucleotide of claim 18, wherein all internucleoside linkages in the antisense oligonucleotide are modified internucleoside linkages.

20. 20. The antisense oligonucleotide of claim 18 or claim 19, wherein each modified internucleoside linkage is independently selected from the group consisting of phosphorothioate internucleoside linkages and phosphorodithioate internucleoside linkages.

21. An antisense oligonucleotide comprising or consisting of a compound selected from: (a) [LR] (A) [sP]. [LR] (G) [sP]. [dR] (G) [sP]. [dR] (C) [sP]. [LR] (A) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (G) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR] ([5meC]) (SEQ ID NO: 1, compound number 1_1), (b) [LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_1), (c) [LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(SEQ ID NO: 3, Compound No. 3_1), (d) [LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G)(SEQ ID NO: 4, Compound No. 4_1), (e) [LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[mR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G)(SEQ ID NO: 4, Compound No. 4_2), (f) [LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, Compound No. 5_1), (g) [LR](T)[PS2].[LR](A)[sP].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 5, Compound No. 5_2), (h) [LR](G)[sP].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[sP].[LR](T) (SEQ ID NO: 6, Compound No. 6_1), (i) [MOE](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[MOE](T)[sP].[MOE](T)[sP].[MOE]([5meC]) (SEQ ID NO: 7, Compound No. 7_1), (j) [LR](G)[sP].[LR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])(SEQ ID NO: 7, Compound No. 7_2), (k) [MOE](G)[sP].[MOE](G)[sP].[MOE]([5meC])[sP].[LR](A)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2].[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC])(SEQ ID NO: 8, Compound No. 8_1), (l) [LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_2), (m) [LR](T)[PS2].[LR](G)[sP].[dR](G)[sP].[LR](A)[sP].[dR](C)[sP].[dR](A)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](A)[PS2].[LR]([5meC])(SEQ ID NO: 9, Compound No. 9_1), (n) [LR](G)[PS2].[LR](G)[PS2].[dR](A)[sP].[dR](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP][mR](U)[sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 10, Compound No. 10_1), (o) [LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, Compound No. 11_1), (p) [LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, Compound No. 4_3), (q) [LR](T)[PS2].[LR](A)[PS2].[dR](G)[sP].[dR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 12, Compound No. 12_1), (r) [MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T) (SEQ ID NO: 5, Compound No. 5_3), (s) [MOE](T)[sP].[MOE](A)[sP].[MOE](G)[sP].[MOE](A)[sP].[LR](G)[PS2].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[mR](U)[sP].[dR](G)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[MOE](T) (SEQ ID NO: 13, Compound No. 13_1), (t) [LR](A)[PS2].[LR](T)[sP].[LR](A)[sP].[LR](G)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 14, Compound No. 14_1), (u) [LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 15, Compound No. 15_1), (v) [LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 16, Compound No. 16_1), (w) [MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP][dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 16, Compound No. 16_2), (x) [MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP][dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 16, Compound No. 16_3), (y)[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_3), (z)[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_4), (aa)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_5), (ab)[LR](A)[PS2].[MOE](A)[sP].[MOE](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 2, Compound No. 2_6), (ac)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_7), (ad)[MOE](A)[sP].[MOE](A)[sP].[LR](A)[PS2].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 2, Compound No. 2_8), (ae)[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[sP].[MOE]([5meC])(SEQ ID NO: 2, Compound No. 2_9), (af)[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_10), (ag)[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC])(SEQ ID NO: 2, Compound No. 2_11), (ah)[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 2, Compound No. 2_12), (ai)[MOE](A)[sP].[MOE](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 17, Compound No. 17_1), (aj)[LR](A)[PS2].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 18, Compound No. 18_1), (ak)[LR](A)[PS2].[LR](G)[sP].[dR](G)[sP].[dR](C)[sP].[LR](A)[sP].[mR](U)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 19, Compound No. 19_1), (al)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 20, Compound No. 20_1), (am)[LR](G)[PS2].[LR]([5meC])[sP].[mR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 20, Compound No. 20_2), (an)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 20, Compound No. 20_3), (ao)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 20, Compound No. 20_4), (ap)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[MOE]([5meC]) (SEQ ID NO: 20, Compound No. 20_5), (aq)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[mR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 20, Compound No. 20_6), (ar)[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 6, Compound No. 6_2), (as)[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 6, Compound No. 6_3), (at) [LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 6, Compound No. 6_4), (au) [LR](G)[PS2].[LR]([5meC])[sP].[mR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 6, Compound No. 6_5), (av) [LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 6, Compound No. 6_6), (aw) [LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 6, Compound No. 6_7), (ax)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[mR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 6, Compound No. 6_8), (ay)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[MOE](T)(SEQ ID NO: 6, Compound No. 6_9), (az)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[MOE]([5meC])[sP].[MOE](T)(SEQ ID NO: 6, Compound No. 6_10), (ba)[MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[PS2].[LR]([5meC])[PS2].[MOE](T)(SEQ ID NO: 6, Compound No. 6_11), (bb) [MOE](G)[sP].[LR]([5meC])[PS2].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[PS2].[LR](T)[PS2].[MOE]([5meC])[sP].[MOE](T) (SEQ ID NO: 6, Compound No. 6_12), (bc) [LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 21, Compound No. 21_1), (bd) [LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 22, Compound No. 22_1), (be) [LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[LR](T)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 23, Compound No. 23_1), (bf)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[mR](U)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 24, Compound No. 24_1), (bg)[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 25, Compound No. 25_1), (bh)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[mR](U)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T)(SEQ ID NO: 25, Compound No. 25_2), (bi)[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC])(SEQ ID NO: 26, Compound No. 26_1), (bj) [LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 27, Compound No. 27_1), (bk) [LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 27, Compound No. 27_2), (bl) [LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[mR](U)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 28, Compound No. 28_1), (bm) [LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[mR](U)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 29, Compound No. 29_1), (bn) [LR] (G) [PS2]. [LR] ([5meC]) [sP]. [dR] (A) [sP]. [mR] (U) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (G) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR] ([5meC]) [PS2]. [LR](T) (SEQ ID NO: 30, compound NO: 30_1), (bo) [LR] (G) [sP]. [LR] (T) [sP]. [LR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (A) [sP]. [mR] (G) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR](T) (SEQ ID NO: 11, compound number 11_2), and (bp) [LR] (G) [sP]. [LR] (T) [sP]. [LR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (A) [sP]. [mR] (G) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [LR] (T) [sP]. [LR] (T) [PS2]. [LR](T) (SEQ ID NO: 11, compound number 11_3), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase, ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase; ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase; (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase; [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and succeeding nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and succeeding nucleosides).

22. 22. An antisense oligonucleotide conjugate comprising the antisense oligonucleotide of any one of claims 1 to 21 covalently attached to at least one conjugate moiety.

23. 23. The antisense oligonucleotide conjugate of claim 22, wherein the conjugate moiety is an N-acetylgalactosamine (GalNAc) conjugate moiety.

24. 24. The antisense oligonucleotide conjugate of claim 23, wherein the GalNAc conjugate moiety is an aminohexyl-conjugated tri(N-acetyl-galactosamine) as shown in FIG.

25. An antisense oligonucleotide conjugate selected from: (a) [5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (A) [sP]. [LR] (G) [sP]. [dR] (G) [sP]. [dR] (C) [sP]. [LR] (A) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (G) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC]) (SEQ ID NO: 1, compound number 1_1, conjugate number 1_1), (b) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC])(SEQ ID NO: 2, Compound No. 2_1, Conjugate No. 2_1), (c) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](G)[sP].[mR](A)[sP].[dR](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T)(SEQ ID NO: 3, Compound No. 3_1, Conjugate No. 3_1), (d) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[PS2].[LR](T)[PS2].[LR](G)(SEQ ID NO: 4, Compound No. 4_1, Conjugate No. 4_1), (e)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (T) [PS2]. [LR](G)[sP]. [LR] (A) [sP]. [mR] (A) [sP]. [dR] (C) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR] (C) [sP]. [LR]([5meC])[sP]. [LR] (T) [PS2]. [LR](G)(Allocation No. 4, Compound No. 4_2, Cosmetic No. 4_2), (f)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (T) [PS2]. [LR] (A) [PS2]. [dR](G)[sP]. [dR] (A) [sP]. [LR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](G)[sP]. [dR](T)[sP]. [MOE]([5meC])[sP]. [MOE] (T) (Allocation number 5, compound number 5_1, コンジュゲート number 5_1), (g)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (T) [PS2]. [LR] (A) [sP]. [dR](G)[sP]. [dR] (A) [sP]. [LR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](G)[sP]. [dR](T)[sP]. [MOE]([5meC])[sP]. [MOE] (T) (Allocation number 5, compound number 5_2, コンジュゲート number 5_2), (h)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR](G)[sP]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[sP]. [LR](T)(Allocation No. 6, Compound No. 6_1, Cosmetic No. 6_1), (i)[5gn2c6]P. [dR](C)P. [dR](A)P. [MOE] (G) [sP]. [LR](G)[sP]. [dR] (C) [sP]. [LR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [MOE] (T) [sP]. [MOE] (T) [sP]. [MOE] ([5meC]) (Allocation number 7, compound number 7_1, コジュゲート number 7_1), (j)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR](G)[sP]. [LR](G)[sP]. [dR] (C) [sP]. [LR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [mR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR] ([5meC]) (Allocation number 7, compound number 7_2, コンジュゲート number 7_2), (k)[5gn2c6]P. [dR](C)P. [dR](A)P. [MOE] (G) [sP]. [MOE] (G) [sP]. [MOE]([5meC])[sP]. [LR] (A) [PS2]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [mR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [PS2]. [LR] (T) [PS2]. [LR] (T) [PS2]. [MOE] ([5meC]) (Allocation number 8, compound number 8_1, コジュゲート number 8_1), (l)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (A) [PS2]. [LR] (A) [PS2]. [dR] (A) [sP]. [mR] (A) [sP]. [LR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (C) [sP]. [dR](T)[sP]. [dR] (C) [sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [LR] (G) [PS2]. [LR]([5meC])(Allocation No. 2, Compound No. 2_2, COMBINED No. 2_2), (m)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (T) [PS2]. [LR](G)[sP]. [dR](G)[sP]. [LR] (A) [sP]. [dR] (C) [sP]. [dR] (A) [sP]. [mR](U)[sP]. [dR](G)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR] (A) [sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (A) [PS2]. [LR] ([5meC]) (Allocation number 9, compound number 9_1, コンジュゲート number 9_1), (n) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR](G)[PS2].[dR](A)[sP].[dR](C)[sP].[dR](A)[sP].[dR](T)[sP].[LR](G)[sP].[mR](U)[sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 10, Compound No. 10_1, Conjugate No. 10_1), (o) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[sP].[LR](T)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, Compound No. 11_1, Conjugate No. 11_1), (p) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](T)[PS2].[LR](G)[sP].[LR](A)[sP].[dR](A)[sP].[dR](C)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP][dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](C)[sP].[LR]([5meC])[sP].[LR](T)[PS2].[LR](G) (SEQ ID NO: 4, Compound No. 4_3, Conjugate No. 4_3), (q) [5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (T) [PS2]. [LR] (A) [PS2]. [dR] (G) [sP]. [dR] (A) [sP]. [LR] (G) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [mR] (U) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [MOE] ([5meC]) [sP]. [MOE](T) (SEQ ID NO: 12, compound number 12_1, conjugate number 12_1), (r) [5gn2c6]P. [dR](C)P. [dR](A)P. [MOE] (T) [sP]. [MOE] (A) [sP]. [MOE] (G) [sP]. [MOE] (A) [sP] [LR] (G) [PS2]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [LR] ([5meC]) [PS2]. [MOE](T) (SEQ ID NO:5, compound number 5_3, conjugate number 5_3), (s) [5gn2c6]P. [dR](C)P. [dR](A)P. [MOE] (T) [sP]. [MOE] (A) [sP]. [MOE] (G) [sP]. [MOE] (A) [sP] [LR] (G) [PS2]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [mR] (U) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [LR] ([5meC]) [PS2]. [MOE](T) (SEQ ID NO: 13, compound number 13_1, conjugate number 13_1), (t) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](T)[sP].[LR](A)[sP].[LR](G)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](G)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 14, Compound No. 14_1, Conjugate No. 14_1), (u) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 15, Compound No. 15_1, Conjugate No. 15_1), (v) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR]([PPG])[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 16, Compound No. 16_1, Conjugate No. 16_1), (w)5gn2c6((ｼd((3)P.[dｼ(()()() A!s][:(R)(()(S6,R]\,R]())((]]) )sP][d((1))(())))())))())() I.I.I.I.I.I.I.I.I.I.I.I.I.I.I.I. P][dR(3))sP((dR)())tsｰ]? )sP][db(Ai(]])))()())))()) s]!!((5(())s()((R)(1))PS((!!!!!!! 53) (16,000 square meters, 16,200 square meters) (x)5gn2cc6((]((3)(3)P. A!s][:R((()),SR]]\,RR())(]])) )sP][d((1))(())))())))())() I.I.I.I.I.I.I.I.I.I.I.I.I.I.I.I. P][dR(3))sP((dR)())tsｰ]? )sP][db(Ai(]])))()())))()) s]!!((((5())(3()))()(()))))()(!) me3)) (16,000 square feet, 16,300 square feet) (b)l2l2)l.l2)(3)l.l.l.l.l.l.l.l. A!PP([QR(()(]]]]]dR)())(]])) A!sP][:((1))(]]](dR((^]]))) ()!sP](]((())(]]](dｼ((3)(]())) )!s]]]](3))(sP)((dR(A)(]())() G)!ｰ][db(A)(ｳ)))(db(())((])) )sP][dR(1))(()))((())()))(32))) 40000000000000000000000000000000002020000000000000000000002 (20000000000000000000000) (z)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[PS2].[dR](A)[sP].[mR](A)[sP].[LR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[mR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_4, Conjugate No. 2_4), (aa)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_5, Conjugate No. 2_5), (ab)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[MOE](A)[sP].[MOE](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[PS2].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 2, Compound No. 2_6, Conjugate No. 2_6), (ac) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_7, Conjugate No. 2_7), (ad) [5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[MOE](A)[sP].[LR](A)[PS2].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[mR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 2, Compound No. 2_8, Conjugate No. 2_8), (ae) [5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[mR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[sP].[MOE]([5meC]) (SEQ ID NO: 2, Compound No. 2_9, Conjugate No. 2_9), (af)[5gn2c6]P.[dR](C)P.[dR](A)P.[LR](A)[PS2].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[LR]([5meC]) (SEQ ID NO: 2, Compound No. 2_10, Conjugate No. 2_10), (ag)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[sP].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[mR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 2, Compound No. 2_11, Conjugate No. 2_11), (ah)[5gn2c6]P.[dR](C)P.[dR](A)P.[MOE](A)[sP].[LR](A)[PS2].[LR](A)[sP].[dR](A)[sP].[dR](G)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[dR](T)[sP].[dR](C)[sP].[dR](A)[sP].[dR](G)[sP].[dR](A)[sP].[dR](T)[sP].[mR](A)[sP].[LR](G)[sP].[LR](G)[PS2].[MOE]([5meC]) (SEQ ID NO: 2, Compound No. 2_12, Conjugate No. 2_12), (ai)[5gn2c6]P. [dR](C)P. [dR](A)P. [MOE] (A) [sP]. [MOE] (A) [sP]. [LR] (A) [sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [mR](U)[sP]. [dR] (C) [sP]. [dR](T)[sP]. [dR] (C) [sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [LR](G)[sP]. [LR] (G) [PS2]. [MOE] ([5meC]) (Allocation number 17, compound number 17_1, コジュゲート number 17_1), (aj)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (A) [PS2]. [LR](G)[sP]. [dR](G)[sP]. [dR] (C) [sP]. [LR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [mR](U)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [PS2]. [LR] ([5meC]) (Allocation number 18, compound number 18_1, コジュゲート number 18_1), (ak)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (A) [PS2]. [LR](G)[sP]. [dR](G)[sP]. [dR] (C) [sP]. [LR] (A) [sP]. [mR](U)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [PS2]. [LR] ([5meC]) (Allocation number 19, compound number 19_1, コジュゲート number 19_1), (al)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [LR] ([5meC]) (Allocation number 20, compound number 20_1, コンジュゲート number 20_1), (am)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [mR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [LR] ([5meC]) (Allocation number 20, compound number 20_2, コンジュゲート number 20_2), (an)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [mR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [LR] ([5meC]) (Allocation number 20, compound number 20_3, コンジュゲート number 20_3), (ao)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [mR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [LR] ([5meC]) (Allocation number 20, compound number 20_4, コンジュゲート number 20_4), (ap)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [MOE] ([5meC]) (Allocation number 20, compound number 20_5, コジュゲート number 20_5), (aq)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [mR](G)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [LR] ([5meC]) (Allocation number 20, compound number 20_6, コンジュゲート number 20_6), (ar)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [LR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [LR]([5meC])[PS2]. [LR](T)(Allocation No. 6, Compound No. 6_2, Cosmetic No. 6_2), (as)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [LR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [mR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 6, compound number 6_3, コジュゲート number 6_3), (at)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [LR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [mR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 6, compound number 6_4, コジュゲート number 6_4), (au)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [mR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 6, compound number 6_5, コジュゲート number 6_5), (av)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [mR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 6, compound number 6_6, コジュゲート number 6_6), (aw)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [mR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 6, compound number 6_7, コジュゲート number 6_7), (ax)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [mR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 6, compound number 6_8, コジュゲート number 6_8), (ay)[5gn2c6]P. [dR](C)P. [dR](A)P. [MOE] (G) [sP]. [LR]([5meC])[PS2]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[PS2]. [MOE] (T) (Allocation number 6, compound number 6_9, コンジュゲート number 6_9), (az)[5gn2c6]P. [dR](C)P. [dR](A)P. [MOE] (G) [sP]. [LR]([5meC])[PS2]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [PS2]. [MOE]([5meC])[sP]. [MOE] (T) (Allocation number 6, compound number 6_10, コンジュゲート number 6_10), (ba)[5gn2c6]P. [dR](C)P. [dR](A)P. [MOE] (G) [sP]. [LR]([5meC])[PS2]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [PS2]. [LR]([5meC])[PS2]. [MOE] (T) (Allocation number 6, compound number 6_11, コンジュゲート number 6_11), (bb)[5gn2c6]P. [dR](C)P. [dR](A)P. [MOE] (G) [sP]. [LR]([5meC])[PS2]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [PS2]. [LR] (T) [PS2]. [MOE]([5meC])[sP]. [MOE] (T) (Allocation number 6, compound number 6_12, コンジュゲート number 6_12), (bc)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [dR](T)[sP]. [mR](U)[sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [LR] ([5meC]) (Allocation number 21, compound number 21_1, コンジュゲート number 21_1), (bd)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [mR](U)[sP]. [dR](T)[sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [LR] ([5meC]) (Allocation number 22, compound number 22_1, コンジュゲート number 22_1), (be)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [mR](U)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [LR] ([5meC]) (Allocation number 23, compound number 23_1, コジュゲート number 23_1), (bf)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [mR](U)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 24, compound number 24_1, コンジュゲート number 24_1), (bg)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [LR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [mR](U)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [dR](T)[sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 25, compound number 25_1, コンジュゲート number 25_1), (bh)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [mR](U)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 25, compound number 25_2, コンジュゲート number 25_2), (bi) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[LR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[LR](T)[PS2].[LR]([5meC]) (SEQ ID NO: 26, Compound No. 26_1, Conjugate No. 26_1), (bj) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[LR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[dR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 27, Compound No. 27_1, Conjugate No. 27_1), (bk) [5gn2c6]P.[dR](C)P.[dR](A)P.[LR](G)[PS2].[LR]([5meC])[sP].[dR](A)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A)[sP].[dR](G)[sP].[dR](G)[sP].[mR](U)[sP].[dR](T)[sP].[dR](T)[sP].[LR](T)[sP].[LR](T)[sP].[LR]([5meC])[PS2].[LR](T) (SEQ ID NO: 27, Compound No. 27_2, Conjugate No. 27_2), (bl)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [mR](U)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 28, compound number 28_1, コジュゲート number 28_1), (bm)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [dR](T)[sP]. [mR](U)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 29, compound number 29_1, コジュゲート number 29_1), (bn)[5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [PS2]. [LR]([5meC])[sP]. [dR] (A) [sP]. [mR](U)[sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](T)[sP]. [dR] (A) [sP]. [dR](G)[sP]. [dR](G)[sP]. [dR](T)[sP]. [dR](T)[sP]. [dR](T)[sP]. [LR] (T) [sP]. [LR] (T) [sP]. [LR]([5meC])[PS2]. [LR] (T) (Allocation number 30, compound number 30_1, コンジュゲート number 30_1), (bo) [5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [sP]. [LR] (T) [sP]. [LR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (A) [sP]. [mR] (G) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [LR](T)[sP].[LR](T)[sP].[LR](T) (SEQ ID NO:11, Compound No. 11_2, Conjugate No. 11_2), and (bp) [5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [sP]. [LR] (T) [sP]. [LR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (A) [sP]. [mR] (G) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [dR] (G) [sP]. [dR] (T) [sP]. [dR] (G) [sP]. [LR](T)[sP].[LR](T)[PS2].[LR](T) (SEQ ID NO: 11, compound number 11_3, conjugate number 11_3), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase, ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase; ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase; (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase; [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and succeeding nucleosides; [PS2] represents a phosphorodithioate internucleoside linkage between the preceding and succeeding nucleosides; P represents a phosphodiester internucleoside linkage between the preceding nucleoside or moiety and the following nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in FIG. 8).

26. An antisense oligonucleotide conjugate selected from conjugate number 2_1 shown in FIG. 2 and conjugate number 3_1 shown in FIG.

27. 27. The antisense oligonucleotide or antisense oligonucleotide conjugate of any one of claims 1 to 26, wherein the target sequence is a sequence of at least 17 contiguous nucleotides within the sequence GCCUAUCUGAGAAACUUUU (SEQ ID NO:32) (positions 2181 to 2199 of SEQ ID NO:45).

28. 28. The antisense oligonucleotide or antisense oligonucleotide conjugate of claim 27, wherein the target sequence is GCCUAUCUGAGAAACUUUU (SEQ ID NO:32) (positions 2181-2199 of SEQ ID NO:45).

29. 29. The antisense oligonucleotide or antisense oligonucleotide conjugate of claim 27 or claim 28, wherein the sequence of the antisense oligonucleotide and / or the sequence of the contiguous nucleotide sequence comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95% or 100% identity to AAAAGTTTCTCAGATAGGE (SEQ ID NO: 2).

30. An antisense oligonucleotide comprising or consisting of the following compound: [LR] (A) [PS2]. [LR] (A) [sP]. [dR] (A) [sP]. [mR] (A) [sP]. [LR] (G) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (C) [sP]. [dR] (T) [sP]. [dR] (C) [sP]. [dR] (A) [sP]. [dR] (G) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [mR] (G) [sP]. [LR] (G) [PS2]. [LR] ([5meC]) (SEQ ID NO: 2, compound number 2_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase, ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase; ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase; (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase; [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and succeeding nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and succeeding nucleosides).

31. An antisense oligonucleotide conjugate, wherein said antisense oligonucleotide conjugate is [5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (A) [PS2]. [LR] (A) [sP]. [dR] (A) [sP]. [mR] (A) [sP]. [LR] (G) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (C) [sP]. [dR] (T) [sP]. [dR] (C) [sP]. [dR] (A) [sP]. [dR] (G) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [mR] (G) [sP]. [LR] (G) [PS2]. [LR]([5meC]) (SEQ ID NO: 2, compound number 2_1, conjugate number 2_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase, ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase; ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase; (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase; [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and succeeding nucleosides; [PS2] represents a phosphorodithioate internucleoside linkage between the preceding and succeeding nucleosides; P represents a phosphodiester internucleoside linkage between the preceding nucleoside or moiety and the following nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in FIG. 8).

32. An antisense oligonucleotide conjugate, conjugate number 2_1, shown in FIG.

33. The antisense oligonucleotide or antisense oligonucleotide conjugate of any one of claims 1 to 26, wherein the target sequence is a sequence of at least 17 consecutive nucleotides within AAGUAAAAUUAACAUGUCCA (SEQ ID NO:43) (positions 16970 to 16989 of SEQ ID NO:45).

34. 34. The antisense oligonucleotide or antisense oligonucleotide conjugate of claim 33, wherein the target sequence is AAGUAAAAUUAACAUGUCC (SEQ ID NO:33) (positions 16970-16988 of SEQ ID NO:45).

35. 35. The antisense oligonucleotide or antisense oligonucleotide conjugate of claim 33 or claim 34, wherein the sequence of the antisense oligonucleotide and / or the sequence of the consecutive nucleotide sequence comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95% or 100% identity to GGACATGTTAATTTTAACTT (SEQ ID NO: 3).

36. An antisense oligonucleotide comprising or consisting of the following compound: [LR] (G) [sP]. [LR] (G) [sP]. [mR] (A) [sP]. [dR] (C) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [LR] (G) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [LR] (T) (SEQ ID NO: 3, compound number 3_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase, ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase; ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase; (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase; [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and succeeding nucleosides; [PS2] indicates a phosphorodithioate internucleoside linkage between the preceding and succeeding nucleosides).

37. An antisense oligonucleotide conjugate, wherein said antisense oligonucleotide conjugate is [5gn2c6]P. [dR](C)P. [dR](A)P. [LR] (G) [sP]. [LR] (G) [sP]. [mR] (A) [sP]. [dR] (C) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [LR] (G) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (A) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (T) [sP]. [dR] (A) [sP]. [dR] (C) [sP]. [LR] (T) [PS2]. [LR](T) (SEQ ID NO:3, compound number 3_1, conjugate number 3_1), (In the formula, (A) is a nucleoside containing an adenine nucleobase, (C) is a nucleoside containing a cytosine nucleobase, ([5meC]) is a nucleoside containing a 5-methylcytosine nucleobase; ([PPG]) is a nucleoside containing a 7-deaza-8-azaguanine nucleobase; (G) is a nucleoside containing a guanine nucleobase; (U) is a nucleoside containing a uracil nucleobase; (T) is a nucleoside containing a thymine nucleobase; [LR] indicates that the following nucleoside is a beta-D-oxy-LNA nucleoside; [dR] indicates that the following nucleoside is a DNA nucleoside; [mR] indicates that the following nucleoside is a 2'-O-methyl RNA nucleoside; [MOE] indicates that the following nucleoside is a 2'-O-methoxyethyl RNA (MOE RNA) nucleoside; [sP] indicates a phosphorothioate internucleoside linkage between the preceding and succeeding nucleosides; [PS2] represents a phosphorodithioate internucleoside linkage between the preceding and succeeding nucleosides; P represents a phosphodiester internucleoside linkage between the preceding nucleoside or moiety and the following nucleoside; [5gn2c6] is an aminohexyl-conjugated tri(N-acetyl-galactosamine) moiety shown in FIG. 8).

38. An antisense oligonucleotide conjugate, conjugate number 3_1, shown in FIG.

39. The antisense oligonucleotide or antisense oligonucleotide conjugate of any one of claims 1 to 38, wherein the antisense oligonucleotide or the antisense oligonucleotide conjugate is in the form of a pharma- ceutically acceptable salt.

40. 40. The antisense oligonucleotide or antisense oligonucleotide conjugate of any one of claims 1 to 39, wherein the antisense oligonucleotide or antisense oligonucleotide conjugate is encapsulated in a lipid-based delivery vehicle, covalently linked or encapsulated in a dendrimer, or conjugated to an aptamer.

41. A pharmaceutical composition comprising an antisense oligonucleotide or an antisense oligonucleotide conjugate according to any one of claims 1 to 40, and a pharma- ceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

42. An in vitro or in vivo method for reducing A1CF expression in a target cell, comprising administering to the target cell an effective amount of an antisense oligonucleotide or an antisense oligonucleotide conjugate according to any one of claims 1 to 40, or a pharmaceutical composition according to claim 41.

43. A method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a therapeutically or prophylactically effective amount of an antisense oligonucleotide or an antisense oligonucleotide conjugate according to any one of claims 1 to 40, or a pharmaceutical composition according to claim 41.

44. An antisense oligonucleotide or an antisense oligonucleotide conjugate according to any one of claims 1 to 40, or a pharmaceutical composition according to claim 41, for use in the treatment or prevention of a disease in a subject.

45. Use of an antisense oligonucleotide or an antisense oligonucleotide conjugate according to any one of claims 1 to 40, or a pharmaceutical composition according to claim 41, for the preparation of a medicament for treating or preventing a disease in a subject.

46. The method according to claim 43, the antisense oligonucleotide for use according to claim 44, the antisense oligonucleotide conjugate for use according to claim 44 or the pharmaceutical composition for use according to claim 44, or the use according to claim 45, wherein the disease is HBV infection.

Images