Systems, tools and methods for engineering bacteria

Abstract

The present invention relates to a system, a tool and a method for engineering bacteria. The present invention relates in particular to a specific relative configuration of different elements that allows and is convenient to use for robust genome modification of bacterial genomes. In certain embodiments of the system, the tool and the method, genetically modified bacteria can be obtained that do not contain any scar sequence. A further aspect of the present invention relates to an innovative inducible expression system suitable for obtaining regulated gene expression in bacteria.

Description

[Technical field]

[0001] FIELD OF THEINVENTION The present invention is located in the technical field of molecular biology, more specifically in the technical field of genome engineering. Aspects of the present invention relate to tools, systems and methods for engineering bacteria. The present invention further relates to an innovative inducible expression system, particularly suitable for use in bacteria, such as Mycoplasma bacteria. [Background technology]

[0002] 2. Background of the Invention In 1998, a new logic for manipulating bacterial genomes, called recombineering, was developed (Murphy et al., J Bacteriol, 1998; Zhang et al., Nat Genet, 1998). This technology relies on phage-derived proteins such as those encoded by the Red operon from λ phage or RecET from the Rac prophage. Both systems encode at least two distinct protein activities: (i) a 5' to 3' dsDNA exonuclease (Exo and RecE, respectively, described in Little et al., J Biol Chem, 1967; and Clark et al., Cold Spring Harb Symp Quant Biol, 1984) and (ii) a single-stranded (ss)DNA annealing protein (SSAP) (Beta and RecT, respectively, described in Li et al., J Mol Biol, 1998; and Hall et al., J Bacteriol, 1993). Thanks to the coordinated action of these two activities, recombineering protocols use linear dsDNA fragments as substrates for recombination, even when they have regions of homology as short as 40 nucleotides (nt) (Datsenko, Proc Natl Acad Sci USA, 2000).

[0003] However, recombineering using dsDNA substrates was mostly limited to Escherichia coli (E, coli) genome engineering, and the technology only really flourished when it was discovered that synthetic ssDNA molecules (i.e., commercially available oligonucleotides) could be used as recombinogenic substrates (Ellis et al., Proc Natl Acad Sci USA, 2001). This process, known as oligonucleotide recombineering (hereafter oligorecombineering), requires only the activity of phage-derived SSAPs to mediate homology-driven hybridization of editing oligonucleotides with the lagging strand of the replication fork. Oligorecombineering was initially set up in Escherichia coli (E. coli) using the β protein of λ phage as the SSAP, but attempts to directly transfer this technology to other bacteria have given limited results (Ricaurte et al., Microb Biotechnol, 2018; Sun et al., Appl Microbiol Biotechnol, 2015). Indeed, the performance of phage-derived recombinases is not maintained across different bacterial genera and depends on the phylogenetic distance between the phage's natural host and the bacteria being engineered (Filsinger et al., Nat Chem Biol, 2021). These findings prompted the investigation of phage genomes to identify efficient SSAPs for a wide variety of microorganisms. This has enabled the use of oligorecombineering protocols in at least 29 different bacterial species (Wannier et al., Nar Rev Methods Primers, 2021), and the recent development of a method called "Serial Enrichment for Efficient recombineering" (SEER, Wannier et al., Proc Natl Acad Sci USA, 2020) promises to further expand the range of editable microorganisms.

[0004] However, oligorecombineering also features a major drawback due to the small size of the recombinogenic substrates used in this technique, which prevents the introduction of large inserts of DNA at precise locations. This limits this technique to gene deletions, nucleotide substitutions, or the introduction of very small sequences. Importantly, this same limitation precludes the inclusion of a selection marker, which would facilitate the selection of edited cells. In some species, this is not a major issue since small edits can be obtained at ultra-high frequencies (e.g., 5.1 × 10 in E. coli). -1 However, the oligorecombineering protocols employed in most strains have modest editing rates (10 -2 ~10 -5 ) (Wannier et al., Proc Natl Acad Sci USA, 2020). Moreover, in all species, oligo incorporation rates tend to decline in a power trend that correlates with the size of the attempted edit (Wang et al., Nature, 2009; Pinero Lambea et al., ACS Synth Biol, 2020). This makes the selection of cells with large genetic alterations a cumbersome process, even for species for which highly efficient oligorecombineering protocols are available. To solve this, oligorecombineering protocols have been combined with CRISPR / Cas9-based counterselection methods, in which sgRNAs are designed to generate double-strand breaks (DSBs) only in unmodified cells (Aparicio et al., Biotechnol J, 2018). Nevertheless, gene portions encoding the CRISPR / Cas9 system have a frequency (10 ) that can exceed that of oligorecombineering for large (i.e., substantial) genetic alterations. -3 ~10 -4 ) can accumulate mutations (Aparicio et al., Biotechnol J, 2018; Oh and Van Pijkeren, Nucleic Acids Res, 2014), preventing the selection of edited cells.

[0005] Therefore, there is an unmet need for genome engineering tools and methods that combine the ease of use and high editing efficiency of oligorecombineering with the high selection potential of antibiotic resistance inclusion. Ideally, such tools would allow the generation of i) several seamless mutants (i.e., mutants lacking residual scar sequences) with gene deletions at different loci (including edited genomic regions of up to 30 kb), and ii) deletions of large DNA segments containing non-essential and / or essential genes. Such marker-free, scarless editing methods would greatly facilitate the engineering of different bacterial species, ultimately facilitating further development in the field of synthetic biology. Summary of the Invention [Means for solving the problem]

[0006] Summary of the Invention As demonstrated in detail by the examples described herein, the present invention relates to tools, systems and methods for modifying bacterial genomic sequences. The inventors have defined a set of components, preferably nucleotide arrangements, that allow the modification of genomic sequences of bacterial cells in a robust manner by using tools, systems and methods that are convenient to use. The genome engineering workflow relies on the specific positioning of recombinase sites and the use of their corresponding recombinases to allow the modification of the genome sequence of virtually any bacteria, including bacterial cells that are notoriously difficult to genetically modify under controlled conditions, such as Mycoplasma bacteria. An embodiment of the present invention allows the obtaining of genetically modified bacteria whose genome sequence only differs from its naturally occurring (i.e. non-genetically modified) counterpart by the inserted nucleotide sequence, but without redundant and residual sequences used in the genome engineering process. Furthermore, the inventors have developed an innovative inducible expression system that allows highly regulated expression of the gene product of interest.

[0007] Therefore, the present invention provides the following aspects.

[0008] 1. An oligonucleotide modification system for genetic modification of bacteria, comprising: the bacterium comprises a ssDNA annealing protein or an oligonucleotide encoding the ssDNA annealing protein; The oligonucleotide modification system: A first nucleotide sequence comprising: - two nucleotide sequences (HA1 and HA2), each of which comprises a stretch of at least 5 consecutive nucleotides (located at) the 5' and 3', respectively, of the target genomic sequence to be genetically modified; a recognition sequence for a first site-specific recombinase (RSA), Including, the first nucleotide arrangement is arranged to include one of the two nucleotide sequences (HA1) that comprises a stretch of at least 5 consecutive nucleotides 5' to the RSA recognition sequence, and the other nucleotide sequence (HA2) that comprises a stretch of at least 5 consecutive nucleotides 3' to the RSA recognition sequence; a first nucleotide sequence; A second oligonucleotide configuration, - a recognition sequence for said first site-specific recombinase (RSA), - at least two recognition sequences for a second site-specific recombinase (RSB), Including, The second nucleotide sequence is arranged to include at least one RSB recognition sequence 5' to the RSA recognition sequence and at least one RSB recognition sequence 3' to the RSA sequence. and a second oligonucleotide sequence.

[0009] Embodiment 2. The oligonucleotide modified system according to embodiment 1, wherein the two nucleotide sequences (HA1 and HA2) each comprise a stretch of at least 8 consecutive nucleotides, preferably each comprise a stretch of at least 10 consecutive nucleotides, more preferably each comprise a stretch of at least 15 consecutive nucleotides.

[0010] Aspect 3. The oligonucleotide modification system according to aspect 1 or 2, wherein the ssDNA annealing protein is a third recombinase, preferably a GP35 recombinase, more preferably a GP35 recombinase having a nucleotide sequence encoding a protein that is at least 65% identical, preferably at least 75% identical, more preferably at least 85% identical, and most preferably at least 95% identical to the amino acid sequence of GP35 from Bacillus subtilis bacteriophage SPP1 as defined by SEQ ID NO:1, based on the full length of the amino acid sequence of the recombinase.

[0011] Embodiment 4. The oligonucleotide modification system according to any one of embodiments 1 to 3, wherein the first recombinase, the second recombinase, and / or the third recombinase lacks cross-reactivity.

[0012] Embodiment 5. The oligonucleotide modification system according to any one of embodiments 1 to 4, wherein the second nucleotide arrangement further comprises a nucleotide sequence encoding at least one selectable marker that allows selection of a phenotype of a bacterium comprising the second nucleotide arrangement.

[0013] Embodiment 6. The oligonucleotide modification system according to embodiment 5, wherein the selection marker is a luminescent protein, an antibiotic resistance protein, a protein that alleviates an auxotrophy, a component of a toxin-antitoxin system, or any combination thereof.

[0014] Embodiment 7. The oligonucleotide modified system according to any one of embodiments 1 to 6, wherein the second nucleotide arrangement is a circular double-stranded DNA construct, preferably wherein said second nucleotide arrangement is a plasmid.

[0015] Embodiment 8. The oligonucleotide modification system according to any one of embodiments 1 to 7, wherein the second nucleotide arrangement further comprises a nucleotide sequence encoding a first recombinase (RSA) and / or a nucleotide sequence encoding a second recombinase (RSB), preferably each recombinase being operably linked to a promoter sequence.

[0016] Embodiment 9. The oligonucleotide modification system according to embodiment 8, wherein the first recombinase (RSA) and the second recombinase (RSB) are each operably and independently linked to a promoter sequence.

[0017] Embodiment 10. The oligonucleotide modification system according to embodiment 8 or 9, wherein the first recombinase (RSA) and the second recombinase (RSB) are each operably linked to a separate promoter sequence.

[0018] Embodiment 11. The oligonucleotide modification system according to any one of embodiments 8 to 10, wherein at least the first recombinase (RSA) or the second recombinase (RSB) is operably linked to an inducible operator sequence, preferably the second recombinase (RSB) is operably linked to an inducible operator sequence.

[0019] Embodiment 12. The oligonucleotide modification system according to any one of embodiments 8 to 11, wherein at least one of the recombinases is operably linked to a cumate promoter and operator sequence (CuO), preferably a cumate promoter and operator sequence (CuO) having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence identity to SEQ ID NO:6 or SEQ ID NO:10, most preferably a cumate promoter and operator sequence (CuO) comprising SEQ ID NO:6 or SEQ ID NO:10.

[0020] Embodiment 13. The first nucleotide arrangement is - between the RSA recognition sequence and a stretch of at least 5 consecutive nucleotides of the genomic sequence (HA1) of the bacterium to be modified 5' of the RSA recognition sequence, or - between the RSA recognition sequence and a stretch of at least 5 consecutive nucleotides of the genomic sequence (HA2) of the bacterium to be modified 3' of the RSA recognition sequence. and further comprising an intron-encoded endonuclease restriction site sequence located at Preferably, the intron-encoded endonuclease restriction site is an I-SceI endonuclease restriction site. 13. The oligonucleotide modification system according to any one of embodiments 1 to 12.

[0021] Embodiment 14. The oligonucleotide modification system according to any one of embodiments 1 to 12, wherein the first sequence consists essentially of or consists of two nucleotide sequences of at least 5 nucleotides of a bacterial genomic sequence and a site-specific recognition site sequence of a first recombinase (RSA).

[0022] Embodiment 15. The oligonucleotide modification system according to any one of embodiments 1 to 14, wherein the first recombinase and / or the second recombinase is selected from the group consisting of cre recombinase, Scre recombinase, Vika recombinase, and Bxb1 recombinase.

[0023] Aspect 16. The oligonucleotide modified system according to any one of aspects 1 to 15, wherein the bacterium is selected from the group consisting of Mycoplasma, Pseudomonas, and Lactobacillus, preferably the bacterium is Mycoplasma, more preferably the bacterium is Mycoplasma pneumoniae.

[0024] Embodiment 17. Use of an oligonucleotide modification system as defined in any one of embodiments 1 to 16 for the genetic modification of bacteria.

[0025] Embodiment 18. The use according to embodiment 17, wherein the oligonucleotide modification system is used to introduce a nucleotide sequence encoding a heterologous gene product into a bacterial genomic sequence.

[0026] Embodiment 19. The use according to embodiment 17 or 18, wherein the oligonucleotide modification system is used to replace and / or delete nucleotide sequences encoding one or more virulence factors.

[0027] Embodiment 20. The use according to embodiment 19, wherein the use of the oligonucleotide modification system results in a genetically modified bacterium that has reduced pathogenicity when introduced into a host organism, when compared to native and unmodified bacteria.

[0028] 21. A method for genetically modifying a bacterium, comprising: - transforming a culture of said bacteria containing a ssDNA annealing protein or an oligonucleotide encoding said ssDNA annealing protein with (i) an oligonucleotide modification system as defined in any one of aspects 1 to 16 and (ii) a first recombinase (RSA), - selecting from the culture those bacteria which comprise a genomic sequence in which the second nucleotide sequence has been integrated, - expressing a second recombinase (RSB) in the bacterium, thereby removing the second nucleotide sequence from the bacterial genomic sequence. A method comprising:

[0029] Embodiment 22. The method of embodiment 21, comprising the further step of selecting from the culture a bacterium, wherein the second nucleotide sequence has been deleted from the genomic sequence of the bacterium.

[0030] Embodiment 23. The method according to embodiment 21 or 22, wherein the first recombinase (RSA) and / or the second recombinase (RSB) are encoded by a nucleotide sequence of a third nucleotide arrangement.

[0031] Embodiment 24 The method according to embodiment 21 or 22, wherein the second recombinase (RSB) is encoded by a nucleotide sequence of the second nucleotide arrangement.

[0032] Embodiment 25. The method according to any one of embodiments 21 to 24, wherein the first and second recombinases are encoded by a nucleotide sequence of the second nucleotide arrangement.

[0033] Embodiment 26. The method according to any one of embodiments 21 to 25, wherein the second nucleotide arrangement is a circular double-stranded DNA construct, preferably said second nucleotide arrangement is a plasmid.

[0034] Embodiment 27. The method according to any one of embodiments 21 to 26, comprising individual regulation of expression of the first and / or second recombinase, preferably comprising sequential regulation of expression of the second recombinase.

[0035] Aspect 28. The method according to any one of aspects 21 to 26, comprising the further steps of contacting the bacterium with a nucleotide sequence consisting of HA1 and HA2 and contacting the bacterium with an intron-encoded endonuclease, preferably wherein the intron-encoded endonuclease is I-SceI endonuclease.

[0036] Embodiment 29. The method according to embodiment 28, wherein the obtained bacterium does not contain a site-specific recombinase scar sequence in its genomic sequence.

[0037] Embodiment 30. A genetically modified bacterium obtainable by a method defined in any one of embodiments 21 to 29.

[0038] Aspect 31. The genetically modified bacterium of aspect 30, wherein the bacterium does not contain a site-specific recombinase scar sequence in its genomic sequence.

[0039] Aspect 32. The genetically modified bacterium according to aspect 30 or 31, wherein the bacterium is selected from the group consisting of Mycoplasma, Pseudomonas, and Lactobacillus, preferably the bacterium is Mycoplasma, more preferably the bacterium is Mycoplasma pneumoniae.

[0040] Embodiment 33. A cumate promoter and operator sequence (CuO) comprising a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence identity to SEQ ID NO:6 or SEQ ID NO:10, and not comprising or consisting of SEQ ID NO:9 or SEQ ID NO:11, most preferably a cumate promoter and operator sequence (CuO) comprising SEQ ID NO:6 or SEQ ID NO:10.

[0041] Embodiment 34. A cumate promoter and operator sequence (CuO) according to embodiment 33, which consists essentially of or consists of a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence identity to SEQ ID NO:6 or SEQ ID NO:10, and does not comprise or consist of SEQ ID NO:9 or SEQ ID NO:11, most preferably the cumate promoter and operator sequence consists of SEQ ID NO:6 or SEQ ID NO:10.

[0042] Embodiment 35. A cumate inducible expression system comprising: - the repressor protein CymR or a nucleotide sequence encoding CymR, and - a nucleotide sequence comprising: 1) a cumate promoter and operator sequence (CuO) according to embodiment 33 or 34, and 3) a nucleotide sequence that encodes a gene product or that forms an insertion site suitable for insertion of a nucleotide-encoded gene product; Including, A cumate inducible expression system, wherein the cumate promoter and operator sequences are located 5' of a nucleotide sequence encoding a gene product or forming a suitable insertion site for insertion of a nucleotide-encoded gene product.

[0043] Embodiment 36. The cumate-inducible expression system according to embodiment 35, wherein the promoter sequence is a promoter sequence suitable for achieving expression of the gene product in a prokaryotic cell, preferably a promoter sequence suitable for achieving expression of the gene product in a bacterial cell.

[0044] Embodiment 37. A kit of parts comprising a cumate-inducible expression system as defined in embodiment 35 or 36, and cumate.

[0045] A cell comprising the cumate-inducible expression system according to embodiment 35 or 36.

[0046] Aspect 39. The cell according to aspect 38, wherein the cell is a prokaryotic cell, preferably a bacterial cell.

[0047] Embodiment 40. A method for obtaining inducible gene expression in a cell, comprising: - introducing into a cell a cumate-inducible expression system according to aspect 35 or 36, operably linked to a gene of interest; - contacting the cells with cumate, thereby achieving inducible expression of said gene. A method comprising:

[0048] The above and further aspects and preferred embodiments of the present invention are set out in the following section and in the appended claims, the subject matter of which is specifically incorporated into this specification. [Brief description of the drawings]

[0049] BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1] Rationale for the genome engineering method / system of the present invention. Cells with a wild-type (WT) genome are co-transformed with an editing oligo and a selector plasmid. The editing oligo is composed of two homologous arms (HA1 and HA2) that hybridize at regions flanking the target gene and a site-specific recombinase A recognition site (RSA). The selector plasmid has one copy of RSA and two copies of site-specific recombinase B recognition sites (RSB), as well as an antibiotic resistance gene (not shown). After an oligo-recombineering event catalyzed by a phage-derived SSAP, an edited genome with a "non-selectable" phenotype is generated. Site-specific recombinase A can then mediate recombination between the RSA introduced at the edited locus and the RSA present in the selector plasmid, thereby integrating the vector and generating a selectable phenotype for the edited cells. Finally, site-specific recombinase B can drive the excision of the vector via recombination between the two RSBs. [Figure 2A] Validation of the genome engineering system at four different loci. Scheme showing the chromosomal location of the four loci selected to test the functionality of the system. Insert: Detailed scheme of the target region showing the coding sequence present in either the plus strand (top) or minus strand (bottom) and the molecule that will be transformed into the cell. The shaded triangles indicate where in the chromosome the sequence used as HA is present, at a distance of 1 kb from each other. [Figure 2B]As an example, a scheme showing the chromosomal conformation of the mpn088 locus before editing (unedited genome) and after editing with the inserted plasmid (edited genome) or the excised plasmid (edited and degraded genome). The black arrows above and below the genome represent the primers used for PCR screening, and their expected sizes are shown above the dashed lines connecting them. [Figure 2C] Top: Electrophoretic analysis of PCR performed at the indicated loci in five different puromycin-resistant colonies (analyzed colonies); negative control and WT samples are included as references. The ratio of edited clones at each locus is based on the observed size of the PCR products. Bottom: Electrophoretic analysis of PCR products from the indicated loci in five different colonies (analyzed colonies) obtained after transformation of one clone carrying a plasmid inserted at the edited locus with a suicide plasmid encoding Vcre. Negative control and WT samples are included as references. [Diagram 3] Engineering efficiency of genome engineering methods at different loci. Histogram showing the number of puromycin-resistant colonies found in all four transformations performed to deplete 1 kb fragments of mpn088, mpn256, mpn440 and mpn583 genes. In the negative control, only 40 colonies were found, which corresponds to cells transformed with the selector plasmid without editing oligo. Thus, the insertion of the plasmid was dependent on the previous placement of the landing pad by the editing oligo. [Figure 4A]Performance of the methodology in the maximum removable region of the M. pneumoniae genome. Chromosome section representing the maximum removable region in the M. pneumoniae genome and showing a series of designed editing oligos. Coding sequences present on either the plus strand (top) or minus strand (bottom) are represented by arrows and gene identifiers related to essential genes (mpn489 and mpn515) and non-essential genes (remainder of annotated genes). Shaded triangles between the chromosome and oligos indicate where in the genome the sequence used as HA is present ("Δ" or "delta" indicates deletion hereafter throughout this disclosure). All editing oligos share a common 5' HA, but the 3' HA binds to chromosomal regions located at different distances from the 5' HA, as shown in each editing oligo above. [Figure 4B] As an example, schemes showing the expected chromosomal rearrangements upon Δ90bp (left) and Δ30kb (right) genome editing. The unedited genome for both cases is also shown. The black arrows above and below the genomes represent the primers used for PCR screening, and the expected sizes for each situation are shown above the dashed line connecting them. For all edits, the modified genome should produce a PCR product slightly larger than the selector plasmid (3.4kb), while the WT genome should produce a PCR product slightly larger than the attempted deletion. Note that for deletions of 10kb or more, the processivity of the polymerase is not efficient enough to amplify the products. [Figure 4C] Electrophoretic analysis of PCR performed for the indicated edits in five different puromycin-resistant colonies (e.g., analyzed colonies); negative control and WT samples are included as references. The percentage of edited clones at each locus is shown at the bottom of each figure. [Diagram 5]Further review of genome engineering methodology. Histogram (Figure 3A) showing the number of puromycin-resistant colonies found in various transformations performing depletions ranging from 90 bp to 30 kb of genomic regions for up to 5.48% of the non-essential (NE) genome (Lluch-Senar et al., Mol Syst Biol, 2015), where 25 NE-encoding genes (mpn490 to mpn514) are located. The number of puromycin-resistant colonies tends to decrease with the size of the attempted deletion, even though all transformations showed a higher number of colonies compared to the no-primer control. [Figure 6A] Scarless genome engineering method. Cells carrying the WT genome were co-transformed with SSR-A mediated plasmid integration and an editing oligo containing a restriction site for SceI enzyme and an RSA site between the two homology arms (HA1 and HA2). [Figure 6B] Upon integration of the vector, the edited cells had a resistance marker included in their genome. After picking colonies and isolating genomic DNA, the cells were analyzed by PCR. Four of the five clones analyzed showed a positive band at 3681 bp, consistent with the edited genome. [Figure 6C] Positive clones were transformed with the pSSR-B vector, which mediated excision of the integrated vector, thereby eliminating the resistance marker and leaving a scar of 326 bp sequence containing the SceI site and lox sequence from the recombination event. Four of the five clones analyzed were positive by PCR. [Figure 6D] Cells were transformed with oligos that eliminate 326 bp of the genome and a selector vector that allows expression of the SceI enzyme. The SceI enzyme did not cut if the cells were edited and they removed the scar. NT, non-transformed cells (e.g., DNA was from cells in the previous step), had an edited scar (cells that were not co-transformed with oligos and a Sce-encoding plasmid). [Figure 6E]Cells were transformed with an oligo that eliminated 326 bp of the genome and a selector vector that allows expression of the SceI enzyme. If the cell was not edited by the oligo, the genome was cut and the cell died. All five of the clones analyzed excised the SceI site, confirming that the scar had been removed. [Figure 7] Results of the scarless genome editing method. Histogram showing the number of colony forming units resistant to puromycin from co-transformation of editing oligos and selector vector, depleting a 90 bp region of the mpn490 gene and simultaneously containing an I-SceI restriction site. The number of colonies obtained was significantly higher in the co-transformation of editing oligos and selector vector than in the control transformation with only the pLoxPuro plasmid. [Figure 8A] Suitability of genome engineering methods with different SSRs. Structures of the different selector plasmids constructed and editing primers used to test their activity. All primers shared the same homology arms (HA1 and HA2) flanking the indicated RS. [Figure 8B] Scheme showing the chromosomal location of loci chosen to compare the efficiency of different selector plasmids. A more detailed view of the target region is shown in the box, showing the coding sequence present in either the plus (top) or minus (bottom) strand, and the molecule transformed into the cell. The HA of the editing primer has the sequence of the chromosomal plus strand, while the RS present in the editing oligo and selector plasmid are drawn in multiple colors to reflect that their sequences change depending on the particular RS / SSR pair used. The shaded triangle indicates where the sequences used as HA are present in the chromosome, 0.84 kb apart from each other. [Figure 8C]Scheme showing the chromosomal conformation of the mpn088 locus before editing (unedited genome) and after editing with the inserted plasmid (edited genome). The black arrows above and below the genome represent the primers used for PCR screening, and the expected sizes for each situation are shown above the dashed line connecting them. Note that the sizes shown correspond to the sizes expected using pLoxPuroCre as the selector plasmid, but all selector plasmids generate PCR products of similar size. [Figure 8D] Electrophoretic analysis of PCR performed for each selector plasmid on five different puromycin-resistant colonies (analyzed colonies); negative control and WT samples are included as references. The percentage of edited clones at each locus is indicated at the bottom of each image. [Figure 9] Extension of genome engineering method logic to different site-specific recombinases. Histogram representing the number of puromycin-resistant cells obtained after co-transformation of editing oligos with each of these selector plasmids in a strain expressing only GP35 as SSAP (strain M129-GP35). We observed a variable number of puromycin-resistant colonies, with pLoxPuroCre being the most productive vector and pSloxPuroScre being the least productive vector in terms of the number of colonies obtained. Control transformations with selector plasmids showed in most cases a limited number of colonies; however, control transformations with pVoxPuroVika gave about one-third of the number of colonies obtained in the co-transformation of this vector with editing oligos. This suggests the presence of vox-like sequences in the genome of M. pneumoniae, which led to non-specific integration of the vector, independent of the previous positioning in the target region of the vox landing by the editing oligo. [Figure 10]Genome engineering of gene platforms. Histogram showing the number of puromycin-resistant CFUs obtained from cotransformations performed with oligos designed to delete the entire region of 5.5 kb (mpn633 to mpn638) and the selector plasmid called pLoxPuroCreCOMP636-637. Cotransformation of both molecules in strain M129-GP35 gave rise to substantially more colonies than the control transformation with only the selector plasmid. [Figure 11A] Insertion of a gene platform at a desired location. Scheme showing the chromosomal location of the region where targeted insertion of the gene platform was tested. A more detailed view of the target region is shown in the box. The genes encoded in this region are only present in the plus strand (top strand), but their associated gene identifiers are essential genes (mpn636 and mpn637) or non-essential genes (mpn633, mpn634, mpn635, mpn638). Above the chromosome are depicted the editing oligo and selector plasmid transformed into the cell. The HA of the editing oligo has the sequence of the plus strand of the chromosome; the shaded triangle indicates the genomic location of the HA sequence, which is 5.5 kb away from each other. [Figure 11B] FIG. 1 shows the main features contained in the selector plasmid used for targeted insertion of the genetic platform (in this case the mpn636 and mpn637 genes). Note that features important to the engineering process are shown for clarity. [Figure 11C] Scheme showing the chromosomal conformation of the modified region before editing (unedited genome) and after editing with the inserted plasmid (edited genome) or with the excised plasmid (edited & degraded genome). Note that after excision, the two essential genes of the vector in which cloning occurred are maintained in the chromosome. The black arrows above and below the genome represent the primers used for PCR screening, and the expected sizes for each situation are shown above the dashed line connecting them. [Figure 11D]Top: Electrophoretic analysis of PCR performed on five different puromycin-resistant colonies (analyzed colonies); negative control and WT samples are included as references. The percentage of edited clones is indicated based on the observed size of the PCR products. Bottom: Electrophoretic analysis of PCR of five different colonies (analyzed colonies) obtained after transformation of one clone carrying a plasmid inserted at the edited locus with a suicide plasmid encoding Vcre. Negative control and WT samples are included as references. [Figure 12A] Development of a novel inducible system for M. pneumoniae based on the Pcum2.1 design. Schematic representation of the regulatory region of the cumate inducible system. The DNA sequences of the three tested promoters (Pcum1; PCum2 and Pcum2.1) derived from Pveg are shown in the dashed boxes. The Pcum1 design was based on the WT sequence of PVeg, which has two distinct binding sites for RNA polymerase (RNApol)78. In PCum2, the RNApol binding site more distal to CuO was removed. Pcum2.1 is a derivative of PCum2 in which seven nucleotides (lowercase letters in the sequence) were altered to increase the affinity of the RNApol complex for the sequence. Genes are represented by arrows. [Figure 12B] Histograms showing the fluorescent signal emitted by different strains expressing the Venus protein under different promoter sequences and inducer doses. The cumate-inducible system is compared side-by-side with an inducible system based on the tetracycline repressor (for each condition from left to right: M129 WT; M129 PCum1Venus; M129 PCum2Venus; M129 PCum2.1Venus; M129 PTetVenus). The WT strain without the Venus-encoding gene was included as a negative control for all induction conditions. [Figure 12C] Histogram showing leakiness for all lines (i.e., the ratio between the fluorescent signal in the absence of inducer and that observed in the WT strain) was negligible for all lines except for the PCum1 line, which produced a fluorescent signal 8-fold higher than that observed in the control strain. [Figure 12D]Histogram showing inducibility (i.e., fold change in Venus expression between optimal induction and non-induced conditions), which was nearly 3-fold higher for Pcum2.1 than for Ptet. [Figure 13A] Selection of small- and large-scale genome editing using all-in-one selector plasmids. Diagram showing the main features contained in the all-in-one selector plasmid, which can mediate its own integration and excision as needed. [Figure 13B] Left, scheme showing the expected chromosomal conformation upon the indicated genome editing selected with the pLoxPuroCreVcre plasmid. The black arrows above and below the genome represent the primers used for PCR screening, the expected size for each situation is shown above the dashed line connecting them. Right: electrophoretic analysis of PCR performed for the indicated editing in five different puromycin-resistant colonies (analyzed colonies), negative control and WT samples are included as references. The proportion of edited clones at each locus is shown at the bottom of each figure. [Figure 13C] Photograph of a 12-well plate inoculated with three clones carrying a Δ30 kb edit selected with pLoxPuroCreVcre and grown in the presence (+) or absence (-) of puromycin and cumate as indicated. Growth is monitored by measuring M. pneumoniae-associated acidification, which corresponds to a color change of the growth medium containing phenol red. Note: The rightmost column of the photograph is characterized by an intense red color (dark gray), whereas the three leftmost columns are characterized by a yellow color (light gray). [Figure 13D] Left, scheme showing the expected chromosomal conformation of the modified region in the Δ30kb edit after vector excision. Black arrows above and below the genome represent primers used for PCR screening, expected sizes are shown above the dashed lines. Right, PCR electrophoretic analysis was performed on three clones carrying the Δ30kb edit selected with pLoxPuroCreVcre, after induction of Vcre expression by growth in the presence of coumate (+). A non-induced clone (-) is shown as a reference. [Figure 14A] All-in-one vector. Histogram showing the number of puromycin-resistant colonies obtained in the different cotransformations (left: Δ90 bp; right: Δ30 kb). Regardless of the attempted modification, cotransformation of the editing oligo and the pLoxPuroCre selector plasmid resulted in the highest number of puromycin-resistant colonies. All cotransformations resulted in a clearly higher amount of puromycin-resistant colonies than those obtained in their respective control transformations containing only the selector plasmid. [Figure 14B] pLoxPuro selector vector. [Figure 14C] pLoxPuroCre selector vector. [Figure 14D] To confirm the exact identity of the clones obtained by transformation with the pLoxPuro selector vector, PCR analysis of five puromycin-resistant colonies was performed. [Figure 14E] PCR analyzed clones obtained using pLoxPuroCre as a selector vector. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0050] Detailed Description of the Invention As used herein, the singular forms "a," "an," and "the" include both singular and plural referents unless the context clearly dictates otherwise.

[0051] As used herein, the terms "comprising," "comprise," and "comprised of" are synonymous with "including," "include," "containing," or "contain" and are inclusive or open-ended and do not exclude additional, unrecited members, elements, or method steps. These terms also encompass "consisting of" and "consisting essentially of," which have well-established meanings in patent language.

[0052] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within each range, as well as the recited endpoints. This applies to numerical ranges whether introduced by the phrase "from to," "between," or otherwise.

[0053] As used herein, when referring to a measurable value such as a parameter, amount, duration, and the like, the term "about" or "approximately" is intended to encompass variations of the specified value and from the specified value, such as variations of + / - 10% or less, preferably + / - 5% or less, more preferably + / - 1% or less, and even more preferably + / - 0.1% or less, to the extent that such variations are appropriate for practice in the disclosed invention. It should be understood that the value to which the modifier "about" or "approximately" refers is itself also specifically and preferably disclosed.

[0054] The term "one or more" or "at least one," e.g., one or more elements or at least one element of a group of elements, will itself be apparent from further illustration, but the term specifically encompasses reference to any one of said elements, or any two or more of said elements, e.g., any of >3, >4, >5, >6, or >7 of said elements, and up to all of said elements. In other examples, "one or more" or "at least one" can refer to 1, 2, 3, 4, 5, 6, 7, or more.

[0055] The discussion of the background of the invention herein is included to explain the context of the invention and should not be construed as an admission that any of the mentioned material was published, known, or part of the common general knowledge in any country as of the priority date of any of the claims.

[0056] Throughout this disclosure, various publications, patents, and published patent specifications are referenced by specific citations. All documents cited herein are incorporated by reference in their entirety. In particular, the teachings or sections of such documents that are specifically mentioned in this specification are incorporated by reference.

[0057] Unless otherwise defined, all terms used in disclosing the present invention, including technical and scientific terms, have the meanings commonly understood by those skilled in the art to which the present invention belongs. As a further guide, definitions of terms are included to better understand the teachings of the present invention. When a particular term is defined in relation to a particular aspect of the present invention or a particular embodiment of the present invention, such connotation or meaning is intended to apply throughout this specification, i.e., in the context of other aspects or embodiments of the present invention, unless otherwise defined. For example, an embodiment relating to a product is also applicable to the corresponding method and use features.

[0058] In the following passages, different aspects or embodiments of the invention are defined in more detail. Each aspect or embodiment so defined can be combined with any other aspect or embodiment, unless expressly indicated otherwise. In particular, any feature indicated as being preferred or advantageous can be combined with any other feature indicated as being preferred or advantageous.

[0059] Throughout this specification, reference to "one embodiment" or "embodiment" means that a particular feature, configuration, or characteristic described in connection with an embodiment is included in at least one embodiment of the present invention. Thus, the appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification do not necessarily all refer to the same embodiment. Furthermore, particular features, structures, or characteristics can be combined in any suitable manner in one or more embodiments, as would be apparent to one of ordinary skill in the art from this disclosure. Furthermore, although some embodiments described herein include some features included in other embodiments (without other features included in other embodiments), combinations of features of different embodiments are intended to be within the scope of the present invention and form different embodiments, as would be understood by one of ordinary skill in the art. For example, in the appended claims, alternative combinations of the claimed embodiments are encompassed, as would be understood by one of ordinary skill in the art.

[0060] Amino acids are referred to herein by their full name, their three letter abbreviation or their one letter abbreviation. Unless otherwise specified, reference herein to any peptide, polypeptide, protein or nucleic acid, or fragment thereof, may also generally encompass modified forms of said peptide, polypeptide, protein or nucleic acid, or fragment thereof, having post-expression modifications, including the following non-limiting examples: phosphorylation, glycosylation, lipidation, methylation, cysteinylation, sulfonation, glutathionylation, acetylation, oxidation of methionine to methionine sulfoxide or methionine sulfone, or combinations thereof.

[0061] The term "plasmid", "plasmid vector", "expression vector" or "vector" as used herein refers to a nucleic acid molecule, typically DNA, into which a nucleic acid fragment, preferably a recombinant nucleic acid molecule as defined herein, can be inserted and cloned, i.e., propagated. Thus, a vector typically contains one or more unique restriction sites and may be capable of autonomous replication in a defined cell or vehicle organism, such that the cloned sequence can be reproduced. A vector may also preferably contain a selection marker, such as an antibiotic resistance gene, to allow for the selection of recipient cells that contain the vector.

[0062] As used herein, "gene product" refers to any molecule that is directly derived from a gene or a functional fragment of a gene. Those skilled in the art will recognize that the term "gene product" can also refer to a product that is derived from a non-naturally occurring operon contained in a Mycoplasma bacterium, as indicated by the terms "heterologous gene product" or "exogenous gene product." Thus, the term can encompass any protein of biotechnological interest.

[0063] The term "oligonucleotide modification system" as used in the context of the present invention refers to an assembly, i.e., a number of different molecular elements, that can specifically target and subsequently modify a nucleotide sequence. Oligonucleotide modification systems have been described in the art and can be introduced into target cells in various forms, as further described herein, including DNA, RNA, protein, or any combination herein. Those skilled in the art will understand that in the context used herein, the term modification system refers to a genome engineering system, and thus to an assembly of separate molecular elements (i.e., components) resulting from the alteration of a target nucleotide sequence. The term "oligonucleotide modification system" in no way imposes any limitations on the physical entities contained in said oligonucleotide modification system, but only reflects the entities that are intended to be modified. Thus, an oligonucleotide system may include one or more components that do not fall under the term "oligonucleotide", but would be understood by those skilled in the art, for example, as a protein. Furthermore, those skilled in the art will readily understand that the absolute and / or relative amounts of the separate components of an oligonucleotide modification system may need to be optimized on a case-by-case basis. Non-limiting exemplary parameters that may affect the absolute and / or relative amounts of the oligonucleotide modification system include the bacterium (i.e., bacterial strain) being modified, the tolerance of the bacterium, and / or the genomic sequence being modified, the genomic region or location being modified, and / or the purity of the components of the oligonucleotide modification system, for example, by transformation.

[0064] As used herein, "nucleotide arrangement" or synonymously "nucleotide sequence", "polynucleotide arrangement", "polynucleotide sequence" refers to an arrangement of multiple nucleotides that are physically linked to form a nucleotide sequence. Unless expressly stated otherwise, the nucleotide arrangements are not presented as part of or embedded in their naturally occurring genome. Means and methods for obtaining, producing, and modifying isolated polynucleotide sequences are well known to those skilled in the art (Alberts et al., Molecular Biology of the Cell. 4th edition, 2002).

[0065] As a guide, but not limited to, any nucleotide arrangement may be part of an expression vector, such as a plasmid, optionally a non-replicating plasmid, a phagemid, a bacteriophage, a bacteriophage-derived vector, an artificial chromosome, a minicircle, a lentiviral vector, a retroviral vector, an adenoviral or adeno-associated viral vector, a piggyback vector, or a tol2 vector. The skilled artisan will be aware of these various types of constructs, and their creation and manipulation have been detailed in many instances (Sambrook et al., Molecular cloning: a laboratory manual, ISBN 0879693096, 1989, and the corresponding updated 4 thEdition, Cold Spring Harbor Laboratory Press, 2012). Moreover, it is clear to the skilled artisan that plasmid DNA, or (circular) recombinant DNA, is generally referred to in the art as copy DNA, complementary DNA, or even by the abbreviation "cDNA", each of which may be used interchangeably. In certain embodiments, the nucleotide arrangement included in the oligonucleotide modification system is part of a bicistronic expression construct. In further embodiments, the nucleotide arrangement is incorporated, i.e. inserted, into a cellular genome, preferably a bacterial genomic sequence, more preferably a bacterial genomic sequence whose genomic sequence is to be modified. In yet further embodiments, the nucleotide arrangement is part of a cellular genome, for example a de novo designed cellular genome or a mutagenized or synthetic bacterium. In further embodiments, the nucleotide arrangement is included in a bacterial artificial chromosome or a yeast artificial chromosome. In certain embodiments, the 5' and / or 3' ends of the polynucleotide arrangement are modified to improve the stability of the sequence, in order to actively avoid degradation. Suitable modifications in this context include, but are not limited to, biotinylated nucleotides and phosphorothioate nucleotides. In certain embodiments, the polynucleotide sequence, multiple nucleotide arrangements, or complete oligonucleotide modification system disclosed herein is contained in a bacteriophage. In further embodiments, the polynucleotide sequence, multiple nucleotide arrangements, or complete oligonucleotide modification system disclosed herein is contained in a bacteriophage in the form of a gene drive. Those skilled in the art will recognize the term "gene drive" as further described in this disclosure. The term "bacteriophage" as described herein refers to a virus that can infect and optionally replicate in bacteria and archaea, which can be modified for therapeutic purposes, as described in the art (e.g., Principi et al., Advantages and Limitations of Bacteriophages for the Treatment of Bacterial Infections, Frontiers in Pharmacology, 2019).

[0066] "Genetic modification" as referred to herein refers to any change in the nucleotide sequence of an organism, in this context a bacterium. The type of modification is not particularly limited and therefore includes both insertion, rearrangement, deletion, point mutation, inversion, exchange, or combinations thereof, of one or more nucleotides in the target genomic sequence of the bacterium. The effect of the resulting genetic modification on the transcriptome and / or proteome of said bacterium is not particularly limited. Similarly, "genetically modified" as used herein refers to an organism or cell that comprises a genomic sequence that deviates from the genomic sequence of the organism or cell occurring under natural conditions. Thus, "genetically modified" refers to a non-naturally occurring organism or cell that is obtained by targeted mutagenesis, i.e., by artificial intervention. Thus, "genetically modified" as used herein excludes organisms that are newly found in nature and are the product of natural selection and / or natural evolutionary mutagenesis.

[0067] Suitable bacteria that can be modified using the tools, systems and methods described herein are not particularly limited. Thus, bacteria can be naturally occurring and / or commercially available bacteria. Those skilled in the art are aware of repositories and suppliers from which bacteria can be obtained, non-limiting examples of which are the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures, the American Type Culture Collection, or the National Collection of Type Cultures. Considering the idea that the collection of suitable bacteria that can be modified using the oligonucleotide modification system described herein is not particularly limited, bacteria can be bacteria with naturally occurring genomic sequences or bacteria with non-naturally occurring genomic sequences (e.g., bacteria that have been the subject of at least one previous artificially introduced genomic modification).

[0068] Throughout this disclosure, the relative position of a particular nucleotide sequence is indicated by the terms "5' (five prime)" and "3' (three prime)". Those skilled in the art will readily understand the meaning of these indicators and will recognize that they refer to a particular position of a particular nucleotide sequence relative to a second position of a particular nucleotide sequence. The term 5' may be used interchangeably with the term "upstream", which is also common in the art. The term 3' may be used interchangeably with the term "downstream", which is also common in the art. It is clear that these terms refer to the relative position of a nucleotide sequence or a portion thereof relative to another nucleotide sequence or a portion thereof in a larger nucleotide sequence. Throughout the art and in this disclosure, the 5' to 3' strand of a double-stranded nucleotide sequence is typically visualized as the top strand. In such representations, the 5' position is typically visually depicted as the more left position of the 5' to 3' strand, while the 3' position is typically visually depicted as the more right position of the 5' to 3' strand. Such exemplification does not impose any limitations on the actual relative positions of elements or portions of a nucleotide sequence, but is merely a conventional way of displaying a nucleotide sequence.

[0069] Throughout this disclosure, certain components of the oligonucleotide modification system may be exogenous components. "Exogenous" in this context refers to a component contained in a cell, not that cell type and / or organism, and said component is expressed in a naturally occurring context (i.e., wild-type, non-genetically modified, or non-engineered cell or organism). "Exogenous" may be used interchangeably with the term "heterologous" according to accepted nomenclature in the art and in the art of molecular biology. For example, those skilled in the art will understand that a protein that is exclusively expressed in wild-type E. coli is considered an exogenous (i.e., heterologous) protein in Mycoplasma bacteria when expressed in said Mycoplasma bacteria by engineering said Mycoplasma bacteria. Alternatively, a protein that is exclusively expressed in, for example, non-engineered hepatocytes is considered an exogenous protein when expressed in neuronal cells. Obviously, the terms "exogenous" and "heterologous" are not limited to being used in the context of proteins, but may equally be used to indicate foreign nucleotide sequences, such as DNA or RNA sequences (i.e., transcripts). Finally, the terms do not impose any restrictions on where the exogenous components are located in the engineered cell, and therefore include components so introduced into the cell (e.g., recombinant proteins), components introduced into the cell that result in the expression of the exogenous components (e.g., expression constructs, expression vectors, RNA sequences, etc.), and components stably inserted into the genomic sequence of the engineered cell, for example, by genome engineering methodology. Means and methods for expressing proteins, such as the construction of appropriate expression vectors, as well as methods that contribute to the establishment of any biological framework, including cells, that mediate the expression of one or more genes encoded in such expression vectors, are known to those skilled in the art and have been described in the art on numerous occasions (e.g., Srinivasan et al., Fundamentals of Molecular Biology, Current Developments in Biotechnology and Bioengineering, 2017).

[0070] A first aspect of the present invention relates to an oligonucleotide modification system suitable for the genetic modification of bacteria. More specifically, this aspect relates to an oligonucleotide modification system suitable for the genetic modification of bacteria, said bacteria comprising an ssDNA annealing protein or an oligonucleotide encoding said ssDNA annealing protein, said oligonucleotide modification system comprising a first nucleotide arrangement and a second nucleotide arrangement. The first nucleotide arrangement comprises two nucleotide sequences (HA1 and HA2), each of which comprises a stretch of at least 5 consecutive nucleotides of a target genomic sequence of the bacterium (i.e. the bacterium to be genetically modified) and a recognition sequence of a first site-specific recombinase (RSA). The two nucleotide sequences (HA1 and HA2) and the recognition sequence of the first site-specific recombinase (RSA) are arranged such that said first nucleotide arrangement comprises one of said two nucleotide sequences (HA1) comprising a stretch of at least 5 consecutive nucleotides 5' (located) of said RSA recognition sequence, and the other nucleotide sequence (HA2) comprising a stretch of at least 5 consecutive nucleotides 3' (located) of said RSA recognition sequence. The second nucleotide arrangement comprises a recognition sequence of the first site-specific recombinase (RSA) and at least two recognition sequences of the second site-specific recombinase (RSB). The recognition sequence of the first site-specific recombinase (RSA) and at least two recognition sequences of the second site-specific recombinase (RSB) are arranged such that the second nucleotide arrangement comprises at least one RSB recognition sequence 5' (located at) the RSA recognition sequence and at least one RSB recognition sequence 3' (located at) the RSA sequence. Such an oligonucleotide modification system provides a particularly interesting and convenient framework for the efficient introduction of genome modifications into a host bacterium.

[0071] A "stretch of x contiguous nucleotides" in the context of the present disclosure denotes a "linear nucleotide sequence of x nucleotides" as well as an "unbranched nucleotide sequence of x nucleotides".

[0072] The term "target genomic sequence" as used herein in conjunction with the term "target sequence" refers to any genomic sequence that is modified by an oligonucleotide modification system (e.g., by inserting one or more nucleotides, deleting one or more nucleotides, substituting one or more nucleotides, or any combination thereof). Thus, the term does not specifically limit the "information" encoded in the sequence, and thus includes both target (genomic) sequences that code for one or more gene products and target (genomic) sequences that do not code for gene products (such as, but not limited to, regulatory elements such as promoter sequences). There is also no limit to the length of the genomic sequence of interest, and those skilled in the art will readily understand that the target genomic sequence is smaller when attempting to introduce a single nucleotide mutation compared to the target genomic sequence when attempting to delete a nucleotide sequence that codes for a complete gene product such as a protein.

[0073] Those skilled in the art will understand that the abbreviations "HA1" and "HA2" refer to homology arms (HA). The use of the term "homologous arms" is widely known in the art of genome engineering, and therefore, in the context of the present invention, this term should be interpreted accordingly. Thus, the term "homologous arms" or "homologous regions" refers to a stretch (i.e., sequence) of consecutive nucleotides that is identical or essentially identical to a portion of the bacterial target genome sequence that is subjected to genetic modification. Those skilled in the art will further recognize that, in general, an increase in the number of mismatches of HA to the corresponding bacterial target genome sequence to be genetically modified leads to a further decrease in engineering efficiency (Fels et al., Front Microbiol, 2020).

[0074] As used herein, "ssDNA annealing protein" or the abbreviation "SSAP" refers to a protein capable of carrying out the process of single-strand (ss) annealing. More specifically, in this context, reference to a ssDNA annealing protein refers to a protein capable of mediating (i.e., carrying out, executing, initiating, completing) homology-driven hybridization of an editing oligonucleotide with the lagging strand of a replication fork. In embodiments described herein, the ssDNA annealing protein is a recombinase. In preferred embodiments, the ssDNA annealing protein is an exogenous ssDNA annealing protein, e.g., an exogenous recombinase. Nevertheless, in certain embodiments, the ssDNA annealing protein may be an endogenous ssDNA annealing protein, e.g., an endogenous recombinase. In certain embodiments in which the ssDNA annealing protein is encoded by an oligonucleotide, the oligonucleotide may be included in the cell as part of an expression vector, or the oligonucleotide may alternatively be integrated into (i.e., included as part of) the bacterial genomic sequence. In further alternative embodiments, the ssDNA annealing protein may be introduced into the cell as a recombinant protein or may be introduced into the cell as an RNA oligonucleotide transcript.

[0075] "Recombinase" as defined herein refers to an enzyme capable of performing genetic recombination. Those skilled in the art recognize that genetic recombination is interchangeably annotated in the art by the term "genetic reshuffling", which, when used in the context of genetic engineering, refers to the artificial and deliberate recombination of different DNA parts to create recombinant DNA. Depending on the number and orientation of DNA sites, there may be DNA inversions, rearrangements, deletions or insertions. Recombinases catalyze DNA exchange reactions, which are directionally sensitive between short target site sequences specific for each recombinase. In certain embodiments, the different pieces of DNA are derived from different organisms. In certain embodiments, one different DNA part is integrated into the genome of a host cell and a second different DNA part is recombinant DNA. In the art, the process describing the use of recombinases to exchange DNA sequences is alternatively commonly referred to as "recombineering". Recombineering is an efficient homologous recombination-based method for genome engineering, allowing precise insertion, deletion, or any kind of modification of any DNA sequence (Sharan et al., Nature Protocols, 2009). It will be clear to those skilled in the art that the term "recombinase" as used herein is in its broadest interpretation to refer to any protein that can assist, assist, or contribute to any kind of recombination activity, or that provides any kind of recombination activity.

[0076] It is well known to those skilled in the art that various recombinases have been described in eukaryotes, bacteria, archaea, phages and viruses. Both recombinases that depend only on the homology between different parts of DNA and recombinases that function only by including one or more specific nucleotide sequences in the different parts of DNA have been described. Several systems involving site-specific recombinases and short target sequences are used in molecular biology. Groups of site-specific DNA recombinase systems common for use in genome engineering and synthetic biology include, but are by no means limited to, the Hin / hix system, the Cre / lox system, the Flp / FRT system, the XerCD / dif system, the FimBE / fims system, the KD / KDRT system, the B2 / B2RT system, the B3 / B3RT system, the R / RSRT system, the VCreNloxP system, the SCre / SloxP system, the Vika / vox system, the Dre / rox system, the A-lnt / attP-attB system, the HK022 / attP-attB system, the cpC3 l / attP-attB system, the Bxb 1 / attP-attB system, the Gin / gix system, the Nigri / nox system, the Panto / pox system, and the Tn3 res siteI system. The various site-specific recombinase systems have been extensively reviewed on several occasions (Grindly et al., Molecular Medical Microbiology (Second edition-chapter 15), 2015).

[0077] Thus, the term "recognition sequence of a site-specific recombinase" refers to a specific nucleotide sequence that is recognized by a site-specific recombinase and is essential to initiate and / or complete the recombination process. In general, a recombination site has a nucleotide length ranging from about 30 to about 200 nucleotides and consists of at least two motifs with partial inverted repeat symmetry flanking a central crossover sequence to which the recombinase binds and where recombination takes place. The pair of sites between which recombination takes place can be identical (e.g., Lox sites) or non-identical (e.g., attP and attB sites of lambda integrase). Various pairs of recognition sequences (interchangeably denoted in the art by the term "recognition site") and site-specific recombinases have been described in the art and are known to the skilled artisan (e.g., Olorunniji et al., Biochem J, 2016). Site-specific recombinases are usually abbreviated in the art as "SSR". In certain embodiments, the recombinases referred to herein (e.g., RSA, RSB, and optionally SSAP) are tyrosine recombinases. In alternative embodiments, the recombinases referred to herein (e.g., RSA, RSB, and optionally SSAP) are tyrosine recombinases. In further alternative embodiments, the recombinases referred to herein (e.g., RSA, RSB, and optionally SSAP) are a combination of serine and tyrosine recombinases. The molecular mechanisms of both serine and tyrosine recombinases have been described in the art (e.g., Stark, Microbiol Spectr, 2014; and Jayaram et al., Microbiol Spectr, 2015, respectively).

[0078] As indicated above, the recognition sequence of the first site-specific recombinase (RSA) is preferably identical in the first and second nucleotide positions.

[0079] Instead of indicating the relative positions of different features of the oligonucleotide modification system by terms such as 5', 3', upstream and downstream, the relative positions can additionally or alternatively be indicated by terms such as "adjacent". "Adjacent" should be understood to simply indicate that a particular nucleotide sequence has two other sequences, which may or may not be identical sequences, at both 5' and 3' of said nucleotide sequence. Furthermore, "adjacent" is therefore not necessarily synonymous with expressions such as "directly adjacent" or "next to", although in certain embodiments this interpretation can be ascribed.

[0080] In certain embodiments, the oligonucleotide modification system further comprises one or more alternative nucleotide arrangements that read the first or second nucleotide arrangement of the oligonucleotide system described herein. For example, the oligonucleotide modification system may comprise the first nucleotide arrangement described herein and at least two different second nucleotide arrangements described herein. Alternatively, the oligonucleotide modification system may comprise at least two different first nucleotide arrangements described herein and at least two different second nucleotide arrangements described herein. Furthermore, the oligonucleotide modification system may comprise at least two different first nucleotide arrangements described herein and at least two different second nucleotide arrangements described herein. The inventors envision that such compositions of the oligonucleotide modification system allow for multiple genome manipulation (i.e., simultaneous or near-simultaneous modification of different genome regions and / or positions).

[0081] In certain embodiments, the first nucleotide arrangement has a nucleotide length of 20 to 2500 nucleotides. In preferred embodiments, the first nucleotide arrangement has a nucleotide length of 40 to 1250 nucleotides, preferably 44 to 1000 nucleotides, preferably 45 to 750 nucleotides, preferably 50 to 500 nucleotides, preferably 55 to 300 nucleotides, preferably 58 to 250 nucleotides, preferably 100 to 150 nucleotides. In certain embodiments such as those described above, the recognition sequence of the first site-specific recombinase (RSA) is a sequence having a sequence length of at least 34 nucleotides, preferably at least 47 nucleotides, more preferably at least 48 nucleotides. In certain embodiments, the first nucleotide arrangement has a nucleotide length of at least 44 nucleotides, preferably at least 45 nucleotides, preferably at least 50 nucleotides, preferably at least 55 nucleotides, preferably at least 58 nucleotides, preferably at least 60 nucleotides, preferably at least 65 nucleotides, preferably at least 70 nucleotides, preferably at least 75 nucleotides, preferably at least 80 nucleotides, preferably at least 85 nucleotides, preferably at least 90 nucleotides, preferably at least 95 nucleotides, preferably at least 100 nucleotides.

[0082] In a particular embodiment, an oligonucleotide modification system suitable for genetic modification of a bacterium is provided, said bacterium comprising an ssDNA annealing protein or an oligonucleotide encoding said ssDNA annealing protein, said oligonucleotide comprising a first nucleotide arrangement and a second nucleotide arrangement, said first nucleotide arrangement being two nucleotide sequences (HA1 and HA2) each consisting of a stretch of at least 5 consecutive nucleotides of a target genomic sequence of the bacterium (i.e. the bacterium to be genetically modified), and said first nucleotide arrangement being two nucleotide sequences (HA1 and HA2) each consisting of a stretch of at least 5 consecutive nucleotides 5' of an RSA recognition sequence. and a recognition sequence for a first site-specific recombinase (RSA) arranged such that one of the nucleotide sequences (HA1) consists of a stretch of at least 5 contiguous nucleotides 3' of the RSA recognition sequence and the other nucleotide sequence (HA2) consists of a stretch of at least 5 contiguous nucleotides 3' of the RSA recognition sequence, and the second nucleotide sequence comprises an RSA recognition sequence for said first site-specific recombinase and at least two recognition sequences for a second site-specific recombinase (RSB), such that said second nucleotide sequence consists of at least one RSB recognition sequence 5' of the RSA recognition sequence and at least one RSB recognition sequence 3' of the RSA sequence.

[0083] In a particular embodiment, an oligonucleotide modification system suitable for genetic modification of a bacterium is provided, said bacterium comprising an ssDNA annealing protein or an oligonucleotide encoding said ssDNA annealing protein, said oligonucleotide comprising a first nucleotide arrangement and a second nucleotide arrangement, said first nucleotide arrangement being one of two nucleotide sequences (HA1 and HA2) each consisting of a stretch of at least 5 consecutive nucleotides of a target genomic sequence of the bacterium (i.e. the bacterium to be genetically modified) and one of said two nucleotide sequences (HA1 and HA2) consisting of a stretch of at least 5 consecutive nucleotides 5' of an RSA recognition sequence (located at) said first nucleotide arrangement. A1) and another nucleotide sequence (HA2) consisting of a stretch of at least 5 consecutive nucleotides 3' of the RSA recognition sequence, wherein the second nucleotide arrangement comprises an RSA recognition sequence of said first site-specific recombinase and at least two recognition sequences of a second site-specific recombinase (RSB), such that said second nucleotide arrangement comprises at least one RSB recognition sequence 5' of the RSA recognition sequence and at least one RSB recognition sequence 3' of the RSA sequence.

[0084] In embodiments in which the methods described herein result in the production of genetically modified bacteria featuring one or more inserted exogenous genes or functional gene fragments, the inserted exogenous sequence or sequences (i.e., sequences that are permanently inserted into the genomic sequence of the bacteria) are preferably located at the second nucleotide position. The length of these sequences is not particularly limiting for the present invention.

[0085] In a particular embodiment, HA1 and HA2 each comprise a stretch of at least 6 contiguous nucleotides, preferably each comprise a stretch of at least 7 contiguous nucleotides, preferably each comprise a stretch of at least 8 contiguous nucleotides, preferably each comprise a stretch of at least 9 contiguous nucleotides, preferably each comprise a stretch of at least 10 contiguous nucleotides, preferably each comprise a stretch of at least 12 contiguous nucleotides, preferably each comprise a stretch of at least 15 contiguous nucleotides, preferably each comprise a stretch of at least 20 contiguous nucleotides. It is by no means essential that HA1 and HA2 are equal in terms of their base length. Thus, in certain embodiments, HA1 and HA2 each comprise a stretch of about 5 to about 200 nucleotides, preferably each comprise a stretch of about 6 to 175 contiguous nucleotides, preferably each comprise a stretch of about 7 to 150 contiguous nucleotides, preferably each comprise a stretch of 8 to 125 contiguous nucleotides, preferably each comprise a stretch of 9 to 100 contiguous nucleotides, preferably each comprise a stretch of 10 to 75 contiguous nucleotides, preferably each comprise a stretch of 12 to 50 contiguous nucleotides, preferably each comprise a stretch of 15 to 25 contiguous nucleotides, preferably each comprise a stretch of about 20 contiguous nucleotides.

[0086] In certain embodiments, the ssDNA annealing protein is a third recombinase.

[0087] In a preferred embodiment, the ssDNA annealing protein is a GP35 recombinase. In an even more preferred embodiment, the ssDNA annealing protein is a GP35 recombinase having an amino acid sequence that is at least 65% identical, preferably at least 70% identical, more preferably at least 75% identical, more preferably at least 80% identical, more preferably at least 85% identical, more preferably at least 90% identical, more preferably at least 92.5% identical, more preferably at least 95% identical, and most preferably at least 97.5% identical to the amino acid sequence of GP35 from Bacillus subtilis bacteriophage SPP1 as defined by SEQ ID NO: 1, based on the full length of the amino acid sequence of the recombinase. In a particular embodiment, the ssDNA annealing protein is a homolog or ortholog of GP35 from Bacillus subtilis bacteriophage SPP1. In a preferred embodiment, the ssDNA annealing protein is a GP35 recombinase having an amino acid sequence that is at least 95% identical to the amino acid sequence of GP35 from Bacillus subtilis bacteriophage SPP1 defined by SEQ ID NO:1. In a preferred embodiment, the bacterium is a Mycoplasma bacterium, preferably a Mycoplasma pneumoniae bacterium.

[0088] The SPP1 GP35 amino acid sequence, annotated under the NCBI reference sequence NP_690727.1, is reproduced below (SEQ ID NO:1): [ka]

[0089] In another preferred embodiment, the ssDNA annealing protein is recT recombinase. In an even more preferred embodiment, the ssDNA annealing protein is Lactobacillus reuteri recT recombinase or Enterococcus faecalis recT recombinase. In a particular embodiment, the ssDNA annealing protein is a homolog or ortholog of Lactobacillus reuteri recT recombinase or Enterococcus faecalis recT recombinase. In a further preferred embodiment, the recT recombinase is a recombinase having an amino acid sequence that is at least 65% identical, preferably at least 70% identical, more preferably at least 75% identical, more preferably at least 80% identical, more preferably at least 85% identical, more preferably at least 90% identical, more preferably at least 92.5% identical, more preferably at least 95% identical, and most preferably at least 97.5% identical, based on the full length of the amino acid sequence of the recombinase. In a preferred embodiment, where the ssDNA annealing protein is a Lactobacillus reuteri recT recombinase having an amino acid sequence that is at least 95% identical to the amino acid sequence of the Lactobacillus reuteri recT recombinase defined by SEQ ID NO: 2, the bacterium is a Lactobacillus bacterium.

[0090] The Lactobacillus reuteri recT recombinase amino acid sequence, annotated under the NCBI reference sequence WP_003668036.1, is reproduced below (SEQ ID NO: 2): [ka]

[0091] In yet an alternative further preferred embodiment, the recT recombinase is a recombinase having an amino acid sequence that is at least 65% identical, preferably at least 70% identical, more preferably at least 75% identical, more preferably at least 80% identical, more preferably at least 85% identical, more preferably at least 90% identical, more preferably at least 92.5% identical, more preferably at least 95% identical, and most preferably at least 97.5% identical, based on the full length of the amino acid sequence of the recombinase. In a preferred embodiment in which the ssDNA annealing protein is an Enterococcus faecalis recT recombinase having an amino acid sequence that is at least 95% identical to the amino acid sequence of the Enterococcus faecalis recT recombinase defined by SEQ ID NO: 3, the bacterium is a Lactobacillus bacterium.

[0092] The Enterococcus faecalis recT recombinase amino acid sequence, annotated under the GenBank reference sequence AAO81865.1, is reproduced below (SEQ ID NO: 3): [ka]

[0093] In alternative preferred embodiments, the ssDNA annealing protein is rec2 recombinase or Ssr recombinase. In even more preferred embodiments, the ssDNA annealing protein is Pseudomonas putida rec2 recombinase or Pseudomonas putida Ssr recombinase. In certain embodiments, the ssDNA annealing protein is a homolog or ortholog of Pseudomonas putida rec2 recombinase or Pseudomonas putida Ssr recombinase. In a further preferred embodiment, the rec2 recombinase is a recombinase having an amino acid sequence that is at least 65% identical, preferably at least 70% identical, more preferably at least 75% identical, more preferably at least 80% identical, more preferably at least 85% identical, more preferably at least 90% identical, more preferably at least 92.5% identical, more preferably at least 95% identical, and most preferably at least 97.5% identical, based on the full length of the amino acid sequence of the recombinase, to the amino acid sequence of the Pseudomonas putida rec2 recombinase defined by SEQ ID NO: 4. In a preferred embodiment, where the ssDNA annealing protein is a Pseudomonas putida rec2 recombinase having an amino acid sequence that is at least 95% identical to the amino acid sequence of the Pseudomonas putida rec2 recombinase defined by SEQ ID NO: 4, the bacterium is a Pseudomonas bacterium.

[0094] The Pseudomonas putida rec2 recombinase amino acid sequence as defined by the NCBI identifier WP_009397165.1 is reproduced below (SEQ ID NO: 4): [ka]

[0095] In a further preferred embodiment, the Ssr recombinase is a recombinase having an amino acid sequence that is at least 65% identical, preferably at least 70% identical, more preferably at least 75% identical, more preferably at least 80% identical, more preferably at least 85% identical, more preferably at least 90% identical, more preferably at least 92.5% identical, more preferably at least 95% identical, and most preferably at least 97.5% identical, based on the full length of the amino acid sequence of the recombinase, to the amino acid sequence of the Pseudomonas putida Ssr recombinase defined by SEQ ID NO: 5. In a preferred embodiment, where the ssDNA annealing protein is a Pseudomonas putida Ssr recombinase having an amino acid sequence that is at least 95% identical to the amino acid sequence of the Pseudomonas putida Ssr recombinase defined by SEQ ID NO: 5, the bacterium is a Pseudomonas bacterium.

[0096] The Pseudomonas putida Ssr recombinase amino acid sequence, as defined by the UniProtKB identifier I7AX46, is reproduced below (SEQ ID NO:5): [ka]

[0097] Methods and tools for verifying sequence homology or sequence identity between different sequences of amino acids or nucleic acids are well known to those skilled in the art, and include non-limiting tools such as Protein BLAST, ClustalW2, SIM alignment tool, TranslatorX and T-COFFEE. The percentage of identity between two sequences may show slight variability depending on the choice and parameters of the algorithm. The term "sequence identity" refers to the relationship between sequences at the nucleotide (or amino acid) level. The expression "% identical" is determined by comparing optimally aligned sequences, e.g., two or more, over a comparison window, and the portion of the sequence in the comparison window may contain insertions or deletions compared to the reference sequence for optimal alignment of the sequences. The reference sequence does not contain insertions or deletions. Select a reference window, then determine the number of nucleotides (or amino acids) that are identical between the sequences in the window, and calculate the "% identity" by dividing the number of identical nucleotides (or amino acids) by the number of nucleotides (or amino acids) in the window and multiplying by 100. Unless otherwise specified, the sequence identity is calculated over the entire length of the reference sequence.

[0098] The terms "homolog" and "ortholog" should be interpreted according to their generally accepted meaning in the art. Thus, one of skill in the art will understand that a "homologue" or "homolog" (used interchangeably with terms such as "homologous genes") is a gene inherited in two species by a common ancestor. Similarly, one of skill in the art will understand that an "orthologue" or "ortholog" (used interchangeably with terms such as "orthologous genes") is a gene in different species that evolved from a common ancestral gene by speciation and generally retains the same function during evolution.

[0099] In a particular embodiment, the first recombinase (RSA), the second recombinase (RSB), and / or the optional third recombinase are recombinases characterized by less than 50% cross-reactivity, preferably less than 40% cross-reactivity, more preferably less than 30% cross-reactivity, more preferably less than 25% cross-reactivity, more preferably less than 20% cross-reactivity, more preferably less than 20% cross-reactivity, more preferably less than 15% cross-reactivity, more preferably less than 10% cross-reactivity. In a further embodiment, the first recombinase (RSA), the second recombinase (RSB), and / or the optional third recombinase are recombinases that do not exhibit detectable cross-reactivity. "Cross-reactivity" in the context of this specification indicates that the recognition sequence intended to be exclusively bound by the first recombinase also exhibits some degree of reactivity when bound by the second recombinase. Methods for assessing the cross-reactivity of recombinases and recognition sites have been described in the art (e.g., Suzuki and Nakayama, Nucleic Acids Res, 2011) and are therefore known to those skilled in the art.

[0100] In certain embodiments, the second nucleotide arrangement further comprises a nucleotide sequence encoding at least one gene product that allows for phenotypic selection of bacteria that comprise the second nucleotide arrangement. Those skilled in the art will understand that "gene product that allows for phenotypic selection" are interchangeable and are generally referred to in the art as "selection markers". These terms should therefore be interpreted as any gene that encodes a gene product that confers a trait suitable for artificial selection. Thus, in the context of the present disclosure, these selection markers are highly suitable for separating bacteria that have not been recombined with the second nucleotide arrangement from bacteria that have been recombined with the second nucleotide arrangement. The trait that the selection marker introduces to the bacterial cell of interest is not particularly limited, and therefore also includes reporter genes. In certain embodiments, the at least one selection marker is a positive selection marker that confers a selective advantage to the bacterial cell. A non-limiting example characteristic of the present specification is an antibiotic resistance gene. In alternative embodiments, the at least one selection marker is a negative selection marker (i.e., a counter selectable marker) that reduces or prevents the growth of the bacterial cell of interest. A non-limiting example characteristic of the present invention is thymidine kinase, which is known to render cells sensitive to ganciclovir selection. In a further alternative embodiment, at least one selection marker is both a positive and a negative selection marker. A non-limiting example characteristic of the present invention is a gene whose corresponding gene product confers a selective advantage to the bacterial cell in a first condition, but reduces or prevents the growth of the bacterial cell in a second condition. A non-limiting example characteristic of the present invention is an enzyme that can alleviate an auxotrophy, but can also convert a particular molecule or substance into a molecule that is toxic to the bacterial cell. The skilled artisan will understand that "auxotrophy" refers to the inability of a cell to synthesize a product that is essential for its growth and / or survival. It will be further clear to the skilled artisan, aware of the above, that combinations of selection markers are equally envisioned in certain situations, such as situations in which multiple second oligonucleotide arrangements are used, or situations in which at least two selection criteria are required to arrive at the desired genetically modified bacterial cell.Thus, suitable selectable markers include, but are not limited to, a luminescent protein, an antibiotic resistance protein, a protein that confers an auxotrophy, a component of a toxin-antitoxin system, an enzyme, or any combination thereof.

[0101] In certain embodiments, the second nucleotide arrangement is (part of) a circular construct. In certain embodiments, the second nucleotide arrangement is (part of) a double-stranded DNA construct. In further embodiments, the second nucleotide arrangement is (part of) a circular double-stranded DNA construct. In yet further embodiments, the second nucleotide arrangement is (part of) an expression construct. In yet another embodiment, the second nucleotide arrangement is (part of) a plasmid. "Plasmid" refers to a circular double-stranded DNA construct into which additional DNA fragments (i.e., DNA nucleotide sequences) can be inserted by molecular cloning methods.

[0102] In certain embodiments, the second nucleotide arrangement further comprises a nucleotide sequence encoding a first recombinase (RSA) and / or a nucleotide sequence encoding a second recombinase (RSB), preferably each recombinase being operably linked to a promoter sequence. The term "operably linked" refers to multiple genetic elements linked as part of the same nucleic acid molecule, appropriately positioned and oriented for transcription initiated from the promoter. Thus, "operably linked" indicates that a specific nucleotide sequence encoding a specific gene product of interest (in the context of the present invention, encoding the first recombinase (RSA) and / or the second recombinase (RSB)) is linked to a regulatory element DNA, such as a promoter sequence, in an arrangement that allows expression of the gene product of interest. In certain embodiments, the first recombinase (RSA) and the second recombinase (RSB) are coded to be expressed as a fusion protein, the expression of said fusion protein being regulated by a single promoter sequence. In an alternative embodiment, the first recombinase (RSA) and the second recombinase (RSB) are coded to be expressed as one transcript, the expression of which is regulated by a single promoter sequence, and the single transcript translates into two physically distinct recombinases. In such an embodiment, the nucleotide sequence encoding the first recombinase (RSA) and the second recombinase (RSB) is adjacent to a third nucleotide sequence that causes separation during translation, such as a sequence encoding a 2A peptide. It is established in the art that the 2A peptide is a short peptide that results in the production of equimolar levels of multiple genes from the same mRNA. The ribosome skips synthesis of the peptide bond at the C-terminus of the 2A peptide, resulting in separation between the end of the 2A sequence and the next peptide downstream.This skipping occurs between glycine and proline residues found on the C-terminus, i.e., the upstream cistron has some additional residues added to its end, while the downstream cistron starts with a proline that is part of the 2A sequence (Liu et al., Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector, Scientific Reports, 2017). An alternative, non-limiting example of a third nucleotide sequence that causes separation during translation is the so-called internal ribosome entry site (IRES) sequence (Bochkov and Palmenberg, Biotechniques, 2018).

[0103] In an alternative embodiment, the nucleotide sequence encoding the first recombinase (RSA) and the nucleotide sequence encoding the second recombinase (RSB) are each operably linked to a separate promoter sequence, which may or may not be identical to each other. Thus, in a further embodiment, the nucleotide sequence encoding the first recombinase (RSA) and the nucleotide sequence encoding the second recombinase (RSB) are each operably linked to a dedicated promoter sequence. In such an embodiment, it can be understood that the nucleotide sequence encoding the first recombinase (RSA) and the nucleotide sequence encoding the second recombinase (RSB) are each operably linked to a promoter sequence that is not operably linked to the other recombinase. The term "unique" in this context does not impose a limitation on the embodiment in which it is assumed that the promoter sequences should contain different nucleotide sequences, although this can occur. Thus, in certain embodiments, the nucleotide sequence encoding the first recombinase (RSA) and the nucleotide sequence encoding the second recombinase (RSB) are each operably linked to a unique promoter sequence, and the promoter sequences do not have 100% sequence identity with each other. In alternative embodiments, the nucleotide sequence encoding the first recombinase (RSA) and the nucleotide sequence encoding the second recombinase (RSB) are each operably linked to a unique promoter sequence, and the promoter sequences do not have 100% sequence identity with each other. In some of the above embodiments, the promoter sequence allows the first recombinase (RSA) and the second recombinase (RSB) to be expressed independently of each other. In such embodiments, the oligonucleotide modification system comprises functionally independent promoter sequences.

[0104] The term "promoter" as defined herein is a region of DNA that initiates transcription of a particular gene, thus allowing transcription of the gene. Thus, a promoter is an example of a regulatory element. A promoter is recognized by RNA polymerase and subsequently initiates transcription. Thus, a promoter comprises a DNA sequence that is directly bound by RNA polymerase or is involved in the recruitment of RNA polymerase. A promoter sequence can also comprise an "enhancer region", which is one or more regions of DNA that can bind proteins (i.e., trans-acting factors) to enhance the transcription level of genes in a gene cluster. Enhancers are typically at the 5' end of a coding region, but can also be separate from the promoter sequence, for example, within an intron region of a gene or within the 3' of a coding region of a gene. A promoter can be located in close proximity to the start codon of a gene, in a preferred embodiment, on the same strand, typically upstream (5') of the gene. A promoter can vary in size, preferably about 100-1000 nucleotides in length. In certain embodiments, a promoter can be a constitutive promoter. A constitutive promoter is understood by those skilled in the art to be a promoter whose expression is constant under standard culture conditions, i.e., a promoter that expresses a gene product at a constant expression level. Alternatively, an inducible (conditional) promoter is understood to be a promoter that responds to at least one induction cue. Inducible promoters, more specifically bacterial inducible promoter systems, have been described in great detail in the art (see, inter alia, Brautaset et al., Positively regulated bacterial expression systems, Microbial biotechnology, 2009).

[0105] Thus, in certain embodiments, at least the first recombinase (RSA) and / or the second recombinase (RSB) are operably linked to an inducible operator sequence. In certain embodiments, the inducible promoter is chemically regulated (e.g., a promoter whose transcriptional activity is regulated by the presence or absence of a chemical inducer such as alcohol, tetracycline, steroids, metals, or other small molecules) or physically regulated (e.g., a promoter whose transcriptional activity is regulated by the presence or absence of a physical inducer such as light or high or low temperature). Inducible promoters can also be constitutive or regulated by other transcription factors that are themselves directly regulated by chemical or physical cues. In a preferred embodiment, the first recombinase (RSA) is operably linked to a constitutive promoter and the second recombinase (RSB) is operably linked to an inducible operator sequence.

[0106] As an alternative, non-limiting example, the inducible promoter can be the TetR promoter portion of the Tet-On or Tet-off system (Krueger et al., Tetracycline derivatives: alternative effectors for Tet transregulators, Biotechniques, 2004, and Loew et al., Improved Tet-responsive promoters with minimized background expression, BioMedCentral Biotechnology, 2010).

[0107] As an alternative, non-limiting example, at least one of the recombinases may be operably linked to a cumate promoter and operator sequence (CuO). In certain preferred embodiments, the cumate promoter and operator sequence (CuO) has at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95% sequence identity to SEQ ID NO:6 or SEQ ID NO:10, and does not include or consist of SEQ ID NO:9 or SEQ ID NO:11. In even more preferred embodiments, the cumate promoter and operator sequence comprises SEQ ID NO:6 or SEQ ID NO:10.

[0108] SEQ ID NO:6 and SEQ ID NO:10 are further objects of the invention as further discussed herein and correspond to the following nucleotide sequences: TTTATTTGACAAAAATGAGATTATTTGGTATAATTAATGTAGTAACAAACAGACAATCTGGTCTGTTTGTATTAATATAAACTAATAAGGAGGACAAAC (SEQ ID NO: 6) ATTTTGTCAAAATTTTATTTGACAAAAATGAGATTATTTGGTATAATTAATGTAGTAACAAACAGACAATCTGGTCTGTTTGTATTAATATAAACTAATAAGGAGGACAAAC (SEQ ID NO: 10)

[0109] In certain embodiments, the first nucleotide arrangement is a nucleotide sequence that essentially consists of or consists of a recognition sequence for a first recombinase (RSA) flanked by two homologous arms (HA1 and HA2) of at least 5 consecutive nucleotides each. Such embodiments do not exclude any embodiment in which the first nucleotide arrangement is a nucleotide sequence that essentially consists of or consists of a recognition sequence for a first recombinase (RSA) flanked by two homologous arms (HA1 and HA2) of at least 5 consecutive nucleotides each, and in which at least one nucleotide is chemically modified. For example, in any of the embodiments described herein, the 5' nucleotide and / or the 3' nucleotide may include a chemical modification that protects the first nucleotide arrangement from degradation upon introduction into the bacterium to be genetically modified. A non-limiting example of a suitable modification is a phosphorothioate modification.

[0110] In an alternative embodiment, the first nucleotide arrangement further comprises an intron-encoded endonuclease restriction site sequence located between the RSA recognition sequence and a stretch of at least 5 consecutive nucleotides of the genomic sequence (HA1) of the bacterium to be modified 5' to the RSA recognition sequence. In a further alternative embodiment, the first nucleotide arrangement further comprises an intron-encoded endonuclease restriction site sequence located between the RSA recognition sequence and a stretch of at least 5 consecutive nucleotides of the genomic sequence (HA2) of the bacterium to be modified 3' to the RSA recognition sequence. In a preferred embodiment, the intron-encoded endonuclease restriction site is an I-SceI endonuclease restriction site. In a further preferred embodiment, the intron-encoded endonuclease restriction site comprises the sequence 5'-TAGGGATAACAGGGTAAT-3' (SEQ ID NO: 8). In certain embodiments, the first nucleotide arrangement consists essentially of the following components, listed in 5' to 3' orientation: a stretch of at least 5 consecutive nucleotides of the genomic sequence of the bacterium to be modified (HA1), an I-SceI endonuclease restriction site, an RSA recognition sequence, and a second stretch of at least 5 consecutive nucleotides of the genomic sequence of the bacterium to be modified (HA2). In certain embodiments, the first nucleotide arrangement consists essentially of the following components, listed in 5' to 3' orientation: a stretch of at least 5 consecutive nucleotides of the genomic sequence of the bacterium to be modified (HA1), an RSA recognition sequence, an I-SceI endonuclease restriction site, and a second stretch of at least 5 consecutive nucleotides of the genomic sequence of the bacterium to be modified (HA2). In a preferred embodiment, the first nucleotide arrangement has a nucleotide length of 62 to 1250 nucleotides, preferably 65 to 1000 nucleotides, preferably 70 to 750 nucleotides, preferably 75 to 500 nucleotides, preferably 76 to 300 nucleotides, preferably 80 to 250 nucleotides, preferably 85 to 150 nucleotides.In certain embodiments, such as those described above, the recognition sequence of the first site-specific recombinase (RSA) is a sequence having a sequence length of at least 34 nucleotides, preferably at least 47 nucleotides, more preferably at least 48 nucleotides. In certain embodiments, the first nucleotide arrangement has a nucleotide length of at least 62 nucleotides, preferably at least 65 nucleotides, preferably at least 75 nucleotides, preferably at least 76 nucleotides, preferably at least 80 nucleotides, preferably at least 85 nucleotides, preferably at least 90 nucleotides, preferably at least 95 nucleotides, preferably at least 100 nucleotides, preferably at least 105 nucleotides, preferably at least 110 nucleotides, preferably at least 115 nucleotides, preferably at least 120 nucleotides, preferably at least 130 nucleotides.

[0111] The selection of the first and second recombinases in the present invention is not particularly limited. Illustrative non-limiting examples of suitable recombinases include cre recombinase, Scre recombinase, Vika recombinase, and Bxb1 recombinase.

[0112] Bacteria that can be genetically modified by the oligonucleotide modification system described herein are also not particularly limited. Non-limiting examples of bacteria include Mycoplasma bacteria, Pseudomonas bacteria and Lactobacillus bacteria. Each of the bacteria used in conjunction with the embodiments of the present invention described herein can be a naturally occurring bacterial strain (i.e., a wild-type strain) or a bacterial strain that has been artificially genetically modified at a previous time. In addition, so-called synthetic bacterial strains, i.e., strains newly synthesized by human synthetic biology approaches, are envisioned.

[0113] Exemplary Mycoplasma species include the following non-exhaustive list: M. adleri, M. agalactiae, M. agassizii, M. alcalescens, M. alligatoris, M. alvi, M. amphoriforme, M. anatis, M. anseris, M. arginine, M. arthritidis, M. arthritidis, M. auris, M. bovigenitalium, M. bovirhinis, M. bovis, M. bovoculi, M. buccale, M. buteonis, M. californicum, M. canadense, M. canis, M. capricolum, M. capricolum subsp. capricolum, M. capricolum subsp. capricolum, M. capricolum subsp. capripneumoniae subsp.capripneumoniae, M.caviae, M.cavipharyngis, M.ciconiae, M.citelli, M.cloacale, M.collis, M.columbinasale, M.columbinum, M.columborare, M.c olumborale, M.conjunctivae, M.corogypsi, M.cottewii, M.cricetuli, M.crocodyli, M.cynos, M.dispar, M.edwardii, M.elephantis, M.M. equigenitalium, M. equirhinis, M. falconis, M. fastidiosum, M. faucium, M. felifaucium, M. feliminutum, M. felis, M. feriruminatoris, M. fermentans, M. flocculus M. flocculare, M. gallinaceum, M. gallinarum, M. gallisepticum, M. gallopavonis, M. gateae, M. genitalium, M. glycophilum, M. gypis, M. haemocanis, M. haemofelis, M. haemomuris (M.haemomuris), M.hominis, M.hyopharyngis, M.hyopneumoniae, M.hyorhinis, M.hyosynoviae, M.iguana, M.imitans, M.indiense, M.iners, M.iowae, M.lagogenitali um), M. leachii, M. leonicaptivi, M. leopharyngis, M. lipofaciens, M. lipophilum, M. maculosum, M. meleagridis, M. microti, M. moatsii, M. mobile, M. molare, M. mucosicanis.mucosicanis, M. muris, M. mustelae, M. mycoides, M. mycoides subsp. capri, M. mycoides subsp. mycoides, M.neophronis, M.neurolyticum, M.opalescens, M.orale, M.ovipneumoniae, M.ovis, M.oxoniensis, M.penetrans, M.phocicerebrale, M.phocidae, M.phocirhinis, M.pirum, M.pneumoniae, M.primatum, M.pullorum, M.pulmonis , M. putrefaciens, M. salivarium, M. simbae, M. spermatophilum, M. spumans, M. sturni, M. sualvi, M. subdolum, M. sui Mycoplasma includes the following non-limiting list of candidate species: Moeniiplasma glomeromycotorum, M. aoti, M. corallicola, M. erythroservae ...a, M. erythroserva, M. erythroserva, M. erythroserva, M. erythroserva, M. erythroserva, M. erythroserva, M. erythroserva, M. erythroserva, M. erythroserva, M. erythroserva, Merythrocervae, M. girerdii, M. haematoparvum, M. haemobos, M. haemocervae, M. haemodidelphidis, M. haemohominis, M. haemolamae, M. haemomacaque, M. haemomeles, M. haemominutum, M. haemomuris subsp. musculi, M. Haemomuris subsp. subsp. ratti, M. haemovis, M. haemozalophi, M. kahaneii, M. ravipulmonis, M. struthiolus, M. turicensis, M. haemotarandirangiferis, M. preputii and others, such as M. insons, M. sphenisci, M. vulturis, and M. zalophi. Similarly, it will be apparent to one of skill in the art that the term Mycoplasma further includes any Mycoplasma strain or species produced by genetic or chemical synthesis, or by any type of rational design and / or rearrangement of the naturally occurring Mycoplasma genomic sequence, and thus the term also encompasses Mycoplasma strains and species referred to in the art as "synthetic Mycoplasma," or alternatively as "Mycoplasma laboratorium," "Mycoplasma synthia," or even shorter "Synthia" (Gibson et al., 2002)., Science, 2010). Thus, in certain embodiments described throughout the specification, the Mycoplasma species subject of the invention has a genomic sequence that comprises at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% overall sequence identity to a naturally occurring or commercially available Mycoplasma bacterium such as those described herein. In certain embodiments, the Mycoplasma bacterium is M. pneumoniae M129-B7, available from the American Type Culture Collection, accession number 29342.

[0114] Exemplary Pseudomonas species include P. aeruginosa species, P. chlororaphis species, P. fluorescens species, P. pertucinogena species, P. putida species, P. stutzeri species, P. syringae species, and incertae sedis species. sedis, and thus includes the following non-exhaustive list: P. aeruginosa, P. alcaligenes, P. anguilliseptica, P. argentinensis, P. borbori, P. citronellolis, P. flavescens, P. mendocina, P. nitroreducens, P. oleovorans, P. pseudoalcaligenes, P. resinovorans, P. straminea, P. aurantiaca, P. aurantiaca, P. argentinensis, P. borbori, P. citronellolis, P. flavescens, P. mendocina, P. nitroreducens, P. oleovorans, P. pseudoalcaligenes, P. resinovorans, P. straminea, P. aurantiaca, P. aurantiaca, P. argentinensis, P. borbori, P. citronellolis, P. flavescens, P. mendocina, P. nitroreducens, P. oleovorans, P. pseudoalcaligenes, P. resinovorans, P. straminea, P. aurantiaca, P. aurantiaca, P. aeruginosa, P. alcaligenes, P. anguilliseptic ... ca), P. aureofaciens, P. chlororaphis, P. fragi, P. lundensis, P. taetrolens, P. antarctica, P. azotoformans, P. blatchfordae rdae), P. brassicacearum, P. brenneri, P. cedrina, P. corrugata, P. fluorescens, P. gessardii, P. libanensis, P. mandelii, P. margenalis, P.marginalis, P.mediterranea, P.meridiana, P.migulae, P.mucidolens, P.orientalis, P.panacis, P.proteolytica, P.rhodesiae, P.synxantha, P.thivervalensis, P.tolaa sii), P. veronii, P. denitrificans, P. pertucinogena, P. cremoricolorata, P. entomophila, P. fulva, P. monteilii, P. mosselii, P. oryzihabitans, P. parafulva, P. plecoglossida, P. plecoglossicida, P. putida, P. balearica, P. luteola, P. stutzeri, P. amygdali, P. avellanae, P. caricapapayae, P. cichorii, P. coronafaciens, P. ficuserectae, P. helianthi, P. .helianthi, P. meliae, P. savastanoi, P. syringae, P. tomato, P. viridiflava, P. abietaniphila, P. acidophila, P. agarici, P. alcaliphila, P. alkanolytica, P. amyloderamosa, P.amyloderamosa, P. asplenii, P. azotifigens, P. cannabina, P. coenobios, P. congelans, P. costantinii, P. cruciviae, P. delhiensis, P. excibis, P. extremorientalis lis, P. frederiksbergensis, P. fuscovaginae, P. gelidicola, P. grimontii, P. indica, P. jessenii, P. jinjuensis, P. kilonensis, P. knackmussii, P. koreensis, P. lini P. lini, P. lutea, P. moraviensis, P. otitidis, P. pachastrellae, P. palleroniana, P. papaveris, P. peli, P. perolens, P. poae, P. pohangensis, P. protegens, P. cyclophylla ychrophila, P. psychrotolerans, P. rathonis, P. reptilivora, P. resiniphila, P. rhizosphaerae, P. rubescens, P. salomonii, P. segitis, P. septica, P. simiae, P. suis, P.P. teessidea, P. thermotolerans, P. toyotomiensis, P. tremae, P. trivialis, P. turbinellae, P. tuticorinensis, P. umsongensis, P. vancouverensis, P. vranove nsis, and P. xanthomarina. It will be apparent to those skilled in the art that the term Pseudomonas further includes any Pseudomonas strain or species produced by genetic or chemical synthesis, or by any type of rational design and / or rearrangement of a naturally occurring Pseudomonas genomic sequence, and thus the term also encompasses Pseudomonas strains and species referred to as "synthetic Pseudomonas," or "Pseudomonas laboratorium," or "Pseudomonas synthia." Thus, in certain embodiments described throughout the specification, the Pseudomonas species subjects of the invention have a genomic sequence that comprises at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% overall sequence identity to naturally occurring or commercially available Pseudomonas bacteria such as those described herein.

[0115] Exemplary Lactobacillus species include the following non-exhaustive list: L. acetotolerans, L. acidophilus, L. alvi, L. amylolyticus, L. amylovorus, L. apis, L. backi, L. bombicola, L. colini, L. crispatus, L. spp. ... patus, L.delbrueckii, L.equicursoris, L.fornicalis, L.gallinarum, L.gasseri, L.gigeriorum, L.ginsenosidimutans, L.hamster, L.helsingborgensis, L.helveticus ticus, L.hominis, L.iners, L.intestinalis, L.jensenii, L.jinshani, L.johnsonii, L.kalixensis, L.kefiranofaciens, L.kimbladii, L.kitasatonis, L.klabergensis ullabergensis, L.melliventris, L.mulieris, L.nasalidis, L.panisapium, L.paragasseri, L.pasteurii, L.porci, L.psittaci, L.raoultii, L.rodentium, L.rogosae, L.Lactobacillus taiwanensis, L. thermophilus, L. timonensis, L. ultunensis, and L. xujianguonis. It is clear to those skilled in the art that the term "Lactobacillus" also includes any Lactobacillus strain or species that is produced by genetic or chemical synthesis, or any kind of rational design and / or rearrangement of naturally occurring Lactobacillus genome sequence, and thus the term also includes Lactobacillus strains and species that are called "synthetic Lactobacillus", or "Lactobacillus laboratorium", or "Lactobacillus synthia". Thus, in certain embodiments described throughout the specification, the Lactobacillus species subject of the invention have a genomic sequence that comprises at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% overall sequence identity to naturally occurring or commercially available Lactobacillus bacteria such as those described herein.

[0116] A further aspect of the invention relates to the use of the oligonucleotide modification system described herein for the genetic modification (i.e., alteration of the genomic sequence) of bacteria. Preferably, the use of the oligonucleotide modification described herein for the genetic modification of bacteria is its in vitro use. In a particular embodiment, the oligonucleotide modification system is used to introduce a nucleotide sequence encoding one or more heterologous gene products into the genomic sequence of the bacteria. In an alternative embodiment, the oligonucleotide modification system is used to introduce a nucleotide sequence encoding an additional copy of one or more endogenous gene products into the genomic sequence of the bacteria. In a further alternative embodiment, the oligonucleotide modification system is used to introduce one or more nucleotide sequences encoding one or more therapeutic gene products, such as, but not limited to, therapeutic proteins and therapeutic peptides. In a further alternative embodiment, the oligonucleotide modification system is used to introduce a nucleotide sequence encoding a combination of at least one heterologous gene product and at least one additional copy of an endogenous gene product into the genomic sequence of the bacteria. In yet a further embodiment, the oligonucleotide modification system is used to rearrange a particular portion of the genomic sequence of the bacteria. In a still further embodiment, the portion of the genomic sequence of the bacteria is a protein-coding gene. In an alternative embodiment, the oligonucleotide modification system is used to alter the sequence of a regulatory genomic element of the bacteria. In further embodiments, the regulatory genomic element is a nucleotide sequence capable of increasing or decreasing the expression of one or more specific genes. In certain embodiments, the oligonucleotide modification system is used to introduce a nucleotide sequence encoding one or more heterologous gene products into the bacterial genomic sequence, which can further induce one or more modifications in the bacterial genomic sequence.Non-limiting illustrative examples herein are "engineered" nucleases, such as zinc zinger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems (CRISPR / Cas systems). Exemplary Cas proteins include, but are not limited to, Cas1, Cas1b, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, Cas9, Csn2, Cas4, Cpf1 (i.e., Cas12), C2c1, C2c3, Cas13a, Cas13b, Cas13c, and Cas13d. The terms ZFN, TALEN, and CRISPR / Cas systems also encompass homologs or mutants of said ZFN, TALEN, and CRISPR / Cas systems.

[0117] Those skilled in the art will understand that terms such as "regulatory (genomic) element" and "regulatory (genomic) sequence" are interchangeably referred to in the art by the terms "control element" and "control sequence", respectively. By way of example and not limitation, a regulatory element or regulatory sequence may be an enhancer, a selection marker, an origin of replication, a linker sequence, a polyA sequence, a terminator sequence, or a degradation sequence.

[0118] The term "therapeutic protein" or "therapeutic peptide" will be clear to those of skill in the art, who will understand that a wide range of therapeutic proteins are described in the art. Therapeutic proteins can be hierarchical into five major groups: (a) replacing proteins that are missing or abnormal; (b) enhancing existing pathways; (c) providing novel functions or activities; (d) interfering with molecules or organisms; and (e) delivering other compounds or proteins, such as radionuclides, cytotoxic drugs, or effector proteins. Alternatively, therapeutic proteins can also be classified based on their molecular type, including antibody-based drugs, Fc fusion proteins, anticoagulants, blood factors, bone morphogenetic proteins, engineered protein scaffolds, enzymes, growth factors, hormones, interferons, interleukins, and thrombolytic drugs. Therapeutic proteins and peptides can also be classified based on the mechanism of action of their molecules, such as (a) non-covalently binding to a target, such as monoclonal antibodies; (b) affecting covalent bonds, such as enzymes; and (c) exerting activity without specific interactions (e.g., serum albumin). The above classifications and the contribution of each group to the state of the art are described in the scientific literature (Dimitrov, Therapeutic proteins, Methods in Molecular Biology, 2012). Non-limiting examples of therapeutic protein classes include cytokines, antibodies, nanobodies, (soluble) receptors, antibody-like protein scaffolds, and functional fragments thereof.

[0119] In further embodiments where an oligonucleotide modification system is used to insert a protein-encoding nucleotide sequence into a bacterial genomic sequence, the gene product may further comprise a peptide or protein tag sequence. Non-limiting examples of commonly used peptide tag sequences are Avi-tag, C-tag, calmodulin-tag, polyglutamic acid tag, E-tag, Flag-tag, HA-tag, His-tag, Myc-tag, NE-tag, Rho1D4-tag, S-tag, SBP-tag, Sof tag 1, Sof tag 3, Spot-tag, Strep-tag, TC-tag, Ty-tag, V5-tag, VSV-tag, Xpress-tag, isopeptag, Spy-tag, Snoop-tag, Dog-tag, and Sdy-tag.

[0120] In certain embodiments, the oligonucleotide modification system is used to replace, mutate and / or delete nucleotide sequences encoding one or more virulence factors. The term "virulence factor" should be interpreted according to the general interpretation of said term in the art, i.e., any cellular structure, molecule, or regulatory system that allows a pathogen to achieve colonization in a host (or a host niche), evade the host's immune response (either partial or complete), exert immunosuppression (either partial or complete), and obtain nutrients from the host. An immune response in the context of this specification is a reaction that occurs in an organism with the aim of combating a foreign invading organism by a host organism exposed to the foreign organism. In certain prior art documents, the immune response is generally described as repelling or inhibiting the growth or survival of a foreign organism in the host organism. Alternatively, it is known in the art that the purpose of the immune response is to protect the host organism from the invading organism. Those skilled in the art will understand that an immune response generally results in an improved health status of an infected organism. However, in certain instances, the improved health status of an infected organism is characterized by a prior temporary decrease in the health status of the infected organism. In certain embodiments, the virulence factor may be replaced by an exogenous gene product, in other words, the genetically modified bacterium may be attenuated against the same bacterium prior to the initiation of the genome modification process or the introduction of the oligonucleotide modification system into the bacterium.

[0121] The term "attenuated" as used herein may be used interchangeably with terms such as "weakened" and "reduced". The term "attenuated strain" is commonly used in the art to refer to a weakened disease agent, i.e., a weakened pathogen. An attenuated bacterium is a bacterium that is weakened, less aggressive, and less virulent when compared to its traditionally occurring counterpart. An attenuated bacterium according to embodiments of the present invention refers to a genetically modified bacterium in which the expression of a gene whose gene product is involved or contributes to a degree of virulence or toxicity has been modified to reduce the deleterious effect of said gene on an infected subject. In a particular embodiment, the expression of a gene product that is involved in a degree of virulence is completely prevented by the use of an oligonucleotide modification system. In a further embodiment, the promoter of a gene encoding a toxic gene product is inactivated by mutagenesis of the promoter sequence by the use of an oligonucleotide modification system. In an alternative further embodiment, the coding region or exon of a gene that contributes to virulence is mutagenized or removed by the use of an oligonucleotide modification system. In yet a further embodiment, a frameshift in a gene that contributes to virulence is induced by the use of an oligonucleotide modification system. In yet a further embodiment, the gene encoding a toxic or harmful gene product is replaced with a heterologous nucleotide-encoded gene product by using an oligonucleotide modification system. In yet a further embodiment, the expression level of the toxic or harmful gene product is reduced by using an oligonucleotide modification system. In a further embodiment, one or more fragments of the toxic or harmful gene are removed by using an oligonucleotide modification system, whereby, optionally, one or more fragments are removed without changing the reading frame, and thus the modified gene product is still expressed.

[0122] The term "subject" refers to an animal that has been the subject of treatment, observation or experiment, preferably a warm-blooded animal, more preferably a vertebrate, even more preferably a mammal, including humans and non-human mammals in particular. The term "mammal" or "mammalian subject" refers to any animal classified as such, including, but not limited to, humans, livestock, commercial animals, farm animals, zoo animals, sports animals, pets and laboratory animals, such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, dairy cows; primates, such as apes, monkeys, orangutans, and chimpanzees; canines, such as dogs and wolves; felines, such as cats, lions, and tigers; equines, such as horses, donkeys, and zebras; food animals, such as dairy cows, pigs, and sheep; ungulates, such as deer and giraffes; rodents, such as mice, rats, hamsters, and guinea pigs; and the like. Preferred subjects are human subjects, including all genders and all age categories thereof.

[0123] In certain embodiments, the use of the oligonucleotide modification system results in a genetically modified bacterium that has reduced pathogenicity and / or immunogenicity when introduced into a host organism, when compared to a naturally occurring unmodified bacterium. In further embodiments, the pathogenicity and / or immunogenicity of the modified bacterium is reduced by at least 10%, preferably at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 75%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, when compared to a reference bacterium, which may be a corresponding unmodified bacterium and / or a naturally occurring wild-type bacterium, provided that said reference bacterium does not contain said genomic modification introduced by the oligonucleotide modification system. In certain embodiments, the reduced pathogenicity and / or immunogenicity is reduced to such an extent that the genetically modified bacterium does not result in the development of clinical symptoms when introduced into a healthy human subject, in contrast to the naturally occurring corresponding bacterium. In a further embodiment, the reduced virulence and / or immunogenicity is characterized by a reduction in toxicity of at least 10%, preferably at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 75%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95% when the bacterium is introduced into a host organism, when compared to a suitable reference bacterium. A suitable reference bacterium in this context is a bacterium having an identical genomic sequence to the bacterium of interest, with the proviso that the reference bacterium does not contain a genomic sequence. In yet a further embodiment, the reduced toxicity is assessed by measuring an inflammatory response by the host organism upon infection with the bacterium, preferably by measuring the expression level of inflammatory cytokines in the host organism upon infection with the bacterium. In a particular embodiment, the genetically modified bacterium is a replication-deficient genetically modified bacterium.

[0124] A further aspect of the invention relates to a method for genetically modifying a bacterium, the method comprising: (i) transforming a culture of said bacterium comprising an ssDNA annealing protein or an oligonucleotide encoding said ssDNA annealing protein with (i) an oligonucleotide modification system as defined in any one of the embodiments described herein, and (ii) a first recombinase (RSA); (ii) selecting bacteria from the culture that contain a genomic sequence into which the second nucleotide sequence has been integrated; (iii) expressing a second recombinase (RSB) in the bacterium, thereby removing the second nucleotide sequence from the bacterial genomic sequence. Includes.

[0125] Methods and protocols for introducing nucleotide sequences into bacteria, i.e., methods of bacterial transformation, are known to those skilled in the art (Johnston et al., Nature Rev Microbiol, 2014). The term "transformation" refers to the direct uptake and genetic change of a cell resulting from incorporation of exogenous genetic material. In this context, specifically, "uptake" does not refer to incorporation into the genomic sequence of the cell, but simply refers to the internalization of exogenous genetic material into the cell. Transformation is a horizontal gene transfer process and is commonly used in the context of introducing foreign DNA into bacterial, yeast, plant, animal, or human cells. Cells that can uptake foreign DNA are called competent cells. In other embodiments, transformation can refer to the insertion of new genetic material into animal and human cells, although the term "transfection" is more common for these cells. Thus, "the term transformation encompasses chemical, physical, and electrical processes (or any combination thereof) that facilitate or force the uptake of exogenous genetic material such as DNA (Ren et al., Appl Microbiol Biotechnol, 2019). By way of example and not limitation, suitable transformation techniques thus include chemical treatment with cations, any method relying on the Yoshida effect (e.g., rubbing with nanoparticles), electroporation, ultrasonic transformation, microshock waves, freeze-thaw, or any combination thereof.

[0126] For example, in heat shock transformation, artificial competence is induced by rendering cells permeable to DNA, typically by subjecting the cells to non-physiological conditions. In such a typical transformation experiment, cells are incubated in a solution containing divalent cations, often under cold conditions, before the cells are exposed to heat shock. It is theorized that exposure of cells to divalent cations is responsible for weakening of cell surface structures, making it (more) permeable to DNA. Heat shock creates a thermal imbalance across the membrane, forcing the entry of DNA through cell pores (i.e., adhesion regions or Bayer junctions) or damaged cell walls. Alternatively, electroporation is hypothesized to create pores in the cell membrane. In electroporation, bacterial cells are briefly exposed to an electric field of 10-20 kV / cm. After the shock, cell membrane repair mechanisms remove the pores.

[0127] The methods described herein start with a bacterium that contains a ssDNA annealing protein. Different embodiments of the ssDNA annealing protein are described throughout the present specification and are equally applicable to the methods described herein. The details of how and in what physical form the ssDNA annealing protein is introduced into the bacterium are not particularly limiting to the present invention. Thus, in certain embodiments, the ssDNA annealing protein may be transiently expressed from an expression construct, such as a plasmid in the bacterium. Alternatively, the ssDNA annealing protein may be recombinantly introduced into the bacterium. Further alternatively, an RNA sequence encoding the ssDNA annealing protein may be introduced into the bacterium. Further alternatively, the nucleotide sequence encoding the ssDNA annealing protein may be stably integrated into the target genome sequence. In a further embodiment, when stably integrated into the bacterial genome sequence, the nucleotide sequence encoding the ssDNA annealing protein may be operably linked to a constitutive promoter sequence. In an alternative further embodiment, when stably integrated into the bacterial genome sequence, the nucleotide sequence encoding the ssDNA annealing protein may be operably linked to an inducible promoter sequence.

[0128] The oligonucleotide modification system and the first recombinase (RSA) described herein may be introduced into the bacterium simultaneously or subsequently. In a preferred embodiment, the oligonucleotide modification system is introduced into the bacterium in a first step, and the first recombinase (RSA) is introduced into the bacterium in a second step, the first step occurring at a first time point and the second step occurring at a time point later than the first time point. The details of how and in what physical form the first recombinase (RSA) is introduced into the bacterium are not particularly limiting of the invention. Thus, in certain embodiments, the first recombinase (RSA) may be transiently expressed from an expression construct, such as a plasmid in the bacterium. Alternatively, the first recombinase (RSA) may be introduced into the bacterium as a recombinant protein. Additionally or alternatively, an RNA sequence encoding the first recombinase (RSA) may be introduced into the bacterium.

[0129] In a particular embodiment of the method, bacteria from the culture comprising a genomic sequence in which the second nucleotide arrangement is integrated are selected from non-modified bacteria in said culture by addition of a molecule or substance to the culture medium. In a further embodiment, the molecule or substance is an antibiotic or a toxin. In an alternative embodiment, bacteria from the culture comprising a genomic sequence in which the second nucleotide arrangement is integrated are selected from non-modified bacteria in said culture by stratification of said bacteria based on a distinguishing morphological characteristic. In a further embodiment, the distinguishing morphological characteristic is fluorescence-based or shape-based. In yet another embodiment, the selection is performed by a cell sorting process, which may optionally be a fluorescence-activated cell sorting (FACS) process. In a particular embodiment, bacteria comprising a genomic sequence in which the second nucleotide arrangement is integrated are selected from the culture by isolation of a number of bacteria from the culture (which comprises both modified and wild-type bacteria), optionally followed by clonal expansion, and analysis of the genomic sequences of the various clonal populations. In further embodiments, the analysis of the genomic sequences of the various clonal populations is accomplished by polymerase chain reaction (PCR) on bacterial genomic DNA, by sequencing bacterial genomic DNA or a portion thereof, by one or more restriction digests, or by a combination of both PCR and sequencing. In certain embodiments where a portion of genomic DNA is analyzed by sequencing, the sequenced genomic region includes at least the genetically modified region. In certain embodiments where PCR analysis of the genome is performed, the PCR analysis includes performing junction PCR, overspanning PCR, or a combination thereof.Those skilled in the art will understand that junction PCR is PCR in which a first primer is designed to engage with a portion of the DNA sequence of the second nucleotide and a second primer is designed to engage with a genomic DNA sequence 5' or 3' of the proposed insertion position of the second nucleotide arrangement, while overspanning PCR relies on a first primer designed to engage with a genomic DNA sequence upstream of the insertion site of the second nucleotide arrangement and a second primer designed to engage with a genomic DNA sequence downstream of the insertion site of the second nucleotide arrangement. The term "restriction digestion" and methods for performing restriction digestion are known to those skilled in the art.

[0130] In certain embodiments of the methods described herein, the method includes a second step of selecting bacteria from the culture, in which the second nucleotide arrangement is deleted from the genomic sequence of the bacteria after expression of the second recombinase (RSB) in the bacteria. The details of how and in what physical form the second recombinase (RSB) is introduced into the bacteria are not particularly limiting to the present invention. Thus, in certain embodiments, the second recombinase (RSB) may be transiently expressed from an expression construct, such as a plasmid in the bacteria. Alternatively, the second recombinase (RSB) may be introduced into the bacteria as a recombinant protein. Additionally or alternatively, an RNA sequence encoding the second recombinase (RSB) may be introduced into the bacteria.

[0131] Optionally, the first recombinase (RSA) can be encoded by a nucleotide sequence at a third nucleotide location of the oligonucleotide modification system described herein, forming an expression construct such as a plasmid. Alternatively, the second recombinase (RSB) can be encoded by a nucleotide sequence at a third nucleotide location, forming an expression construct such as a plasmid. Optionally, the first recombinase (RSA) and the second recombinase (RSB) are encoded by nucleotide sequences at separate (i.e., different) nucleotide locations, each forming an expression construct that functions independently, such as a plasmid.

[0132] In certain preferred embodiments, the second recombinase (RSB) is encoded by a nucleotide sequence contained in the second nucleotide arrangement of the oligonucleotide modification system described herein. In further embodiments, the second recombinase (RSB) is optionally arranged to be encoded such that at least one RSB recognition sequence of the second nucleotide arrangement is 5' (located) to the nucleotide sequence encoding the second recombinase (RSB) and at least one RSB recognition sequence of the second nucleotide arrangement is 3' (located). In yet further embodiments, the second recombinase (RSB) is encoded 5' of the RSA recognition sequence. In alternative further embodiments, the second recombinase (RSB) is encoded 3' of the RSA recognition sequence.

[0133] In a particular preferred embodiment, both the first recombinase (RSA) and the second recombinase (RSB) are encoded by a nucleotide sequence contained in the second nucleotide arrangement of the oligonucleotide modification system described herein. In a further embodiment, both the first recombinase (RSA) and the second recombinase (RSB) are optionally arranged to be encoded such that at least one RSB recognition sequence of the second nucleotide arrangement is 5' of the nucleotide sequence encoding the first recombinase (RSA) and the nucleotide sequence encoding the second recombinase (RSB), and at least one RSB recognition sequence of the second nucleotide arrangement is 3'. In yet a further embodiment, the first recombinase (RSA) and the second recombinase (RSB) are encoded 5' of the RSA recognition sequence. In an alternative further embodiment, the first recombinase (RSA) and the second recombinase (RSB) are encoded 3' of the RSA recognition sequence. In a preferred embodiment, the transcription of the first recombinase (RSA) and the second recombinase (RSB) is independently controlled by separate promoter sequences. In a further preferred embodiment, the transcription of the first recombinase (RSA) and the second recombinase (RSB) is independently controlled by separate promoter sequences that allow for temporal control of the expression of said recombinases. In a further preferred embodiment, the transcription of the first recombinase (RSA) or the second recombinase (RSB) is independently controlled by an inducible promoter sequence. In a further preferred embodiment, the transcription of both the first recombinase (RSA) and the second recombinase (RSB) is independently controlled by an inducible promoter sequence, preferably a separate inducible promoter sequence.

[0134] It is a preferred embodiment that the expression of the first recombinase (RSA) and / or the expression of the second recombinase can be subject to independent regulation, regardless of which embodiment is considered. It is an alternative preferred embodiment that the expression of at least the second recombinase (RSB) can be subject to temporal regulation, regardless of which embodiment is considered. In a further preferred embodiment, the expression of the second recombinase (RSB) can be regulated such that said recombinase is expressed after the expression of the first recombinase (RSA) has been initiated and optionally terminated (i.e. sequential expression regulation).

[0135] Optionally, the method further comprises contacting said genetically modified bacterium with a nucleotide arrangement consisting of HA1 and HA2, and contacting said bacterium with an intron-encoded endonuclease. In a preferred embodiment, the intron-encoded endonuclease is an I-SceI endonuclease. In such an embodiment, the genetically modified bacterium is contacted with the nucleotide arrangement consisting of HA1 and HA2 after expression of the first recombinase (RSA) and after expression of the second recombinase (RSB). Furthermore, in such an embodiment, the method described herein preferably comprises as the first nucleotide arrangement an intron-encoded endonuclease restriction site sequence, preferably an I-SceI restriction site sequence located between the RSA recognition sequence and a stretch of at least 5 consecutive nucleotides of the genomic sequence (HA1) of the modified bacterium 5' (located) to the RSA recognition sequence, or between the RSA recognition sequence and a stretch of at least 5 consecutive nucleotides of the genomic sequence (HA2) of the modified bacterium 3' (located) to the RSA recognition sequence. It will be appreciated that in such embodiments, a genetically modified bacterium is obtained that does not contain a scar sequence, such as a site-specific recombinase recognition site scar sequence, in its genomic sequence.

[0136] "Scar sequence" is a term commonly used in the field of genome engineering and synthetic biology. This term refers to any nucleotide sequence that remains overly integrated in the genome sequence of an organism after genome engineering. In the context of the present invention, this term encompasses any selectable marker gene, any site-specific recombinase recognition sequence, or any recombinase that is not a sequence essential to achieve the goal of the person using the oligonucleotide modification system. For example, a person aiming to genetically modify a genomic sequence of interest (i.e., a target genomic sequence) of a bacterium to express a therapeutic protein would consider any recombination site sequence or selectable marker gene that is still embedded in the genome sequence of the modified bacterium upon completion of the genome engineering protocol as a scar sequence, since these sequences do not contribute to or affect the expression of said therapeutic protein. In other words, a scarless genetically modified bacterium does not contain sequences that could provide information or hints about how the genome modification was introduced into said bacterium.

[0137] Genetically modified bacteria obtained by any of the methods described herein are also contemplated by the present disclosure. In certain embodiments, the genetically modified bacteria are inactivated and / or killed after performing the method. In alternative embodiments, the genetically modified bacteria are further cultured after performing the method. In certain embodiments, the genetically modified bacteria obtained by any of the methods described herein express a heterologous ssDNA annealing protein, a first recombinase (RSA), a second recombinase (RSB), or any combination thereof.

[0138] In a preferred embodiment, the genetically modified bacterium does not contain a site-specific recombinase scar sequence in its genome sequence. In a further preferred embodiment, the genetically modified bacterium does not contain a scar sequence in its genome sequence. In a preferred embodiment, the genetically modified bacterium is a bacterium selected from the group consisting of Mycoplasma bacteria, Pseudomonas bacteria, and Lactobacillus bacteria. In a further preferred embodiment, the genetically modified bacterium is a bacterium selected from the group consisting of Mycoplasma bacteria species described herein, Pseudomonas bacteria species described herein, and Lactobacillus bacteria described herein. In a particular embodiment, the genetically modified bacterium is a component of a pharmaceutical composition further comprising at least one excipient. The term "excipient", commonly referred to in the art as "carrier", can refer to any solvent, including, but in no way limited to, diluents, buffers (e.g., neutral buffered saline, phosphate buffered saline, or optionally Tris-HCl, acetate or phosphate buffer), solubilizers (e.g., Tween 80, Polysorbate 80), colloids, dispersion media, vehicles, fillers, chelating agents (e.g., EDTA or glutathione), amino acids (e.g., glycine), proteins, disintegrants, binders, lubricants, wetting agents, stabilizers, emulsifiers, sweeteners, colorants, flavors, fragrances, thickeners, agents for achieving a depot effect, coating agents, antifungal agents, preservatives (e.g., benzyl alcohol), antioxidants (e.g., ascorbic acid, sodium metabisulfite, etc.), isotonicity agents, absorption retarders, adjuvants, bulking agents (e.g., lactose, mannitol), and the like. The use of such media and agents to formulate pharmaceutical compositions is well known in the art.

[0139] In certain embodiments, the genetically modified bacteria are metabolically active bacteria. In alternative embodiments, the genetically modified bacteria are metabolically inactive bacteria. In certain embodiments, the genetically modified bacteria obtained by any of the methods described herein are preserved in a lyophilized form. The term "lyophilization", which may be used interchangeably with terms such as "freeze-drying" and "lyophilization", may be used interchangeably herein and refers to a dehydration process that involves freezing the product (i.e., the genetically modified bacteria) without destroying the physical structure of the substance. Lyophilization includes at least a freezing step and a sublimation step. The sublimation step may include two stages of drying, a primary drying step and a secondary drying step. The advantages of lyophilization may include, but are not limited to, improved aseptic handling, enhanced stability of the dried powder, removal of water without excessive heating of the product, and enhanced product stability in the dry state. In general, the quality of the rehydrated lyophilized product is superior and does not show inferior quality to the non-lyophilized product. In the context of the present invention, bacterial quality may refer to any of the following non-limiting examples: growth rate, morphology, pathogenicity, expression levels of heterologous nucleotide-encoding gene products, and metabolite production.

[0140] Cumate inducible expression systems have been reported in the art (e.g., SEQ ID NO: 9 and SEQ ID NO: 11, as described in Mullick et al., BMC Biotechnol, 2006; and Gaillet et al., Biotechnol. Bioeng. 2010). However, the present inventors have developed a particularly strong cumate promoter and operator sequence, characterized by high inducible expression levels while maintaining low leaky expression levels in a significantly improved ratio than the cumate promoter and operator sequences and cumate inducible expression systems reported in the art, suitable for use in Mycoplasma bacteria. Thus, another aspect of the present invention relates to a cumate promoter and operator sequence (CuO) comprising a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence identity to SEQ ID NO: 6 or SEQ ID NO: 10, which does not include or consist of SEQ ID NO: 9 or SEQ ID NO: 11. In a preferred embodiment, the cumate operator sequence (CuO) has a sequence comprising SEQ ID NO: 6 or SEQ ID NO: 10.

[0141] The term "cumate operator sequence" and its abbreviation "CuO" as used in this disclosure refer to a DNA element that can be bound by the cumate repressor protein (CymR). Thus, CuO is the DNA recognition sequence of CymR. In the absence of cumate small molecules, the cumate repressor protein (CymR) binds to the cumate operator sequence (CuO) in the associated cumate promoter sequence. When the operator site is located proximal to the promoter sequence, the CymR protein blocks the formation of the transcription initiation complex, thus preventing transcription by steric hindrance.

[0142] In certain embodiments, the cumate promoter and operator sequence (CuO) drives expression of an operably linked gene product in the absence of cumate that is at least 2-fold, preferably at least 5-fold, at least 10-fold, at least 20-fold, at least 25-fold, at least 50-fold, at least 100-fold higher when compared to expression of the operably linked gene product in the presence of cumate. In certain embodiments, the cumate promoter and operator sequence (CuO) described herein drives expression of an operably linked gene product in the presence of cumate that is 1.5-fold, preferably 2-fold, preferably 5-fold, preferably 10-fold, preferably 15-fold, preferably 20-fold higher than expression of a gene product operably linked to a cumate promoter and operator sequence (CuO) known in the art. In a particular embodiment, the presence of cumate drives expression of an operably linked gene product that is 1.5-fold, preferably 2-fold, preferably 5-fold, preferably 10-fold, preferably 15-fold, preferably 20-fold stronger than expression of a gene product operably linked to a cumate promoter and operator sequence (CuO) comprising SEQ ID NO:9 or SEQ ID NO:11, as reproduced below: [ka] [ka]

[0143] In certain embodiments, the cumate promoter and operator sequences (CuO) described herein are characterized by a reduction in leakage in the absence of cumate when compared to a cumate promoter and operator sequence (CuO) comprising SEQ ID NO:9 or SEQ ID NO:11, of at least 20%, preferably at least 25%, preferably at least 30%, preferably at least 35%, preferably at least 40%, preferably at least 45%, preferably at least 50%, preferably at least 55%, preferably at least 60%, preferably at least 65%, preferably at least 70%, preferably at least 75%, preferably at least 80%.

[0144] In an alternative preferred embodiment, the cumate promoter and operator sequence (CuO) consists essentially of or consists of a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence identity to SEQ ID NO:6 or SEQ ID NO:10, which does not include or consist of SEQ ID NO:9 or SEQ ID NO:11. In a further preferred embodiment, the cumate promoter and operator sequence (CuO) consists essentially of or consists of SEQ ID NO:6 or SEQ ID NO:10.

[0145] In a further preferred embodiment, the cumate promoter and operator sequence (CuO) comprises an RNA polymerase binding domain corresponding to SEQ ID NO:7 or SEQ ID NO:12. TTTATTTGACAAAAATGAGATTATTTGGTATAATTAATGTAGT (SEQ ID NO: 7) ATTTTGTCAAAATTTTATTTGACAAAAATGAGATTATTTGGTATAATTAATGTAGT (SEQ ID NO: 12)

[0146] In a further preferred embodiment, the cumate promoter and operator sequence (CuO) comprises a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence identity to SEQ ID NO:6 or SEQ ID NO:10, and comprises an RNA polymerase binding domain corresponding to SEQ ID NO:7 or SEQ ID NO:12, which does not include or consist of SEQ ID NO:52 or SEQ ID NO:53. In a further preferred embodiment, the cumate promoter and operator sequence (CuO) comprises, consists essentially of, or consists of a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% sequence identity to SEQ ID NO:6 or SEQ ID NO:10, and consists essentially of, or consists of a single RNA polymerase binding domain corresponding to SEQ ID NO:7 or SEQ ID NO:12.

[0147] Similarly, aspects of the invention relate to a cumate inducible expression system comprising a nucleotide sequence encoding the repressor protein CymR or CymR, and 1) a cumate promoter and operator sequence (CuO) as described herein, and 2) a nucleotide sequence comprising (alternatively expressed as "representing" or "comprising") a nucleotide sequence encoding a gene product or forming a suitable insertion site for insertion of a nucleotide-encoded gene product. In such a cumate inducible expression system, the cumate promoter and operator sequence are operably linked and positioned 5' to the nucleotide sequence encoding the gene product, or form a suitable insertion site for insertion of a nucleotide-encoded gene product. In certain embodiments, the cumate inducible expression system is encoded in an expression construct, such as a vector or plasmid. In certain embodiments, the nucleotide sequence encoding CymR and the nucleotide sequence comprising the cumate promoter and operator sequence as described herein operably linked to the nucleotide sequence encoding the gene product are each included in a single nucleotide configuration, such as a vector or plasmid. In alternative embodiments, the nucleotide sequence encoding CymR is positioned on a different nucleotide configuration than the remaining components of the cumate inducible expression system. In a preferred embodiment, the plasmid comprises a multiple cloning site as an insertion site for insertion of a nucleotide-encoding gene product. In an alternative preferred embodiment, the plasmid comprises one or more recombinases, such as a first recombinase (RSA) and / or a second recombinase (RSB), as a nucleotide-encoding gene product, a multiple cloning site.

[0148] The term "multiple cloning site", interchangeably indicated by the term "polylinker", is widely used in the field of molecular biology and is therefore known to those skilled in the art to be the position in an expression construct at which a specific DNA fragment can be conveniently integrated into said position and thus into said expression construct. A multiple cloning site is a relatively short segment of DNA that contains different restriction sites. The number of restriction sites is not particularly limited, and those skilled in the art can generate and use different multiple cloning sites depending on their envisaged functionality.

[0149] In certain embodiments, the promoter sequence portion of the cumate promoter and operator sequence is a promoter sequence suitable for achieving expression of a gene product in a prokaryotic and / or eukaryotic cell, preferably a promoter sequence suitable for achieving expression of a gene product in a bacterial cell.

[0150] In certain embodiments, the cumate inducible expression system comprises a nucleotide sequence encoding the repressor protein CymR or CymR, and at least two, preferably at least three, nucleotide sequences comprising: 1) a cumate promoter and operator sequence (CuO) as described herein, and 2) a nucleotide sequence encoding a gene product or forming an insertion site suitable for insertion of a nucleotide-encoded gene product, which may optionally be a multiple cloning site.

[0151] Also contemplated by the present invention are kits of parts comprising the cumate inducible expression system and cumate as defined herein. In certain embodiments, the kits of parts further comprise a DNA ligase, and optionally one or more restriction enzymes. In certain embodiments, the kits of parts further comprise reagents and / or materials for purification of the nucleotide sequence comprising the cumate promoter and operator sequence, and the nucleotide sequence encoding the inserted and operably linked gene product. In further embodiments, the kits of parts further comprise a DNA ligase, and / or one or more restriction enzymes, and / or reagents and / or materials for purification of the nucleotide sequence comprising the cumate promoter and operator sequence.

[0152] Obviously, the kit of parts may be accompanied by instructions for its use, safety statements, quality assurance statements, and other information typically provided in a kit of parts.

[0153] Further, a cell comprising the cumate inducible expression system described herein is contemplated. In a particular embodiment, the cell is a prokaryotic cell, preferably a bacterial cell. In an alternative embodiment, the cell is a eukaryotic cell. In a further embodiment, the eukaryotic cell is preferably a eukaryotic cell selected from the group of cells comprising yeast cells, plant cells, insect cells, and mammalian cells. In a further preferred embodiment, the eukaryotic cell is a human cell.

[0154] In a final aspect of the invention, a method for obtaining inducible gene expression in a cell is envisaged, the method comprising the steps of introducing into the cell a cumate inducible expression system as described herein (operably linked to a gene of interest) and contacting the cell with cumate, thereby achieving inducible expression of said gene. In a particular embodiment, the cell is contacted with fresh culture medium, and cumate is added to said fresh medium before contacting the cell with said fresh medium. In an alternative embodiment, the cell is contacted with cumate by adding cumate to the culture medium of the cell.

[0155] While the present invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art in light of the foregoing description. Accordingly, it is intended to embrace all such alternatives, modifications, and variations within the spirit and broad scope of the appended claims. The aspects, descriptions, and embodiments of the present invention disclosed herein are further supported by the following non-limiting examples. EXAMPLES

[0156] Working Example Example 1. Rationale and validation of the system at four different loci To overcome the main drawbacks associated with oligorecombineering protocols (Figure 1), we envisioned a system based on two components: oligos and a non-replicating plasmid (hereafter, selector plasmid). First, the oligos perform the genetic modification via the homology arms (HA) and introduce the recognition sites (RS) of the site-specific recombinase (SSR). The editing oligos create the desired modification with a non-selectable phenotype, but leave the RS of the SSR at the edited locus, which can act as a landing pad. Second, the selector plasmid carries an antibiotic resistance gene and an RS that matches the one placed in the landing pad. Thus, co-transformation of the oligos with the selector plasmid leads to plasmid integration and the generation of a selectable phenotype. Once a clone with the desired modification is selected, the plasmid can be removed from the edited region by including two RSs that are not compatible with those used for integration of the vector. The engineering rationale is shown in Figure 1.

[0157] We tested this hypothesis using M. pneumoniae, as this bacterium has traditionally been difficult to manipulate (Halbedel et al., Int J Med Microbiol, 2007).

[0158] When applied to M. pneumoniae, the basic enzymes required as components in genome engineering protocols are i) GP35 as SSAP; ii) SSR-A to catalyze plasmid integration; and iii) SSR-B to perform vector deletion from edited clones. For SSR-A, we selected Cre, a well-characterized and widely used tyrosine recombinase derived from P1 bacteriophage (Sternberg et al., J Mol Biol, 1981; Nagy et al., Genesis, 2000). For SSR-B, we focused on Vcre, a lesser known tyrosine recombinase encoded by a plasmid present in some Vibrio species (Suzuki et al., Nucleic Acids Res, 2011). In line with these choices, we used a lox motif as RSA and a vlox sequence as RSB. Of note, it has previously been demonstrated that the Cre / lox and Vcre / vlox systems do not cross-react with each other (Suzuki et al., Nucleic Acids Res, 2011). We selected these recombinase enzymes and SSR sites because they function in a wide variety of microorganisms.

[0159] First, we obtained a strain expressing both GP35 (SSAP) and Cre (SSR-A) using constitutive and inducible Tet promoters, respectively, by transposon delivery (M129-GP35-PtetCre strain). We then transformed this strain with oligos designed to delete 1 kb at four different non-essential locations on the chromosome (e.g., mpn088, mpn256, mpn440 and mpn583 loci) and insert lox sites at the edited loci (Figure 2A). Each oligo was then co-transformed with a selector plasmid carrying a puromycin resistance cassette (called pLoxPuro), one lox site as RSA and two vlox sites as RSB (Figure 2A). Numerous puromycin-resistant colonies were obtained in all four transformations, ranging from 890 to 1820 colony forming units (CFU) depending on the edited locus (Figure 3). We found only 40 CFU in the negative control (transformation with selector plasmid only, no oligos), indicating that plasmid insertion was mainly dependent on the placement of the landing pad by the editing oligos. Five colonies from each transformation were analyzed by PCR to confirm the desired deletion. A schematic showing the expected chromosomal conformation of the mpn088 locus before and after editing is shown as an example in Figure 2B. PCR screening showed that 60% of the cells were edited at both the mpn088 and mpn583 loci (3 out of 5 tested clones), 80% at the mpn256 locus (4 out of 5 clones), and 100% at the mpn440 locus (5 out of 5 clones) (Figure 2C).

[0160] To finish the protocol, we performed a second transformation step with a suicide plasmid encoding SSR-B (i.e., Vcre), which resulted in vector excision in 90% of the analyzed colonies (i.e., 18 out of 20 colonies; Figure 2C). All edited loci were verified by sequencing. Thus, the genome manipulation protocol described herein allows for the generation and selection of clones with 1 kb marker-free edits in a rapid, cloning-free manner and with high efficiency, regardless of the location of the genomic region to be edited.

[0161] Example 2. Further investigation of genome engineering methods We next evaluated whether the selection capacity of the genome engineering system allows to isolate clones with large genome modifications. Based on the availability of high-coverage essential studies of M. pneumoniae, we identified the largest chromosomal region that can be deleted without affecting essential functions of this bacterium. This region encompasses more than 30 kb and represents ~5.48% of the non-essential (NE) genome, including 25 NE-encoding genes (mpn490 to mpn514) (Figure 4A). We designed a series of editing primers in which the 5'HA is always located at the 3' end of the mpn490 gene; in each primer, the 3'HA is shifted by different distances (ranging from 90 bp to 30 kb) from the 5'-HA (Figure 4A). In separate reactions, each of these oligos was transformed into the M129-GP35-PtetCre strain together with pLoxPuro (as the selector plasmid). Although we observed a trend for the number of puromycin-resistant colonies to decrease with increasing size of the attempted deletion, all transformations showed a higher number of colonies compared to the no-primer control (Figure 5). A scheme showing the expected chromosome conformation before and after the smallest and largest edits is shown in Figure 4B as an example. For all attempted deletions, more than 50% of all cells (i.e., 29 out of 35 colonies analyzed by PCR) had the expected modification (Figure 4C). Moreover, in some conditions, this percentage increased to 100% of the colonies screened (Δ90bp, Δ10kb and Δ30kb edits). Sequencing of the PCR products confirmed the accuracy of the designed deletions and the resulting integration of the selector plasmid between the regions selected as HA in the editing primers. These results demonstrate that the genome engineering protocol described herein is capable of performing small and large changes, and thus this method provides a simple way to perform targeted editing not only at the gene level but also on a genome scale.

[0162] Example 3. Scarless genome editing in bacteria using currently described methods By including a lox66 site between the HAs of the editing oligo, it is possible to rescue the ultra-rare events of oligo-recombineering that were due to the integration of a selector plasmid at the edited locus that had a lox71 site compatible with the one introduced by the oligo (Albert et al., Plant J, 1995). If these two lox sites recombine to mediate integration of the selector plasmid, even after vector removal, a scar of the edited region is generated that contains a double mutant inactive lox72 site (in the chromosome) and a wild-type active loxP site (in the selector plasmid) (Figure 2B). In this scenario, further rounds of editing are not possible, where it is unlikely that the lox-based selector plasmid will preferentially insert into this scar instead of into the novel lox landing created by the new event of oligo-recombineering.

[0163] To overcome this limitation, we evaluated whether the rationale of the currently described genome manipulations could be translated into a scarless genome editing method. To this end, we repeated the 90 bp deletion performed in Figure 4 with a new oligo: in addition to introducing a lox site, this also mediates the insertion into the edited region of 18 bp constituting the restriction site of the I-SceI homing endonuclease (Figure 6A) (Monteilhet et al., Nucleic Acids Res, 1990). The extended length of this restriction site makes this endonuclease a non-cutting enzyme in most bacterial genomes, favoring its use as a counterselectable marker in some genome editing methods (Posfai et al., Nucleic Acids Res, 1999). As expected, the number of colonies obtained was significantly higher in the co-transformation of the editing oligo and the selector vector when compared to the control transformation with only the pLoxPuro plasmid (Figure 7). Of the five puromycin-resistant colonies analyzed, four showed PCR amplification products compatible with insertion of the selector plasmid into the target site (Figure 6B). One of these clones was expanded and transformed with a non-replicating plasmid encoding Vcre, resulting in vector excision in the majority of the analyzed colonies (Figure 6C). Remarkably, the editing scar retained after Vcre excision contained one vlox site, two lox sites, and an I-Sce-I restriction site (Figure 6C). We took advantage of this by co-transforming a suicide plasmid expressing the I-Sce-I endonuclease in an inducible manner with a new editing oligo designed to remove the scar from edited cells. Specifically, this oligo has exactly the same sequence as the one used in the first editing step, without the lox or I-Sce-I restriction sites. In this framework, upon co-transformation and induction of I-Sce-I expression, only cells that have integrated the editing oligo and consequently removed the restriction site from the chromosome are expected to survive (Figures 6D and 6E). Accordingly, the five surviving colonies analyzed by PCR showed amplification products compatible with the deletion of the editing scar (Figure 6D), and this deletion of the scar was confirmed by sequencing the PCR products.Taken together, these results demonstrate that the methods / systems described herein generate scarless edits in a simple and cloning-free manner, which will ultimately enable repeated rounds of editing with a single selector vector (i.e., pLoxPuro). Although the incorporation of the I-SceI restriction site in this example is mediated by the editing oligo, it can also be incorporated via a selector plasmid, which reduces the length of the editing oligo, thereby reducing its cost and improving its editing capacity.

[0164] Example 4. Extending the currently described rationale for genome engineering to different site-specific recombinases We have demonstrated that it is possible to overcome the main limitation of the described genome engineering techniques (i.e., the inevitable presence of a scar containing an active RS at the end of the editing protocol) by developing a "scarless" editing protocol. This approach allows iterative rounds of genome editing to be performed, but with an additional transformation step.

[0165] To accelerate the final iterative rounds of editing and increase the modularity of the method / system, we generated a collection of selector plasmids based on different SSRs. As a first step, using the pLoxPuro vector as a reference, we generated four additional selector vectors (called pSloxPuroScre, pRoxPuroDre, pVoxPuroVika and pAttBuroBxb1) based on the Scre (Suzuki et al., Nucleic Acids Res, 2011), Dre (Sauer et al., Nucleic Acids Res, 1999), Vika (Karimova et al., Nucleic Acids Res, 2013) and Bxb1 (Kim et al., Mol Microbiol, 2003; Grindley et al., Annu Rev Biochem, 2006) recombinases, respectively; each of these has a corresponding RS (e.g., slox, rox, vox and attB / attP, respectively). In contrast to our previous assays, these selector plasmids now contain an SSR-A coding gene under the control of a Tet-inducible promoter, thus avoiding the need to obtain strains expressing specific SSR-A beforehand. We then compared the ability of these selector plasmids (e.g., this set and pLoxPuroCre) (Figure 8A) to select for an oligorecombineering event mediating a 0.84 kb deletion at the mpn507 locus (Figure 8B). After cotransformation of each of these selector plasmids and the editing oligo into a strain expressing only GP35 as the SSAP (M129-GP35 strain), we observed a variable number of puromycin-resistant colonies, with pLoxPuroCre being the most productive vector and pSloxPuroScre being the least productive for the resulting colonies (Figure 9). Control transformations with most selector plasmids showed only a small number of colonies. In contrast, the control transformation with pVoxPuroVika gave approximately one third of the colonies obtained from co-transformation of this vector with the editing oligos (Figure 9).This suggests the presence of vox-like sequences in the genome of M. pneumoniae that led to non-specific integration of the vector (e.g., independent of the editing oligo). A scheme showing the expected chromosome conformation before and after the desired edit is shown in Figure 8C, using the pLoxPuroCre selector vector as an example. PCR screening revealed that all plasmids mediated the selection of edited cells with high efficiency (4 or 5 out of 5 cells screened; Figure 8D), whereas with pVoxPuroVika, only 3 out of 5 colonies screened carried out the desired modification (Figure 8D). This is likely a consequence of the relaxed specificity of the Vika / vox system in M. pneumoniae (Figure 9). Sequencing of the PCR products showed in all cases integration of the different selector plasmids and deletion of the targeted region. Taken together, these results demonstrated that the present logic is compatible with several SSRs, regardless of the family to which they belong. This expanded modularity provides a faster approach to perform iterative rounds of genome editing compared to scarless approaches.

[0166] Example 5. Allowing gene platforms to be introduced into target loci The second major drawback of the oligorecombineering protocol (in addition to the inability to directly select edited clones in the absence of obvious phenotypes) is the lack of a single-step process for introducing gene platforms. Given that the techniques described herein involve transient integration of plasmids to facilitate selection of edited clones, the inventors considered that cloning of the desired platform into a specific location of the vector could overcome the limitations of this classical recombineering protocol (Yus et al., Cell Syst, 2019; Breton et al., Microbiology (Reading), 2010); Mariscal et al., DNA Res, 2016; Krishnamurthy et al., BMC Microbiol, 2016; Gibson et al., Science, 2008).

[0167] We tested the ability of this method / system to introduce a gene platform within the framework of genome streamlining. As a proof of concept, we focused on a chromosomal region close to the ori (origin of replication) containing non-essential genes (mpn633, mpn634, mpn635 and mpn638) and flanking the E operon consisting of two essential genes (mpn636 and mpn637) (Figure 8A). For this, we designed i) editing oligos to delete the entire region (5.5 kb; mpn633 to mpn638) and ii) a selector plasmid (called pLoxPuroCreCOMP636-637) in which to clone the two E genes to complement the planned deletion (Figure 8B). Co-transformation of both molecules into the M129-GP35 strain gave rise to a substantially higher number of colonies than those observed in the control transformation with only the selector plasmid (Figure 10). We analyzed five puromycin-resistant colonies from the co-transformation by PCR. For three of these, we obtained PCR products of a size compatible with the deletion of the entire region and the insertion of the pLoxPuroCreCOMP636-637 vector (Figures 8C and 8D). One of these clones was then transformed with a suicide vector encoding Vcre, excising the vector backbone but leaving the edited region in the E operon (Figure 8C). PCR analysis (Figure 8D) and sequencing of the amplified product confirmed that the vector was successfully removed from the target region. These results demonstrate that the technology allows the introduction of a gene platform into a target locus in a single step, a feature that may be particularly interesting in genome streamlining processes.

[0168] Example 6. Adaptation of the cumate induction system for Mycoplasma and its use to generate an all-in-one genome engineering vector The inventors have shown that the rationale for the currently described genome engineering is a very versatile system that allows a wide range of genome modifications to be performed in a single step, with an efficiency always exceeding 50% of the colonies screened, regardless of the type of modification attempted or the SSR used. Nevertheless, an additional transformation step with a suicide vector encoding SSR-B (i.e., Vcre recombinase) must be performed to obtain marker-free modifications and to excise the inserted vector. Since the inclusion of a gene encoding SSR-A in the sequence of the selector plasmid resulted in a system that was still functional (Figures 6-11), the inventors considered that it might also be possible to clone the coding sequence of SSR-B. In this framework, the selector plasmid possesses all the elements (except SSAP) required for a functional genome engineering technique as currently described, in other words generating an on-demand, self-integrating, and self-excisable plasmid. For this purpose, SSR-A and SSR-B should act in a strictly temporal order to mediate the integration and excision of the vector at will. Their expression therefore needs to be driven by two different inducible systems. Unfortunately, only a tetracycline-inducible system was available for Mycoplasma; this system was used to drive the expression of SSR-A upon the addition of anhydrotetracycline (aTc). This forced us to adapt a novel cumate-based system that could control the expression of SRR-B in response to external signals different from aTc. Based on this system, we rationally designed different cumate-responsive constructs for Mycoplasma (see Methods section) and tested their performance to drive the expression of a reporter gene (i.e., the coding sequence of the Venus fluorescent protein).The levels of Venus fluorescence obtained with the three designs (termed Pcum1, Pcum2 and Pcum2.1) (Figure 12A) were tested over a range of inducer doses and compared side-by-side with those produced by the only inducible system previously reported for Mycoplasma, based on the tetracycline repressor (Figure 12B). Leakiness (i.e., the ratio of the fluorescent signal in the absence of inducer to that observed in the WT strain) was negligible for all systems except the PCum1 line, which produced a fluorescent signal 8-fold higher than that observed in the control strain (Figure 12C). In contrast, inducibility (i.e., the fold change in Venus expression between optimal induction conditions and the uninduced state) was nearly 3-fold more pronounced in Pcum2.1 than in Ptet (Figure 12D). Taken together, these results confirm the development of a novel inducible system for M. pneumoniae based on the Pcum2.1 design, which is clearly superior to previously available systems.

[0169] Using this novel inducible system, we constructed an all-in-one genome engineering selector plasmid, named pLoxPuroCreVcre (Figure 13A). We aimed to compare the performance of this selector plasmid with that observed for a selector vector encoding only a puromycin resistance gene (e.g., pLoxPuro) or additionally carrying an SSR-A coding gene (e.g., pLoxPuroCre). Therefore, we assessed in parallel the ability of the three plasmids to select clones with the smallest (Δ90bp) or largest (Δ30kb) editing tested in this study. For this purpose, equimolar amounts of the different selector plasmids were transformed with the appropriate editing oligos into either M129-GP35-Cre (for pLoxPuro plasmids) or M129-GP35 (for pLoxPuroCre and pLoxPuroCreVcre plasmids). Regardless of the attempted modification, cotransformation of editing oligos and pLoxPuroCre selector plasmid showed the highest number of puromycin-resistant colonies. In any case, all cotransformations resulted in a clearly higher amount of puromycin-resistant colonies than that obtained in the respective control transformations with the selector plasmid alone (Figure 14A). To confirm the exact identity of the obtained edits, we analyzed five puromycin-resistant colonies of each cotransformation by PCR with oligos flanking the edited region. According to this analysis, the pLoxPuro selector vector mediated the intended modification in four or five of the five analyzed colonies for the Δ90bp and Δ30kb edits, respectively (Figures 14B and 14D), whereas these percentages were 100% and 60% when pLoxPuroCre was used as the selector vector (Figures 14C and 14E).Although the use of pLoxPuroCreVcre as the selector plasmid resulted in a reduced number of puromycin-resistant colonies compared to pLoxPuro or PloxPuroCre, the percentage of analyzed colonies with the intended modification was as high as that observed with the pLoxPuro selector plasmid: 100% for the Δ90bp edit and 80% for the Δ30kb edit (Figure 13B). Next, three of the clones with the Δ30kb edit selected with pLox66PuroCreVcre were grown in different combinations of puromycin and cumate to check the possibility of mediating vector excision without any additional round of transformation with the Vcre-encoding vector. All clones were able to grow in all conditions tested, except for the condition in which cumate and puromycin were simultaneously present (Figure 13C). This is consistent with the expected behavior of the system, since cumate induction should lead to the expression of Vcre, which would excise the vector from the edited locus and prevent bacterial growth in puromycin. To further confirm this, we analyzed three clones grown in the presence of cumate by PCR, which yielded PCR products of a size compatible with that expected for vector excision (Figure 13D). These products were sequenced, confirming removal of the selector plasmid from the edited region. Together, these results confirmed the functionality of the all-in-one genome engineering selector plasmid, which generates marker-free, genome-scale (up to 30 kb) edits in a single step.

[0170] Alternative bacteria that may be of particular interest for genetic engineering can be equally subjected to the methods described above. Briefly, 15 mL cultures of L. johnsonii strains expressing the RecT protein from Lactobacillus reuteri strain ATCC PTA 6475 (accession number WP_003668036.1) or the RecT protein from Enterococcus faecalis (accession number AAO81865.1), either from the chromosome or from a replicating plasmid, were grown overnight at 37°C under static conditions in Man-Rogosa-Sharpe (MRS) medium. The next day, half of this preinocolum was added to a 50 mL tube containing 42 mL of a cell-weakened version of MRS medium (1.1 M glycine, 1 M sucrose) that also contained an inducer for RecT expression (nisin or cumate). The resulting cell suspension was incubated for 90 min at 37° C. in static conditions. The cells were harvested at 5000 g for 10 min and 4° C. and washed twice with ice-cold MilliQ water. The cell pellet was then resuspended in 1 mL of 50 mM EDTA and left on ice for 5 min before a new round of two washing steps, this time in 0.3 M sucrose. Finally, the cell pellet was resuspended in 400 μL of 0.3 M sucrose and 100 μL of this cell suspension was mixed with 5 μL of the desired editing oligo and 1 μg of a selector plasmid carrying either chloramphenicol or erythromycin resistance and an SSR-encoding gene under the control of a nisin or cumate-responsive promoter. The resulting cell and DNA mixture was transferred to a 0.2 cm gap electroporation cuvette. After a transformation pulse (1.5 kV, 200 Ω and 25 μF), the cells were harvested from the cuvette using 900 μL of MRS medium containing either nisin or cumate as inducers of SSAP and SSR expression and allowed to recover at 37 °C for at least 4 h before being plated on selective (chloramphenicol or erythromycin) MRS agar plates.

[0171] Example 7: Materials and Methods Bacterial strains and culture conditions All strains are summarized in Table 1. Mycoplasma pneumoniae wild-type (WT) strain M129-B7 (ATTC 29342, subtype 1, broth passage number 35) and all its derivatives were grown at 37 °C under 5% CO2 in tissue culture flasks or multiwell plates containing Hayflick modified medium as described elsewhere69. When necessary, Hayflick broth was supplemented with puromycin (3 μg / ml), gentamicin (100 μg / ml) or chloramphenicol (20 μg / ml) for cell selection. To induce the Ptet or Pcum system, anhydrotetracycline (5 ng / ml) or p-isopropyl benzoate (cumate) (100 μM) were used unless otherwise stated. When growth on plates was required, Hayflick broth was supplemented with 0.8% bacto agar.

[0172] [Table 1]

[0173] [Table 2]

[0174] For cloning purposes, E. coli NEB® 5-α High Efficiency strain was grown at 37° C. in LB broth supplemented with ampicillin (100 μg / ml) or on LB agar plates.

[0175] Plasmids and oligonucleotides All plasmids generated in this study were assembled according to the Gibson method 70 and are listed in Table 2. Gene amplification was performed with Phusion DNA polymerase. When necessary, IDT performed gene synthesis. Oligonucleotides used as substrates for recombineering (editing oligos) and oligonucleotides used to screen edited clones were synthesized by IDT (Table 3). Editing oligonucleotides were designed by selecting sequences included in the 40 nucleotide homology arms (HA) of the editing oligonucleotides, taking into account the occurrence of said sequences in the M129 strain genome, allowing up to three mismatches to ensure specificity and to minimize the number of off-target recombineering events. The exact identity of the assembled plasmids and edited genomes was verified by Sanger sequencing (Eurofins genomics).

[0176] [Table 3]

[0177] [Table 4]

[0178] [Table 5]

[0179] [Table 6]

[0180] Editing transformations Electrocompetent cells from M129-GP35-PtetCre or M129-GP35 strains (depending on the presence or absence of the SSR-A coding gene in the selector plasmid used) were prepared as previously described23. The resulting cell suspension (70 μl) was mixed with 0.5 nmol of the selected editing primer (i.e., 5 μl of 100 μM oligo solution) and 2 μg of the desired selector vector, except for the one used to compare the performance of the three different systems (Figure 14A), where the amount of plasmid was adjusted to convert to equimolar amounts (i.e., 1.23 μg, 2 μg or 2.7 μg for pLoxPuro, pLoxPuroCre or pLoxPuroCreVcre, respectively). In all cases, control transformations with only the selector vector were performed to estimate the frequency of spontaneous plasmid insertion in the absence of editing oligos. After the electroporation pulse, the cells were harvested from the cuvette in Hayflick medium already supplemented with aTc and allowed to recover for 2 hours at 37°C. The entire transformation volume was then inoculated into a 75cm2 flask containing 25ml of Hayflick supplemented with puromycin and aTc to induce expression of SSR-A, which mediates plasmid integration. After 24 hours, the cells were scraped off the flask and plated onto puromycin-selective Hayflick agar plates. For all edits, except for the Δ90bp edit (which was plated with only 1% of the transformation volume), a third portion of the transformation was plated. The total number of puromycin-resistant colonies in each transformation was calculated according to the plated volume for each edit.

[0181] Screening of edited clones Colonies were picked from puromycin-selective Hayflick-agar plates and inoculated into 96-well plates filled with 200 μl puromycin-supplemented Hayflick medium per well. Cells were grown and when confluent, genomic DNA was extracted using the MasterPure DNA purification kit (Lucigen) according to the manufacturer's instructions. For screening, approximately 30 ng of gDNA prep was used as template for PCR reaction. PCR products were analyzed by electrophoresis to estimate the size of the amplified products. To further confirm the presence of the correct modifications, products were cleaned using the QIAquick PCR purification kit and sequenced by the Sanger method.

[0182] Vector backbone excision mediated by a suicide plasmid encoding Vcre Clones carrying any selector vector inserted into the edited region were grown in tissue culture flasks to prepare electrocompetent cells as described above. The resulting cell suspensions (70 μl each) were mixed with 2 μg of a suicide vector called pGentaVcre. A control transformation without the plasmid was always performed in parallel. After the electroporation pulse, the cells were allowed to recover for 2 h at 37 °C, after which one-fifth of the transformation was inoculated into a 75 cm2 flask containing 25 ml of Hayflick supplemented with gentamicin. The flasks were incubated at 37 °C for 5 days, a time frame sufficient to kill non-transformed cells and excise the selector plasmid from the edited region of cells that received the pGentaVcre suicide vector. After this incubation, the surviving cells were scraped from the flask and plated onto non-selective Hayflick agar plates. Colonies grown on 96-well plates containing 200 μl of non-selective Hayflick were picked; after expansion, genomic DNA was extracted as described above and excision of the selector plasmid from the edited region was confirmed by PCR.

[0183] ScarlessEdit Electrocompetent cells from edited + degraded clones (i.e., strains with the intended modification with the vector backbone excised from the edited region) were prepared as previously described23. The resulting cell suspension (70 μl) was mixed with 0.5 nmol of editing primers intended to remove the scar at the modified locus (i.e., 5 μl of 100 μM oligo solution) and 2 μg of a suicide vector called pPuroPtet-I-SceI. Control transformations without primers or without plasmid were performed in parallel. After the electroporation pulse, cells were allowed to recover for 2 h at 37 °C, and then one-fifth of the transformation was inoculated into a 75 cm2 flask containing 25 ml of Hayflick supplemented with puromycin. The flasks were incubated at 37 °C for 5 days, and 1 day after inoculation, aTc was added to the medium to induce expression of I-SceI. In this way, the cells have a 24 hour window to take up the oligos and remove the scar before expressing the endonuclease, eliminating clones that have restriction sites incorporated into the scar. After this incubation, surviving cells were scraped from the flask and plated onto non-selective Hayflick agar plates. Growing colonies were picked from the 96-well plates filled with 200 μl of non-selective Hayflick agar, and after growth, genomic DNA was extracted as described above and PCR was used to identify excision of the selector plasmid from the edited region.

[0184] Rational design and screening of Pcum inducible systems using Venus reporters In recent years, a novel inducible system based on the regulatory components of the cmt operon from Pseudomonas putida (i.e., the CymR transcription factor and its operator sequence, CuO) has been successfully applied to various organisms, including mammalian cells (Mullick et al., BMC Biotechnol, 2006) (Choi et al., Appl Environ Microbiol, 2010; Choi et al., Appl Environ Microbiol, 2006; Kaczmarczyk et al., Appl Environ Microbiol, 2013; Horbal et al., Appl Microbiol Biotechnol, 2014; Seo et al., Appl Microbiol Biotechnol, 2019). Given its apparent portability and the fact that the system responds to cumate, a non-toxic, inexpensive, and carbon source-independent compound, we decided to adapt this system to M. pneumoniae. Based on this system, we rationally designed different cumate-responsive constructs for Mycoplasma and tested their performance in driving the expression of a reporter gene (i.e., the coding sequence for the Venus fluorescent protein).

[0185] In all designs, the CymR coding gene (i.e., the repressor of the system) is placed under the control of the SynMyco regulatory region (RR), a synthetic sequence that promotes efficient transcription and translation of coding sequences in various Mycoplasma species. To drive reporter gene expression, we used three different sequences derived from PVeg, namely the strong constitutive promoter of B. subtilis already used in the cumate inducible system available for this strain (Figure 12A). The Pcum1 design is based on the WT sequence of PVeg, which has been described to have two different binding sites for RNA polymerase (RNApol) (Figure 12A). Based on the near-constitutive behavior of the Pcum1 design (Figure 12B), we generated PCum2 in which the RNApol binding site more distal from CuO was removed (Figure 12A). Finally, given the limited strength of the Pcum2 design under inducing conditions (Fig. S12B), we generated a derivative of PCum2, Pcum2.1, in which a few nucleotides were altered to increase the affinity of the RNApol complex for this sequence (Fig. S12A).

[0186] For the screening of different induction systems, transposons carrying the Venus-encoded gene coupled to the Pcum design or the previously available Ptet system were transformed into the WT strain. The resulting strains were inoculated together into 96-well plates filled with Hayflick medium supplemented with the corresponding doses of cumate (4 μM, 20 μM and 100 μM) or aTc (2 ng / ml, 10 ng / ml and 50 ng / ml) as inducer, as indicated. In addition, the WT strain (which did not have the Venus-encoded gene) was included as a control strain to determine autofluorescence. Each strain and inducer dose was evaluated in three different wells (i.e. biological replicates). After 48 h of growth, the medium was removed from the wells and washed twice with PBS to minimize the interference of the medium with the fluorescence measurements. Absorbance and fluorescence values ​​were measured using a Tecan I-Control 1.9.17.0 Infinite 200. Settings were determined for optimal gain, 25 flashes, and an integration time of 20 μs. Fluorescence settings were λex=514 nm and λem=574 nm, and absorbance was determined at λ=600 nm. All fluorescence levels were normalized by absorbance levels. To summarize all results, we calculated the leakiness and inducibility of all induction systems. Leakiness was determined after dividing the fluorescence signal in the absence of inducer for each strain by that observed in the WT strain. Inducibility was calculated after dividing the fluorescence signal observed at the optimal inducer concentration by that obtained in the absence of inducer for each strain. The values ​​obtained for these two parameters in each induction system were evaluated for statistical significance using a one-way analysis of variance Tukey's test.

[0187] Vector backbone excision mediated by cumate induction Clones carrying the pLoxPuroCreVcre selector vector inserted in the edited region were grown in Hayflick medium supplemented with cumate at a final concentration of 100 μM in 24-well plates. Additional medium compositions based on Hayflick plain, Hayflick supplemented with puromycin, or Hayflick supplemented with puromycin and cumate were included as controls (Figure 13C). Cells were grown and upon reaching confluence, genomic DNA was extracted using the MasterPure DNA Purification Kit (Lucigen) according to the manufacturer's instructions. For screening, approximately 30 ng of gDNA preps were used as template for PCR reactions. The products of the PCR were subjected to electrophoretic analysis to estimate the size of the amplified products. To further confirm the intended modifications, these products were cleaned using the QIAquick PCR Purification Kit and sequenced by the Sanger method.

[0188] Funding Approval Carlos Pinero Lambea is supported by the “Programa Torres Quevedo” (PTQ) contract PTQ2020-011048 funded by MCIN / AEI / 10.13039 / 501100011033 and NextGenerationEU / PRTR.

Claims

1. 1. An oligonucleotide modification system for the genetic modification of bacteria, comprising: the bacterium comprises a ssDNA annealing protein or an oligonucleotide encoding the ssDNA annealing protein; The oligonucleotide modification system comprises: A first nucleotide sequence: - two nucleotide sequences (HA1 and HA2) each comprising a stretch of at least 5 consecutive nucleotides (located at) respectively the 5' and 3' of the target genomic sequence to be genetically modified, a recognition sequence for a first site-specific recombinase (RSA), a first nucleotide sequence arranged such that the first nucleotide arrangement comprises one of the two nucleotide sequences (HA1) comprising a stretch of at least 5 consecutive nucleotides 5' to the RSA recognition sequence and the other nucleotide sequence (HA2) comprising a stretch of at least 5 consecutive nucleotides 3' to the RSA recognition sequence; A second nucleotide sequence: - said recognition sequence for said first site-specific recombinase (RSA), at least two recognition sequences for a second site-specific recombinase (RSB), a second nucleotide sequence arranged such that the second nucleotide arrangement includes at least one RSB recognition sequence 5' to the RSA recognition sequence and at least one RSB recognition sequence 3' to the RSA sequence; An oligonucleotide modification system comprising:

2. 2. The oligonucleotide modification system of claim 1, wherein the ssDNA annealing protein is a third recombinase, preferably a GP35 recombinase, more preferably a GP35 recombinase having an amino acid sequence that is at least 65% identical, preferably at least 75% identical, more preferably at least 85% identical, and most preferably at least 95% identical to the amino acid sequence of GP35 from Bacillus subtilis bacteriophage SPP1 as defined in SEQ ID NO:1, based on the full length of the amino acid sequence of the recombinase.

3. 3. The oligonucleotide modification system of claim 1 or 2, wherein the second nucleotide arrangement further comprises a nucleotide sequence encoding at least one gene product that allows for phenotypic selection of a bacterium containing the second nucleotide arrangement.

4. The oligonucleotide modification system according to any one of claims 1 to 3, wherein the second nucleotide arrangement further comprises a nucleotide sequence encoding the first recombinase (RSA) and / or a nucleotide sequence encoding the second recombinase (RSB), preferably each recombinase being operably linked to a promoter sequence.

5. The oligonucleotide modification system according to any one of claims 1 to 4, wherein at least the first recombinase (RSA) or the second recombinase (RSB) is operably linked to an inducible operator sequence, preferably the second recombinase (RSB) is operably linked to an inducible operator sequence.

6. The oligonucleotide modified system according to any one of claims 1 to 5, wherein at least one of said recombinases is operably linked to a cumate-responsive inducible operator sequence (CuO), preferably having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity to SEQ ID NO:6 or SEQ ID NO:

10.

7. The first nucleotide sequence is between said RSA recognition sequence and a stretch of at least 5 consecutive nucleotides of the genomic sequence (HA1) of said bacterium to be modified (located 5' of said RSA recognition sequence), or between said RSA recognition sequence and a stretch of at least 5 consecutive nucleotides of the genomic sequence (HA2) of said bacterium to be modified (located 3' of said RSA recognition sequence), and further comprising an intron-encoded endonuclease restriction site sequence located at Preferably, said intron-encoded endonuclease restriction site is an I-SceI endonuclease restriction site. The oligonucleotide modification system according to any one of claims 1 to 6.

8. Use of the oligonucleotide modification system according to any one of claims 1 to 7 for the genetic modification of bacteria, preferably wherein said genetic modification is the introduction, substitution or deletion of one or more nucleotide sequences.

9. 1. A method for genetically modifying a bacterium, comprising: - transforming a culture of said bacteria containing a ssDNA annealing protein or an oligonucleotide encoding said ssDNA annealing protein with (i) an oligonucleotide modification system according to any one of claims 1 to 7, and (ii) a first recombinase (RSA); - selecting bacteria from said culture which contain a genomic sequence into which said second nucleotide sequence has been integrated; - expressing a second recombinase (RSB) in said bacterium, thereby removing said second nucleotide sequence from said genomic sequence of said bacterium. A method comprising:

10. 10. The method of claim 9, wherein the first recombinase (RSA) and / or the second recombinase (RSB) are encoded by a nucleotide sequence of a third nucleotide arrangement.

11. 11. The method of claim 9 or 10, wherein said first and second recombinases are encoded by said second nucleotide arrangement, preferably said second nucleotide arrangement being a plasmid.

12. 12. The method of claim 11, comprising the temporal regulation of expression of said first and / or said second recombinase, preferably comprising the temporal regulation of expression of said second recombinase.

13. 13. The method of any one of claims 9 to 12, comprising the further steps of contacting the bacterium with a nucleotide sequence consisting of HA1 and HA2 and contacting the bacterium with an intron-encoded endonuclease, preferably wherein the intron-encoded endonuclease is I-SceI endonuclease.

14. The method according to claim 13, wherein the resulting bacterium does not contain a site-specific recombinase scar sequence in its genomic sequence.

15. A genetically modified bacterium obtainable by the method defined in any one of claims 9 to 14.

Images