Systems and methods for identifying microbiomic treatment for hereditary and metabolic diseases

WO2025185695A8PCT designated stage Publication Date: 2025-10-02FUDAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/081010
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-07
Filing Date
2025-03-06
Publication Date
2025-10-02

AI Technical Summary

Technical Problem

Current methods struggle to effectively identify and verify microbiome-based therapeutic interventions for hereditary and metabolic diseases due to complex interactions and interindividual variability, lacking efficient screening and verification processes.

Method used

A high-throughput screening method using Caenorhabditis elegans models and bacterial libraries with single-gene mutations, enabling unbiased phenotype-based identification of genetically modified bacteria that affect disease-related phenotypes, followed by verification in mammalian models.

Benefits of technology

This approach allows for rapid identification and verification of microbiome-related therapeutic options for metabolic and hereditary diseases, bypassing the need for comprehensive mechanistic studies and providing effective treatments.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

Disclosed herein are methods and systems ofscreening for microbiomics treatments for hereditary diseases or metabolic diseases using high-throughput nematode models. Genetically modified bacteria with therapeutic potential in treating certain hereditary diseases or metabolic diseases, compositions comprising such bacteria, as well as methods of uses such bacteria are also disclosed herein.
Need to check novelty before this filing date? Find Prior Art

Description

SYSTEMS AND METHODS FOR IDENTIFYING MICROBIOMIC TREATMENT FOR HEREDITARY AND METABOLIC DISEASES

[0001] This application claims priority to PCT International Application No. PCT / CN2024 / 080599, filed March 7, 2024, which is entirely incorporated herein by reference. 1. Reference to Sequence Listing Submitted Electronically

[0002] This application incorporates by reference a Sequence Listing as an XML file entitled “076A001WO02_SL” created on March 3, 2025, and having a size of 20, 128 bytes.2. Field

[0003] The present invention relates to microbiome, molecular biology, genomics, and medicine.3. Background

[0004] The microbiome holds immense promise in addressing a wide range of human diseases, from metabolic disorders to hereditary conditions. Research suggests that the composition and function of the microbiome influence various physiological processes, including metabolism, immune function, and inflammation. While significant progress has been made in understanding the role of the microbiome in disease, translating this knowledge into effective treatments remains a formidable task. The challenges relating to developing novel microbiome-based therapeutic interventions include, for example, deciphering its complex interactions, addressing interindividual variability, ensuring safety and efficacy of interventions, etc. As such, despite the great potential, effective microbiome-based therapeutic options for metabolic or hereditary diseases are still lacking and in urgent need.

[0005] Provided herein are novel systems and methods that address this need and provide related advantages.4. Brief Description of Drawings

[0006] FIG. 1 shows results of fluorescence imaging of transgenic C. elegans Is [ins-1p: : GFP] . As shown, B. subtilis with suppression of acpP, asd, or metS significantly enhanced the fluorescence signals.

[0007] FIG. 2 provides results of SRS microscopy showing in vivo fat content in nematodes. As shown, B. subtilis with suppression of dapH significantly decreased the fat content while the bacteria with racE suppression significantly increased the fat content in the intestine of the C. elegans.

[0008] FIG. 3 shows results of in vivo fat storage observation in mice. Consistent with the findings in C. elegans, B. subtilis with suppression of dapH significantly decreased the fat content while the bacteria with racE suppression significantly increased the adipose tissues in mice.

[0009] FIG. 4 provides pictures of nematodes at the same scale for comparison of body length. As shown, B. subtilis with suppression of accA or coaBC significantly increased the body length of the C. elegans with sma-6 (wk7) mutation.

[0010] FIG. 5 shows results of fluorescence imaging of transgenic C. elegans Is [unc-54p: : Q40: : YFP] . As shown, E. coli with deletion of pheL significantly reduced the number of the aggregations.

[0011] FIG. 6 shows results of pharyngeal pumping rate observation. As shown, the difference in pharyngeal pumping rates of nematodes with chd-7 (gk290) and chd-7 (gk306) mutations was diminished in the same transgenic nematodes fed on E. coli with deletion of potA, ymfl or agaB.

[0012] FIG. 7 illustrates the basic setup of the social experiment measuring the social preference index in Chd8+ / -mutant mice.

[0013] FIG. 8 shows social preference index analysis of Chd8+ / -mutant mice. As shown, treatment with E. coli with mutation in agaB corrected the autistic behavior in Chd8+ / -mutant mice.5. Summary

[0014] Provided herein are methods of screening for a genetically modified bacterium for treating a hereditary disease or metabolic disease in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria; wherein the nematodes provide a model for the hereditary disease or metabolic disease; and (2) identifying the genetically modified bacterium that affects a disease-related phenotype in the nematode model.

[0015] In some embodiments, the nematodes are Caenorhabditis elegans. In some embodiments, the nematodes are genetically modified. In some embodiments, the genetic modification of the nematodes comprises overexpression, mutation or deletion of an endogenous gene, or expression of an exogenous gene. In some embodiments, the genetic modification of the nematodes comprises mutation of an endogenous gene.

[0016] In some embodiments, methods provided herein further comprise (0) generating a nematode model for the hereditary disease or metabolic disease. In some embodiments, step (0) comprises identifying a measurable disease-related phenotype in nematode. In some embodiments, the hereditary disease or metabolic disease is caused by a gene mutation, and step (0) comprises identifying a nematode homolog of the disease-causing gene in mammals and generating a nematode with a mutation in the homologous gene and measurable disease-related phenotype.

[0017] In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats the disease in a mammal. In some embodiments, step (3) comprises administering the genetically modified bacterium to the mammal having the disease and monitoring the disease in the mammal. In some embodiments, the mammal is mouse.

[0018] In some embodiments of the methods provided herein, the bacteria are E. coli. In some embodiments, the bacteria are B. subtilis.

[0019] In some embodiments of the methods provided herein, the library is a single gene mutation library. In some embodiments, the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library.

[0020] In some embodiments of the methods provided herein, the hereditary disease or metabolic disease is Type I diabetes, a lipid metabolism disorder, idiopathic short stature (ISS) , a polyglutamine disease, or autism spectrum disorder (ASD) .

[0021] In some embodiments, provided herein are methods of screening for a genetically modified bacterium for treating Type I diabetes in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria; and (2) identifying the genetically modified bacterium that activates insulin expression in the nematode. In some embodiments, the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein driven by promoter for ins-1 (ins-1p) and step (2) comprises identifying the genetically modified bacterium that enhances florescent signal in the nematode. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats Type I diabetes in a mammal. In some embodiments, step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its insulin expression.

[0022] In some embodiments, provided herein are methods of screening for a genetically modified bacterium for treating a lipid metabolism disorder in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria; and (2) identifying the genetically modified bacterium that increases or decreases the lipid storage in the nematodes. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium affects lipid metabolism in a mammal. In some embodiments, step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its lipid storage.

[0023] In some embodiments, provided herein are methods of screening for a genetically modified bacterium for treating ISS in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria, wherein the nematodes comprise a mutation in sma-6; and (2) identifying the genetically modified bacterium that restores the shortened body length in the nematode. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats ISS in a mammal. In some embodiments, step (3) comprises administering the genetically modified bacterium to a mouse with mutation in BMPR1A or BMPRIB and monitoring its body length, limb length, limb morphology, or any combination thereof. In some embodiments, step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its body length and / or limb length. In some embodiments, step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its limb morphology.

[0024] In some embodiments, provided herein are methods of screening for a genetically modified bacterium for treating a polyglutamine disease in a mammal, comprising: (1) feeding a plurality of nematodes with a library of genetically modified bacteria, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein tagged with multiple glutamine residues and (2) identifying the genetically modified bacterium that reduces aggregated fluorescent signals in the nematode. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats polyglutamine disease in a mammal. In some embodiments, step (3) comprises administering the genetically modified bacterium to a mouse model for polyglutamine disease and monitoring disease progression.

[0025] In some embodiments, provided herein are methods of screening for a genetically modified bacterium for treating ASD in a mammal, comprising: (1) feeding a plurality of nematodes with a library of genetically modified bacteria, wherein the nematodes comprise a deletion of an allele of chd-7; and (2) identifying the genetically modified bacterium that restores the pharyngeal pumping rate in the nematode. In some embodiments, the nematodes comprise a deletion of chd-7 (gk290) . In some embodiments, the nematodes comprise a deletion of chd-7 (gk306) . In some embodiments, the nematodes comprise a first group having a deletion of chd-7 (gk290) and a second group having a deletion of chd-7 (gk306) . In some embodiments, the pharyngeal pumping rate in the nematode is restored to normal level. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats ASD in a mammal. In some embodiments, step (3) comprises administering the genetically modified bacterium to a mouse with Chd8 mutation and monitoring its social behavior.

[0026] In some embodiments of the methods disclosed herein, the nematodes are C. elegans.

[0027] In some embodiments of the methods disclosed herein, the bacteria are E. coli. In some embodiments, the bacteria are B. subtilis. In some embodiments of the methods disclosed herein, the library is a single gene mutation library. In some embodiments, the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library.

[0028] Provided herein are systems for screening for a genetically modified bacterium for treating a hereditary disease or metabolic disease in a mammal, comprising: a plurality of nematodes that provide a model for the genetic disease or metabolic disease and a library of genetically modified bacteria.

[0029] In some embodiments, the nematodes are C. elegans.

[0030] In some embodiments, systems provided herein further comprise a mammal that provides a model for the genetic disease or metabolic disease. In some embodiments, the mammal is mouse.

[0031] In some embodiments of the systems provided herein, the bacteria are E. coli. In some embodiments, the bacteria are B. subtilis. In some embodiments, the library is a single gene mutation library. In some embodiments, the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library.

[0032] In some embodiments of the systems provided herein, the nematodes are genetically modified. In some embodiments, the genetic modification of the nematodes comprises overexpression, mutation or deletion of an endogenous gene, or expression of an exogenous gene. In some embodiments, the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein driven by promoter for ins-1 (ins-1p) . In some embodiments, the nematodes comprise a mutation in sma-6 (wk7) . In some embodiments, the nematodes comprise a deletion of an allele of chd-7. In some embodiments, the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein tagged with multiple glutamine residues.

[0033] In some embodiments of the systems provided herein, the hereditary disease or metabolic disease is Type I diabetes, a lipid metabolism disorder, idiopathic short stature (ISS) , a polyglutamine disease, or autism spectrum disorder (ASD) .

[0034] In some embodiments, provided herein are pharmaceutical compositions for treating a hereditary disease or metabolic disease in a mammal comprising the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.

[0035] In some embodiments, provided herein are methods of treating a hereditary disease or metabolic disease in a mammal comprising administering to the mammal the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.

[0036] In some embodiments, provided herein are pharmaceutical compositions for treating Type I diabetes in a mammal comprising the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier. In some embodiments, provided herein are pharmaceutical compositions for treating Type I diabetes in a mammal comprising a genetically modified bacterium having a mutation in acpP, asd, or metS or a gene homologous to acpP, asd, or metS, and a pharmaceutically acceptable carrier.

[0037] In some embodiments, provided herein are methods of treating Type I diabetes in a mammal comprising administering to the mammal the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium. In some embodiments, provided herein are methods of treating Type I diabetes in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in acpP, asd, or metS or a gene homologous to acpP, asd, or metS.

[0038] In some embodiments, provided herein are pharmaceutical compositions for treating a lipid metabolism disorder in a mammal comprising the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier. In some embodiments, provided herein are pharmaceutical compositions for treating a lipid metabolism disorder in a mammal comprising a genetically modified bacterium having a mutation in dapH or racE or a gene homologous to dapH or racE, and a pharmaceutically acceptable carrier.

[0039] In some embodiments, provided herein are methods of treating a lipid metabolism disorder in a mammal comprising administering to the mammal the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium. In some embodiments, provided herein are methods of treating a lipid metabolism disorder in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in dapH or racE or a gene homologous to dapH or racE.

[0040] In some embodiments, provided herein are pharmaceutical compositions for treating ISS in a mammal comprising the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier. In some embodiments, provided herein are pharmaceutical compositions for treating ISS in a mammal comprising a genetically modified bacterium having a mutation in accA or coaBC or a gene homologous to accA or coaBC, and a pharmaceutically acceptable carrier.

[0041] In some embodiments, provided herein are methods of treating ISS in a mammal comprising administering to the mammal the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium. In some embodiments, provided herein are methods of treating ISS in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in accA or coaBC or a gene homologous to accA or coaBC.

[0042] In some embodiments, provided herein are pharmaceutical compositions for treating a polyglutamine disease in a mammal comprising the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier. In some embodiments, provided herein are pharmaceutical compositions for treating a polyglutamine disease in a mammal comprising a genetically modified bacterium having a mutation in pheL or a gene homologous to pheL, and a pharmaceutically acceptable carrier.

[0043] In some embodiments, provided herein are methods of treating a polyglutamine disease in a mammal comprising administering to the mammal the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium. In some embodiments, provided herein are methods of treating a polyglutamine disease in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in pheL or a gene homologous to pheL.

[0044] In some embodiments, provided herein are pharmaceutical compositions for treating ASD in a mammal comprising the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier. In some embodiments, provided herein are pharmaceutical compositions for treating ASD in a mammal comprising a genetically modified bacterium having a mutation in potA, ymfI, or agaB or a gene homologous to potA, ymfI, or agaB, and a pharmaceutically acceptable carrier.

[0045] In some embodiments, provided herein are methods of treating ASD in a mammal comprising administering to the mammal the genetically modified bacterium identified by methods disclosed herein or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium. In some embodiments, provided herein are methods of treating ASD in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in potA, ymfI, or agaB or a gene homologous to potA, ymfI, or agaB.

[0046] In some embodiments, of the pharmaceutical compositions or the methods disclosed herein, the bacterium is a Gram-positive bacterium or a Gram-negative bacterium. In some embodiments, the bacterium is a Gram-positive bacterium. In some embodiments, the bacterium is a Gram-negative bacterium. In some embodiments, the bacterium is a bacterium existing in the human microbiota.

[0047] In some embodiments, the bacterium is Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, Fusobacteria or Verrucomicrobia. In some embodiments, the bacterium is Faecalibacterium, Clostridium, Ruminococcus, Ruthenibacterium, Lactobacillus, Lacticaseibacillus, Limosilactobacilli, Enterococcus, Staphylococcus, Eubacterium, Streptococcus, Bacillus, Pediococcus, Leuconostoc, Lactococcus, Bacteroides, Prevotella, Parabacteroides, Bifidobacterium, Corynebacterium, Propionibacterium, Acidipropionibacterium, Escherichia, Fusobacterium, or Akkermansia.

[0048] In some embodiments, the bacterium is E. coli, B. subtilis, F. prausnitzii, C. butyricum, C. beijerinckii, R. faecis, R. bromii, R. lactatiformans, L. reuteri, L. delbrueckii, L. acidophilus, L. helveticus, L. casei, L. paracasei, L. rhamnosus, L. reuteri, L. fermentum, E. faecium, E. faecalis, S. xylosus, S. carnosus, S. vitulinus, E. rectale, S. parasanguinis, S. thermophilus, B. cereus, B. coagulans, P. acidilactici, P. pentosaceus, L. mesenteroides, L. lactis, L. cremoris, B. fragilis, B. vulgatus, B. uniformis, P. copri, P. distasonis. B. longum, B. bifidum, B. breve, B. adolescentis, B. animalis, C. accolens, P. freudenreichii, A. acidipropionici, F. nucleatum, or A. muciniphila.6. Detailed Description

[0049] Scientists aiming to develop novel microbiome-based therapeutic interventions for hereditary and metabolic diseases have tried to search for a single genetic component in the intestinal flora that affects the disease process and construct engineered bacteria that have such genetic components as a potential therapeutic. However, there has been very limited progress due to the challenges in identifying and confirming the genetic component that possesses therapeutic potential. Not only the technical difficulties, but also the lack of basic understanding have created the formidable barrier.

[0050] The systems and methods provided herein overcome the above-mentioned challenges and enable efficient identification of verifiable microbiome-related therapeutic options for metabolic diseases and hereditary diseases. Briefly, systems and methods provided herein are characterized by, for example, high throughput screening based on Caenorhabditis elegans and bacterial libraries with single-gene mutation. Using the C. elegans disease models disclosed herein, mutant bacteria with known genetic background can be quickly identified and subject to further verification using mammal models (e.g., mouse models) . The mechanisms of action of the mutant bacteria can also be explored. Nonetheless, different from prior research guided by known mechanisms, the systems and methods disclosed herein are routed in unbiased, phenotype-based screening, therefore bypassing the need for comprehensive mechanistic studies before identification of microbiome-based therapies. 6.1 Definitions

[0051] Unless otherwise defined herein, scientific and technical terms used in the present disclosures shall have the meanings that are commonly understood by those of ordinary skill in the art. For example, the CONCISE DICTIONARY OF BIOMEDICINE AND MOLECULAR BIOLOGY, Juo, Pei-Show, 2nd ed., 2002, CRC Press; THE DICTIONARY OF CELL AND MOLECULAR BIOLOGY, 3rd ed., 1999, Academic Press; and the OXFORD DICTIONARY OF BIOCHEMISTRY AND MOLECULAR BIOLOGY, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.

[0052] Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art.

[0053] The term “a” or “an” entity refers to one or more of that entity; for example, “an antibody, ” is understood to represent one or more antibodies.

[0054] The term “and / or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B, ” “A or B, ” “A” (alone) , and B” (alone) . Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone) ; B (alone) ; and C (alone) .

[0055] As used herein, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects. The term “about” encompasses the exact number recited. In some embodiments, “about” means within plus or minus 10%of a given value or range. In certain embodiments, “about” means that the variation is±5%, ±4%, ±3%, ±2%, ±1%, ±0.5%, ±0.2%, or ±0.1%of the value to which “about” refers. In some embodiments, “about” means that the variation is±1%, ±0.5%, ±0.2%, or±0.1%of the value to which “about” refers.

[0056] As used herein and understood in the art, the term “gene” refers to segments of DNA located on chromosomes which encode for proteins or functional RNA molecules. Genes determine various characteristics of an organism, including its physical traits, biochemical properties, and susceptibility to certain diseases. A “gene mutation” refers to an alteration in the DNA sequence of a gene. Gene mutations can arise spontaneously or be induced by external factors. Mutations can affect the expression or function of a gene, leading to changes in protein structure or function, disruptions in gene regulation, or loss of gene activity.

[0057] Gene mutations can be gain-of-function or loss-of-function. Gain-of-function mutations result in an increase in the expression or activity of the gene product (usually a protein) encoded by the mutated gene. Loss-of-function mutations result in a decrease or complete loss of activity of the gene product, leading to a reduction or absence of its normal function. This can occur through protein inactivation, reduced expression, protein degradation. A mutation is repressive means that it is a loss-of-function mutation. A deletion mutation, which involves the loss or removal of a segment of DNA from a gene typically leads to the loss of gene function.

[0058] As used herein and understood in the art, the term “endogenous” refers to genes or molecules that originate from within the host organism. The term “exogenous, ” on the other hand, refers to genes or molecules that are introduced into the host organism from external sources. For example, the molecule can be introduced by introduction of an encoding nucleic acid into the host genetic material such as by integration into a host chromosome or as non-chromosomal genetic material such as a plasmid.

[0059] As used herein and understood in the art, a gene “homolog” refers to a gene that is evolutionarily related to the reference gene through common ancestry. Gene homologs share sequence similarity or structural conservation with each other, which may be present within the same organism (paralogs) or between different species (orthologs) . Gene homologs often retain similar functions or biochemical properties.

[0060] As used herein, a “disease-causing gene, ” also referred to as a “pathogenic gene” or “disease gene, ” is a gene that harbors mutations or variants that directly contribute to the development or predisposition to a specific disease or disorder. These mutations can alter the normal function of the gene's protein product or disrupt regulatory elements, leading to dysregulated biological processes, cellular dysfunction, and ultimately, disease phenotypes. Depending on the nature of the gene and the mutation, disease-causing genes may exert their effects through different mechanisms, such as loss of function, gain of function, dominant inheritance, recessive inheritance, or multifactorial inheritance. A “gene associated with a disease” refers to a gene that has been implicated in the development, progression, or susceptibility to a specific disease or disorder based on scientific evidence from genetic studies, functional analyses, or clinical observations. These genes also can harbor mutations, variants, or dysregulations that contribute to the disease phenotype or increase the risk of developing the disease.

[0061] As used herein and understood in the art, a “genetically modified” organism refers to an organism whose genetic material has been altered using genetic engineering techniques. Genetic modification involves the introduction, deletion, or modification of specific genes or DNA sequences to impart desired traits or characteristics to the organism.

[0062] As used herein, a bacteria “library” refers to a collection of bacterial cells, each containing a specific genetic modification targeting a particular gene of interest. A “single gene mutation library” is a collection of bacterial cells, each harboring a specific mutation in a single gene within its genome. These mutations can be generated using various genetic engineering techniques, such as site-directed mutagenesis, random mutagenesis, or CRISPR-Cas9 genome editing. Each bacterial cell in the library has a distinct mutation in a particular gene, resulting in a diverse population of mutants with altered gene function or expression. A single gene mutation library can be, for example, a single gene deletion library, a single gene repression library, or a single gene overexpression library. A “single gene deletion library” refers to a collection of bacterial cells, each containing a deletion or disruption of a single gene in its genome. These deletions are typically generated using genetic engineering techniques such as homologous recombination or transposon mutagenesis. A “single gene repression library” refers to a collection of bacterial cells, each containing a genetic modification that represses or downregulates the expression of a specific gene. This repression can be achieved by, for example, inducible promoters, RNA interference (RNAi) mechanisms, or antisense RNA molecules that target the mRNA transcripts of the gene of interest. A “single gene overexpression library” refers to a collection of bacterial cells, each containing a genetic modification that leads to the overexpression or upregulation of a specific gene. This overexpression can be achieved by, for example, introducing additional copies of the gene into the bacterial genome, using plasmid vectors or chromosomal integration systems, under the control of strong promoters or regulatory elements.

[0063] As used herein and understood in the art, an “animal model” such as a “nematode model” or a “mouse model” for human disease refers to a non-human animal that mimic specific aspects of human diseases or disorders. These model animals are chosen based on their genetic, physiological, and behavioral similarities to humans, as well as their amenability to experimental manipulation and analysis. Animal models are often used to represent specific aspects or features of a disease rather than fully replicate the complicated disease. Animal models can, for example, carry a similar gene mutation that is associated with the human disease.

[0064] As used herein and understood in the art, the term “phenotype” refers to the observable characteristics or traits of an organism, which arise from the interaction between its genotype and the environment. Phenotypes can encompass a wide range of traits, including physical features (such as height, weight, or body shape) , physiological functions (such as blood sugar or lipid levels) , biochemical properties (such as enzyme activity or hormone levels) , and behavioral traits (such as locomotor activity or learning ability) . Phenotypes are the result of gene expression, protein function, and interactions between genes and the environment. A “disease-related phenotype” refers to the specific set of observable characteristics or traits associated with a particular disease or disorder. These phenotypic features can include symptoms, signs, biochemical abnormalities, or physiological dysfunctions that are characteristic of the disease state. Disease-related phenotypes can vary widely depending on the nature of the disease, its underlying genetic or environmental causes, and the affected tissues or organs. A “measurable phenotype” refers to a phenotype that can be quantitatively measured, assessed, or analyzed using objective methods, techniques, or instruments to characterize and study genetic, physiological, or behavioral traits in organisms, including humans and model organisms. Examples of measurable phenotypes can include physical measurements (such as height, weight, or body mass index) , biochemical assays (such as enzyme activity or hormone levels) , imaging techniques (such as CT or PET scans) , behavioral assays (such as activity monitoring or cognitive tests) , or molecular analyses (such as gene expression profiling or proteomics) . Measurable phenotypes provide quantitative data that can be analyzed statistically and compared between individuals or experimental conditions. As used herein, a treatment that “affects” a phenotype means that the treatment results in a change in the measurable phenotype. The change can be statistically significant.

[0065] The term “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” refers to a material that is suitable for drug administration to an individual along with an active agent without causing undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition. In some embodiments, the pharmaceutical compositions disclosed herein can comprise one or more of a buffer system, a preservative, a tonicity agent, a chelating agent, a stabilizer and / or a surfactant, as well as various combinations thereof. The use of preservatives, isotonic agents, chelating agents, stabilizers and surfactants in pharmaceutical compositions is well-known to the skilled person. Reference may be made to REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY, 19th edition, 1995.

[0066] The term “treat” and its grammatical equivalents as used herein in connection with a disease or a condition, or a subject having a disease or a condition refer to an action, intervention and / or measure that suppresses, eliminates, reduces, and / or ameliorates a symptom, the severity of the symptom, and / or the frequency of the symptom associated with the disease or disorder being treated.

[0067] The term “administer” and its grammatical equivalents as used herein refer to the act of delivering, or causing to be delivered, a therapeutic or a pharmaceutical composition to the body of a subject by a method described herein or otherwise known in the art. The therapeutic can be a compound, a polypeptide, an antibody, an antibody-drug conjugate, or a cell. Administering a therapeutic or a pharmaceutical composition includes prescribing a therapeutic or a pharmaceutical composition to be delivered into the body of a subject. Exemplary forms of administration include oral dosage forms, such as tablets, capsules, syrups, suspensions; injectable dosage forms, such as intravenous (IV) , intramuscular (IM) , or intraperitoneal (IP) ; transdermal dosage forms, including creams, jellies, powders, or patches; buccal dosage forms; inhalation powders, sprays, suspensions, and rectal suppositories.

[0068] The terms “effective amount, ” “therapeutically effective amount, ” and their grammatical equivalents as used herein refer to the administration of an agent to a subject, either alone or as a part of a pharmaceutical composition and either in a single dose or as part of a series of doses, in an amount that is capable of having any detectable, positive effect on any symptom, aspect, or characteristics of a disease, disorder or condition when administered to the subject. The therapeutically effective amount can be ascertained by measuring relevant physiological effects. The exact amount required varies from subject to subject, depending on the age, weight, and general condition of the subject, the severity of the condition being treated, the judgment of the clinician, and the like. An appropriate “effective amount” in any individual case can be determined by one of ordinary skill in the art using routine experimentation.

[0069] The term “subject” as used herein refers to any animal (e.g., a mammal) , including, but not limited to, humans, non-human primates, canines, felines, rodents, and the like, which is to be the recipient of a particular treatment. Mammals include, but are not limited to, farm animals, sport animals, pets, primates, horses, dogs, cats, mice and rats. A human subject who needs the treatment may be a human subject having, at risk for, or suspected of having a disease. A subject having a disease can be identified by routine medical examination, e.g., a physical examination, a laboratory test, an organ functional test, a CT scan, or an ultrasound. A subject suspected of having any of such a disease can show one or more symptoms of the disease. A subject at risk for the disease can be a subject having one or more of the risk factors for that disease. A subject can be a human. A subject can have a particular disease or condition.

[0070] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0071] Exemplary genes and polypeptides are described herein with reference to GenBank numbers, GI numbers and / or SEQ ID NOS. It is understood that one skilled in the art can readily identify homologous sequences by reference to sequence sources, including but not limited to Uniprot (https:  / / www. uniprot. org / ) , GenBank (ncbi. nlm. nih. gov / genbank / ) and EMBL (embl. org / ) . 6.2 Methods

[0072] Provided herein are methods of screening for a genetically modified bacterium for treating a hereditary disease or metabolic disease in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria; wherein the nematodes provide a model for the hereditary disease or metabolic disease; and (2) identifying the genetically modified bacterium that affects a disease-related phenotype in the nematode model. In some embodiments, methods provided herein further comprise (0) generating a nematode model for the hereditary disease or metabolic disease. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats the disease in a mammal.

[0073] As used herein and consistently with the understanding in the art, hereditary diseases are also known as genetic disorders, which refer to diseases caused by gene mutations that can be passed down from one generation to the next. Although some hereditary diseases can also arise spontaneously due to new mutations. Hereditary diseases can be caused by various types of genetic mutations, including single-gene mutations, chromosomal abnormalities, and mitochondrial DNA mutations.

[0074] As used herein and consistently with the understanding in the art, metabolic diseases, also known as metabolic disorders or metabolic conditions, refer to a group of medical disorders characterized by abnormalities in the body’s metabolism, namely, the synthesis (or anabolism) , conversion, and breakdown (or catabolism) of important biomolecules, such as carbohydrate, lipid, or protein. Metabolic diseases can arise from genetic mutations, environmental factors, lifestyle choices, or a combination of these factors.

[0075] In some embodiments, methods provided herein comprise identifying the genetically modified bacterium that affects a disease-related phenotype in the nematode model; and verifying that the genetically modified bacterium treats the disease in a mammal. In some embodiments, methods provided herein further comprise generating a nematode model for the hereditary disease or metabolic disease.

[0076] In some embodiments, nematodes used in methods provided herein are Caenorhabditis elegans. 6.2.1 Generating nematode model

[0077] In some embodiments, methods provided herein can comprise generating a nematode model for metabolic diseases and hereditary diseases. The nematode can be C. elegans. In some embodiments, this step comprises identifying a measurable disease-related phenotype in the nematode. The measurable disease-related phenotype can be a physiological trait, for example, the length of the larvae, the fat storage, and the pharyngeal pumping rate, etc. The measurable disease-related phenotype can also be a biochemical marker, for example, the expression level of a particular gene, the level of certain metabolite (glucose, lipid) , etc.

[0078] In some embodiments, the disease-related phenotype is a physiological trait, including for example, reproduction, movement and locomotion (such as speed, thrashing frequency, coordination, pharyngeal pumping) , growth and development (such as body length, limb length, etc. ) , feeding behavior, response to sensory stimuli (such as chemotaxis, thermotaxis, olfactory response, mechanosensation) , learning and memory (such as response to conditioned stimuli, response to repeated exposure to a non-threatening stimulus, response to stimulus following prior exposure to an aversive stimulus) , social behavior (such as aggregation, dispersal) , etc.

[0079] In some embodiments, the disease-related phenotype is a biochemical marker, including, for example, lipid content, protein expression levels, gene expression profiling, enzyme activities, metabolite levels, oxidative stress markers, neurotransmitter levels, glycan profiles, etc.

[0080] In some embodiments, methods provided herein use a wildtype nematode and comprise identifying a genetically modified bacterium that affects a disease-related phenotype in the nematode. The disease-related phenotype can be any disease-related phenotype disclosed herein or otherwise known in the art.

[0081] In some embodiments, the step of generating a nematode model for metabolic diseases and hereditary diseases comprise identifying the disease-causing gene in the mammal, identifying a nematode homolog of the disease-causing gene, and generating a nematode with a mutation in the homologous gene and measurable disease-related phenotype.

[0082] In some embodiments, methods provided herein comprise generating a genetically modified nematode. In some embodiments, methods provided herein comprise generating a transgenic nematode. The transgenic nematode can comprise a nucleic acid that encodes an endogenous gene, an exogenous gene, or a heterologous gene.

[0083] In some embodiments, the genetically modified nematode can comprise a mutation in an endogenous gene. In some embodiments, the mutation reduces the expression level of the endogenous gene. In some embodiments, the mutation reduces the activity of the endogenous gene. In some embodiments, the genetically modified nematode can comprise a deletion in an endogenous gene. The endogenous gene can be involved in the signaling pathway relating to the hereditary disease or metabolic disease. The endogenous gene can be associated with the hereditary disease or metabolic disease. The endogenous gene can be a homolog of a disease-causing gene in a mammal.

[0084] Methods of generating transgenic C. elegans are well known in the art. For example, the process can include the following steps: a. Construct generation: A plasmid vector containing the transgene of interest, along with suitable regulatory sequences for expression in C. elegans is designed and constructed. This typically includes a promoter for driving expression in the desired tissues, a coding sequence for the gene of interest, and optionally, fluorescent protein markers for visualization. b. Microinjection: The plasmid DNA is microinjected into the gonads of young adult hermaphrodite worms using a fine needle and a microinjection setup. The DNA is typically mixed with a co-injection marker (e.g., rol-6 (su1006) ) to facilitate selection of transgenic animals. c. Selection and establishment of Transgenic Lines: Transgenic animals are selected based on the expression of the co-injection marker or the fluorescent protein marker. Stable transgenic lines are established by isolating and culturing individual transgenic animals, ensuring that the transgene is stably integrated into the worm genome and transmitted to progeny. d. Verification of transgene expression: Transgene expression can be verified by observing the expression of fluorescent markers or by performing molecular assays such as PCR or RT-PCR to detect the presence of transgene transcripts.

[0085] Methods of generating C. elegans with mutations or deletions of endogenous genes are also well known in the art. For example, the process can include the following steps: a. CRISPR / Cas9 Design: single-guide RNAs (sgRNAs) targeting the genomic region of interest can be designed using bioinformatics tools. The sgRNAs should guide the Cas9 nuclease to induce site-specific double-strand breaks (DSBs) near the gene of interest. b. CRISPR / Cas9 injection: The sgRNAs and Cas9 protein can be microinjected into the gonads of young adult hermaphrodite worms. The Cas9 protein cleaves the genomic DNA at the target site, inducing DSBs. c. Homology-directed repair (HDR) or non-homologous endjoining (NHEJ) : Optionally, provide a repair template containing the desired mutation or deletion sequence to guide HDR-mediated repair. Alternatively, rely on the error-prone NHEJ pathway to introduce random mutations or deletions at the target site. d. Screening and selection: Screen for worms with the desired mutation or deletion using methods such as PCR-based genotyping, restriction fragment length polymorphism (RFLP) analysis, or DNA sequencing. Select and propagate worms carrying the desired genetic alteration. e. Establishment of mutant lines: Establish homozygous mutant lines by crossing heterozygous animals and selecting progeny with the desired genotype. Characterize the phenotype of the mutant worms to assess the functional consequences of the genetic alteration. 6.2.2 Screening for mutant bacteria

[0086] Methods provided herein include screening for a genetically modified bacterium for treating a hereditary disease or metabolic disease in a mammal, comprising (1) feeding a plurality of nematodes on a library of genetically modified bacteria; wherein the nematodes provide a model for the hereditary disease or metabolic disease; and (2) identifying the genetically modified bacterium that affects a disease-related phenotype in the nematode model.

[0087] In some embodiments, the library of genetically modified bacteria used in methods disclosed herein is a single gene mutation library. In some embodiments, the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library. In some embodiments, the library is a single gene deletion library. In some embodiments, the library is a single gene repression library. In some embodiments, the library is a single gene overexpression library.

[0088] The bacteria that can be used in the methods disclosed herein are preferably well-characterized, genetically tractable, and amenable to manipulation. Several bacterial species meet these criteria and are frequently employed in microbiome research. Some of these bacteria also have available single-gene mutation libraries. For example, in some embodiments, the bacteria used in methods disclosed herein are Escherichia coli (E. coli) . In some embodiments, the bacteria are Bacillus subtilis (B. subtilis) . In some embodiments, the bacteria are Lactobacillus spp. In some embodiments, the bacteria are Bacteroides thetaiotaomicron (B. theta) . In some embodiments, the bacteria are Bifidobacterium spp.

[0089] The above-mentioned bacteria are all well characterized and particularly suitable for the methods disclosed herein. For example, the EcoGene database provides comprehensive information on the E. coli K-12 genome, including gene annotations, mutant phenotypes, and genetic tools. Similarly, SubtiWiki is a comprehensive database for B. subtilis genetics and genomics, which provides information on gene annotations, mutant phenotypes, and genetic tools for studying gene function and regulation in B. subtilis.

[0090] Some of these bacteria also have available single-gene mutation libraries. To name a few, the Keio collection consists of single-gene knockout mutants, where each non-essential gene in the E. coli K-12 genome has been individually deleted. Additionally, the ASKA library (A Complete Set of E. coli K-12 ORF Archive) is a collection of E. coli K-12 strains, each containing a plasmid with an individual open reading frame (ORF) cloned under the control of an inducible promoter. This library allows for conditional overexpression of individual genes and complements the Keio Collection. The DAmP (Decreased Abundance by mRNA Perturbation) Library consists of E. coli strains in which the expression of specific genes is reduced due to the insertion of a kanamycin resistance cassette into the 3' untranslated region (UTR) of the target gene. These strains exhibit decreased gene expression, allowing for the study of gene dosage effects and partial loss-of-function phenotypes. The EcoFlex library is a collection of E. coli K-12 strains, each containing a plasmid with an individual gene cloned under the control of an inducible promoter. This library allows for tunable gene expression and can be used to study the effects of gene overexpression on cellular phenotypes. Furthermore, the E. coli Genetic Resource ATCC 47076 from the American Type Culture Collection (ATCC) includes a collection of E. coli K-12 mutants with defined genetic lesions, including insertions, deletions, and point mutations. The E. coli Genome Project (EGP) Library is a collection of E. coli strains with deletions in nonessential genes, similar to the Keio Collection. However, the EGP library includes mutants generated by transposon mutagenesis.

[0091] Single-gene mutation or deletion libraries are also available for B. subtilis. For example, Bacillus Genetic Stock Center (BGSC) maintains a collection of Bacillus strains, including B. subtilis mutants with specific gene deletions or mutations. NCIMB 3610 Transposon Mutant Library consists of mutants with disruptions in nonessential genes, generated using transposon in the NCIMB 3610 strain of B. subtilis. The Marburg B. subtilis Strain Collection maintained by the Department of General Microbiology at the University of Marburg includes a variety of strains and mutants of B. subtilis, including deletion mutants and strains with specific genetic modifications. The J.D. Gross Lab in the University of California, San Francisco constructed a B. subtilis essential gene CRISPRi library and a non-essential gene deletion library, maintained by Addgene.

[0092] Aside from the publicly available libraries, single gene mutation libraries, including single gene overexpression libraries, single gene suppression libraries and single gene deletion libraries, can also be prepared using methods known in the art. For example, here are some approaches that can be used for generating a single gene suppression library of, for example, E. coli or B. subtilis. 1. CRISPRi (CRISPR interference) : CRISPRi allows for targeted and reversible gene repression using the CRISPR / Cas9 system. By expressing a catalytically inactive Cas9 (dCas9) protein and a guide RNA (gRNA) targeting the promoter region of a gene of interest, transcription initiation can be inhibited, leading to gene suppression. 2. Antisense RNA: Antisense RNA molecules can be used to inhibit gene expression by binding to complementary mRNA transcripts and preventing translation or promoting mRNA degradation. Antisense RNA constructs can be designed to target specific genes of interest and expressed in the bacteria to achieve gene suppression. 3. Promoter mutations: Mutations in promoter regions can alter gene expression levels by affecting transcription initiation or promoter activity. 6.2.3 Verifying in mammals

[0093] In some embodiments, methods provided herein further comprise verifying that the genetically modified bacterium treats the disease in a mammal. In some embodiments, this step comprises administering the genetically modified bacterium to a mammal having the disease and monitoring the disease in the mammal. In some embodiments, this step comprises confirming the therapeutic activity of the genetically modified bacterium in a mammal model of the disease.

[0094] The mammal used for the verification can be any mammal that can serve as a model for this disease. For example, the mammal can be a mouse (Mus musculus) model, a rat (Rattus norvegicus) model, a pig (Sus scrofa domesticus) model, or a non-human primate, such as monkeys including macaques and baboons. In some embodiments, methods provided herein comprise verifying that the genetically modified bacterium treats the disease in a mouse. In some embodiments, methods provided herein comprise confirming the therapeutic activity of the genetically modified bacterium in a mouse model of the disease.

[0095] Methods to generate mammal models for human metabolic diseases and hereditary diseases are well known in the art. A number of them have been generated and are available in the art, which are described in further detail below. For illustrative purposes, the following general procedure can be followed to generate a mouse model for a metabolic disease or hereditary disease: 1. Gene Identification: Identify the specific gene (s) associated with the disease phenotype. 2. Gene targeting strategy: Determine the appropriate gene targeting strategy based on the nature of the genetic alteration required to model the disease phenotype. This could involve gene knockout, knock-in, conditional knockout, or transgenic approaches. 3. Gene Editing Techniques: Choose the appropriate gene editing techniques for introducing the desired genetic alterations into mouse embryonic stem cells (ESCs) or zygotes. Common gene editing techniques include CRISPR / Cas9-mediated genome editing, homologous recombination, and lentiviral transduction. 4. Design guide RNAs (gRNAs) or targeting constructs to specifically edit or modify the genomic sequence of the target gene (s) in mouse ESCs or zygotes. 5. Generation of Genetically Modified Mice: Perform microinjection of targeting constructs, CRISPR / Cas9 components, or lentiviral vectors into mouse zygotes at the pronuclear stage. This involves injecting the genetic material directly into the male pronucleus of fertilized mouse embryos. Alternatively, perform gene targeting in mouse ESCs using homologous recombination, followed by selection of correctly targeted clones and injection of targeted ESCs into mouse blastocysts to generate chimeric mice. Transfer injected zygotes or targeted ESCs into the oviducts of pseudopregnant female mice to allow for implantation and gestation. Monitor pregnancy and birth of genetically modified mouse pups. 6. Genotyping and phenotypic analysis: Perform genotyping of founder mice or offspring to confirm the presence of the desired genetic alteration (s) in the mouse genome. This typically involves PCR-based genotyping using DNA extracted from tail biopsies. Perform phenotypic analysis of genetically modified mice to characterize the disease phenotype and assess the effects of the genetic alteration (s) on metabolic parameters, physiological functions, and disease progression. Conduct histological, biochemical, and functional assays to evaluate tissue pathology, metabolic dysregulation, and other disease-related phenotypes in the mouse model. 7. Breeding and Maintenance: Establish breeding colonies of genetically modified mice to propagate the mouse model and maintain the disease phenotype across generations. Perform appropriate breeding schemes to generate experimental cohorts with the desired genotypes for experimental studies and functional characterization. Maintain the mouse colonies under specific pathogen-free (SPF) conditions and provide appropriate housing, nutrition, and care in accordance with ethical guidelines and regulatory standards.

[0096] In some embodiments, methods provided herein to verify the efficacy of a microbiome-based therapy in a mouse model of a hereditary disease or metabolic disease include the following steps: First, the microbiome-based therapeutic is administered to the diseased mice. Various routes can be used, such as oral gavage (i.e., stomach gavage) , dietary supplementation, or fecal microbiota transplantation (FMT) . In some embodiments, oral gavage is used. In some embodiments, dietary supplementation is used. In some embodiments, FMT is used. Then, the treated mice are monitored for the effects of the microbiome-based therapeutic on disease progression, symptoms, and relevant physiological parameters over time. Impact of the therapeutic intervention on disease-related outcomes, such as inflammation, tissue damage, metabolic parameters, immune responses, or behavioral phenotypes, can be evaluated as appropriate.

[0097] As a person of ordinary skill in the art would appreciate, the methods disclosed herein can be used to screen for potential microbiome-based therapeutics for any metabolic disease or hereditary disease for which a measurable phenotype can be identified in the nematodes (e.g., C. elegans) . Exemplary metabolic diseases and hereditary diseases include, but are not limited to, Type I diabetes, a lipid metabolism disorder, idiopathic short stature (ISS) , a polyglutamine disease, or autism spectrum disorder (ASD) . 6.2.4 Exemplary methods (1) -Type I diabetes

[0098] In some embodiments, provided herein are methods of screening for a genetically modified bacterium for treating Type I diabetes in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria; and (2) identifying the genetically modified bacterium that affects a Type I diabetes-related phenotype in the nematode. In some embodiments, methods provided herein comprise (1) feeding a plurality of nematodes on a library of genetically modified bacteria; and (2) identifying the genetically modified bacterium that activates insulin expression in the nematode. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats Type I diabetes in a mammal.

[0099] Type I diabetes, also known as juvenile diabetes or insulin-dependent diabetes mellitus (IDDM) , is a chronic autoimmune condition characterized by the body’s inability to produce insulin and resulting in elevated blood sugar levels (hyperglycemia) . Without proper treatment, persistent hyperglycemia can lead to various complications, including damage to the eyes, kidneys, nerves, and blood vessels. In severe cases, untreated hyperglycemia can lead to diabetic ketoacidosis (DKA) , a life-threatening condition characterized by dangerously high levels of ketones in the blood.

[0100] Nematode model: For use in methods disclosed herein, a nematode model can be established which comprises an exogenous nucleic acid encoding a fluorescent protein driven by promoter for insulin. As such, the fluorescent level in the nematode indicates insulin expression, providing a measurable marker relating to Type I diabetes. In some embodiments, the nematode model can comprise an exogenous nucleic acid encoding a green fluorescent protein drive by ins-1 promoter (ins-1p: : GFP) . In some embodiments, the nematode model can comprise an exogenous nucleic acid having the nucleotide sequences of SEQ ID NO: 5.

[0101] Table 1: Nucleotide sequence of ins-1p: : GFP

[0102] Accordingly, in some embodiments, methods provided herein for screening for a genetically modified bacterium for treating Type I diabetes comprise (1) feeding a plurality of nematodes on a library of genetically modified bacteria, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein driven by promoter for ins-1 (ins-1p) and (2) identifying the genetically modified bacterium that enhances florescent signal in the nematode.

[0103] In some embodiments, the nematodes used in methods disclosed herein are C. elegans.

[0104] Bacteria library: In some embodiments, the library of genetically modified bacteria used in methods disclosed herein for screening for a therapeutic for Type I diabetes is a single gene mutation library. In some embodiments, the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library. In some embodiments, the library is a single gene deletion library. In some embodiments, the library is a single gene repression library. In some embodiments, the library is a single gene overexpression library. In some embodiments, the bacteria are E. coli. In some embodiments, the bacteria are B. subtilis. In some embodiments, the library is a single-gene knockdown library of B. subtilis. In some embodiments, the library is a single-gene deletion library of E. coli.

[0105] Mouse model:

[0106] In some embodiments, methods provided herein further comprise verifying that the genetically modified bacterium treats Type I diabetes in a mammal. In some embodiments, this step comprises administering the genetically modified bacterium to a mammal having Type I diabetes and monitoring the disease in the mammal. In some embodiments, this step comprises confirming the therapeutic activity of the genetically modified bacterium in a mammal model of Type I diabetes.

[0107] The mammal used for the verification can be any mammal that can serve as a model for Type I diabetes. In some embodiments, methods provided herein comprise verifying that the genetically modified bacterium treats Type I diabetes in a mouse. In some embodiments, methods provided herein comprise confirming the therapeutic activity of the genetically modified bacterium in a mouse model of Type I diabetes. Some mouse models for Type I diabetes are available in the art, including for example, non-obese diabetic (NOD) mice, non-obese diabetic / severe combined immunodeficiency (NOD-SCID) mice, and insulin-deficient (Akita) mice. NOD mice spontaneously develop autoimmune diabetes resembling human Type 1 diabetes, which exhibit autoimmune destruction of pancreatic beta cells, resulting in insulin deficiency and hyperglycemia. NOD-SCID mice are derived from NOD mice but have a severe combined immunodeficiency phenotype due to a mutation in the Prkdc gene. Akita mice carry a spontaneous point mutation in the Ins2 gene, resulting in misfolding of proinsulin and hyperglycemia due to severe insulin deficiency, resembling some aspects of Type 1 diabetes.

[0108] In some embodiments, methods provided herein to verify the efficacy of a microbiome-based therapy in a mouse model of Type I diabetes include the following steps: First, the microbiome-based therapeutic is administered to the diseased mice. Various routes can be used, such as oral gavage (i.e., stomach gavage) , dietary supplementation, or fecal microbiota transplantation (FMT) . In some embodiments, oral gavage is used. Then, the treated mice are monitored for the effects of the microbiome-based therapeutic on disease progression, symptoms, and relevant physiological parameters over time, including, for example, blood insulin levels, blood glucose levels, glycated hemoglobin (HbA1c) , diabetic ketoacidosis (DKA) . In some embodiments, insulin expression activity can be monitored. In some embodiments, blood glucose level can be monitored. 6.2.5 Exemplary methods (2) -Lipid metabolism disorder

[0109] In some embodiments, provided herein are methods of screening for a genetically modified bacterium for treating a lipid metabolism disorder in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria; and (2) identifying the genetically modified bacterium that affects a lipid metabolism-related phenotype in the nematode. In some embodiments, methods provided herein comprise (1) feeding a plurality of nematodes on a library of genetically modified bacteria; and (2) identifying the genetically modified bacterium that increases or decreases the lipid storage in the nematodes. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats lipid metabolism disorder in a mammal.

[0110] Lipid metabolism disorder, also known as a lipid disorder or dyslipidemia, refers to abnormal levels or metabolism of lipids (fats) in the body. Common types of lipids include cholesterol, triglycerides, phospholipids, and fatty acids. Lipid metabolism disorders can involve abnormalities in the levels of lipids circulating in the bloodstream or defects in the way the body processes and utilizes lipids. These disorders can lead to various health problems and increase the risk of cardiovascular disease, obesity, and other metabolic conditions. Exemplary lipid metabolism disorders include, for example, hyperlipidemia, familial hypercholesterolemia, hypertriglyceridemia, lipodystrophy, familial combined hyperlipidemia (FCHL) . Briefly, hyperlipidemia refers to elevated levels of lipids in the bloodstream, including cholesterol and triglycerides; FH is a genetic disorder characterized by high levels of low-density lipoprotein (LDL) cholesterol; hypertriglyceridemia is characterized by elevated levels of triglycerides in the bloodstream; lipodystrophy refers to abnormalities in adipose tissue distribution and metabolism, leading to reduced fat mass in certain areas of the body and excess fat accumulation in others; and FCHL is a genetic disorder characterized by elevated levels of both cholesterol and triglycerides.

[0111] Nematode model: For use in methods disclosed herein, a nematode model can be a wildtype nematode or a genetically modified nematode. Like mammals, C. elegans stores lipids in lipid droplets, which serve as a reservoir for energy storage and play a crucial role in lipid metabolism. The fat deposits in C. elegans can be directly visualized using Stimulated Raman scattering (SRS) microscopy, which provides a measurable phenotype relating to lipid metabolism and associated disorders. Furthermore, genetically modified nematodes can be generated with mutation or overexpression in genes involved in fat metabolism, lipid droplet formation, lipolysis, or fatty acid synthesis. For instance, mutations in genes encoding acyl-CoA synthetases, lipases, or transcription factors regulating lipid metabolism can lead to alterations in fat storage, lipid droplet morphology, or fatty acid composition in C. elegans; mutations associated with FH (e.g., the LDL receptor gene or the ApoE gene) can be introduced to generate C. elegans model for FH. Additionally, transgenic C. elegans strains expressing fluorescent protein reporters fused to lipid-binding domains or lipid droplet-associated proteins can also be used to visualize lipid droplets, lipid metabolism, or lipid trafficking in live animals.

[0112] In some embodiments, the nematodes used in methods disclosed herein are C. elegans.

[0113] Bacteria library: In some embodiments, the library of genetically modified bacteria used in methods disclosed herein for screening for a therapeutic for a lipid metabolism disorder is a single gene mutation library. In some embodiments, the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library. In some embodiments, the library is a single gene deletion library. In some embodiments, the library is a single gene repression library. In some embodiments, the library is a single gene overexpression library. In some embodiments, the bacteria are E. coli. In some embodiments, the bacteria are B. subtilis. In some embodiments, the library is a single-gene knockdown library of B. subtilis. In some embodiments, the library is a single-gene deletion library of E. coli.

[0114] Mouse model:

[0115] In some embodiments, methods provided herein further comprise verifying that the genetically modified bacterium treats lipid metabolism disorder in a mammal. In some embodiments, this step comprises administering the genetically modified bacterium to a mammal having lipid metabolism disorder and monitoring the disease in the mammal. In some embodiments, this step comprises confirming the therapeutic activity of the genetically modified bacterium in a mammal model of lipid metabolism disorder.

[0116] The mammal used for the verification can be any mammal that can serve as a model for lipid metabolism disorder. In some embodiments, methods provided herein comprise verifying that the genetically modified bacterium treats lipid metabolism disorder in a mouse. In some embodiments, methods provided herein comprise confirming the therapeutic activity of the genetically modified bacterium in a mouse model of lipid metabolism disorder. The fat deposits in mouse can be observed and quantified using Micro-computed tomography (microCT) . As such, in some embodiments, methods provided herein comprise treating mice with the genetically modified bacterium and observing changes in its fat storage.

[0117] Some mouse models are available in the art for lipid metabolism disorder, including for example, dyslipidemia and atherosclerosis. For example, ob / ob mice is a model for studying obesity-related metabolic disorders, including dyslipidemia and non-alcoholic fatty liver disease (NAFLD) ; db / db mice carry a mutation in the leptin receptor gene, leading to leptin resistance, and hyperphagia, insulin resistance, and dyslipidemia; ApoE knockout (ApoE- / -) mice lack functional ApoE protein and has impaired clearance of cholesterol, which results in the development of severe hypercholesterolemia and atherosclerosis when fed a high-fat diet; LDLR knockout (LDLR- / -) mice: LDLR- / -mice lack functional low-density lipoprotein receptors (LDLR) , resulting in elevated plasma LDL cholesterol levels and the development of spontaneous atherosclerosis on a normal chow diet.

[0118] In some embodiments, methods provided herein to verify the efficacy of a microbiome-based therapy in a mouse model of a lipid metabolism disorder include the following steps: First, the microbiome-based therapeutic is administered to the diseased mice. Various routes can be used, such as oral gavage (i.e., stomach gavage) , dietary supplementation, or fecal microbiota transplantation (FMT) . In some embodiments, oral gavage is used. Then, the treated mice are monitored for the effects of the microbiome-based therapeutic on disease progression, symptoms, and relevant physiological parameters over time, including, for example, lipid profiles, fat storage, and body weight. In some embodiments, the lipid profile can be monitored. In some embodiments, fat storage can be monitored. 6.2.6 Exemplary methods (3) -Idiopathic short stature

[0119] In some embodiments, provided herein are methods of screening for a genetically modified bacterium for treating idiopathic short stature (ISS) in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria, wherein the nematodes provide a model for ISS; and (2) identifying the genetically modified bacterium that affects an ISS-related phenotype in the nematode model. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats ISS in a mammal.

[0120] Idiopathic short stature (ISS) is a condition in which children have a height below the third percentile for their age, sex, and ethnic group without an identifiable cause. Children with ISS typically have normal growth hormone (GH) secretion and normal growth velocity during childhood, but they do not achieve a normal adult height. Bone morphogenetic proteins (BMPs) are signaling molecules that play crucial roles in skeletal development, bone formation, and growth plate regulation. Mutations or dysregulation in BMP receptor genes can lead to skeletal dysplasias, growth disorders, and short stature. Studies have implicated the mutations or variations in genes encoding BMP receptor type 1A (BMPR1A) and BMP receptor type 1B (BMPR1B) in the pathogenesis of ISS.

[0121] Nematode model:

[0122] Sma-6 is a nematode homolog of the BMP receptor. In C. elegans, Sma-6 functions as a receptor for BMP-like ligands. Mutations or alterations in sma-6 can lead to phenotypic changes in C. elegans, such as small body size, which is reminiscent of those observed in BMP receptor mutants in mammals. As such, in some embodiments, for use in methods disclosed herein, a nematode model for ISS can be established which comprises a mutation or deletion of sma-6. As such, the body size of the animal (i.e., length of the larvae) provides a measurable marker for the screening. In some embodiments, the nematode model comprises a mutation in sma-6 (wk7) .

[0123] Accordingly, in some embodiments, methods provided herein for screening for a genetically modified bacterium for treating ISS comprise (1) feeding a plurality of nematodes on a library of genetically modified bacteria, wherein the nematodes comprise a mutation in sma-6, and (2) identifying the genetically modified bacterium that restores the shortened body length in the nematode.

[0124] In some embodiments, the nematodes used in methods disclosed herein are C. elegans.

[0125] Bacteria library:

[0126] In some embodiments, the library of genetically modified bacteria used in methods disclosed herein for screening for a therapeutic for ISS is a single gene mutation library. In some embodiments, the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library. In some embodiments, the library is a single gene deletion library. In some embodiments, the library is a single gene repression library. In some embodiments, the library is a single gene overexpression library. In some embodiments, the bacteria are E. coli. In some embodiments, the bacteria are B. subtilis. In some embodiments, the library is a single-gene knockdown library of B. subtilis. In some embodiments, the library is a single-gene deletion library of E. coli.

[0127] Mouse model:

[0128] In some embodiments, methods provided herein further comprise verifying that the genetically modified bacterium treats ISS in a mammal. In some embodiments, this step comprises administering the genetically modified bacterium to a mammal having ISS and monitoring the disease in the mammal. In some embodiments, this step comprises confirming the therapeutic activity of the genetically modified bacterium in a mammal model of ISS.

[0129] The mammal used for the verification can be any mammal that can serve as a model for ISS. In some embodiments, methods provided herein comprise verifying that the genetically modified bacterium treats ISS in a mouse. In some embodiments, methods provided herein comprise confirming the therapeutic activity of the genetically modified bacterium in a mouse model of ISS. In some embodiments, methods provided herein comprise generating a mouse model of ISS by, for example, knocking down a homolog of the BMP receptor gene.

[0130] In some embodiments, methods provided herein to verify the efficacy of a microbiome-based therapy in a mouse model of ISS include the following steps: First, the microbiome-based therapeutic is administered to the diseased mice. Various routes can be used, such as oral gavage (i.e., stomach gavage) , dietary supplementation, or fecal microbiota transplantation (FMT) . In some embodiments, oral gavage is used. Then, the treated mice are monitored for the effects of the microbiome-based therapeutic on disease progression, symptoms, and relevant physiological parameters over time, including, for example, limb length, longitudinal body length, bone morphology, etc. In some embodiments, limb length can be monitored. In some embodiments, limb morphology can be monitored. In some embodiments, longitudinal body length can be monitored. 6.2.7 Exemplary methods (4) -Polyglutamine disease

[0131] In some embodiments, provided herein are methods of screening for a genetically modified bacterium for treating a polyglutamine disease in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria, wherein the nematodes provide a model for a polyglutamine disease; and (2) identifying the genetically modified bacterium that affects a polyglutamine disease-related phenotype. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats a polyglutamine disease in a mammal.

[0132] Polyglutamine diseases, also known as polyQ diseases, are a group of inherited neurodegenerative disorders characterized by the abnormal expansion of CAG trinucleotide repeats within specific genes. These repeats result in the production of abnormally long stretches of the amino acid glutamine, known as polyglutamine (polyQ) tracts, within the encoded proteins. The expanded polyQ tracts lead to protein misfolding, aggregation, and toxicity, ultimately causing progressive degeneration of neurons in the brain. Polyglutamine diseases include, for example, Huntington's disease (HD) , spinocerebellar ataxias (SCAs) , spinobulbar muscular atrophy (SBMA) , and (dentatorubral-pallidoluysian atrophy (DRPLA) . HD, for example, is caused by an expansion of CAG repeats in the huntingtin (HTT) gene, which leads to the formation of toxic aggregates, neuronal dysfunction, and progressive degeneration of the basal ganglia and cortex.

[0133] The pathogenesis of polyglutamine diseases involves multiple cellular mechanisms, including protein misfolding, aggregation, impaired protein clearance, mitochondrial dysfunction, excitotoxicity, and transcriptional dysregulation. Therapeutic strategies for polyglutamine diseases aim to target these underlying disease mechanisms, with approaches such as promoting protein clearance, reducing protein aggregation, and modulating cellular stress responses. However, effective treatments for polyglutamine diseases remain elusive, and research efforts are ongoing to develop novel therapeutic approaches to halt or slow the progression of these devastating neurodegenerative disorders.

[0134] Nematode model:

[0135] For use in methods disclosed herein, a nematode model can be established which comprises an exogenous nucleic acid encoding a fluorescent protein with a polyQ track. As such, the aggregation of fluorescent signals in the nematode indicates polyQ aggregation, providing a measurable marker relating to polyglutamine diseases. In some embodiments, the nematode model can comprise exogenous nucleic acid encoding a yellow fluorescent protein with a polyQ track (e.g., unc-54p: : Q40: : YFP) . In some embodiments, the nematode model can comprise exogenous nucleic acid having the nucleotide sequences of SEQ ID NO: 6.

[0136] Table 2: Nucleotide sequence of unc-54p: : Q40: : YFP

[0137] Accordingly, in some embodiments, methods provided herein for screening for a genetically modified bacterium for treating a polyglutamine disease comprise (1) feeding a plurality of nematodes with a library of genetically modified bacteria, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein tagged with multiple glutamine residues and (2) identifying the genetically modified bacterium that reduces aggregated fluorescent signals in the nematode.

[0138] In some embodiments, the nematodes used in methods disclosed herein are C. elegans.

[0139] Bacteria library:

[0140] In some embodiments, the library of genetically modified bacteria used in methods disclosed herein for screening for a therapeutic for a polyglutamine disease is a single gene mutation library. In some embodiments, the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library. In some embodiments, the library is a single gene deletion library. In some embodiments, the library is a single gene repression library. In some embodiments, the library is a single gene overexpression library. In some embodiments, the bacteria are E. coli. In some embodiments, the bacteria are B. subtilis. In some embodiments, the library is a single-gene knockdown library of B. subtilis. In some embodiments, the library is a single-gene deletion library of E. coli.

[0141] Mouse model:

[0142] In some embodiments, methods provided herein further comprise verifying that the genetically modified bacterium treats polyglutamine diseases in a mammal. In some embodiments, this step comprises administering the genetically modified bacterium to a mammal having a polyglutamine disease and monitoring the disease in the mammal. In some embodiments, this step comprises confirming the therapeutic activity of the genetically modified bacterium in a mammal model of a polyglutamine disease.

[0143] The mammal used for the verification can be any mammal that can serve as a model for polyglutamine disease. In some embodiments, methods provided herein comprise verifying that the genetically modified bacterium treats the polyglutamine disease in a mouse. In some embodiments, methods provided herein comprise confirming the therapeutic activity of the genetically modified bacterium in a mouse model of a polyglutamine disease. Some mouse models for polyglutamine diseases (e.g., HD) are available in the art, including for example, R6 / 2 Mouse Model, N171-82Q Mouse Model, BACHD (Bacterial Artificial Chromosome HD) Mouse Model and the R6 / 1 Mouse Model. The R6 / 2 mouse model carries a transgene with a fragment of the human huntingtin (HTT) gene containing an expanded CAG repeat, which has been widely used to study the pathogenesis of HD and to test potential therapeutic interventions. The N171-82Q mouse model expresses a truncated form of mutant huntingtin with an expanded polyglutamine tract under the control of the neuron-specific enolase promoter. The BACHD mouse model carries a full-length human HTT gene with an expanded CAG repeat inserted into the mouse genome. Similar to the R6 / 2 model, the R6 / 1 mouse model carries a transgene expressing a fragment of the human HTT gene with an expanded CAG repeat, which exhibit a milder phenotype compared to R6 / 2 mice, with later onset of symptoms and slower disease progression.

[0144] In some embodiments, methods provided herein to verify the efficacy of a microbiome-based therapy in a mouse model of polyglutamine diseases include the following steps: First, the microbiome-based therapeutic is administered to the diseased mice. Various routes can be used, such as oral gavage (i.e., stomach gavage) , dietary supplementation, or fecal microbiota transplantation (FMT) . In some embodiments, oral gavage is used. Then, the treated mice are monitored for the effects of the microbiome-based therapeutic on disease progression, symptoms, and relevant physiological parameters over time, including, for example, motor function and neurological symptoms. In some embodiments, motor symptoms (e.g., chorea, dystonia, bradykinesia) can be monitored. In some embodiments, cognitive function can be monitored. Exemplary tests include Morris water maze, novel object recognition test, Y-maze test, radial arm maze, and T-maze test, etc. 6.2.8 Exemplary methods (5) -Autism spectrum disorder

[0145] In some embodiments, provided herein are methods of screening for a genetically modified bacterium for treating autism spectrum disorder (ASD) in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria, wherein the nematodes provide a model for ASD; and (2) identifying the genetically modified bacterium that affects an ASD-related phenotype. In some embodiments, methods provided herein further comprise (3) verifying that the genetically modified bacterium treats ASD in a mammal.

[0146] Autism Spectrum Disorder (ASD) is a complex neurodevelopmental disorder characterized by persistent deficits in social communication and interaction, as well as restricted, repetitive patterns of behavior, interests, or activities. As a spectrum disorder, ASD encompasses a wide range of symptoms and severity levels, with individuals exhibiting varying degrees of impairment across different domains of functioning. Chd8 (chromodomain helicase DNA-binding protein 8) encodes a chromatin remodeling factor that plays a role in regulating gene expression and chromatin structure during development. Mutations or alterations in Chd8 are observed in a subset of individuals with ASD.

[0147] Nematode model:

[0148] In C. elegans, the chd-7 gene is a homolog of human Chd8, which is involved in chromatin remodeling and gene regulation. chd-7 is expressed in neurons and is implicated in regulating neuronal development and function in C. elegans. Alterations in chd-7 expression or function may lead to behavioral abnormalities reminiscent of neurodevelopmental disorders. In some embodiments, methods provided herein can use mutant strains are chd-7 (gk290) and chd-7 (gk306) . Both chd-7 (gk290) and chd-7 (gk306) mutant strains have a deletion mutation in the chd-7 gene, which changes the involuntary pharyngeal pumping rate in opposite directions. Specifically, the chd-7 (gk290) deletion mutant has decreased involuntary pharyngeal pumping rate compared to wildtype, whereas the chd-7 (gk306) deletion mutant has increased pumping rate compared to wildtype. As such, in some embodiments, for use in methods disclosed herein, a nematode model for ASD can be established which comprises a mutation or deletion of chd-7. The involuntary pharyngeal pumping rate of the animal provides a measurable marker for the screening. In some embodiments, the nematode model comprises both chd-7 (gk290) and chd-7 (gk306) mutant strains.

[0149] Accordingly, provided herein are methods of screening for a genetically modified bacterium for treating ASD in a mammal, comprising: (1) feeding a plurality of nematodes with a library of genetically modified bacteria, wherein the nematodes comprise a deletion of an allele of chd-7; and (2) identifying the genetically modified bacterium that restores the pharyngeal pumping rate in the nematode. In some embodiments, the nematodes comprise a deletion of chd-7 (gk290) . In some embodiments, the nematodes comprise a deletion of chd-7 (gk306) . In some embodiments, the nematodes comprise a first group having a deletion of chd-7 (gk290) and a second group having a deletion of chd-7 (gk306) and methods provided herein comprise identifying the genetically modified bacterium that reduces or eliminates the difference in pharyngeal pumping rates between the two mutant strains.

[0150] In some embodiments, the nematodes used in methods disclosed herein are C. elegans.

[0151] Bacteria library:

[0152] In some embodiments, the library of genetically modified bacteria used in methods disclosed herein for screening for a therapeutic for ASD is a single gene mutation library. In some embodiments, the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library. In some embodiments, the library is a single gene deletion library. In some embodiments, the library is a single gene repression library. In some embodiments, the library is a single gene overexpression library. In some embodiments, the bacteria are E. coli. In some embodiments, the bacteria are B. subtilis. In some embodiments, the library is a single-gene knockdown library of B. subtilis. In some embodiments, the library is a single-gene deletion library of E. coli.

[0153] Mouse model:

[0154] In some embodiments, methods provided herein further comprise verifying that the genetically modified bacterium treats ASD in a mammal. In some embodiments, this step comprises administering the genetically modified bacterium to a mammal having ASD and monitoring the disease in the mammal. In some embodiments, this step comprises confirming the therapeutic activity of the genetically modified bacterium in a mammal model of ASD.

[0155] The mammal used for the verification can be any mammal that can serve as a model for ASD. In some embodiments, methods provided herein comprise verifying that the genetically modified bacterium treats ASD in a mouse. In some embodiments, methods provided herein comprise confirming the therapeutic activity of the genetically modified bacterium in a mouse model of ASD. Some mouse models for ASD are available in the art, including for example, FMR1 Knockout (FMR1-KO) Mice, Shank3 Knockout (Shank3-KO) Mice, and Cntnap2 Knockout (Cntnap2-KO) Mice, etc. In some embodiments, Chd8 mutant mice which carry a 1163 bp deletion in its Chd8 gene and impaired social willingness and ability can be used as a model for ASD.

[0156] In some embodiments, methods provided herein to verify the efficacy of a microbiome-based therapy in a mouse model of ASD include the following steps: First, the microbiome-based therapeutic is administered to the diseased mice. In some embodiments, the Chd8 mutant mice can be used. Various routes can be used, such as oral gavage (i.e., stomach gavage) , dietary supplementation, or fecal microbiota transplantation (FMT) . In some embodiments, oral gavage is used. Then, the treated mice are monitored for the effects of the microbiome-based therapeutic on disease progression, symptoms, and relevant physiological parameters over time, including, for example, social behavior and repetitive behavior. In some embodiments, social preference index can be monitored. 6.3 Systems

[0157] In accordance with the methods disclosed herein, also provided herein are systems for screening a genetically modified bacterium for treating a hereditary disease or metabolic disease in a mammal, comprising: a plurality of nematodes that provide a model for the genetic disease or metabolic disease and a library of genetically modified bacteria. In some embodiments, the systems further comprise a mammal that provides a model for the genetic disease or metabolic disease.

[0158] In some embodiments of the systems provided herein, the nematode can be C. elegans. In some embodiments, the C. elegans has a measurable disease-related phenotype. The measurable disease-related phenotype can be a physiological trait, for example, the length of the larvae, the fat storage, and the pharyngeal pumping rate, etc. The measurable disease-related phenotype can also be a biochemical marker, for example, the expression level of a particular gene, the level of certain metabolite (glucose, lipid) , etc. Exemplary physiological traits and biochemical markers are disclosed herein, and many others are known in the art.

[0159] In some embodiments, systems provided herein comprise wildtype nematodes. In some embodiments, systems provided herein comprise genetically modified nematodes. In some embodiments, the nematodes carry a gene mutation that resembles the disease-causing gene mutation in mammals.

[0160] In some embodiments, the genetically modified nematodes are transgenic nematodes. The transgenic nematode can comprise a nucleic acid that encodes an endogenous gene, an exogenous gene, or a heterologous gene. In some embodiments, the genetically modified nematode comprises a nucleic acid encoding a reporter protein, such as a fluorescent protein. In some embodiments, the expression for the fluorescent protein can be driven by a promoter for a gene associated with a hereditary disease or metabolic condition. For example, in some embodiments, the genetically modified nematodes comprise an exogenous nucleic acid encoding a fluorescent protein driven by insulin promoter. The florescent protein can also be conjugated to a disease-causing protein. For example, in some embodiments, the genetically modified nematodes comprise a nucleic acid encoding a fluorescent protein with a polyQ track, such that the aggregation of polyQ is labeled with fluorescence.

[0161] In some embodiments, the genetically modified nematode can comprise a mutation in an endogenous gene. In some embodiments, the mutation reduces the expression level of the endogenous gene. In some embodiments, the mutation reduces the activity of the endogenous gene. In some embodiments, the genetically modified nematode can comprise a deletion in an endogenous gene. The endogenous gene can be involved in the signaling pathway relating to the hereditary disease or metabolic disease. The endogenous gene can be associated with the hereditary disease or metabolic disease. The endogenous gene can be a homolog of a disease-causing gene in a mammal. For illustrative purposes, in some embodiments, the genetically modified nematode has a shortened body length. In some embodiments, the genetically modified nematode comprises a mutation in sma-6. In some embodiments, the genetically modified nematode comprises a mutation in sma-6 (wk7) . In some embodiments, the genetically modified nematode has abnormal fat storage. In some embodiments, the genetically modified nematode has abnormal intestinal fat storage. In some embodiments, the genetically modified nematode has an abnormal pharyngeal pumping rate. In some embodiments, the genetically modified nematode has an increased pharyngeal pumping rate. In some embodiments, the genetically modified nematode has a decreased pharyngeal pumping rate. In some embodiments, the genetically modified nematode comprises a deletion of an allele of chd7. In some embodiments, the genetically modified nematode comprises a deletion of chd7 (gk290) . In some embodiments, the genetically modified nematode comprises a deletion of chd7 (gk306) .

[0162] Systems provided herein comprise a library of genetically modified bacteria. In some embodiments, the library of genetically modified bacteria can be a single gene mutation library. In some embodiments, the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library. In some embodiments, the library is a single gene deletion library. In some embodiments, the library is a single gene repression library. In some embodiments, the library is a single gene overexpression library.

[0163] The bacteria that can be used in the methods disclosed herein are preferably well-characterized, genetically tractable, and amenable to manipulation. Several bacterial species meet these criteria and are frequently employed in microbiome research. Some of these bacteria also have available single-gene mutation libraries. For example, in some embodiments, the bacteria used in methods disclosed herein are Escherichia coli (E. coli) . In some embodiments, the bacteria are Bacillus subtilis (B. subtilis) . Some available bacteria single-gene mutation libraries are disclosed herein. Many others are known in the art and can be used in the systems disclosed herein.

[0164] In some embodiments, systems provided herein further comprise a mammal having the hereditary disease or metabolic disease. In some embodiments, systems provided herein further comprise a mammal model for the hereditary disease or metabolic disease. The mammal used for the verification can be any mammal that can serve as a model for this disease. For example, the mammal can be a mouse (Mus musculus) model, a rat (Rattus norvegicus) model, a pig (Sus scrofa domesticus) model, or a non-human primate, such as monkeys including macaques and baboons. In some embodiments, systems provided herein comprise a mouse. In some embodiments, systems provided herein comprise a mouse model of the disease. A number of mammal models for human metabolic diseases and hereditary diseases are well known in the art, some disclosed herein.

[0165] For illustrative purposes, in some embodiments, provided herein are systems for screening for a genetically modified bacterium for treating Type I diabetes in a mammal, comprising: a plurality of nematodes that provide a model for Type I diabetes and a library of genetically modified bacteria. The nematode model can be a wildtype nematode or a genetically modified nematode. In some embodiments, the nematode model can be established which comprises an exogenous nucleic acid encoding a fluorescent protein driven by promoter for insulin. As such, the fluorescent level in the nematode indicates insulin expression, providing a measurable marker relating to Type I diabetes. In some embodiments, the nematode model can comprise an exogenous nucleic acid encoding a green fluorescent protein drive by ins-1 promoter (ins-1p: : GFP) . In some embodiments, the nematodes are C. elegans.

[0166] In some embodiments, the systems can further comprise a mammal having Type I diabetes or a mammal model for Type I diabetes. In some embodiments, the mammal is a mouse.

[0167] In some embodiments, provided herein are systems for screening for a genetically modified bacterium for treating a lipid metabolism disorder in a mammal, comprising: a plurality of nematodes that provide a model for the lipid metabolism disorder and a library of genetically modified bacteria. The nematode model can be a wildtype nematode or a genetically modified nematode. In some embodiments, the genetically modified nematodes can be generated with mutation or overexpression in genes involved in fat metabolism, lipid droplet formation, lipolysis, or fatty acid synthesis. In some embodiments, transgenic nematodes expressing fluorescent protein reporters fused to lipid-binding domains or lipid droplet-associated proteins can be used in the systems. In some embodiments, the nematodes are C. elegans.

[0168] In some embodiments, the systems can further comprise a mammal having lipid metabolism disorder or a mammal model for lipid metabolism disorder. In some embodiments, the mammal is a mouse. In some embodiments, wildtype mice are used herein. In some embodiments, mouse models available in the art for lipid metabolism disorder, including for example, dyslipidemia and atherosclerosis are used herein.

[0169] In some embodiments, provided herein are systems for screening for a genetically modified bacterium for treating idiopathic short stature (ISS) in a mammal, comprising: a plurality of nematodes that provide a model for ISS and a library of genetically modified bacteria. The nematode model can be a wildtype nematode or a genetically modified nematode. In some embodiments, the nematodes have a mutation or alteration in Sma-6. In some embodiments, the nematode model comprises a mutation in sma-6 (wk7) . In some embodiments, the nematodes are C. elegans.

[0170] In some embodiments, the systems can further comprise a mammal having ISS or a mammal model for ISS. In some embodiments, the mammal is a mouse. In some embodiments, the mouse has a mutation or deletion in a BMP receptor homolog gene.

[0171] In some embodiments, provided herein are systems for screening for a genetically modified bacterium for treating a polyglutamine disease in a mammal, comprising: a plurality of nematodes that provide a model for the polyglutamine disease and a library of genetically modified bacteria. The nematode model can be a wildtype nematode or a genetically modified nematode. In some embodiments, a nematode model can comprise an exogenous nucleic acid encoding a fluorescent protein with a polyQ track. As such, the aggregation of fluorescent signals in the nematode indicates polyQ aggregation, providing a measurable marker relating to polyglutamine diseases. In some embodiments, the nematode model can comprise exogenous nucleic acid encoding a yellow fluorescent protein with a polyQ track (e.g., unc-54p: : Q40: : YFP) . In some embodiments, the nematode model can comprise exogenous nucleic acid having the nucleotide sequences of SEQ ID NO: 6. In some embodiments, the nematodes are C. elegans.

[0172] In some embodiments, the systems can further comprise a mammal having lipid metabolism disorder or a mammal model for polyglutamine disease. In some embodiments, the mammal is a mouse. Any mouse models for polyglutamine diseases can be used in the systems disclosed herein, such as the available mouse models for huntingtin disease.

[0173] In some embodiments, provided herein are systems for screening for a genetically modified bacterium for treating autism spectrum disorder (ASD) in a mammal, comprising: a plurality of nematodes that provide a model for ASD and a library of genetically modified bacteria. The nematode model can be a wildtype nematode or a genetically modified nematode. In some embodiments, the genetically modified nematodes have alterations in chd-7 expression or function. In some embodiments, systems provided herein comprise mutant strain chd-7 (gk290) , chd-7 (gk306) , or both. In some embodiments, the nematodes are C. elegans.

[0174] In some embodiments, the systems can further comprise a mammal having ASD or a mammal model for ASD. In some embodiments, the mammal is a mouse. The mouse models for ASD available in the art can be used. In some embodiments, systems provided herein comprise Chd8 mutant mice which carry a 1163 bp deletion in its Chd8 gene and impaired social willingness and ability.

[0175] Guided by the teachings of instant disclosure, a person of ordinary skill in the art would understand that the methods and systems disclosed herein are not limited to specific diseases or model animals. Instead, methods and systems disclosed herein can be applied to identify and verify potential microbiome-based therapies for any metabolic diseases and hereditary diseases as long as a nematode model for such disease can be established with a measurable phenotype for screening. 6.4 Compositions

[0176] Provided herein are compositions (e.g., probiotic, therapeutics, pharmaceutical, etc. ) comprising one or more strains of genetically modified bacteria for treating a hereditary disease or metabolic disease in a mammal. As a person of ordinary skill in the art would understand, bacteria with therapeutic potential are not limited to the specific bacteria (e.g., E. coli or B. subtilis) identified by methods disclosed herein. Once a genetically modified bacterium is identified by the methods disclosed herein to have therapeutic potential, other bacterium having a mutation in a homologous gene can be identified, which is expected to have similar therapeutic potential. For example, B. subtilis having a modified acpP, asd, or metS with suppressed function is identified to increase insulin production by methods disclosed herein. Accordingly, bacteria other than B. subtilis that has a mutation in a gene homologous to acpP, asd, or metS which results in the suppression of the function of the homologous gene are also expected to increase insulin production. As such, in some embodiments, the compositions comprise the genetically modified bacteria identified by methods described herein. In some embodiments, the compositions comprise bacteria comprising a mutation in a gene homologous to the modified gene in the identified bacterium. The genetically modified bacteria can be either Gram-positive or Gram-negative.

[0177] As such, the modified bacterium to be used in methods disclosed herein can be any bacterium having a gene that is homologous to the modified gene in the identified bacterium. In some embodiments of the compositions disclosed herein, the genetically modified bacterium can be a Gram-positive bacterium. In some embodiments, the bacterium is Actinobacteria or Firmicutes.

[0178] In some embodiments, the bacterium is Actinobacteria. In some embodiments, the bacterium is Bifidobacterium, Corynebacterium, Propionibacterium or Acidipropionibacterium.

[0179] In some embodiments, the bacterium is Bifidobacterium. In some embodiments, the bacterium is B. longum, B. bifidum, B. breve, B. adolescentis or B. animalis. In some embodiments, the bacterium is B. longum. In some embodiments, the bacterium is B. bifidum. In some embodiments, the bacterium is B. breve. In some embodiments, the bacterium is B. adolescentis. In some embodiments, the bacterium is B. animalis. In some embodiments, the bacterium is Corynebacterium. In some embodiments, the bacterium is C. accolens. In some embodiments, the bacterium is Propionibacterium. In some embodiments, the bacterium is P. freudenreichii. In some embodiments, the bacterium is Acidipropionibacterium. In some embodiments, the bacterium is A. acidipropionici.

[0180] In some embodiments, the bacterium is Firmicutes. In some embodiments, the bacterium is Faecalibacterium, Clostridium, Ruminococcus, Ruthenibacterium, Lactobacillus, Lacticaseibacillus, Limosilactobacilli, Enterococcus, Staphylococcus, Eubacterium, Streptococcus, Bacillus, Pediococcus, Leuconostoc or Lactococcus. In some embodiments, the bacterium is Faecalibacterium. In some embodiments, the bacterium is F. prausnitzii. In some embodiments, the bacterium is Clostridium. In some embodiments, the bacterium is C. butyricum or C. beijerinckii. In some embodiments, the bacterium is C. butyricum. In some embodiments, the bacterium is C. beijerinckii. In some embodiments, the bacterium is Ruminococcu. In some embodiments, the bacterium is R. faecis or R. bromii. In some embodiments, the bacterium is R. faecis. In some embodiments, the bacterium is R. bromii. In some embodiments, the bacterium is Ruthenibacterium. In some embodiments, the bacterium is R. lactatiformans. In some embodiments, the bacterium is Lactobacillus. In some embodiments, the bacterium is L. reuteri, L. delbrueckii, L. acidophilus or L. helveticus. In some embodiments, the bacterium is L. reuteri. In some embodiments, the bacterium is L. delbrueckii. In some embodiments, the bacterium is L. acidophilus. In some embodiments, the bacterium is L. helveticus. In some embodiments, the bacterium is Lacticaseibacillus. In some embodiments, the bacterium is L. casei, L. paracasei or L. rhamnosus. In some embodiments, the bacterium is L. casei. In some embodiments, the bacterium is L. paracasei. In some embodiments, the bacterium is L. rhamnosus. In some embodiments, the bacterium is Limosilactobacilli. In some embodiments, the bacterium is L. reuteri or L. fermentum. In some embodiments, the bacterium is L. reuteri. In some embodiments, the bacterium is L. fermentum. In some embodiments, the bacterium is Enterococcus. In some embodiments, the bacterium is E. faecium or E. faecalis. In some embodiments, the bacterium is E. faecium. In some embodiments, the bacterium is E. faecalis. In some embodiments, the bacterium is Staphylococcus. In some embodiments, the bacterium is S. xylosus, S. carnosus or S. vitulinus. In some embodiments, the bacterium is S. xylosus. In some embodiments, the bacterium is S. carnosus. In some embodiments, the bacterium is S. vitulinus. In some embodiments, the bacterium is Eubacterium. In some embodiments, the bacterium is E. rectale. In some embodiments, the bacterium is Streptococcus. In some embodiments, the bacterium is S. parasanguinis or S. thermophilus. In some embodiments, the bacterium is S. parasanguinis. In some embodiments, the bacterium is S. thermophilus. In some embodiments, the bacterium is Bacillus. In some embodiments, the bacterium is B. cereus or B. coagulans. In some embodiments, the bacterium is B. cereus. In some embodiments, the bacterium is B. coagulans. In some embodiments, the bacterium is Pediococcus. In some embodiments, the bacterium is P. acidilactici or P. pentosaceus. In some embodiments, the bacterium is P. acidilactici. In some embodiments, the bacterium is P. pentosaceus. In some embodiments, the bacterium is Leuconostoc. In some embodiments, the bacterium is L. mesenteroides. In some embodiments, the bacterium is Lactococcus. In some embodiments, the bacterium is L. lactis or L. cremoris. In some embodiments, the bacterium is L. lactis. In some embodiments, the bacterium is L. cremoris.

[0181] In some embodiments, the genetically modified bacterium can be a Gram-negative bacterium. In some embodiments, the bacterium is Bacteroidetes, Fusobacteria or Verrucomicrobia.

[0182] In some embodiments, the bacterium is Bacteroidetes. In some embodiments, the bacterium is Bacteroides, Prevotella or Parabacteroides. In some embodiments, the bacterium is Bacteroides. In some embodiments, the bacterium is B. fragilis, B. vulgatus or B. uniformis. In some embodiments, the bacterium is B. fragilis. In some embodiments, the bacterium is B. vulgatus. In some embodiments, the bacterium is B. uniformis. In some embodiments, the bacterium is Prevotella. In some embodiments, the bacterium is P. copri. In some embodiments, the bacterium is Parabacteroides. In some embodiments, the bacterium is P. distasonis.

[0183] In some embodiments, the bacterium is Fusobacteria. In some embodiments, the bacterium is Fusobacterium. In some embodiments, the bacterium is F. nucleatum.

[0184] In some embodiments, the bacterium is Verrucomicrobia. In some embodiments, the bacterium is Akkermansia. In some embodiments, the bacterium is A. muciniphila.

[0185] In some embodiments, the bacterium to be used in the compositions disclosed herein can be a bacterium existing in the human microbiota, such as Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, Fusobacteria, Verrucomicrobia, etc. In some embodiments, the bacterium is Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, Fusobacteria or Verrucomicrobia.

[0186] In some embodiments, the compositions comprise one or more strains of genetically modified bacteria from E. coli disclosed herein and / or B. subtilis disclosed herein for treating a hereditary disease or metabolic disease in a mammal. In some embodiments, the compositions comprise one or more strains of genetically modified bacteria from E. coli identified by methods disclosed herein and / or B. subtilis identified by methods disclosed herein for treating a hereditary disease or metabolic disease in a mammal. In some embodiments, the compositions comprise one or more strains of genetically modified bacteria from E. coli disclosed herein. In some embodiments, the compositions comprise one strain of genetically modified bacteria from E. coli disclosed herein. In some embodiments, the compositions comprise one or more strains of genetically modified bacteria from B. subtilis disclosed herein. In some embodiments, the compositions comprise one strain of genetically modified bacteria from B. subtilis disclosed herein. Embodiments are not limited to a particular bacterial species.

[0187] In some embodiments, provided herein are compositions for treating Type I diabetes in a mammal. In some embodiments, the compositions comprise one or more strains of genetically modified bacteria having a mutation in acpP, asd, or metS. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in acpP. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in asd. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in metS. In some embodiments, the modified bacterium is B. subtilis. The compositions for treating Type I diabetes disclosed herein can comprise one or more strains of any other bacterium having a mutation in a gene homologous to acpP, asd, or metS. The bacterium can have a mutation in a gene homologous to acpP. The bacterium can have a mutation in a gene homologous to asd. The bacterium can have a mutation in a gene homologous to metS. The homologous gene of acpP, asd, or metS can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the homologous gene is an orthologous gene. In some embodiments, the homologous gene is a paralogous gene. In some embodiments, the homologous gene is a xenologous gene.

[0188] In some embodiments, provided herein are compositions for treating a lipid metabolism disorder, e.g., a lipid storage disorder or a lipid transport disorder. In some embodiments, provided herein are compositions for treating a lipid storage disorder. In some embodiments, provided herein are compositions for treating a lipid transport disorder. In some embodiments, the compositions comprise one or more strains of genetically modified bacteria having a mutation in dapH or racE. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in dapH. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in racE. In some embodiments, the modified bacterium is B. subtilis. Embodiments are not limited to a particular bacterial species. The compositions for treating a lipid metabolism disorder disclosed herein can comprise one or more strains of any other bacterium having a mutation in a gene homologous to dapH or racE. The bacterium can have a mutation in a gene homologous to dapH. The bacterium can have a mutation in a gene homologous to racE. The homologous gene of dapH or racE can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the homologous gene is an orthologous gene. In some embodiments, the homologous gene is a paralogous gene. In some embodiments, the homologous gene is a xenologous gene.

[0189] In some embodiments, provided herein are compositions for treating ISS in a mammal. In some embodiments, the compositions comprise one or more strains of genetically modified bacteria having a mutation in accA or coaBC. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in accA. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in coaBC. In some embodiments, the modified bacterium is B. subtilis. Embodiments are not limited to a particular bacterial species. The compositions for treating ISS disclosed herein can comprise one or more strains of any other bacterium having a mutation in a gene homologous to accA or coaBC. The bacterium can have a mutation in a gene homologous to accA. The bacterium can have a mutation in a gene homologous to coaBC. The homologous gene of accA or coaBC can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the homologous gene is an orthologous gene. In some embodiments, the homologous gene is a paralogous gene. In some embodiments, the homologous gene is a xenologous gene.

[0190] In some embodiments, provided herein are compositions for treating a polyglutamine disease. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in pheL. In some embodiments, the modified bacterium is E. coli. Embodiments are not limited to a particular bacterial species. The compositions for treating a polyglutamine disease disclosed herein can comprise one or more strains of any other bacterium having a mutation in a gene homologous to pheL. The homologous gene of pheL can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the homologous gene is an orthologous gene. In some embodiments, the homologous gene is a paralogous gene. In some embodiments, the homologous gene is a xenologous gene.

[0191] In some embodiments, provided herein are compositions for treating ASD in a mammal. In some embodiments, the compositions comprise one or more strains of genetically modified bacteria having a mutation in potA, ymfI, or agaB. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in potA. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in ymfI. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in agaB. In some embodiments, the modified bacterium is E. coli. Embodiments are not limited to a particular bacterial species. The compositions for treating ASD disclosed herein can comprise one or more strains of any other bacterium having a mutation in a gene homologous to potA, ymfI, or agaB. The bacterium can have a mutation in a gene homologous to potA. The bacterium can have a mutation in a gene homologous to ymfI. The bacterium can have a mutation in a gene homologous to agaB. The homologous gene of potA, ymfI, or agaB can be an orthologous gene, aparalogous gene or a xenologous gene. In some embodiments, the homologous gene is an orthologous gene. In some embodiments, the homologous gene is a paralogous gene. In some embodiments, the homologous gene is a xenologous gene.

[0192] In some embodiments of the genetically modified bacteria disclosed herein, the mutations refer to loss-of-function mutations. Types of mutation can comprise insertions and deletions, point mutation, frameshift mutations, repeat expansion mutation, etc. In some embodiments, the mutations are deletions.

[0193] In some embodiments, compositions comprise a single species of bacteria. In other embodiments, the compositions comprise two or more species of bacteria, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 500, l000 or more, or ranges therebetween species of bacteria. In one embodiment, compositions comprise no more than 20 species of bacteria, e.g., 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 species of bacteria. In some embodiments, compositions comprise bacteria of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more or ranges therebetween) strains disclosed herein. In some embodiments, methods of administering such compositions are provided.

[0194] In some embodiments, compositions comprise one or more additional components (e.g., including but not limited to, one or more additional additive (s) selected from the group consisting of an energy substrate, a source of nitrogen, phosphorus or iron [Fe (II) and / or Fe (III) ] , a mineral, a vitamin, or combinations thereof) .

[0195] In some embodiments, in addition to bacteria disclosed herein, a composition comprises one or more beneficial and / or commensal bacteria selected from other genera and / or taxa.

[0196] In some embodiments, bacteria are vegetative cells, freeze-dried cells, where possible spores, etc. Freeze-dried bacteria can be stored for several years with maintained viability. In certain applications, freeze-dried bacteria are sensitive to humidity. One way of protecting the bacterial cells is to store them in oil. The freeze-dried bacterial cells can be mixed directly with a suitable oil, or alternately the bacterial cell solution can be mixed with an oil and freeze dried together, leaving the bacterial cells completely immersed in oil. Suitable oils may be edible oils such as olive oil, rapeseed oil which is prepared conventionally or cold-pressed, sunflower oil, soy oil, maize oil, cotton-seed oil, peanut oil, sesame oil, cereal germ oil such as wheat germ oil, grape kernel oil, palm oil and palm kernel oil, linseed oil. The viability of freeze-dried bacteria in oil is maintained for at least nine months. Optionally live cells can be added to one of the above oils and stored. In some embodiments, compositions are added to nutraceuticals, food products, or 25 foods. In some embodiments, to give the composition or nutraceutical a pleasant taste, flavoring substances such as for example mints, fruit juices, licorice, Stevia rebaudiana, steviosides or other calorie free sweeteners, rebaudioside A, essential oils like eucalyptus oil, or menthol can optionally be included in compositions of embodiments of the present disclosure.

[0197] In some embodiments, compositions are formulated in pharmaceutical compositions. The bacteria of embodiments herein may be administered alone or in combination with pharmaceutically acceptable carriers or diluents, and such administration may be carried out in single or multiple doses as described herein.

[0198] The pharmaceutical compositions may, for example, be in the form of tablets, resolvable tablets, capsules, bolus, drench, pills sachets, vials, hard or soft capsules, aqueous or oily suspensions, aqueous or oily solutions, emulsions, powders, granules, syrups, elixirs, lozenges, reconstitutable powders, liquid preparations, creams, troches, hard candies, sprays, chewing-gums, creams, salves, jellies, gels, pastes, toothpastes, rinses, dental floss and tooth-picks, liquid aerosols, dry powder formulations, HF A aerosols or organic or inorganic acid addition salts.

[0199] The pharmaceutical compositions may be in a form suitable for, e.g., rectal, oral, topical, buccal administration. Depending upon the disorder and patient to be treated and the route of administration, the pharmaceutical compositions may be administered at varying doses.

[0200] In some embodiments, one or more bacteria strains are formulated in pharmaceutical compositions for rectal administration. Such formulations include enemas, rectal gels, rectal foams, rectal aerosols, suppositories, jelly suppositories, or retention enemas, containing conventional suppository bases such as cocoa butter or other glycerides, as well as synthetic polymers such as polyvinylpyrrolidone, PEG, Pi-PEG, and the like. In suppository forms of the pharmaceutical compositions, a low-melting wax such as, but not limited to, a mixture of fatty acid glycerides, optionally in combination with cocoa butter is first melted.

[0201] In some embodiments, one or more bacteria strains are formulated in pharmaceutical compositions for oral administration. Oral dosage forms include push fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. In some embodiments, push fit 30 capsules contain the active ingredients in admixture with one or more filler. Fillers include, by way of example only, lactose, binders such as starches, and / or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In other embodiments, soft capsules, contain one or more active compound that is dissolved or suspended in a suitable liquid. Suitable liquids include, by way of example only, one or more fatty oil, liquid paraffin, or liquid polyethylene glycol. In addition, stabilizers are optionally added. For example, a stabilizer can be a buffer component to help stabilize the pH. In some embodiments, the pH is between 4.5-8.5. For example, the pH can be approximately 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9 or 8.0, including any value in between. In some embodiments, the pH is from 5.0 to 8.0, 6.0 to 7.5, 6.8 to 7.4, or about 7.0. Non-limiting examples of buffers can include ACES, acetate, ADA, ammonium hydroxide, AMP (2-amino-2-methyl-l-propanol) , AMPD (2-amino-2-methyl-1, 3-propanediol) , AMPSO, BES, BICINE, bis-tris, BIS-TRIS propane, borate, CABS, cacodylate, CAPS, CAPSO, carbonate (pKl) , carbonate (pK2) , CHES, citrate (pKl) , citrate (pK2) , citrate (pK3) , DIPSO, EPPS, HEPPS, ethanolamine, formate, glycine (pK I) , glycine (pK2) , glycylglycine (pK I) , glycylglycine (pK2) , HEPB S, HEPES, HEPPSO, histidine, hydrazine, imidazole, malate (pKl) , malate (pK2) , maleate (pKl) , maleate (pK2) , MES, methylamine, MOBS, MOPS, MOPSO, phosphate (pKl) , phosphate (pK2) , phosphate (pK3) , piperazine (pKl) , piperazine (pK2) , piperidine, PIPES, POPSO, propionate, pyridine, pyrophosphate, succinate (pKl) , succinate (pK2) , TABS, TAPS, TAPSO, taurine (AES) , TES, tricine, triethanolamine (TEA) , and Trizma (tris) .

[0202] In some embodiments, the bacterial formulation comprises at least 1x104 CFU (e.g., 1x104 CFU, 2x104 CFU, 5x104 CFU, 1x105 CFU, 2x105 CFU, 5x105 CFU, 1x106 CFU, 2x106 CFU, 5x106 CFU, 1x107 CFU, 2x107 CFU, 5x107 CFU, 1x108 CFU, 2x108 CFU, 5x108 CFU, 1x109 CFU, 2x109 CFU, 5x109 CFU, 1x1010 CFU, 2x1010 CFU, 5x1010 CFU, 1x1011 CFU, 2x1011 CFU, 5x1011 CFU, 1x1012 CFU, 2x1012 CFU, 5x1012 CFU, or more or ranges there between) of bacteria, alone or with other active components. In some embodiments, the bacterial formulation is administered to the subject in two or more doses (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, or ranges there between) . In some embodiments, the administration of doses is separated by at least 1 day (e.g., 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, or ranges there between) .

[0203] For oral or buccal administration, bacteria disclosed herein may be combined with various excipients. Solid pharmaceutical compositions for oral administration often include, but are not limited to binding agents (for example syrups, acacia, gelatin, tragacanth, polyvinylpyrrolidone, sodium lauryl sulphate, pregelatinized maize starch, starches, modified starches, gum acacia, gum tragacanth, guar gum, pectin, wax binders, microcrystalline cellulose, methylcellulose, carboxymethylcellulose, hydroxypropyl methylcellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, copolyvidone and sodium alginate) , disintegrants (such as starch and preferably com, potato or tapioca starch, alginic acid and certain complex silicates, polyvinylpyrrolidone, gelatin, acacia, sodium starch glycollate, microcrystalline cellulose, crosscarmellose sodium, crospovidone, hydroxypropyl methylcellulose and hydroxypropyl cellulose) , lubricating agents (such as magnesium stearate, sodium lauryl sulfate, talc, silica polyethylene glycol waxes, stearic acid, palmitic acid, calcium stearate, camuba wax, hydrogenated vegetable oils, mineral oils, polyethylene glycols and sodium stearyl fumarate) and fillers (including high molecular weight polyethylene glycols, lactose, calcium phosphate, glycine magnesium stearate, starch, rice flour, chalk, gelatin, microcrystalline cellulose, calcium sulphate, and lactitol) . Such compositions may also include preservative agents and anti-oxidants, the preservative agents or anti-oxidants can be any conventional preservative agents or anti-oxidants for the solid pharmaceutical composition.

[0204] Liquid pharmaceutical compositions for oral administration may be in the form of, for example, emulsions, syrups, or elixirs, or may be presented as a dry product for reconstitution with water or other suitable vehicle before use. Such liquid pharmaceutical compositions may contain, but are not limited to conventional additives such as suspending agents (e.g. syrup, methyl cellulose, hydrogenated edible fats, gelatin, hydroxyalkylcelluloses, carboxymethylcellulose, aluminium stearate gel) , emulsifying agents (e.g. lecithin, sorbitan monooleate, or acacia) , aqueous or non-aqueous vehicles (including edible oils, e.g. almond oil, fractionated coconut oil) oily esters (for example esters of glycerine, propylene glycol, polyethylene glycol or ethyl alcohol) , glycerine, water or normal saline; preservatives (e.g. methyl or propyl p-hydroxybenzoate or sorbic acid) and conventional flavoring, preservative, sweetening or coloring agents. Diluents such as water, ethanol, propylene glycol, glycerin and combinations thereof may also be included.

[0205] Other suitable fillers, binders, disintegrants, lubricants and additional excipients are well known to a person skilled in the art.

[0206] In some embodiments, microbes are spray-dried. In some embodiments, microbes are suspended in an oil phase and are encased by at least one protective layer, which is water-soluble (e.g., water-soluble derivatives of cellulose or starch, gums or pectins; See e.g., EP0180743, herein incorporated by reference in its entirety) .

[0207] In some embodiments, the pharmaceutical compositions comprise small molecules to attenuate the virulence response of microorganisms. For example, the small molecule may inhibit the expression of collagenases and proteolytic activities related to virulence, such as activation of intestinal tissue matrix metalloprotease-9 (MMP9) . Such small molecules that attenuate the virulence response include, but are not limited to phosphorylated PEG (e.g. Pi-PEG15-20) .

[0208] In some embodiments, the pharmaceutical compositions comprise prebiotic compounds such as carbohydrate compounds selected from the group consisting of inulin, fructooligosaccharide (FOS) , short-chain fructooligosaccharide (short chain FOS) , galacto-oligosaccharide (GOS) , xylooligosaccharide (XOS) , glangliosides, partially hydrolysed guar gum (PHGG) acacia gum, soybean-gum, apple extract, lactowolfberry, wolfberry extracts or mixture thereof. Other carbohydrates may be present such as a second carbohydrate acting in synergy with the first carbohydrate and that is selected from the group consisting of xylooligosaccharide (XOS) , gum, acacia gum, starch, partially hydrolysed guar gum or mixture thereof. The carbohydrate or carbohydrates may be present at about 1 g to 20 g or 1%to 80%or 20%to 60%in the daily doses of the composition. Alternatively, the carbohydrates are present at 10%to 80%of the dry composition.

[0209] The daily doses of carbohydrates, and all other compounds administered with the probiotics comply with published safety guidelines and regulatory requirements. This is particularly important with respect to the administration to newborn babies.

[0210] In some embodiments, the pharmaceutical compositions are administered on an ongoing, recurrent, or repeat basis (e.g., multiple times a day, once a day, once every 2, 3, 4, 5, or 6 days, once a week, etc. ) for a period of time (e.g., multiple days, months, or weeks) . Suitable dosages and dosing schedules are determined by one of skill in the art using suitable methods. In some embodiments, the pharmaceutical compositions are administered once to a subject in need thereof.

[0211] The dosage amount and frequency are selected to create an effective level of the bacteria described herein without substantially harmful effects. When administered (e.g., orally, rectally, etc. ) , the dosage will generally comprise at least 1x104 CFU per dose or per day (e.g., 1x104 CFU, 2x104 CFU, 5x104 CFU, 1x105 CFU, 2x105 CFU, 5x105 CFU, 1x106 CFU, 2x106 CFU, 5x106 CFU, 1x107 CFU, 2x107 CFU, 5x107 CFU, 1x108 CFU, 2x108 CFU, 5x108 CFU, 1x109 CFU, 2x109 CFU, 5x109 CFU, 1x1010 CFU, 2x1010 CFU, 5x1010 CFU, 1x1011 CFU, 2x1011 CFU, 5x1011 CFU, 1x1012 CFU, 2x1012 CFU, 5x1012 CFU, or more or ranges there between) of bacteria.

[0212] In some embodiments, a single dose of the pharmaceutical compositions is administered to a subject. In other embodiments, multiple doses are administered over two or more time points, separated by hours, days, weeks, etc. In some embodiments, the pharmaceutical compositions are administered over a long period of time (e.g., chronically) , for example, for a period of months or years (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more months or years; for the subject's lifetime) . In some embodiments, the pharmaceutical compositions may be taken on a regular scheduled basis (e.g., daily, weekly, etc. ) for the duration of the extended period.

[0213] In some embodiments, provided herein are pharmaceutical compositions for treating Type I diabetes in a mammal. In some embodiments, the pharmaceutical compositions comprise a genetically modified bacterium and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical compositions comprise one or more strains of genetically modified bacteria having a mutation in acpP, asd, or metS. In some embodiments, the pharmaceutical compositions comprise one strain of genetically modified bacteria having a mutation in acpP. In some embodiments, the pharmaceutical compositions comprise one strain of genetically modified bacteria having a mutation in asd. In some embodiments, the pharmaceutical compositions comprise one strain of genetically modified bacteria having a mutation in metS. In some embodiments, the modified bacterium is B. subtilis. Embodiments are not limited to a particular bacterial species. The pharmaceutical compositions for treating Type I diabetes disclosed herein can comprise one or more strains of any other bacterium having a mutation in a gene homologous to acpP, asd, or metS. The bacterium can have a mutation in a gene homologous to acpP. The bacterium can have a mutation in a gene homologous to asd. The bacterium can have a mutation in a gene homologous to metS. The homologous gene of acpP, asd, or metS can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0214] In some embodiments, provided herein are pharmaceutical compositions for treating a lipid metabolism disorder (e.g., a lipid storage disorder or a lipid transport disorder) in a mammal. In some embodiments, provided herein are pharmaceutical compositions for treating a lipid storage disorder in a mammal. In some embodiments, provided herein are pharmaceutical compositions for treating a lipid transport disorder in a mammal. In some embodiments, the pharmaceutical compositions comprise a genetically modified bacterium and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical compositions comprise one or more strains of genetically modified bacteria having a mutation in dapH or racE. In some embodiments, the pharmaceutical compositions comprise one strain of genetically modified bacteria having a mutation in dapH. In some embodiments, the pharmaceutical compositions comprise one strain of genetically modified bacteria having a mutation in racE. In some embodiments, the modified bacterium is B. subtilis. Embodiments are not limited to a particular bacterial species. The pharmaceutical compositions for treating a lipid metabolism disorder disclosed herein can comprise one or more strains of any other bacterium having a mutation in a gene homologous to dapH or racE. The bacterium can have a mutation in a gene homologous to dapH. The bacterium can have a mutation in a gene homologous to racE. The homologous gene of dapH or racE can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the homologous gene is an orthologous gene. In some embodiments, the homologous gene is a paralogous gene. In some embodiments, the homologous gene is a xenologous gene. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0215] In some embodiments, provided herein are pharmaceutical compositions for treating ISS in a mammal. In some embodiments, the pharmaceutical compositions comprise a genetically modified bacterium and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical compositions comprise one or more strains of genetically modified bacteria having a mutation in accA or coaBC. In some embodiments, the pharmaceutical compositions comprise one strain of genetically modified bacteria having a mutation in accA. In some embodiments, the pharmaceutical compositions comprise one strain of genetically modified bacteria having a mutation in coaBC. In some embodiments, the modified bacterium is B. subtilis. Embodiments are not limited to a particular bacterial species. The pharmaceutical compositions for treating ISS disclosed herein can comprise one or more strains of any other bacterium having a mutation in a gene homologous to accA or coaBC. The bacterium can have a mutation in a gene homologous to accA. The bacterium can have a mutation in a gene homologous to coaBC. The homologous gene of accA or coaBC can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the homologous gene is an orthologous gene. In some embodiments, the homologous gene is a paralogous gene. In some embodiments, the homologous gene is a xenologous gene. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0216] In some embodiments, provided herein are pharmaceutical compositions for treating a polyglutamine disease in a mammal. In some embodiments, the pharmaceutical compositions comprise a genetically modified bacterium and a pharmaceutically acceptable carrier. In some embodiments, the compositions comprise one or more strain of genetically modified bacteria having a mutation in pheL. In some embodiments, the compositions comprise one strain of genetically modified bacteria having a mutation in pheL. In some embodiments, the compositions comprise one or more strain of genetically modified E. coli having a mutation in pheL. Embodiments are not limited to a particular bacterial species. The pharmaceutical compositions for treating a polyglutamine disease disclosed herein can comprise one or more strains of any other bacterium having a gene homologous to pheL. The homologous gene of pheL can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the homologous gene is an orthologous gene. In some embodiments, the homologous gene is an orthologous gene. In some embodiments, the homologous gene is a paralogous gene. In some embodiments, the homologous gene is a xenologous gene. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0217] In some embodiments, provided herein are pharmaceutical compositions for treating ASD in a mammal. In some embodiments, the pharmaceutical compositions comprise a genetically modified bacterium and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical compositions comprise one or more strains of genetically modified bacteria having a mutation in potA, ymfI, or agaB. In some embodiments, the pharmaceutical compositions comprise one strain of genetically modified bacteria having a mutation in potA. In some embodiments, the pharmaceutical compositions comprise one strain of genetically modified bacteria having a mutation in ymfI. In some embodiments, the pharmaceutical compositions comprise one strain of genetically modified bacteria having a mutation in agaB. In some embodiments, the modified bacterium is E. coli. Embodiments are not limited to a particular bacterial species. The compositions for treating ASD disclosed herein can comprise one or more strains of any other bacterium having a mutation in a gene homologous to potA, ymfI, or agaB. The bacterium can have a mutation in a gene homologous to potA. The bacterium can have a mutation in a gene homologous to ymfI. The bacterium can have a mutation in a gene homologous to agaB. The homologous gene of potA, ymfI, or agaB can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the homologous gene is an orthologous gene. In some embodiments, the homologous gene is a paralogous gene. In some embodiments, the homologous gene is a xenologous gene. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion. 6.5 Methods of treatment

[0218] Provided herein are methods of treating a hereditary disease or metabolic disease in a subject comprising administering to the subject a therapeutically effective amount of the genetically modified bacterium identified by the methods of screening disclosed herein. As a person of ordinary skill in the art would understand, bacteria with therapeutic potential are not limited to the specific bacteria (e.g., E. coli or B. subtilis) identified by methods disclosed herein. Once a genetically modified bacterium is identified by the methods disclosed herein to have therapeutic potential, other bacterium having a mutation in a homologous gene can be identified, which is expected to have similar therapeutic potential. As such, the modified bacterium to be used in methods disclosed herein can be any bacterium having a gene that is homologous to the modified gene in the identified bacterium. Accordingly, in some embodiments, methods provided herein comprise administering the genetically modified bacteria identified by methods described herein. In some embodiments, methods provided herein comprise administering the bacteria comprising a mutation in a gene homologous to the modified gene in the identified bacterium. Any bacterium having a gene that is homologous to the modified gene in the identified bacterium can be used in methods disclosed herein. The genetically modified bacteria can be either gram-positive or gram-negative. In some embodiments, the bacterium to be used in the compositions disclosed herein can be a bacterium existing in the human microbiota. Exemplary species are disclosed in the section above.

[0219] The subject to be treated by methods disclosed herein can be a mammal. In some embodiments, the subject is a human. The hereditary diseases include, but are not limited to, ISS, a polyglutamine disease, and ASD. In some embodiments, the hereditary disease is ISS. In some embodiments, the hereditary disease is a polyglutamine disease. In some embodiments, the hereditary disease is ASD. The metabolic diseases include, but are not limited to, diabetes mellitus and a lipid metabolism disorder. In some embodiments, the metabolic diseases are Type I diabetes. In some embodiments, the metabolic disease is a lipid metabolism disorder.

[0220] Provided herein are methods of treating Type I diabetes in a subject comprising administering to the subject the genetically modified bacterium identified by the methods of screening disclosed herein. The subject can be a mammal. In some embodiments, the subject is a human. Type 1 diabetes is a chronic condition in which the pancreas produces little to no insulin, the hormone responsible for regulating blood sugar levels. In some embodiments, the methods of treating Type I diabetes disclosed herein enhance insulin production in the subject.

[0221] In some embodiments, provided herein are methods of treating Type I diabetes in a mammal comprising administering to the mammal one or more strains of genetically modified bacteria having a mutation in acpP, asd, or metS. In some embodiments, the genetically modified bacteria have a mutation in acpP. In some embodiments, the genetically modified bacteria have a mutation in asd. In some embodiments, the genetically modified bacteria have a mutation in metS. In some embodiments, the modified bacterium is B. subtilis. Embodiments are not limited to a particular bacterial species. Provided herein are methods of treating Type I diabetes in a subject comprising administering to the subject a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium. In some embodiments, provided herein are methods of treating Type I diabetes in a mammal comprising administering to the mammal one or more strains of a bacterium having a mutation in a gene homologous to acpP, asd, or metS. The bacterium can have a mutation in a gene homologous to acpP. The bacterium can have a mutation in a gene homologous to asd. The bacterium can have a mutation in a gene homologous to metS. The homologous gene of acpP, asd, or metS can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0222] Provided herein are methods of treating a lipid metabolism disorder in a subject comprising administering to the subject the genetically modified bacterium identified by the methods of screening disclosed herein. The lipid metabolism disorder can be a lipid storage disorder. The lipid metabolism disorder can be a lipid transport disorder. The subject can be a mammal. In some embodiments, the subject is a human. Lipid metabolism disorders refer to conditions where the body has difficulty processing or regulating fats (lipids) , leading to imbalances in lipid levels in the blood. In some embodiments, the methods of treating a lipid metabolism disorder disclosed herein reduce fat storage in the subject. In some embodiments, the methods of treating a lipid metabolism disorder disclosed herein increase fat storage in the subject.

[0223] In some embodiments, provided herein are methods of treating a lipid metabolism disorder in a mammal comprising administering to the mammal one or more strains of genetically modified bacteria having a mutation in dapH or racE. In some embodiments, the genetically modified bacteria have a mutation in dapH. In some embodiments, the genetically modified bacteria have a mutation in racE. In some embodiments, the modified bacterium is B. subtilis. Embodiments are not limited to a particular bacterial species. Provided herein are methods of treating a lipid metabolism disorder in a subject comprising administering to the subject a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium. In some embodiments, provided herein are methods of treating a lipid metabolism disorder in a mammal comprising administering to the mammal one or more strains of a bacterium having a mutation in a gene homologous to dapH or racE. The bacterium can have a mutation in a gene homologous to dapH. The bacterium can have a mutation in a gene homologous to racE. The homologous gene of dapH or racE can be an orthologous gene, aparalogous gene or a xenologous gene. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0224] Provided herein are methods of treating ISS in a subject comprising administering to the subject the genetically modified bacterium identified by the methods of screening disclosed herein. The subject can be a mammal. In some embodiments, the subject is a human. In some embodiments, the methods of treating ISS disclosed herein increase the body length, height, or limb length of the subject. In some embodiments, the methods of treating ISS disclosed herein improve the limb morphology of the subject. In some embodiments, provided herein are methods of treating ISS in a mammal comprising administering to the mammal one or more strains of genetically modified bacteria having a mutation in accA or coaBC. In some embodiments, the genetically modified bacteria have a mutation in accA. In some embodiments, the genetically modified bacteria have a mutation in coaBC. In some embodiments, the modified bacterium is B. subtilis. Embodiments are not limited to a particular bacterial species. Provided herein are methods of treating ISS in a subject comprising administering to the subject a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium. In some embodiments, provided herein are methods of treating ISS in a mammal comprising administering to the mammal one or more strains of a bacterium having a mutation in a gene homologous to accA or coaBC. The bacterium can have a mutation in a gene homologous to accA. The bacterium can have a mutation in a gene homologous to coaBC. The homologous gene of accA or coaBC can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0225] Provided herein are methods of treating a polyglutamine disease in a subject comprising administering to the subject the genetically modified bacterium identified by the methods of screening disclosed herein. The subject can be a mammal. In some embodiments, the subject is a human. Polyglutamine diseases include, for example, Huntington's disease (HD) , spinocerebellar ataxias (SCAs) , spinobulbar muscular atrophy (SBMA) , and (dentatorubral-pallidoluysian atrophy (DRPLA) . In some embodiments, the methods of treating a polyglutamine disease disclosed herein reduce the aggregation of polyQ in the subject. In some embodiments, the methods of treating a polyglutamine disease disclosed herein slower progression of the polyglutamine disease in the subject. In some embodiments, the methods of treating a polyglutamine disease disclosed herein reverse progression of the polyglutamine disease in the subject.

[0226] In some embodiments, provided herein are methods of treating a polyglutamine disease in a mammal comprising administering to the mammal one or more strain of genetically modified bacteria having a mutation in pheL. In some embodiments, the modified bacterium is E. coli. Embodiments are not limited to a particular bacterial species. Provided herein are methods of treating a polyglutamine disease in a subject comprising administering to the subject a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium. In some embodiments, provided herein are methods of treating a polyglutamine disease in a mammal comprising administering to the mammal one or more strains of a bacterium having a mutation in a gene homologous to pheL. The homologous gene of pheL can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0227] Provided herein are methods of treating ASD in a subject comprising administering to the subject the genetically modified bacterium identified by the methods of screening disclosed herein. The subject can be a mammal. In some embodiments, the subject is a human. In some embodiments, the methods of treating ASD disclosed herein ameliorate social willingness and ability of the subject. In some embodiments, the methods of treating ASD disclosed herein ameliorate the autistic symptoms of the subject.

[0228] In some embodiments, provided herein are methods of treating ASD in a mammal comprising administering to the mammal one or more strains of genetically modified bacteria having a mutation in potA, ymfI, or agaB. In some embodiments, the genetically modified bacteria have a mutation in potA. In some embodiments, the genetically modified bacteria have a mutation in ymfI. In some embodiments, the genetically modified bacteria have a mutation in agaB. In some embodiments, the modified bacterium is E. coli. Embodiments are not limited to a particular bacterial species. Provided herein are methods of treating ASD in a subject comprising administering to the subject a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium. In some embodiments, provided herein are methods of treating ASD in a mammal comprising administering to the mammal one or more strains of a bacterium having a mutation in a gene homologous to potA, ymfI, or agaB. The bacterium can have a mutation in a gene homologous to potA. The bacterium can have a mutation in a gene homologous to ymfI. The bacterium can have a mutation in a gene homologous to agaB. The homologous gene of potA, ymfI, or agaB can be an orthologous gene, a paralogous gene or a xenologous gene. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0229] Provided herein are also uses of the genetically modified bacteria described herein (e.g., genetically modified E. coli or genetically modified B. subtilis) in treating Type I diabetes in a subject. Provided herein are also uses of the genetically modified bacteria described herein (e.g., genetically modified E. coli or genetically modified B. subtilis) in the manufacture of a medicament for treating Type I diabetes in a subject. The subject can be a mammal. In some embodiments, the genetically modified bacteria have a mutation in acpP, asd, or metS. In some embodiments, the genetically modified bacteria have a mutation in acpP. In some embodiments, the genetically modified bacteria have a mutation in asd. In some embodiments, the genetically modified bacteria have a mutation in metS. Embodiments are not limited to a particular bacterial species. In some embodiments, the genetically modified bacteria have a mutation in a gene homologous to acpP, asd, or metS. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0230] Provided herein are also uses of the genetically modified bacteria described herein (e.g., genetically modified E. coli or genetically modified B. subtilis) in treating a lipid metabolism disorder in a subject. Provided herein are also uses of the genetically modified bacteria described herein (e.g., genetically modified E. coli or genetically modified B. subtilis) in the manufacture of a medicament for treating a lipid metabolism disorder in a subject. The subject can be a mammal. In some embodiments, the subject is a human. In some embodiments, the genetically modified bacteria have a mutation in dapH or racE. In some embodiments, the genetically modified bacteria have a mutation in dapH. In some embodiments, the genetically modified bacteria have a mutation in racE. Embodiments are not limited to a particular bacterial species. In some embodiments, the genetically modified bacteria have a mutation in a gene homologous to dapH or racE. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0231] Provided herein are also uses of the genetically modified bacteria described herein (e.g., genetically modified E. coli or genetically modified B. subtilis) in treating ISS in a subject. Provided herein are also uses of the genetically modified bacteria described herein (e.g., genetically modified E. coli or genetically modified B. subtilis) in the manufacture of a medicament for treating ISS in a subject. The subject can be a mammal. In some embodiments, the subject is a human. In some embodiments, the genetically modified bacteria have a mutation in accA or coaBC. In some embodiments, the genetically modified bacteria have a mutation in accA. In some embodiments, the genetically modified bacteria have a mutation in coaBC. Embodiments are not limited to a particular bacterial species. In some embodiments, the genetically modified bacteria have a mutation in a gene homologous to accA or coaBC. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0232] Provided herein are also uses of the genetically modified bacteria described herein (e.g., genetically modified E. coli or genetically modified B. subtilis) in treating a polyglutamine disease in a subject. Provided herein are also uses of the genetically modified bacteria described herein (e.g., genetically modified E. coli or genetically modified B. subtilis) in the manufacture of a medicament for treating a polyglutamine disease in a subject. The subject can be a mammal. In some embodiments, the subject is a human. In some embodiments, the genetically modified bacteria have a mutation in pheL. Embodiments are not limited to a particular bacterial species. In some embodiments, the genetically modified bacteria have a mutation in a gene homologous to pheL.

[0233] Provided herein are also uses of the genetically modified bacteria described herein (e.g., genetically modified E. coli or genetically modified B. subtilis) in treating ASD in a subject. Provided herein are also uses of the genetically modified bacteria described herein (e.g., genetically modified E. coli or genetically modified B. subtilis) in the manufacture of a medicament for treating ASD in a subject. The subject can be a mammal. In some embodiments, the subject is a human. In some embodiments, the genetically modified bacteria have a mutation in potA, ymfI, or agaB. In some embodiments, the genetically modified bacteria have a mutation in potA. In some embodiments, the genetically modified bacteria have a mutation in ymfI. In some embodiments, the genetically modified bacteria have a mutation in agaB. Embodiments are not limited to a particular bacterial species. In some embodiments, the genetically modified bacteria have a mutation in a gene homologous to potA, ymfI, or agaB. In some embodiments, the mutation is a loss-of-function mutation. In some embodiments, the mutation is a deletion.

[0234] Actual dosage levels of the genetically modified bacteria (e.g., genetically modified E. coli or genetically modified B. subtilis) described herein can be varied so as to obtain an amount of the bacteria which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular compositions described herein, the route of administration, the time of administration, the rate of excretion, the duration of the treatment, other drugs, compounds and / or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, and until the patient shows partial or complete amelioration of symptoms of disease.

[0235] The genetically modified bacteria or pharmaceutical compositions provided herein can be administered to a subject by any conventional methods known in the art, for example, rectal, oral, topical, or buccal administration.

[0236] Combination therapy using agents with different mechanisms of action can result in additive or synergetic effects. Combination therapy can allow for a lower dose of each agent than is used in monotherapy, thereby reducing toxic side effects and / or increasing the therapeutic index of the bacteria or pharmaceutical compositions disclosed herein. The additional therapy can be administered prior to, concurrently with, or subsequent to administration of the bacteria or pharmaceutical compositions described herein. Combined administration can include co-administration, either in a single pharmaceutical formulation or using separate formulations, or consecutive administration in either order but generally within a time period such that all active agents can exert their biological activities simultaneously. A person skilled in the art can readily determine appropriate regimens for administering a pharmaceutical composition described herein and an additional therapy in combination, including the timing and dosing of an additional agent to be used in a combination therapy, based on the needs of the subject being treated.

[0237] In the methods disclosed herein, a therapeutically effective amount of genetically modified bacteria or pharmaceutical compositions disclosed herein is administered to a subject in need of treatment for a hereditary disease or metabolic disease. In the methods and uses disclosed herein, the subject can be a mammal. In some embodiments, the subject is a human. 6.6 Kits

[0238] Also provided herein are kits comprising the systems or compositions described herein. In certain embodiments, the kit comprises systems provide herein for screening for a genetically modified bacterium for treating a hereditary disease or metabolic disease in a mammal, comprising: a plurality of nematodes that provide a model for the genetic disease or metabolic disease and a library of genetically modified bacteria. The kits can comprise one or more containers, as well as instructions regarding the use thereof.

[0239] In some embodiments, kits provided can comprise compositions (e.g., pharmaceutical compositions provided herein) that comprise a genetically modified bacterium disclosed herein or identified by methods disclosed herein. Kits provided herein can be used for the treatment of a metabolic disease or hereditary disease, such as Type I diabetes, a lipid metabolism disorder, idiopathic short stature (ISS) , a polyglutamine disease, or autism spectrum disorder (ASD) . Components of the kits are packaged into suitable packaging material. A kit can include a label or packaging insert including a description of the components or instructions for use in vitro, in vivo, or ex vivo, of the components therein.

[0240] Exemplary instructions include instructions for treatment and / or prevention of a metabolic disease or hereditary disease. In some embodiments, the disease is Type I diabetes. In some embodiments, the disease is a lipid metabolism disorder. In some embodiments, the disease is idiopathic short stature (ISS) . In some embodiments, the disease is polyglutamine disease (e.g., Huntington’s disease) . In some embodiments, the disease is autism spectrum disorder (ASD) .

[0241] The term “packaging material” refers to a physical structure housing the components of the kit. The packaging material can maintain the components sterilely, and can be made of material commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampules, vials, tubes, etc. ) .

[0242] Kits provided herein can include labels or inserts. Labels or inserts include “printed matter, ” e.g., paper or cardboard, separate or affixed to a component, a kit or packing material (e.g., a box) , or attached to, for example, an ampule, tube or vial containing a kit component. Labels or inserts can additionally include a computer readable medium, such as a disk (e.g., hard disk, card, memory disk) , optical disk such as CD-or DVD-ROM / RAM, DVD, MP3, magnetic tape, or an electrical storage media such as RAM and ROM or hybrids of these such as magnetic / optical storage media, FLASH media or memory type cards. In some embodiments, the instructions recite a method provided herein.

[0243] Labels or inserts can include, among other things, identifying information of one or more components therein, dosing parameters, and / or information on the clinical pharmacology of the active ingredient (s) , including mechanism of action, pharmacokinetics and pharmacodynamics. Labels or inserts can include information identifying manufacturer information, lot numbers, manufacturer location and date.

[0244] Labels or inserts can include information on a condition, disorder, disease or symptom for which a kit component may be used. Labels or inserts can include instructions for the clinician or for a subject for using one or more of the kit components in a method, treatment protocol or therapeutic regimen. Instructions can include dosage amounts, frequency or duration, and instructions for practicing any of the methods, treatment protocols or therapeutic regimens set forth herein. Exemplary instructions include instructions for treatment or use of pharmaceutical compositions disclosed herein in treating a metabolic disease or hereditary disease. Kits provided herein therefore can additionally include labels or instructions for practicing any of the methods and uses provided herein, including treatment methods and uses.

[0245] Labels or inserts can include information on any benefit that a component may provide, such as a prophylactic or therapeutic benefit. Labels or inserts can include information on potential adverse side effects, such as warnings to the subject or clinician regarding situations where it would not be appropriate to use a particular composition. Adverse effects could also occur when the subject has, will be, or is currently taking one or more other medications that may be incompatible with the composition, or the subject has, will be, or is currently undergoing another treatment protocol or therapeutic regimen which would be incompatible with the composition and, therefore, instructions could include information regarding such incompatibilities.

[0246] Kits provided herein can additionally include other components. Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package. In certain embodiments, kits are designed for cold storage. Kits provided herein can further be designed to contain the pharmaceutical compositions provided herein. Kits provided herein can also be designed to contain, either separately or in combination with the pharmaceutical compositions provided herein, one or more additional agents useful in the treatment or prevention of a metabolic disease or hereditary disease. Any cells in the kit can be maintained under appropriate storage conditions until ready to use. 6.7 Exemplified Embodiments

[0247] Embodiment 1: A method of screening for a genetically modified bacterium for treating a hereditary disease or metabolic disease in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria; wherein the nematodes provide a model for the hereditary disease or metabolic disease; and (2) identifying the genetically modified bacterium that affects a disease-related phenotype in the nematode model.

[0248] Embodiment 2: The method of Embodiment 1, wherein the nematodes are Caenorhabditis elegans.

[0249] Embodiment 3: The method of Embodiment 1 or 2, wherein the nematodes are genetically modified.

[0250] Embodiment 4: The method of Embodiment 3, wherein the genetic modification of the nematodes comprises overexpression, mutation or deletion of an endogenous gene, or expression of an exogenous gene.

[0251] Embodiment 5: The method of Embodiment 3, wherein the genetic modification of the nematodes comprises mutation of an endogenous gene.

[0252] Embodiment 6: The method of any one of Embodiments 1 to 5, further comprising (0) generating a nematode model for the hereditary disease or metabolic disease.

[0253] Embodiment 7: The method of Embodiment 6, wherein step (0) comprises identifying a measurable disease-related phenotype in nematode.

[0254] Embodiment 8: The method of Embodiment 6, wherein the hereditary disease or metabolic disease is caused by a gene mutation, and step (0) comprises identifying a nematode homolog of the disease-causing gene in mammals and generating a nematode with a mutation in the homologous gene and measurable disease-related phenotype.

[0255] Embodiment 9: The method of any one of Embodiments 1 to 8, further comprising (3) verifying that the genetically modified bacterium treats the disease in a mammal.

[0256] Embodiment 10: The method of Embodiment 9, wherein step (3) comprises administering the genetically modified bacterium to the mammal having the disease and monitoring the disease in the mammal.

[0257] Embodiment 11: The method of Embodiment 9 or 10, wherein the mammal is mouse.

[0258] Embodiment 12: The method of any one of Embodiments 1 to 11, wherein the bacteria are E. coli.

[0259] Embodiment 13: The method of any one of Embodiments 1 to 11, wherein the bacteria are B. subtilis.

[0260] Embodiment 14: The method of any one of Embodiments 1 to 13, wherein the library is a single gene mutation library.

[0261] Embodiment 15: The method of Embodiment 14, wherein the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library.

[0262] Embodiment 16: The method of any one of Embodiments 1 to 15, wherein the hereditary disease or metabolic disease is Type I diabetes, a lipid metabolism disorder, idiopathic short stature (ISS) , a polyglutamine disease, or autism spectrum disorder (ASD) .

[0263] Embodiment 17: A method of screening for a genetically modified bacterium for treating Type I diabetes in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria; and (2) identifying the genetically modified bacterium that activates insulin expression in the nematode.

[0264] Embodiment 18: The method of Embodiment 17, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein driven by promoter for ins-1 (ins-1p) and step (2) comprises identifying the genetically modified bacterium that enhances florescent signal in the nematode.

[0265] Embodiment 19: The method of Embodiment 17 or 18, further comprising (3) verifying that the genetically modified bacterium treats Type I diabetes in a mammal.

[0266] Embodiment 20: The method of Embodiment 19, wherein step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its insulin expression.

[0267] Embodiment 21: A method of screening for a genetically modified bacterium for treating a lipid metabolism disorder in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria; and (2) identifying the genetically modified bacterium that increases or decreases the lipid storage in the nematodes.

[0268] Embodiment 22: The method of Embodiment 21, further comprising (3) verifying that the genetically modified bacterium affects lipid metabolism in a mammal.

[0269] Embodiment 23: The method of Embodiment 21 or 22, wherein step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its lipid storage.

[0270] Embodiment 24: A method of screening for a genetically modified bacterium for treating ISS in a mammal, comprising: (1) feeding a plurality of nematodes on a library of genetically modified bacteria, wherein the nematodes comprise a mutation in sma-6; and (2) identifying the genetically modified bacterium that restores the shortened body length in the nematode.

[0271] Embodiment 25: The method of Embodiment 24, further comprising (3) verifying that the genetically modified bacterium treats ISS in a mammal.

[0272] Embodiment 26: The method of Embodiment 24 or 25, wherein step (3) comprises administering the genetically modified bacterium to a mouse with mutation in BMPR1A or BMPRIB and monitoring its body length, limb length, or limb morphology, or any combination thereof.

[0273] Embodiment 27: The method of Embodiment 26, wherein step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its body length and / or limb length.

[0274] Embodiment 28: The method of Embodiment 26, wherein step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its limb morphology.

[0275] Embodiment 29: A method of screening for a genetically modified bacterium for treating a polyglutamine disease in a mammal, comprising: (1) feeding a plurality of nematodes with a library of genetically modified bacteria, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein tagged with multiple glutamine residues and (2) identifying the genetically modified bacterium that reduces aggregated fluorescent signals in the nematode.

[0276] Embodiment 30: The method of Embodiment 29, further comprising (3) verifying that the genetically modified bacterium treats polyglutamine disease in a mammal.

[0277] Embodiment 31: The method of Embodiment 30, wherein step (3) comprises administering the genetically modified bacterium to a mouse model for polyglutamine disease and monitoring disease progression.

[0278] Embodiment 32: A method of screening for a genetically modified bacterium for treating ASD in a mammal, comprising: (1) feeding a plurality of nematodes with a library of genetically modified bacteria, wherein the nematodes comprise a deletion of an allele of chd-7; and (2) identifying the genetically modified bacterium that restores the pharyngeal pumping rate in the nematode.

[0279] Embodiment 33: The method of Embodiment 32, wherein the nematodes comprise a deletion of chd-7 (gk290) .

[0280] Embodiment 34: The method of Embodiment 32, wherein the nematodes comprise a deletion of chd-7 (gk306) .

[0281] Embodiment 35: The method of Embodiment 32, wherein the nematodes comprise a first group having a deletion of chd-7 (gk290) and a second group having a deletion of chd-7 (gk306) .

[0282] Embodiment 36: The method of Embodiment 32, wherein the pharyngeal pumping rate in the nematode is restored to normal level.

[0283] Embodiment 37: The method of any one of Embodiments 32 to 36, further comprising (3) verifying that the genetically modified bacterium treats ASD in a mammal.

[0284] Embodiment 38: The method of Embodiment 37, wherein step (3) comprises administering the genetically modified bacterium to a mouse with Chd8 mutation and monitoring its social behavior.

[0285] Embodiment 39: The method of any one of Embodiments 17 to 38, wherein the nematodes are C. elegans.

[0286] Embodiment 40: The method of any one of Embodiments 17 to 39, wherein the bacteria are E. coli.

[0287] Embodiment 41: The method of any one of Embodiments 17 to 39, wherein the bacteria are B. subtilis.

[0288] Embodiment 42: The method of any one of Embodiments 17 to 41, wherein the library is a single gene mutation library.

[0289] Embodiment 43: The method of Embodiment 42, wherein the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library.

[0290] Embodiment 44: A system for screening for a genetically modified bacterium for treating a hereditary disease or metabolic disease in a mammal, comprising: a plurality of nematodes that provide a model for the genetic disease or metabolic disease and a library of genetically modified bacteria.

[0291] Embodiment 45: The system of Embodiment 44, wherein the nematodes are C. elegans.

[0292] Embodiment 46: The system of Embodiment 44 or 45, further comprising a mammal that provides a model for the genetic disease or metabolic disease.

[0293] Embodiment 47: The system of Embodiment 46, wherein the mammal is mouse.

[0294] Embodiment 48: The system of any one of Embodiments 44 to 47, wherein the bacteria are E. coli.

[0295] Embodiment 49: The system of any one of Embodiments 44 to 47, wherein the bacteria are B. subtilis.

[0296] Embodiment 50: The system of any one of Embodiments 44 to 49, wherein the library is a single gene mutation library.

[0297] Embodiment 51: The system of Embodiment 50, wherein the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library.

[0298] Embodiment 52: The system of any one of Embodiments 44 to 51, wherein the nematodes are genetically modified.

[0299] Embodiment 53: The system of Embodiment 52, wherein the genetic modification of the nematodes comprises overexpression, mutation or deletion of an endogenous gene, or expression of an exogenous gene.

[0300] Embodiment 54: The system of Embodiment 53, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein driven by promoter for ins-1 (ins-1p) .

[0301] Embodiment 55: The system of Embodiment 53, wherein the nematodes comprise a mutation in sma-6 (wk7) .

[0302] Embodiment 56: The system of Embodiment 53, wherein the nematodes comprise a deletion of an allele of chd-7.

[0303] Embodiment 57: The system of Embodiment 53, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein tagged with multiple glutamine residues.

[0304] Embodiment 58: The system of any one of Embodiments 44 to 57, wherein the hereditary disease or metabolic disease is Type I diabetes, a lipid metabolism disorder, idiopathic short stature (ISS) , a polyglutamine disease, or autism spectrum disorder (ASD) .

[0305] Embodiment 59: A pharmaceutical composition for treating a hereditary disease or metabolic disease in a mammal comprising the genetically modified bacterium identified in any of Embodiments 1 to 16 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.

[0306] Embodiment 60: The pharmaceutical composition of Embodiment 59, comprising the genetically modified bacterium identified in any of Embodiments 1 to 16.

[0307] Embodiment 61: A method of treating a hereditary disease or metabolic disease in a mammal comprising administering to the mammal the genetically modified bacterium identified in any of Embodiments 1 to 16 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.

[0308] Embodiment 62: The method of Embodiment 61, comprising administering to the mammal the genetically modified bacterium identified in any of Embodiments 1 to 16.

[0309] Embodiment 63: A pharmaceutical composition for treating Type I diabetes in a mammal comprising the genetically modified bacterium identified in any one of Embodiments 17 to 20 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.

[0310] Embodiment 64: The pharmaceutical composition of Embodiment 63, comprising the genetically modified bacterium identified in any one of Embodiments 17 to 20.

[0311] Embodiment 65: A pharmaceutical composition for treating Type I diabetes in a mammal comprising a genetically modified bacterium having a mutation in acpP, asd, or metS or a gene homologous to acpP, asd, or metS, and a pharmaceutically acceptable carrier.

[0312] Embodiment 66: The pharmaceutical composition of Embodiment 65, comprising a genetically modified bacterium having a mutation in acpP, asd, or metS.

[0313] Embodiment 67: A method of treating Type I diabetes in a mammal comprising administering to the mammal the genetically modified bacterium identified in any one of Embodiments 17 to 20 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.

[0314] Embodiment 68: The method of Embodiment 67, comprising administering to the mammal the genetically modified bacterium identified in any one of Embodiments 17 to 20.

[0315] Embodiment 69: A method of treating Type I diabetes in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in acpP, asd, or metS or a gene homologous to acpP, asd, or metS.

[0316] Embodiment 70: The method of Embodiment 69, comprising administering to the mammal a genetically modified bacterium having a mutation in acpP, asd, or metS.

[0317] Embodiment 71: A pharmaceutical composition for treating a lipid metabolism disorder in a mammal comprising the genetically modified bacterium identified in any one of Embodiments 21 to 23 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.

[0318] Embodiment 72: The pharmaceutical composition of Embodiment 71, comprising the genetically modified bacterium identified in any one of Embodiments 21 to 23.

[0319] Embodiment 73: A pharmaceutical composition for treating a lipid metabolism disorder in a mammal comprising a genetically modified bacterium having a mutation in dapH or racE or a gene homologous to dapH or racE, and a pharmaceutically acceptable carrier.

[0320] Embodiment 74: The pharmaceutical composition of Embodiment 73, comprising a genetically modified bacterium having a mutation in dapH or racE.

[0321] Embodiment 75: A method of treating a lipid metabolism disorder in a mammal comprising administering to the mammal the genetically modified bacterium identified in Embodiments 21 to 23 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.

[0322] Embodiment 76: The method of Embodiment 75, comprising administering to the mammal the genetically modified bacterium identified in Embodiments 21 to 23.

[0323] Embodiment 77: A method of treating a lipid metabolism disorder in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in dapH or racE or a gene homologous to dapH or racE.

[0324] Embodiment 78: The method of Embodiment 77, comprising administering to the mammal a genetically modified bacterium having a mutation in dapH or racE.

[0325] Embodiment 79: A pharmaceutical composition for treating ISS in a mammal comprising the genetically modified bacterium identified in any one of Embodiments 24 to 28 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.

[0326] Embodiment 80: The pharmaceutical composition of Embodiment 79, comprising the genetically modified bacterium identified in any one of Embodiments 24 to 28.

[0327] Embodiment 81: A pharmaceutical composition for treating ISS in a mammal comprising a genetically modified bacterium having a mutation in accA or coaBC or a gene homologous to accA or coaBC, and a pharmaceutically acceptable carrier.

[0328] Embodiment 82: The pharmaceutical composition of Embodiment 81, comprising a genetically modified bacterium having a mutation in accA or coaBC.

[0329] Embodiment 83: A method of treating ISS in a mammal comprising administering to the mammal the genetically modified bacterium identified in any one of Embodiments 24 to 28 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.

[0330] Embodiment 84: The method of Embodiment 83, comprising administering to the mammal the genetically modified bacterium identified in any one of Embodiments 24 to 28.

[0331] Embodiment 85: A method of treating ISS in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in accA or coaBC or a gene homologous to accA or coaBC.

[0332] Embodiment 86: The method of Embodiment 85, comprising administering to the mammal a genetically modified bacterium having a mutation in accA or coaBC.

[0333] Embodiment 87: A pharmaceutical composition for treating a polyglutamine disease in a mammal comprising the genetically modified bacterium identified in any one of Embodiments 29 to 31 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.

[0334] Embodiment 88: The pharmaceutical composition of Embodiment 87, comprising the genetically modified bacterium identified in any one of Embodiments 29 to 31.

[0335] Embodiment 89: A pharmaceutical composition for treating a polyglutamine disease in a mammal comprising a genetically modified bacterium having a mutation in pheL or a gene homologous to pheL, and a pharmaceutically acceptable carrier.

[0336] Embodiment 90: The pharmaceutical composition of Embodiment 89, comprising a genetically modified bacterium having a mutation in pheL.

[0337] Embodiment 91: A method of treating a polyglutamine disease in a mammal comprising administering to the mammal the genetically modified bacterium identified in any one of Embodiments 29 to 31 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.

[0338] Embodiment 92: The method of Embodiment 91, comprising administering to the mammal the genetically modified bacterium identified in any one of Embodiments 29 to 31.

[0339] Embodiment 93: A method of treating a polyglutamine disease in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in pheL or a gene homologous to pheL.

[0340] Embodiment 94: The method of Embodiment 93, comprising administering to the mammal a genetically modified bacterium having a mutation in pheL.

[0341] Embodiment 95: A pharmaceutical composition for treating ASD in a mammal comprising the genetically modified bacterium identified in any one of Embodiments 32 to 38 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.

[0342] Embodiment 96: The pharmaceutical composition of Embodiment 95, comprising the genetically modified bacterium identified in any one of Embodiments 32 to 38.

[0343] Embodiment 97: A pharmaceutical composition for treating ASD in a mammal comprising a genetically modified bacterium having a mutation in potA, ymfI, or agaB or a gene homologous to potA, ymfI, or agaB, and a pharmaceutically acceptable carrier.

[0344] Embodiment 98: The pharmaceutical composition of Embodiment 97, comprising a genetically modified bacterium having a mutation in potA, ymfI, or agaB.

[0345] Embodiment 99: A method of treating ASD in a mammal comprising administering to the mammal the genetically modified bacterium identified in any one of Embodiments 32 to 38 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.

[0346] Embodiment 100: The method of Embodiment 99, comprising administering to the mammal the genetically modified bacterium identified in any one of Embodiments 32 to 38.

[0347] Embodiment 101: A method of treating ASD in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in potA, ymfI, or agaB or a gene homologous to potA, ymfI, or agaB.

[0348] Embodiment 102: The method of Embodiment 101, comprising administering to the mammal a genetically modified bacterium having a mutation in potA, ymfI, or agaB.

[0349] Embodiment 103: The pharmaceutical composition of any one of Embodiments 59, 60, 63 to 66, 71 to 74, 79 to 82, 87 to 90, and 95 to 98 or the method of any one of Embodiments 61, 62, 67 to 70, 75 to 78, 83 to 86, 91 to 94, and 99 to 102, wherein the bacterium is a gram-positive bacterium or a gram-negative bacterium.

[0350] Embodiment 104: The pharmaceutical composition or the method of Embodiment 103, wherein the bacterium is a gram-positive bacterium.

[0351] Embodiment 105: The pharmaceutical composition or the method of Embodiment 103, wherein the bacterium is a gram-negative bacterium.

[0352] Embodiment 106: The pharmaceutical composition or the method of Embodiment 103, wherein the bacterium is a bacterium existing in the human microbiota.

[0353] Embodiment 107: The pharmaceutical composition or the method of claim 103, wherein the bacterium is E. coli or B. subtilis.

[0354] Embodiment 108: The pharmaceutical composition or the method of Embodiment 103, wherein the bacterium is Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, Fusobacteria or Verrucomicrobia.

[0355] Embodiment 109: The pharmaceutical composition or the method of Embodiment 108, wherein the bacterium is Faecalibacterium, Clostridium, Ruminococcus, Ruthenibacterium, Lactobacillus, Lacticaseibacillus, Limosilactobacilli, Enterococcus, Staphylococcus, Eubacterium, Streptococcus, Bacillus, Pediococcus, Leuconostoc or Lactococcus.

[0356] Embodiment 110: The pharmaceutical composition or the method of Embodiment 109, wherein the bacterium is F. prausnitzii, C. butyricum, C. beijerinckii, R. faecis, R. bromii, R. lactatiformans, L. reuteri, L. delbrueckii, L. acidophilus, L. helveticus, L. casei, L. paracasei, L. rhamnosus, L. reuteri, L. fermentum, E. faecium, E. faecalis, S. xylosus, S. carnosus, S. vitulinus, E. rectale, S. parasanguinis, S. thermophilus, B. cereus, B. coagulans, P. acidilactici, P. pentosaceus, L. mesenteroides, L. lactis, or L. cremoris.

[0357] Embodiment 111: The pharmaceutical composition or the method of Embodiment 108, wherein the bacterium is Bacteroides, Prevotella or Parabacteroides.

[0358] Embodiment 112: The pharmaceutical composition or the method of Embodiment 111, wherein the bacterium is B. fragilis, B. vulgatus, B. uniformis, P. copri, or P. distasonis.

[0359] Embodiment 113: The pharmaceutical composition or the method of Embodiment 108, wherein the bacterium carrying a homologous gene mutation is Bifidobacterium, Corynebacterium, Propionibacterium or Acidipropionibacterium.

[0360] Embodiment 114: The pharmaceutical composition or the method of Embodiment 113, wherein the bacterium is B. longum, B. bifidum, B. breve, B. adolescentis, B. animalis, C. accolens, P. freudenreichii, or A. acidipropionici.

[0361] Embodiment 115: The pharmaceutical composition or the method of Embodiment 108, wherein the bacterium carrying a homologous gene mutation is Fusobacterium.

[0362] Embodiment 116: The pharmaceutical composition or the method of Embodiment 115, wherein the bacterium carrying a homologous gene mutation is F. nucleatum.

[0363] Embodiment 117: The pharmaceutical composition or the method of Embodiment 108, wherein the bacterium carrying a homologous gene mutation is Akkermansia.

[0364] Embodiment 118: The pharmaceutical composition or the method of Embodiment 117, wherein the bacterium carrying a homologous gene mutation is A. muciniphila. 6.8 Experimental

[0365] The examples provided below are for purposes of illustration only, which are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teachings provided herein.

[0366] Briefly, studies described illustrate development of various nematodes models for hereditary diseases and metabolic diseases and uses thereof to identify genetically modified bacterium with therapeutic potential for such diseases. Studies verifying such therapeutic potential in mouse models are also described. 6.8.1 Example 1: General procedures

[0367] Preparation of culture plates with single gene mutant bacteria: Autoclaved NGM (Nematode Growth Medium) agar medium was prepared. 3 mL NGM was aliquoted into 3 cm sterile petri dishes on an ultra-clean table. Single gene mutant Bacillus subtilis from 96-well plates (solid LB) was inoculated into 1 mL autoclaved LB liquid medium in a sterile manner and grown overnight in a shaker at 220 rpm at 37℃. 100μL of bacterial solution was then added to the petri dish with NGM agar medium, and the excess water in the bacterial solution was evaporated by blowing for 0.5 to 1 hour on an ultra-clean table.

[0368] The bacteria library was commercially available, purchased from Addgene, and Dharmacon, etc. References: E. coli non-essential gene library: Bara et al., 2006 (PMID: 16738554) and B. subtilis essential gene library: Peters et al., 2016 (PMID: 27238023) .

[0369] Preparation of synchronized sterile nematodes: As a large number of eggs appeared on the culture plates for nematodes, both nematodes and eggs were collected. First, the nematodes and eggs were washed with sterile water and collected into sterile centrifuge tubes, repeated once to ensure that all the nematodes and eggs on the plates were collected. Then, the tubes were centrifuged at 3000 rpm for 1 min, and the supernatant was discarded. 5 mL lysis buffer (30 mL H2O, 4 mL NaOH, 5 mL commercial bleach) was added into the centrifuge tubes, which were then capped and shaken vigorously for about 50 times, and then centrifuged at 3000 rpm for 30 s. The procedure was repeated once until no intact nematode was observed under the microscope. The tubes were washed with 10 mL sterile water, centrifuged at 3000 rpm for 30 s, and the supernatant was discarded, and the wash was repeated twice. 10 mL M9 solution (a buffering solution commonly used in laboratories, containing KH2PO4, Na2HPO4, NaCl, and MgSO4 in water with a pH 7.2) was added, and the tubes were centrifuged at 3000 rpm for 30 s and the supernatant was discarded, which was repeated once. Finally, 5 mL M9 solution was added, and the resulting mixture was incubated with rotation at 20℃for 24 to 48 hours.

[0370] Screening: Synchronized nematodes were added to the NGM plates with bacteria and incubated at 20℃. Phenotype was measured at the first day of adulthood. Bright field microscopy, fluorescence microscopy or stimulated Raman scattering (SRS) microscopy was used depending on the phenotype to be measured in the nematode model. An agar-padded slide (2%Agarose) was prepared, and the anesthetic (10 mM levamisole solution) was dropped in the center of the cover slide. The nematodes were transferred to the anesthetic on the cover slide. After the nematodes were anesthetized, the slide was covered, and photographs were taken. Depending on the nature of the data, the results were analyzed using the appropriate statistic method, and a difference of p<0.05 was considered significant.

[0371] Mice Maintenance: Mice were maintained in the animal facility at the Children’s Hospital of Fudan University under specific pathogen-free conditions. The temperature was kept at 22± 0.5℃with a relative humidity of 30-70%, and the dark / light cycle was 12h: 12h. After weaning, mice with different genotypes were housed separately. 6.8.2 Example 2: Identification and verification of genetically modified bacteria for  treating Type I Diabetes

[0372] To screen for genetically modified bacteria with therapeutic potential for treating Type I Diabetes in a mammal, transgenic C. elegans Is [ins-1p: : GFP] were generated, which contained a nucleic acid encoding a green fluorescent protein driven by the insulin promoter (ins-1p) . As such, the strength of the fluorescent signal in the nematodes could indicate the transcriptional activity of the insulin promoter.

[0373] The B. subtilis Essential Gene Knockdown Library was used in the screening according to methods described above. Nematodes were screened for enhanced fluorescence signals (stronger signal at particular sites and / or additional sites with signals) , and bacteria associated with the enhanced fluorescence signals were identified. As shown in FIG. 1, B. subtilis with mutation in acpP, asd, or metS significantly enhanced fluorescence signals, indicating that these mutant bacteria could potentially enhance insulin production in mammals.

[0374] For verification, mouse models for Type I Diabetes, including e.g., Non-Obese Diabetic (NOD) Mouse can be used. B. subtilis with mutation in acpP, asd, or metS are administered to the mice by daily gastric gavage for about 1-3 months. Blood insulin level and glucose level of the mice are monitored. Mice administered with B. subtilis with mutation in acpP, asd, or metS are expected to have increased insulin and reduced glucose levels compared to those administered with control wildtype bacteria. 6.8.3 Example 3: Identification and verification of genetically modified bacteria for  treating lipid metabolism disorders

[0375] To screen for genetically modified bacteria with therapeutic potential for treating lipid metabolism disorders in a mammal, wildtype C. elegans and the B. subtilis Essential Gene Knockdown Library was used in the screening according to methods described above. Total fat levels stored in the intestine of the nematodes were measured by SRS microscopy.

[0376] Nematodes were screened for significant changes in the total fat levels stored in intestine. As shown in FIG. 2, dapH mutant significantly decreased the fat level, indicating that dapH mutant bacteria could potentially reduce fat storage in mammals, whereas racE mutant significantly increased the fat level, indicating that racE mutant bacteria could potentially increase fat storage in mammals.

[0377] The therapeutic potential of both mutant bacteria was verified in mice. C57BL / 6 mice, 6 weeks old, male, were purchased from Shanghai Jessie Laboratory Animal Co., Ltd. and used in this study. Specifically, mice were randomly divided into groups after 7 days of adaptation in a pathogen-free grade animal house. Mice had free access to SPF grade feed and water. The control bacteria (B. subtilis with no sgRNA) and the mutants with sgRNAs of target genes dapH and race, respectively, were prepared by culturing overnight in LB medium supplemented with 1%xylose with shaking. Then, mice were administered with 200μl bacteria culture (CFU about 109 / ml) by stomach gavage once a day for 9 days before their body fat distribution was measured using Quantum GX2 Micro-CT small animal in vivo imaging system. Specifically, the fat content in epididymis, subcutaneous and abdominal cavity of each study mice were measured, the distribution of fat content was observed quantified and subject to 3D image reconstruction.

[0378] As shown in FIG. 3, a slight decrease in fat content was observed in the mice treated with control bacteria (likely caused by experimental manipulation and stress) . Compared to the control, dapH mutant B. subtilis significantly decreased the fat storage while racE mutant significantly increased the fat storage in mice. The results were consistent with the results obtained in nematodes, confirming that the microbiome-based treatment identified in nematodes was also therapeutically effective in treating mammals. 6.8.4 Example 4: Identification and verification of genetically modified bacteria for  treating idiopathic short stature (ISS)

[0379] To screen for genetically modified bacteria with therapeutic potential for treating idiopathic short stature (ISS) in a mammal, a C. elegans with mutation in sma-6 (wk7) were generated. Mutations in BMP receptor genes were known to be associated with limb dysplasia and dwarfism in mammals, and mutations in the C. elegans homolog gene sma-6 caused severe shortening of the body length of larvae.

[0380] As such, by monitoring their impact on the body length of C. elegans, mutant bacteria that could potentially ameliorate ISS were identified.

[0381] The B. subtilis Essential Gene Knockdown Library was used in the screening according to methods described above. Nematodes with sma-6 (wk7) mutation were screened for restoration in body length. As shown in FIG. 4, accA and coaBC mutants significantly increased the body length of the C. elegans, respectively, even restoring it to the wildtype level.

[0382] For verification, a mouse model for ISS is generated with a mutation in the BMP receptor gene (e.g., BMPR1A or BMPRIB) and used to confirm the therapeutic potential of the mutant bacterial strains identified in the study discussed above. B. subtilis with mutation in accA or coaBC are administered to the mice by daily gastric gavage for about 1-3 months. The body length, limb length, and limb morphology of the mice are monitored. Mice administered with B. subtilis with mutation in accA or coaBC are expected to have increased body length, increased limb length, and improved limb morphology compared to those administered with control wildtype bacteria. 6.8.5 Example 5: Identification and verification of genetically modified bacteria for  treating polyglutamine diseases

[0383] Many neurodegenerative diseases such as Huntington’s disease are caused by polyglutamine protein (polyQ) aggregation-induced neurotoxicity. To screen for genetically modified bacteria with therapeutic potential for treating such polyQ diseases in a mammal, a transgenic C. elegans Is [unc-54p: : Q40: : YFP] was generated, which overexpressed a polyQ (40 glutamine residues) tagged fluorescent protein. As such, the amount of polyQ aggregates could be monitored in situ by monitoring the strength and aggregation of the fluorescent signals in the nematodes.

[0384] An E. Coli knockout library containing a set of single-gene deletions for all non-essential genes in E. Coli was used in the screening according to methods described above. Nematodes were screened for reduced fluorescence signals and / or reduced aggregation of fluorescence signals, and bacteria resulted in such reduction were identified. As shown in FIG. 5, pheL mutant significantly reduced the aggregation of fluorescence signals.

[0385] For verification, a mouse model for polyglutamine diseases (e.g., R6 / 2 mouse model, and N171-82Q mouse model) can be used. E. coli with mutation in pheL are administered to the mice by daily gastric gavage for about 1-3 months. The mice are monitored for progression of polyglutamine diseases by available assays for measuring, for example, motor function and neurological symptoms. Mice administered with E. coli with mutation in pheL are expected to have slower or reversed progression of the polyglutamine disease compared to those administered with control wildtype bacteria. 6.8.6 Example 6: Identification and verification of genetically modified bacteria for  treating autism spectrum disorders (ASD)

[0386] Chd8 was known to be closely associated with the development of ASD in mammals. To screen for genetically modified bacteria with therapeutic potential for treating ASD in a mammal, C. elegans with deletion in an allele of chd-7 gene, a homolog of Chd8, were generated. The deletion of chd-7 (gk290) decreased the involuntary pharyngeal pumping rate in C. elegans, whereas the deletion of chd-7 (gk306) increased the involuntary pharyngeal pumping rate in C. elegans.

[0387] As such, by monitoring their impact on the involuntary pharyngeal pumping rate in C. elegans, mutant bacteria that could potentially ameliorate ASD were identified.

[0388] An E. coli knockout library containing a set of single-gene deletions for all non-essential genes in E. coli was used in the screening according to methods described above. Nematodes with chd-7 (gk290) or chd-7 (gk306) mutation were screened for restoration of involuntary pharyngeal pumping rate to normal level. Mutant bacteria that reduced or eliminated the difference in pharyngeal pumping rates between the two nematode mutants were identified.

[0389] As shown in FIG. 6, E. coli with mutation in potA, ymfl or agaB mutants significantly reduced the difference in pharyngeal pumping rate between the two nematode mutants, indicating their therapeutic potential in correcting neurological diseases caused Chd8 mutation, such as ASD.

[0390] The therapeutic potential of agaB mutant bacteria was further verified in mice. The Chd8 mutant mouse model was established by Cyagen Biosciences Inc (Guangzhou, China) . Briefly, two single guide RNAs targeting Chd8 exons were designed: gRNA-A1: ATATAATGCCTCCTGCTCTGAGG (SEQ ID NO: 1) ; gRNA-A2: GCAGCTCTCTTATATGGAGGTGG (SEQ ID NO: 2) . Cas9 mRNA and gRNA were injected into mouse zygotes (C57BL / 6J) . The mice of generation F0 were genotyped by PCR followed by DNA sequencing analysis. The mouse carrying a 1163 bp deletion was selected as the founder and was imported to the animal facility at the Children’s Hospital of Fudan University. The founder was crossed with wild-type female mice to generate F1 mice. All F1 mice were genotyped by PCR and male mice carrying the desired mutations were kept and crossed with wild-type female mice to generate F2 mice. F2 and other generations of mice were genotyped with PCR primers specific for the 1163 bp deletion allele. To genotype offspring, genomic PCR of tail DNA was performed with forward 5'-TTTAGGAACAGGCTGTCTCATGG-3' (SEQ ID NO: 3) and reverse 5'-CTCTGAGGAGCAAATAACAGAGATGAA-3' (SEQ ID NO: 4) primers.

[0391] E. coli BW 25113, the parent strain, was used as control. E. coli BW 25113 and E. coli agaB mutant with ampicillin resistance were stored at-80℃until use. Before gastric gavage, monoclonal colonies on LB plate were picked and inoculated into 3 mL of LB liquid with ampicillin and cultured for 12 h at 220 rpm on 37℃shaking table. After weaning, mice were separated such as each cage had the same genotype and were treated with the same bacteria. 28 days after birth, mice were administered with 0.1 mL freshly cultured bacterial liquid by stomach gavage, and then once every 72 h until the mice were evaluated for behavior at 8-9 weeks of age. As shown in FIG. 7, the mice were allowed to choose between familiar and unfamiliar (previously unmet) individuals, and the communication time between the mice was recorded by video. Social preference index, calculated according to the formula below, was assessed, which positively correlated with social willingness and ability.

[0392] Social preference index= (Tunfamiliar–Tfamiliar)  /  (Tunfamiliar+Tfamiliar)

[0393] As shown in FIG. 8, compared to wildtype mice, those with Chd8 mutant had a significantly lower social preference index, which was almost completely corrected in the same mutant mice treated with agaB mutant E. coli, confirming that the agaB mutant E. coli identified in the C. elegans model effectively ameliorated the autistic symptoms in mouse model.

[0394] As such, studies described above have demonstrated the generation of C. elegans models for human diseases and efficient screening method and system for identifying microbiome-based treatment using such models. Therapeutic effects of some treatments were also confirmed in mouse models.

[0395] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

Claims

1.A method of screening for a genetically modified bacterium for treating a hereditary disease or metabolic disease in a mammal, comprising:(1) feeding a plurality of nematodes on a library of genetically modified bacteria; wherein the nematodes provide a model for the hereditary disease or metabolic disease; and(2) identifying the genetically modified bacterium that affects a disease-related phenotype in the nematode model.2.The method of claim 1, wherein the nematodes are Caenorhabditis elegans.3.The method of claim 1 or 2, wherein the nematodes are genetically modified.4.The method of claim 3, wherein the genetic modification of the nematodes comprises overexpression, mutation or deletion of an endogenous gene, or expression of an exogenous gene.5.The method of claim 3, wherein the genetic modification of the nematodes comprises mutation of an endogenous gene.6.The method of any one of claims 1 to 5, further comprising (0) generating a nematode model for the hereditary disease or metabolic disease.7.The method of claim 6, wherein step (0) comprises identifying a measurable disease-related phenotype in nematode.8.The method of claim 6, wherein the hereditary disease or metabolic disease is caused by a gene mutation, and step (0) comprises identifying a nematode homolog of the disease-causing gene in mammals and generating a nematode with a mutation in the homologous gene and measurable disease-related phenotype.9.The method of any one of claims 1 to 8, further comprising (3) verifying that the genetically modified bacterium treats the disease in a mammal.10.The method of claim 9, wherein step (3) comprises administering the genetically modified bacterium to the mammal having the disease and monitoring the disease in the mammal.11.The method of claim 9 or 10, wherein the mammal is mouse.12.The method of any one of claims 1 to 11, wherein the bacteria are E. coli.13.The method of any one of claims 1 to 11, wherein the bacteria are B. subtilis.14.The method of any one of claims 1 to 13, wherein the library is a single gene mutation library.15.The method of claim 14, wherein the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library.16.The method of any one of claims 1 to 15, wherein the hereditary disease or metabolic disease is Type I diabetes, a lipid metabolism disorder, idiopathic short stature (ISS) , a polyglutamine disease, or autism spectrum disorder (ASD) .17.A method of screening for a genetically modified bacterium for treating Type I diabetes in a mammal, comprising:(1) feeding a plurality of nematodes on a library of genetically modified bacteria; and(2) identifying the genetically modified bacterium that activates insulin expression in the nematode.18.The method of claim 17, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein driven by promoter for ins-1 (ins-1p) and step (2) comprises identifying the genetically modified bacterium that enhances florescent signal in the nematode.19.The method of claim 17 or 18, further comprising (3) verifying that the genetically modified bacterium treats Type I diabetes in a mammal.20.The method of claim 19, wherein step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its insulin expression.21.A method of screening for a genetically modified bacterium for treating a lipid metabolism disorder in a mammal, comprising:(1) feeding a plurality of nematodes on a library of genetically modified bacteria; and(2) identifying the genetically modified bacterium that increases or decreases the lipid storage in the nematodes.22.The method of claim 21, further comprising (3) verifying that the genetically modified bacterium affects lipid metabolism in a mammal.23.The method of claim 21 or 22, wherein step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its lipid storage.24.A method of screening for a genetically modified bacterium for treating ISS in a mammal, comprising:(1) feeding a plurality of nematodes on a library of genetically modified bacteria, wherein the nematodes comprise a mutation in sma-6; and(2) identifying the genetically modified bacterium that restores the shortened body length in the nematode.25.The method of claim 24, further comprising (3) verifying that the genetically modified bacterium treats ISS in a mammal.26.The method of claim 24 or 25, wherein step (3) comprises administering the genetically modified bacterium to a mouse with mutation in BMPR1A or BMPRIB and monitoring its body length, limb length, or limb morphology, or any combination thereof.27.The method of claim 26, wherein step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its body length and / or limb length.28.The method of claim 26, wherein step (3) comprises administering the genetically modified bacterium to a mouse and monitoring its limb morphology.29.A method of screening for a genetically modified bacterium for treating a polyglutamine disease in a mammal, comprising:(1) feeding a plurality of nematodes with a library of genetically modified bacteria, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein tagged with multiple glutamine residues and(2) identifying the genetically modified bacterium that reduces aggregated fluorescent signals in the nematode.30.The method of claim 29, further comprising (3) verifying that the genetically modified bacterium treats polyglutamine disease in a mammal.31.The method of claim 30, wherein step (3) comprises administering the genetically modified bacterium to a mouse model for polyglutamine disease and monitoring disease progression.32.A method of screening for a genetically modified bacterium for treating ASD in a mammal, comprising:(1) feeding a plurality of nematodes with a library of genetically modified bacteria, wherein the nematodes comprise a deletion of an allele of chd-7; and(2) identifying the genetically modified bacterium that restores the pharyngeal pumping rate in the nematode.33.The method of claim 32, wherein the nematodes comprise a deletion of chd-7 (gk290) .34.The method of claim 32, wherein the nematodes comprise a deletion of chd-7 (gk306) .35.The method of claim 32, wherein the nematodes comprise a first group having a deletion of chd-7 (gk290) and a second group having a deletion of chd-7 (gk306) .36.The method of claim 32, wherein the pharyngeal pumping rate in the nematode is restored to normal level.37.The method of any one of claims 32 to 36, further comprising (3) verifying that the genetically modified bacterium treats ASD in a mammal.38.The method of claim 37, wherein step (3) comprises administering the genetically modified bacterium to a mouse with Chd8mutation and monitoring its social behavior.39.The method of any one of claims 17 to 38, wherein the nematodes are C. elegans.40.The method of any one of claims 17 to 39, wherein the bacteria are E. coli.41.The method of any one of claims 17 to 39, wherein the bacteria are B. subtilis.42.The method of any one of claims 17 to 41, wherein the library is a single gene mutation library.43.The method of claim 42, wherein the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library.44.A system for screening for a genetically modified bacterium for treating a hereditary disease or metabolic disease in a mammal, comprising: a plurality of nematodes that provide a model for the genetic disease or metabolic disease and a library of genetically modified bacteria.45.The system of claim 44, wherein the nematodes are C. elegans.46.The system of claim 44 or 45, further comprising a mammal that provides a model for the genetic disease or metabolic disease.47.The system of claim 46, wherein the mammal is mouse.48.The system of any one of claims 44 to 47, wherein the bacteria are E. coli.49.The system of any one of claims 44 to 47, wherein the bacteria are B. subtilis.50.The system of any one of claims 44 to 49, wherein the library is a single gene mutation library.51.The system of claim 50, wherein the library is a single gene deletion library, a single gene repression library, or a single gene overexpression library.52.The system of any one of claims 44 to 51, wherein the nematodes are genetically modified.53.The system of claim 52, wherein the genetic modification of the nematodes comprises overexpression, mutation or deletion of an endogenous gene, or expression of an exogenous gene.54.The system of claim 53, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein driven by promoter for ins-1 (ins-1p) .55.The system of claim 53, wherein the nematodes comprise a mutation in sma-6 (wk7) .56.The system of claim 53, wherein the nematodes comprise a deletion of an allele of chd-7.57.The system of claim 53, wherein the nematodes comprise an exogenous nucleic acid encoding a fluorescent protein tagged with multiple glutamine residues.58.The system of any one of claims 44 to 57, wherein the hereditary disease or metabolic disease is Type I diabetes, a lipid metabolism disorder, idiopathic short stature (ISS) , a polyglutamine disease, or autism spectrum disorder (ASD) .59.A pharmaceutical composition for treating a hereditary disease or metabolic disease in a mammal comprising the genetically modified bacterium identified in any of claims 1 to 16 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.60.The pharmaceutical composition of claim 59, comprising the genetically modified bacterium identified in any of claims 1 to 16.61.A method of treating a hereditary disease or metabolic disease in a mammal comprising administering to the mammal the genetically modified bacterium identified in any of claims 1 to 16 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.62.The method of claim 61, comprising administering to the mammal the genetically modified bacterium identified in any of claims 1 to 16.63.A pharmaceutical composition for treating Type I diabetes in a mammal comprising the genetically modified bacterium identified in any one of claims 17 to 20 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.64.The pharmaceutical composition of claim 63, comprising the genetically modified bacterium identified in any one of claims 17 to 20.65.A pharmaceutical composition for treating Type I diabetes in a mammal comprising a genetically modified bacterium having a mutation in acpP, asd, or metS or a gene homologous to acpP, asd, or metS, and a pharmaceutically acceptable carrier.66.The pharmaceutical composition of claim 65, comprising a genetically modified bacterium having a mutation in acpP, asd, or metS.67.A method of treating Type I diabetes in a mammal comprising administering to the mammal the genetically modified bacterium identified in any one of claims 17 to 20 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.68.The method of claim 67, comprising administering to the mammal the genetically modified bacterium identified in any one of claims 17 to 20.69.A method of treating Type I diabetes in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in acpP, asd, or metS or a gene homologous to acpP, asd, or metS.70.The method of claim 69, comprising administering to the mammal a genetically modified bacterium having a mutation in acpP, asd, or metS.71.A pharmaceutical composition for treating a lipid metabolism disorder in a mammal comprising the genetically modified bacterium identified in any one of claims 21 to 23 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.72.The pharmaceutical composition of claim 71, comprising the genetically modified bacterium identified in any one of claims 21 to 23.73.A pharmaceutical composition for treating a lipid metabolism disorder in a mammal comprising a genetically modified bacterium having a mutation in dapH or racE or a gene homologous to dapH or racE, and a pharmaceutically acceptable carrier.74.The pharmaceutical composition of claim 73, comprising a genetically modified bacterium having a mutation in dapH or racE.75.A method of treating a lipid metabolism disorder in a mammal comprising administering to the mammal the genetically modified bacterium identified in claims 21 to 23 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.76.The method of claim 75, comprising administering to the mammal the genetically modified bacterium identified in claims 21 to 23.77.A method of treating a lipid metabolism disorder in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in dapH or racE or a gene homologous to dapH or racE.78.The method of claim 77, comprising administering to the mammal a genetically modified bacterium having a mutation in dapH or racE.79.A pharmaceutical composition for treating ISS in a mammal comprising the genetically modified bacterium identified in any one of claims 24 to 28 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.80.The pharmaceutical composition of claim 79, comprising the genetically modified bacterium identified in any one of claims 24 to 28.81.A pharmaceutical composition for treating ISS in a mammal comprising a genetically modified bacterium having a mutation in accA or coaBC or a gene homologous to accA or coaBC, and a pharmaceutically acceptable carrier.82.The pharmaceutical composition of claim 81, comprising a genetically modified bacterium having a mutation in accA or coaBC.83.A method of treating ISS in a mammal comprising administering to the mammal the genetically modified bacterium identified in any one of claims 24 to 28 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.84.The method of claim 83, comprising administering to the mammal the genetically modified bacterium identified in any one of claims 24 to 28.85.A method of treating ISS in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in accA or coaBC or a gene homologous to accA or coaBC.86.The method of claim 85, comprising administering to the mammal a genetically modified bacterium having a mutation in accA or coaBC.87.A pharmaceutical composition for treating a polyglutamine disease in a mammal comprising the genetically modified bacterium identified in any one of claims 29 to 31 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.88.The pharmaceutical composition of claim 87, comprising the genetically modified bacterium identified in any one of claims 29 to 31.89.A pharmaceutical composition for treating a polyglutamine disease in a mammal comprising a genetically modified bacterium having a mutation in pheL or a gene homologous to pheL, and a pharmaceutically acceptable carrier.90.The pharmaceutical composition of claim 89, comprising a genetically modified bacterium having a mutation in pheL.91.A method of treating a polyglutamine disease in a mammal comprising administering to the mammal the genetically modified bacterium identified in any one of claims 29 to 31 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.92.The method of claim 91, comprising administering to the mammal the genetically modified bacterium identified in any one of claims 29 to 31.93.A method of treating a polyglutamine disease in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in pheL or a gene homologous to pheL.94.The method of claim 93, comprising administering to the mammal a genetically modified bacterium having a mutation in pheL.95.A pharmaceutical composition for treating ASD in a mammal comprising the genetically modified bacterium identified in any one of claims 32 to 38 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium, and a pharmaceutically acceptable carrier.96.The pharmaceutical composition of claim 95, comprising the genetically modified bacterium identified in any one of claims 32 to 38.97.A pharmaceutical composition for treating ASD in a mammal comprising a genetically modified bacterium having a mutation in potA, ymfI, or agaB or a gene homologous to potA, ymfI, or agaB, and a pharmaceutically acceptable carrier.98.The pharmaceutical composition of claim 97, comprising a genetically modified bacterium having a mutation in potA, ymfI, or agaB.99.A method of treating ASD in a mammal comprising administering to the mammal the genetically modified bacterium identified in any one of claims 32 to 38 or a bacterium having a mutation in a gene homologous to the modified gene in the identified bacterium.100.The method of claim 99, comprising administering to the mammal the genetically modified bacterium identified in any one of claims 32 to 38.101.A method of treating ASD in a mammal comprising administering to the mammal a genetically modified bacterium having a mutation in potA, ymfI, or agaB or a gene homologous to potA, ymfI, or agaB.102.The method of claim 101, comprising administering to the mammal a genetically modified bacterium having a mutation in potA, ymfI, or agaB.103.The pharmaceutical composition of any one of claims 59, 60, 63 to 66, 71 to 74, 79 to 82, 87 to 90, and 95 to 98 or the method of any one of claims 61, 62, 67 to 70, 75 to 78, 83 to 86, 91 to 94, and 99 to 102, wherein the bacterium is a gram-positive bacterium or a gram-negative bacterium.104.The pharmaceutical composition or the method of claim 103, wherein the bacterium is a Gram-positive bacterium.105.The pharmaceutical composition or the method of claim 103, wherein the bacterium is a Gram-negative bacterium.106.The pharmaceutical composition or the method of claim 103, wherein the bacterium is a bacterium existing in the human microbiota.107.The pharmaceutical composition or the method of claim 103, wherein the bacterium is E. coli or B. subtilis.108.The pharmaceutical composition or the method of claim 103, wherein the bacterium is Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, Fusobacteria or Verrucomicrobia.109.The pharmaceutical composition or the method of claim 108, wherein the bacterium is Faecalibacterium, Clostridium, Ruminococcus, Ruthenibacterium, Lactobacillus, Lacticaseibacillus, Limosilactobacilli, Enterococcus, Staphylococcus, Eubacterium, Streptococcus, Bacillus, Pediococcus, Leuconostoc or Lactococcus.110.The pharmaceutical composition or the method of claim 109, wherein the bacterium is F. prausnitzii, C. butyricum, C. beijerinckii, R. faecis, R. bromii, R. lactatiformans, L. reuteri, L. delbrueckii, L. acidophilus, L. helveticus, L. casei, L. paracasei, L. rhamnosus, L. reuteri, L. fermentum, E. faecium, E. faecalis, S. xylosus, S. carnosus, S. vitulinus, E. rectale, S. parasanguinis, S. thermophilus, B. cereus, B. coagulans, P. acidilactici, P. pentosaceus, L. mesenteroides, L. lactis, or L. cremoris.111.The pharmaceutical composition or the method of claim 108, wherein the bacterium is Bacteroides, Prevotella or Parabacteroides.112.The pharmaceutical composition or the method of claim 111, wherein the bacterium is B. fragilis, B. vulgatus, B. uniformis, P. copri, or P. distasonis.113.The pharmaceutical composition or the method of claim 108, wherein the bacterium carrying a homologous gene mutation is Bifidobacterium, Corynebacterium, Propionibacterium or Acidipropionibacterium.114.The pharmaceutical composition or the method of claim 113, wherein the bacterium is B. longum, B. bifidum, B. breve, B. adolescentis, B. animalis, C. accolens, P. freudenreichii, or A. acidipropionici.115.The pharmaceutical composition or the method of claim 108, wherein the bacterium carrying a homologous gene mutation is Fusobacterium.116.The pharmaceutical composition or the method of claim 115, wherein the bacterium carrying a homologous gene mutation is F. nucleatum.117.The pharmaceutical composition or the method of claim 108, wherein the bacterium carrying a homologous gene mutation is Akkermansia.118.The pharmaceutical composition or the method of claim 117, wherein the bacterium carrying a homologous gene mutation is A. muciniphila.