Tetracyclic compounds and uses thereof

Abstract

The present invention relates to a tetracyclic compound and its use. The compound of the present invention has a significantly better therapeutic effect on tumors with low expression, no expression, low activation or inactivation of mitochondrial permeability transition pore, low expression, no expression, low activation or inactivation of peptidylprolyl isomerase F, low expression or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of NNMT gene and / or hypermethylation of DNA CpG sites in NNMT gene region. The present invention provides a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof. JPEG2025509621000059.jpg80147

Description

[Technical field]

[0001] The present invention relates to the field of medicine, in particular to tetracyclic compounds and their uses. [Background technology]

[0002] Tumors, as a common disease that seriously endangers the health of mankind, have also brought about a constant upward trend in the mortality rate of malignant tumors. Due to the heterogeneity of tumors, simply using the same treatment or the same drug according to their origin and pathological characteristics will easily cause problems caused by inappropriate treatment, which will delay the important treatment time and opportunity for patients. Therefore, there seems to be a great need to adopt precision treatment for various tumor situations. With the development of biological technology, tumors have a continuous genotype distribution at the molecular level of genes and proteins, and changes in the expression and activity of tumor-related genes and proteins have been discovered one after another, and the changes in the expression and activity of tumor-related genes and proteins play an important role in the development of malignant tumors. The discovery and application of biomarkers provides precise guidance for the application of related drugs and enables precision treatment of tumors, thereby achieving targeted dosing, greatly improving the therapeutic effect, and reducing the drug dosage and toxic side effects.

[0003] Therefore, there is an urgent need in the art to develop drugs that can precisely treat tumors. Summary of the Invention [Problem to be solved by the invention]

[0004] The present invention aims to provide a compound having a significantly superior therapeutic effect against tumors with low, non-expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low, non-expression, low activity or inactivity of peptidyl prolyl isomerase F, tumors with low or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. [Means for solving the problem]

[0005] A first aspect of the present invention provides the use of a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, for the manufacture of a composition or formulation for use in the prevention and / or treatment of a tumor; [ka] Here, R1 and R2 each independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C3-C16 cycloalkyl group, a substituted or unsubstituted 3-12 membered heterocycloalkyl group, a substituted or unsubstituted C1-C16 halogenated alkyl group, a substituted or unsubstituted C3-C16 halogenated cycloalkyl group, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C10 alkyl group-, a substituted or unsubstituted 5-16 membered heteroaryl group-substituted or unsubstituted C1-C10 alkyl group-, or a substituted or unsubstituted C2-C10 alkenyl group-substituted or unsubstituted C1-C10 alkyl group-; R and R are each independently a hydrogen atom, R 16 -O- or R 16 -S- stands for; R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 and R 15each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a halogen atom; R9 and R 10 are linked to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring; R 16 represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group, or a substituted or unsubstituted C3-C16 cycloalkyl group.

[0006] In another preferred example, the heterocycloalkyl group, the heteroaryl group, and the heterocycloalkyl ring each independently have 1 to 4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S on the heterocycle.

[0007] In another preferred example, there are 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S on the heterocycle of the heterocycloalkyl group.

[0008] In another preferred example, there are 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S on the heterocyclic ring of the heteroaryl group.

[0009] In another preferred example, there are 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S on the heterocyclic ring of the heterocycloalkyl ring.

[0010] In another preferred embodiment, the optional "substitution" is one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C8 alkyl group, a C3-C12 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro It refers to being substituted by a substituent selected from a group consisting of a -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, and a 5-10 membered heterocycloalkyl group.

[0011] In another preferred embodiment, the optional "substitution" is one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C6 alkyl group, a C3-C10 cycloalkyl group, a C1-C6 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro It refers to being substituted by a substituent selected from a group consisting of a -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C6 alkoxyl group, a C1-C6 alkylthiol group, a C1-C6 halogenated alkoxyl group, a C1-C6 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, and a 5-10 membered heterocycloalkyl group.

[0012] In another preferred embodiment, the optional "substitution" is one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C4 alkyl group, a C3-C10 cycloalkyl group, a C1-C4 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro group ... It refers to being substituted by a substituent selected from a group consisting of a -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C4 alkoxyl group, a C1-C4 alkylthiol group, a C1-C4 halogenated alkoxyl group, a C1-C4 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, and a 5-10 membered heterocycloalkyl group.

[0013] In another preferred example, the optional "substitution" refers to one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or on the atomic group being each independently replaced by a substituent.

[0014] In another preferred embodiment, at least one of R1 and R2 does not represent a hydrogen atom.

[0015] In another preferred example, R1 represents a hydrogen atom and R2 does not represent a hydrogen atom.

[0016] In another preferred embodiment, R1 does not represent a hydrogen atom and R2 represents a hydrogen atom.

[0017] In another preferred example, neither R1 nor R2 represents a hydrogen atom.

[0018] In another preferred embodiment, R1 does not represent a hydrogen atom.

[0019] In another preferred embodiment, R2 does not represent a hydrogen atom.

[0020] In another preferred embodiment, R1 and R2 represent the same or different atomic groups.

[0021] In another preferred embodiment, R1 and R2 each independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C12 alkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group, a substituted or unsubstituted 3-12 membered heterocycloalkyl group, a substituted or unsubstituted C1-C12 halogenated alkyl group, a substituted or unsubstituted C3-C12 halogenated cycloalkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C8 alkyl group-, a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C8 alkyl group-, or a substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C8 alkyl group-.

[0022] In another preferred embodiment, R1 and R2 each independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, a substituted or unsubstituted 3-10 membered heterocycloalkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted C3-C10 halogenated cycloalkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C8 alkyl group-.

[0023] In another preferred embodiment, R1 and R2 each independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-8 membered heterocycloalkyl group, a substituted or unsubstituted C1-C6 halogenated alkyl group, a substituted or unsubstituted C3-C8 halogenated cycloalkyl group, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted C2-C6 alkenyl group-substituted or unsubstituted C1-C6 alkyl group-.

[0024] In another preferred embodiment, R1 and R2 each independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-6 membered heterocycloalkyl group, a substituted or unsubstituted C1-C6 halogenated alkyl group, a substituted or unsubstituted C3-C6 halogenated cycloalkyl group, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-.

[0025] In another preferred embodiment, R1 and R2 each independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-6 membered heterocycloalkyl group, a substituted or unsubstituted C1-C4 halogenated alkyl group, a substituted or unsubstituted C3-C6 halogenated cycloalkyl group, a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-.

[0026] In another preferred embodiment, R1 and R2 each independently represent a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C6 cycloalkyl group, a substituted or unsubstituted 3-8 membered heterocycloalkyl group, a substituted or unsubstituted C1-C2 halogenated alkyl group, a substituted or unsubstituted C3-C6 halogenated cycloalkyl group, a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C2 alkyl group-, or a substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-.

[0027] In another preferred example, R1 and R2 each independently represent a hydrogen atom, a substituted or unsubstituted methyl group, a substituted or unsubstituted ethyl group, a substituted or unsubstituted propyl group, a substituted or unsubstituted butyl group, a substituted or unsubstituted amyl group, a substituted or unsubstituted hexyl group, a substituted or unsubstituted heptyl group, a substituted or unsubstituted octyl group, a substituted or unsubstituted vinyl group-substituted or unsubstituted methyl group-, a substituted or unsubstituted vinyl group-substituted or unsubstituted ethyl group-, a substituted or unsubstituted halomethyl group, a substituted or unsubstituted cycloamyl group, or a substituted or unsubstituted cyclohexyl group.

[0028] In another preferred example, R1 and R2 each independently represent a hydrogen atom, a methyl group, an ethyl group, a propyl group, a butyl group, an amyl group, a hexyl group, a vinyl group-methyl group-, a vinyl group-ethyl group-, a halogenated methyl group, a cycloamyl group, or a cyclohexyl group.

[0029] In another preferred embodiment, the aryl group refers to a phenyl group.

[0030] In another preferred embodiment, the propyl group is an n-propyl group or an isopropyl group.

[0031] In another preferred embodiment, the propyl group is [ka]

[0032] In another preferred embodiment, the butyl group is an n-butyl group.

[0033] In another preferred embodiment, the butyl group is [ka]

[0034] In another preferred embodiment, the hexyl group is an n-hexyl group.

[0035] In another preferred embodiment, the hexyl group is [ka]

[0036] In another preferred embodiment, the chemical structure of the vinyl group-ethyl group is [ka]

[0037] In another preferred embodiment, the cycloamyl group is [ka]

[0038] In another preferred embodiment, the cyclohexyl group is [ka]

[0039] In another preferred example, the halogen atom is a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

[0040] In another preferred example, the halogenation refers to 1-position halogenation, 2-position halogenation, 3-position halogenation or full halogenation.

[0041] In another preferred embodiment, the halogenation refers to fluorination, chlorination, bromination or iodination.

[0042] In another preferred embodiment, the halogenated methyl group is trichloromethyl or trifluoromethyl.

[0043] In another preferred example, the deuteration refers to 1-position deuteration, 2-position deuteration, 3-position deuteration or full deuteration.

[0044] In another preferred embodiment, R and R are each independently a hydrogen atom, R 16 -O- or R 16 Represents -S-.

[0045] In another preferred embodiment, R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 and R 15 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a halogen atom.

[0046] In another preferred embodiment, R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 and R 15 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom.

[0047] In another preferred embodiment, R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 and R 15 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a halogen atom.

[0048] Another preferred example is R9 and R 10 are joined to form a substituted or unsubstituted 3-10 membered heterocycloalkyl ring.

[0049] Another preferred example is R9 and R 10 are joined to form a substituted or unsubstituted 3-8 membered heterocycloalkyl ring.

[0050] Another preferred example is R9 and R 10 are joined to form a substituted or unsubstituted 5-8 membered heterocycloalkyl ring.

[0051] Another preferred example is R9 and R 10 are joined to form a substituted or unsubstituted 5-7 membered heterocycloalkyl ring.

[0052] Another preferred example is R9 and R 10 are joined to form a substituted or unsubstituted 3-membered heterocycloalkyl ring, a substituted or unsubstituted 4-membered heterocycloalkyl ring, a substituted or unsubstituted 5-membered heterocycloalkyl ring, a substituted or unsubstituted 6-membered heterocycloalkyl ring, a substituted or unsubstituted 7-membered heterocycloalkyl ring, a substituted or unsubstituted 8-membered heterocycloalkyl ring, a substituted or unsubstituted 9-membered heterocycloalkyl ring, a substituted or unsubstituted 10-membered heterocycloalkyl ring, a substituted or unsubstituted 11-membered heterocycloalkyl ring, or a substituted or unsubstituted 12-membered heterocycloalkyl ring.

[0053] Another preferred example is R9 and R 10 is bonded to a substituted or unsubstituted [ka]

[0054] In another preferred embodiment, W 1 represents O or S.

[0055] In another preferred embodiment, W2 represents O or S.

[0056] Another favorable example is R 16 represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C12 alkyl group, or a substituted or unsubstituted C3-C12 cycloalkyl group.

[0057] Another favorable example is R 16 represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group.

[0058] Another favorable example is R 16 represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a substituted or unsubstituted C3-C8 cycloalkyl group.

[0059] Another favorable example is R 16 represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0060] Another favorable example is R 16 represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0061] Another favorable example is R 16 represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C2 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0062] Another favorable example is R 16 represents a hydrogen atom, a substituted or unsubstituted methyl group, a substituted or unsubstituted ethyl group, a substituted or unsubstituted propyl group, or a substituted or unsubstituted butyl group.

[0063] Another favorable example is R 16 represents a hydrogen atom or a methyl group.

[0064] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C8 alkyl group.

[0065] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group.

[0066] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C4 alkyl group.

[0067] In another preferred embodiment, the compound of formula I is optically inactive or optically active.

[0068] In another preferred embodiment, the compound of formula I does not have a chiral carbon atom or has a chiral carbon atom.

[0069] In another preferred embodiment, the compound of formula I has one chiral carbon atom.

[0070] In another preferred embodiment, the compound of formula I has the structure of a racemate, an R configuration, or an S configuration.

[0071] In another preferred embodiment, the chemical structure of the compound of formula I is as follows: [ka] Here, R1, R2, R3, R4, R5, R6, R7, R8, R9, R 10 , R 11 , R 12 , R 13 , R 14 sum R 15 are each independently as defined above.

[0072] In another preferred embodiment, "*" represents the structure of a compound.

[0073] In another preferred embodiment, "*" indicates that the compound is in the racemic, R or S configuration.

[0074] In another preferred embodiment, "*" represents a chiral carbon atom.

[0075] In another preferred embodiment, the structure of the chiral carbon atom is a racemate, an R-structure or an S-structure.

[0076] In another preferred embodiment, the structure of the chiral carbon atom is an R-structure and / or an S-structure.

[0077] In another preferred embodiment, the R-structure and S-structure of the chiral carbon atom refer to a racemic structure.

[0078] In another preferred embodiment, the chemical structure of the compound of formula I is as follows: [ka] Here, R1, R2, R3, R4, R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 , R 15 , R 17 , W1 and W2 are each independently as defined above.

[0079] In another preferred embodiment, the chemical structure of the compound of formula I is as follows: [ka] Here, R1, R2, R3, R4, R5, R6, R7, R8, R 11 , R 12 , R 13 , R 14 , R 15 , R 17 , W1, W2 and * are each independently as defined above.

[0080] In another preferred embodiment, the pharma- ceutically acceptable salts of the compounds of formula I include salts of the compounds of formula I formed with an acid.

[0081] In another preferred example, the acid comprises one or more of hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid.

[0082] In another preferred example, the pharma- ceutically acceptable salts of the compounds of formula I include salts formed by the compounds of formula I with one or more of hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid.

[0083] In another preferred embodiment, the pharma- ceutically acceptable salts of the compounds of formula I include salts formed by the compounds of formula I with hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, or glutamic acid.

[0084] In another preferred embodiment, the base of the pharma- ceutically acceptable salt of the compound of formula I is a phenyl group in which the acid is one H + This includes bases formed by loss of

[0085] In another preferred embodiment, the base of the pharma- ceutically acceptable salt of the compound of formula I is hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, or glutamic acid. + This includes bases formed by loss of

[0086] In another preferred embodiment, the base of the pharma- ceutically acceptable salt of the compound of formula I is - , Cl - , Br - , I - , H.C.O.O. - , CH3COO - , SO4 2- Or NO3 - Includes.

[0087] In another preferred embodiment, the chemical structure of the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is as follows: [ka] JPEG2025509621000014.jpg236154JPEG2025509621000015.jpg42154

[0088] In another preferred embodiment, the tumor is of human origin.

[0089] In another preferred embodiment, the tumor is a human tumor.

[0090] In another preferred embodiment, the tumor comprises a tumor in which the mitochondrial permeability transition pore is underexpressed, unexpressed, underactivated or inactivated.

[0091] In another preferred embodiment, the tumor comprises a tumor in which peptidyl prolyl isomerase F is underexpressed, not expressed, underactivated or inactivated.

[0092] In another preferred example, peptidylprolyl isomerase F has its protein number UniProtKB / Swiss-Prot: P30405 and its gene number NCBI Entrez Gene: 10105.

[0093] In another preferred embodiment, the tumor in which the mitochondrial permeability transition pore is underexpressed or underactivated refers to a tumor in which the expression level or activity of the mitochondrial permeability transition pore in tumor cells is lower than the expression level or activity of the mitochondrial permeability transition pore in the same type of cells or normal cells (e.g., cancerous bladder tissue cells).

[0094] In another preferred embodiment, the tumor in which the mitochondrial permeability transition pore is underexpressed or underactivated refers to a tumor in which the ratio (H1 / H0) between the expression level or activity H1 of the mitochondrial permeability transition pore in a certain cell (e.g., a tumor cell) and the expression level or activity H0 of the mitochondrial permeability transition pore in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.8, and more preferably ≦0.7, ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0095] In another preferred embodiment, the certain cell comprises a tumor cell.

[0096] In another preferred embodiment, identical cells refer to similar cells.

[0097] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0098] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0099] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0100] In another preferred embodiment, the allogeneic cell refers to a cell (allogeneic tumor cell) in which the mitochondrial permeability transition pore is normally expressed, highly expressed, normally activated, or highly activated.

[0101] In another preferred embodiment, the allogeneic cells refer to cells of the same type, but in which the mitochondrial permeability transition pore is normally expressed or highly expressed or normally activated or highly activated (allogeneic tumor cells).

[0102] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0103] In another preferred embodiment, the normal cells refer to normal tissue cells (e.g., cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which the mitochondrial permeability transition pore is normally expressed or normally activated.

[0104] In another preferred embodiment, H0 represents the expression level or activity of the mitochondrial permeability transition pore of a cell in which the mitochondrial permeability transition pore is normally expressed, highly expressed, normally activated, or highly activated.

[0105] In another preferred embodiment, the cells in which the mitochondrial permeability transition pore is normally expressed, overexpressed, normally activated or overactivated include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0106] In another preferred embodiment, the tumor in which peptidyl prolyl isomerase F is underexpressed or underactivated refers to a tumor in which the expression level or activity of peptidyl prolyl isomerase F in tumor cells is lower than the expression level or activity of peptidyl prolyl isomerase F in similar cells or normal cells (e.g., cancerous bladder tissue cells).

[0107] In another preferred embodiment, the tumor with low expression or low activity of peptidyl prolyl isomerase F refers to a tumor in which the ratio (P1 / P0) between the expression level or activity P1 of peptidyl prolyl isomerase F in a certain cell (e.g., a tumor cell) and the expression level or activity P0 of peptidyl prolyl isomerase F in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.8, and more preferably ≦0.7, ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0108] In another preferred embodiment, identical cells refer to similar cells.

[0109] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0110] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0111] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0112] In another preferred embodiment, the allogeneic cells refer to cells in which peptidyl prolyl isomerase F is normally expressed, highly expressed, normally activated or highly activated (allogeneic tumor cells).

[0113] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which peptidyl prolyl isomerase F is normally expressed or highly expressed or normally activated or highly activated (allogeneic tumor cells).

[0114] In another preferred embodiment, the normal cells refer to normal tissue cells in which peptidyl prolyl isomerase F is normally expressed or normally activated (e.g., cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0115] In another preferred embodiment, P0 represents the expression level or activity of peptidyl prolyl isomerase F in cells in which peptidyl prolyl isomerase F is normally expressed, highly expressed, normally activated, or highly activated.

[0116] In another preferred embodiment, the cells in which peptidyl prolyl isomerase F is normally expressed, overexpressed, normally activated or overactivated include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0117] In another preferred embodiment, the tumor in which the mitochondrial permeability transition pore is under-expressed, not expressed, hypoactive or inactivated can be achieved by administering an inhibitor of the mitochondrial permeability transition pore.

[0118] In another preferred embodiment, the tumor that has low expression, no expression, low activity or inactivation of peptidyl prolyl isomerase F can be treated by administering an inhibitor of peptidyl prolyl isomerase F.

[0119] In another preferred embodiment, the inhibitor comprises an inhibitor having specificity.

[0120] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore includes an inhibitor capable of under-expressing, not expressing, under-activating or inactivating the mitochondrial permeability transition pore in tumors.

[0121] In another preferred embodiment, said inhibitor of peptidyl prolyl isomerase F includes an inhibitor capable of under-expressing, not expressing, under-activating or inactivating peptidyl prolyl isomerase F in tumors.

[0122] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore is selected from Cyclosporin A, a CyP-D protein inhibitor, a peroxide scavenger, or a combination thereof.

[0123] In another preferred embodiment, said inhibitor of peptidyl prolyl isomerase F comprises an shRNA.

[0124] In another preferred example, the nucleotide sequence of the shRNA is GTTCTTCATCTGCACCATAAA.

[0125] In another preferred embodiment, the tumor comprises a tumor in which the NNMT gene is underexpressed or not expressed.

[0126] In another preferred embodiment, the tumor comprises a tumor in which DNA methyltransferase is highly expressed.

[0127] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0128] In another preferred embodiment, the tumor comprises a tumor in which DNMT1 is highly expressed.

[0129] In another preferred embodiment, the tumor comprises a tumor in which DNMT3a is highly expressed.

[0130] In another preferred embodiment, the tumor comprises a tumor in which DNMT3b is highly expressed.

[0131] In another preferred embodiment, the tumor comprises a tumor in which UHRF1 is highly expressed.

[0132] In another preferred embodiment, said tumor comprises a tumor with hypermethylation of nucleotide sites in the NNMT gene and / or hypermethylation of DNA CpG sites in the NNMT gene region.

[0133] In another preferred embodiment, the tumor comprises a tumor in which the nucleotide site in the NNMT gene is hypermethylated.

[0134] In another preferred embodiment, said methylation at a nucleotide site in the NNMT gene refers to methylation at a cytosine nucleotide site in the NNMT gene.

[0135] In another preferred embodiment, said methylation at a nucleotide site in the NNMT gene refers to methylation of a cytosine at the nucleotide site in the NNMT gene.

[0136] In another preferred embodiment, said methylation of the nucleotide site in the NNMT gene refers to methylation of the 5th carbon atom on the cytosine of the nucleotide in the NNMT gene.

[0137] In another preferred embodiment, the tumor comprises a tumor in which DNA CpG sites in the NNMT gene region are hypermethylated.

[0138] In another preferred embodiment, said methylation of the DNA CpG site in the NNMT gene region refers to methylation of the cytosine nucleotide site in the DNA CpG site in the NNMT gene region.

[0139] In another preferred embodiment, said methylation of the DNA CpG site in the NNMT gene region refers to the methylation of the cytosine of the nucleotide in the DNA CpG site in the NNMT gene region.

[0140] In another preferred embodiment, said methylation of the DNA CpG site in the NNMT gene region refers to methylation of the 5th carbon atom on the cytosine of the nucleotide in the DNA CpG site in the NNMT gene region.

[0141] In another preferred embodiment, the NNMT gene is a human-derived NNMT gene.

[0142] In another preferred embodiment, the NNMT gene is a human NNMT gene.

[0143] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 10 μg of protein extracted from the tumor, more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 100 μg of protein extracted from the tumor, and more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 1000 μg of protein extracted from the tumor.

[0144] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the expression level of the NNMT gene in tumor cells is lower than the expression level of the NNMT gene in the same type of cells or normal cells.

[0145] In another preferred example, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in tumor cells and the expression level E0 of the NNMT gene in similar cells or normal cells is <1.0.

[0146] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in a similar cell or a normal cell is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0147] In another preferred embodiment, the certain cell comprises a tumor cell.

[0148] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0149] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0150] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0151] In another preferred embodiment, said allogeneic cells refer to cells in which the NNMT gene is normally expressed or highly expressed (allogeneic tumor cells).

[0152] In another preferred embodiment, said allogeneic cells comprise cells of the same type, yet in which the NNMT gene is normally expressed or highly expressed.

[0153] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0154] In another preferred embodiment, the normal cells refer to normal tissue cells in which the NNMT gene is normally expressed (eg, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0155] In another preferred embodiment, E0 is the expression level of the NNMT gene in cells where the NNMT gene is normally expressed or highly expressed.

[0156] In another preferred embodiment, the cells in which the NNMT gene is normally expressed or highly expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0157] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed refers to a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.01 μg of protein extracted from the tumor.

[0158] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed refers to a tumor in which the expression level of DNA methyltransferase in tumor cells is greater than the expression level of DNA methyltransferase in the same type of cells or normal cells.

[0159] In another preferred embodiment, the tumor with high expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0160] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0161] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0162] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0163] In another preferred embodiment, the allogeneic cells refer to cells in which DNA methyltransferase is normally expressed or under-expressed (eg, allogeneic tumor cells).

[0164] In another preferred embodiment, said allogeneic cells comprise cells of the same type, but in which DNA methyltransferase is normally expressed or under-expressed.

[0165] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0166] In another preferred embodiment, the normal cell refers to a normal tissue cell in which DNA methyltransferase is normally expressed (e.g., a cell derived from a tumor cell, a tumor-adjacent cell, or a cancerous bladder tissue cell).

[0167] In another preferred embodiment, A0 is the expression level of DNA methyltransferase in cells in which DNA methyltransferase is normally expressed or under-expressed.

[0168] In another preferred embodiment, said cells in which DNA methyltransferase is normally expressed or under-expressed comprise cells which are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0169] In another preferred embodiment, the tumor in which DNMT1 is highly expressed refers to a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 0.01 μg of protein extracted from the tumor.

[0170] In another preferred embodiment, the tumor with high DNMT1 expression refers to a tumor in which the expression level of DNMT1 in tumor cells is greater than the expression level of DNMT1 in the same type of cells or normal cells.

[0171] In another preferred embodiment, the tumor with high expression of DNMT1 refers to a tumor in which the ratio (B1 / B0) between the expression level B1 of DNMT1 in tumor cells and the expression level B0 of DNMT1 in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0172] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0173] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0174] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0175] In another preferred embodiment, the allogeneic cells refer to cells in which DNMT1 is normally expressed or under-expressed (eg, allogeneic tumor cells).

[0176] In another preferred embodiment, said allogeneic cells include cells of the same type, yet in which DNMT1 is normally expressed or under-expressed.

[0177] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0178] In another preferred embodiment, the normal cells refer to normal tissue cells in which DNMT1 is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0179] In another preferred embodiment, B0 is the expression level of DNMT1 in cells where DNMT1 is normally expressed or under-expressed.

[0180] In another preferred embodiment, the cells in which DNMT1 is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0181] In another preferred embodiment, the tumor in which DNMT3a is highly expressed refers to a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 0.01 μg of protein extracted from the tumor.

[0182] In another preferred embodiment, the tumor with high DNMT3a expression refers to a tumor in which the expression level of DNMT3a in tumor cells is higher than the expression level of DNMT3a in the same type of cells or normal cells.

[0183] In another preferred embodiment, the tumor with high expression of DNMT3a refers to a tumor in which the ratio (C1 / C0) between the expression level C1 of DNMT3a in tumor cells and the expression level C0 of DNMT3a in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0184] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0185] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0186] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0187] In another preferred embodiment, the allogeneic cells refer to cells in which DNMT3a is normally expressed or under-expressed (eg, allogeneic tumor cells).

[0188] In another preferred embodiment, said allogeneic cells include cells of the same type, but in which DNMT3a is normally expressed or under-expressed.

[0189] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0190] In another preferred embodiment, the normal cells refer to normal tissue cells in which DNMT3a is normally expressed (e.g., cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0191] In another preferred embodiment, C0 is the expression level of DNMT3a in cells where DNMT3a is normally expressed or under-expressed.

[0192] In another preferred embodiment, the cells in which DNMT3a is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0193] In another preferred embodiment, the tumor in which DNMT3b is highly expressed refers to a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 0.01 μg of protein extracted from the tumor.

[0194] In another preferred embodiment, the tumor in which DNMT3b is highly expressed refers to a tumor in which the expression level of DNMT3b in tumor cells is greater than the expression level of DNMT3b in the same type of cells or normal cells.

[0195] In another preferred embodiment, the tumor with high expression of DNMT3b refers to a tumor in which the ratio (D1 / D0) between the expression level D1 of DNMT3b in tumor cells and the expression level D0 of DNMT3b in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0196] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0197] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0198] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0199] In another preferred embodiment, said allogeneic cells refer to cells in which DNMT3b is normally expressed or under-expressed (allogeneic tumor cells).

[0200] In another preferred embodiment, said allogeneic cells include cells of the same type, but in which DNMT3b is normally expressed or under-expressed.

[0201] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0202] In another preferred embodiment, the normal cells refer to normal tissue cells in which DNMT3b is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0203] In another preferred embodiment, D0 is the expression level of DNMT3b in cells where DNMT3b is normally expressed or under-expressed.

[0204] In another preferred embodiment, the cells in which DNMT3b is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0205] In another preferred embodiment, the tumor in which UHRF1 is highly expressed refers to a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 0.01 μg of protein extracted from the tumor.

[0206] In another preferred embodiment, the tumor in which UHRF1 is highly expressed refers to a tumor in which the expression level of UHRF1 in tumor cells is greater than the expression level of UHRF1 in the same type of cells or normal cells.

[0207] In another preferred embodiment, the tumor in which UHRF1 is highly expressed refers to a tumor in which the ratio (F1 / F0) between the expression level F1 of UHRF1 in tumor cells and the expression level F0 of UHRF1 in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0208] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0209] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0210] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0211] In another preferred embodiment, said allogeneic cells refer to cells in which UHRF1 is normally expressed or under-expressed (allogeneic tumor cells).

[0212] In another preferred embodiment, said allogeneic cells include cells of the same type, yet in which UHRF1 is normally expressed or under-expressed.

[0213] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0214] In another preferred embodiment, the normal cells refer to normal tissue cells in which UHRF1 is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0215] In another preferred embodiment, F0 is the expression level of UHRF1 in cells where UHRF1 is normally expressed or under-expressed.

[0216] In another preferred embodiment, the cells in which UHRF1 is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0217] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is greater than the methylation level of the nucleotide site of the NNMT gene in a similar cell or a normal cell.

[0218] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0219] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is ≧1%, preferably ≧3%, ≧5%, ≧10%, ≧15% or ≧20%, and more preferably ≧25%, ≧30%, ≧40% or ≧50%.

[0220] In another preferred embodiment, the certain cell comprises a tumor cell.

[0221] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0222] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0223] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0224] In another preferred embodiment, said allogeneic cells refer to cells in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated (allogeneic tumor cells).

[0225] In another preferred embodiment, said allogeneic cells comprise cells of the same type, yet in which the nucleotide site in the NNMT gene is normally methylated or hypomethylated.

[0226] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0227] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which the nucleotide site of the NNMT gene is normally methylated.

[0228] In another preferred embodiment, the cells in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0229] In another preferred example, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level (M%) of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is ≧3% and less than M1%, where M1 is any positive integer between 3 and 100.

[0230] In another preferred embodiment, M1 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0231] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene refers to the ratio between the number of methylated nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region.

[0232] In another preferred embodiment, said methylation level of a nucleotide site in the NNMT gene comprises a methylation level of a nucleotide site in the NNMT gene promoter region.

[0233] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1.

[0234] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene comprises the methylation level of a nucleotide site within a region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene.

[0235] In another preferred embodiment, the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene is positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0236] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene comprises the methylation level of a nucleotide site within a region from 1050 bp prior to the transcription start site of the NNMT gene to 193 bp prior to the transcription start site.

[0237] In another preferred embodiment, the region from 1050 bp prior to the transcription initiation site of the NNMT gene to 193 bp prior to the transcription initiation site is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0238] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene comprises the methylation level of a nucleotide site within a region from 840 bp prior to the transcription start site of the NNMT gene to 469 bp prior to the transcription start site.

[0239] In another preferred embodiment, the region from 840 bp prior to the transcription initiation site of the NNMT gene to 469 bp prior to the transcription initiation site is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0240] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of a nucleotide site within a region between any two of positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 (including these two positions themselves).

[0241] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide at one or more (e.g., 2, 3, 4, 5, 6 or 7) sites among positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 of human chromosome 11.

[0242] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide of a site selected from position 114165695 of human chromosome 11, position 114165730 of human chromosome 11, position 114165769 of human chromosome 11, position 114165804 of human chromosome 11, position 114165938 of human chromosome 11, position 114166050 of human chromosome 11, position 114166066 of human chromosome 11, or a combination thereof.

[0243] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide site within a region between any two of the following positions of the nucleotide sequence of SEQ ID NO:1: 1161, 1196, 1235, 1270, 1404, 1516, and 1532 (including these two positions themselves).

[0244] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of one or more (e.g., 2, 3, 4, 5, 6 or 7) of the nucleotide sites 1161, 1196, 1235, 1270, 1404, 1516 and 1532 of the nucleotide sequence of SEQ ID NO:1.

[0245] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of nucleotides at sites selected from sites 1161, 1196, 1235, 1270, 1404, 1516, 1532 or combinations thereof of the nucleotide sequence of SEQ ID NO:1.

[0246] In another preferred embodiment, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the methylation level of the DNA CpG site in the NNMT gene region in a certain cell (e.g., a tumor cell) is greater than the methylation level of the DNA CpG site in the NNMT gene region in a similar cell or a normal cell.

[0247] In another preferred embodiment, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG site in the NNMT gene region of a certain cell (e.g., a tumor cell) and the methylation level W0 of the DNA CpG site in the NNMT gene region of a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0248] In another preferred embodiment, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the methylation level of the DNA CpG site in the NNMT gene region of a certain cell (e.g., tumor cell) is ≧1%, preferably ≧3%, ≧5%, ≧10%, ≧15% or ≧20%, and more preferably ≧25%, ≧30%, ≧40% or ≧50%.

[0249] In another preferred embodiment, the certain cell comprises a tumor cell.

[0250] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0251] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0252] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0253] In another preferred embodiment, said allogeneic cells refer to cells (eg allogeneic tumor cells) in which DNA CpG sites in the NNMT gene region are normally methylated or hypomethylated.

[0254] In another preferred embodiment, said allogeneic cells comprise cells of the same type, yet in which DNA CpG sites in the NNMT gene region are normally methylated or hypomethylated.

[0255] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0256] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which DNA CpG sites in the NNMT gene region are normally methylated.

[0257] In another preferred embodiment, said cells in which DNA CpG sites in the NNMT gene region are normally methylated or hypomethylated include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0258] In another preferred example, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the methylation level (M%) of the DNA CpG site in the NNMT gene region of a certain cell (e.g., a tumor cell) is ≧3% and less than M2%, where M2 is any positive integer between 3 and 100.

[0259] In another preferred embodiment, M2 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0260] In another preferred embodiment, the methylation level of a CpG site refers to the ratio between the number of methylated CpG nucleotides in a certain gene region and the number of all nucleotides in the gene region.

[0261] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region.

[0262] In another preferred embodiment, the methylation level of a CpG site refers to the ratio between the number of methylated CpG nucleotides in a gene region and the number of all CpG nucleotides in the gene region.

[0263] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all CpG nucleotides in the NNMT gene region.

[0264] In another preferred embodiment, said methylation level of DNA CpG sites refers to the ratio between the number of methylated CpG sites in a region of DNA and the number of all CpG sites in said region of DNA.

[0265] In another preferred embodiment, said methylation level of a DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in a region of DNA and the number of all nucleotides in said region of DNA.

[0266] In another preferred embodiment, said methylation level of a DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in a region of DNA and the number of all CpG nucleotides in said region of DNA.

[0267] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region refers to the ratio between the number of methylated CpG sites in the DNA of the NNMT gene region and the number of all CpG sites in the DNA of the NNMT gene region.

[0268] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region refers to the ratio between the number of methylated CpG nucleotides in the DNA of the NNMT gene region and the number of all CpG nucleotides in the DNA of the NNMT gene region.

[0269] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites in the NNMT gene promoter region.

[0270] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1.

[0271] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene.

[0272] In another preferred embodiment, the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene is positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0273] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene.

[0274] In another preferred embodiment, the region from 1050 bp prior to the transcription initiation site of the NNMT gene to 193 bp prior to the transcription initiation site is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0275] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene.

[0276] In another preferred embodiment, the region from 840 bp prior to the transcription initiation site of the NNMT gene to 469 bp prior to the transcription initiation site is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0277] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites within a region between any two of positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 (including these two positions themselves).

[0278] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of one or more (e.g., 2, 3, 4, 5, 6 or 7) sites among positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 of human chromosome 11.

[0279] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of a site selected from position 114165695 on human chromosome 11, position 114165730 on human chromosome 11, position 114165769 on human chromosome 11, position 114165804 on human chromosome 11, position 114165938 on human chromosome 11, position 114166050 on human chromosome 11, position 114166066 on human chromosome 11, or a combination thereof.

[0280] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region between any two of the following positions of the nucleotide sequence of SEQ ID NO:1: 1161, 1196, 1235, 1270, 1404, 1516 and 1532 (including these two positions themselves).

[0281] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of one or more (e.g., 2, 3, 4, 5, 6 or 7) of the sites at positions 1161, 1196, 1235, 1270, 1404, 1516 and 1532 of the nucleotide sequence of SEQ ID NO:1.

[0282] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of sites selected from the sites at positions 1161, 1196, 1235, 1270, 1404, 1516, 1532 or combinations thereof of the sites of SEQ ID NO:1.

[0283] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed can be treated by administering an inhibitor of the NNMT gene.

[0284] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed can be treated by administering a promoter of DNA methyltransferase.

[0285] In another preferred embodiment, the tumor in which DNMT1 is highly expressed can be produced by administering a promoter of DNMT1.

[0286] In another preferred embodiment, the tumor in which DNMT3a is highly expressed can be produced by administering a promoter of DNMT3a.

[0287] In another preferred embodiment, the tumor in which DNMT3b is highly expressed can be produced by administering a promoter of DNMT3b.

[0288] In another preferred embodiment, the tumor in which UHRF1 is highly expressed can be produced by administering a promoter of UHRF1.

[0289] In another preferred embodiment, said tumor in which the nucleotide site of the NNMT gene is hypermethylated can be treated by administering an agent that enhances methylation of the nucleotide site of the NNMT gene.

[0290] In another preferred embodiment, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated can be treated by administering an agent that promotes methylation of the DNA CpG site in the NNMT gene region.

[0291] In another preferred embodiment, the inhibitor comprises an inhibitor having specificity.

[0292] In another preferred embodiment, the enhancer comprises an enhancer having specificity.

[0293] In another preferred embodiment, said inhibitor of the NNMT gene comprises an inhibitor capable of causing under-expression or non-expression of the NNMT gene in tumors.

[0294] In another preferred embodiment, said promoter of DNA methyltransferase comprises a promoter that allows high expression of DNA methyltransferase in tumors.

[0295] In another preferred embodiment, said promoter of DNMT1 comprises a promoter capable of high expression of DNMT1 in tumors.

[0296] In another preferred embodiment, said promoter of DNMT3a comprises a promoter capable of high expression of DNMT3a in tumors.

[0297] In another preferred embodiment, the promoter of DNMT3b comprises a promoter capable of high expression of DNMT3b in tumors.

[0298] In another preferred embodiment, said promoter of UHRF1 comprises a promoter that allows high expression of UHRF1 in tumors.

[0299] In another preferred embodiment, said promoter of methylation of a nucleotide site in the NNMT gene comprises a promoter capable of hypermethylating a nucleotide site in the NNMT gene in a tumor.

[0300] In another preferred embodiment, said promoter of methylation of DNA CpG sites in the NNMT gene region comprises a promoter capable of hypermethylating DNA CpG sites in the NNMT gene region in tumors.

[0301] In another preferred embodiment, the tumor is selected from lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain cancer, liver cancer, prostate cancer, or a combination thereof.

[0302] In another preferred embodiment, the lung cancer is selected from non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0303] In another preferred embodiment, the lung cancer cells comprise NCI-H82 cells.

[0304] In another preferred embodiment, the colon cancer comprises colon adenocarcinoma.

[0305] In another preferred embodiment, the colon cancer cells comprise SW48 cells.

[0306] In another preferred embodiment, the colon cancer cells comprise MDA-MB-453 cells.

[0307] In another preferred embodiment, the breast cancer comprises triple-negative breast cancer.

[0308] In another preferred embodiment, the lymphoma is selected from B cell lymphoma, T cell lymphoma, or a combination thereof.

[0309] In another preferred embodiment, the lymphoma comprises diffuse large B-cell lymphoma.

[0310] In another preferred embodiment, the brain tumor is selected from glioblastoma, glioma, medulloblastoma, neuroblastoma, or a combination thereof.

[0311] In another preferred embodiment, the brain medulloblastoma comprises a cerebellar medulloblastoma.

[0312] In another preferred embodiment, the glioblastoma comprises glioblastoma multiforme.

[0313] In another preferred embodiment, the brain tumor comprises a medulloblastoma.

[0314] In another preferred embodiment, the brain tumor comprises a glioblastoma.

[0315] In another preferred embodiment, the brain tumor comprises a cranial fossa glioblastoma.

[0316] In another preferred embodiment, the brain tumor comprises a medulloblastoma.

[0317] In another preferred embodiment, the brain tumor cells comprise Daoy cells.

[0318] In another preferred embodiment, the brain tumor cells comprise one or more of GB-1 cells, SF126 cells, D341 Med cells, Kelly cells, and NB-1 cells.

[0319] In another preferred embodiment, the renal cancer is selected from renal clear cell adenocarcinoma, renal cancer Wilms, or a combination thereof.

[0320] In another preferred embodiment, the renal cancer comprises renal clear cell adenocarcinoma.

[0321] In another preferred embodiment, the renal cancer comprises Wilms renal cancer.

[0322] In another preferred embodiment, the renal cancer cancer cells comprise renal cancer Wilms cells.

[0323] In another preferred embodiment, the renal cancer cancer cells include one or more of G-401 cells and 786-O cells.

[0324] In another preferred embodiment, the pancreatic cancer comprises pancreatic ductal adenocarcinoma.

[0325] In another preferred embodiment, the pancreatic cancer cells comprise CFPAC-1 cells.

[0326] In another preferred embodiment, the leukemia is selected from T lymphocytic leukemia, myeloid leukemia, or a combination thereof.

[0327] In another preferred embodiment, the T lymphocytic leukemia comprises acute T lymphocytic leukemia.

[0328] In another preferred embodiment, the myeloid leukemia comprises M4 AML acute myeloid leukemia.

[0329] In another preferred embodiment, the myeloid leukemia comprises FAB M4 AML acute myeloid leukemia.

[0330] In another preferred embodiment, said expression comprises protein expression and / or mRNA expression.

[0331] In another preferred embodiment, the level comprises a protein level and / or an mRNA level.

[0332] In another preferred embodiment, the composition or formulation is a pharmaceutical composition or formulation.

[0333] In another preferred embodiment, the composition or formulation further comprises a pharma- ceutically acceptable carrier.

[0334] In another preferred embodiment, said expression is mRNA expression or protein expression.

[0335] In another preferred embodiment, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0336] In another preferred embodiment, the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0337] In another preferred embodiment, the injectable formulation is an intravenous injection formulation.

[0338] In another preferred embodiment, the composition or formulation is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill, or a coating.

[0339] A second aspect of the present invention provides a marker for determining whether the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for the prevention and / or treatment of a tumor in a tumor patient, the marker comprising a mitochondrial permeability transition pore, peptidyl prolyl isomerase F, the NNMT gene, DNA methyltransferase, UHRF1, methylation of a nucleotide site in the NNMT gene and / or methylation of a DNA CpG site in the NNMT gene region.

[0340] In another preferred embodiment, the marker comprises the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene and / or the methylation level of a DNA CpG site in the NNMT gene region.

[0341] In another preferred embodiment, when the tumor cells of a tumor patient are under-expressed, under-expressed, under-activated or inactivated of the mitochondrial permeability transition pore, under-expressed, under-expressed, under-activated or inactivated of peptidyl prolyl isomerase F, under-expressed or under-expressed of the NNMT gene, over-expressed of DNA methyltransferase, over-expressed of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in said tumor patient.

[0342] In another preferred embodiment, in tumor cells of a tumor patient, there is high expression or activation of the mitochondrial permeability transition pore, there is high expression or activation of peptidyl prolyl isomerase F, there is high expression of the NNMT gene, there is low expression of DNA methyltransferase, there is low expression of UHRF1, there is low methylation of nucleotide sites of the NNMT gene, and / or there is low methylation of DNA CpG sites in the NNMT gene region, such that said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes unsuitable for the prevention and / or treatment of tumors in said tumor patient.

[0343] In another preferred embodiment, the content that the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is suitable for preventing and / or treating a tumor in a tumor patient means that tumor cells of the tumor patient are sensitive to the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0344] In another preferred embodiment, the content that the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is not suitable for preventing and / or treating a tumor in a tumor patient means that tumor cells of the tumor patient are insensitive to the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0345] In another preferred embodiment, the tumor in which the mitochondrial permeability transition pore is underexpressed, unexpressed, underactivated or inactivated is a tumor according to the first aspect of the present invention.

[0346] In another preferred embodiment, the tumor in which peptidyl prolyl isomerase F is underexpressed, unexpressed, underactivated or inactivated is a tumor according to the first aspect of the present invention.

[0347] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed is a tumor according to the first aspect of the present invention.

[0348] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0349] In another preferred embodiment, the tumour resulting in high expression of DNA methyltransferase (eg DNMT1) is a tumour according to the first aspect of the invention.

[0350] In another preferred embodiment, the tumor resulting in high expression of UHRF1 is a tumor according to the first aspect of the present invention.

[0351] In another preferred embodiment, said tumor resulting in hypermethylation of the nucleotide site of the NNMT gene is a tumor according to the first aspect of the invention.

[0352] In another preferred embodiment, said tumor resulting in hypermethylation of DNA CpG sites in the NNMT gene region is a tumor according to the first aspect of the invention.

[0353] In another preferred embodiment, the tumor with high expression or activation of the mitochondrial permeability transition pore refers to a tumor in which the ratio (H1 / H0) between the expression level or activity H1 of the mitochondrial permeability transition pore in a certain cell (e.g., a tumor cell) and the expression level or activity H0 of the mitochondrial permeability transition pore in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0354] In another preferred embodiment, the tumor with high expression or activation of peptidyl prolyl isomerase F refers to a tumor in which the ratio (P1 / P0) between the expression level or activity P1 of peptidyl prolyl isomerase F in a certain cell (e.g., a tumor cell) and the expression level or activity P0 of peptidyl prolyl isomerase F in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0355] In another preferred embodiment, the tumor with high expression of the NNMT gene refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in a similar cell or a normal cell is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0356] In another preferred embodiment, the tumor with low expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in related cells or normal cells is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0357] In another preferred embodiment, the tumor with low expression of DNMT1 refers to a tumor in which the ratio (B1 / B0) between the expression level B1 of DNMT1 in tumor cells and the expression level B0 of DNMT1 in similar cells or normal cells is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0358] In another preferred embodiment, the tumor with low expression of DNMT3a refers to a tumor in which the ratio (C1 / C0) between the expression level C1 of DNMT3a in tumor cells and the expression level C0 of DNA methyltransferase in similar cells or normal cells is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0359] In another preferred embodiment, the tumor with low expression of DNMT3b refers to a tumor in which the ratio (D1 / D0) between the expression level D1 of DNMT3b in tumor cells and the expression level D0 of DNA methyltransferase in similar cells or normal cells is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0360] In another preferred example, the tumor with low expression of UHRF1 refers to a tumor in which the ratio (F1 / F0) between the expression level F1 of UHRF1 in tumor cells and the expression level F0 of UHRF1 in similar cells or normal cells is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0361] In another preferred embodiment, the tumor having hypomethylation of the nucleotide site of the NNMT gene refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0362] In another preferred embodiment, the tumor with hypomethylation of DNA CpG sites in the NNMT gene region refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG site in the NMT gene region of a certain cell (e.g., a tumor cell) and the methylation level W0 of the DNA CpG site in the NMT gene region of the same cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0363] A third aspect of the present invention provides a detection reagent kit, comprising: (i) A detection reagent is provided for detecting the expression level or activity of the mitochondrial membrane permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region.

[0364] In another preferred embodiment, the detection sample of the detection reagent kit includes tumor cells.

[0365] In another preferred embodiment, the level comprises a protein level and / or an mRNA level.

[0366] In another preferred embodiment, said expression comprises mRNA and / or protein expression.

[0367] A fourth aspect of the present invention provides the use of a detection reagent kit according to the third aspect of the present invention for the manufacture of a concomitant diagnostic kit for determining whether the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for the prevention and / or treatment of tumors in tumor patients.

[0368] In another preferred embodiment, the companion detection reagent kit further comprises instructions or a label.

[0369] In another preferred embodiment, the instructions or label include: The present invention relates to a method for treating tumors comprising administering to a patient a therapeutically effective amount of a compound of formula I, an optical isomer or racemate thereof, a solvate thereof, a pharmacologic agent or a deuterated compound thereof, a medicament for treating a tumor, a method ...

[0370] In another preferred embodiment, the instructions or label include: The present invention relates to a method for treating tumors comprising administering to a patient a therapeutically effective amount of a compound of formula I, an optical isomer or racemate thereof, a solvate thereof, a pharmacologic agent or a deuterated compound thereof, a medicament for preventing and / or treating tumors, ...

[0371] In another preferred embodiment, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, being suitable for the prophylaxis and / or treatment of tumors in tumor patients, has the meaning according to the second aspect of the present invention.

[0372] In another preferred embodiment, the content that said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof is not suitable for the prophylaxis and / or treatment of tumors in said tumor patients has the meaning according to the second aspect of the present invention.

[0373] A fifth aspect of the invention provides a medical kit.

[0374] The medical kit comprises: (i) a detection reagent for detecting the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region; (ii) the compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0375] In another preferred embodiment, the expression level or activity of the mitochondrial membrane permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site in the NNMT gene region means the expression level or activity of the mitochondrial membrane permeability transition pore in tumor cells, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site in the NNMT gene region.

[0376] In another preferred embodiment, the sample for detection comprises a tumor.

[0377] In another preferred embodiment, the medical kit further comprises instructions or a label.

[0378] In another preferred embodiment, the instructions or label include: The present invention relates to a method for treating tumors comprising administering to a patient a therapeutically effective amount of a compound of formula I, an optical isomer or racemate thereof, a solvate thereof, a pharmacologic agent or a deuterated compound thereof, a medicament for treating a tumor, a method ...

[0379] In another preferred embodiment, the instructions or label include: The present invention relates to a method for treating tumors comprising administering to a patient a therapeutically effective amount of a compound of formula I, an optical isomer or racemate thereof, a solvate thereof, a pharmacologic agent or a deuterated compound thereof, a medicament for preventing and / or treating tumors, ...

[0380] A sixth aspect of the present invention provides a method for the prevention and / or treatment of tumors by administering to a subject to be treated said compound of formula I as defined in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, to effect prevention and / or treatment of tumors.

[0381] In another preferred embodiment, the tumor is a tumor according to the first aspect of the invention.

[0382] In another preferred embodiment, the subject to be treated is a human or non-human mammal (eg, rodents, rabbits, monkeys, livestock, dogs, cats).

[0383] In another preferred embodiment, the method further comprises: First, the tumor to be treated is caused to have an underexpression, non-expression, underactivation or inactivation of the mitochondrial permeability transition pore, an underexpression, non-expression, underactivation or inactivation of peptidyl prolyl isomerase F, an underexpression or non-expression of the NNMT gene, an overexpression of DNA methyltransferase, an overexpression of UHRF1, a hypermethylation of the nucleotide site of the NNMT gene, and / or a hypermethylation of the DNA CpG site of the NNMT gene region, and then the prevention and / or treatment is carried out by administering said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0384] In another preferred embodiment, the method further comprises: First, an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of the nucleotide site of the NNMT gene, and / or an enhancer of DNA CpG site of the NNMT gene region are administered so that the tumor to be treated has low expression, no expression, low activation or inactivation of the mitochondrial permeability transition pore, low expression, no expression, low activation or inactivation of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide site of the NNMT gene, and / or high methylation of the DNA CpG site of the NNMT gene region. This comprises administering to the subject an agent for promoting methylation of CpG sites, followed by administering said compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, to effect prophylaxis and / or treatment.

[0385] In another preferred embodiment, the above-mentioned contents of an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site in the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the first aspect of the present invention.

[0386] A seventh aspect of the present invention provides an apparatus or system.

[0387] The device or system includes: (i) a detection module used to detect the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region; (ii) an output module.

[0388] The output module includes: information that in the tumor cells of a tumor patient, the under-expression, under-expression, under-activation or under-activation of the mitochondrial permeability transition pore, the under-expression, under-expression, under-activation or under-activation of peptidyl prolyl isomerase F, the under-expression or under-expression of the NNMT gene, the over-expression of DNA methyltransferase, the over-expression of UHRF1, the hypermethylation of nucleotide sites of the NNMT gene, and / or the hypermethylation of DNA CpG sites in the NNMT gene region renders said compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, suitable for the prevention and / or treatment of tumors in said tumor patient, and / or When there is high expression or high activation of the mitochondrial permeability transition pore, high expression or high activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites of the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region in tumor cells of a tumor patient, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for tumor prevention and / or treatment in the tumor patient.

[0389] In another preferred embodiment, the device comprises a gene detector or a protein detector.

[0390] In another preferred embodiment, the device or system further comprises a sample delivery module.

[0391] In another preferred embodiment, the sample supply module is used to supply a tumor cell extract.

[0392] In another preferred embodiment, the device or system further comprises a data processing module.

[0393] In another preferred embodiment, the data processing module processes the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene and / or the methylation level of a DNA CpG site in the NNMT gene region to obtain their numerical ranges.

[0394] An eighth aspect of the present invention provides the use of an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, a promoter of DNA methyltransferase, a promoter of UHRF1, a promoter of methylation of nucleotide sites in the NNMT gene and / or a promoter of methylation of DNA CpG sites in the NNMT gene region, to manufacture a composition or formulation for use in enhancing the anti-tumor effect of an anti-tumor drug.

[0395] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore includes an inhibitor capable of under-expressing, not expressing, under-activating or inactivating the mitochondrial permeability transition pore in tumors.

[0396] In another preferred embodiment, said inhibitor of peptidyl prolyl isomerase F includes an inhibitor capable of under-expressing, not expressing, under-activating or inactivating peptidyl prolyl isomerase F in tumors.

[0397] In another preferred embodiment, said inhibitor of the NNMT gene comprises an inhibitor capable of causing under-expression or non-expression of the NNMT gene in tumors.

[0398] In another preferred embodiment, said promoter of DNA methyltransferase comprises a promoter that allows high expression of DNA methyltransferase in tumors.

[0399] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0400] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT1.

[0401] In another preferred embodiment, said promoter of DNMT1 comprises a promoter capable of high expression of DNMT1 in tumors.

[0402] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT3a.

[0403] In another preferred embodiment, said promoter of DNMT3a comprises a promoter capable of high expression of DNMT3a in tumors.

[0404] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT3b.

[0405] In another preferred embodiment, the promoter of DNMT3b comprises a promoter capable of high expression of DNMT3b in tumors.

[0406] In another preferred embodiment, said promoter of UHRF1 comprises a promoter that allows high expression of UHRF1 in tumors.

[0407] In another preferred embodiment, said promoter of methylation of a nucleotide site in the NNMT gene comprises a promoter capable of hypermethylating a nucleotide site in the NNMT gene in a tumor.

[0408] In another preferred embodiment, said promoter of methylation of DNA CpG sites in the NNMT gene region comprises a promoter capable of hypermethylating DNA CpG sites in the NNMT gene region in tumors.

[0409] In another preferred embodiment, the inhibitor comprises an inhibitor having specificity.

[0410] In another preferred embodiment, the enhancer comprises an enhancer having specificity.

[0411] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0412] In another preferred embodiment, the tumor is a tumor according to the first aspect of the invention.

[0413] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore is selected from Cyclosporin A, a CyP-D protein inhibitor, a peroxide scavenger, or a combination thereof.

[0414] In another preferred embodiment, said inhibitor of peptidyl prolyl isomerase F comprises an shRNA.

[0415] In another preferred example, the nucleotide sequence of the shRNA is GTTCTTCATCTGCACCATAAA.

[0416] In another preferred embodiment, the composition or formulation is a pharmaceutical composition or formulation.

[0417] In another preferred embodiment, the composition or formulation further comprises a pharma- ceutically acceptable carrier.

[0418] In another preferred embodiment, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0419] In another preferred embodiment, the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0420] In another preferred embodiment, the injectable formulation is an intravenous injection formulation.

[0421] In another preferred embodiment, the composition or preparation is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill, or a coating.

[0422] A ninth aspect of the invention provides a composition of active ingredients comprising: (1) a first active ingredient comprising an antitumor drug; and (2) a second active ingredient comprising an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region.

[0423] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0424] In another preferred embodiment, the above-mentioned contents of an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site in the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the eighth aspect of the present invention.

[0425] In another preferred embodiment, the molar ratio between the first active ingredient and the second active ingredient is 0.01-600:1, preferably 0.05-500:1, and more preferably 0.1-400:1, 0.2-200:1, 0.5-100:1, 0.5-80:1 or 1-50:1.

[0426] In another preferred embodiment, the combination of active ingredients includes at least one independent active ingredient.

[0427] In another preferred embodiment, the combination of active ingredients includes a first active ingredient and a second active ingredient that are independent of each other.

[0428] A tenth aspect of the present invention provides a composition comprising the following components: (1) a first active ingredient comprising an antitumor drug; and (2) a second active ingredient comprising an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region.

[0429] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0430] In another preferred embodiment, the above-mentioned contents of an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site in the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the eighth aspect of the present invention.

[0431] In another preferred embodiment, the composition is a pharmaceutical composition.

[0432] In another preferred embodiment, the pharmaceutical composition further comprises a pharma- ceutically acceptable carrier.

[0433] In another preferred embodiment, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0434] In another preferred embodiment, the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0435] In another preferred embodiment, the composition or preparation is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill, or a coating.

[0436] In another preferred embodiment, the content of said first active ingredient relative to the total weight of active ingredients of the composition is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and more preferably 1-99 wt%, 10-99 wt% or 20-99 wt%.

[0437] In another preferred embodiment, the content of said second active ingredient relative to the total weight of active ingredients of the composition is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and more preferably 1-99 wt%, 10-99 wt% or 20-99 wt%.

[0438] An eleventh aspect of the invention provides a medical kit comprising the following formulation: (A) a first formulation having a first active ingredient comprising an antitumor drug; and (B) A second formulation having a second active ingredient comprising an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, a promoter of methylation of nucleotide sites in the NNMT gene and / or a promoter of methylation of DNA CpG sites in the NNMT gene region.

[0439] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0440] In another preferred embodiment, the above-mentioned contents of an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site in the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the eighth aspect of the present invention.

[0441] In another preferred embodiment, the medical kit further comprises an instruction manual.

[0442] In another preferred embodiment, the first formulation and the second formulation are independent of each other.

[0443] In another preferred embodiment, the first and second formulations are combined.

[0444] In another preferred embodiment, the instructions include instructions to use the first formulation in combination with the second formulation to enhance the antitumor activity of the antitumor drug.

[0445] In another preferred embodiment, the method of combination is to first administer the second formulation having the second active ingredient, followed by the first formulation having the first active ingredient.

[0446] A twelfth aspect of the invention provides a method for inhibiting tumour cells, said method comprising contacting tumour cells with said compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, to inhibit said tumour cells.

[0447] In another preferred embodiment, the method is performed in vitro or is an in vitro method.

[0448] In another preferred embodiment, the method is an in vitro, non-therapeutic, non-diagnostic method.

[0449] In another preferred embodiment, the contacting is performed in an in vitro culture.

[0450] In another preferred embodiment, the tumor is a tumor according to the first aspect of the invention.

[0451] In another preferred embodiment, the method further comprises: First, the tumor cells are caused to have an underexpression, non-expression, underactivation or inactivation of the mitochondrial permeability transition pore, an underexpression, non-expression, underactivation or inactivation of peptidyl prolyl isomerase F, an underexpression or non-expression of the NNMT gene, an overexpression of DNA methyltransferase, an overexpression of UHRF1, a hypermethylation of the nucleotide site of the NNMT gene, and / or a hypermethylation of the DNA CpG site of the NNMT gene region, and then the tumor cells are contacted with said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, thereby inhibiting the tumor cells.

[0452] In another preferred embodiment, the method further comprises: First, an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, a promoter of DNA methyltransferase, a promoter of UHRF1, a promoter of methylation of the nucleotide site of the NNMT gene, and / or a promoter of DNA CpG site of the NNMT gene region are administered to the tumor cells, so that the tumor cells have low expression, no expression, low activation or inactivation of the mitochondrial permeability transition pore, low expression, no expression, low activation or inactivation of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide site of the NNMT gene, and / or high methylation of the DNA CpG site of the NNMT gene region. providing to said tumour cells an agent for promoting methylation of CpG sites, and then contacting said tumour cells with said compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, thereby inhibiting said tumour cells.

[0453] In another preferred embodiment, the above-mentioned contents of an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site in the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the eighth aspect of the present invention.

[0454] A thirteenth aspect of the present invention provides the use of the medical kit according to the fifth aspect of the present invention for the manufacture of a pharmaceutical kit for use in the prevention and / or treatment of tumors.

[0455] In another preferred embodiment, the pharmaceutical kit further comprises instructions or a label.

[0456] In another preferred embodiment, the instructions or label include: The present invention relates to a method for treating tumors comprising administering to a patient a therapeutically effective amount of a compound of formula I, an optical isomer or racemate thereof, a solvate thereof, a pharmacologic agent or a deuterated compound thereof, a medicament for treating a tumor, a method ...

[0457] In another preferred embodiment, the instructions or label include: The present invention relates to a method for treating tumors comprising administering to a patient a therapeutically effective amount of a compound of formula I, an optical isomer or racemate thereof, a solvate thereof, a pharmacologic agent or a deuterated compound thereof, a medicament for preventing and / or treating tumors, ...

[0458] Within the scope of the present invention, each of the above technical features of the present invention may be combined with the following specific technical features to constitute a new or preferred technical solution. [Brief description of the drawings]

[0459]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

[0460] As a result of long-term and in-depth research, the present inventors have unexpectedly found for the first time a compound having a significantly excellent therapeutic effect on tumor cells with low expression, no expression, low activation or inactivation of the mitochondrial membrane permeability transition pore, tumor cells with low expression, no expression, low activation or inactivation of peptidyl prolyl isomerase F, tumor cells with low expression or no expression of the NNMT gene, tumor cells with high expression of DNA methyltransferase, tumor cells with high expression of UHRF1, tumor cells with high methylation of the nucleotide site of the NNMT gene, and / or tumor cells with high methylation of the DNA CpG site in the NNMT gene region. The expression level or activity of the mitochondrial membrane permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region serve as markers for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients. The present inventors have achieved the present invention based on this.

[0461] term Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0462] As used herein, the terms "including," "comprising," and "having" may be used interchangeably and have closed definitions as well as semi-closed and open definitions. In other words, the terms have the meaning "consisting of" or "consisting essentially of."

[0463] As used herein, the terms "anti-cancer drug" and "anti-tumor drug" may be used interchangeably.

[0464] As used herein, the terms "cancer" and "tumor" may be used interchangeably.

[0465] As used herein, the term "a cell" refers to a cell (e.g., a single tumor cell) or a group of cells including multiple similar cells (e.g., a tumor tissue).

[0466] As used herein, "the compound of the present invention is suitable for a tumor patient" means that the tumor of the tumor patient is sensitive to the compound of the present invention, and so on.

[0467] As used herein, "the compounds of the present invention are not suitable for tumor patients" means that the tumors of the tumor patients are insensitive to the compounds of the present invention, and the like.

[0468] As used herein, "IC50" and "IC 50 The term "50% inhibiting concentration" may be used interchangeably and refers to the concentration of an inhibitor at which 50% of the inhibitory effect is achieved.

[0469] As used herein, the term "P / S" refers to the addition of Penicillin and Streptomycin to the relevant media.

[0470] As used herein, "expression level or activity of the mitochondrial permeability transition pore, expression level or activity of peptidyl prolyl isomerase F, expression level of the NNMT gene, expression level of DNA methyltransferase, expression level of UHRF1, methylation level of the nucleotide site of the NNMT gene, and / or methylation level of the DNA CpG site in the NNMT gene region" refers to one or more of the expression level or activity of the mitochondrial permeability transition pore, expression level or activity of peptidyl prolyl isomerase F, expression level of the NNMT gene, expression level of DNA methyltransferase, expression level of UHRF1, methylation level of the nucleotide site of the NNMT gene, and methylation level of the DNA CpG site in the NNMT gene region.

[0471] As used herein, "resulting in low expression, no expression, low activation or inactivation of the mitochondrial permeability transition pore, low expression, no expression, low activation or inactivation of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region" refers to one or more of the following: low expression, no expression, low activation or inactivation of the mitochondrial permeability transition pore, low expression, no expression, low activation or inactivation of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and hypermethylation of DNA CpG sites in the NNMT gene region.

[0472] As used herein, "resulting in high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region" refers to one or more of high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and hypomethylation of DNA CpG sites in the NNMT gene region.

[0473] As used herein, the term "mitochondrial permeability transition pore" is abbreviated as mPTP (mitochondrial permeability transition pore).

[0474] As used herein, the term "peptidyl-prolyl isomerase F" is abbreviated as PPIF (Peptidyl-prolyl cis-trans isomerase F).

[0475] As used herein, "there is hypermethylation of DNA CpG sites", "there is hypermethylation of DNA CpG sites", and "DNA CpG sites are hypermethylated" may be used interchangeably.

[0476] As used herein, "there is hypomethylation of DNA CpG sites", "there is hypomethylation of DNA CpG sites", and "DNA CpG sites are hypomethylated" may be used interchangeably.

[0477] As used herein, "there is hypermethylation at a nucleotide site", "the nucleotide site becomes hypermethylated", and "the nucleotide site is hypermethylated" may be used interchangeably.

[0478] As used herein, "there is hypomethylation at a nucleotide site," "the nucleotide site becomes hypomethylated," and "the nucleotide site is hypomethylated" may be used interchangeably.

[0479] As used herein, "methylation of DNA CpG sites," "methylation of CpG nucleotides," and "CpG methylation" may be used interchangeably.

[0480] As used herein, the term "a cell" refers to a cell (e.g., a single tumor cell) or a group of cells including multiple similar cells (e.g., a tumor tissue).

[0481] As used herein, "the compound of the present invention is suitable for a tumor patient" means that the tumor of the tumor patient is sensitive to the compound of the present invention, and so on.

[0482] As used herein, "the compounds of the present invention are not suitable for tumor patients" means that the tumors of the tumor patients are insensitive to the compounds of the present invention, and the like.

[0483] As used herein, the English name of the term "NNMT" is Nicotinamide N-Methyltransferase.

[0484] As used herein, the term "bp" refers to base pair.

[0485] As used herein, the term "SST" refers to the transcription start site.

[0486] As used herein, the term "Chr11" refers to human chromosome 11 defined according to the human genome version GCF_000001405.25 (GRCh37.p13).

[0487] As used herein, the term "human chromosome 11" refers to human chromosome 11 defined according to the human genome version GCF_000001405.25 (GRCh37.p13).

[0488] As used herein, the terms "before the transcription start site" and "after the transcription start site" do not include the transcription start site itself.

[0489] As used herein, "position 114165695 of human chromosome 11" refers to the nucleotide at position 114165695 of human chromosome 11; "position 114165730 of human chromosome 11" refers to the nucleotide at position 114165730 of human chromosome 11; "position 114165769 of human chromosome 11" refers to the nucleotide at position 114165769 of human chromosome 11; "position 114165804 of human chromosome 11" refers to the nucleotide at position 114165804 on human chromosome 11; "position 114165938 on human chromosome 11" refers to the nucleotide at position 114165938 on human chromosome 11; "position 114166050 on human chromosome 11" refers to the nucleotide at position 114166050 on human chromosome 11; and "position 114166066 on human chromosome 11" refers to the nucleotide at position 114166066 on human chromosome 11.

[0490] As used herein, gene expression includes protein expression of the gene and / or mRNA expression of the gene, and the like.

[0491] As used herein, the term "DNMT3a" refers to DNA methyltransferase 3a, which may be used interchangeably with "DNMT3A."

[0492] As used herein, the term "DNMT3b" refers to DNA methyltransferase 3b, which may be used interchangeably with "DNMT3B."

[0493] As used herein, the term "DNMT1" refers to DNA methyltransferase 1.

[0494] As used herein, the term "UHRF1" refers to ubiquitin-related tau protein 1 that contains a PHD and a RING finger domain.

[0495] As used herein, the term "MS-ESI" refers to electrospray ionization mass spectrometry.

[0496] As used herein, " 1 The term "H NMR" refers to nuclear magnetic resonance hydrogen spectroscopy.

[0497] It should be understood that one skilled in the art can select the substituents and substitution patterns on the compounds of the present invention to produce chemically stable compounds, and can synthesize said compounds using techniques known in the art and the methods described below. When substituted with one or more (multiple) substituents, it should be understood that these substituents can be located on the same carbon or on different carbons, so long as a stable structure is produced.

[0498] As used herein, the terms "substitution" or "substituted" refer to the replacement of hydrogen atoms on a group with non-hydrogen atom groups as necessary to satisfy their valences and which produce chemically stable compounds, i.e., compounds that do not spontaneously undergo transformations such as cyclization or elimination.

[0499] As used herein, "deuteration" refers to the replacement of one or more hydrogen atoms in a compound or group of atoms with a deuterium atom. Deuteration can be 1-deuteration, 2-deuteration, 3-deuteration or full deuteration.

[0500] As used herein, the term "solvate" refers to a complex formed when a compound coordinates with solvent molecules in a specific ratio.

[0501] As used herein, "R", "R1" and "R 1 " have the same meaning, may be used interchangeably, and have the same meaning as other similar definitions.

[0502] As used herein, [ka] represents the bonding site of the atomic group.

[0503] As used herein, the term "alkyl group" refers to a straight-chain (i.e., unbranched) or branched saturated hydrocarbon group containing only carbon and hydrogen atoms, or a group of atoms that combines straight and branched chains. A carbon number specified before the alkyl group (e.g., C1-C6 alkyl group) refers to the alkyl group having the specified number of carbon atoms (e.g., 1 to 6), for example, C1-C4 alkyl group refers to an alkyl group containing 1 to 4 carbon atoms. Representative examples of these alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, s-butyl, t-butyl, or similar groups.

[0504] As used herein, the term "alkenyl group" refers to a hydrocarbyl group formed by removing one hydrogen atom connected to a double bond from a straight or branched chain molecule having one or more double bonds. The alkenyl group specified by the number of carbon atoms (e.g., C2-C6 alkenyl group) refers to the alkenyl group having the specified number of carbon atoms (e.g., 1 to 6), for example, C2-C4 alkenyl group refers to an alkenyl group containing 2 to 4 carbon atoms. Representative examples of these alkenyl groups include, but are not limited to, vinyl group (CH2=CH-), butenyl group (C(CH3)2=CH-) or similar atomic groups.

[0505] As used herein, the term "halogen atom" refers to a fluorine atom, chlorine atom, bromine atom, or iodine atom.

[0506] As used herein, the term "halogenated" refers to substitution with a halogen atom.

[0507] As used herein, the term "halogenated alkyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three or four) hydrogen atoms of an alkyl group with halogen atoms. The alkyl group and halogen atom are as defined above. A halogenated alkyl group specified by the number of carbon atoms (e.g., C1-C8 halogenated alkyl group) refers to a halogenated alkyl group having the specified number of carbon atoms (e.g., 1 to 8), for example, C1-C6 halogenated alkyl group refers to a halogenated alkyl group containing 1 to 6 carbon atoms. Representative examples of these halogenated alkyl groups include, but are not limited to, -CF3, -CHF2, monofluorinated isopropyl group, difluorinated butyl group or similar atomic groups.

[0508] As used herein, the term "cycloalkyl group" refers to a saturated or partially saturated monocyclic, bicyclic or polycyclic (fused, bridged or spiro) ring group. A carbon number specified before the cycloalkyl group (e.g., C3-C12) refers to the cycloalkyl group having the specified number of ring carbon atoms (e.g., 3 to 12). For example, the term "C3-C8 cycloalkyl group" refers to a saturated or partially saturated monocycloalkyl or dicycloalkyl group having 3 to 8 ring carbon atoms, including cyclopropyl, cyclobutyl, cycloamyl, cycloheptyl or similar groups. A "spirocycloalkyl group" refers to a bicyclic or polycyclic group sharing a carbon atom (called a spiro atom) between the monocyclic rings, which may contain one or more double bonds, but in which none of the rings have a completely conjugated pi-electron system. "Fused cycloalkyl group" refers to a bicyclic or polycyclic group of all carbon atoms in which each ring in the system shares an adjacent pair of carbon atoms with another ring in the system, where one or more of the rings may contain one or more double bonds, but none of the rings has a complete conjugated pi-electron system. "Bridged cycloalkyl group" refers to a polycyclic group of all carbon atoms in which any two rings share two carbon atoms that are not directly connected, where such group may contain one or more double bonds, but none of the rings has a complete conjugated pi-electron system. Representative examples of these cycloalkyl groups are as follows: [ka]

[0509] As used herein, the term "halogenated cycloalkyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three or four) hydrogen atoms of a cycloalkyl group with a halogen atom. The cycloalkyl group and the halogen atom are as defined above. A cycloalkyl group limited by the number of carbon atoms (e.g., C3-C8 halogenated cycloalkyl group) refers to a cycloalkyl group having the corresponding number of ring carbon atoms (e.g., 3 to 8), for example, a C3-C8 halogenated cycloalkyl group refers to a halogenated cycloalkyl group containing 3 to 8 ring carbon atoms. Representative examples of these halogenated cycloalkyl groups include, but are not limited to, a monofluorinated cyclopropyl group, a monochlorinated cyclobutyl group, a monofluorinated cycloamyl group, a difluorinated cycloheptyl group or similar atomic groups.

[0510] As used herein, the term "alkoxyl group" refers to an R-O-atom group, where R is an alkyl group. Alkyl groups are as defined above. An alkoxyl group that is specified by the number of carbon atoms before the alkoxyl group (e.g., a C1-C8 alkoxyl group) refers to an alkoxyl group in which the alkyl group has the specified number of carbon atoms (e.g., 1 to 8). Representative examples of these alkoxyl groups include, but are not limited to, methoxy, ethoxy, N-propoxy, isopropoxy, t-butoxy, or similar groups.

[0511] As used herein, the term "alkylthiol group" refers to an R-S group, where R is an alkyl group. The alkyl group is as defined above. An alkylthiol group that is specified by the number of carbon atoms before the alkylthiol group (e.g., a C1-C8 alkoxyl group) refers to an alkyl group in the alkylthiol group that has the specified number of carbon atoms (e.g., 1 to 8). Representative examples of these alkylthiol groups include, but are not limited to, a methylthio group, an ethylthio group, an N-propylthio group, an isopropylthio group, a t-butylthio group, or a similar group.

[0512] As used herein, the term "halogenated alkoxyl group" refers to a halogenated alkyl group -O-, the halogenated alkyl group being as defined above. For example, a C1-C6 halogenated alkoxyl group refers to a halogenated alkoxyl group having 1 to 6 carbon atoms. Representative examples of these halogenated alkoxyl groups include, but are not limited to, a monofluorinated methoxy group, a monofluorinated ethoxy group, a difluorinated butoxy group, or similar atomic groups.

[0513] As used herein, the term "halogenated alkylthiol group" refers to a halogenated alkyl group -S-. The halogenated alkyl group is as defined above. For example, a C1-C6 halogenated alkylthiol group refers to a halogenated alkylthiol group having 1 to 6 carbon atoms. Representative examples of these halogenated alkylthiol groups include, but are not limited to, a monofluorinated methylthio group, a monofluorinated ethylthio group, a difluorinated butylthio group, or a similar atomic group.

[0514] As used herein, the term "cycloalkoxyl group" refers to an R-O-atom group, where R is a cycloalkyl group. Cycloalkyl groups are as defined above. A cycloalkoxyl group that is specified by the number of carbon atoms before the cycloalkoxyl group (e.g., a C3-C8 cycloalkoxyl group) refers to a cycloalkyl group in the cycloalkoxyl group that has the specified number of carbon atoms (e.g., 3 to 8). Representative examples of these cycloalkoxyl groups include, but are not limited to, a cyclopropoxy group, a cyclobutoxy group, or similar groups.

[0515] As used herein, the term "cycloalkylthiol group" refers to an R-S-atom group, where R is a cycloalkyl group. Cycloalkyl groups are as defined above. A cycloalkylthiol group that is specified by the number of carbon atoms before the cycloalkylthiol group (e.g., a C3-C8 cycloalkoxyl group) refers to a cycloalkyl group in the cycloalkylthiol group that has the specified number of carbon atoms (e.g., 3 to 8). Representative examples of these cycloalkylthiol groups include, but are not limited to, a cyclopropylthio group, a cyclobutylthiol group, or similar atomic groups.

[0516] As used herein, the term "halogenated cycloalkoxyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three or four) hydrogen atoms of a cycloalkoxyl group with a halogen atom. The cycloalkoxyl group and the halogen atom are as defined above. A halogenated cycloalkoxyl group limited by the number of carbon atoms (e.g., a C3-C8 halogenated cycloalkoxyl group) refers to a halogenated cycloalkoxyl group having the specified number of ring carbon atoms (e.g., 3 to 8), for example, a C3-C8 halogenated cycloalkoxyl group refers to a halogenated cycloalkoxyl group containing 3 to 8 ring carbon atoms. Representative examples of these halogenated cycloalkoxyl groups include, but are not limited to, a monofluorinated cyclopropyl group -O-, a monochlorinated cyclobutyl group -O-, a monofluorinated cycloamyl group -O-, a difluorinated cycloheptyl group -O-, or similar atomic groups.

[0517] As used herein, the term "halogenated cycloalkylthiol group" refers to an atomic group formed by replacing one or more (preferably one, two, three or four) hydrogen atoms of a cycloalkylthiol group with a halogen atom. The cycloalkylthiol group and the halogen atom are as defined above. A halogenated cycloalkylthiol group limited by the number of carbon atoms (e.g., a C3-C8 halogenated cycloalkoxyl group) refers to a halogenated cycloalkylthiol group having the corresponding number of ring carbon atoms (e.g., 3 to 8), for example, a C3-C8 halogenated cycloalkylthiol group refers to a halogenated cycloalkylthiol group containing 3 to 8 ring carbon atoms. Representative examples of these halogenated cycloalkylthiol groups include, but are not limited to, a monofluorinated cyclopropyl group -S-, a monochlorinated cyclobutyl group -S-, a monofluorinated cycloamyl group -S-, a difluorinated cycloheptyl group -S- or similar atomic groups.

[0518] As used herein, the term "heterocycloalkyl ring" refers to a fully saturated or partially unsaturated ring (including, but not limited to, a 3- to 7-membered monocyclic ring, a 7- to 11-membered bicyclic ring, or an 8- to 16-membered tricyclic ring) in which at least one heteroatom is present in a ring having at least one carbon atom. The number of members preceding the heterocycle refers to the number of ring atoms in the heterocycloalkyl ring. For example, a 3- to 16-membered heterocycle refers to a heterocycle having 3 to 16 ring atoms. Each heterocycle having a heteroatom may have one or more (e.g., 1, 2, 3, or 4) heteroatoms, each of which is independently selected from a nitrogen atom, an oxygen atom, or a sulfur atom, where the nitrogen atom or sulfur atom may be oxidized, and the nitrogen atom may also be quaternized. Representative examples of these monocyclic heterocycloalkyl rings include, but are not limited to, an azetidinyl ring, an oxetane ring, a tetrahydrofuranyl ring, a piperidine ring, and a piperazine ring. Multicyclic heterocycloalkyl rings include piperazine rings having spiro, fused and bridged rings, where the associated spiro, fused and bridged heterocycles are optionally connected to other rings by single bonds or are further fused to other cycloalkyl and heterocycles through any two or more atoms on the ring.

[0519] As used herein, the term "heterocycloalkyl group" refers to a fully saturated or partially unsaturated cyclic group (including, but not limited to, a series of 3- to 7-membered monocyclic, 7- to 11-membered bicyclic, 8- to 16-membered tricyclic, etc.) in which at least one heteroatom is present in a ring having at least one carbon atom. The number of members in front of the heterocycloalkyl group refers to the number of ring atoms in the heterocycloalkyl group. For example, a 3- to 16-membered heterocycloalkyl group refers to a heterocycloalkyl group having 3 to 16 ring atoms. Each heterocycle having a heteroatom may have one or more (e.g., 1, 2, 3, or 4) heteroatoms, each of which is independently selected from a nitrogen atom, an oxygen atom, or a sulfur atom, where the nitrogen atom or sulfur atom may be oxidized and the nitrogen atom may be quaternized. Representative examples of these monocyclic heterocycloalkyl groups include, but are not limited to, an azetidinyl group, an oxetane group, a tetrahydrofuranyl group, a piperidine group, a piperazine group, etc. Polycyclic heterocycloalkyl groups include spirocyclic, fused-ring, and bridged-ring heterocyclic groups. Related spirocyclic, fused-ring, and bridged-ring heterocycloalkyl groups are optionally connected to other atomic groups through a single bond or are further fused to other cycloalkyl rings and heterocycles through any two or more atoms on the ring.

[0520] As used herein, the term "aryl group" refers to an all-carbon atom monocyclic or fused polycyclic (rings sharing adjacent pairs of carbon atoms) atomic group having a conjugated π-electron system, which is an atomic group of an aromatic cyclic hydrocarbon compound. The aryl group specified by the number of carbon atoms before the aryl group (e.g., C6-C12 aryl group) refers to the aryl group having the specified number of ring carbon atoms (e.g., 6 to 12). Representative examples of these aryl groups include phenyl and naphthoyl groups.

[0521] As used herein, the term "heteroaryl group" refers to an aromatic heterocyclic group having one or more (preferably one, two, three or four) heteroatoms. The group may be a single ring (monocyclic) or multiple rings (bicyclic, tricyclic or polycyclic) that are fused or covalently bonded, and each heterocyclic ring that includes a heteroatom may have one or more (e.g., one, two, three or four) heteroatoms independently selected from oxygen, sulfur and nitrogen atoms. The number of members in the heteroaryl group refers to the number of ring atoms in the heteroaryl group. For example, a 5-12 membered heteroaryl group refers to a heteroaryl group having 5 to 12 ring atoms. Representative examples of these heteroaryl groups include, but are not limited to, pyrrolyl, pyrazole, imidazole, thiazole, furan, pyridine, pyrimidine, and the like.

[0522] As used herein, the term "carboxyl group" refers to a group of atoms of -COOH or -alkyl-COOH, where alkyl is as defined above. For example, a "C2-C4 carboxyl group" refers to a group of atoms of -C1-C3 alkyl-COOH. Representative examples of these carboxyl groups include, but are not limited to, -COOH, -CH2COOH, or similar groups.

[0523] As used herein, the term "ester group" refers to a group of atoms of RC(O)-O- or -C(O)-OR, where alkyl group (R) is as defined above. For example, a "C2-C4 ester group" refers to a group of atoms of -C1-C3 alkyl group -C(O)-O- or a group of atoms of -C(O)-O-C1-C3 alkyl group. Representative examples of these ester groups include, but are not limited to, CH3C(O)O-, C2H5C(O)O-, (CH3)2CHC(O)O-, -C(O)OCH3, -C(O)OC2H5, or similar groups.

[0524] As used herein, the term "acylamino group" refers to the group RC(O)-N- or -C(O)-NR, where the alkyl group (R) is as defined above. For example, a "C2-C4 acylamino group" refers to the group -C1-C3 alkyl group -C(O)-N- or -C(O)-N-C1-C3 alkyl group. Representative examples of these acylamino groups include, but are not limited to, CH3C(O)-N-, C2H5C(O)-N-, (CH3)2CHC(O)-N-, -C(O)-N-CH3, -C(O)-N-C2H5, or similar groups.

[0525] As used herein, the term "acyl group" means [ka] Here, R represents an alkyl group, and the alkyl group is as defined above. The acyl group is limited by the number of carbon atoms (e.g., C2-C6 acyl group) before the acyl group means that the acyl group has the number of ring carbon atoms (e.g., 2 to 6), and for example, C2-C4 acyl group means an atomic group having the structure of C1-C3 alkyl group -C(O)-. Representative examples of these acyl groups include, but are not limited to, CH3C(O)-, C2H5C(O)-, or similar atomic groups.

[0526] As used herein, "-C(O)-" [ka]

[0527] As used herein, an "amino group" alone or as part of another substituent refers to -NH2.

[0528] As used herein, a "nitro group" alone or as part of another substituent refers to --NO2.

[0529] As used herein, a "cyan group" alone or as part of another substituent refers to -CN.

[0530] As used herein, a "hydroxyl group" alone or as part of another substituent refers to --OH.

[0531] As used herein, a "mercapto group" alone or as part of another substituent refers to -SH.

[0532] In this specification, all substituents are meant to be unsubstituted unless expressly stated as "substituted". The term "substituted" refers to a substituent replacing one or more hydrogen atoms on an atomic group. The substituents are the substituents described above or appearing in each Example. Preferably, the "substitution" refers to one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on a ring or atomic group being replaced by a C1-C8 alkyl group, a C3-C12 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro group, -CN, a hyaluronic acid, a hydroxyl group ... It refers to being substituted by a substituent selected from a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, and a 5-10 membered heterocycloalkyl group.

[0533] In the present invention, "prevention" refers to a method of preventing the onset of a disease and / or its associated symptoms or protecting a subject from contracting the disease. As used herein, "prevention" also refers to delaying the onset of a disease and / or its associated symptoms, as well as reducing the subject's risk of contracting the disease.

[0534] "Treatment" according to the present invention means slowing and terminating the progression of the disease or eliminating the disease, but does not require 100% inhibition, elimination or reversal. In some embodiments, the associated disease (e.g., tumor) and its complications are reduced, inhibited and / or reversed by at least about 10%, 30%, 50%, 80%, 90% or 100%, etc. under the action of the compounds of the present invention, compared to the levels observed in the absence of the compounds of the present invention.

[0535] compound As used herein, "a compound of the present invention", "said compound of the present invention", "a compound of formula I of the present invention" or "a compound of formula I" may be used interchangeably and refer to a compound having the chemical structure of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof. This term should be understood to include mixtures of the above components. [ka]

[0536] In particular, the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is described in the first aspect of the invention.

[0537] In the present invention, the compound of formula I can be racemic, R or S. The racemic, R or S structure of the compound of the present invention and the knowledge of how to determine it are well known to those skilled in the art, for example, the racemic, R or S structure are as follows: [ka]

[0538] Other compounds may be in racemic, R or S configuration, among many others.

[0539] Typically, the compounds of formula I of the present invention are the specific compounds prepared in the Examples of the present invention.

[0540] The compounds of formula I of the present invention may be prepared by organic synthesis methods known in the art.

[0541] In the present invention, the term "pharmaceutical acceptable salt" refers to a salt formed by the compound of the present invention and an acid or base, which is suitable for use as a drug. Pharmaceutically acceptable salts include inorganic salts and organic salts. A preferred type of salt is a salt formed by the compound of the present invention and an acid, and the acid suitable for forming the salt includes, but is not limited to, inorganic acids such as hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, phosphoric acid, etc., organic acids such as formic acid, acetic acid, trifluoroacetic acid, trifluoroformic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, etc., and acidic amino acids such as aspartic acid and glutamic acid. One type of preferred salt is a metal salt formed by a compound of the present invention and a base, and bases suitable for forming such salts include, but are not limited to, inorganic bases such as sodium hydroxide, potassium hydroxide, sodium carbonate, sodium bicarbonate, sodium phosphate, and organic bases such as ammonia, triethylamine, diethylamine, and the like.

[0542] The present invention may convert the compounds of formula I into their pharma- ceutically acceptable salts in a conventional manner, for example, by adding a solution of a suitable acid to a solution of the compound, and removing the solvent after complete salification, the suitable salt of the compound of the present invention can be obtained.

[0543] Preferably, said compounds of the invention are those prepared in the Examples of the invention.

[0544] Mitochondrial permeability transition pore In the present invention, the English name of the term "mitochondria permeability transition pore" is mitochondria permeability transition pore, abbreviated as mPTP.

[0545] The remarkably excellent therapeutic effect of the compound of the present invention on tumors with low expression, no expression, low activity or inactivity of the mitochondrial membrane permeability transition pore means that tumors with low expression, no expression, low activity or inactivity of the mitochondrial membrane permeability transition pore are sensitive to the compound of the present invention.

[0546] Preferably, the tumour with low, absent, low activity or inactive mitochondrial permeability transition pore expression is as described in the first aspect of the invention.

[0547] In the present invention, the expression level or activity of the mitochondrial membrane permeability transition pore is measured by a conventional method, for example, measuring the activity of mPTP or measuring the expression level of mPTP at the protein level or mRNA level.

[0548] Peptidylprolyl isomerase F In the present invention, the English name of the term "peptidyl-prolyl isomerase F" is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF.

[0549] The remarkably excellent therapeutic effect of the compound of the present invention on tumors with low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F means that tumors with low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F are sensitive to the compound of the present invention.

[0550] Preferably, the tumour with under-expression, non-expression, low activity or inactivity of peptidyl prolyl isomerase F is as described in the first aspect of the invention.

[0551] In the present invention, the expression level or activity of peptidylprolyl isomerase F is measured by a conventional method, for example, measuring the activity of PPIF or measuring the expression level of PPIF at the protein level or mRNA level.

[0552] NNMT gene In the present invention, the English name of NNMT is Nicotinamide N-Methyltransferase. Different databases have different identification numbers for NNMT gene, such as HGNC:7861; Entrez Gene:4837; Ensembl:ENSG00000166741; OMIM:600008; UniProtKB:P40261.

[0553] According to the human genome version GCF_000001405.25 (GRCh37.p13), the NNMT gene region is located from bp 114,128,528 to bp 114,184,258 on human chromosome 11, and is a DNA sequence with a total length of 55,731 bp. This region includes the NNMT gene promoter region, the NNMT gene exon region and the NNMT gene intron region, and the NNMT gene transcription start site is at bp 114,166,535.

[0554] The NNMT gene promoter region is the nucleotide sequence from bp 114,164,535 to bp 114,167,034 on human chromosome 11, i.e., the sequence from 2000 bp (bold) before the transcription start site of the NNMT gene to the transcription start site itself and 499 bp (underlined) after it. The NNMT gene promoter region has a total length of 2500 bp, and its nucleotide sequence is shown in the following SEQ ID NO:1.

[0555] SEQ ID NO: 1: GAGGAGGTGCTTGCCAGACACTGGGTCATGGCAGTGGTCGGTGAAGCTGCAGTTGCCTAGGGCAGGGATGGAGAGAGAGTCTGGGCATGAGGAGAGGGTCTCGGGATGTTTGGCTGGACTAGATTTTACAGAAAGCCTTATCCAGGCTTTTAAAATTACTCTTTCCAGACTTCATCTGAGACTCCTTCTTCAGCCAACATTCCTTAGCCCTGAATACATTTCCTATCCTCATCTTTCCCTTCTTTTTTTTCCTTTCTTTTACATGTTTAAATTTAAACCATTCTTCGTGACCCCTTTTCTTGGGAGATTCATGGCAAGAACGAGAAGAATGATGGTGCTTGTTAGGGGATGTCCTGTCTCTCTGAACTTTGGGGTCCTATGCATTAAATAATTTTCCTGACGAGCTCAAGTGCTCCCTCTGGTCTACAATCCCTGGCGGCTGGCCTTCATCCCTTGGGCAAGCATTGCATACAGCTCATGGCCCTCCCTCTACCATACCC .

[0556] In the present invention, the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site is positions 951-2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0557] In the present invention, the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site is positions 951-1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0558] In the present invention, the region from 840 bp before the transcription start site of the NNMT gene to 469 bp before the transcription start site is positions 1161-1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0559] In the present invention, the sites of the nucleotide sequence of SEQ ID NO:1 corresponding to positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 of human chromosome 11 are shown in Table 1, respectively. [Table 1]

[0560] DNA methylation DNA methylation is a form of chemical modification of DNA that alters gene expression without changing the DNA sequence. Many studies have shown that DNA methylation may alter chromatin structure, DNA morphology, DNA stability, and DNA-protein interaction patterns, thereby regulating gene expression.

[0561] DNA methylation is one of the first and most thoroughly studied epigenetic regulators. In the broad sense, DNA methylation refers to the chemical modification process in which specific bases in DNA sequences acquire one methyl group via covalent bond with S-adenosyl methionine as the methyl donor under the catalysis of DNA methyltransferase 1. This DNA methylation modification can occur at the C-5 position of cytosine, the N-6 position of adenine, and the N-7 position of guanine. In general research, DNA methylation refers to the process in which the fifth carbon atom of cytosine in CpG dinucleotides is methylated. The product is called 5-methylcytosine (5-mC), which is the main form of DNA methylation in eukaryotes such as plants and animals. DNA methylation, as a relatively stable modification, can be inherited to new generations of DNA during the DNA replication process under the action of DNA methyltransferases, making it an important regulator of epigenetic inheritance.

[0562] DNA methylation reactions can be divided into two types: in the first type, DNA with two unmethylated strands is methylated, called de novo methylation, and in the second type, double-stranded DNA with one methylated strand is methylated on the other unmethylated strand, called maintenance methylation.

[0563] Typically, DNA methylation is the methylation of DNA CpG sites. CpG dinucleotides are distributed very unevenly in the human genome, and some segments of the genome have CpGs at higher than normal rates. Enriched regions of CpG sites (also called CpG islands) are mainly located in promoter and exon regions of genes, and some regions are enriched in CpG dinucleotides, among which more than 60% of gene promoters contain CpG islands. Here, CpG is an abbreviation of cytosine (C)-phosphate (p)-guanine (G).

[0564] Intracellular gene expression is subject to various types of regulation by signal transduction pathways, transcription factors, and epigenetic modifications. DNA methylation modification is an important method by which epigenetic modifications regulate gene expression. The DNA methylation level in a specific gene region always affects the expression level of that gene. Compared with the regulation of gene expression by signal transduction pathways and transcription factors, DNA methylation modification, an epigenetic modification, has a more stable effect on gene expression and is less susceptible to the extracellular environment. DNA methylation modification is an ideal biomarker because it can be easily detected by existing technologies.

[0565] tumor According to the present study, the compounds of the present invention are useful for the prevention and / or treatment of tumors.

[0566] In the present invention, the terms "tumor," "carcinosis," "cancer," and "mass" may be used interchangeably.

[0567] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor having low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore. As a representative example, a tumor having low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore according to the present invention is as described in the first aspect of the present invention.

[0568] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor having low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F. As a representative example, the tumor having low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F according to the present invention is as described in the first aspect of the present invention.

[0569] In a preferred embodiment of the present invention, the "tumor" of the present invention includes a tumor having low or no expression of the NNMT gene. As a representative example, the tumor having low or no expression of the NNMT gene of the present invention is as described in the first aspect of the present invention.

[0570] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor with high expression of DNA methyltransferase. As a representative example, the tumor with high expression of DNA methyltransferase according to the present invention is as described in the first aspect of the present invention.

[0571] The DNA methyltransferase according to the present invention includes, but is not limited to, DNMT1, DNMT3a, DNMT3b, or a combination thereof. Preferably, the DNA methyltransferase according to the present invention includes DNMT1.

[0572] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor with high expression of DNMT1. As a representative example, the tumor with high expression of DNMT1 according to the present invention is as described in the first aspect of the present invention.

[0573] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor with high expression of DNMT3a. As a representative example, the tumor with high expression of DNMT3a according to the present invention is as described in the first aspect of the present invention.

[0574] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor with high expression of DNMT3b. As a representative example, the tumor with high expression of DNMT3b according to the present invention is as described in the first aspect of the present invention.

[0575] In a preferred embodiment of the present invention, the "tumor" according to the present invention comprises a tumor with high expression of UHRF1 (ubiquitin-related tau protein 1 containing PHD and ring finger domains). As a representative example, the tumor with high expression of UHRF1 according to the present invention is as described in the first aspect of the present invention.

[0576] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor having hypermethylation of the nucleotide site of the NNMT gene. As a representative example, the tumor having hypermethylation of the nucleotide site of the NNMT gene according to the present invention is as described in the first aspect of the present invention.

[0577] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor having hypermethylation of DNA CpG sites in the NNMT gene region. As a representative example, the tumor having hypermethylation of DNA CpG sites in the NNMT gene region according to the present invention is as described in the first aspect of the present invention.

[0578] Typically, the tumor according to the invention is as described in the first aspect of the invention.

[0579] In the present invention, representative tumor types corresponding to various tumor cell lines are shown in Table 2 below. [Table 2]

[0580] Antitumor drugs In the present invention, the antitumor drug can be the compound of formula I of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0581] use The present invention provides the use of the compounds of the invention in the prevention and / or treatment of tumors.

[0582] In particular, the compound of the present invention has a significantly excellent therapeutic effect on tumors with low expression, no expression, low activity or inactivity of the mitochondrial membrane permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of the nucleotide site of the NNMT gene and / or tumors with hypermethylation of the DNA CpG site of the NNMT gene region, i.e., tumors with low expression, no expression, low activity or inactivity of the mitochondrial membrane permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of the nucleotide site of the NNMT gene and / or tumors with hypermethylation of the DNA CpG site of the NNMT gene region are sensitive to the compound of the present invention. The expression level or activity of mitochondrial permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of NNMT gene and / or the methylation level of DNA CpG site of NNMT gene region can serve as markers for determining whether the compound of the present invention is suitable for the refinement treatment of tumor cells. The markers can effectively identify tumor patients who are sensitive to the compound of the present invention, improve the therapeutic effect, and may avoid administering the compound of the present invention to tumor patients who are not sensitive to it, thereby realizing the refinement treatment of tumors.

[0583] The present invention provides a method for preventing and / or treating a tumor, which comprises administering the compound of the present invention to a subject.

[0584] The compound of the present invention has a significantly excellent therapeutic effect on tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidylprolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. In the process of preventing and / or treating a tumor, first, an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, a promoter of methylation at the nucleotide site of the NNMT gene, and / or a promoter of methylation at the DNA CpG site of the NNMT gene region are administered to the subject of treatment so that the tumor of the subject of treatment becomes underexpressed, not expressed, underactivated or inactivated in the mitochondrial membrane permeability transition pore, underexpressed, not expressed, underactivated or inactivated in the peptidyl prolyl isomerase F, underexpressed or not expressed in the NNMT gene, overexpressed in the DNA methyltransferase, overexpressed in the UHRF1, overmethylated in the nucleotide site of the NNMT gene, and / or overmethylated in the DNA CpG site of the NNMT gene region, and then the compound of the present invention is administered to prevent and / or treat the tumor. Therefore, a compound capable of significantly enhancing the antitumor effect by combining with an inhibitor of the mitochondrial membrane permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation at the nucleotide site of the NNMT gene, and / or an enhancer of methylation at the DNA CpG site of the NNMT gene region has been developed. The compound of the present invention can be combined with an inhibitor of the mitochondrial membrane permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation at the nucleotide site of the NNMT gene, and / or an enhancer of methylation at the DNA CpG site of the NNMT gene region, thereby significantly enhancing the therapeutic effect of the compound of the present invention against tumors.

[0585] In another preferred embodiment, the subject to be treated is a human or non-human mammal (eg, rodents, rabbits, monkeys, livestock, dogs, cats).

[0586] In the present invention, the method for under-expressing, not expressing, under-activating or inactivating the mitochondrial membrane permeability transition pore, under-expressing, not expressing, under-activating or inactivating peptidyl prolyl isomerase F, under-expressing or not expressing the NNMT gene, over-expressing DNA methylase, over-expressing UHRF1, hypermethylating the nucleotide site of the NNMT gene, and / or hypermethylating the DNA CpG site in the NNMT gene region is not particularly limited, and for example, the expression or activity of the mitochondrial membrane permeability transition pore and / or peptidyl prolyl isomerase F is specifically suppressed in a tumor through means such as gene insertion, gene knockout or gene suppression (e.g., introducing shRNA).

[0587] In another preferred embodiment, said inhibitor of peptidyl prolyl isomerase F comprises an shRNA.

[0588] In another preferred example, the nucleotide sequence of the shRNA is GTTCTTCATCTGCACCATAAA.

[0589] marker The present invention provides a marker for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients, the marker comprising the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region.

[0590] In one embodiment, the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site in the NNMT gene region serve as markers for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients. The method includes: in tumor cells of a tumor patient, there is an under-expression, under-expression, under-activation or inactivation of the mitochondrial permeability transition pore, there is an under-expression, under-expression, under-activation or inactivation of peptidyl prolyl isomerase F, there is an under-expression or under-expression of the NNMT gene, there is an over-expression of DNA methyltransferase, there is an over-expression of UHRF1, there is a hypermethylation of nucleotide sites of the NNMT gene, and / or there is a hypermethylation of DNA CpG sites in the NNMT gene region, then said compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for the prevention and / or treatment of tumors in said tumor patient, and / or In tumor cells of a tumor patient, when there is high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of the NNMT gene, and / or low methylation of DNA CpG sites in the NNMT gene region, said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes unsuitable for tumor prevention and / or treatment in said tumor patient.

[0591] Specifically, the tumor in which the mitochondrial permeability transition pore is underexpressed, not expressed, low-active or inactive, and / or the tumor in which peptidylprolyl isomerase F is underexpressed, not expressed, low-active or inactive, is as described in the first aspect of the present invention.

[0592] Specifically, the tumors exhibiting low or no expression of the NNMT gene, the tumors exhibiting high expression of DNA methyltransferase (e.g., DNMT1), the tumors exhibiting high expression of UHRF1, the tumors exhibiting hypermethylation of nucleotide sites in the NNMT gene and / or the tumors exhibiting hypermethylation of DNA CpG sites in the NNMT gene region are as described in the first aspect of the present invention.

[0593] Specifically, the tumor exhibiting high expression or activation of the mitochondrial permeability transition pore and / or the tumor exhibiting high expression or activation of peptidylprolyl isomerase F is as described in the second aspect of the present invention.

[0594] In one preferred embodiment of the present invention, the tumor with high expression of the NNMT gene, the tumor with low expression of a DNA methyltransferase (e.g., DNMT1), the tumor with low expression of UHRF1, the tumor with hypomethylation of nucleotide sites in the NNMT gene and / or the tumor with hypomethylation of DNA CpG sites in the NNMT gene region are as described in the second aspect of the present invention.

[0595] The present invention further provides the use of the marker (or the expression level thereof) or detection agent, which is used to manufacture a detection agent kit, which is used to determine whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients.

[0596] Compositions or formulations, combinations of active ingredients and medical kits, and methods of administration Preferably, the composition according to the present invention is a pharmaceutical composition, and the composition according to the present invention may comprise a pharma- ceutically acceptable carrier.

[0597] As used herein, "pharmaceutical acceptable carrier" refers to one or more compatible solid, semi-solid, liquid and gel fillers that are suitable for human or animal use and must be of sufficient purity and sufficiently low toxicity. "Compatibility" refers to the fact that each component in the drug composition and the active ingredient of the drug can be mixed and mixed together without significantly decreasing the efficacy of the drug.

[0598] In the present invention, it should be understood that the pharma- ceutically acceptable carrier is not particularly limited and may be selected from materials commonly used in the art, prepared by a conventional method, or purchased from the market. Some representative examples of pharma-ceutically acceptable carriers include cellulose and its derivatives (e.g., methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, etc.), gelatin, talc, solid lubricants (e.g., stearic acid and magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyhydric alcohols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (e.g., Tween), wetting agents (e.g., sodium lauryl sulfate), buffers, chelating agents, thickeners, pH adjusters, penetration enhancers, colorants, flavorings, stabilizers, antioxidants, preservatives, bacteriostatic agents, heat-free raw water, etc.

[0599] In a preferred embodiment of the present invention, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0600] In a preferred embodiment of the present invention, the type of the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0601] Representative examples of the composition or formulation include tablets, injections, infusions, ointments, gels, solutions, pills, and coatings.

[0602] The drug formulation should be consistent with the dosage regimen. The drug of the present invention may also be used with other synergistic therapeutic agents (before, during, or after use). When using a drug composition or formulation, a safe and effective amount of drug is administered to the subject (e.g., a human or non-human mammal). The safe and effective amount is usually at least about 10 μg / kg of body weight, and in most cases, less than about 8 mg / kg of body weight, preferably about 10 μg / kg to about 1 mg / kg of body weight. Of course, the specific dosage should be determined in consideration of conditions such as the route of administration and the health condition of the patient, but these conditions are taken into account by a skilled physician.

[0603] The present invention mainly has the following excellent technical effects.

[0604] The present invention has developed a compound that has a significantly superior and precise therapeutic effect on tumors with low, no, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low, no, low activity or inactivity of peptidyl prolyl isomerase F, tumors with low or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. Tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of the nucleotide site of the NNMT gene and / or tumors with hypermethylation of the DNA CpG site of the NNMT gene region are highly sensitive to the compound of the present invention, i.e., the compound of the present invention has a significantly superior therapeutic effect on tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of the nucleotide site of the NNMT gene and / or tumors with hypermethylation of the DNA CpG site of the NNMT gene region. Therefore, the compound of the present invention may perform precision treatment on tumors with low, no, low activity or inactivity of mitochondrial permeability transition pore, low, no, low activity or inactivity of peptidylprolyl isomerase F, low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of nucleotide sites of NNMT gene and / or high methylation of DNA CpG sites in NNMT gene region, thereby improving the therapeutic effect and avoiding administration of the compound of the present invention to tumor patients who are not sensitive to it.Therefore, the compound of the present invention, which has a significantly superior therapeutic effect on tumors with low, no, low activity or inactivity of the mitochondrial permeability transition pore, low, no, low activity or inactivity of peptidylprolyl isomerase F, low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene and / or hypermethylation of DNA CpG sites in the NNMT gene region, has advantages such as better preventive and therapeutic effects on tumors, low drug dosage and small side effects, and not only improves the preventive and therapeutic effects of the compound of the present invention on tumors, but also reduces side effects and improves patient compliance.

[0605] We will further describe the present invention in conjunction with the following specific examples. The following specific examples provide detailed embodiments and specific operation procedures on the basis of the present technical solutions, but it should be understood that the protection scope of the present invention is not limited to these examples. EXAMPLES

[0606] The English name of the term "mitochondria permeability transition pore" is mitochondria permeability transition pore, abbreviated as mPTP.

[0607] The English name of the term "peptidyl-prolyl isomerase F" is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF.

[0608] DNMT3a refers to DNA methyltransferase 3a, and its English name is DNA methyltransferase 3a, NCBI entrez gene:1788; Uniprotkb / Swiss-port: Q9Y6K1.

[0609] DNMT3b refers to DNA methyltransferase 3b, and its English name is NDNA methyltransferase 3b, CBI entrez gene:1789; Uniprotkb / Swiss-port: Q9UBC3.

[0610] DNMT1 refers to DNA methyltransferase 1, and its English name is DNA methyltransferase 1, NCBI entrez gene:1786; Uniprotkb / Swiss-port: P26358.

[0611] UHRF1 refers to ubiquitin-related tau protein 1 containing PHD and RING finger domains, and its English name is NCBI entrez gene:29128; Uniprotkb / Swiss-port:Q96T88.

[0612] The English name of the NNMT gene is Nicotinamide N-Methyltransferase.

[0613] Example 1 Synthesis of compound AB31882 The chemical structure of the compound AB31882 is as follows: [ka]

[0614] The method for synthesizing compound AB31882 is as follows. [ka]

[0615] Compound 1 (200 mg, 0.54 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and butenyl magnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31882 from the crude product via thin layer chromatography (DCM / MeOH=30 / 1).

[0616] Compound AB31882: MS-ESI: Theoretical value [M+H] + : 392.18, actual value: 392.20. 1 H NMR(400 MHz, CDCl3)δ 7.14(s, 1H), 6.75-6.72(m, 2H), 6.59(s, 1H), 5.94(s, 2H), 5.81(s, 1H), 5.76-5.67(m, 1H), 4.95-4.84(m, 2H), 4.76-4.73(m, 1H), 3.88(s, 3H), 3.85(s, 3H), 3.49-3.29(m, 2H), 2.93-2.80(m, 2H), 2.06-1.71(m, 4H).

[0617] Example 2 Synthesis of compound AB31883 The chemical structure of the compound AB31883 is as follows: [ka]

[0618] The method for synthesizing compound AB31883 is as follows. [ka]

[0619] Compound 1 (200 mg, 0.54 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and ethyl magnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and the reaction is quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31883 from the crude product via thin layer chromatography (DCM / MeOH=30 / 1).

[0620] Compound AB31883: MS-ESI: Theoretical value [M+H] + : 366.17, actual value: 366.10. 1 H NMR(400 MHz, CDCl3)δ 7.14(s, 1H), 6.76-6.71(m, 2H), 6.59(s, 1H), 5.94(s, 2H), 5.78(s, 1H), 4.70-4.67(m, 1H), 3.88(s, 3H), 3.84(s, 3H), 3.46-3.44(m, 1H), 3.32-3.27(m, 1H), 2.93-2.79(m, 2H), 1.78-1.64(m, 2H), 0.82-0.78(m, 3H).

[0621] Example 3 Synthesis of compound AB31884 The chemical structure of the compound AB31884 is as follows: [ka]

[0622] The method for synthesizing compound AB31884 is as follows. [ka]

[0623] Compound 1 (200 mg, 0.54 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and propylmagnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31884 from the crude product via thin layer chromatography (DCM / MeOH=30 / 1).

[0624] Compound AB31884: MS-ESI: Theoretical value [M+H] + : 380.18, actual value: 380.10. 1 H NMR(400 MHz, CDCl3)δ 7.14(s, 1H), 6.76-6.73(m, 2H), 6.59(s, 1H), 5.94(s, 2H), 5.80(s, 1H), 4.73-4.70(m, 1H), 3.88(s, 3H), 3.84(s, 3H), 3.47-3.20(m, 2H), 2.87-2.79(m, 2H), 1.73-1.59(m, 2H), 1.29-1.20(m, 2H), 0.81-0.78(m, 3H).

[0625] Example 4 Synthesis of compound AB31885 The chemical structure of the compound AB31885 is as follows: [ka]

[0626] The method for synthesizing compound AB31885 is as follows. [ka]

[0627] Compound 1 (200 mg, 0.54 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and isopropylmagnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31885 from the crude product via thin layer chromatography (DCM / MeOH=30 / 1).

[0628] Compound AB31885: MS-ESI: Theoretical value [M+H]+: 380.18, Found value: 380.20. 1 H NMR(400 MHz, CDCl3)δ 7.13(s, 1H), 6.78-6.71(m, 2H), 6.59(s, 1H), 5.94(s, 2H), 5.77(s, 1H), 5.43-5.42(m, 1H), 3.87(s, 3H), 3.84(s, 3H), 3.51-3.45(m, 2H), 2.97-2.92(m, 1H), 2.81-2.74(m, 1H), 2.07-2.02(m, 1H), 0.90-0.86(m, 6H).

[0629] Example 5 Synthesis of compound AB31886 The chemical structure of the compound AB31886 is as follows: [ka]

[0630] The method for synthesizing compound AB31886 is as follows. [ka]

[0631] Compound 1 (1.0 g, 2.69 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (30 mL), and methylmagnesium bromide (4.5 mL, 13.45 mmol, 5 eq, 3M) was added dropwise under nitrogen gas protection at 0 °C. The reaction was carried out for 0.5 hours, and the complete reaction was confirmed by LCMS. The organic phase was quenched with saturated aqueous ammonium chloride solution, extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound AB31886 from the crude product via flash chromatography (100-200 mesh silica gel, DCM / MeOH=100 / 1).

[0632] Compound AB31886: MS-ESI: Theoretical value [M+H] + : 352.15, actual value: 352.10. 1 H NMR(400 MHz, CDCl3)δ 7.15(s, 1H), 6.74(s, 2H), 6.59(s, 1H), 5.94(s, 2H), 5.85(s, 1H), 4.87-4.83(m, 1H), 3.90(s, 3H), 3.84(s, 3H), 3.41-3.32(m, 2H), 2.94-2.77(m, 2H), 1.18(d, J= 8.0 Hz, 3H).

[0633] Example 6 Synthesis of compound AB31891 The chemical structure of the compound AB31891 is as follows: [ka]

[0634] The method for synthesizing compound AB31891 is as follows. [ka]

[0635] Compound 1 (200 mg, 0.54 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and propenyl magnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1M) is added dropwise under nitrogen gas protection at 0 ° C., and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31891 from the crude product via thin layer chromatography (DCM / MeOH=50 / 1).

[0636] Compound AB31891: MS-ESI: Theoretical value [M+H] + : 378.17, actual value: 378.35. 1 H NMR(400 MHz, CDCl3)δ 7.11(s, 1H), 6.72-6.69(m, 2H), 6.56(s, 1H), 5.92(d, J= 8.0 Hz, 2H), 5.83-5.74(m, 2H), 4.88-4.80(m, 3H), 3.87(s, 3H), 3.82(s, 3H), 3.48-3.26(m, 2H), 2.84-2.77(m, 2H), 2.44-2.40(m, 3H).

[0637] Example 7 Synthesis of compound AB31893 The chemical structure of the compound AB31893 is as follows: [ka]

[0638] The method for synthesizing compound AB31893 is as follows. [ka]

[0639] Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cyclohexylmagnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1M) was added dropwise under nitrogen gas protection at 0°C, and the reaction was carried out for 0.5 hours, and the complete reaction was confirmed by LCMS inspection, and the reaction was quenched with saturated aqueous ammonium chloride solution, and the organic phase was extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31893 from the crude product via thin layer chromatography (DCM / MeOH= 50 / 1).

[0640] Compound AB31893: MS-ESI: Theoretical value [M+H] + : 420.21, actual value: 420.20. 1 H NMR(400 MHz, DMSO-d6)δ 7.23(s, 1H), 6.82(d, J= 8.0 Hz, 1H), 6.76(s, 1H), 6.66(d, J= 8.0 Hz, 1H), 5.99(s, 2H), 5.85(s, 1H), 4.46-4.45(m, 1H), 3.75(d, J= 8.0 Hz, 6H), 3.41-3.38(m, 2H), 2.96-2.89(m, 1H), 2.68-2.64(m, 1H), 1.65-1.50(m, 7H), 1.11-1.03(m, 4H).

[0641] Example 8 Synthesis of compound AB31900 The chemical structure of the compound AB31900 is as follows: [ka]

[0642] The method for synthesizing compound AB31900 is as follows. [ka]

[0643] Compound 1 (200 mg, 0.54 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cycloamylmagnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1M) was added dropwise under nitrogen gas protection at 0°C, and the reaction was carried out for 0.5 hours, and the complete reaction was confirmed by LCMS inspection, and the reaction was quenched with saturated aqueous ammonium chloride solution, and the organic phase was extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31900 from the crude product via thin layer chromatography (DCM / MeOH=30 / 1).

[0644] Compound AB31900: MS-ESI: Theoretical value [M+H] + :406.20, actual value:406.20. 1 H NMR(400 MHz, DMSO-d6)δ 7.20(s, 1H), 6.79(d, J= 8.0 Hz, 1H), 6.73(s, 1H), 6.64(d, J= 8.0 Hz, 1H), 5.96(s, 2H), 5.87(s, 1H), 4.51(d, J= 8.0 Hz, 1H), 3.72(s, 6H), 3.41-3.35(m, 2H), 2.86-2.63(m, 2H), 2.17-2.15(m, 1H), 1.55-1.15(m, 8H).

[0645] Example 9 Synthesis of compound AB35403 The chemical structure of the compound AB35403 is as follows: [ka]

[0646] The method for synthesizing compound AB35403 is as follows. [ka]

[0647] Compound 1 (500 mg, 1.34 mmol, 1 eq) was dissolved in dichloromethane (50 mL), and cesium fluoride (204 mg, 1.34 mmol, 1 eq) and (trifluoromethoxy)trimethylsilane (96 mg, 0.67 mmol, 2 eq) were added. The reaction was carried out overnight at 40 °C under nitrogen gas protection. The reaction was confirmed to be complete by LCMS. The reaction product was diluted with water, and the organic phase was extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35403 from the crude product via flash chromatography (dichloromethane).

[0648] Compound AB35403: MS-ESI: Theoretical value [M+H] + : 406.12, actual value: 406.10. 1 H NMR(400 MHz, DMSO-d6)δ 7.26(s, 1H), 7.03(d, J= 8.0 Hz, 1H), 6.82(s, 1H), 6.79(s, 1H), 6.03(s, 1H), 6.01(s, 2H), 5.52-5.46(m, 1H), 3.82(d, J= 8.0 Hz, 6H), 3.58-3.55(m, 2H), 2.89-2.71(m, 2H).

[0649] Example 10 Synthesis of compound AB31875 The chemical structure of the compound AB31875 is as follows: [ka]

[0650] The method for synthesizing compound AB31875 is as follows. [ka]

[0651] Compound 1 (336 mg, 1 mmol) was dissolved in n-butyl magnesium bromide (10 mL) and stirred at 0°C for 10 minutes. The complete reaction was confirmed by LCMS. The reaction product was quenched with water, and tetrahydrofuran was added to dissolve and filter to obtain the mother liquor. The organic solvent was removed by distillation under reduced pressure, and the compound AB31875 was obtained through purification.

[0652] Compound AB31875: MS-ESI: Theoretical value [M+H] + : 394.48, actual value: 394.20. 1 H NMR(400 MHz, dmso)δ 7.20(s, 1H), 6.78(s, 1H), 6.74(s, 1H), 6.64(s, 1H), 5.97(s, 2H), 5.82(s, 1H), 4.66 - 4.56(m, 1H), 3.73(s, 6H), 3.20 - 3.17(m, 2H), 2.92 - 2.64(m, 2H), 1.60 - 1.46(m, 1H), 1.13(s, 3H), 0.72(s, 3H).

[0653] Example 11 Synthesis of compound AB35435 The chemical structure of the compound AB35435 is as follows: [ka]

[0654] The method for synthesizing compound AB35435 is as follows. [ka]

[0655] Compound 1 (150 mg, 0.40 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and hexylmagnesium bromide (2 mL, 2.0 mmol, 5.0 eq, 1M) was added at 0 °C, and the reaction was carried out at room temperature for 0.5 h. After TLC check and thorough reaction was confirmed by LCMS check, the organic phase was quenched with saturated aqueous ammonium chloride, extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound AB35435 from the crude product via flash chromatography (DCM / MeOH=50 / 1).

[0656] Compound AB35435: MS-ESI: Theoretical value [M+H]+: 422.23, Found value: 422.40. 1 H NMR(400 MHz, DMSO-d6)δ 7.23(s, 1H), 6.82(d, J= 8.0 Hz, 1H), 6.77(s, 1H), 6.66(d, J= 8.0 Hz, 1H), 6.00(d, J= 4.0 Hz, 2H), 5.85(s, 1H), 4.66-4.63(m, 1H), 3.76(s, 6H), 3.31-3.26(m, 2H), 2.85-2.67(m, 2H), 1.62-1.49(m, 2H), 1.20-1.13(m, 8H), 0.80-0.77(m, 3H).

[0657] Example 12 Synthesis of compound AB31714 The chemical structure of compound AB31714 is as follows: [ka]

[0658] The method for synthesizing compound AB31714 is as follows. [ka]

[0659] Compound 1 (2 g, 5.95 mmol) is dissolved in chloroform (60 mL), ammonia water (24 mL) is added, and the mixture is stirred at room temperature overnight. When a new compound is detected by thin layer chromatography, the product is extracted and centrifuged, and the solution is concentrated under reduced pressure to remove the organic solvent, yielding compound AB31714 as a solid.

[0660] Compound AB31714: MS-ESI: Theoretical value [M+H]+: 454.03, Found value: 454.10. 1 H NMR(400 MHz, DMSO-d6)δ 7.29(s, 1H), 7.06(d, J = 8.5 Hz, 1H), 6.86(d, J = 8.5 Hz, 1H), 6.76(s, 1H), 6.27(s, 1H), 5.97(d, J = 5.9 Hz, 2H), 5.61(s, 1H), 3.78(t, J = 6.8 Hz, 7H), 3.61(t, J = 9.0 Hz, 1H), 3.26 - 3.13(m, 2H), 2.68(d, J = 16.0 Hz, 1H).

[0661] Example 13 Synthesis of compound AB31713 The chemical structure of the compound AB31713 is as follows: [ka]

[0662] The compound AB31713 is commercially available.

[0663] Example 14 The activity of the mitochondrial permeability transition pore in the relevant cells is examined. Experimental background: The mitochondria permeability transition pore (mPTP) is a non-specific pathway on the inner mitochondrial membrane that allows small molecules with a molecular weight of less than 1.5 KD to pass freely. Its activity is affected by intramitochondrial permeability transition pores (e.g., H2O2), pH, and calcium ions. Some mitochondria permeability transition pores are activated, while some mitochondria permeability transition pores are inactivated. In cells in which the mitochondria permeability transition pore is activated, the addition of peroxides (e.g., H2O2) increases the activity of the mitochondria permeability transition pore and decreases the mitochondria membrane potential. In contrast, in cells in which the mitochondria permeability transition pore is inactivated, the addition of peroxides (e.g., H2O2) has no obvious effect on the activity of the mitochondria permeability transition pore and does not cause any obvious change in the mitochondria membrane potential. Based on this principle, we can determine whether mPTP is activated in a particular cell by measuring the change in mitochondrial transmembrane potential under stimulation with peroxide.

[0664] Experimental Method and Results: Daoy cells (human medulloblastoma, ATCC number HTB-186) were cultured in DMEM medium + P / S with 10% fetal bovine serum. The medium contained 1.5 μM cyclosporin A (Cyclosporin A). S Abbreviated as A. S A effectively inhibits the activity of the mPTP mitochondrial membrane permeability transition pore) and simultaneously adds C S The cells cultured without A were selected as the control group. When the mitochondrial membrane potential difference was detected using tetramethylrhodamine (TMRM), the TMRM fluorescence intensity increased, indicating a large membrane potential difference. The results are shown in Table 3. [Table 3] Note: "+" means presence and "-" means absence.

[0665] From Table 3, C SFor normal Daoy cells without A in the medium, their membrane potential dropped significantly under the action of H2O2, indicating that mPTP in Daoy cells was activated, but the membrane potential of activated C, in which the membrane permeability transition pore of mPTP mitochondrion was added to the medium, was significantly decreased. S For Daoy cells in A, the addition of H2O2 prevented the membrane potential from dropping, which indicates that the activated mPTP S A indicates that the membrane potential of the membrane is not decreased by H2O2.

[0666] Therefore, as can be seen from Table 3, the permeability transition pore of the mitochondria in Daoy cells is activated.

[0667] Example 15 The inhibitory effect of the compound of the present invention on the activity of Daoy cells in which mPTP is normally activated and on the activity of Daoy cells in which mPTP is inactivated by introducing shRNA of PPIF mRNA is examined.

[0668] The English name of the term "peptidyl-prolyl isomerase F" is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF. Its protein number is UniProtKB / Swiss-Prot: P30405, and its gene number is NCBI Entrez Gene: 10105.

[0669] 1)Daoy cells form by hypoactivating the mitochondrial membrane permeability transition pore (mPTP). 1.1 Experimental background: The activity of the mitochondria permeability transition pore (mPTP) is regulated by PPIF protein, so when PPIF protein is suppressed, the activity of mPTP is significantly reduced. Since the activity of PPIF protein is controlled by the expression level of PPIF protein in cells, the expression level of PPIF protein in Daoy cells is specifically reduced by introducing shRNA of specific-induced degradation PPIF mRNA into Daoy cells, and thus Daoy cells with inactivated mitochondria permeability transition pore (mPTP) are formed (abbreviated as mPTP-inactivated Daoy cells).

[0670] 1.2 Experimental method and results: A viral vector carrying shRNA for specificity-induced degradation of PPIF mRNA was obtained by means of cloning technology, and the shRNA sequence (nucleotide sequence is GTTCTTCATCTGCACCATAAA (SEQ ID NO: 2)) carried by the viral vector was used to perform specificity-induced degradation of PPIF mRNA. The experimental group was Daoy cells with the viral vector carrying shRNA for specificity-induced degradation of PPIF mRNA, and the control group was Daoy cells with the empty viral vector without shRNA for specificity-induced degradation of PPIF mRNA. The expression level of PPIF protein in Daoy cells was detected by Western blotting, and the results are shown in Figure 1. As can be seen from Figure 1, PPIF (PPIF shRNA in Figure 1) was hardly expressed in Daoy cells with shRNA for specificity-induced degradation of PPIF mRNA, and PPIF (Con shRNA in Figure 1, control group) was normally expressed in Daoy cells without shRNA for specificity-induced degradation of PPIF mRNA. When the mitochondrial membrane potential difference was detected in Daoy cells in which an empty virus vector without shRNA for specificity-induced decomposition of PPIF mRNA was introduced by Tetramethylrhodamine (TMRM) according to the method of Example 14, and in Daoy cells in which a virus vector with shRNA for specificity-induced decomposition of PPIF mRNA was introduced, the TMRM fluorescence intensity was high and the membrane potential difference was large. The results are shown in Table 4-5. [Table 4] [Table 5]

[0671] As seen from Table 4-5, in Daoy cells where genes are introduced into an empty viral vector that does not have shRNA for specific-induced decomposition PPIF mRNA, the mitochondrial membrane permeability transition pore (mPTP) is activated. In Daoy cells where genes are introduced into a viral vector that has shRNA for specific-induced decomposition PPIF mRNA, the mitochondrial membrane permeability transition pore (mPTP) is inactivated. By introducing shRNA for specific-induced decomposition PPIF mRNA into Daoy cells, Daoy cells with inactivated mitochondrial membrane permeability transition pore (mPTP) are successfully formed.

[0672] Using Promega CellTiter-Glo kit (which reflects cell vitality by examining the intracellular ATP content), the vitality of Daoy cells in which mPTP was inactivated by shRNA of specificity-induced decomposition PPIF mRNA and the vitality of Daoy cells in which mPTP was activated by no shRNA of isomer-induced decomposition PPIF mRNA were detected, and the results are shown in Figure 2. As can be seen from Figure 2, the vitality of Daoy cells in which mPTP was inactivated by shRNA of specificity-induced decomposition PPIF mRNA and the vitality of Daoy cells in which mPTP was activated by no shRNA of isomer-induced decomposition PPIF mRNA were detected are almost the same. There is no statistical significance in the difference in cell vitality.

[0673] 2. The relationship between the inhibitory effect of the compound of the present invention on cancer cells and mPTP activity is examined. 2.1 Experimental background: The Promega CellTiter-Glo kit is used to detect cell vitality, which reflects cell activity by directly measuring the intracellular ATP content. This experiment was carried out to compare the IC20 value of the Daoy cell vitality with the inactivation of mPTP in Daoy cells that had been transfected with shRNA for specificity-induced decomposition of PPIF mRNA and the IC20 value of the Daoy cell vitality with the activation of mPTP in Daoy cells that had not been transfected with shRNA for specificity-induced decomposition of PPIF mRNA. 50 Detect the value.

[0674] 2.2 Experimental method and results: Daoy cells with inactivated mPTP that had been transfected with shRNA for specificity-induced decomposition of PPIF mRNA and Daoy cells with activated mPTP that had not been transfected with shRNA for specificity-induced decomposition of PPIF mRNA were cultured in EMEM medium + P / S containing 10% fetal bovine serum. The IC50 values ​​of the median inhibitory concentration of the compound of the present invention for both types of cells were calculated. 50 The results are shown in Table 6. [Table 6] Note:IC 50 is the half inhibitory concentration (50% inhibiting concentration), i.e., the concentration of the inhibitor when achieving 50% inhibition effect. Daoy cells with mPTP activation are Daoy cells with an empty virus vector that does not have shRNA for specific induction decomposition PPIF mRNA, and Daoy cells with mPTP inactivation are Daoy cells with a virus vector that has shRNA for specific induction decomposition PPIF mRNA.

[0675] From Table 6, the compound of the present invention achieves a significant inhibitory effect on Daoy cells with inactivated mPTP, but achieves an insufficient inhibitory effect on Daoy cells with activated mPTP. By reducing the activity of mPTP in Daoy cells to significantly enhance the inhibitory effect of the compound of the present invention, the compound of the present invention has a more significant inhibitory effect on Daoy cells with inactivated mPTP, and Daoy cells with inactivated mPTP are highly sensitive to the compound of the present invention, so that the compound of the present invention has an excellent and refined therapeutic effect on Daoy cells with inactivated mPTP. As mentioned above, when PPIF protein is suppressed, the activity of mPTP is significantly reduced. By suppressing the expression level of PPIF protein, the activity of mPTP in Daoy cells is reduced. Therefore, the compound of the present invention achieves a significant inhibitory effect on Daoy cells with low expression of PPIF protein, and has an insufficient inhibitory effect on Daoy cells with normal expression of PPIF protein, so that by reducing the expression level of PPIF protein, the inhibitory effect of the compound of the present invention can be significantly enhanced. Therefore, the compounds of the present invention have a more significant inhibitory effect on Daoy cells with low expression of PPIF protein, i.e., compared with Daoy cells with normal expression of PPIF protein, Daoy cells with low expression of PIF protein are highly sensitive to the compounds of the present invention, and thus the compounds of the present invention have an excellent and refined therapeutic effect on Daoy cells with low expression of PPIF protein.

[0676] Example 16 In this example, the sensitivity of various compounds prepared in the examples to the expression levels of NNMT and DNMT1 in NCI-H82 cells is examined.

[0677] Experimental method and results: NCI-H82 cells with high expression of NNMT protein (ov-NNMT NCI-H82 cells) were obtained by introducing NMT gene into NCI-H82 cells via a viral vector to overexpress NNMT protein in NCI-H82 cells. NCI-H82 cells with low expression of NMT protein (sh-DNMT1 NCI-H82 cells) were obtained by knocking down the expression of DNMT1 in NCI-H82 cells by introducing shRNA (nucleotide sequence of shRNA is GATCCGGATGAGTCCATCAAGGAAGATTCAAGAGATCTTCCTTGATGGACTCATCCTTTTTTG) (SEQ ID No: 3)) via a viral vector. NCI-H82 cells with low expression of NMT protein (sh-DNMT1 NCI-H82 cells) were obtained by introducing NNMT gene into an empty viral vector without shRNA (Con-NCI-H82 cells) as a control group. The results of the DNMT1 protein content in Con-NCI-H82 cells and ov-NNMT NCI-H82 cells detected by Western Blot experiment, and the DNMT1 protein content in Con-NCI-H82 cells and sh-DNMT1 NCI-H82 cells detected by Western Blot experiment are shown in Figure 3 and Figure 4. As can be seen from Figure 3 and Figure 4, compared with Con-NCI-H82 cells, NNMT protein is highly expressed in ov-NNMT NCI-H82 cells, and DNMT1 protein is knocked down, i.e., low expressed, in sh-DNMT1 NCI-H82 cells.

[0678] Promega CellTiter-Glo kit (which reflects cell vitality by examining the intracellular ATP content) was used to detect cell vitality of Con-NCI-H82 cells, ov-NNMT NCI-H82 cells and sh-DNMT1 NCI-H82 cells, and the results are shown in Figure 5 and Figure 6. From Figure 5 and Figure 6, the cell vitality of on-NCI-H82 cells, ov-NNMT NCI-H82 cells and sh-DNMT1 NCI-H82 cells is almost the same. The difference in cell vitality has no statistical significance.

[0679] The inhibitory effects (IC) of various compounds prepared in this example on Con-NCI-H82 cells, ov-NNMT NCI-H82 cells and sh-DNMT1 NCI-H82 cells were measured using Promega CellTiter-Glo kit, that is, by detecting the cell vitality by examining the intracellular ATP content through the kit. 50 ) was detected, and the results are shown in Table 7. [Table 7] JPEG2025509621000054.jpg42161Note:IC 50 represents the half inhibitory concentration (50% inhibiting concentration), i.e., the concentration of the inhibitor when achieving 50% inhibitory effect. Con-NCI-H82 represents the control group of NCI-H82 cells with an empty viral vector that does not have the NNMT gene and shRNA. ov-NNMT NCI-H82 represents the experimental group of NCI-H82 cells with a viral vector that has the NNMT gene, and the NNMT protein in the ov-NNMT NCI-H82 cells is highly expressed. sh-DNMT1 NCI-H82 represents the experimental group of NCI-H82 cells with a viral vector that has shRNA, and the NNMT protein in the ov-NNMT NCI-H82 cells is knocked down (i.e., low expressed).

[0680] From Table 7, this embodiment further verifies that the compound of the present invention has a significant inhibitory effect on tumor cells that express NNMT gene low or not express and express DNMT1 highly, but has a poor inhibitory effect on tumor cells that express NNMT gene high and express DNMT1 highly; the inhibitory effect of the compound of the present invention is enhanced by reducing the expression of NNMT gene in tumors or increasing the expression of DNMT1 in tumors; the expression level of NNMT in tumor cells is significantly inversely correlated with the sensitivity to the compound of the present invention, but the expression level of DNMT1 in tumor cells is significantly positively correlated with the sensitivity to the compound of the present invention. Therefore, the compound of the present invention has a significant inhibitory effect on tumor cells that express DNMT gene low or not express and express DNMT1 highly, and the tumor cells that express DNMT gene low or not express and express DNMT1 highly have high sensitivity to the compound of the present invention, so that the compound of the present invention has a significantly excellent therapeutic effect on tumor cells that express DNMT gene low or not express and express DNMT1 highly.

[0681] Example 17 The methylation level of cellular DNA is maintained by DNA methyltransferases DNMT3a, DNMT3b and DNMT1, and DNMT3a and DNMT3b perform de novo methylation on DNA, while DNMT1 replicates and maintains methylated DNA with the help of the protein UHRF1 (ubiquitin-like tau protein 1 containing PHD and RING finger domains). This example detects the correlation between NNMT expression in tumors and DNMT1, UHRF1, DNMT3a and DNMT3b expression.

[0682] Experimental methods and results: The expression data of NNMT gene, DNMT1, UHRF1, DNMT3a and DNMT3b in various cells are obtained from the public database (Cancer Cell Line Encyclopedia, CCLE, a total of 1019 cell lines), and then the correlation between NNMT expression and DNMT1, UHRF1, DNMT3a and DNMT3b expression in these cells, and the correlation between the expression level of NNMT gene in each cell and the expression level of DNMT1, UHRF1, DNMT3a and DNMT3b are analyzed by bioinformatics methods. The experimental results are shown in Figure 7.

[0683] 7, the expression of NNMT in each cell is inversely correlated with the expression of DNA methyltransferase and UHRF1. Therefore, tumor cells with high expression of DNA methyltransferase and UHRF1 are highly sensitive to the compound of the present invention, and the compound of the present invention has a significantly excellent therapeutic effect on tumors with high expression of DNA methyltransferase and UHRF1.

[0684] It should be noted that the above content is an embodiment designed to address a certain aspect, and that those skilled in the art may make some modifications without departing from the principles of the present invention, and these modifications should also be considered as within the scope of protection of the present invention.

Claims

1. Use of a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, for the manufacture of a composition or formulation for use in the prevention and / or treatment of tumors. 【Chemistry 1】 (R 1 and R 2 each independently represents a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C3-C16 cycloalkyl group, a substituted or unsubstituted 3-12 membered heterocycloalkyl group, a substituted or unsubstituted C1-C16 halogenated alkyl group, a substituted or unsubstituted C3-C16 halogenated cycloalkyl group, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C10 alkyl group-, a substituted or unsubstituted 5-16 membered heteroaryl group-substituted or unsubstituted C1-C10 alkyl group-, or a substituted or unsubstituted C2-C10 alkenyl group-substituted or unsubstituted C1-C10 alkyl group-; R 3 and R 4 are each independently a hydrogen atom, R 16 -O- or R 16 represents -S-; R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 and R 15 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a halogen atom; R 9 and R 10 are joined to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring; R 16 represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group, or a substituted or unsubstituted C3-C16 cycloalkyl group; said heterocycloalkyl group, said heteroaryl group and said heterocycloalkyl ring each independently have from 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms selected from N, O and S on the heterocycle; The optional "substitution" mentioned above means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced with a C1-C8 alkyl group, a C3-C12 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro group, - CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, and a 5-10 membered heterocycloalkyl group.

2. The compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, has the following chemical structure:

2. The use according to claim 1 . 【Chemistry 2】 【change】 【change】

3. The tumor is Tumors in which the mitochondrial permeability transition pore is underexpressed, absent, underactivated, or inactivated; Tumors in which peptidyl prolyl isomerase F is underexpressed, not expressed, underactivated or inactivated; Tumors in which the NNMT gene is underexpressed or not expressed; Tumors with high expression of DNA methyltransferases, Tumors in which UHRF1 is highly expressed, Tumors in which the nucleotide site of the NNMT gene is hypermethylated, and / or tumors in which DNA CpG sites in the NNMT gene region are hypermethylated; 2. The use according to claim 1 .

4. The DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof; 4. The use according to claim 3.

5. The tumor with low expression or low activation of mitochondrial permeability transition pore refers to a tumor in which the ratio (H1 / H0) between the expression level or activity H1 of mitochondrial permeability transition pore in a certain cell (e.g., tumor cell) and the expression level or activity H0 of mitochondrial permeability transition pore in the same cell or normal cell (e.g., cancerous bladder tissue cell) is <1.0, preferably ≦0.8, and more preferably ≦0.7, ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001, or ≦0.0000001; The tumor with low expression or low activity of peptidyl prolyl isomerase F refers to a tumor in which the ratio (P1 / P0) between the expression level or activity P1 of peptidyl prolyl isomerase F in a certain cell (e.g., tumor cell) and the expression level or activity P0 of peptidyl prolyl isomerase F in the same cell or normal cell (e.g., cancerous bladder tissue cell) is <1.0, preferably ≦0.8, and more preferably ≦0.7, ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001; The tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in the same type of cell or a normal cell is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001, or ≦0.0000001; The tumor with high expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in the same kind of cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50; The tumor with high expression of UHRF1 refers to a tumor in which the ratio (F1 / F0) between the expression level F1 of UHRF1 in tumor cells and the expression level F0 of UHRF1 in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50; said tumor having hypermethylation at the nucleotide site of the NNMT gene refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 at the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 at the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example 2-50; and / or The tumor in which the DNA CpG site of the NNMT gene region is hypermethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG site of the NNMT gene region of a certain cell (e.g., tumor cell) and the methylation level W0 of the DNA CpG site of the NNMT gene region of a similar cell or a normal cell (e.g., cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

4. The use according to claim 3.

6. The allogeneic cells are Similar tumor cells in which the mitochondrial permeability transition pore is normally expressed, highly expressed, normally activated, or highly activated; Similar tumor cells in which peptidyl prolyl isomerase F is normally expressed, highly expressed, normally activated, or highly activated; Similar tumor cells in which the NNMT gene is normally or highly expressed; Similar tumor cells in which DNA methyltransferases are normally expressed or underexpressed; Similar tumor cells in which UHRF1 is normally or underexpressed; Similar tumor cells in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated, and / or including similar tumor cells in which DNA CpG sites in the NNMT gene region are either normally methylated or hypomethylated; 6. Use according to claim 5.

7. The tumor is selected from lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain cancer, liver cancer, prostate cancer, or a combination thereof; 2. The use according to claim 1 .

8. is used to determine whether a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for tumor prevention and / or treatment in a tumor patient, Markers including mitochondrial permeability transition pore, peptidyl prolyl isomerase F, NNMT gene, DNA methyltransferase, UHRF1, methylation of nucleotide sites in the NNMT gene and / or methylation of DNA CpG sites in the NNMT gene region.

9. 2. The compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, for use in the manufacture of a companion diagnostic kit for determining whether a tumor patient is suitable for the prevention and / or treatment of a tumor, (i) Use of a detection reagent kit comprising a detection reagent for detecting the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region, The accompanying diagnostic kit in tumor cells of a tumor patient, the under-expression, non-expression, under-activation or inactivation of the mitochondrial permeability transition pore, the under-expression, non-expression, under-activation or inactivation of peptidyl prolyl isomerase F, the under-expression or non-expression of the NNMT gene, the over-expression of DNA methyltransferase, the over-expression of UHRF1, the hypermethylation of nucleotide sites of the NNMT gene, and / or the hypermethylation of DNA CpG sites in the NNMT gene region, render said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, suitable for the prevention and / or treatment of tumors in said tumor patient; and / or and further comprising an instruction manual or label stating that, in tumor cells of a tumor patient, there is high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of the NNMT gene, and / or low methylation of DNA CpG sites in the NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes unsuitable for the prevention and / or treatment of tumors in said tumor patient. Use of a detection reagent kit comprising:

10. (i) a detection agent for detecting the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region; (ii) a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, A medical kit comprising:

11. Used for producing a composition or formulation for enhancing the antitumor effect of an antitumor drug; The antitumor drug comprises a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof; Use of an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, a promoter of methylation of nucleotide sites in the NNMT gene and / or a promoter of methylation of DNA CpG sites in the NNMT gene region, characterized by the above.

12. (1) a first active ingredient comprising an antitumor drug; (2) a second active ingredient comprising an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene, and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region; The antitumor drug comprises a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof; A composition comprising:

13. (1) a first active ingredient comprising an antitumor drug; (2) a second active ingredient comprising an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene, and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region; The antitumor drug comprises a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof; A composition comprising:

Images