Bicyclic heterocycles and their ligands for targeted delivery of therapeutic agents

Abstract

The present invention provides novel bicyclic heterocycles and targeting ligands thereof that can be conjugated with therapeutic agents and used as drugs. Methods for their preparation, pharmaceutical compositions containing the therapeutic compounds, and pharmaceutical uses thereof are disclosed.

Description

[Technical Field]

[0001] The present invention relates to the pharmaceutical field and to bicyclic heterocycles, GalNAc-conjugation, oligonucleotide therapeutic agents, methods for their preparation, pharmaceutical compositions containing the compounds, and pharmaceutical uses thereof. [Background technology]

[0002] Targeted delivery of oligonucleotides to hepatocytes using N-acetylgalactosamine (GalNAc) conjugation, which binds to the asialoglycoprotein receptor (ASGPR), has become a groundbreaking approach in the field of therapeutic oligonucleotides. ASGPR combines tissue specificity, high expression levels (500,000 copies / cell), and rapid internalization and turnover (15 min), making it an ideal target for delivering therapeutic oligonucleotides to the liver. GalNAc-conjugation has led to several FDA-approved siRNA drugs and numerous clinical drug candidates targeting various targets in hepatocytes. In addition to oligonucleotides, GalNAc can also be conjugated to small molecules, peptides, proteins, and LNPs, which can be used to target hepatocytes. There is ample evidence that the inhibitory potency of oligosaccharides with different valencies for the binding of labeled ligands to liver lectins in mammalian hepatocytes follows a distinct order: tetraantennary > triantennary >> diantennary >> monoantennary. Given the advantages of GalNAc-conjugation as a powerful delivery platform, diverse GalNAc-conjugation structures are crucial for improving performance across different modalities.

[0003] Other GalNAc conjugate moieties have been previously described. GalNAc is linked to oligonucleotides via different linkers. Here, tetrafunctional and trifunctional groups were utilized to form tri-antennary GalNAc. The tetrafunctional group links three GalNAc units via linkers of different lengths. The trifunctional group links the GalNAc, oligonucleotide, and solid support (during synthesis). Derivatized species such as Tris, triacid, hydroxyprolinol, and glycerol are widely used as tetrafunctional and trifunctional groups. While the application of oligonucleotides and oligonucleotide analogs as therapeutic agents has progressed, there remains a need for oligonucleotides with improved pharmacological properties. Summary of the Invention

[0004] The present invention discloses a series of tetra- and tri-functional groups (including bicyclic heterocyclic and polycyclic hexane structures) that can link GalNAc and oligonucleotides and other therapeutic agents with unique shapes and properties. In one aspect, a targeting ligand is provided having the structure shown in formula (Ia): [ka] where: X1 and X2 each independently represent NR a (CH2) r -, -O(CH2) r - and -S(CH2) r wherein R1 and R2 are linked to N, O or S; M1 is C, CH or N; M2 is absent, O, C(O) or CH2; M3 is absent, CH, C, N, O, or S; each of M4 and M6 is independently selected from C(O) and CH2; M5 is CH, CH2 or NH; R ais selected from the group consisting of hydrogen, deuterium, halogen, amino group, cyano group, hydroxy group, alkyl group, alkoxy group, alkylthio group, and halogenated alkyl group; R1 is hydrogen or a protecting group; R2 is hydrogen, or a solid support optionally linked via a linker group, or a phosphoramidite; R3 is independently hydrogen, an amino group, or -(CH2) r selected from COOH, alkylamino, or hydroxyalkyl; or two of R3 together with the C atom to which they are attached form a heterocyclyl group containing an N atom, and the heterocyclyl group containing an N atom has the structure shown in formula (II): [ka] R is a carbohydrate or derivative thereof having a hydroxy protecting group linked via a linker group; R b are independently selected from the group consisting of hydrogen, oxo, and alkyl groups; m is 0, 1, 2, 3, 4, 5 or 6; n is 0, 1, 2, 3, 4, 5, or 6; x is 1, 2, 3 or 4; y is 1, 2, 3 or 4, and Each r is independently selected from 0, 1, 2, and 3.

[0005] The present invention discloses a series of tetra- and tri-functional groups (including bicyclic heterocyclic and polycyclic hexane structures) that can link GalNAc and oligonucleotides and other therapeutic agents with unique shapes and properties. In one aspect, a targeting ligand is provided having the structure shown in formula (I): [ka] where: X1 and X2 each independently represent NR a (CH2)r -, -O(CH2) r - and -S(CH2) r wherein R1 and R2 are linked to N, O or S; M1 is C, CH or N; M2 is absent, O, C(O) or CH2; M3 is absent, CH, C, N, O, or S; each of M4 and M6 is independently selected from C(O) and CH2; M5 is CH, CH2 or NH; R a is selected from the group consisting of hydrogen, deuterium, halogen, amino group, cyano group, hydroxy group, alkyl group, alkoxy group, alkylthio group, and halogenated alkyl group; R1 is hydrogen or a protecting group; R2 is hydrogen, or a solid support optionally linked via a linker group, or a phosphoramidite; R3 is independently hydrogen, an amino group, or -(CH2) r selected from COOH, alkylamino, or hydroxyalkyl; or two of R3 together with the C atom to which they are attached form a heterocyclyl group containing an N atom, and the heterocyclyl group containing an N atom has the structure shown in formula (II): [ka] R is a carbohydrate or derivative thereof having a hydroxy protecting group linked via a linker group; R b are independently selected from the group consisting of hydrogen, oxo, and alkyl groups; m is 0, 1, 2, 3, 4, 5 or 6; n is 0, 1, 2, 3, 4, 5, or 6; x is 1, 2, 3 or 4; y is 1, 2, 3 or 4, and Each r is independently selected from 0, 1, 2, and 3.

[0006] In embodiments, the targeting ligand has the structure shown in formula (III) or (III-a): [ka] [ka] is a single or double bond, R b is independently selected from the group consisting of hydrogen and oxo; each of m and n is independently selected from 1, 2, 3, 4, and 5; Each of m1 and n1 is independently selected from 0, 1, 2, 3 and 4.

[0007] In embodiments, the targeting ligand has the structure shown in formula (III-b), (III-c) or (III-d): [ka] m is independently selected from 0, 1, 2, 3, 4, and 5; n is independently selected from 1, 2, 3, 4, and 5; each of r, s, and t is independently selected from 0, 1, and 2; Each of m1 and n1 is independently selected from 0, 1, 2, 3 and 4.

[0008] In a preferred embodiment, R is linked via a linker group, -linker-R9, where R9 is a carbohydrate.

[0009] In a more preferred embodiment, R9 is galactose, galactosamine, N-acetylgalactosamine (GalNAc), D-galactosaminol, mannose, mannosamine, mannose-6-phosphate, glucose, glucosamine, N-acetyl-glucosamine (GluNAc), glucose-6-phosphate, glucoseaminol, glucoseglyceraldehyde, fucose, fucosamine, fuculose, lactose, allose, altrose, arabinose, chrysosamine ... The sugar is selected from the group consisting of ladinose, erythrose, erythrulose, fructose, D-fucitol, L-fucitol, L-glycerol-D-mannose-heptose, glycerol, glycerone, gulose, idose, lyxose, psicose, quinose, quinosamine, rhamnose, rhamnitol, rhamnosamine, ribose, ribulose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose, xylose and xylulose.

[0010] In some embodiments, R9 is N-acetylgalactosamine.

[0011] In embodiments, R is linked via a linker group and has the structure shown in formula (IV), (IV-a), (IV-b) or (IV-c): [ka] A is C 3-10 a cycloalkyl group or a 4- to 12-membered heterocyclyl group, each of L1, L2, L3, L4, and L5 is independently selected from the group of substituents consisting of absent, O, S, SS, NH, CO, CONH, NHCO, and a 4- to 10-membered heterocyclyl group; Each of R4, R6, R7, and R8 is independently selected from the group of substituents consisting of CH2, OCH2CH2, and CH2CH2O; R5 is independently selected from absent, CH2, OCH2, CH2O, OCH2CH2, CH2CH2O, NHCH2, CH2NH, NHCH2CH2, CH2CH2NH, C 0-6 Alkyl (C 3-8 cycloalkyl) and C0-6 is selected from the group of substituents consisting of alkyl(4-10 membered heterocyclyl); R9 is a carbohydrate, Each of t1, t2, t3, t4, and t5 is independently selected from 0, 1, 2, 3, 4, 5, and 6.

[0012] In embodiments, R has the structure shown in formula (IV-1), (IV-a-1), (IV-b-1) or (IV-c-1): [ka] Here, A is [ka] and each of L1, L3, L4 and L5 is independently selected from the group of substituents consisting of absent, O, S, SS, NH, CO, CONH and NHCO; L2 is absent and is O, S, SS, NH, CO, CONH, NHCO and [ka] and R5 is independently absent, CH2, CH2O, CH2NH, C 3-6 Cycloalkyl groups, C 3-6 Cycloalkyl C 1-3 4-8 membered heterocyclyl C containing 1, 2 or 3 cycloheteroatoms selected from alkyl, N or O 1-3 It is selected from the group of substituents consisting of alkyl, and 4-8 membered heterocyclyl groups containing 1, 2 or 3 heteroatoms selected from N or O.

[0013] In some embodiments, R has a structure shown in formula (IV-d), (IV-e), (IV-f), (IV-da), (IV-ea), or (IV-fa): [ka] [ka] where: R5 is independently selected from the group of substituents consisting of OCH2, NHCH2, and a 4- to 6-membered heterocyclyl group containing 1 or 2 heteroatoms selected from N or O; m is independently selected from 0, 1, 2, 3, 4, 5, and 6; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, and r is 0, 1, 2, 3, 4 or 5.

[0014] In some embodiments, R9 is N-acetylgalactosamine.

[0015] In some embodiments, R5 is independently -OCH2-, -NHCH2-, [ka] is selected from.

[0016] In some embodiments, R is: [ka] [ka] [ka] s is independently selected from 0, 1, 2 and 3; r is independently selected from 0, 1, 2, 3, 4, and 5; n is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.

[0017] In some embodiments, R is [ka] and [ka] [ka] [ka] r is independently selected from 0, 1, 2, 3, 4, and 5; n is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.

[0018] In some embodiments, n is 7 or 8.

[0019] In some embodiments, R is [ka] [ka] [ka] [ka] is.

[0020] In some embodiments, the targeting ligand is: [ka] [ka] [ka] [ka] R p is H or a hydroxy protecting group, preferably the hydroxy protecting group is an acetyl group; X is O or S; each of m and n is independently selected from 1 or 2; Each of m1 and n1 is independently selected from 1, 2, or 3.

[0021] In some embodiments, R1 is hydrogen.

[0022] In some embodiments, R1 is a substituted or unsubstituted triphenylmethylhydroxy protecting group.

[0023] In some embodiments, R1 is [ka] is.

[0024] In some embodiments, R1 is [ka] is.

[0025] In some embodiments, R2 is hydrogen.

[0026] In some embodiments, R2 is [ka] and [ka] is a solid support.

[0027] In some embodiments, R2 is [ka] is.

[0028] The targeting ligands of the present invention can be used as drugs by linking them to therapeutic agents, which are selected from small molecule drugs and polymeric drugs.

[0029] In a preferred embodiment, the therapeutic agent is an siRNA.

[0030] In another aspect, the present invention further provides spirocycles and fused bicyclic heterocycles having formulas (V) and (VI). Bicyclic compounds are molecules containing two rings linked together. The rings can be linked in three different ways: (1) fused bicyclic rings—two atoms and the bond between them are shared; (2) bridged bicyclic rings—two or more atoms are shared; and (3) spirocycles—two rings are linked together through a single atom. Bicyclic compounds can be fully carbocyclic (completely carbon) or heterocyclic (having one or more non-carbon atoms). Bicyclic heterocycles are important intermediates in drug synthesis and can be divided into nitrogen-, sulfur-, and oxygen-containing compounds. Bicyclic heterocycles have recently attracted attention due to their interesting conformational features and their structural significance for biological systems. Strained bicyclic compounds have become important targets because they exhibit a variety of novel biological activities in response to their unique shapes and properties. Furthermore, bicyclic scaffolds can potentially modulate binding potency and specificity, as well as improve bioavailability and metabolic stability, which are important issues when developing new pharmacological entities. This patent has designed a series of novel spirocyclic and fused bicyclic heterocycles with multiple functional groups, as shown below. These spirocyclic and fused bicyclic compounds can be used to link different moieties, such as GalNAc, oligonucleotides, and solid supports. [ka] [ka] is a single or double bond, R b is independently selected from the group consisting of hydrogen and oxo; each of m and n is independently selected from 1, 2, 3, 4, and 5; Each of m1 and n1 is independently selected from 0, 1, 2, 3 and 4.

[0031] In another aspect, the present invention further provides a bicyclic heterocycle having formula (VI-a), (VI-b), or (VI-c), or a tautomer, or a pharmaceutically acceptable salt: [ka] m is independently selected from 0, 1, 2, 3, 4, and 5; n is independently selected from 1, 2, 3, 4, and 5; each of r, s, and t is independently selected from 0, 1, and 2; Each of m1 and n1 is independently selected from 0, 1, 2, 3 and 4.

[0032] In a preferred embodiment, [ka] or a tautomer or a pharmaceutically acceptable salt thereof.

[0033] GalNAc-spirocycle / fused bicyclic ring conjugation GalNAc can be conjugated with different modalities via different linkers and tethering groups. Spirocyclic / bicyclic compounds can provide unique conformations for the entire conjugation. To introduce GalNAc into an oligonucleotide, the GalNAc ligand is first assembled as a single, so-called tri-antennary ligand, and then conjugated to a solid support or converted to its phosphoramidite form. However, an alternative method was further described, which uses a monovalent GalNAc support and adds two monovalent GalNAc phosphoramidites, resulting in the structure shown below. Such a (1+1+1) trivalent GalNAc structure resulted in the efficacy of GalNAc-modified siRNA oligonucleotides equal to that of equivalent siRNAs bearing tri-antennary GalNAc ligands both in vitro and in vivo. [ka]

[0034] The present invention provides a series of novel GalNAc-bicyclic compounds that can be conjugated to oligonucleotides via phosphoramidite chemistry or attached to a solid support and used in solid phase oligonucleotide synthesis, for example: [ka] is.

[0035] The tetrafunctional group is [ka] [ka] is selected from.

[0036] In another aspect, the present invention provides a therapeutic compound, the therapeutic compound comprising at least one therapeutic oligonucleotide, and the oligonucleotide is conjugated to a targeting ligand.

[0037] In some embodiments, the targeting ligand is conjugated to the 3' or 5' end of the oligonucleotide, more preferably the oligonucleotide is an siRNA, more preferably the siRNA is selected from the group consisting of C3, C5, CFB, PCSK9, TTR, AGT, LPA, Agtr1, ALK, VEGF, ANGPTL3, ANGPTL4, ANGPTL8, APOA, APOC3, ASGR1, CIDEB, COL1A1, COL3A1, CTGF, DGAT2, DMPK, DNAJC15 / MCJ, DPP4, Factor VIII, Factor X, Factor IX, Factor XI, Factor XII, GPR146, GPR75, GRB 10 / 14, TLR7 / 8 / RIG-1, HSD17B13, INHBE, ITGV6, KHK, KLK1, MASP2, MTARC1, MUC5B, NPC1L1, PNPLA3, ASGR1, SCAP, SERPINA1, SERPINF2, SREBF2, HMGCR, TGFB1, COX-2, These are TP53, CD4, CD8, CD40, CD71, DUX4, XDH, LDHA, ALDH2, DMD, EPHA2, KIF11, BCL2L12, APOA1, TRPV1, CASP2, KRAS, TMPRSS6, STAT3, PRDM14, PTGS2, CTGF, DDIT4, and siRNA.

[0038] The novel GalNAc conjugates of the present invention have greater activity in vitro and in vivo than previous GalNAc conjugates.

[0039] The present invention further provides pharmaceutical compositions, which comprise a therapeutic compound or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, diluent, or excipient.

[0040] In another aspect, the invention relates to a method of treating a disease or condition, the method comprising administering to a subject in need thereof an effective amount of a therapeutic compound or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the therapeutic compound or a pharmaceutically acceptable salt thereof.

[0041] In some embodiments, the disease or condition is liver disease, a genetic disorder, a bleeding disorder (e.g., hemophilia), a rare disease (e.g., acromegaly), a metabolic disorder (e.g., hypercholesterolemia, dyslipidemia, hypertriglyceridemia), cardiovascular disease, obesity, hemochromatosis, alcoholism, and anemia (e.g., anemia of chronic disease, thalassemia).

[0042] In some embodiments, the liver disease is liver injury, liver fibrosis, alcoholic liver disease, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), or viral hepatitis.

[0043] In another aspect, the present invention relates to a method of synthesizing a therapeutic compound, the method comprising providing a targeting ligand having formula (I) and conjugating the targeting ligand to an oligonucleotide.

[0044] In a preferred embodiment, the targeting ligand is conjugated to the 3' or 5' end of the oligonucleotide.

[0045] In a preferred embodiment, the targeting ligand can be conjugated to the 3' and 5' ends of the oligonucleotide.

[0046] As mentioned above, GalNAc can be conjugated to the oligonucleotide singly or in a stepwise (1+1+1) manner. [ka]

[0047] To achieve the 1+1+1 assembly, a mono-GalNAc phosphoramidite and a mono-GalNAc solid support need to be synthesized. [ka]

[0048] R b, m, n, m1 and n1 are defined as shown in formulas (Va) and (Vb).

[0049] The specific method is as follows: [ka] [ka] [ka] [Brief explanation of the drawings]

[0050] [Figure 1] FIG. 1 shows the effects of siRNA-24 and siRNA-25 on serum mC3 protein in an in vivo study. [Figure 2] FIG. 1 shows the effects of siRNA-24 and siRNA-25 on hepatic mC3 mRNA levels in an in vivo study. DETAILED DESCRIPTION OF THE INVENTION

[0051] The following provides definitions of terms used in this application. Any terms not defined herein will adopt their common meaning as understood by those skilled in the art.

[0052] "Alkyl group" means a saturated aliphatic hydrocarbon group, C1-C 20This includes straight chain and branched chain groups. Preferably, the alkyl group is an alkyl group having 1 to 12 carbon atoms, sometimes preferably 1 to 6 carbon atoms, sometimes more preferably 1 to 4 carbon atoms. Representative examples include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, a sec-butyl group, an n-pentyl group, a 1,1-dimethylpropyl group, a 1,2-dimethylpropyl group, a 2,2-dimethylpropyl group, a 1-ethylpropyl group, a 2-methylbutyl group, a 3-methylbutyl group, an n-hexyl group, a 1-ethyl-2-methylpropyl group, a 1,1,2-trimethylpropyl group, a 1,1-dimethylbutyl group, a 1,2-dimethylbutyl group, a 2,2-dimethylbutyl group, a 1,3-dimethylbutyl group, a 2-ethylbutyl group, a 2-methylpentyl group, a 3-methylpentyl group, a 4-methylpentyl group, a 2,3-dimethylbutyl group, an n-heptyl group, a 2-methylhexyl group, a 3-methylhexyl group, a 4-methylhexyl group, a 5-methylhexyl group, a 2, Examples include, but are not limited to, 3-dimethylpentyl, 2,4-dimethylpentyl, 2,2-dimethylpentyl, 3,3-dimethylpentyl, 2-ethylpentyl, 3-ethylpentyl, n-octyl, 2,3-dimethylhexyl, 2,4-dimethylhexyl, 2,5-dimethylhexyl, 2,2-dimethylhexyl, 3,3-dimethylhexyl, 4,4-dimethylhexyl, 2-ethylhexyl, 3-ethylhexyl, 4-ethylhexyl, 2-methyl-2-ethylpentyl, 2-methyl-3-ethylpentyl, n-nonyl, 2-methyl-2-ethylhexyl, 2-methyl-3-ethylhexyl, 2,2-diethylpentyl, n-decyl, 3,3-diethylhexyl, 2,2-diethylhexyl, and branched chain isomers thereof. More preferably, the alkyl group is a lower alkyl group having 1 to 6 carbon atoms.Representative examples include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, 2-methylbutyl, 3-methylbutyl, n-hexyl, 1-ethyl-2-methylpropyl, 1,1,2-trimethylpropyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 2,2-dimethylbutyl, 1,3-dimethylbutyl, 2-ethylbutyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 2,3-dimethylbutyl, etc. Alkyl groups may be substituted or unsubstituted. When substituted, the substituents may be substituted at any available point of attachment, and preferably the substituents are one or more independently selected from the group consisting of alkyl, halogen, alkoxy, alkenyl, alkynyl, alkylsulfo, alkylamino, thiol, hydroxy, nitro, cyano, amino, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, cycloalkoxy, heterocyclyl, cycloalkylthio, heterocycloalkylthio, and oxo.

[0053] The term "alkoxy group" refers to both an -O-(alkyl) and an -O-(unsubstituted cycloalkyl) group, where the alkyl group is as defined above. Representative examples include, but are not limited to, a methoxy group, an ethoxy group, a propoxy group, a butoxy group, a cyclopropoxy group, a cyclobutyloxy group, a cyclopentyloxy group, a cyclohexyloxy group, and the like. The alkoxy group may be substituted or unsubstituted. When substituted, the substituents are independently selected from the group consisting of an alkyl group, an alkenyl group, an alkynyl group, an alkoxy group, an alkylsulfo group, an alkylamino group, a halogen atom, a thiol group, a hydroxy group, a nitro group, a cyano group, a cycloalkyl group, a heterocycloalkyl group, an aryl group, a heteroaryl group, a cycloalkoxy group, a heterocycloalkoxy group, a cycloalkylthio group, and a heterocycloalkylthio group, and the substituents are preferably one or more, in some cases preferably 1 to 5, and in some cases more preferably 1 to 3, selected from the group consisting of an alkyl group, an alkenyl group, an alkynyl group, an alkoxy group, an alkylsulfo group, an alkylamino group, a halogen atom, a thiol group, a hydroxy group, a nitro group, a cyano group, a cycloalkyl group, a heterocycloalkyl group, an aryl group, a heteroaryl group, a cycloalkoxy group, a heterocycloalkoxy group, a cycloalkylthio group, and a heterocycloalkylthio group, and the substituents are independently selected from the group consisting of an alkyl group, an alkenyl group, an alkynyl group, an alkoxy group, an alkylsulfo group, an alkylamino group, a halogen atom, a thiol group, a hydroxy group, a nitro group, a cyano group, a cycloalkyl group, a heterocycloalkyl group, an aryl group, a heteroaryl group, a cycloalkoxy group, a heterocycloalkoxy group, a cycloalkylthio group,

[0054] An "alkylthio group" refers to both an --S-(alkyl) and an --S-(unsubstituted cycloalkyl) group, where the alkyl group is as defined above.

[0055] A "halogenated alkyl group" is an alkyl group substituted with a halogen group, where the alkyl group is defined as above.

[0056] A "halogen" is a fluorine, chlorine, bromine or iodine atom.

[0057] A "cycloalkyl group" is a saturated and / or partially unsaturated monocyclic or polycyclic hydrocarbon group having 3 to 20 carbon atoms, preferably 3 to 12 carbon atoms, more preferably 3 to 10 carbon atoms, and most preferably 3 to 8 carbon atoms or 3 to 6 carbon atoms. Representative examples of monocyclic cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, cycloheptyl, cycloheptatrienyl, and cyclooctyl groups. Polycyclic cycloalkyl groups include cycloalkyl groups having spiro rings, fused rings, or bridged rings.

[0058] A "spirocycloalkyl group" is a 5- to 20-membered polycyclic group in which the rings are connected via one common carbon atom (called a spiro atom), where one or more rings may contain one or more double bonds, but no ring has a completely conjugated π-electron system. Preferably, the spirocycloalkyl group has 6 to 14 members, and more preferably 7 to 10 members. Depending on the number of common spiro atoms, the spirocycloalkyl group is divided into a monospirocycloalkyl group, a bisspirocycloalkyl group, or a polyspirocycloalkyl group, and is preferably a monospirocycloalkyl group or a bisspirocycloalkyl group, and more preferably a 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 5-membered, or 5-membered / 6-membered monospirocycloalkyl group. Representative examples of spirocycloalkyl groups include: [ka] The substituents include, but are not limited to:

[0059] A "fused cycloalkyl group" is a 5- to 20-membered polycyclic hydrocarbon group, in which each ring in the system shares an adjacent pair of carbon atoms with another ring, and in which one or more rings may contain one or more double bonds, but no ring has a completely conjugated π-electron system. Preferably, the fused cycloalkyl group has 6 to 14 members, more preferably 7 to 10 members. Depending on the number of ring members, the fused cycloalkyl group is divided into bicyclic, tricyclic, tetracyclic, or polycyclic fused cycloalkyl groups, and is preferably a bicyclic or tricyclic fused cycloalkyl group, more preferably a 5-membered / 5-membered or 5-membered / 6-membered bicyclic fused cycloalkyl group. Representative examples of fused cycloalkyl groups are: [ka] The substituents include, but are not limited to:

[0060] A "bridged cycloalkyl group" is a 5- to 20-membered polycyclic hydrocarbon group, in which every two rings in the system share two unlinked carbon atoms. These rings may have one or more double bonds, but do not have a completely conjugated π-electron system. Preferably, the bridged cycloalkyl group has 6 to 14 members, and more preferably 7 to 10 members. Depending on the number of ring members, the bridged cycloalkyl group is divided into bicyclic, tricyclic, tetracyclic, or polycyclic bridged cycloalkyl groups, and is preferably a bicyclic, tricyclic, or tetracyclic bridged cycloalkyl group, and more preferably a bicyclic or tricyclic bridged cycloalkyl group. Representative examples of bridged cycloalkyl groups include, but are not limited to, the following substituents: [ka]

[0061] A cycloalkyl group may be fused to the ring of an aryl group, a heteroaryl group, or a heterocycloalkyl group, where the ring connected to the parent structure is a cycloalkyl group. Representative examples include, but are not limited to, indanylacetic acid, tetralin, benzocycloheptyl, and the like. A cycloalkyl group may be optionally substituted or unsubstituted. When substituted, the substituents are preferably one or more, sometimes preferably 1 to 5, and sometimes more preferably 1 to 3, independently selected from the group consisting of alkyl groups, halogens, alkoxy groups, alkenyl groups, alkynyl groups, alkylsulfo groups, alkylamino groups, thiol groups, hydroxy groups, nitro groups, cyano groups, amino groups, cycloalkyl groups, heterocycloalkyl groups, aryl groups, heteroaryl groups, cycloalkoxy groups, heterocyclyl groups, cycloalkylthio groups, heterocycloalkylthio groups, and oxo groups.

[0062] A "heterocyclyl group" is a 3- to 20-membered saturated and / or partially unsaturated monocyclic or polycyclic hydrocarbon group, which includes N, O, and S(O) m (where m is 0, 1, or 2), optionally preferably 1 to 5, optionally more preferably 1 to 3 heteroatoms as ring atoms, and the remaining ring atoms in the ring, except for -OO-, -OS-, or -SS-, are C. Preferably, the heterocyclyl group is a 3- to 12-membered heterocyclyl group having 1 to 4 heteroatoms, more preferably a 3- to 10-membered heterocyclyl group having 1 to 3 heteroatoms, and most preferably a 5- or 6-membered heterocyclyl group having 1 to 2 heteroatoms. Representative examples of monocyclic heterocyclyl groups include, but are not limited to, a pyrrolidinyl group, a piperidine group, a piperazinyl group, a morpholinyl group, a sulfomorpholinyl group, a homopiperazinyl group, and the like. Polycyclic heterocyclyl groups include heterocyclyl groups having a spiro ring, a fused ring, or a bridged ring.

[0063] A "spiroheterocyclyl group" is a 5- to 20-membered polycyclic heterocyclyl group in which the rings are joined through one common carbon atom (called a spiroatom), and wherein the rings are not substituted with N, O, or S(O). m (where m is 0, 1, or 2), and the remaining ring atoms are C, where one or more rings may contain one or more double bonds, but none of the rings has a completely conjugated π-electron system. Preferably, the spiroheterocyclyl group has 6 to 14 members, and more preferably 7 to 10 members. Depending on the number of common spiro atoms, the spiroheterocyclyl group is divided into a monospiroheterocyclyl group, a bisspiroheterocyclyl group, or a polyspiroheterocyclyl group, and is preferably a monospiroheterocyclyl group or a bisspiroheterocyclyl group, and more preferably a 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 5-membered, or 5-membered / 6-membered monospiroheterocyclyl group. Representative examples of spiroheterocyclyl groups include: [ka] The substituents include, but are not limited to:

[0064] A "fused heterocyclyl group" is a 5- to 20-membered polycyclic heterocyclyl group, in which each ring in the system shares an adjacent pair of carbon atoms with another ring, in which one or more rings may contain one or more double bonds, but in which no ring has a completely conjugated pi-electron system, and in which the rings are not fused to N, O, and S(O) p(wherein p is 0, 1 or 2), optionally preferably 1 to 5, optionally more preferably 1 to 3 heteroatoms as ring atoms, and the remaining ring atoms are C. Preferably, the fused heterocyclyl group has 6 to 14 ring members, and more preferably 7 to 10 ring members. Depending on the number of ring members, the fused heterocyclyl group is divided into bicyclic, tricyclic, tetracyclic or polycyclic fused heterocyclyl groups, and is preferably a bicyclic or tricyclic fused heterocyclyl group, more preferably a 5-membered / 5-membered or 5-membered / 6-membered bicyclic fused heterocyclyl group. Representative examples of fused heterocyclyl groups are: [ka] The substituents include, but are not limited to:

[0065] A "bridged heterocyclyl group" is a 5- to 14-membered polycyclic heterocycloalkyl group, in which every two rings in the system share two non-linking atoms, the rings may have one or more double bonds but do not have a completely conjugated pi-electron system, and the rings are not heterocyclic, and ... m (where m is 0, 1 or 2), and the remaining atoms are C. Preferably, the bridged heterocyclyl group has 6 to 14 ring members, and more preferably 7 to 10 ring members. Depending on the number of ring members, the bridged heterocyclyl group is divided into bicyclic, tricyclic, tetracyclic or polycyclic bridged heterocyclyl groups, and is preferably a bicyclic, tricyclic or tetracyclic bridged heterocyclyl group, and more preferably a bicyclic or tricyclic bridged heterocyclyl group. Representative examples of bridged heterocyclyl groups include: [ka] The substituents include, but are not limited to:

[0066] The ring of the heterocyclyl group may be fused to the ring of an aryl group, heteroaryl group, or cycloalkyl group, where the ring attached to the parent structure is the heterocyclyl group. Representative examples are: [ka] The substituents include, but are not limited to, the following:

[0067] The heterocyclyl group is optionally substituted or unsubstituted. When substituted, the substituents are preferably one or more, sometimes preferably 1 to 5, sometimes more preferably 1 to 3 groups independently selected from the group consisting of alkyl groups, alkenyl groups, alkynyl groups, alkoxy groups, alkylsulfo groups, alkylamino groups, halogen, thiol, hydroxy groups, nitro groups, cyano groups, cycloalkyl groups, heterocycloalkyl groups, aryl groups, heteroaryl groups, cycloalkoxy groups, heterocycloalkoxy groups, cycloalkylthio groups, and heterocycloalkylthio groups.

[0068] The use of "heterocycle" is intended to include heteroaryl groups.

[0069] A "pharmaceutical composition" is a mixture of one or more compounds according to the present invention, or physiologically / pharmaceutically acceptable salts or prodrugs thereof, with other chemical components (e.g., physiologically / pharmaceutically acceptable carriers and excipients). The purpose of a pharmaceutical composition is to facilitate administration of the compound to an organism and promote absorption of the active ingredient, thereby exerting its biological activity.

[0070] A "pharmaceutically acceptable salt" is a salt of a compound of the present invention, which salt is safe and effective when used in mammals and possesses the relevant biological activity.

[0071] "Optionally" or "optionally" means that the subsequently described event or circumstance may, but does not necessarily, occur, and the statement includes instances where the event or circumstance may or may not occur. For example, "a heterocyclyl group is optionally substituted with an alkyl group" means that an alkyl group may, but does not necessarily, be present, and the statement includes instances where the heterocyclyl group is substituted with an alkyl group and instances where the heterocyclyl group is not substituted with an alkyl group.

[0072] "Substitution" means that one or more hydrogen atoms, preferably up to 5, more preferably 1 to 3 hydrogen atoms in a group, are independently replaced with the corresponding number of substituents. It is clear that the substituents are present at their only possible chemical positions. Those skilled in the art can determine whether substitution is possible without excessive effort through experiment or theory. For example, an amino group or a hydroxy group having free hydrogen may have an unstable bond with a carbon atom having an unsaturated bond (e.g., an ethylene bond).

[0073] As used herein, a "conjugate" is a biomolecule covalently linked to a non-nucleotide moiety. Particular conjugates of the invention are nucleic acid conjugates, in which a nucleic acid molecule (e.g., an oligonucleotide or siRNA) is covalently linked to a non-nucleotide moiety, such as a GalNAc conjugate moiety of the invention.

[0074] As used herein, an "oligonucleotide" is defined as a molecule comprising two or more covalently linked nucleosides, as commonly understood by those of skill in the art. Such covalently linked nucleosides may also be referred to as a nucleic acid molecule or oligomer.

[0075] Oligonucleotides are usually produced in laboratories by solid-phase chemical synthesis followed by purification. When referring to the sequence of an oligonucleotide, it refers to the sequence or order of the nucleobase moieties of covalently linked nucleotides or nucleosides or their modifications. The oligonucleotides of the present invention are artificial and chemically synthesized, and typically purified or isolated. The oligonucleotides of the present invention may contain one or more modified nucleosides or nucleotides.

[0076] "siRNA" can consist of two annealed polynucleotides or a single polynucleotide that forms a hairpin structure. The siRNA molecule of the present invention comprises a sense region and an antisense region. The antisense region has the same (fully complementary) or nearly the same (partially complementary) nucleotide sequence as the target nucleic acid.

[0077] RNAi molecules are essentially synthetic artificial molecules that function within the RNA interference (RNAi) pathway, where they interfere with target nucleic acids with complementary nucleotide sequences by degrading mRNA after transcription, thereby rendering them non-translatable. siRNA interacts with a protein complex called Dicer, which cuts the siRNA into smaller fragments. One strand of these fragments (most often the antisense strand) is carried by another protein complex called the RNA-induced silencing complex (RISC). The RISC-bound strand then connects the complex to the target nucleic acid through base pairing. Because the target nucleic acid is cut and destroyed, it is no longer able to synthesize proteins.

[0078] "Inhibition of expression" refers to a reduction or blocking of expression or activity, and does not necessarily indicate a complete elimination of expression or activity.

[0079] example The following examples are intended to illustrate the present invention, but should not be construed as limiting the scope of the present invention. Unless specific experimental conditions are given in the examples of the present invention, general conditions or those recommended by the manufacturers of raw materials and products are generally followed. Any reagents not specified as having a specific source are commonly available commercially.

[0080] The structure of each compound is identified by nuclear magnetic resonance (NMR) and / or mass spectrometry (MS). The NMR chemical displacements (δ) are -6 Spectra are given in ppm. NMR was determined on a Varian Mercury 300 MHz and a Bruker Avance III 400 MHz machine. Solvents used were deuterated dimethyl sulfoxide (DMSO-d), deuterated chloroform (CDCl), and deuterated methanol (CDOD).

[0081] High-performance liquid chromatography (HPLC) was performed using an Agilent 1200DAD high-pressure liquid chromatograph (Sunfire C18 150 x 4.6 mm chromatography column) and a Waters 2695-2996 high-pressure liquid chromatograph (Gimini C18 150 x 4.6 mm chromatography column). Liquid chromatography mass spectrometry (LCMS) was performed using an Agilent 1200 high-pressure liquid chromatograph and mass spectrometer (Sunfire C18 4.6 x 50 mm 3.5 μm chromatography column) and an Agilent 19091S-433 HP-5 high-pressure liquid chromatograph and mass spectrometer (XBridge C18 4.6 x 50 mm 3.5 μm chromatography column).

[0082] Chiral high performance liquid chromatography (HPLC) was established using SFC Thar 80 & 150 & 200 (Waters).

[0083] The thin-layer silica gel plates used in thin-layer chromatography are Yantai Xinnuo silica gel plates. The size of the plates used in TLC is 0.15mm-0.2mm, and the size of the plates used in thin-layer chromatography for product purification is 0.4mm-0.5mm.

[0084] Column chromatography typically uses 200-300 mesh silica gel from Qingdao Haiyang as the carrier.

[0085] The known starting materials of the present invention can be prepared by common synthetic methods in the prior art or may be purchased from sources such as ABCR GmbH & Co. KG, Acros Organics, Aldrich Chemical Company, Accela ChemBio Inc. or Dari Chemical Company.

[0086] Unless otherwise stated in the examples, all of the following reactions are carried out under an argon or nitrogen gas atmosphere.

[0087] The terms "argon gas atmosphere" or "nitrogen gas atmosphere" refer to a reaction flask equipped with a balloon containing 1 L of argon gas or nitrogen gas.

[0088] The term "hydrogen gas atmosphere" refers to a reaction flask equipped with a balloon containing 1 L of hydrogen gas.

[0089] MS is mass spectrometry, where (+) is the positive pattern and usually M+1 (or M+H) absorption is formed, where M = molecular mass.

[0090] Example 1 [ka]

[0091] Compound 1-2: Compound 1-1 (5 g, 12.84 mmol) in anhydrous 1,2-dichloroethane (30 mL) was stirred at 0 °C, and TMSOTf (3.43 g, 15.41 mmol, 2.78 mL) was added dropwise over 10 min with continued stirring, followed by overnight stirring at room temperature. The reaction mixture was quenched with cold saturated NaHCO solution (200 mL), and the organic layer was separated. The product was extracted with dichloromethane (60 mL × 2). The combined organic layer was washed with water and brine, dried over anhydrous NaSO, and evaporated to dryness under reduced pressure to give compound 1-2 (4.23 g, 99% yield) as a yellow oil, which was used without further purification.

[0092] C 14 H 19 Calculated mass of NO8: 329.1, Measured mass: 330.1 [M+H] + ,ESI.

[0093] Compound 1-3: Compound 1-2 (4.23 g, 12.85 mmol) in anhydrous 1,2-dichloroethane (20 mL) was stirred at room temperature for 5 min with 4 Å molecular sieves (4.7 g). 5-Hexen-1-ol (1.42 g, 14.13 mmol) was added and stirring was continued for 30 min. TMSOTf (1.43 g, 6.42 mmol, 1.16 mL) was added dropwise at 0 °C and stirring was continued at room temperature for 2 h. The reaction mixture was quenched with cold saturated NaHCO solution (100 mL), and the organic layer was separated. The product was extracted with dichloromethane (60 mL × 2). The combined organic layer was washed with water, dried over anhydrous NaSO, and evaporated to dryness under reduced pressure to give compound 1-3 (5.5 g, 99% yield) as a yellow oil, which was used without further purification.

[0094] C 20 H 31 Calculated mass of NO9: 429.2, Measured mass: 430.2 [M+H] + ,ESI.

[0095] Compound 1-4: To a solution of compound 1-3 (5.5 g, 12.81 mmol) in DCM (35 mL) and MeCN (35 mL) was added 4.0 mol equivalents of sodium (meta)periodate (10.96 g, 51.24 mmol) in water (45.5 mL). The mixture was cooled to 0 °C in an ice bath and stirred for 15 min. Ruthenium chloride trihydrate (110.5 mg, 423 μmol) was added to the cold reaction mixture. The reaction mixture was stirred at room temperature for 4 h. The reaction mixture was diluted with water (90 mL), and the pH was adjusted to 7.5 by adding solid NaHCO3. The DCM layer was removed, the aqueous layer was washed with DCM (30 mL x 2), and the organic extract was discarded. The pH of the aqueous layer was adjusted to 3 by adding citric acid, and the carboxylic acid 1-4 was extracted into DCM (50 mL x 3). The organic layer was stirred with saturated brine (50 mL x 1), and then NaSO solution (50 mL x 1) was added dropwise until the dark green organic phase turned pale yellow. The layers were separated, and the organic layer was dried over anhydrous NaSO and evaporated under reduced pressure to give compound 1-4 (2.3 g, 40% yield) as a white solid, which was used without further purification.

[0096] C 19 H 29 NO 11 Calculated mass: 447.2, Measured mass: 448.2 [M+H] + ,ESI.

[0097] 1 H NMR (400MHz,DMSO-d6) δ 7.81 (d,J=9.2Hz,1H),5.84-5.73 (m,1H),5.21 (d,J=3.3Hz,1H),4.98-4.93 (m,3H),4.48 (d,J=8.5Hz,1H),4.04-4.00 (m,3H),3.88-3.83 (m,1H),3.73-3.68 (m,1H),3.40-3.36 (m,1H),2.10 (s,3H),2.03-2.02 (m,2H),2.00 (s,3H),1.89 (s,3H),1.76 (s,3H),1.43-1.32 (m,4H).

[0098] Compound 1-6: To a solution of compound 1-5 (1.16 g, 6.17 mmol) and acid 1-4 (2.3 g, 5.14 mmol) in DMF (30 mL) was added HBTU (2.92 g, 7.71 mmol) and DIPEA (1.99 g, 15.42 mmol, 2.69 mL). The reaction was stirred at room temperature for 43 h and diluted with water (150 mL). The mixture was extracted with ethyl acetate (60 mL x 3). The combined organic layers were washed with water (100 mL x 3) and brine (100 mL). After drying over anhydrous Na2SO4, the solvent was evaporated under reduced pressure to give compound 1-6 (4.3 g, crude) as a yellow oil, which was used without further purification.

[0099] C 29 H 48 N2O 12 Calculated mass: 616.3, Measured mass: 617.4 [M+H] + ,ESI.

[0100] Compound 1-7: Compound 1-6 (4.23 g, assumed to be 6.86 mmol) was added to formic acid (30 mL) and the mixture was stirred overnight at room temperature. Completion of the reaction was confirmed by LC-MS. The mixture was then evaporated under reduced pressure and purified by silica gel chromatography (DCM:MeOH=10:1) to give compound 1-7 (2.88 g, 75% yield over two steps) as a yellow oil.

[0101] C 25 H 40 N2O 12 Calculated mass: 560.3, Measured mass: 561.3 [M+H] + ,ESI.

[0102] 1H NMR (400MHz,DMSO-d6) δ12.02 (s,1H),7.83 (d,J=9.2Hz,1H),7.25 (t,J=5.6Hz,1H),5.21 (d,J=3.2Hz,1H),4.96 (dd,J=11.2,3.6Hz,1H),4.47 (d,J=8.4Hz,1H),4.04-4.00 (m,3H),3.90-3.83 (m,1H),3.73-3.68 (m,1H),3.42-3.36 (m,1H),3.02-2.97(m,1H),2.18 (t,J=7.2Hz,2H),2.10 (s,3H),2.02 (t,J=7.2Hz,2H),1.99 (s,3H),1.89 (s,3H),1.77 (s,3H),1.54-1.41 (m,7H),1.27-1.21 (m,3H).

[0103] Example 2 Method 1: [ka]

[0104] Compound 2-1: A mixture of 2,2-bis(bromomethyl)propane-1,3-diol (270 g, 1.03 mol), benzaldehyde (114.86 g, 1.08 mol), and TsOH (17.74 g, 340.55 mmol) in toluene (1 L) was refluxed for 6 h. The mixture was cooled, extracted with EA (1 L), washed with NaHCO solution and brine, and dried over NaSO. The solvent was removed under reduced pressure, and the residue was recrystallized with MeOH to give the desired product 2-1 (247 g, 68% yield).

[0105] 1 H NMR (400MHz,DMSO-d6) δ 7.47-7.41 (m,2H),7.40-7.36 (m,3H),5.48 (s,1H),4.09-3.93 (m,6H),3.46 (s,2H).

[0106] Compound 2-2: To a suspension of t-BuOK (137.27 g, 1.43 mol) in dry DMF (700 mL) was added diisopropyl malonate (268.85 g, 1.43 mol) dropwise (maintaining the temperature below 70 °C), followed by compound 2-1 (250 g, 714.19 mmol). The resulting reaction mixture was heated at 140 °C for 6 h. After cooling, saturated NH4Cl solution (1.5 L) was added, and the mixture was extracted with hexane (500 mL x 3). The combined organic extracts were dried over sodium sulfate and concentrated in vacuo. The solid product was separated from the liquid residue by filtration, washed with hexane (100 mL x 2), and dried to give pure product 2-2 as a white solid (194 g, 68% yield).

[0107] C 21 H 28 Calculated mass of O6: 376.2, Measured mass: 377.2 [M+H] + ,ESI.

[0108] 1 H NMR (400MHz,DMSO-d6) δ 7.45-7.31 (m,5H),5.45 (s,1H),5.02-4.93 (m,2H),3.96 (d,J=11.2Hz,2H),3.77 (d,J=11.1Hz,2H),2.55 (s,2H),2.13 (s,2H),1.23-1.15 (m,12H).

[0109] Compound 2-3: To a solution of compound 2-2 (155 g, 411.7 mmol) in MeOH (750 mL) was added 10% Pd / C (31 g), and the resulting suspension was hydrogenated under 5 atm H2 at ambient temperature for 48 h with stirring. The catalyst was filtered and the solvent removed in vacuo to give compound 2-3 (118 g, 99% yield) as a colorless oil, which was used in the next step without purification.

[0110] C 21 H 28 Calculated mass of O6: 288.2, Measured mass: 289.4 [M+H] + ,ESI.

[0111] Compound 2-4: To a solution of compound 2-3 (140 g, 485.5 mmol) in dichloromethane (840 mL) was added methanesulfonyl chloride (155.7 g, 1.36 mol). The resulting mixture was cooled to -30 °C, and triethylamine (323.9 g, 3.2 mol) was added dropwise. After the addition was complete, the reaction mixture was warmed to ambient temperature, stirred for 12 h, and washed with water (1000 mL), 10% aqueous citric acid solution (1000 mL), and brine (1000 mL). The organic phase was dried over sodium sulfate and evaporated under reduced pressure to give compound 2-4 (125 g, 58% yield).

[0112] C 21 H 28 Calculated mass of O6: 444.1, Measured mass: 445.2 [M+H] + ,ESI.

[0113] 1 H NMR (400MHz,DMSO-d6) δ 5.02-4.93 (m,2H),4.20 (s,4H),3.23 (s,6H),2.45 (s,4H),1.22-1.14 (m,12H).

[0114] Compound 2-5: A solution of compound 2-4 (63 g, 141.73 mmol), potassium carbonate (100.88 g, 729.89 mmol), and p-toluenesulfonamide (25.48 g, 148.81 mmol) in DMSO (300 mL) was heated at 85 °C for 12 h. After cooling, water (300 mL) was added, and the mixture was extracted with EtOAc (600 mL). The combined organic phase was washed with 10% aqueous citric acid (600 mL) and brine (600 mL), dried over sodium sulfate, evaporated in vacuo, and recrystallized from isopropyl ether to give compound 2-5 (48 g, 80% yield).

[0115] C 21 H 28 Calculated mass of O6: 423.2, Measured mass: 424.2 [M+H] + ,ESI.

[0116] 1 H NMR (400MHz,DMSO-d6) δ 7.67 (d,J=8.2Hz,2H),7.45 (d,J=8.0Hz,2H),4.45 (t,J=5.4Hz,2H ),3.60 (s,4H),3.14 (d,J=5.7Hz,4H),2.43 (s,3H),1.67 (s,4H).

[0117] Compound 2-6: To a solution of compound 2-5 (58.7 g, 138.60 mmol) in THF (100 mL) at -20 °C, a solution of lithium borohydride (2 M) in THF (263.82 mL) was added. The resulting mixture was stirred at room temperature for 16 h. The mixture was slowly added to ice water (1 L). The pH was adjusted to 7 with aqueous citric acid. The mixture was extracted with EA (500 mL), dried over anhydrous sodium sulfate, and evaporated under reduced pressure to give compound 2-6 (40 g, 93% yield).

[0118] C 21 H 28 Calculated mass of O6: 311.1, Measured mass: 312.1 [M+H] + ,ESI.

[0119] 1 H NMR (400MHz,DMSO-D6) δ 7.67 (d,J=8.2Hz,2H),7.45 (d,J=8.0Hz,2H),4.45 (t,J=5.4Hz,2H ),3.60 (s,4H),3.14 (d,J=5.7Hz,4H),2.43 (s,3H),1.67 (s,4H).

[0120] Compound 2-7: Compound 2-6 (5 g, 16.1 mmol) and Mg (powder, 3.47 g, 144.6 mmol) were mixed in MeOH (anhydrous, 60 mL) and stirred overnight at room temperature. LC-MS showed complete conversion, and water (30 mL) was added. A white pellet formed. The mixture was filtered, and the pH of the filtrate was adjusted to 6 with HCl (aqueous 4 M) and concentrated to dryness to give compound 2-7 (2.55 g crude) as a yellow solid. The crude was used without further purification.

[0121] C8H 15 Calculated mass of NO2: 157.1, Measured mass: 158.1 [M+H] + ,ESI.

[0122] Compound 2-8: Compound 2-7 (2.55 g, assumed to be 16.2 mmol) was dissolved in dioxane (20 mL) and FmocCl (4.60 g, 17.8 mmol) was slowly added at 0 °C, followed by Na2CO3 (saturated, 20 mL). The reaction was stirred at 30 °C for 3 h. LC-MS showed complete conversion. The reaction mixture was extracted with EA (20 mL x 3). The organic phase was concentrated and purified by high-performance silica gel column chromatography (DCM:MeOH = 97:3) to give 2-8 as a white solid (2.75 g, 44.7% yield over two steps).

[0123] C 23 H 25 Calculated mass of NO4: 379.2, Measured mass: 380.2 [M+H] + ,ESI.

[0124] Compound 2-9: Compound 2-8 (2.7 g, 7.1 mmol) and pyridine (20 mL) were mixed in a flask, and DMTr-Cl (2.4 g, 7.1 mmol) was added portionwise. The reaction was stirred at room temperature for 4 h. LC-MS showed complete conversion. The reaction mixture was extracted with EA (20 mL x 3). The organic phase was concentrated and purified by high-performance silica gel column chromatography (DCM:MeOH = 97:3) to give 2-9 as a yellow solid (2.8 g, 58% yield).

[0125] C 44 H 43 Calculated mass of NO6: 681.3, Measured mass: 682.3 [M+H] + ,ESI.

[0126] Compound 2-10: Compound 2-9 (2.3 g, 6.8 mmol), piperidine (5 mL), and MeOH (anhydrous, 45 mL) were mixed in a flask and stirred at 30 °C for 3 h. LC-MS showed complete conversion. The reaction mixture was concentrated and purified by high-performance silica gel column chromatography (DCM:MeOH = 95:5) to give 2-10 (0.5 g, 33% yield) as a yellow solid.

[0127] C 29 H 33 Calculated mass of NO4: 459.2, Measured mass: 460.2 [M+H] + ,ESI.

[0128] Compound 2-11: Compound 1-7 (325 mg, 0.58 mmol), HOBT (105 mg, 0.77 mmol), and EDCI (150 mg, 0.78 mmol) were dissolved in DCM (6 mL), stirred at room temperature for 15 min, and then cooled to 0 °C. DIPEA (211 mg, 1.6 mmol) was added, followed by compound 2-9 (300 mg, 0.65 mmol), and the mixture was stirred at room temperature for 4 h. LC-MS showed complete conversion. NaHCO3 (saturated, 10 mL) was added. The reaction mixture was extracted with DCM (5 mL x 3). The organic phase was concentrated and purified by silica gel high-performance column chromatography (DCM:MeOH = 95:5) to give crude compound 2-11 as a white solid (350 mg, 88% purity at 210 nm, 46% yield). Purification by preparative HPLC: Crude compound 2-7 (1.8 g, 88% purity at 210 nm) was purified by preparative HPLC (C-18 column, water / ACN, 10% to 80% ACN) to give compound 2-11 (650 mg, 42% recovery). 54 H 71 N3O 15 Calculated mass: 1001.5, Measured mass: 1024.5 [M+Na] + ,ESI.

[0129] 1H NMR (400MHz,DMSO) δ 7.82 (d,J=9.2Hz,1H),7.75-7.69 (br,1H),7.40-7.35 (m,2H),7.37-7.21 (m,7H),6.95-6.88 (m,4H),5.21 (d,J=3.3Hz,1H),5.00-4.90 (m,1H),4.66-4.63 (m,1H),4.48 (d,J=8.4Hz,1H),4.08-4.00 (br,4H),3.91-3.83(m,1H),3.73 (s,6H),3.72-3.66 (m,3H),3.51 (s,1H),3.43-3.37 (m,3H),3.03-2.96 (m,2H),2.91 (s,2H),2.10 (s,3H),2.00-1.76 (m,17H),1.49-1.30 (m,8H),1.23-1.19 (m,2H). [ka]

[0130] Compound 2-12: To a solution of compound 2-11 (300.0 mg, 0.30 mmol) in anhydrous DCM (3.0 mL) at room temperature, 4,5-dicyanoimidazole (32.0 mg, 0.27 mmol) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (108 mg, 0.36 mmol) were added and stirred for 1 h. LCMS showed that the starting material was completely consumed. The solution was quenched with water (100 mL), washed with brine (300 mL x 3), and dried over Na2SO4. The solution was then concentrated under reduced pressure, and the residue was purified by high-speed preparative HPLC under the following conditions: column: C18 silica gel, mobile phase: CH3CN / HO = 1 / 1 increased to CH3CN / HO = 1 / 0 within 20 min, detector: UV 254 nm. This gave compound 2-12 as a white solid (177 mg, 49% yield).

[0131] C 63 H 88 N5O 16 Calculated mass of P: 1201.60, Measured mass: 1202.6 [M+H] +,ESI.

[0132] 1 HNMR (600MHz,CD3CN) δ 7.37-7.34 (m,2H),7.24-7.20 (m,6H),7.14-7.12 (m,1H),6.79-6.77 (m,4H),6.57-6.54 (m,1H),6.44-6.43 (m,1H),5.20 (d,J=6.0Hz,1H),4.93-4.91 (m,1H),4.44 (d,J=6.0Hz,1H),4.04-3.83 (m,5H),3.73-3.39 (m,16H),3.04-2.91 (m,4H),2.52-2.50 (m,2H),2.03-1.75 (m,24H),1.53-1.33 (m,9H), 1.21-1.04 (m,15H).

[0133] 31 PNMR (242MHz,CD3CN) δ 147.37,147.30.

[0134] Compound 2-13: To a solution of compound 2-11 (80 mg, 0.080 mmol) in anhydrous DCM (1.0 mL) was added DMAP (5 mg, 0.04 mmol) and TEA (24 mg, 0.24 mmol), followed by succinic anhydride (20 mg, 0.2 mmol). The reaction mixture was stirred at room temperature for 3 h, and LCMS showed that the starting material was completely consumed. The reaction mixture was diluted with DCM (10 mL), washed with HO (3 mL x 4), and brine (3 mL x 4). The organic layer was concentrated to give compound 2-13 (85 mg, 97% yield) as a white solid.

[0135] C 58 H 75 N3O 18 Calculated mass: 1101.50, measured mass: 1100.4 [MH] - ,ESI.

[0136] 1HNMR (600MHz,DMSO-d6) δ 12.22 (s,1H),7.84-7.81 (m,1H),7.71-7.69 (m,1H),7.37-7.16 (m,9H),6.92-6.89 (m,4H),5.21 (d,J=6.0Hz,1H),4.97-4.95 (m,1H),4.48 (d,J=12.0Hz,1H),4.07-4.01 (m,6H),3.89-3.84 (m,1H),3.73-3.65 (m,9H),3.49 (s,1H),3.41-3.38 (m,1H),3.01-2.95 (m,4H),2.45-2.44 (m,4H),2.09-1.76 (m,20H),1.48-1.19 (m,10H).

[0137] Solid support 2-14: Native amino-LCAA-CPG (loading value: 75 umol / g, 1000 Å) was washed with ACN (100 mL×2), DMF (100 mL×2) and DCM (100 mL×2) and dried under high vacuum overnight.

[0138] To a solution of succinate ester 2-13 (85 mg, 0.077 mmol) and HBTU (53 mg, 0.14 mmol) in anhydrous DMF (1.5 mL) was added DIPEA (30 mg, 0.23 mmol). The reaction mixture was shaken at room temperature for 10 min, and then natural amino-LCAA-CPG (250 mg, loading 75 μmol / g) was added. The suspension was shaken at room temperature for 20 h, filtered, and washed with DMF (20 mL x 5), ACN (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 2 h to give the solid support (260 mg). The unreacted amino groups on the solid support were blocked by stirring with AcO / pyridine / N-methylimidazole (90 μL / 1.0 mL / 80 μL) at room temperature for 1 h and then washed with DMF (20 mL x 5), CHCl (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spots at 254 nm. The solid support was dried under vacuum for 15 h to obtain solid support 2-14 (260 mg). For loading calculations, 6.5 mg of loaded dried CPG was taken and 25 mL of 3% DCA in DCM was added. The solution was shaken, and the UV absorbance at 500 nm was measured. To ensure signal saturation, the absorbance value was ensured to be less than 1.0 unit. Loading (µmol / g) = (total amount of DCA added (mL)) * (absorbance value at 500 nm) * 1000) / (76 * (mg of CPG taken)) Total amount of DCA added (mL) = 25 mL Absorbance value at 500 nm = 0.7721 mg of CPG taken = 6.5mg The following equation was applied: Loading (μmol / g) = ((25)*(0.7721)*1000) / (76*(6.5)) = 39 μmol / g. Method 2: [ka]

[0139] Compound 2-2: In a 250 mL flask, compound 2-1 (11 g, 26.0 mmol) was dissolved in THF (anhydrous, 100 mL). At 0 °C, LiAlH (1.97 g, 52 mmol) was added portionwise over 15 min. The reaction was then stirred at room temperature for 4 h. LC-MS showed complete conversion. The reaction was cooled to 0 °C, and water (2 mL) was added slowly, followed by NaOH (10%, 2 mL) and water (6 mL). The mixture was filtered, and the filtrate was concentrated to dryness to give compound 2-2 (6.5 g, 80% yield) as a white solid. The crude material was used without further purification.

[0140] C 15 H 21 NO4S: 311.1, Actual value: 312.1 [M+H] + ,ESI.

[0141] 1 H NMR (400MHz,DMSO) δ 7.67 (d,J=8.0Hz,2H),7.48 (d,J=8.0Hz,2H),4.46 (t,J=5.4Hz,2H),3.60 (s,4H),3.31 (d,J=5.6Hz,4H),2.43 (s,3H),1.67 (s,4H).

[0142] Compound 2-3: Compound 2-2 (5 g, 16.1 mmol) and Mg (powder, 3.47 g, 144.6 mmol) were mixed in MeOH (anhydrous, 60 mL) and stirred overnight at room temperature. LC-MS showed complete conversion, and water (30 mL) was added. A white pellet formed. The mixture was filtered, and the pH of the filtrate was adjusted to 6 with HCl (aqueous 4 M) and concentrated to dryness to give compound 2-3 (2.55 g crude) as a yellow solid. The crude was used without further purification.

[0143] C8H 15 Calculated mass of NO2: 157.1, Measured mass: 158.1 [M+H] + ,ESI.

[0144] Compound 2-4: Compound 2-3 (2.55 g, assumed to be 16.2 mmol) was dissolved in dioxane (20 mL) and FmocCl (4.60 g, 17.8 mmol) was slowly added at 0 °C, followed by Na2CO3 (saturated, 20 mL). The reaction was stirred at 30 °C for 3 h. LC-MS showed complete conversion. The reaction mixture was extracted with EA (20 mL x 3). The organic phase was concentrated and purified by high-performance silica gel column chromatography (DCM:MeOH = 97:3) to give 2-4 as a white solid (2.75 g, 44.7% yield over two steps).

[0145] C 23 H 25 Calculated mass of NO4: 379.2, Measured mass: 380.2 [M+H] + ,ESI.

[0146] Compound 2-5: Compound 2-4 (2.7 g, 7.1 mmol) and pyridine (20 mL) were mixed in a flask, and DMTr-Cl (2.4 g, 7.1 mmol) was added portionwise. The reaction was stirred at room temperature for 4 h. LC-MS showed complete conversion. The reaction mixture was extracted with EA (20 mL x 3). The organic phase was concentrated and purified by high-performance silica gel column chromatography (DCM:MeOH = 97:3) to give 2-5 as a yellow solid (2.8 g, 58% yield).

[0147] C 44 H 43 Calculated mass of NO6: 681.3, Measured mass: 682.3 [M+H] + ,ESI.

[0148] Compound 2-6: Compound 2-5 (2.3 g, 6.8 mmol), piperidine (5 mL), and MeOH (anhydrous, 45 mL) were mixed in a flask and stirred at 30 °C for 3 h. LC-MS showed complete conversion. The reaction mixture was concentrated and purified by high-performance silica gel column chromatography (DCM:MeOH = 95:5) to give 2-6 (0.5 g, 33% yield) as a yellow solid.

[0149] C 29H 33 Calculated mass of NO4: 459.2, Measured mass: 460.2 [M+H] + ,ESI.

[0150] Compound 2-7: Compound 1-7 (325 mg, 0.58 mmol), HOBT (105 mg, 0.77 mmol), and EDCI (150 mg, 0.78 mmol) were dissolved in DCM (6 mL), stirred at room temperature for 15 min, and then cooled to 0 °C. DIPEA (211 mg, 1.6 mmol) was added, followed by compound 2-6 (300 mg, 0.65 mmol), and the mixture was stirred at room temperature for 4 h. LC-MS showed complete conversion. NaHCO3 (saturated, 10 mL) was added. The reaction mixture was extracted with DCM (5 mL x 3). The organic phase was concentrated and purified by silica gel high-performance column chromatography (DCM:MeOH = 95:5) to give crude compound 2-7 as a white solid (350 mg, 88% purity at 210 nm, 46% yield). Purification by preparative HPLC: Crude compound 2-7 (1.8 g, 88% purity at 210 nm) was purified by preparative HPLC (C-18 column, water / ACN, 10% to 80% ACN) to give compound 2-7 (650 mg, 96% purity at 210 nm, 42% recovery). 54 H 71 N3O 15 Calculated mass: 1001.5, Measured mass: 1024.5 [M+Na] + ,ESI.

[0151] 1H NMR (400MHz,DMSO) δ 7.82 (d,J=9.2Hz,1H),7.75-7.69 (br,1H),7.40-7.35 (m,2H),7.37-7.21 (m,7H),6.95-6.88 (m,4H),5.21 (d,J=3.3Hz,1H),5.00-4.90 (m,1H),4.66-4.63 (m,1H),4.48 (d,J=8.4Hz,1H),4.08-4.00 (br,4H),3.91-3.83(m,1H),3.73 (s,6H),3.72-3.66 (m,3H),3.51 (s,1H),3.43-3.37 (m,3H),3.03-2.96 (m,2H),2.91 (s,2H),2.10 (s,3H),2.00-1.76 (m,17H),1.49-1.30 (m,8H),1.23-1.19 (m,2H).

[0152] Compound 2-8: To a solution of compound 2-7 (300.0 mg, 0.30 mmol) in anhydrous DCM (3.0 mL) at room temperature, DCI (32.0 mg, 0.27 mmol) and CEP[N(iPr)] (108 mg, 0.36 mmol) were added and stirred for 1 h. LCMS showed that the starting material was completely consumed. The solution was quenched with water (100 mL), washed with brine (300 mL x 3), and dried over NaSO. The solution was then concentrated under reduced pressure, and the residue was purified by MPLC under the following conditions: column: C18 silica gel; mobile phase: CHCN / H0 = 1 / 1, increased to CHCN / H0 = 1 / 0 within 20 min; eluted product was collected at the CHCN / H0 = 3 / 2 position; detector: UV 254 nm). This gave compound 2-8 as a white solid (177 mg, 0.15 mmol, 97.0% purity, 49% yield).

[0153] C 63 H 88 N5O 16 Calculated mass of P: 1201.60, Measured mass: 1202.6 [M+H] + ,ESI.

[0154] 1H-NMR (600MHz,CD3CN): δ=7.37-7.34 (m,2H),7.24-7.20 (m,6H),7.14-7.12 (m,1H),6.79-6.77 (m,4H),6.57-6.54 (m,1H),6.44-6.43 (m,1H),5.20-5.19 (d,J=6.0Hz,1H),4.93-4.91 (m,1H),4.44-4.43 (d,J=6.0Hz,1H),4.04-3.83 (m,5H),3.73-3.39 (m,16H),3.04-2.91 (m,4H),2.52-2.50 (m,2H),2.03-1.75 (m,24H),1.53-1.33 (m,9H),1.21-1.04 (m,15H); 31 PNMR (242MHz,CD3CN) δ 147.37,147.29.

[0155] Compound 2-9: To a solution of compound 2-7 (80 mg, 0.080 mmol) in anhydrous DCM (1.0 mL) was added DMAP (5 mg, 0.04 mmol) and TEA (24 mg, 0.24 mmol), followed by succinic anhydride (20 mg, 0.2 mmol). The reaction mixture was stirred at room temperature for 3 h, and LCMS showed that the starting material was completely consumed. The reaction mixture was diluted with DCM (10 mL), washed with HO (3 mL x 4), and brine (3 mL x 4). The organic layer was concentrated to give compound 2-9 (85 mg, 0.077 mmol, 97% purity, 97% yield) as a white solid. 58 H 75 N3O 18 Calculated mass: 1101.50, measured mass: 1100.4 [MH] - ,ESI.

[0156] 1H-NMR (600MHz,DMSO-d6): δ=12.22 (s,1H),7.84-7.81 (m,1H),7.71-7.69 (m,1H),7.37-7.16 (m,9H),6.92-6.89 (m,4H),5.21-5.20 (d,J=6.0Hz,1H),4.97-4.95 (m,1H),4.49-4.47 (d,J=12.0Hz,1H),4.07-4.01 (m,6H),3.89-3.84 (m,1H),3.73-3.65 (m,9H),3.49 (s,1H),3.41-3.38 (m,1H),3.01-2.95 (m,4H),2.45-2.44 (m,4H),2.09-1.76 (m,20H),1.48-1.19 (m,10H).

[0157] Solid support 2-10: Native amino-LCAA-CPG (loading value: 75 umol / g, 1000 Å) was washed with ACN (100 mL×2), DMF (100 mL×2) and DCM (100 mL×2) and dried under high vacuum overnight.

[0158] To a solution of succinate ester 2-9 (85 mg, 0.077 mmol) and HBTU (53 mg, 0.14 mmol) in anhydrous DMF (1.5 mL) was added DIPEA (30 mg, 0.23 mmol). The reaction mixture was shaken at room temperature for 10 min, and then natural amino-LCAA-CPG (250 mg, loading 75 μmol / g) was added. The suspension was shaken at room temperature for 20 h, filtered, and washed with DMF (20 mL x 5), ACN (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 2 h to give the solid support (260 mg). The unreacted amino groups on the solid support were blocked by stirring with AcO / pyridine / N-methylimidazole (90 μL / 1.0 mL / 80 μL) at room temperature for 1 h and then washed with DMF (20 mL x 5), CHCl (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spots at 254 nm. The solid support was dried under vacuum for 15 h to obtain solid support 2-10 (260 mg). For loading calculations, 6.5 mg of loaded dried CPG was taken and 25 mL of 3% DCA in DCM was added. The solution was shaken, and the UV absorbance at 500 nm was measured. To ensure signal saturation, the absorbance value was ensured to be less than 1.0 unit. Loading (µmol / g) = (total amount of DCA added (mL)) * (absorbance value at 500 nm) * 1000) / (76 * (mg of CPG taken)) Total amount of DCA added (mL) = 25 mL Absorbance value at 500 nm = 0.7721 mg of CPG taken = 6.5mg The following equation was applied: Loading (μmol / g) = ((25)*(0.7721)*1000) / (76*(6.5)) = 39 μmol / g.

[0159] Example 3 [ka]

[0160] Compound 3-2: To a solution of compound 3-1 (40 g, 211.36 mmol) in NH / MeOH (7 M, 192 mL) was added dropwise ethyl 2-cyanoacetate (47.82 g, 422.71 mmol), and the mixture was stirred overnight. LC-MS showed complete conversion, and the reaction was filtered. The filter cake was triturated with PE (100 mL) and filtered. The filter cake was dried to give solid compound 3-2 (41 g, 44% yield).

[0161] Calculated mass of C18H18N4O2: 322.1, Measured mass: 323.1 [M+H] + ,ESI.

[0162] Compound 3-3: Compound 3-2 (80 g, 248.17 mmol) was dissolved in sulfuric acid solution (concentrated HSO / water = 1:1, v / v, 160 mL) and stirred at 120 °C for 5 h. LC-MS showed complete conversion, and the pH of the reaction mixture was adjusted to 9-10 by adding NaOH (30% aqueous solution) and readjusted to 4-5 by adding 1 M HCl solution. The reaction was then filtered, and the filtrate was concentrated to dryness to give crude compound 3-3 (72 g, 95% yield). The crude material was used directly without further purification.

[0163] Calculated mass of C16H21NO4: 291.2, Measured mass: 292.3 [M+H] + ,ESI.

[0164] Compound 3-4: Compound 3-3 (72.3 g, crude) in MeOH (1600 mL) and HSO (160 mL, concentrated HSO / water = 1:1, v / v) was stirred at 85 °C for 4 h. LC-MS showed complete conversion. The reaction mixture was filtered, concentrated to dryness, and purified by silica gel column chromatography (0% to 25% EA in PE) to give compound 3-4 (62.5 g, 78% yield over two steps).

[0165] C 18 H 25 Calculated mass of NO4: 319.2, Measured mass: 320.3 [M+H] +,ESI.

[0166] Compound 3-5: To a solution of compound 3-4 (40 g, 125.2 mmol) in THF (295 mL) at 0 °C, LiAlH (14.3 g, 375.1 mmol) was added portionwise and stirred for 1 h. LC-MS showed complete conversion, and ethyl acetate (100 mL) was added to the reaction mixture. The pH was adjusted to 9-10 by adding 10% NaOH (aq). The mixture was then filtered and washed with ethyl acetate (50 mL × 2). The combined filtrate was concentrated to dryness to give crude compound 3-5 (23 g, 83% yield). The crude product was used in the next step without further purification.

[0167] Calculated mass of C16H25NO2: 263.2, Measured mass: 264.3 [M+H] + ,ESI.

[0168] Compound 3-6: Compound 3-5 (20 g, 75.94 mmol), BocO (16.57 g, 75.94 mmol), and Pd / C (10% Pd on carbon, wet, approximately 55% water) in MeOH (150 mL) were stirred at room temperature under 1 atm H overnight. LC-MS showed complete conversion, and the reaction mixture was filtered and concentrated to give compound 3-6 (20 g, 96% yield) as an oil, which was used without further purification.

[0169] C 14 H 27 Calculated mass of NO4: 273.2, Measured mass: 274.1 [M+H] + ,ESI.

[0170] Compound 3-7: To a solution of compound 3-6 (58 g, 212.17 mmol) in triethylamine (85.88 g, 848.67 mmol, 118.37 mL) and DCM (1.16 L) was added MsCl (72.91 g, 636.51 mmol). The reaction was stirred at room temperature overnight. LC-MS showed complete conversion (EtOH quench and detection by diether). The reaction mixture was diluted with DCM (1 L), washed with 10% citric acid and NaHCO (saturated aqueous solution), and dried to give compound 3-7 (87 g, 95% yield) as an oil, which was used directly in the next step without purification.

[0171] C 16 H 31 Calculated mass of NO8S2: 429.2, Measured mass: 430.3 [M+H] + ,ESI.

[0172] Compound 3-8: Under nitrogen gas, NaH (60% in mineral oil, 3.72 g, 93.12 mmol) was suspended in anhydrous DMF (60 mL) and diisopropyl malonate (8.76 g, 46.56 mmol) was added. The reaction mixture was stirred at room temperature for 30 min to form a clear solution. KI (1.55 g, 9.31 mmol) was added, followed by compound 3-7 (20 g, 46.56 mmol). The reaction mixture was stirred at 70 °C for 30 min and then stirred again at 140 °C for 30 min. LC-MS showed complete conversion. The reaction was cooled to room temperature, diluted with ethyl acetate (300 mL), and washed with citric acid (10% aqueous solution, 200 mL x 2) and NaHCO3 (saturated aqueous solution, 200 mL). The organic phase was concentrated and purified by silica gel column (0% to 10% EA in PE) to give compound 3-8 as a colorless oil (3.55 g, 18% yield).

[0173] C 23 H 39 Calculated mass of NO6: 425.3, Measured mass: 426.2 [M+H] + ,ESI.

[0174] 1H NMR (400MHz,DMSO-d6) δ 4.96-4.90 (m,2H),3.27 (br,4H),1.86 (t,J=10.8Hz,4H),1.38 (br,13H),1.28 (s,4H),1.17-1.16 (m,12H).

[0175] Compound 3-9: LiBH4 (172 mL, 1 M in THF) was added to compound 3-8 (7.5 g, 17.62 mmol) at 0 °C, and the mixture was stirred overnight. LC-MS showed complete conversion. Ethyl acetate (10 mL) and NaOH (10% aqueous solution, 20 mL) were added to the reaction mixture, followed by filtration. The filtrate was diluted with water (200 mL), extracted with ethyl acetate (50 mL × 3), and concentrated to give compound 3-9 (6.35 g, 98% yield) as a colorless oil, which was used directly in the next step without purification.

[0176] C 17 H 31 Calculated mass of NO4: 313.2, Measured mass: 314.2 [M+H] + ,ESI.

[0177] Compound 3-10: Compound 3-9 (6.35 g, 20.26 mmol) was mixed with HCl (63.5 mL, 4 M in dioxane), and the mixture was stirred at room temperature for 3 h. LC-MS showed complete conversion. The reaction mixture was concentrated to dryness and azeotropically dried with toluene to give compound 3-10 (7 g, 99% yield), which was used directly in the next step without purification.

[0178] C 12 H 23 Calculated mass of NO2 (free base): 213.2, Found: 214.2 [M+H] + ,ESI.

[0179] 1H NMR (400MHz,D2O) δ 3.39 (br,4H),3.18 (t,J=11.6Hz,4H),1.59 (t,J=12.0Hz,4H),1.36-1.33 (m,4H),1.25 (t,J=12.4Hz,4H).

[0180] Compound 3-11: A solution of compound 3-10 (5 g, 20.02 mmol), DIEA (6.47 g, 50.04 mmol, 8.72 mL), HOBT (3.25 g, 24.02 mmol), and EDCI (4.60 g, 24.02 mmol) in DCM (150 mL) was stirred at 0 °C for 30 min, and Fmoc-6-aminocaproic acid (5.66 g, 16.01 mmol) was added, and the mixture was stirred at room temperature for 1 h. LC-MS showed complete conversion. The reaction mixture was diluted with another DCM (100 mL), washed with citric acid (10% aq., 200 mL), NaHCO3 (sat. aq., 200 mL), and water (200 mL), dried over Na2SO4, and concentrated to give the crude product, which was purified by silica gel column (0%-10% EA in PE) to give compound 3-11 (3.65 g, LC-MS purity 92%, 33% yield) as a gel.

[0181] C 33 H 44 Calculated mass of N2O5: 548.3, Measured mass: 549.3 [M+H] + ,ESI.

[0182] 1 H NMR (400MHz,DMSO-d6) δ 7.88 (d,J=7.5Hz,2H),7.84 (d,J=7.5Hz,2H),7.41 (t,J=7.3Hz,2H),7.34 (t,J=7.3Hz,2H),6.65 (t,J=5.3Hz,1H),6.28 (s,2H),4.36-4.18 (m,3H),3.36 (dt,J=19.9,5.2Hz,4H),3.24 (s,4H),2.92-2.87 (m,2H),2.24 (t,J=7.4Hz,2H),1.49-1.26 (m,18H).

[0183] Compound 3-12: A solution of compound 3-11 (2.55 g, 4.65 mmol), 4,4'-(chloro(phenyl)methylene)bis(methoxybenzene) (1.57 g, 4.65 mmol), DIEA (600.6 mg, 4.65 mmol), and DMAP (56.8 mg, 0.47 mmol) in DCM (51 mL) was stirred at room temperature overnight. LC-MS showed partial conversion. The reaction mixture was then concentrated and purified by silica gel column chromatography (10% to 40% EA in PE to elute impurities, and 5% to 10% MeOH in DCM (containing 0.1% NH₃·H₂O)) to give compound 3-12 (2.75 g, 69% yield).

[0184] 1 H NMR (400MHz,DMSO-d6) δ 7.88-7.87 (m,2H),7.69-7.68 (m,2H),7.41-7.37 (m,4H),7.33-7.25 (m,9H),6.89-6.80 (m,5H),4.41 (t,J=5.0Hz,1H),4.28 (d,J=6.8Hz,2H),4.20 (t,J=6.8Hz,1H),3.72 (s,8H),3.40-3.39 (m,2H),3.32-3.27 (m,4H),2.96 (q,J=6.3Hz,2H),2.22 (t,J=7.9Hz,2H),1.48-0.86 (m,18H).

[0185] Compound 3-13: To a solution of compound 3-12 (1.7 g, 2.00 mmol) in MeOH (51 mL) was added piperidine (5.1 mL), and the mixture was stirred at room temperature for 3 h. LC-MS showed complete conversion. The reaction mixture was concentrated and azeotropically dried with ditoluene. The residue was purified by silica gel column chromatography (0% to 10% MeOH in DCM, containing 0.1% NH3·H2O) to give compound 3-13 (1.1 g, 87% yield) as a gel.

[0186] C 39 H 52 Calculated mass of N2O5: 628.4, Measured mass: 629.4 [M+H] + ,ESI.

[0187] Compound 3-14: A solution of compound 3-13 (0.94 g, 1.49 mmol), DIEA (482.98 mg, 3.74 mmol), HOBT (242.38 mg, 1.79 mmol), and EDCI (343.87 mg, 1.79 mmol) in DCM (29 mL) was stirred at 0 °C, and compound 1-4 (936.36 mg, 2.09 mmol) was added, and the mixture was stirred at room temperature for 1 h. LC-MS showed complete conversion. The reaction mixture was diluted with another 20 mL of DCM, washed with NaHCO (saturated aqueous solution, 50 mL) and water (50 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 3-14 (700 mg, 44% yield).

[0188] C 58 H 79 N3O 15 Calculated mass: 1057.6, Measured mass: 1080.5 [M+Na] + ,ESI.

[0189] 1 H NMR (400MHz,DMSO-d6) δ 7.82 (d,J=9.2Hz,1H),7.69 (t,J=5.5Hz,1H),7.40-7.38 (m,2H),7.32-7.19 (m,7H),6.89-6.87 (m,4H),5.21 (d,J=3.3Hz,1H),4.97 (dd,J=11.2,3.4Hz,1H),4.48 (d,J=8.5Hz,1H),4.40 (t,J=5.0Hz,1H),4.02 (s,3H),3.91-3.83 (m,1H),3.73-3.68 (m,7 H),3.43-3.39 (m,3H),3.32-3.27 (m,2H),2.99 (q,J=6.6Hz,2H),2.87 (s,2H),2.22 (t,J=7.3Hz,2H),2.10 (s,3H),2.03 (t,J=7.0Hz,2H),1.99 (s,3H),1.89 (s,3H),1.77 (s,3H),1.53-1.03 (m,20H),0.90-0.83 (m,2H).

[0190] Compound 3-15: To a solution of compound 3-14 (670.0 mg, 0.61 mmol) in anhydrous DCM (3.0 mL) at room temperature, 4,5-dicyanoimidazole (96.0 mg, 0.81 mmol) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (324 mg, 1.08 mmol) were added and stirred for 1 h. LCMS showed that the starting material was completely consumed. The solution was quenched with water (100 mL), washed with brine (300 mL x 3), and dried over Na2SO4. The solution was then concentrated under reduced pressure, and the residue was purified by high-speed preparative HPLC under the following conditions: column: C18 silica gel, mobile phase: CH3CN / HO = 1 / 1 increased to CH3CN / HO = 1 / 0 within 20 min, detector: UV 254 nm. This gave compound 3-15 as a white solid (600 mg, 83% yield).

[0191] C 67 H 96 N5O 16 Calculated mass of P: 1257.66, Measured mass: 1204.5 [M-CH2CH2CN] - ,ESI.

[0192] 1 HNMR (600MHz,DMSO-d6) δ 7.81-7.67 (m,2H),7.40-7.19 (m,9H),6.88-6.86 (m,4H),5.21 (d,J=6.0Hz,1H),4.98-4.94 (m,1H),4.49 (d,J=6.0Hz,1H),4.04-3.83 (m,4H),3.73-3.32 (m,15H),3.01-2.89 (m,4H),2.73-2.70 (m,2H),2.24-2.20 (m,2H),2.11-1.76 (m,15H),1.49-0.91 (m,34H).

[0193] 31 PNMR (242MHz,DMSO-d6) δ 146.21,146.19.

[0194] Example 4 [ka]

[0195] Compound 4-2: At 0° C., potassium carbonate (8.10 g, 58.61 mmol) was added to a solution of MeOH (80 mL), HO (60 mL), formaldehyde (3.52 g, 117.22 mmol), and compound 4-1 (25 g, 117.22 mmol). The reaction mixture was stirred at 0° C. overnight. The reaction mixture was concentrated to 70% of its volume, and the residue was extracted three times with ethyl acetate. The organic phase was washed with water, brine, dried over anhydrous sodium sulfate, and concentrated to give crude product 4-2 (27 g, 95% yield), which was used in the next step without purification.

[0196] C 12 H 21 Calculated mass of NO4: 243.2, Measured mass: 244.1 [M+H] + ,ESI.

[0197] Compound 4-3: Sodium borohydride (11.97 g, 316.48 mmol) was added to a solution of compound 4-2 (35 g, 143.86 mmol) in methanol (28 ml) at 0 °C within 5 min. The reaction mixture was stirred at 0 °C and then warmed to room temperature and stirred for 5 h. The reaction was quenched with saturated ammonium chloride solution and concentrated, extracted three times with ethyl acetate (EA), washed with brine, and recrystallized from EA:PE = 1:3 to give compound 4-3 (19.6 g, 54% yield).

[0198] C 12 H 23 Calculated mass of NO4: 245.2, Measured mass: 146.1 [M+H-Boc] + ,ESI.

[0199] Compound 4-4: Compound 4-3 (30 g, 122.29 mmol), triethylamine (30.94 g, 305.73 mmol, 42.64 mL), and DCM (300 mL) were mixed, cooled to −30° C., and MsCl (35.02 g, 305.73 mmol) was slowly added. After stirring at room temperature for 1.5 h, the reaction mixture was extracted with 400 mL of water, washed with 100 mL of 10% aqueous citric acid, and dried over anhydrous sodium sulfate. After concentration, the residue was purified using a silica gel column to give compound 4-4 (40 g, 81% yield) as a pale yellow oily liquid.

[0200] C 14 H 27 Calculated mass of NO8S2: 401.1, Measured mass: 302.1 [M+H-Boc] + ,ESI.

[0201] Compound 4-5: Under nitrogen gas, diisopropyl malonate (14.06 g, 74.72 mmol) was slowly added to a mixture of t-BuONa (9.57 g, 99.63 mmol) in DMA (50 mL). After stirring for 20 min, compound 4-4 (20 g, 49.81 mmol) and KI (4.13 g, 24.91 mmol) were added. The reaction mixture was heated to 140 °C and stirred overnight. The reaction was quenched by adding saturated ammonium chloride and extracted with ethyl acetate. After concentration, the residue was purified by silica gel column (PE:EA) to give compound 4-5 (6 g, 30% yield).

[0202] C 21 H 35 Calculated mass of NO6: 397.3, Measured mass: 398.2 [M+H] + ,ESI.

[0203] 1 H NMR (400MHz,DMSO) δ 4.98-4.90 (m,2H),3.22-3.20 (m,4H),2.25 (s,4H),1.42 (t,J=5.6Hz,4H),1.38 (s,9H),1.17 (d,J=6.0Hz,12H).

[0204] Compound 4-6: To a solution of compound 4-5 (9.75 g, 24.53 mmol) in anhydrous THF (200 mL) was added lithium borohydride (10.69 g, 490.56 mmol) at 0 °C. The reaction mixture was slowly warmed to room temperature and stirred overnight. Ethyl acetate (200 mL) was then added to the reaction mixture, which was extracted with water (150 mL x 3) and washed with saturated sodium chloride, dried over anhydrous sodium sulfate, and concentrated to give crude product 4-6 (6.52 g, 93% yield), which was used in the next step without purification.

[0205] C 15 H 27 Calculated mass of NO4: 285.2, Measured mass: 186.2 [M+H-Boc] + ,ESI.

[0206] Compound 4-7: To a solution of product 4-6 (7.52 g, 26.35 mmol) in DCM (100 mL) was added HCl (4 M in 1,4-dioxane, 21.52 mL) within 15 min at 0 °C. The reaction mixture was allowed to warm to room temperature and stirred for 3 h. The reaction mixture was filtered, and the filter cake was washed with dichloromethane (x3) to give crude product 4-7 (3.7 g, 76% yield).

[0207] C 10 H 19 Calculated mass of NO2 (free base): 185.1 m / z, Found: 186.2 [M+H] + ,ESI.

[0208] Compound 4-8: A mixture of Fmoc-6-aminocaproic acid (1.91 g, 5.41 mmol), 1-hydroxybenzotriazole (HOBT, 609.41 mg, 4.51 mmol), EDCI (864.59 mg, 4.51 mmol), and DIEA (582.89 mg, 4.51 mmol, 785.56 μL) in DCM (10 mL) was stirred at room temperature for 30 min and then added to a solution of compound 4-7 (1 g, 4.51 mmol) in DCM, and the mixture was stirred for 4 h. The reaction mixture was washed with saturated sodium bicarbonate solution, brine, and dried over anhydrous sodium sulfate. After concentration, the residue was purified using a silica gel column to give compound 4-8 (1.35 g, 58% yield).

[0209] C 31 H 40 Calculated mass of N2O5: 520.3, Measured mass: 521.2 [M+H] + ,ESI.

[0210] 1 H NMR (400MHz,DMSO) δ 7.88 (d,J=7.5Hz,2H),7.68 (d,J=7.4Hz,2H),7.39 (d,J=7.5Hz,4H),7.34-7.18 (m,10H),6.89 (d,J=8.8Hz,4H),4.64 (t,J=4.7Hz,1H),4.28 (d,J=6.8Hz,2H),4.20 (t,J=6.8Hz,1H),3.73 (s,6H),3.44 (d,J=5.0Hz,2H),3.30-3.10 (m,4H),3.01 (s,2H),3.00-2.90 (m,2H),2.21 (t,J=7.2Hz,2H),1.56 (d,J=11.9Hz,2H),1.46-1.30 (m,8H),1.21-1.00 (m,4H).

[0211] Compound 4-9: A mixture of DMTr-Cl (488.07 mg, 1.44 mmol) and compound 4-8 (0.75 g, 1.44 mmol) in pyridine (6 ml) was stirred at room temperature overnight. The reaction mixture was concentrated in vacuo. The residue was redissolved in ethyl acetate (containing 1% pyridine), dried over alumina, and purified by alumina column chromatography (0% to 10% MeOH, 0.1% TEA in DCM) to give compound 4-9 (0.39 g, 32.9% yield).

[0212] 1 H NMR (400MHz,DMSO) δ 7.39 (d,J=7.3Hz,2H),7.34-7.18 (m,7H),6.89 (d,J=8.8Hz,4H),4.63 (s,1H),3.73 (s,6H),3.43 (s,2H),3.30-3.18 (m,6H),3.05 (s,2H),2.22 (t,J=7.4Hz,2H),1.57 (d,J=12.1Hz,2H),1.47-1.08 (m,12H).

[0213] Compound 4-10: Compound 4-9 (1.4 g, 1.70 mmol) was dissolved in MeOH (40 mL) and piperidine (4 mL) was added. The mixture was stirred at room temperature overnight. The reaction mixture was concentrated in vacuo. Piperidine residues were further removed by azeotropic drying with ditoluene. The residue was then purified by silica gel column chromatography (DCM:MeOH = 10:1, methanol containing 10% aqueous ammonia) to give compound 4-10 (1 g, 97% yield).

[0214] C 37 H 48 Calculated mass of N2O5: 600.4, Measured mass: 601.4 [M+H] + ,ESI.

[0215] 1H NMR (400MHz,DMSO-d6) δ 7.40-7.39 (m,2H),7.33-7.21 (m,7H),6.89 (d,J=8.8Hz,4H),4.63 (s,1H),3.73 (s,6H),3.44-3.16 (m,8H),3.01-3.00 (m,2H),2.24-2.21 (m,2H),1.57 (d,J=12.2Hz,2H),1.45-1.33 (m,7H),1.27-1.21 (m,4H),1.09 (s,1H).

[0216] Compound 4-11: A mixture of compound 1-4 (959.23 mg, 2.14 mmol), HOBt (289.68 mg, 2.14 mmol), EDCI (410.98 mg, 2.14 mmol), and DIEA (395.82 mg, 3.06 mmol, 533.45 μL) in DCM (10 mL) was stirred for 20 min and added to a solution of compound 4-10 (920 mg, 1.53 mmol) in DCM (5 mL) and stirred overnight at room temperature. Water was added to quench the reaction, and the organic layer was separated and concentrated. The residue was purified by preparative HPLC to give compound 4-11 (1 g, 63% yield).

[0217] C 56 H 75 N3O 15 Calculated mass: 1029.5, Measured mass: 1052.3 [M+Na] + ,ESI.

[0218] 1H NMR (400MHz,DMSO-d6) δ 7.82 (d,J=9.2Hz,1H),7.79 (t,J=5.0Hz,1H),7.40-7.19 (m,9H),6.90-6.88 (m,2H),5.21 (d,J=3.2Hz,1H),4.97 (dd,J=11.2,3.3Hz,1H),4.62 (t,J=4.9Hz,1H),4.48 (d,J=8.4Hz,1H),4.02 (s,3H),3.87 (dd,J=20.4,9.6Hz,1H),3.97-3.67 (m,7H),3.45-3.38 (m,3H),3.30-3.13 (m,4H),3.05-2.96 (m,4H),2.22 (t,J=7.3Hz,2H),2.10 (s,3H),2.04-1.99 (m,5H),1.89 (s,3H),1.77 (s,3H),1.59-1.21 (m,18H). [ka]

[0219] Compound 4-12: To a solution of compound 4-11 (750.0 mg, 0.75 mmol) in anhydrous DCM (7.0 mL) at room temperature, 4,5-dicyanoimidazole (80.0 mg, 0.67 mmol) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (270 mg, 0.90 mmol) were added and stirred for 1 h. LCMS showed that the starting material was completely consumed. The solution was quenched with water (100 mL), washed with brine (300 mL x 3), and dried over Na2SO4. The solution was then concentrated under reduced pressure, and the residue was purified by high-speed preparative HPLC using the following conditions: C18 silica gel column, mobile phase: CH3CN / HO = 1 / 1, increased to CH3CN / HO = 1 / 0 within 20 min, detector: UV 254 nm. This gave compound 4-12 as a white solid (500 mg, 53% yield).

[0220] C 65 H 92 N5O 16Calculated mass of P: 1229.63, Measured mass: 1129.0 [MN(CH(CH3)2)2] + ,ESI.

[0221] 1 HNMR (600MHz,DMSO-d6): δ 7.44-7.18 (m,9H),6.85-6.83 (m,4H),6.52-6.44 (m,2H),5.26 (d,J=6.0Hz,1H),4.99-4.96 (m,1H),4.49 (d,J=6.0Hz,1H),4.13-3.89 (m,4H),3.79-3.55 (m,13H),3.44-3.48 (m,1H),3.35-3.07 (m,8H),2.58-2.56 (m,2H),2.24-1.89 (m,16H),1.62-1.11 (m,31H).

[0222] 31 PNMR (242MHz,DMSO-d6) δ 147.17,147.16.

[0223] Compound 4-13: To a solution of compound 4-11 (80 mg, 0.080 mmol) in anhydrous DCM (1.0 mL) was added DMAP (5 mg, 0.04 mmol) and TEA (24 mg, 0.24 mmol), followed by succinic anhydride (20 mg, 0.2 mmol). The reaction mixture was stirred at room temperature for 3 h. LCMS showed that the starting material was completely consumed. The reaction mixture was diluted with DCM, washed with water (3 mL×4), and brine (3 mL×4). The organic layer was concentrated to give compound 4-13 (85 mg, 97% yield) as a white solid.

[0224] C 60 H 79 N3O 18 Calculated mass: 1129.54, measured mass: 1128.6 [MH] - ,ESI.

[0225] 1HNMR (600 MHz, DMSO-d6) δ 12.22 (s, 1H), 7.84 - 7.81 (m, 1H), 7.71 - 7.69 (m, 1H), 7.37 - 7.16 (m, 9H), 6.92 - 6.89 (m, 4H), 5.21 (d, J = 6.0 Hz, 1H), 4.97 - 4.95 (m, 1H), 4.48 (d, J = 12.0 Hz, 1H), 4.12 - 4.01 (m, 3H), 3.89 - 3.84 (m, 1H), 3.73 - 3.65 (m, 7H), 3.41 - 3.38 (m, 2H), 3.28 - 3.15 (m, 4H), 3.15 - 2.98 (m, 4H), 2.46 - 2.44 (m, 4H), 2.22 - 2.20 (m, 2H), 2.09 - 1.76 (m, 14H), 1.65 - 1.60 (m, 2H), 1.48 - 1.06 (m, 19H).

[0226] Compound 4 - 14: To a solution of compound 4-13 (85 mg, 0.077 mmol) and HBTU (53 mg, 0.14 mmol) in anhydrous DMF (1.5 mL) was added DIPEA (30 mg, 0.23 mmol). The reaction mixture was shaken at room temperature for 10 min, and then native amino-lcaa-CPG (250 mg, loading 75 μmol / g) was added. The suspension was shaken at room temperature for 20 h, filtered, and washed with DMF (20 mL x 5), ACN (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 2 h to give solid support (260 mg). The unreacted amino groups on the support were blocked by stirring with AcO / pyridine / N-methylimidazole (90 μL / 1.0 mL / 80 μL) at room temperature for 1 h, and then washed with DMF (20 mL x 5), ACN (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 15 h to obtain solid support 4-14 (260 mg). For loading calculation, 5.97 mg of loaded dried CPG was taken and 25 mL of 3% DCA in DCM was added. The solution was shaken, and the UV absorbance at 500 nm was measured. The absorbance value was ensured to be less than 1.0 unit to ensure the signal was not saturated. Loading (umol / g) = (total amount of DCA added (mL)) * (absorbance value at 500 nm) * 1000) / 76 * (mg of CPG taken) Total amount of DCA added (mL) = 25 mL Absorbance value at 500 nm = 0.6689 mg of CPG taken = 5.97mg The following equation was applied: Loading (umol / g) = ((25) * (0.6689) * 1000) / 76 * (5.97) = 36.85umol / g.

[0227] Example 5 [ka]

[0228] Compound 5-2: Under nitrogen gas, compound 5-1 (10 g, 41.78 mmol) was added to a solution of methoxymethyl(triphenyl)phosphonium chloride (12.89 g, 37.61 mmol) and KOtBu (4.69 g, 41.79 mmol) in THF (150 mL) at 0 °C. The reaction mixture was stirred at 25 °C overnight. TLC showed complete conversion. The pH of the reaction was then adjusted to 6 by adding citric acid (10% aqueous solution) and extracted with ethyl acetate (EA). The organic phase was concentrated and purified by high-performance column chromatography (0% to 10% EA in PE) to give compound 5-2 (2.92 g, 37% yield) as an oil.

[0229] C 15 H 25 Calculated mass of NO3: 267.2, Measured mass: 268.2 [M+H] + ,ESI.

[0230] Compound 5-3: To a mixture of compound 5-2 (8.2 g, 30.67 mmol) in MeCN (220 mL) was added 2,2,2-trichloroacetic acid (6.31 g, 38.64 mmol) in water (70 mL), and the mixture was stirred overnight. TLC showed complete conversion. The reaction was then quenched by adjusting the pH to 7-8 with NaHCO3 (aqueous, saturated) and extracted with ethyl acetate. The organic phase was concentrated to give compound 5-3 (7.8 g) as an oil. The crude product was used directly in the next step without purification.

[0231] C 14 H 23 Calculated mass of NO3: 253.2, Measured mass: 154.2 [M+H-Boc] + ,ESI.

[0232] Compound 5-4: To a mixture of compound 5-3 (1.35 g, 5.33 mmol) and NaOH (21.32 mg, 532.89 μmol, 29.38 μL) in MeOH (30 mL) was added formaldehyde solution (454.47 mg, 15.13 mmol, 37% aqueous solution, 0.91 g). The reaction mixture was stirred at 25 °C for 36 h. The reaction mixture was concentrated to remove most of the methanol and extracted with ethyl acetate. The organic phase was concentrated and purified by column chromatography (0% to 5% MeOH in DCM) to give compound 5-4 as a solid (1.5 g, 96% yield over two steps).

[0233] C 15 H 25 Calculated mass of NO4: 283.2, Measured mass: 184.2 [M+H-Boc] + ,ESI.

[0234] Compound 5-5: To a solution of compound 5-4 (2.95 g, 10.41 mmol) in MeOH (90 mL) was added sodium borohydride (866.50 mg, 22.90 mmol). The reaction mixture was stirred for 1 h. LC-MS showed complete conversion. The pH of the reaction mixture was adjusted to 6 with citric acid (10% aqueous solution) and concentrated to dryness, and the residue was extracted with DCM and filtered. The filtrate was concentrated to give compound 5-5 (2.95 g, 73% yield), which was used directly in the next step without purification.

[0235] C 15 H 27 Calculated mass of NO4: 285.2, Measured mass: 271.2 [M+ACN+H-tBu] + ,ESI.

[0236] Compound 5-6: To compound 5-5 (4 g, 14.02 mmol) was added HCl (4 M in dioxane, 63.5 mL). The reaction mixture was stirred for 3 h. LC-MS showed complete conversion. The reaction mixture was concentrated to give compound 5-6 (3.5 g), which was used directly in the next step without purification.

[0237] C 10 H19 Calculated mass of NO2 (free base): 185.1, Found: 186.1 [M+H] + ,ESI.

[0238] Compound 5-7: A solution of Fmoc-6-aminocaproic acid (3.19 g, 9.02 mmol), DIEA (2.91 g, 22.55 mmol, 3.93 mL), HOBT (1.46 g, 10.82 mmol), and EDCI (2.08 g, 10.82 mmol) in DCM (12 mL) was stirred at 0 °C for 30 min, and compound 5-6 (2 g, 9.02 mmol) was added. The reaction mixture was stirred at room temperature overnight. LC-MS showed complete conversion. The reaction mixture was diluted with DCM (12 mL) and washed with citric acid (10% aqueous solution, 20 mL) and water. The organic phase was concentrated and purified by silica gel column chromatography (0% to 5% MeOH in DCM) to give compound 5-7 (3.5 g, 34% yield).

[0239] C 31 H 40 Calculated mass of N2O5: 520.3, Measured mass: 521.2 [M+H] + ,ESI.

[0240] 1 H NMR (400MHz,DMSO-d6) δ 7.91-7.68 (m,4H),7.44-7.28 (m,5H),4.32-4.28 (m,4H),4.20 (t,J=6.6Hz,1H),3.69 (s,2H),3.43 (s,2H),3.22 (t,J=5.6Hz,4H),2.02-1.98 (m,3H),1.55-1.52 (t,J=6.6Hz,4H),2.26-2.23 (m,4H),1.24-1.16 (m,8H).

[0241] Compound 5-8: To a solution of compound 5-7 (2.2 g, 4.23 mmol), DMAP (51.6 mg, 0.423 mmol), and DIEA (1.09 g, 8.46 mmol) in DCM (66 mL) was added DMTrCl (1.43 g, 4.23 mmol). The reaction mixture was stirred at room temperature overnight. LC-MS showed partial conversion. The reaction mixture was filtered through an alumina pad and washed with DCM (50 mL). The filtrate was concentrated and purified on a silica gel column (10% to 40% EA in PE (containing 0.1% aqueous ammonia) and 0% to 10% MeOH in DCM (containing 0.1% aqueous ammonia)) to give compound 5-8 (3.0 g, 86% yield).

[0242] C 52 H 58 Calculated mass of N2O7: 822.4, Measured mass: 845.3 [M+Na] + ,ESI.

[0243] 1H NMR (400MHz,DMSO-d6) δ 7.90-7.67 (m,4H),7.42-7.39 (m,4H),7.41-7.24 (m,14H),6.89-6.87 (m,4H),4.44 (t,J=7.6Hz,1H),4.24-4.19 (m,1H),4.06-4.01 (m,1H),3.74-3.73 (m,6H),3.65-3.59 (m,2H),3.42-3.39 (m,3H),3.32 (br,1H),3.00-2.83 (m,4H),1.99-1.96 (m,4H),1.45-1.16 (m,16H).

[0244] Compound 5-9: To a solution of compound 5-8 (3 g, 3.65 mmol) in MeOH (90 mL) was added piperidine (9 mL). The reaction mixture was stirred at room temperature overnight. LC-MS showed complete conversion. The reaction mixture was concentrated and further azeotroped with ditoluene. The residue was purified by silica gel column chromatography (0% to 10% MeOH in DCM with 1% TEA) to give compound 5-9 (1.1 g, 91% yield).

[0245] C37 H 48 Calculated mass of N2O5: 600.4, Measured mass: 601.3 [M+H] + ,ESI.

[0246] 1 H NMR (400MHz,DMSO-d6) δ 7.40-7.21 (m,9H),6.89 (d,J=7.2Hz,4H),3.74 (s,6H),3.67-3.61 (m,2H),3.39-3.33 (m,2H),2.86-2.62 (m,4H),1.99 (t,J=7.4Hz,2H),1.51-1.21 (m,16H).

[0247] Compound 5-10: A solution of compound 1-4 (2.09 g, 4.66 mmol), DIEA (1.08 g, 8.32 mmol, 1.45 mL), HOBT (539.77 mg, 3.99 mmol), and EDCI (765.80 mg, 3.99 mmol) in DCM (60 mL) was stirred at 0 °C for 30 min, and compound 5-9 (2 g, 3.33 mmol) was added. The reaction mixture was stirred overnight. The reaction mixture was concentrated, and the residue was purified by preparative HPLC (C18, water / ACN) to give compound 5-10 (1.0 g, 15% yield).

[0248] C 56 H 75 N3O 15 Calculated mass: 1029.5, Measured mass: 1052.3 [M+Na] + ,ESI.

[0249] 1H NMR (400MHz,DMSO-d6) δ 7.83 (d,J=9.2Hz,1H),7.71 (t,J=5.2Hz,1H),7.40-7.38 (m,2H),7.32-7.19 (m,5H),6.90-9.87 (m,2H),5.22 (d,J=3.4Hz,1H),4.97 (dd,J=11.2,3.4Hz,1H),4.49 (d,J=8.5Hz,1H),4.42 (t,J=5.0Hz,1H),4.03 (s,2H),3.91-3.84 (m,2H),3.74 (s,6H),3.67-3.61 (m,1H),3.44-3.37 (m,4H),3.00 (dd,J=12.7,6.6Hz,2H),2.85 (d,J=9.6Hz,2H),2.11 (s,3H),2.05-1.96 (m,7H),1.90 (s,3H),1.78 (s,3H),1.52-1.18 (m,18H).

[0250] Compound 5-11: To a solution of compound 5-10 (690.0 mg, 0.66 mmol) in anhydrous DCM (3.0 mL) at room temperature, 4,5-dicyanoimidazole (96.0 mg, 0.81 mmol) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (324 mg, 1.08 mmol) were added and stirred for 1 h. LCMS showed that the starting material was completely consumed. The solution was quenched with water (100 mL), washed with brine (300 mL x 3), and dried over Na2SO4. The solution was then concentrated under reduced pressure, and the residue was purified by high-speed preparative HPLC using the following conditions: C18 silica gel column, mobile phase: CH3CN / HO = 1 / 1, increased to CH3CN / HO = 1 / 0 within 20 min, detector: UV 254 nm. This gave compound 5-11 as a white solid (460 mg, 56% yield).

[0251] C 65 H 92 N5O 16 Calculated mass of P: 1229.63, Measured mass: 1230.3 [M+H] + ,ESI.

[0252] 1 HNMR (600MHz,DMSO-d6) δ 7.81-7.67 (m,2H),7.40-7.19 (m,9H),6.88-6.86 (m,4H),5.21 (d,J=6.0Hz,1H),4.98-4.94 (m,1H),4.49 (d,J=6.0Hz,1H),4.04-3.83 (m,4H),3.73-3.32 (m,18H),3.01-2.83 (m,4H),2.72-2.69 (m,2H),2.10-1.76 (m,16H),1.52-1.04 (m,30H).

[0253] 31 PNMR (242MHz,DMSO-d6) δ 146.33,146.26.

[0254] Example 6 [ka]

[0255] Compound 6-2: Compound 6-1 (20 g, 99.88 mmol) was dissolved in THF (200 mL). At 0 °C, NaH (4.79 g, 119.86 mmol, 60% purity) was added to the reaction mixture and stirred for 30 min. 2,3-Dibromopropene (20.96 g, 104.88 mmol) was slowly added to the reaction mixture. The reaction was then stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NH4Cl solution (100 mL), extracted with EA (200 mL x 3), washed with brine (100 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance silica gel column chromatography to give compound 6-2 (31 g, 97% yield) as a colorless oil.

[0256] C 13 H 19 Calculated mass of BrO4: 318.0, Measured mass: 319.0 [M+H] + ,ESI.

[0257] 1H NMR (400MHz, CDCl3) δ 5.71-5.58 (m,3H),5.14-5.10 (m,2H),4.25-4.13 (m,4H),3.14 (s,2H),2.7 (d,J=7.2Hz,2H),1.26 (t,J=6.8Hz,6H).

[0258] Compound 6-3: Compound 6-2 (31 g, 97.12 mmol), Pd(OAc) (2.18 g, 9.71 mmol), PPh (5.09 g, 19.42 mmol), and AgOAc (19.45 g, 116.54 mmol) were dissolved in CAN (600 mL). The reaction mixture was stirred at 85 °C under a N atmosphere for 3 h. The reaction was cooled to room temperature, filtered, concentrated in vacuo, and purified by high-performance silica gel column chromatography to give compound 6-3 (21 g, 91% yield) as a colorless oil. 13 H 18 Calculated mass of O4: 238.1, Measured mass: 239.2 [M+H] + ,ESI.

[0259] 1 H NMR (400MHz, CDCl3) δ 5.39 (t,J=2Hz,2H),4.95 (t,J=1.6Hz,2H),4.18 (q,J=7.2Hz,4H),3.03 (t,J=7.2Hz,4H),1.24 (t,J=7.2Hz,6H).

[0260] Compound 6-4: Compound 6-3 (21 g, 88.13 mmol) was dissolved in DCM (300 mL) and cooled to −78 °C. Br (14.08 g, 88.13 mmol, 4.51 mL) was dissolved in DCM (100 mL) and added to the reaction mixture over 1 h. The mixture was stirred at −78 °C for 1 h. The reaction mixture was quenched with saturated NaSO solution (100 mL), extracted with DCM (200 mL × 3), washed with brine (100 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance silica gel column chromatography to give compound 6-4 (28 g, 80% yield) as a pale yellow oil.

[0261] C 13 H 18 Calculated mass of Br2O4: 396.0, Measured mass: 397.0 [M+H] + ,ESI.

[0262] 1 H NMR (400MHz, CDCl3) δ:4.21 (q,J=7.2Hz,4H),4.00 (s,4H),3.19 (s,4H),1.26 (t,J=7.2Hz,6H).

[0263] Compound 6-5: 4-Methylbenzenesulfonamide (12.05 g, 70.35 mmol) was dissolved in DMF (260 mL). NaH (6.19 g, 154.77 mmol) was added to the reaction mixture at 0 °C, and the reaction mixture was stirred at 0 °C for 30 min. Compound 6-4 (28 g, 70.35 mmol) in DMF (50 mL) was slowly added to the reaction mixture. The mixture was stirred at room temperature for 1 h. The reaction mixture was quenched with saturated NH4Cl solution (500 mL), extracted with EA (200 mL x 3), washed with water (500 mL x 3), brine (300 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance silica gel column chromatography to give compound 6-5 as a colorless solid (22 g, 76% yield).

[0264] C 20 H 25 Calculated mass of NO6S: 407.1, Measured mass: 408.2 [M+H] + ,ESI.

[0265] 1 H NMR (400MHz,CDCl3) δ 7.70-7.68 (m,2H),7.32-7.30 (m,2H),4.17 (q,J=7.2Hz,4H),3.96 (s,4H),2.89 (s,4H),2.42 (s,3H),1.22 (t,J=7.2Hz,6H).

[0266] Compound 6-6: Compound 6-5 (22 g, 54.05 mmol) was dissolved in THF (300 mL). LiBH (11.8 g, 540.5 mmol) was added to the reaction mixture at 0 °C. The reaction was stirred at room temperature for 1 h. The reaction mixture was quenched with water (100 mL), extracted with EA (200 mL × 3), washed with brine (100 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance silica gel column chromatography to give compound 6-6 (14.8 g, 89% yield) as a white solid.

[0267] C 16 H 21 Calculated mass of NO4S: 323.1, Measured mass: 324.1 [M+H] + ,ESI.

[0268] 1 H NMR (400MHz,DMSO-d6) δ 7.70-7.68 (m,2H),7.43-7.41 (m,2H),4.56 (t,J=5.2Hz,2H),3.26 (d,J=4.8Hz,4H),2.84 (s,4H),2.39 (s,3H),1.95 (s,4H).

[0269] Compound 6-7: Compound 6-6 (4.1 g, 12.68 mmol) and DIEA (4.92 g, 3.83 mmol) were dissolved in DCM (20 mL). DMTrCl (4.30 g, 12.68 mmol) in DCM (80 mL) was slowly added to the reaction mixture at 0 °C. The reaction was stirred at room temperature for 1 h. The reaction mixture was quenched with saturated NaHCO solution (20 mL), extracted with DCM (50 mL x 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance AlO column chromatography (0% to 3% MeOH) to give compound 6-7 as a white foamy solid (6.39 g, 80% yield).

[0270] C 37 H 39 Calculated mass of NO6S: 625.25, Measured mass: 648.25 [M+Na] + ,ESI.

[0271] 1 H NMR (400MHz,DMSO-d6) δ 7.68 (d,J=8.0Hz,2H),7.41 (d,J=8.0Hz,2H),7.33 (d,J=4.0Hz,2H),7.31-7.18 (m,7H),6.85 (d,J=8.0Hz,4H),4.68 (t,J=4.8Hz,1H),3.83 (s,4H),3.72 (s,6H),3.37 (d,J=2.0Hz,2H),2.94 (s,2H),2.39 (s,3H),2.07-2.03 (m,2H),1.92-1.89 (m,2H).

[0272] Compound 6-8: Compound 6-7 (6.0 g, 9.59 mmol) was dissolved in MeOH (300 mL), and Mg (18 g) was added to the reaction mixture at 0 °C. The mixture was stirred at room temperature overnight. The reaction mixture was quenched with HO, extracted with DCM, washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance AlO column chromatography (0%-15% MeOH) to give compound 6-8 (1.2 g, 26.6% yield) as a white foamy solid.

[0273] C 30 H 33 Calculated mass of NO4: 471.24, Measured mass: 472.20 [M+H] + ,ESI.

[0274] 1 H NMR (400MHz,DMSO-d6) δ 7.37 (d,J=8.0Hz,2H),7.32-7.28 (m,2H),7.25-7.19 (m,5H),6.89-6.87 (m,4H),4.76 (s,1H),3.83 (s,1H),3.73 (s,6H),3.47 (s,3H),3.45 (s,3H),3.00 (s,2H),2.13-2.09 (m,2H),1.97-1.93 (m,2H).

[0275] Compound 6-9: Compound 6-8 (2.4 g, 5.09 mmol) and Fmoc-6-aminocaproic acid (1.80 g, 5.09 mmol) were dissolved in DCM (60 mL), and DIEA (1.97 g, 15.27 mmol), EDCI (1.95 g, 10.18 mmol), and HOBT (1.38 g, 10.18 mmol) were added to the mixture. The reaction was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO solution (200 mL), extracted with DCM (60 mL x 3), washed with brine (60 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance AlO column chromatography (0% to 10% MeOH) to give compound 6-9 (3.1 g, 75% yield) as a white foamy solid.

[0276] 1 H NMR(400MHz,DMSO-d6) δ 7.88 (d,J=7.4Hz,2H),7.68 (d,J=7.4Hz,2H),7.43-7.37 (m,4H),7.34-7.28 (m,5H),7.26-7.21 (m,5H),6.88 (d,J=8.9Hz,4H),4.75 (t,J=4.8Hz,1H),4.30-4.28 (m,2H),4.22-4.19 (m,1H),4.11-3.91 (m,2H),3.91-3.85 (m,2H),3.73 (s,6H),3.49-3.48 (d,J=4.6Hz,2H),3.02-2.95 (m,4H),2.20-2.14 (m,4H),2.00-1.97 (m,2H),1.52-1.46 (m,2H),1.44-1.36 (m,2H),1.24-1.29 (m,2H).

[0277] Compound 6-10: Compound 6-9 (3.1 g, 3.84 mmol) was dissolved in MeOH (60 mL), and piperidine (6 mL) was added to the mixture. The reaction was stirred at room temperature for 8 h. The reaction mixture was quenched with water, extracted with DCM (100 mL x 3), washed with brine (60 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance AlO column chromatography (0% to 20% MeOH) to give compound 6-10 (1.45 g, 64% yield) as a white foamy solid.

[0278] Calculated mass of C36H44N2O5: 584.33, Measured mass: 585.4 [M+H] + ,ESI.

[0279] 1 H NMR (400MHz,DMSO-d6) δ 7.39-7.39 (m,2H),7.37-7.28 (m,2H),7.25-7.19 (m,5H),6.88 (d,J=8.8Hz,2H),4.76 (s,1H),4.04 (m,2H),3.86 (m,2H),3.78 (s,6H),3.49 (s,2H),3.02 (s,2H),2.55 (m,2H),2.22-2.14 (m,4H),2.01-1.97 (m,2H),1.53-1.46 (m,2H),1.37-1.25 (m,5H).

[0280] Compound 6-11: Compound 6-10 (1.5 g, 2.57 mmol) and compound 1-4 (1.15 g, 2.57 mmol) were dissolved in DCM (60 mL), and DIEA (1.66 g, 12.83 mmol), EDCI (1.10 g, 6.41 mmol), and HOBT (519.92 mg, 3.85 mmol) were added to the mixture. The reaction was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO3 solution (200 mL), extracted with DCM (60 mL x 3), washed with brine (60 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance Al2O3 column chromatography (0% to 10% MeOH) to give compound 6-11 (2 g, 76% yield) as a white foamy solid.

[0281] C 55 H 71 N3O 15 Calculated mass: 1013.49, Measured mass: 1014.4 [M+H] + ,ESI.

[0282] 1H NMR(400MHz,DMSO-d6) δ 7.82 (d,J=9.2Hz,1H),7.72 (t,J=5.6Hz,1H),7.39-7.37 (m,2H),7.32-7.28 (m,2H),7.26-7.19 (m,5H),6.90-6.87 (m,4H),5.22 (d,J=3.4Hz,1H),4.97 (dd,J=11.2,3.4Hz,1H),4.50-4.48 (m,1H),4.03-4.00 (m,5H),3.91-3.84 (m,3H),3.74 (s,7H),3.49 (d,J=4.6Hz,1H),3.43-3.38 (m,1H),3.02-2.98 (m,4H),2.21-2.15 (m,4H),2.10-2.08 (m,3H),2.05-2.00 (m,7H),1.89 (s,3H),1.78 (s,3H),1.52-1.35 (m,9H),1.27-1.24 (m,3H).

[0283] Compound 6-12: To a solution of compound 6-11 (790.0 mg, 0.78 mmol) in anhydrous DCM (3.0 mL) at room temperature, 4,5-dicyanoimidazole (96.0 mg, 0.81 mmol) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (324 mg, 1.08 mmol) were added and stirred for 1 h. LCMS showed that the starting material was completely consumed. The solution was quenched with water (100 mL), washed with brine (300 mL x 3), and dried over Na2SO4. The solution was then concentrated under reduced pressure, and the residue was purified by high-speed preparative HPLC using the following conditions: C18 silica gel column, mobile phase: CH3CN / HO = 1 / 1, increased to CH3CN / HO = 1 / 0 within 20 min, detector: UV 254 nm. This gave compound 6-12 as a white solid (680 mg, 71% yield).

[0284] C 64 H 88 N5O 16 Calculated mass of P: 1213.60, Measured mass: 1159.5 [M-CH2CH2CN] - ,ESI.

[0285] 1 HNMR (600MHz,DMSO-d6) δ 7.82-7.68 (m,2H),7.38-7.19 (m,9H),6.90-6.86 (m,4H),5.21 (d,J=6.0Hz,1H),4.98-4.94 (m,1H),4.48 (d,J=12.0Hz,1H),4.04-3.99 (m,4H),3.90-3.37 (m,16H),3.09-2.87 (m,4H),2.71-2.68 (m,2H),2.19-1.76 (m,20H),1.52-1.05 (m,22H).

[0286] 31 PNMR (242MHz,DMSO-d6) δ 146.51,146.47.

[0287] Example 7 [ka]

[0288] Compound 7-2: To a solution of methoxymethyl(triphenyl)phosphonium chloride (54.78 g, 159.80 mmol) in THF (600 mL) was added KOtBu (19.92 g, 177.55 mmol) at 0 °C and stirred for 0.5 h. Compound 7-1 (20 g, 88.78 mmol) was then added at 0 °C and stirred overnight. The reaction was allowed to warm to room temperature. LC-MS showed complete conversion. The pH of the reaction mixture was adjusted to 6 with citric acid (10% aqueous solution), filtered, and concentrated to dryness. The residue was purified by silica gel column (0% to 5% EA in PE) to give compound 7-2 (15.5 g, 68% yield) as an oil.

[0289] C 14 H 23 Calculated mass of NO3: 253.2, Measured mass: 239.1 [M-tBu+ACN+H] + ,ESI.

[0290] 1H NMR (400MHz,DMSO-d6) δ 5.99 (5 peaks, J=2.1Hz,1H),3.48 (s,3H),3.44-3.36 (m,2H),2.99-2.91 (m,2H),2.59 (br,2H),2.44-2.36 (m,2H),2.04-1.97 (m,2H),1.38 (s,9H).

[0291] Compound 7-3: To a solution of compound 7-2 (5 g, 19.74 mmol) in MeCN (150 mL) was added 2,2,2-trichloroacetic acid (4.06 g, 24.87 mmol, in 50 mL water). The reaction mixture was stirred at room temperature overnight. TLC showed complete conversion. The pH of the reaction mixture was adjusted to 7 with NaHCO3 (aq, saturated) and extracted with EA. The organic phase was concentrated to give crude compound 7-3 (4.7 g, 99% yield) as an oil, which was used directly in the next step without purification.

[0292] C 13 H 21 Calculated mass of NO3: 239.2, Measured mass: 225.1 [M-tBu+ACN+H] + ,ESI.

[0293] Compound 7-4: To a mixture of compound 7-3 (4.7 g, 19.64 mmol) and K2CO3 (542.87 mg, 3.93 mmol) in MeOH (150 mL) was added formalin (15.9 g, 37% aqueous formaldehyde solution, 55.78 mmol). The reaction mixture was stirred at room temperature overnight. TLC showed complete conversion. The pH of the reaction mixture was adjusted to 6 with citric acid (10% aqueous solution) and extracted with EA. The organic phase was concentrated and purified by silica gel column (0% to 3% MeOH in DCM) to give compound 7-4 (5.2 g, 98% yield) as an oil.

[0294] C 14 H 23 Calculated mass of NO4: 269.2, Measured mass: 170.1 [M-Boc+H] + ,ESI.

[0295] Compound 7-5: To a solution of compound 7-4 (17 g, 63.12 mmol) in MeOH (190 mL) was added NaBH4 (5.25 g, 138.86 mmol). The reaction mixture was stirred at room temperature for 1 h. LC-MS showed complete conversion. The pH of the reaction mixture was adjusted to 6 with citric acid (10% aqueous solution), filtered, and extracted with DCM. The organic phase was concentrated and purified by silica gel column (0% to 5% MeOH in DCM) to give compound 7-5 (14.5 g, 84% yield).

[0296] C 14 H 25 Calculated mass of NO4: 271.2, Measured mass: 172.1 [M-Boc+H] + ,ESI.

[0297] 1 H NMR (400MHz,DMSO-d6) δ 4.53 (t,J=5.3Hz),3.37-3.32 (m,2H),3.27 (d,J=5.3Hz,2H),3.19 (d,J=5.3Hz,2H),3.07 (dd,J=10.78,3.5Hz,2H),1.60 (dd,J=13.4,7.9Hz,2H) 1.39 (s,9H),1.27 (dd,J=13.5,6.3Hz,2H).

[0298] Compound 7-6: To a reaction flask containing compound 7-5 (14.5 g, 53.44 mmol), HCl in dioxane (4 M, 140 mL) was added. The reaction mixture was stirred at room temperature for 1.5 h. LC-MS showed complete conversion. The reaction mixture was concentrated to give crude compound 7-6 (11 g), which was used directly in the next step without purification.

[0299] C9H 17 Calculated mass of NO2 (free base): 171.1, Found: 172.1 [M-Boc+H] + ,ESI.

[0300] Compound 7-7: A mixture of Fmoc-6-aminocaproic acid (18.38 g, 52.00 mmol), DIEA (16.80 g, 130.00 mmol, 22.64 mL), HOBT (8.43 g, 62.40 mmol), and EDCI (11.96 g, 62.40 mmol) in DCM (300 mL) was stirred at 0 °C for 30 min, and compound 7-6 (10.8 g, 52.00 mmol) was added. The reaction mixture was stirred overnight and allowed to warm to room temperature. LC-MS showed complete conversion. The reaction mixture was diluted with DCM (300 mL) and washed with NaHCO (aq, saturated) and water. The organic phase was concentrated and purified on a silica gel column (0% to 10% MeOH in DCM) to give compound 7-7 (19.6 g, 74% yield) as a gel.

[0301] C 30 H 38 Calculated mass of N2O5: 506.3, Measured mass: 507.3 [M+H] + ,ESI.

[0302] 1 H NMR (400MHz,DMSO-d6) δ 7.90-7.68 (m,4H),7.44-7.33 (m,5H),4.55 (s,2H),4.29 (d,J=6.8Hz,2H),4.23-4.18 (m,1H),3.28-3.21 (m,6H),2.97-2.96 (m,2H),2.61-2.53 (m,2H),2.17 (t,J =7.6Hz,2H),1.63-1.23 (m,12H).

[0303] Compound 7-8: To a solution of compound 7-7 (19 g, 37.50 mmol), N,N-dimethylpyridin-4-amine (458.17 mg, 3.75 mmol), and DIEA (7.27 g, 56.25 mmol, 9.80 mL) in DCM (590 mL) at 0 °C, DMTrCl (13.98 g, 41.25 mmol) was added portionwise. The reaction mixture was stirred overnight. LC-MS showed partial conversion, with the formation of two isomers and a di-DMTr by-product. The reaction mixture was concentrated and purified by silica gel column chromatography (20% to 100% EA in PE, containing 0.2% TEA) to give compounds 7-8a and 7-8b as a mixture of endo and exo isomers (17.9 g, 47% yield).

[0304] The isomers were separated by preparative HPLC (C18 column, water / ACN) to give compound 7-8a (endo isomer, 7.5 g) and compound 7-8b (exo isomer, 5.7 g).

[0305] 7-8a: C 51 H 56 Calculated mass of N2O7: 808.4, Measured mass: 832.3 [M+Na] + ,ESI.

[0306] 1 H NMR (400MHz,DMSO-d6) δ 7.90-7.88 (m,2H),7.69-7.67 (m,2H),7.43-8.18 (m,13H),6.88-6.85 (m,4H),4.62 (br,1H),4.37-4.28 (m,2H),4.20 (t,J=6.7Hz,1H),3.73 (s,6H),3.47 (dd,J=9.9,8.2Hz,1H),3.28 (br,2H),3.11 (td,J=12.0,4.3Hz,2H),2.99-2.91 (m,4H),2.66-2.54 (m,2H),2.19-2.06 (m,2H),1.67 (5 peaks, J = 6.8 Hz, 2H), 1.51-1.17 (m, 10H).

[0307] 7-8b: C 51 H 56Calculated mass of N2O7: 808.4, Measured mass: 832.3 [M+Na] + ,ESI.

[0308] 1 H NMR (400MHz,DMSO-d6) δ 7.90-7.84 (m,4H),7.44-7.20 (m,13H),6.91-6.89 (m,4H),6.66 (br,1H),6.29 (s,2H),3.74 (s,6H),3.36-3.31 (m,3H),3.22-3.12 (m,3H),2.90 (dd,J=12.7,6.5Hz,2H),2.86 (s,2H),2.44-2.29 (m,2H),2.15 (t,J=7.1Hz,2H),1.64-1.18 (m,12H). [ka]

[0309] Compound 7-9a: A solution of compound 7-8a (6.5 g, 8.03 mmol) in MeOH (200 mL) and piperidine (20 mL) was stirred at room temperature overnight. LC-MS showed complete conversion. The reaction mixture was concentrated, and the residue was purified by silica gel column chromatography (20%-30% MeOH in DCM with 1% TEA) to give compound 7-9a (4.4 g, 94% yield).

[0310] C 36 H 46 Calculated mass of N2O5: 586.3, Measured mass: 587.3 [M+H] + ,ESI.

[0311] Compound 7-10a: A solution of compound 1-4 (4.70 g, 10.50 mmol), DIEA (2.42 g, 18.75 mmol, 3.27 mL), HOBT (1.22 g, 9.00 mmol), and EDCI (1.73 g, 9.00 mmol) in DCM (132 mL) was stirred at 0 °C for 30 min, and compound 7-9a (4.4 g, 7.50 mmol) was added. The reaction mixture was stirred overnight. LC-MS showed complete conversion. The reaction mixture was diluted with DCM (150 mL) and washed with water. The organic phase was concentrated and purified by silica gel column (0% to 10% MeOH in DCM with 1% TEA) to give compound 7-10a (3.8 g, 51% yield).

[0312] C 55 H 73 N3O 15 Calculated mass: 1015.5, Measured mass: 1039.1 [M+Na] + ,ESI.

[0313] 1 H NMR (400MHz,DMSO-d6) δ 7.85 (d,J=9.2Hz,1H),7.74 (t,J=5.3Hz,1H),7.38-7.36 (m,2H),7.31-7.27 (m,2H),7.24-7.19 (m,5H),6.88-6.86 (m,4H),5.22 (d,J=2.8Hz,1H),4.97 (dd,J=11.2,2.8Hz,1H),4.65 (t,J=4.8Hz,1H),4.49 (d,J=8.4Hz,1H),4.03 (s,3H),3.88 (dd,J=19.5,9.1Hz,1H),3.73-3.70 (m,7H),3.50-3.39 (m,2H),3.34-3.31 (m,1H),3.27 (d,J=4.5Hz,2H),3.17 (d,J=5.2Hz,1H),3.15-3.09 (m,2H),3.00 (dd,J=12.4,6.3Hz,2H),2.94 (br,1H),2.67-2.53 (m,2H),2.19-2.08 (m,5H),2.04 (t,J=6.9Hz,2H),2.00 (s,3H),1.89 (s,3H),1.78 (s,3H),1.70-1.63 (m,2H),1.53-1.16 (m,14H).

[0314] Compound 7-11a: To a solution of compound 7-10a (680.0 mg, 0.67 mmol) in anhydrous DCM (3.0 mL) at room temperature, 4,5-dicyanoimidazole (96.0 mg, 0.81 mmol) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (324 mg, 1.08 mmol) were added and stirred for 1 h. LCMS showed that the starting material was completely consumed. The solution was quenched with water (100 mL), washed with brine (300 mL x 3), and dried over Na2SO4. The solution was then concentrated under reduced pressure, and the residue was purified by high-speed preparative HPLC using the following conditions: C18 silica gel column, mobile phase: CH3CN / HO = 1 / 1, increased to CH3CN / HO = 1 / 0 within 20 min, detector: UV 254 nm. This gave compound 7-11a as a white solid (390 mg, 47% yield).

[0315] C 64 H 90 N5O16 P Calculated mass: 1215.61, Measured mass: 1161.3 [M-CH2CH2CN] - ,ESI.

[0316] 1 HNMR (600MHz,DMSO-d6) δ 7.81-7.69 (m,2H),7.40-7.19 (m,9H),6.88-6.86 (m,4H),5.21 (d,J=6.0Hz,1H),4.98-4.94 (m,1H),4.49 (d,J=6.0Hz,1H),4.02-3.83 (m,4H),3.73-3.32 (m,18H),3.01-2.97 (m,6H),2.71-2.68 (m,4H),2.12-1.99 (m,18H),1.49-1.04 (m,24H).

[0317] 31 PNMR (242MHz,DMSO-d6) δ 146.70. [ka]

[0318] Compound 7-9b: A solution of compound 7-8b (5.70 g, 7.05 mmol) in MeOH (200 mL) and piperidine (20 mL) was stirred at room temperature overnight. LC-MS showed complete conversion. The reaction mixture was concentrated and purified by silica gel column chromatography (10%-20% MeOH in DCM with 1% TEA) to give compound 7-9b (4.1 g, 99% yield).

[0319] C 36 H 46 Calculated mass of N2O5: 586.3, Measured mass: 587.3 [M+H] + ,ESI.

[0320] Compound 7-10b: A solution of compound 1-4 (4.38 g, 9.78 mmol), DIEA (2.26 g, 17.47 mmol, 3.04 mL), HOBT (1.13 g, 8.39 mmol), and EDCI (1.61 g, 8.39 mmol) in DCM (120 mL) was stirred at 0 °C for 30 min, and compound 7-9b (4.10 g, 6.99 mmol) was added. The reaction mixture was stirred overnight. LC-MS showed complete conversion. The reaction mixture was diluted with DCM (150 mL) and washed with water. The organic phase was concentrated and purified by silica gel column (0% to 10% MeOH in DCM with 1% TEA) to give 4.4 g of crude product, which was further purified by preparative HPLC (C18, water / ACN) to give compound 7-10b (2.0 g, 28% yield).

[0321] C 55 H 73 N3O 15 Calculated mass: 1015.5, Measured mass: 1039.1 [M+Na] + ,ESI.

[0322] 1H NMR (400MHz,DMSO-d6) δ 7.84 (d,J=9.2Hz,1H),7.72 (t,J=5.5Hz,1H),7.40-7.38 (m,2H),7.33-7.29 (m,2H),7.28-7.20(m,5H),6.91-6.88 (m,4H),5.22 (d,J=3.3Hz,1H),4.97 (dd,J=11.2,3.3Hz,1H),4.66 (t,J=4.9Hz,1H),4.49 (d,J=8.5Hz,1H),4.03 (s,3H),3.88 (dd,J=20.2,8.8Hz,1H),3.74-3.69 (m,7H),3.48-3.38 (m,4H),3.34-3.31 (m,1H),3.21 (dd,J=10.4,4.2Hz,1H),3.14 (dd,J=12.0,4.6Hz,1H),3.00 (dd,J=12.7,6.6Hz,2H),2.86 (s,2H),2.46-2.27 (m,2H),2.16 (t,J=6.7Hz,2H),2.11 (s,3H),2.04 (t,J=7.0Hz,2H),2.00 (s,3H),1.89 (s,3H),1.78 (s,3H),1.63-1.12 (m,14H).

[0323] Compound 7-11b: To a solution of compound 7-10b (680.0 mg, 0.67 mmol) in anhydrous DCM (3.0 mL) at room temperature, 4,5-dicyanoimidazole (96.0 mg, 0.81 mmol) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (324 mg, 1.08 mmol) were added and stirred for 1 h. LCMS showed that the starting material was completely consumed. The solution was quenched with water (100 mL), washed with brine (300 mL x 3), and dried over Na2SO4. The solution was then concentrated under reduced pressure, and the residue was purified by high-speed preparative HPLC using the following conditions: C18 silica gel column, mobile phase: CH3CN / HO = 1 / 1, increased to CH3CN / HO = 1 / 0 within 20 min, detector: UV 254 nm. This gave compound 7-11b as a white solid (390 mg, 47% yield).

[0324] C64 H 90 N5O 16 Calculated mass of P: 1215.61, Measured mass: 1161.6 [M-CH2CH2CN] - ,ESI.

[0325] 1 HNMR (600MHz,DMSO-d6) δ 7.81-7.69 (m,2H),7.40-7.19 (m,9H),6.88-6.86 (m,4H),5.21 (d,J=6.0Hz,1H),4.98-4.94 (m,1H),4.49 (d,J=6.0Hz,1H),4.02-3.83 (m,4H),3.73-3.32 (m,18H),3.01-2.97 (m,6H),2.71-2.68 (m,4H),2.12-1.99 (m,18H),1.49-1.04 (m,24H).

[0326] 31 PNMR (242MHz,DMSO-d6) δ 146.22.

[0327] Example 8 [ka]

[0328] Compound 8-2: To a solution of methoxymethyl(triphenyl)phosphonium chloride (17.71 g, 51.67 mmol) in THF (120 mL) was added KOtBu (9.66 g, 86.12 mmol) at 0 °C and stirred for 0.5 h. Compound 8-1 (9.7 g, 43.06 mmol) was then added at 0 °C and stirred overnight. The reaction was allowed to warm to room temperature. LC-MS showed complete conversion. The pH of the reaction mixture was adjusted to 6 by adding citric acid (10% aqueous solution), filtered, and concentrated to dryness. The residue was purified by silica gel column (0% to 5% EA in PE) to give compound 8-2 (6.0 g, 55% yield) as an oil.

[0329] 1H NMR (400MHz,DMSO-d6) δ 6.01 (s,1H),3.48 (s,3H),3.43-3.33 (m,2H),2.82-2.74 (m,2H),2.35-2.26 (m,2H),1.90-1.79 (m,4H),1.38 (s,9H).

[0330] Compound 8-3: To a solution of compound 8-2 (5.85 g, 23.09 mmol) in THF (50 mL) was added hydrochloric acid (3.28 g, 90.00 mmol, 2N, 45 mL). The reaction mixture was stirred at room temperature for 3 h. TLC showed complete conversion. The pH of the reaction mixture was adjusted to 7 by adding NaHCO3 (aq, saturated) and extracted with EA. The organic phase was concentrated to give crude compound 8-3 (5.5 g) as an oil, which was used directly in the next step without purification.

[0331] 1 H NMR (400MHz,DMSO-d6) δ 9.62 (5 peaks, J=1.2Hz,1H),3.42-3.33 (m,3H),2.82-2.72 (m,2H),2.03-1.93 (m,1H),1.92-1.87 (m,2H),1.75-1.62 (m,1H),1.51-1.44 (m,1H),1.38 (s,9H).

[0332] Compound 8-4: To a mixture of compound 8-3 (5.25 g, 21.94 mmol) and K2CO3 (660.39 mg, 4.39 mmol) in MeOH (30 mL) was added formalin (6.59 g, 37% aqueous solution, 219.38 mmol). The reaction mixture was stirred at room temperature overnight. TLC showed complete conversion. The pH of the reaction mixture was adjusted to 6 by adding citric acid (10% aqueous solution) and extracted with EA. The organic phase was concentrated to give compound 8-4 (6.7 g), which was used directly in the next step without purification.

[0333] Compound 8-5: To a solution of compound 8-4 (6.3 g, 23.39 mmol) in MeOH (50 mL) was added NaBH4 (2.65 g, 70.17 mmol). The reaction mixture was stirred at room temperature for 1 h. LC-MS showed complete conversion. The pH of the reaction mixture was adjusted to 6 by adding citric acid (10% aqueous solution), filtered, and extracted with DCM. The organic phase was concentrated and purified by silica gel column (0% to 5% MeOH in DCM) to give compound 8-5 (1.4 g, 22% yield).

[0334] C 14 H 25 Calculated mass of NO4: 271.18, Measured mass: 257.24 [M-tBu+CH3CN+H] + ,ESI.

[0335] 1 H NMR (400MHz,DMSO-d6) δ 7.16-7.55 (m,1H),4.52-4.48 (m,2H),3.36-3.27 (m,5H),2.74-2.50 (m,2H),1.98-1.84 (m 2H),1.54-1.50 (m 2H), 1.49 (s, 9H), 1.05-0.97 (m, 2H).

[0336] Compound 8-6: Compound 8-5 (1.35 g, 4.97 mmol) was dissolved in DCM (5 mL), and HCl / dioxane (4 M, 10 mL) was added to the mixture at room temperature. The mixture was stirred at room temperature for 2 h. The reaction mixture was concentrated in vacuo to give crude oil 8-6 ​​(1.3 g), which was used in the next step without purification.

[0337] C9H 17 Calculated mass of NO2: 171.1, Measured mass: 172.2 [M+H] + ,ESI.

[0338] Compound 8-7: Z-6-aminocaproic acid (1.99 g, 7.51 mmol), HATU (4.72 g, 12.52 mmol), and DIPEA (2.43 g, 18.78 mmol, 3.27 mL) were dissolved in DCM (20 mL). The reaction was stirred for 20 min, and then compound 8-6 (1.3 g, 6.26 mmol) was added and further stirred for 2 h. The reaction mixture was quenched with HO (20 mL), washed with saturated aqueous NaHCO (30 mL), washed with brine (30 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance silica gel column chromatography (DCM:MeOH = 20:1) to give compound 8-7 (1.5 g, 3.58 mmol, 57% yield) as a white foamy solid. 23 H 34 Calculated mass of N2O5: 418.3, Measured mass: 419.3 [M+H] + ,ESI.

[0339] Compound 8-8: Compound 8-7 (1.2 g, 2.87 mmol) was dissolved in DCM (20 mL). DMTrCl (971.49 mg, 2.87 mmol) and DIPEA (741.12 mg, 5.73 mmol, 998.81 μL) were added. The reaction mixture was stirred at room temperature for 2 h. The reaction was then quenched with water, extracted with DCM (50 mL x 2), and washed with brine (50 mL). The organic phase was collected, dried, concentrated in vacuo, and purified by high-performance AlO column chromatography (DCM:MeOH:TEA = 20:1:0.5%) to give compound 8-8 (850 mg, 41% yield) as a white foamy solid.

[0340] C 44 H 52 Calculated mass of N2O7: 720.4, Measured mass: 721.4 [M+H] + ,ESI.

[0341] 1H NMR (400MHz,DMSO-d6) δ 7.41-7.36 (m,3H),7.35-7.29 (m,6H),7.27-7.20 (m,5H),6.89 (d,J=8.9Hz,4H),5.00 (s,2H),4.67 (t,J=4.9Hz,1H),3.75 (s,6H),3.55-3.47 (m,2H),3.39 (d,J=4.5Hz,2H),3.00-2.95 (m,4H),2.92-2.84 (m,1H),2.62 (q,J=11Hz,1H),2.16-2.10 (m,2H),1.95-1.70 (m,2H),1.62-1.58 (m,1H),1.51-1.35 (m,5H),1.27-1.23 (m,3H),1.12-1.00 (m,2H).

[0342] Compound 8-9: Compound 8-8 (0.8 g, 1.11 mmol) was dissolved in MeOH (10 mL). Pd / C (80 mg) was added. The reaction mixture was stirred at room temperature under a hydrogen gas atmosphere for 3 h. The reaction mixture was filtered and concentrated in vacuo to give crude product 8-9 (550 mg, 84% yield) as a white foamy solid, which was used in the next step without purification.

[0343] C 36 H 46 Calculated mass of N2O5: 586.3, Measured mass: 587.3 [M+H] + ,ESI.

[0344] 1H NMR (400MHz,DMSO-d6) δ 7.40-7.38 (m,2H),7.31 (t,J=7.7Hz,2H),7.29-7.18 (m,5H),6.89 (d,J=8.9Hz,4H),3.74 (s,6H),3.54-3.43 (m,2H),3.34-3.21 (m,2H),2.96 (s,2H),2.94-2.85 (m,2H),2.67-2.55 (m,1H),2.17-2.10 (m,2H),1.99-1.74 (m,2H),1.63-1.58 (m,1H),1.53-1.42 (m,3H),1.36-1.24 (m,5H),1.16-1.10 (m,1H), 1.05-0.98 (m,1H).

[0345] Example 9 [ka]

[0346] Compound 9-2: Methoxymethyl(triphenyl)phosphonium chloride (116.8 g, 340.72 mmol) was dissolved in THF (1200 mL). At 0 °C, KOtBu (46.74 g, 416.56 mmol) was added to the mixture. The reaction mixture was further stirred at 0 °C for 30 min. Compound 9-1 (40 g, 189.34 mmol) was added to the mixture. The mixture was allowed to warm to room temperature and stirred at room temperature overnight. The reaction was quenched with saturated citric acid and the pH was adjusted to 6-7. The reaction mixture was extracted with EA (500 mL x 3), washed with brine (200 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance silica gel column chromatography (10%-30% EA in PE) to give compound 9-2 (24 g, 52% yield) as an oil.

[0347] C 13 H 21 Calculated mass of NO3: 239.3, Measured mass: 225.1 [M-tBu+ACN+H] + ,ESI.

[0348] 1H NMR (400MHz,DMSO-d6) δ 5.88 (t,J=2.4Hz,1H),3.83 (s,4H),3.47 (s,3H),2.79-2.74 (m,4H),1.41 (s,9H).

[0349] Compound 9-3: Compound 9-2 (15 g, 62.68 mmol) was dissolved in ACN (450 mL). 2,2,2-Trichloroacetic acid (12.90 g, 78.98 mmol) in water (150 mL) was added to the reaction mixture. The reaction was stirred at room temperature overnight, and then quenched with saturated NaHCO3 to adjust the pH to 7-8. The mixture was extracted with EA (200 mL x 3), washed with brine (100 mL), dried over Na2SO4, and concentrated in vacuo to give crude oil 9-3 (13 g, 92% yield), which was used in the next step without purification.

[0350] C 12 H 19 Calculated mass of NO3: 225.3, Measured mass: 211.1 [M-tBu+ACN+H] + ,ESI.

[0351] Compound 9-4: Compound 9-3 (13 g, 57.71 mmol) was dissolved in MeOH (400 mL). K2CO3 (1.60 g, 11.54 mmol) and formaldehyde (4.92 g, 163.88 mmol, in water) were added to the mixture. The reaction was stirred at room temperature overnight, and then it was quenched with saturated citric acid to adjust the pH to 6-7. The mixture was concentrated in vacuo to remove MeOH. The residue was extracted with EA (200 mL x 3), washed with brine (100 mL), dried over Na2SO4, and concentrated in vacuo to give crude product 9-4 (14 g, 95% yield).

[0352] C 13 H 21 Calculated mass of NO4: 255.3, Measured mass: 241.1 [M-tBu+ACN+H] + ,ESI.

[0353] Compound 9-5: Compound 9-4 (14 g, 54.84 mmol) was dissolved in MeOH (420 mL). NaBH (4.56 g, 120.64 mmol) was added portionwise. The reaction was stirred at room temperature for 1 h and quenched with water. The pH was adjusted to 6-7 with saturated citric acid. The mixture was concentrated in vacuo to remove MeOH, and the residue was extracted with DCM (200 mL x 3), washed with brine (100 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance silica gel column chromatography (0%-5% MeOH) to give compound 9-5 (7.05 g, 50% yield).

[0354] C 13 H 23 Calculated mass of NO4: 257.3, Measured mass: 243.1 [M-tBu+ACN+H] + ,ESI.

[0355] 1 H NMR (400MHz,DMSO-d6) δ 4.51-4.11 (m,2H),3.83-3.75 (m,4H),3.25-3.17 (m,4H),2.01-1.91 (m,4H),1.36 (s,9H).

[0356] Compound 9-6: Compound 9-5 (13.1 g, 50.91 mmol) was dissolved in HCl in 1,4-dioxane (4 M, 131 mL). The reaction mixture was stirred at room temperature for 1 h, and then concentrated in vacuo to give crude product 9-6 (9.8 g), which was used in the next step without purification.

[0357] C8H 13 Calculated mass of NO2Cl: 157.2, Measured mass: 158.2 [M+H] + ,ESI.

[0358] Compound 9-7: Compound 9-6 (9.8 g, 50.60 mmol) was dissolved in DCM (300 mL). DIEA (22.89 g, 177.10 mmol, 30.85 mL), HOBT (8.20 g, 60.72 mmol), EDCI (11.64 g, 60.72 mmol), and Fmoc-6-hexanoic acid (17.88 g, 50.60 mmol) were added to the reaction mixture. The reaction was stirred overnight at room temperature, quenched with water, washed with 10% citric acid (50 mL), saturated NaHCO3 solution (50 mL), and brine (50 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance silica gel column chromatography (0% to 10% MeOH) to give compound 9-7 (6.7 g, 25% yield over two steps).

[0359] C 30 H 36 Calculated mass of N2O5: 492.3, Measured mass: 493.3 [M+H] + ,ESI.

[0360] 1 H NMR (400MHz,DMSO-d6) δ 7.91-7.68 (m,4H),7.44-7.28 (m,4H),6.76 (s,1H),6.68-6.66 (m,1H),6.29 (s,2H),4.01 (s,2H),3.74 (s,2H),3.69 (s,2H),3.27 (s,4H),2.92-2.87 (m,2H),1.98-1.91 (m,4H),1.46-1.18 (m,6H).

[0361] Compound 9-8: Compound 9-7 (6.7 g, 13.60 mmol), DMAP (166.15 mg, 1.36 mmol), and DIEA (2.64 g, 20.40 mmol, 3.18 mL) were dissolved in DCM (180 mL). At 0 °C, DMTrCl (5.52 g, 14.96 mmol) was added portionwise to the reaction mixture. The reaction was stirred at room temperature overnight and quenched with water. The mixture was extracted with DCM (50 mL x 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance AlO column chromatography (50% to 100% EA) to give compound 9-8 (4.3 g, 40% yield).

[0362] C 51 H 56 Calculated mass of N2O8: 824.4, Measured mass: 848.3 [M+Na] + ,ESI.

[0363] 1 H NMR (400MHz,DMSO-d6) δ 7.91-7.68 (m,4H),7.44-7.28 (m,4H),7.75-7.71 (m,6H),6.90-6.88 (m,6H),6.67-6.65 (m,1H),6.29 (s,2H),3.96 (s,1H),3.74 (s,9H),3.69-3.67 (m,2H),3.53 (s,1H),3.39-3.37 (m,2H),2.92-2.89 (m,4H),2.03-1.79 (m,8H),1.46-1.18 (m,6H).

[0364] Compound 9-9: Compound 9-8 (4.2 g, 5.09 mmol) was dissolved in MeOH (126 mL), and piperidine (12.6 mL) was added to the mixture. The reaction mixture was stirred at room temperature overnight, concentrated in vacuo, and purified by high-performance AlO column chromatography (0%-10% MeOH) to give compound 9-9 (3 g, 97% yield) as a white foam.

[0365] C 36 H 46Calculated mass of N2O6: 602.3, Measured mass: 603.4 [M+H] + ,ESI.

[0366] Compound 9-10: Compound 1-4 (3.2 g, 7.16 mmol) and compound 9-9 (3 g, 5.11 mmol) were dissolved in DCM (130 mL). DIEA (1.65 g, 12.78 mmol, 2.17 mL), HOBT (807.01 mg, 6.13 mmol), and EDCI (1.18 g, 6.13 mmol) were added to the mixture. The reaction was stirred at room temperature overnight, and then quenched with water (40 mL), extracted with DCM (50 mL x 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by HPLC to give compound 9-10 (610 mg, 12% yield).

[0367] C 55 H 73 N3O 16 Calculated mass: 1031.5, Measured mass: 1054.5 [M+Na] + ,ESI.

[0368] 1 H NMR (400MHz,DMSO-d6) δ 7.82-7.73 (m,2H),7.24-6.88 (m,12H),5.22 (s,1H),4.97 (d,J=10.8Hz,1H),4.64-4.48 (m,2H),4.05-3.85 (m,4H),3.71-3.69 (m,12H),3.52 (s,1H),3.39-3.38 (m,1H),3.04-2.91 (m,4H),2.11-1.78 (m,19H),1.46-1.18 (m,14H). [ka]

[0369] Compound 9-11: To a solution of compound 9-10 (1.0 g, 0.97 mmol) in anhydrous DCM (3.0 mL) at room temperature, 4,5-dicyanoimidazole (32.0 mg, 0.27 mmol) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (108 mg, 0.36 mmol) were added and stirred for 1 h. LCMS showed that the starting material was completely consumed. The solution was quenched with water (100 mL), washed with brine (300 mL x 3), and dried over NaSO. The solution was then concentrated under reduced pressure, and the residue was purified by high-speed preparative HPLC under the following conditions: column: C18 silica gel, mobile phase: CHCN / HO = 1 / 1 increased to CHCN / HO = 1 / 0 within 20 min, detector: UV 254 nm. This gave compound 9-11 as a white solid (680 mg, 56% yield).

[0370] C 64 H 90 N5O 17 Calculated mass of P: 1231.61, Measured mass: 1177.1 [M-CH2CH2CN] - ,ESI.

[0371] 1 HNMR (600MHz,DMSO-d6) δ 7.81-7.67 (m,2H),7.26-7.23 (m,6H),6.88-6.86 (m,6H),5.22 (d,J=6.0Hz,1H),4.98-4.95 (m,1H),4.48 (d,J=12.0Hz,1H),4.04-3.96 (m,4H),3.89-3.84 (m,1H),3.73-3.38 (m,20H),3.01-2.93 (m,4H),2.73-2.71 (m,2H),2.10-1.75 (m,20H),1.51-1.07 (m,22H).

[0372] 31 PNMR (242MHz,DMSO-d6) δ 146.82,146.70.

[0373] Compound 9-12: To a solution of compound 9-10 (100 mg, 0.097 mmol) in anhydrous DCM (1.0 mL) was added DMAP (5 mg, 0.04 mmol) and TEA (24 mg, 0.24 mmol), followed by succinic anhydride (20 mg, 0.2 mmol). The reaction mixture was stirred at room temperature for 3 h, and LCMS showed that the starting material was completely consumed. The reaction mixture was diluted with DCM (10 mL), washed with HO (3 mL x 4), and brine (3 mL x 4). The organic layer was concentrated to give compound 9-12 (85 mg, 90% yield) as a white solid.

[0374] C 59 H 77 N3O 19 Calculated mass: 1131.52, measured mass: 1130.2 [MH] - ,ESI.

[0375] 1 HNMR (600MHz,DMSO-d6) δ 7.87-7.72 (m,2H),7.24-7.21 (m,6H),6.90-6.87 (m,6H),5.21 (d,J=6.0Hz,1H),4.98-4.95 (m,1H),4.49 (d,J=12.0Hz,1H),4.06-3.98 (m,6H),3.90-3.83 (m,1H),3.73-3.50 (m,13H),3.02-2.94 (m,4H),2.45-2.44 (m,4H),2.11-1.76 (m,20H),1.48-1.18 (m,12H).

[0376] Solid support 9-13: Native amino-LCAA-CPG (loading value: 75 umol / g, 1000 Å) was washed with ACN (100 mL×2), DMF (100 mL×2) and DCM (100 mL×2) and dried under high vacuum overnight.

[0377] To a solution of succinate esters 9-12 (85 mg, 0.075 mmol) and HBTU (53 mg, 0.14 mmol) in anhydrous DMF (1.5 mL) was added DIPEA (30 mg, 0.23 mmol). The reaction mixture was shaken at room temperature for 10 min, and then native amino-LCAA-CPG (300 mg, loading 75 μmol / g) was added. The suspension was shaken at room temperature for 20 h, filtered, and washed with DMF (20 mL x 5), ACN (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 2 h to give 300 mg of solid support. The unreacted amino groups on the solid support were blocked by stirring with AcO / pyridine / N-methylimidazole (90 μL / 1.0 mL / 80 μL) at room temperature for 1 h, and then washed with DMF (20 mL x 5), CHCl (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 15 h to obtain solid support 9-13 (300 mg). For loading calculation, 5.00 mg of loaded dried CPG was taken and 25 mL of 3% DCA in DCM was added. The solution was shaken, and the UV absorbance at 482 nm was measured. The absorbance value was ensured to be less than 1.0 unit to ensure the signal was not saturated. Loading (umol / g) = (total amount of DCA added (mL)) * (absorbance at 482 nm) * 1000) / 78.3 * (mg of CPG taken) Total amount of DCA added (mL) = 25 mL Absorbance value at 482 nm = 0.577 mg of CPG taken = 5.00mg The following equation was applied: Loading (umol / g) = ((25) * (0.577) * 1000) / 78.3 * (5.00) = 36.8umol / g.

[0378] Example 10 [ka]

[0379] Compound 10-2: Compound 10-1 (0.6 g, 0.299 mmol), DIEA (96.63 mg, 0.748 mmol, 130.23 μL), HOBT (48.49 mg, 0.359 mmol), and EDCI (68.80 mg, 0.359 mmol) were mixed in DCM (18 mL) and stirred at room temperature for 30 min. Compound 2-10 (412.34 mg, 0.897 mmol) was then added and stirred at room temperature for 1 h. LC-MS showed complete conversion. The reaction mixture was concentrated and purified by preparative HPLC (C18 column, eluent A: water, eluent B: ACN) to give compound 10-2 (580 mg, 79% yield) as a white solid.

[0380] C 120 H 179 N 11 O 42 Calculated mass: 2446.22, Measured mass: 1247.61 [M+2Na] 2+ ,ESI.

[0381] 1 H NMR (400MHz,DMSO-d6) δ 7.86-7.82 (m,6H),7.75 (t,J=5.5Hz,3H),7.39-7.29 (m,4H),7.26-7.19 (m,5H),7.00 (br,1H),6.89 (dd,J=8.9,3.7Hz,4H),5.21 (d,J=3.4Hz,3H),4.96 (dd,J=11.2,3.4Hz,3H),4.66-4.64 (m,1H),4.78 (d,J=8.4Hz,3H),4.04-3.96 (m,10H),3.90-3.83 (m,3H),3.73-3.67 (m,11H),3.55-3.50 (m,13H),3.43-3.37 (m,5H),3.02 (5 peak,J=5.8Hz,12H),2.90 (s,2H),2.27 (t,J=6.2Hz,6H),2.10 (s,9H) 2.07-2.00 (m,10H),1.99 (s,9H),1.96-1.92 (m,2H),1.89 (s,9H),1.85-1.80 (m,2H),1.77 (s,9H),1.54-1.37 (m,22H),1.22-1.20 (m,12H).

[0382] Compound 10-3: To a solution of compound 10-2 (150 mg, 0.06 mmol) in anhydrous DCM (1.0 mL) were added DMAP (14 mg, 0.12 mmol) and TEA (24 mg, 0.24 mmol), followed by succinic anhydride (20 mg, 0.2 mmol). The reaction mixture was stirred at room temperature for 3 h. LCMS showed that the starting material was completely consumed. The reaction mixture was diluted with DCM and washed with water (3 mL x 4), and then with brine (3 mL x 4). The organic layer was concentrated to give compound 10-3 as a white solid (130 mg, 97% yield).

[0383] C 124 H 183 N 11 O 45 Calculated mass: 2546.24, Measured mass: 1273.5 [M+2H] 2+ ,ESI.

[0384] 1 HNMR (600MHz,DMSO-d6): 7.84-7.73(m,9H),7.37-7.21 (m,9H),6.98-6.89 (m,5H),5.21 (d,J=6.0Hz,3H),4.97-4.94 (m,3H),4.48 (d,J=12.0Hz,3H),4.07-3.66 (m,26H),3.55-3.37 (m,17H),3.04-2.95 (m,14H),2.45 (d,J=6.0Hz,4H),2.29-2.25 (m,6H),2.11-1.72 (m,50H),1.51-1.12 (m,38H).

[0385] Compound 10-4: To a solution of compound 10-3 (130 mg, 0.05 mmol) and HBTU (53 mg, 0.14 mmol) in anhydrous DMF (1.5 mL) was added DIPEA (30 mg, 0.23 mmol). The reaction mixture was shaken at room temperature for 10 min, and native amino-lcaa-CPG (300 mg, loading 75 μmol / g) was added. The suspension was shaken at room temperature for 20 h, filtered, and washed with DMF (20 mL x 5), ACN (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 2 h to give solid support (300 mg). The unreacted amino groups on the support were blocked by stirring with AcO / pyridine / N-methylimidazole (90 μL / 1.0 mL / 80 μL) at room temperature for 1 h, and then washed with DMF (20 mL x 5), ACN (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 15 h to obtain solid support 10-4 (300 mg). For loading calculation, 5.19 mg of loaded dried CPG was taken and 20 mL of 3% DCA in DCM was added. The solution was shaken, and the UV absorbance at 500 nm was measured. The absorbance value was ensured to be less than 1.0 unit to ensure the signal was not saturated. Loading (µmol / g) = (total amount of DCA added (mL)) * (absorbance value at 500 nm) * 1000) / 76 * (mg of CPG taken) Total amount of DCA added (mL) = 20 mL Absorbance value at 500 nm = 0.335 mg of CPG taken = 5.19mg The following equation was applied: loading (μmol / g) = ((20) * (0.335) * 1000) / 76 * (5.19) = 17 μmol / g.

[0386] Example 11 [ka]

[0387] Compound 11-1: To a solution of compound 2-10 (1.27 g, 3.59 mmol) in DCM (15 mL) were added TEA (495.41 mg, 4.90 mmol) and HATU (1.35 g, 3.59 mmol). After stirring for 15 min, Fmoc-6-hexanoic acid (1.5 g, 3.26 mmol) was added to the reaction mixture, and stirring was continued for 4 h. The mixture was partitioned between DCM (50 mL) and water (35 mL), and the DCM extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with DCM / MeOH = 20 / 1 to give 600 mg of compound 11-1 (23.2% yield).

[0388] 1 H NMR (400MHz,DMSO-d6) δ 7.87 (d,J=7.6Hz,2H),7.68 (d,J=7.4Hz,2H),7.44-7.35 (m,4H),7.35-7.28 (m,4H),7.27-7.17 (m,6H),6.88 (d,J=7.6Hz,4H),4.64 (td,J=5.04,1.6Hz,1H),4.28 (d,J=6.9Hz,2H),4.20 (t,J=6.8Hz,1H),3.96 (s,1H),3.73 (d,J=3.8Hz,6H),3.66 (d,J=10.4Hz,2H),3.50 (s,1H),3.39 (t,J=5.9Hz,2H),2.96 (t,J=6.6Hz,2H),2.91(s,2H),2.06-1.74 (m,6H),1.47-1.31(m,4H),1.26-1.13 (m,2H).

[0389] Compound 11-2: Piperidine (0.4 mL) was added to a solution of compound 11-1 (600 mg, 0.75 mmol) in MeOH (4 mL). After stirring overnight, the mixture was concentrated in vacuo. The residue was purified by column chromatography eluting with DCM / MeOH / NHOH=100 / 10 / 1 to give 360 ​​mg of compound 11-2 (82% yield).

[0390] C 35 H44 Calculated mass of N2O5: 572.3, Measured mass: 573.4 [M+H] + ,ESI.

[0391] 1H NMR (400MHz,DMSO-d6) δ 7.27-7.21 (m,4H),6.91-6.85 (m,9H),3.97 (s,1H),3.73 (s,6H),3.68 (s,2H),3.47 (d,J=6.5Hz,2H),3.16 (s,2H),2.90 (s,2H),2.66-2.62 (m,2H),2.54-2.51 (m,2H),1.49-1.17 (m,12H).

[0392] Compound 11-4: A mixture of compound 11-3 (10 g, 84.65 mmol), 4-bromopyridine (14.71 g, 93.11 mmol), Pd(PPh)Cl (4 g, 5.70 mmol), and t-BuOK (19.00 g, 169.30 mmol) in 1,4-dioxane (200 mL) was degassed by purging with nitrogen gas. The mixture was then heated at 60 °C for 6 h. The mixture was concentrated, and the residue was purified by column chromatography, where it was dissolved in DCM / MeOH / NHOH = 95 / 5 / 1 to give compound 11-4 as a yellow solid (48% yield).

[0393] C 12 Calculated mass of H9N3: 195.1, Measured mass: 196.2 [M+H] + ,ESI.

[0394] Compound 11-5: Compound 11-4 (10 g, 51.22 mmol) was dissolved in tert-butanol and heated to 50 °C. KOH (574.84 mg, 10.24 mmol) and MeOH (5 mL) were added. tert-Butyl acrylate (7.22 g, 56.35 mmol) was then slowly added to the reaction mixture and stirred for 5 h. The mixture was concentrated in vacuo. The residue was partitioned between ethyl acetate (250 mL) and water (150 mL), and the ethyl acetate extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with PE / EA = 1 / 2 to give 11 g of compound 11-5 (66% yield).

[0395] C 19 H 21 Calculated mass of N3O2: 323.2, Measured mass: 324.2 [M+H] + ,ESI.

[0396] 1 H NMR (400MHz,DMSO-d6) δ 8.65 (d,J=5.6Hz,4H),7.50 (d,J=6.0Hz,4H),2.82 (t,J=7.8Hz,2H),2.23 (t,J=7.8Hz,2H),1.35 (s,9H).

[0397] Compound 11-6: Cobalt chloride hexahydrate (1.47 g, 6.18 mmol) was added to a solution of compound 11-5 (1 g, 3.09 mmol) in MeOH (20 mL). Then, sodium borohydride (1.17 g, 30.92 mmol) was slowly added to the reaction mixture at -6 °C. The mixture was allowed to warm to room temperature and stirred for 5 h. The mixture was concentrated in vacuo. The residue was dissolved in EA, filtered through a layer of celite diatomaceous earth, and washed with MeOH. The filtrate was concentrated to give 0.7 g of compound 11-6 (69% yield).

[0398] C 19 H 25 Calculated mass of N3O2: 327.2, Measured mass: 328.3 [M+H] + ,ESI.

[0399] Compound 11-7: Compound 11-6 (2.12 g, 9.16 mmol) was dissolved in DCM (40 mL). TEA (925.42 mg, 9.16 mmol) and HATU (3.46 g, 9.16 mmol) were added to the solution. After stirring for 20 min, Boc-6-aminocaproic acid (3 g, 9.16 mmol) was added to the reaction mixture, and the mixture was stirred for 5 h. The mixture was partitioned between DCM (50 mL) and water (35 mL), and the DCM extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with DCM / MeOH = 9 / 1 to give 2.5 g of compound 11-7 as a yellow oil (71% yield).

[0400] C 30 H 44 Calculated mass of N4O5: 540.3, Measured mass: 541.4 [M+H] + ,ESI.

[0401] 1 H NMR (400MHz,DMSO-d6) δ 8.48 (d,J=5.9Hz,4H),7.45 (t,J=6.6Hz,1H),7.14 (d,J=6.1Hz,4H),6.73 (t,J=5.4Hz,1H),3.88 (d,J=6.1Hz,2H),2.85 (q,J=6.6Hz,2H),2.31 (t,J=8.0Hz,2H),1.94 (q,J=8.0Hz,4H),1.36 (s,9H),1.32 (s,9H),1.31-1.23(m,4H),1.1-0.9(m,2H).

[0402] Compound 11-8: Platinum oxide (2.2 g, 9.69 mmol) was added to a solution of compound 11-7 (4.5 g, 8.32 mmol) in AcOH (15 ml). The mixture was hydrogenated under approximately 0.4 MPa for 56 h. The catalyst was filtered through a layer of celite diatomaceous earth and washed with MeOH. The mixture was concentrated in vacuo. The pH was adjusted to 7 by adding concentrated aqueous NaHCO3 and dried in vacuo. The residue was dissolved in THF, and the mixture was filtered, and the filtrate was evaporated under reduced pressure to give 4 g of compound 11-8 as a colorless oil (87% yield).

[0403] C 30 H 56 Calculated mass of N4O5: 552.4, Measured mass: 553.4 [M+H] + ,ESI.

[0404] Compound 11-9: TEA (402.72 mg, 3.98 mmol) and HATU (1.50 g, 3.98 mmol) were added to a solution of Boc-6-aminocaproic acid (920.49 mg, 3.98 mmol) in DCM (10 mL). After stirring the solution for 20 min, compound 11-8 (1 g, 1.18 mmol) was added to the reaction mixture, and stirring was continued for 5 h. The mixture was partitioned between DCM (50 mL) and water (35 mL), and the DCM extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with DCM / MeOH = 15 / 1 to give 0.4 g of compound 11-9 as a white solid (22% yield).

[0405] C 52 H 94 NO 11 Calculated mass: 978.7, Measured mass: 979.8 [M+H] + ,ESI.

[0406] 1H NMR (400MHz,DMSO-d6) δ 7.41(t,J=6.0Hz,1H),6.78-6.70 (m,3H),3.88 (d,J=11.4Hz,2H),3.02(d,J=6.5Hz,6H),2.92-2.82 (m,8H),2.25 (t,J=7.4Hz,4H),2.15 (t,J=8.1Hz,2H),2.16 (t,J=7.2Hz,2H),1.70-1.50 (m,6H),1.49-1.38 (m,10H),1.38 (s,9H),1.36 (s,27H),1.34-1.15 (m,14H).

[0407] Compound 11-10: TFA (2 mL) was added to a solution of compound 11-9 (1.4 g, 1.43 mmol) in DCM (6 mL), and the mixture was stirred at room temperature for 4 h. The mixture was concentrated in vacuo to give 850 mg of compound 11-10 as a colorless oil (95% yield).

[0408] C 33 H 62 Calculated mass of N6O5: 622.5, Measured mass: 623.6 [M+H] + ,ESI.

[0409] Compound 11-11: TEA (584.84 mg, 5.78 mmol) and HATU (1.64 g, 4.33 mmol) were added to a solution of compound 1-4 (2.13 g, 4.77 mmol) in DMF (10 mL). After stirring for 20 min, compound 11-10 (0.9 g, 1.44 mmol) was added to the reaction mixture, and stirring was continued for 5 h. The mixture was purified by reverse-phase column chromatography (C18 column) to give 1.3 g of compound 11-11 as a white solid (47% yield).

[0410] C 90 H 143 N9O 35 Calculated mass: 1909.9, Measured mass: 956.0 [M+2H] 2+ ,ESI.

[0411] 1H NMR (400MHz,DMSO-d6) δ 12.0 (br,1H),7.83 (d,J=9.2Hz,3H),7.70 (t,J=5.5Hz,3H),7.50-7.40 (m,1H),5.20 (d,J=3.4Hz,3H),4.96 (dd,J=11.24,3.4Hz,3H),4.50-4.40 (m,5H),4.08-3.96 (m,9H),3.92-3.82 (m,5H),3.76-3.66 (m,3H),3.46-3.36 (m,4H),3.15-2.75 (m,11H),2.40-2.30 (m,2H),2.25 (t,J=7.3Hz,4H),2.10 (s,9H),2.08-2.00 (m,8H),1.99 (s,9H),1.98 (s,9H),1.77 (s,9H),1.60-1.08 (m,42H).

[0412] Compound 11-12: Compound 11-11 (1.4 g, 0.73 mmol) was dissolved in DCM (15 mL), and HOBT (148.47 mg, 1.10 mmol), EDCI (210.10 mg, 1.10 mmol), and DIEA (236.69 mg, 1.83 mmol) were added to the solution. After stirring for 15 min, compound 11-2 (503.47 mg, 0.88 mmol) was added to the reaction mixture, and stirring was continued for 4 h. The mixture was partitioned between DCM (50 mL) and water (35 mL), and the DCM extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by reverse-phase column (C18 column) to give 0.8 g of compound 11-12 as a white powder (44% yield).

[0413] C 125 H 185 N 11 O 39 Calculated mass: 2464.3, Measured mass: 1255.6 [M+2Na] 2+ ,ESI.

[0414] 11H NMR (400 MHz, DMSO-d6) δ 7.86 - 7.76 (m, 4H), 7.71 (t, J = 5.3 Hz, 3H), 7.45 (s, 1H), 7.41 - 7.35 (m, 2H), 7.34 - 7.28 (m, 2H), 7.27 - 7.18 (m, 5H), 6.93 - 6.86 (m, 4H), 5.27 - 5.15 (d, J = 3.3 Hz, 3H), 5.02 - 4.90 (dd, J = 11.2, 3.4 Hz, 3H), 4.69 - 4.60 (m, 1H), 4.57 - 4.33 (m, 5H), 4.11 - 3.98 (m, 9H), 3.97 (s, 1H), 3.93 - 3.81 (m, 5H), 3.73 (s, 6H), 3.72 - 3.62 (m, 5H), 3.51 (s, 1H), 3.46 - 3.36 (m, 5H), 3.14 - 2.73 (m, 14H), 2.43 - 2.29 (m, 2H), 2.29 - 2.19 (m, 4H), 2.01 (s, 9H), 2.06 - 1.97 (m, 19H), 1.96 - 1.91 (m, 3H), 1.87 (s, 9H), 1.86 - 1.80 (m, 2H), 1.77 (s, 9H), 1.70 - 1.55 (m, 5H), 1.54 - 1.13 (m, 44H). [Chemical formula]

[0415] Compounds 11 - 13: To a solution of compound 11-12 (2.0 g, 0.8 mmol) in anhydrous DCM (7.0 mL) at room temperature, 4,5-dicyanoimidazole (80.0 mg, 0.67 mmol) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (270 mg, 0.90 mmol) were added and stirred for 1 h. LCMS showed that the starting material was completely consumed. The solution was quenched with water (100 mL), washed with brine (300 mL x 3), and dried over Na2SO4. The solution was then concentrated under reduced pressure, and the residue was purified by high-speed preparative HPLC using the following conditions: C18 silica gel column, mobile phase: CH3CN / HO = 1 / 1, increased to CH3CN / HO = 1 / 0 within 20 min, detector: UV 254 nm. This gave compound 11-13 as a white solid (1.0 g, 45% yield).

[0416] C 134 H 202 N 13 O 40 Calculated mass of P: 2664.39, Found: 1132.5 [M-DMTr-N(CH(CH3)2)2 + 4H] 2+ ,ESI.

[0417] 1 HNMR (600MHz,DMSO-d6) δ 7.82-7.69 (m,6H),7.44-7.19 (m,9H),6.90-6.87 (m,4H),5.21 (d,J=6.0Hz,3H),4.98-4.94 (m,3H),4.49-4.44 (m,5H),4.04-3.37 (m,35H),3.02-2.71 (m,15H),2.33-1.75 (m,56H),1.64-1.07 (m,57H).

[0418] 31 PNMR (242MHz,DMSO-d6) δ 146.79,146.67. [ka]

[0419] Compounds 11-14: To a solution of compound 11-12 (150 mg, 0.06 mmol) in anhydrous DCM (1.0 mL) was added DMAP (5 mg, 0.04 mmol) and TEA (24 mg, 0.24 mmol), followed by succinic anhydride (20 mg, 0.2 mmol). The reaction mixture was stirred at room temperature for 3 h. LCMS showed that the starting material was completely consumed. The reaction mixture was diluted with DCM, washed with water (3 mL x 4), and then washed with brine (3 mL x 4). The organic layer was concentrated to give compound 11-14 (135 mg, 97% yield) as a white solid.

[0420] C 129 H 189 N 11 O 42 Calculated mass: 2564.30, Measured mass: 1132.5 [M-DMTr+2H] 2+ ,ESI.

[0421] 1 H NMR (600MHz,DMSO-d6): 7.84-7.71(m,6H),7.45-7.21 (m,10H),6.92-6.89 (m,4H),5.21 (d,J=6.0Hz,3H),4.98-4.94 (m,3H),4.49-4.44 (m,5H),4.07-3.37 (m,36H),3.16-2.84 (m,14H),2.44-1.77 (m,62H),1.45-1.21 (m,50H).

[0422] Compound 11-15: To a solution of compound 11-14 (135 mg, 0.05 mmol) and HBTU (53 mg, 0.14 mmol) in anhydrous DMF (1.5 mL) was added DIPEA (30 mg, 0.23 mmol). The reaction mixture was shaken at room temperature for 10 min, and native amino-lcaa-CPG (300 mg, loading 75 μmol / g) was added. The suspension was shaken at room temperature for 20 h, filtered, and washed with DMF (20 mL x 5), ACN (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 2 h to give solid support (300 mg). The unreacted amino groups on the support were blocked by stirring with AcO / pyridine / N-methylimidazole (90 μL / 1.0 mL / 80 μL) at room temperature for 1 h, and then washed with DMF (20 mL x 5), ACN (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 15 h to obtain solid support 11-15 (300 mg). For loading calculation, 5.00 mg of loaded dried CPG was taken and 20 mL of 3% DCA in DCM was added. The solution was shaken, and the UV absorbance at 500 nm was measured. The absorbance value was ensured to be less than 1.0 unit to ensure the signal was not saturated. Loading (umol / g) = (total amount of DCA added (mL)) * (absorbance value at 500 nm) * 1000) / 76 * (mg of CPG taken) Total amount of DCA added (mL) = 20 mL Absorbance value at 500 nm = 0.464 mg of CPG taken = 5.0 mg The following equation was applied: Loading (umol / g) = ((20) * (0.464) * 1000) / 76 * (5.0) = 24umol / g.

[0423] Example 12 [ka]

[0424] Compound 12-1: Compound 3-4 (1.1 g, 5.16 mmol) was dissolved in HO (10 mL) and THF (20 mL). KCO (1.43 g, 10.31 mmol) and benzyl chloroformate (967 mg, 5.67 mmol) were added. The reaction mixture was stirred at room temperature for 3 h. It was then concentrated in vacuo and purified by high-performance silica gel column chromatography (PE / EA = 5 / 1) to give compound 12-1 (1.5 g, 84% yield) as a white foamy solid.

[0425] C 20 H 29 Calculated mass of NO4: 347.2, Measured mass: 348.3 [M+H] + ,ESI.

[0426] Compound 12-2: Compound 12-1 (1.52 g, 4.37 mmol), DMAP (147.10 mg, 1.20 mmol), and DIEA (3.11 g, 24.08 mmol, 4.19 mL) were dissolved in DCM (20 mL). DMTrCl (1.48 g, 4.37 mmol) in DCM (20 mL) was slowly added to the reaction mixture at 0 °C. The reaction was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO solution (40 mL), extracted with DCM (50 mL x 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance AlO column chromatography (0% to 3% MeOH) to give compound 12-4 (1.9 g, 67% yield) as a white foamy solid.

[0427] C 41 H 47 Calculated mass of NO6: 649.34, Measured mass: 650.34 [M+H] + ,ESI.

[0428] 1H NMR (400MHz,DMSO-d6) δ 7.41-7.19 (m,15H),6.90-6.87 (m,3H),5.06-5.05 (m,2H),4.42-4.40 (m,1H),3.76 (s,6H),3.40-3.38 (m,6H),2.88 (s,2H),1.39-1.11 (m,12H).

[0429] Compound 12-3: Compound 12-2 (0.7 g, 1.08 mmol) was dissolved in MeOH (30 mL), and Pd / C (140 mg) was added to the solution. The reaction mixture was stirred at room temperature under a hydrogen gas atmosphere for 3 h. The reaction mixture was filtered and concentrated in vacuo to give crude compound 12-3 (520 mg) as a white foamy solid, which was used in the next step without purification.

[0430] C 33 H 41 Calculated mass of NO4: 515.30, Measured mass: 516.30 [M+H] + ,ESI.

[0431] 1 H NMR (400MHz,DMSO-d6) δ 7.38 (d,J=8.8Hz,2H) ,7.32-7.20 (m,7H),6.89-6.87 (m,4H),4.51-4.49 (m,1H),3.73 (s,6H),2.89-2.86 (m,8H),1.52-1.51 (m,2H),1.19-1.12 (m,7H),0.91-0.88 (m,2H).

[0432] Compound 12-4: Compound 10-1 (1.56 g, 0.756 mmol) was dissolved in DCM (20 mL). At 0 °C, DIEA (300.74 mg, 2.33 mmol), EDCI (297.39 mg, 1.55 mmol), and HOBT (209.62 mg, 1.55 mmol) were added to the mixture. The reaction was stirred at 0 °C for 30 min. Compound 12-3 (400 mg, 0.756 mmol) was added to the reaction mixture. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO3 solution (40 mL), extracted with DCM (30 mL x 2), washed with brine (30 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance Al2O3 column chromatography (0% to 8% MeOH) to give compound 12-4 (1 g, 51% yield) as a white foamy solid.

[0433] C 124 H 187 N 11 O 42 Calculated mass: 2503.28, Measured mass: 1101.6 [M-DMTr+2H + ] 2+ ,ESI.

[0434] 1H NMR (400MHz,DMSO-d6) δ 7.85-7.81 (m,6H),7.73 (t,J=5.6Hz,3H),7.39 (d,J=7.32Hz,2H),7.32-7.19 (m,8H),6.99 (s,1H),6.88 (d,J=8.9Hz,4H),5.21-5.20 (m,3H),4.98-4.94 (m,3H),4.48 (d,J=8.44Hz,3H),4.42 (t,J=5.0Hz,1H),4.05-4.00 (m,9H),3.90-3.83 (m,3H),3.73-3.67 (m,9H),3.55-3.52 (m,11H),3.43-3.38 (m,6H),3.22-3.21 (m,6H),3.06-3.00 (m,11H),2.29-2.24 (m,5H),2.22 (t,J=7.4Hz,2H),2.10 (s,8H),2.05 (t,J=6.96Hz,8H),1.99-1.98 (m,9H),1.89 (s,8H),1.77 (s,8H),1.52-1.44 (m,22H),1.30-1.22 (m,24H).

[0435] Example 13 [ka]

[0436] Compound 13-1: Compound 4-7 (1.3 g, 7.01 mmol) was dissolved in THF (30 mL) and HO (15 mL). KCO (2.91 g, 21.05 mmol) was added to the solution. At 0 °C, benzyl chloroformate (1.32 g, 7.72 mmol) was added to the reaction mixture. The mixture was stirred at room temperature for 3 h. The reaction mixture was extracted with EA (50 mL × 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance silica gel column chromatography (0%-5% MeOH) to give compound 13-1 (1.95 g, 87% yield) as a white foamy solid.

[0437] C 18 H 25Calculated mass of NO4: 319.2, Measured mass: 320.2 [M+H] + ,ESI.

[0438] Compound 13-2: Compound 13-1 (2 g, 6.26 mmol) and DIEA (2.43 g, 18.79 mmol, 4.19 mL) were dissolved in DCM (60 mL). DMTrCl (2.02 g, 5.95 mmol) was added to the reaction mixture at 0 °C. The reaction was stirred at 0 °C for an additional 1 h. The reaction mixture was quenched with saturated NaHCO solution (40 mL), extracted with DCM (50 mL × 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance AlO column chromatography (PE / EA = 0% to 40%) to give compound 13-2 (2.6 g, 66% yield) as a white foamy solid.

[0439] Compound 13-3: Compound 13-2 (600 mg, 0.96 mmol) was dissolved in MeOH (20 mL), and Pd / C was added to the reaction mixture. The reaction mixture was stirred at room temperature under a hydrogen gas atmosphere for 3 h. The reaction mixture was filtered and concentrated in vacuo to give crude product 13-3 (470 mg, crude) as a white foamy solid, which was used in the next step without purification.

[0440] C 31 H 37 Calculated mass of NO4: 487.3, Measured mass: 488.3 [M+H] + ,ESI.

[0441] Compound 13-4: Compound 10-1 (1.23 g, 0.61 mmol) was dissolved in DCM (20 mL). At 0 °C, DIEA (239 mg, 1.85 mmol, 0.32 mL), EDCI (236 mg, 1.23 mmol), and HOBT (166 mg, 1.23 mmol) were added to the mixture. The reaction was stirred at 0 °C for 30 min. Compound 13-3 (300 mg, 0.61 mmol) was added to the reaction mixture. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO3 solution (40 mL), extracted with DCM (30 mL x 2), washed with brine (30 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance Al2O3 column chromatography (0% to 8% MeOH) to give compound 13-4 (1 g, 66% yield) as a white foamy solid.

[0442] 1 H NMR (400MHz,DMSO-d6) δ 7.85-7.82(m,6H),7.75-7.73 (m,3H),7.40-7.38 (m,2H),733-7.29 (m,2H),7.27-7.25 (m,4H),7.23-7.19 (m,1H),6.98 (s,1H),6.90-6.88 (m,4H),5.21 (d,J=3.2Hz,3H),4.97 (dd,J=3.2,11.2Hz,3H),4.63-4.61(m,1H),4.48 (d,J=8.4Hz,3H),4.04-4.00 (m,9H),3.91-3.83 (m,3H),3.73 (s,6H),3.71-3.67 (m,3H),3.55-3.52 (m,12H),3.44-3.37 (m,5H),3.27-3.15 (m,5H),3.06-3.01 (m,14H),2.27 (t,J=12.8Hz,6H),2.21 (d,J=14.8Hz,2H),2.10 (s,9H),2.04 (t,J=6.8Hz,8H),1.99 (s,9H),1.89 (s,9H),1.77 (s,9H),1.58-1.33 (m,30H),1.29-1.23 (m,12H).

[0443] Example 14 [ka]

[0444] Compound 14-1: Compound 5-6 (3.6 g, 19.27 mmol) was dissolved in THF (30 mL) and HO (15 mL). KCO (5.33 g, 38.54 mmol) was added to the solution. At 0 °C, benzyl chloroformate (3.62 g, 21.20 mmol) was added to the reaction mixture. The mixture was stirred at room temperature for 2 h. The reaction mixture was extracted with EA (50 mL × 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance silica gel column chromatography (0% to 2% MeOH) to give compound 14-1 (5 g, 81% yield) as a white foamy solid.

[0445] C 18 H 25 Calculated mass of NO4: 319.2, Measured mass: 320.2 [M+H] + ,ESI.

[0446] 1 H NMR (400MHz,DMSO) δ 7.39-7.28 (m,5H),5.01 (s,2H),4.27 (t,J=5.4Hz,2H),3.61-3.50 (m,4H),3.22 (d,J=5.3Hz,4H),1.55 (t,J=6.1Hz,4H),1.25-1.22 (m,8H).

[0447] Compound 14-2: Compound 14-1 (3.5 g, 10.96 mmol) and DIEA (2.12 g, 16.44 mmol) were dissolved in DCM (60 mL). DMTrCl (3.34 g, 9.86 mmol) was added to the reaction mixture at 0 °C. The reaction was stirred at 0 °C for 3 h. The reaction mixture was quenched with saturated NaHCO solution (40 mL), extracted with DCM (50 mL × 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance AlO column chromatography (PE / EA = 0% to 60%) to give compound 14-2 (5.5 g, 81% yield) as a white foamy solid.

[0448] 1 H NMR (400MHz,DMSO-d6) δ 7.39-7.18 (m,14H),6.88 (d,J=8.8Hz,4H),5.00 (s,2H),4.39 (t,J=4.9Hz,1H),3.73 (s,6H),3.58-3.35 (m,6H),2.83 (s,2H),1.29-1.15 (m,8H).

[0449] Compound 14-3: Compound 14-2 (254 mg, 408.52 μmol) was dissolved in MeOH (10 mL), and Pd / C was added to the reaction mixture. The reaction mixture was stirred at room temperature under a hydrogen gas atmosphere for 2 h. The reaction mixture was filtered and concentrated in vacuo to give crude product 14-3 (199 mg, crude) as a white foamy solid, which was used in the next step without purification.

[0450] C 31 H 37 Calculated mass of NO4: 487.3, Measured mass: 488.3 [M+H] + ,ESI.

[0451] Compound 14-4: Compound 10-1 (820 mg, 408.51 μmol) was dissolved in DCM (20 mL). At 0 °C, DIEA (158 mg, 1.23 mmol), EDCI (157 mg, 817 μmol), and HOBT (110 mg, 817 μmol) were added to the mixture. The reaction was stirred at 0 °C for 30 min. Compound 14-3 (199 mg, 408.51 μmol) was added to the reaction mixture. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO3 solution (40 mL), extracted with DCM (30 mL x 2), washed with brine (30 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance Al2O3 column chromatography (0% to 6% MeOH) to give compound 14-4 (540 mg, 53% yield) as a white foamy solid.

[0452] 1H NMR (400MHz,DMSO-d6) δ 7.89-7.80 (m,6H),7.75 (t,J=5.5Hz,3H),7.37 (d,J=7.3Hz,2H),7.30 (t,J=7.7Hz,2H),7.23-7.17 (m,5H),6.99 (s,1H),6.87 (d,J=8.4Hz,4H),5.21 (d,J=3.4Hz,3H),4.96 (dd,J=10.8,3.4Hz,3H),4.47(d,J=8.5Hz,3H),4.41(t,J=4.9Hz,1H),4.04-3.98 (m,9H),3.91-3.82 (m,3H),3.74-3.48 (m,23H),3.43-3.36 (m,6H),3.06-2.98 (m,12H),2.83 (d,J=9.4Hz,2H),2.27 (t,J=6.3Hz,6H),2.09 (s,9H),2.03 (t,J=7.0Hz,8H),2.00-1.95 (m,12H),2.01 (s,9H),1.89 (s,9H),1.77 (s,9H),1.54-1.37 (m,22H),1.31-1.14 (m,20H).

[0453] Example 15 [ka]

[0454] Compound 15-1: Compound 7-6 (3.8 g, 18.30 mmol) was dissolved in THF (30 mL) and HO (15 mL). KCO (5.06 g, 36.59 mmol) was added to the reaction mixture. At 0 °C, benzyl chloroformate (3.43 g, 20.13 mmol) was added to the reaction mixture. The mixture was stirred at room temperature for 2 h. The reaction mixture was extracted with EA (50 mL x 2), washed with brine (50 mL), dried over NaSO, and concentrated in vacuo to give crude product 15-1 (3.46 g, crude) as a white foam.

[0455] C 17 H 23 Calculated mass of NO4: 305.2, Measured mass: 306.2 [M+H] + ,ESI.

[0456] Compound 15-2: Compound 15-1 (3.07 g, 10.06 mmol) and DIEA (1.95 g, 15.09 mmol) were dissolved in DCM (60 mL). DMTrCl (3.41 g, 10.06 mmol) was added to the reaction mixture at 0 °C. The reaction was stirred at 0 °C for 3 h. The reaction mixture was quenched with saturated NaHCO solution (40 mL), extracted with DCM (50 mL x 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance AlO column chromatography (PE / EA = 0% to 60%) and preparative HPLC to give compound 15-2a (1.04 g, 34% yield) and compound 15-2b (1.78 g, 58% yield) as a white foamy solid.

[0457] 15-2a: 1 H NMR (400MHz,DMSO-d6) δ 7.38-7.36 (m,1H),7.36-7.31 (m,5H),7.31-7.20 (m,7H),7.20-7.15 (m,1H),6.85 (d,J=8.9Hz,4H),5.02 (d,J=6.1Hz,2H),6.98 (s,1H),4.61 (t,J=5.0Hz,1H),3.71 (s,6H),3.46-3.35 (m,2H),3.27 (d,J=5.0Hz,2H),3.13-3.05 (m,2H),2.93 (s,2H),2.64-2.55 (m,2H),1.72-1.62 (m,2H),1.30-1.21 (m,2H).

[0458] 15-2b: 1H NMR (400MHz,DMSO-d6) δ 7.40-7.27 (m,9H),7.27-7.22 (m,4H),7.22-7.16 (m,1H),6.89 (d,J=8.9Hz,4H),5.03 (s,2H),6.98 (s,1H),4.64 (t,J=5.1Hz,1H),3.73 (s,6H),3.43-3.34 (m,4H),3.19-3.09 (m,2H),3.13-3.05 (m,2H),2.84 (s,2H),2.41-2.31 (m,2H),1.62-1.54 (m,2H),1.38-1.30 (m,2H).

[0459] Compound 15-3: Compound 15-2a (210 mg, 350.48 μmol) was dissolved in MeOH (10 mL), and Pd / C was added to the solution. The reaction mixture was stirred at room temperature under a hydrogen gas atmosphere for 2 h. The reaction mixture was filtered and concentrated in vacuo to give crude product 15-3a (166 mg, crude) as a white foamy solid, which was used in the next step without purification.

[0460] C 30 H 35 Calculated mass of NO4: 473.3, Measured mass: 474.3 [M+H] + ,ESI.

[0461] Compound 15-2b (610 mg, 1.00 mmol) was dissolved in MeOH (10 mL), and Pd / C was added to the solution. The reaction mixture was stirred at room temperature under a hydrogen gas atmosphere for 2 h. The reaction mixture was filtered and concentrated in vacuo to give crude product 15-3b (475 mg, crude) as a white foamy solid, which was used in the next step without purification.

[0462] Compound 15-4: Compound 10-1 (700 mg, 348.92 μmol) was dissolved in DCM (20 mL). At 0 °C, DIEA (135 mg, 1.05 mmol), EDCI (134 mg, 698 μmol), and HOBT (94 mg, 698 μmol) were added to the mixture. The reaction was stirred at 0 °C for 30 min. Compound 15-3a (199 mg, 408.51 μmol) was added to the reaction mixture. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO3 solution (40 mL), extracted with DCM (30 mL x 2), washed with brine (30 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance Al2O3 column chromatography (0% to 6% MeOH) to give compound 15-4a (550 mg, 64% yield) as a white foamy solid.

[0463] 1 H NMR (400MHz,DMSO-d6) δ 7.88-7.80 (m,6H),7.75 (t,J=5.4Hz,3H),7.38-7.34 (m,2H),7.28 (t,J=7.6Hz,2H),7.24-7.17 (m,5H),7.00 (s,1H),6.87 (d,J=8.9Hz,4H),5.21 (d,J=3.4Hz,3H),4.96 (dd,J=11.3,3.4Hz,3H),4.64-4.60 (m,1H),4.47 (d,J=8.5Hz,3H),4.05-3.98 (m,9H),3.92-3.83 (m,3H),3.76-3.65 (m,9H),3.62-3.45 (m,13H),3.45-3.37 (m,6H),3.28-3.23 (m,2H),3.17-3.09 (m,2H),3.07-2.98 (m,12H),2.97-2.89 (m,2H),2.69-2.53 (m,2H),2.27 (t,J=6.2Hz,6H),2.16-2.07 (m,11H),2.06-1.96 (m,17H),1.88 (s,9H),1.78 (s,9H),1.57-1.36 (m,22H),1.26-1.15 (m,14H).

[0464] Compound 10-1 (1 g, 500.29 μmol) was dissolved in DCM (20 mL). At 0 °C, DIEA (194 mg, 1.50 mmol), EDCI (192 mg, 1.00 mmol), and HOBT (135 mg, 1.00 mmol) were added to the mixture. The reaction was stirred at 0 °C for 30 min. Compound 15-3b (238 mg, 502.53 μmol) was added to the reaction mixture. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO3 solution (40 mL), extracted with DCM (30 mL x 2), washed with brine (30 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance Al2O3 column chromatography (0% to 6% MeOH) to give compound 15-4b (550 mg, 44% yield) as a white foamy solid.

[0465] 1 H NMR (400MHz,DMSO-d6) δ 7.87-7.80 (m,4H),7.74 (t,J=5.6Hz,3H),7.40-7.36 (m,2H),7.31 (t,J=7.7Hz,2H),7.27-7.18 (m,5H),6.99 (s,1H),6.91-6.87 (m,4H),5.22 (d,J=3.4Hz,3H),4.96 (dd,J=11.3,3.4Hz,3H),4.66-4.62 (m,1H),4.48 (d,J=8.4Hz,3H),4.05-3.98 (m,9H),3.92-3.83 (m,3H),3.75-3.67 (m,9H),3.57-3.47 (m,11H),3.46-3.36 (m,6H),3.34-3.27 (m,4H),3.23-3.09 (m,2H),3.07-2.98 (m,12H),2.85 (s,2H),2.46-2.31 (m,2H),2.30-2.24 (m,6H),2.18-2.12 (m,2H),2.09 (s,9H),2.06-2.01 (m,8H),1.99 (s,9H),1.88 (s,9H),1.77 (s,9H),1.55-1.37 (m,22H),1.33-1.14 (m,14H).

[0466] Example 16 [ka]

[0467] Compound 16-1: Compound 6-8 (190 mg, 0.403 mmol) and compound 10-1 (809 mg, 0.403 mmol) were dissolved in DCM (10 mL), and DIEA (156.35 mg, 1.21 mmol), EDCI (154.61 mg, 0.81 mmol), and HOBT (108.97 mg, 0.81 mmol) were added to the mixture. The reaction was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO solution (40 mL), extracted with DCM (30 mL x 2), washed with brine (30 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance AlO column chromatography (0% to 10% MeOH) to give compound 16-1 (772 mg, 77% yield) as a white foamy solid.

[0468] C 121 H 179 N 11 O 42 Calculated mass: 2458.22, Measured mass: 1079.2 [M-DMTr+2H] 2+ ,ESI.

[0469] 1H NMR(400MHz,DMSO-d6) δ 7.85-7.82 (m,6H),7.75-7.72 (m,3H),7.38-7.36 (m,2H),7.29-7.27 (m,2H),7.25-7.22 (m,5H),6.98 (s,1H),6.87 (d,J=8.0Hz,4H),5.21 (d,J=4.0Hz,3H),4.97 (dd,J=3.2,8.0Hz,3H),4.80-4.70 (m,1H),4.48 (d,J=8.4Hz,3H),4.02-4.01 (m,11H),3.88-3.86 (m,5H),3.73-3.69 (m,9H),3.55-3.52 (m,12H),3.46-3.36 (m,5H),3.17 (d,J=5.2Hz,1H),3.04-3.00 (m,14H),2.29-2.26 (m,10H),2.10-2.07 (m,8H),2.06-2.02 (m,19H),1.99 (s,9H),1.77 (s,9H),1.52-1.46 (m,22H),1.45-1.22 (m,12H).

[0470] Example 17 [ka]

[0471] Compound 17-1: Compound 11-11 (1.5 g, 0.78 mmol), DIEA (302.32 mg, 2.35 mmol), HOBT (212.11 mg, 1.57 mmol), and EDCI (300.92 mg, 1.57 mmol) were dissolved in DCM (15 mL) at 0 °C, and compound 3-12 (493.56 mg, 0.78 mmol) was added. The mixture was stirred at room temperature for 1 h. LC-MS showed complete conversion. The reaction mixture was diluted by adding DCM (20 mL), washed with NaHCO (saturated aqueous solution, 50 mL) and water (50 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 17-1 (1.14 g, 58% yield).

[0472] C 129 H 193 N11 O 39 Calculated mass value: 2520.35, measured value: 1109.35 (M-DMTr+2H) 2+ ,ESI.

[0473] 1 H NMR (400MHz, DMSO-d6) δ 7.83 (d,J=9.2Hz,4H),7.73 (t,J=9.2Hz,3H),7.47-7.39 (m,3H),7.33-7.19 (m,7H),6.88 (d,J=8.92Hz,4H),5.21 (d,J=3.3Hz,3H),4.98-4.94 (m,3H),4.49-4.42 (m,5H),4.02 (s,9H),3.91-3.86 (m,5H),3.73-3.68 (m,9H),3.43-3.39 (m,5H),3.34-3.30 (m,3H),3.02-2.99 (m,10H),2.87 (s,4H),2.34-2.33 (m,2H),2.25-2.21 (m,6H),2.10 (s,9H),2.10-2.08 (m,8H),2.0 (s,9H),1.99 (s,3H),1.89 (s,9H),1.77 (s,9H),1.45-1.24 (m,64H).

[0474] Example 18

change

[0475] Compound 18-1: To a solution of compound 11-11 (1.01 g, 0.45 mmol) in DCM (20 mL) at 0 °C, DIEA (193.61 mg, 1.85 mmol, 0.32 mL), EDCI (191.45 mg, 0.99 mmol), and HOBT (134.95 mg, 0.99 mmol) were added. The reaction was stirred at 0 °C for 30 min. Compound 4-10 (300 mg, 0.49 mmol) was added to the reaction mixture. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO3 solution (40 mL), extracted with DCM (30 mL x 2), washed with brine (30 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance Al2O3 column chromatography (0% to 8% MeOH) to give compound 18-1 (500 mg, 46% yield) as a white foamy solid.

[0476] C 127 H 189 N 11 O 39 Calculated mass: 2493.31, Measured mass: 1096.7 [M-DMTr+2H] 2+ ,ESI.

[0477] 1H NMR (400MHz,DMSO-d6) δ 7.84-7.78 (m,2H),7.72 (t,J=5.4Hz,3H),7.45 (br,1H),7.40-7.39 (m,2H),7.33-7.30 (m,2H),7.28-7.20 (m,5H),5.22 (d,J=3.4Hz,3H),4.99-4.95 (m,3H),4.64-4.62 (m,3H),4.49 (d,J=8.4Hz,2H),4.03 (s,9H),3.91-3.84 (m,5H),3.74 (s,6H),3.72-3.68 (m,3H),3.45-3.41 (m,2H),3.40-3.34 (m,4H),3.28-3.16 (m,4H),3.01-2.99 (m,11H),2.85-2.67 (m,4H),2.34-2.32 (m,2H),2.27-2.22 (m,6H),2.07-2.00 (m,17H),1.89 (s,9H),1.78 (s,9H),1.64-1.56 (m,4H),1.55-1.34 (m,36H),1.28-1.21(m,16H).

[0478] Example 19 [ka]

[0479] Compound 19-1: Compound 11-11 (1.59 g, 832.24 μmol) (3.2 g, 7.16 mmol) and compound 5-9 (500 mg, 832.24 μmol) were dissolved in DCM (50 mL). DIEA (215.12 mg, 1.66 mmol, 289.92 μL), EDCI (239.31 mg, 1.25 mmol), and HOBT (112.45 mg, 832.24 μmol) were added to the mixture. The reaction was stirred at room temperature overnight. The reaction mixture was quenched with water (40 mL), extracted with DCM (50 mL x 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by HPLC to give compound 19-1 (840 mg, 36% yield).

[0480] C 127 H189 N 11 O 39 Calculated mass: 2492.3, Measured mass: 1258.4 [M+2Na] 2+ ,ESI.

[0481] 1 H NMR (400MHz,DMSO-d6) δ 7.85-7.71 (m,7H),7.49 (s,1H),7.37-7.20 (m,9H),6.82-6.87 (m,J=8.8Hz,4H),5.22 (d,J=3.2Hz,3H),4.97 (d,J=11.6Hz,3H),4.49-4.46 (m,6H),4.05 (s,9H),3.91-3.85 (m,5H),3.77-3.62 (m,11H),3.41 (s,6H),3.01-2.71 (m,14H),2.32-2.25 (m,6H),2.11-1.78 (m,48H),1.62-1.34 (m,37H), 1.26-1.21 (m,20H).

[0482] Example 20 [ka]

[0483] Compound 20-1a: Compound 11-11 (554 mg, 289.73 μmol) was dissolved in DCM (20 mL). At 0 °C, DIEA (112 mg, 869.18 μmol), EDCI (222 mg, 1.16 mmol), and HOBT (157 mg, 1.16 mmol) were added to the mixture. The reaction was stirred at 0 °C for 30 min. Compound 7-9a (170 mg, 289.73 μmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 2 h. The reaction was quenched with saturated NaHCO solution (40 mL), extracted with DCM (30 mL × 2), washed with brine (30 mL), dried over NaSO, concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 20-1a (640 mg, 89% yield) as a white foamy solid.

[0484] 1H NMR (400MHz,DMSO-d6) δ 7.86-7.76 (m,4H),7.72 (t,J=5.4Hz,3H),7.49-7.42 (m,1H),7.38 (d,J=8.6Hz,2H),7.31 (t,J=7.7Hz,2H),7.27-7.19 (m,5H),6.88 (d,J=8.9Hz,4H),5.21 (d,J=3.4Hz,3H),4.96 (dd,J=11.2,3.4Hz,3H),4.65 (t,J=5.0Hz,1H),4.50-4.41(m,5H),4.05-3.99 (m,9H),3.91-3.82 (m,5H),3.76-3.66 (m,9H),3.49-3.36 (m,6H),3.32-3.28 (m,1H),3.23-3.09 (m,2H),3.08-2.91(m,10H),2.84 (s,2H),2.44-2.21 (m,8H),2.20-1.92 (m,30H),1.88 (s,9H),1.77 (s,9H),1.70-1.08 (m,54H).

[0485] Compound 20-1b: Compound 11-11 (1.3 g, 681.71 μmol) was dissolved in DCM (20 mL). At 0 °C, DIEA (176 mg, 1.36 mmol), EDCI (261 mg, 1.36 mmol), and HOBT (138 mg, 1.02 mmol) were added to the mixture. The reaction was stirred at 0 °C for 30 min. Compound 7-9b (400 mg, 681.71 μmol) was added to the reaction mixture. The reaction mixture was stirred at room temperature for 2 h.

[0486] The reaction mixture was quenched with saturated NaHCO3 solution (40 mL), extracted with DCM (30 mL x 2), washed with brine (30 mL), dried over Na2SO4, concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 20-1b (610 mg, 36% yield) as a white foamy solid.

[0487] 1H NMR (400MHz,DMSO-d6) δ: 7.87-7.76 (m,4H),7.72 (t,J=5.3Hz,3H),7.46 (s,1H),7.35(d,J=7.4Hz,2H),7.28 (t,J=7.6Hz,2H),7.25-7.18 (m,5H),6.86 (d,J=8.9Hz,4H),5.21 (d,J=3.4Hz,3H),4.96 (dd,J=11.2,3.4Hz,3H),4.62 (t,J=5.0Hz,1H),4.50-4.38 (m,5H),4.07-3.98 (m,9H),3.92-3.82 (m,5H),3.75-3.66 (m,9H),3.51-3.36 (m,6H),3.29-3.23 (m,2H),3.15-3.07 (m,2H),3.01-2.94 (m,10H),2.93-2.88 (m,2H),2.87-2.78 (m,2H),2.68-2.60 (m,1H),2.37-2.23 (m,2H),2.29-2.19 (m,4H),2.13-2.08 (m,10H),2.07-1.98 (m,18H),1.88 (s,9H),1.77 (s,9H),1.71-1.58 (m,6H),1.53-1.13 (m,48H).

[0488] Example 21 [ka]

[0489] Compound 21-1: Compound 11-11 (1.76 g, 920.31 μmol), HOBt (248.70 mg, 1.84 mmol), and EDCI (529.27 mg, 2.76 mmol) were dissolved in DCM (20 mL). The mixture was stirred for 30 min, and compound 8-9 (540 mg, 920.31 μmol) was added. The reaction mixture was stirred for another 2 h, and then concentrated and purified by preparative HPLC to give compound 21-1 (1.2 g, 53% yield).

[0490] C 126 H 187 N 11 O 39Calculated mass value: 2478.3, measured value: 1089.6 [M-DMTr+2H] 2+ ,ESI.

[0491] 1 H NMR (400MHz, DMSO-d6) δ 7.84-7.80 (m,4H),7.72 (t,J=5.4Hz,3H),7.39 (s,1H),7.40-7.37 (m,2H),7.31 (t,J=7.7Hz ,2H),7.27-7.20 (m,5H),6.98 (d,J=8.9Hz,4H),5.22 (d,J=3.4Hz,3H),4.97 (dd,J=3.4,7.8Hz,3H),4.67 (t,J=4.8Hz,1H),4.48 (d,J=8.5Hz,3H),4.47-4.42 (m,2H),4.05-3.98 (m,9H),3.92-3.83 (m,5H),3.73 (s,6H),3.72-3.67 (m,3H),3.55-3.45 (m,2H),3.44-3.35 (m,5H),3.05-2.93 (m,11H),2.91-2.80 (m,3H),2.65-2.55 (m,2H),2.38-2.20 (m,9H),2.10 (s,9H),2.08-2.01 (m,9H),2.00 (s,9H),1.89 (s,9H),1.78 (s,9H),1.69-1.52 (m,6H),1.47-0.98 (m,48H).

[0492] Example 22

change

[0493] Compound 22-1: Compound 6-10 (410 mg, 0.71 mmol) and compound 11-11 (1.34 g, 0.71 mmol) were dissolved in DCM (60 mL), and DIEA (453.09 mg, 3.51 mmol), EDCI (299.57 mg, 1.75 mmol), and HOBT (236.85 mg, 1.75 mmol) were added to the solution. The reaction mixture was stirred at room temperature for 2 h. The reaction was quenched with saturated NaHCO3 solution (100 mL), extracted with DCM (60 mL x 3), washed with brine (60 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance Al2O3 column chromatography (0% to 20% MeOH) to give compound 22-1 (1.2 g, 69% yield) as a white foamy solid.

[0494] C 126 H 185 N 11 O 39 Calculated mass: 2476.28, Measured mass: 1088.2 [M-DMTr+2H] 2+ ,ESI.

[0495] 1 H NMR (400MHz,DMSO-d6) δ 7.85-7.81 (m,3H),7.75-7.72 (m,3H),7.47 (s,H),7.39-7.37 (m,2H),7.32-7.25 (m,2H),7.24-7.19 (m,5H),6.88 (d,J=8.84Hz,4H),5.22 (d,J=3.4Hz,2H),4.97 (d,J=11.2Hz,3H),4.75 (t,J=4.4Hz,1H),4.50-4.48 (m,5H),4.03 (s,11H),3.94-3.80 (m,7H),3.77-3.66 (m,9H),3.50-3.41 (m,6H),3.02-3.00 (m,12H),2.92-2.79 (m,2H),2.43-2.30 (m,2H),2.29-2.22 (m,2H),2.21-2.19 (m,3H),2.11-2.08 (m,11H),2.05-2.02 (m,8H),2.00 (s,9H),1.90 (s,9H),1.78 (s,9H),1.62-1.23 (m,48H).

[0496] Example 23 [ka]

[0497] Compound 23-1: A solution of N-Boc-4-piperidone (5 g, 25.09 mmol), malononitrile (2.49 g, 37.64 mmol), AcNH (3.87 g, 50.19 mmol), and AcOH (4.52 g, 75.28 mmol) in toluene (50 mL) was stirred at 110 °C for 2 h. LC-MS showed complete conversion. The reaction mixture was washed with water (50 mL), dried over NaSO, concentrated, and purified by silica gel column chromatography (0% to 10% EA in PE) to give compound 23-1 (6.18 g, 98% yield) as a gel.

[0498] C 13 H 17 Calculated mass of O2N3: 247.1, Measured mass: 246.2 [MH] - ,ESI.

[0499] 1 H NMR (400MHz,DMSO-d6) δ 3.53 (t,J=11.6Hz,4H),2.69 (d,J=11.6Hz,4H),7.41 (t,J=7.3Hz,2H),1.427 (s,9H).

[0500] Compound 23-2: A solution of compound 23-1 (7.6 g, 30.73 mmol) in MeOH (76 mL) was stirred at 0 °C. NaBH (1.16 g, 30.73 mmol) was added portionwise to the stirred solution and stirred for 20 min. The mixture was concentrated in vacuo. The residue was partitioned between ethyl acetate (250 mL) and water (150 mL), and the ethyl acetate extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with PE / EA = 1 / 5 to give compound 23-2 (4.6 g, 60% yield) as a gel.

[0501] C 13 H 19 Calculated mass of O2N3: 249.2, Measured mass: 248.3 [MH] - ,ESI.

[0502] 1 H NMR (400MHz,DMSO-d6) δ 4.04-4.01 (m,2H),2.75 (s,2H),2.31-2.27 (m,1H),1.82-1.78 (m,2H),1.04 (s,9H),1.27-1.16 (m,3H).

[0503] Compound 23-3: A mixture of compound 23-2 (25 g, 100.28 mmol), tert-butyl 3-bromopropionate (41.93 g, 200.56 mmol), t-BuOK (22.50 g, 200.56 mmol), and KI (33.29 g, 200.56 mmol) in DMSO (250 mL) was stirred at 60 °C overnight. LC-MS showed complete conversion. The mixture was concentrated in vacuo. The residue was partitioned between ethyl acetate (100 mL × 3) and water (150 mL × 3), and the ethyl acetate extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with PE / EA = 10 / 1 to give compound 23-3 (32.87 g, 87% yield) as a gel.

[0504] C 20 H 31 Calculated mass of O4N3: 377.2, Measured mass: 319.4 [M-Boc+MeCN+H] + ,ESI.

[0505] 1 H NMR (400MHz,DMSO-d6) δ 4.06 (d,J=11.2Hz,2H),2.75 (s,2H),2.55-2.53 (m,1H),2.35-2.31 (m,3H),1.89 (d,J=12.4Hz,2H),1.43 (s,9H),1.41 (s,9H),1.27-1.19 (m,3H).

[0506] Compound 23-4: Cobalt chloride hexahydrate (40.34 g, 169.55 mmol) was added to a solution of compound 23-3 (16 g, 42.39 mmol) in MeOH (400 mL), and sodium borohydride (32.07 g, 847.73 mmol) was slowly added to the reaction mixture at −20° C. and stirred for 1 h. The mixture was then stirred at room temperature for 1 h. The reaction mixture was concentrated to dryness and azeotropically dried with DMF to give crude compound 23-4, which was used directly in the next step without purification.

[0507] C 20 H 39 Calculated mass of O4N3: 385.5, Measured mass: 386.5 [M+H] + ,ESI.

[0508] Compound 23-5: A solution of Z-6-aminocaproic acid (27.53 g, 103.75 mmol), TEA (12.6 g, 124.50 mmol), and HATU (46.97 g, 124.50 mmol) in DMF (240 mL) was stirred at room temperature for 30 min. Compound 23-4 (16 g, 41.50 mmol) was added and stirred at room temperature overnight. LC-MS showed complete conversion. Water (50 mL) and EA (50 mL) were added to the reaction mixture. The mixture was filtered, and the filtrate was partitioned between ethyl acetate (100 mL × 3) and water (150 mL × 3). The ethyl acetate extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by preparative HPLC (C18 column, ACN / water) to give compound 23-5 (8.3 g, 23% yield) as a gel.

[0509] C 48 H 72 O 11 Calculated mass of N4: 879.5, Measured mass: 880.1 [M+H] + ,ESI.

[0510] 1H NMR (400MHz,DMSO-d6) δ 7.73 (t,J=12.4Hz,2H),7.38-7.30 (m,10H),7.23 (t,J=10.8Hz,2H),5.00 (s,4H),4.06-3.60 (m,4H),3.00-2.97 (m,8H),2.23-2.19 (m,4H),1.99 (s,2H),1.58-1.48 (m,6H),1.42-1.38 (m,25H),1.25-1.23 (m,4H).

[0511] Compound 23-6: At room temperature, a mixture of compound 23-5 (3.8 g, 4.31 mmol), NH3.HO (3.5 mL), and Pd / C (760 mg) in MeOH (38 mL) was stirred under a hydrogen gas atmosphere for 2 h. LC-MS showed complete conversion. The mixture was filtered, and the filtrate was concentrated in vacuo to give crude compound 23-6, which was used directly in the next step without purification.

[0512] C 32 H 60 Calculated mass of N4O7: 611.8, Measured mass: 612.8 [M+H] + ,ESI.

[0513] Compound 23-7: A mixture of compound 1-4 (2.46 g, 5.49 mmol), TEA (757.89 mg, 7.49 mmol), and HATU (2.35 mg, 6.24 mmol) in DCM (15 mL) was stirred at room temperature for 30 min. Compound 23-6 (1.53 g, 2.5 mmol) was added, and the mixture was stirred at room temperature overnight. LC-MS showed complete conversion. The reaction mixture was diluted by adding DCM (20 mL) and washed with water (50 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 23-7 (3.14 g, 85% yield).

[0514] 1H NMR (400MHz,DMSO-d6) δ 7.82 (d,J=9.2Hz,2H),7.71 (s,4H),5.52 (d,J=0.4Hz,2H),4.99-4.95 (m,2H),4.48 (d,J=8.8Hz,2H),4.03 (s,8H),3.95-3.84 (m,2H),3.72-3.70 (m,2H),3.44-3.38 (m,2H),3.01-2.99 (m,8H),2.23-2.19 (m,2H),2.11-2.07 (m,10H),2.05-2.00 (m,10H),1.90 (s,6H),1.78 (s,6H),1.58-1.49 (m,14H),1.39-1.38 (m,25H),1.24-1.23 (m,8H).

[0515] Compound 23-8: A solution of compound 23-7 (3.0 g, 2.04 mmol) and TFA (12 mL) in DCM (30 mL) was stirred at room temperature for 4 h. LC-MS showed complete conversion. The solution was concentrated in vacuo and basified by adding TEA. Compound 23-8 was used directly in the next step without purification.

[0516] C 61 H 99 O 24 Calculated mass of N7: 1313.4, Measured mass: 1314.4 [M+H] + ,ESI.

[0517] Compound 23-9: Compound 1-7 (2.68 g, 2.04 mmol), TEA (412.62.89 mg, 4.08 mmol), and HATU (769.19 mg, 2.04 mmol) in DCM (30 mL) were stirred at room temperature for 4 h. The solution was then added to compound 23-8 (2.68 g, 2.04 mmol) and stirred at room temperature overnight. LC-MS showed complete conversion. The reaction mixture was diluted by adding DCM (20 mL), washed with water (50 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 23-9 (1.76 g, 47% yield).

[0518] C 86 H 137 O 35 Calculated mass of N9: 1857.0, Measured mass: 929.0 [M+2H] 2+ ,ESI.

[0519] 1 H NMR (400MHz,DMSO-d6) δ 7.94 (d,J=9.2Hz,2H),7.88-7.79 (m,6H),5.21 (d,J=3.2Hz,3H),4.99-4.95 (m,3H),4.51-4.48 (m,4H),4.05-4.00 (m,9H),3.92-3.84 (m,4H),3.73-3.37 (m,3H),2.99 (s,10H),2.81 (t,J=23.2Hz,1H),2.48-2.44 (m,2H),2.34-2.16 (m,6H),2.11-2.09 (m,13H),2.05-2.00 (m,16H),1.89 (s,9H),1.78 (s,9H),1.49-1.35 (m,31H),1.24-1.23 (m,6H).

[0520] Compound 23-10: A mixture of compound 23-9 (1.76 g, 0.94 mmol), DIEA (367.47 mg, 2.84 mmol), HOBT (256.12 mg, 1.90 mmol), and EDCI (363.37 mg, 1.90 mmol) in DCM (20 mL) was stirred at 0 °C for 1 h, and compound 11-2 (542.80 mg, 0.94 mmol) was added. The mixture was stirred at room temperature overnight. LC-MS showed complete conversion. The reaction mixture was diluted by adding DCM (20 mL), washed with NaHCO (saturated aqueous solution, 50 mL) and water (50 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 23-10 (1.07 g, 47% yield).

[0521] 1H NMR (400MHz,DMSO-d6) δ 7.83 (d,J=9.2Hz,3H),7.76-7.65 (m,6H),7.40-7.30 (m,4H),7.26-7.22 (m,5H),6.92-6.89 (m,4H),5.22 (d,J=0.8Hz,3H),4.99-4.95 (m,3H),4.65 (d,J=10.4Hz ,1H),4.49 (d,J=8.4Hz ,4H),4.03-3.98 (m,10H),3.91-3.89 (m,4H),3.74-3.67 (m,11H),3.51 (s,1H),3.41-3.39 (m,5H),3.01-2.92 (m,14H),2.27 -2.25 (m,14H),2.05-2.02 (m,7H),2.00-1.94 (m,12H),1.78 (s,9H),1.49-1.37 (m,33H),1.24-1.22 (m,11H).

[0522] Example 24 [ka]

[0523] Compound 24-1: 4-Pyridylacetonitrile (5 g, 42.32 mmol), N-Cbz-4-iodopiperidine (21.91 g, 63.49 mmol), and KOH (4.75 g, 84.64 mmol) were dissolved in DMF (50 mL). The reaction mixture was stirred at room temperature overnight. LC-MS showed complete conversion. The residue was partitioned between ethyl acetate (100 mL × 2) and water (80 mL × 3), and the ethyl acetate extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with DCM / MeOH = 20 / 1 to give compound 24-1 (11.3 g, 80% yield) as a light brown oil.

[0524] C 20 H 21 Calculated mass of N3O2: 335.4, Measured mass: 336.2 [M+H] + ,ESI.

[0525] 1 H NMR (400MHz,DMSO-d6) δ 8.62-8.61 (m,2H),7.40-7.31 (m,7H),5.06 (s,2H),4.35 (d,J=7.2Hz,1H),4.34-4.00 (m,2H),2.75 (s,2H),2.12-2.06 (m,1H),1.64-1.53 ​​(m,2H),1.24-1.14 (m,2H).

[0526] Compound 24-2: KI (2.97 g, 17.89 mmol) and NaH (858.6 mg, 35.78 mmol) in anhydrous THF (10 mL) were cooled at 0 °C under N atmosphere for 10 min. Compound 24-1 (3 g, 8.94 mmol) in anhydrous THF (15 mL) was added. The mixture was stirred for 30 min. N-(chloromethyl)carbamic acid benzyl ester (2.14 g, 10.73 mmol) in anhydrous THF (5 mL) was then added and stirred at room temperature under N atmosphere overnight. The mixture was quenched with water and extracted with ethyl acetate (50 mL × 3). The combined organic layer was washed with brine (60 mL), dried over anhydrous MgSO and concentrated in vacuo. The residue was purified by column chromatography eluting with dichloromethane / methanol 4:1 to give compound 24-2 (1.8 g, 40% yield) as a yellow oil.

[0527] C 29 H 30 Calculated mass of N4O4: 498.2, Measured mass: 499.2 [M+H] + ,ESI.

[0528] 1H NMR (400MHz,DMSO) δ 8.61 (d,J=5.2Hz,2H),7.52-7.57 (m,1H),7.44-7.22 (m,12H),5.06 (s,2H),5.03-4.91 (m,2H),4.14 (d,J=13.6Hz,1H),3.97-3.89 (m,2H),3.73-3.68 (m,1H),2.89-2.68 (m,2H),2.39-2.34 (t,J=11.6Hz,1H),2.07 (d,J=11.8Hz,2H),1.31-1.21 (m,1H),1.18-1.12 (m,1H),1.04-0.94 (m,1H).

[0529] Compound 24-3: CoCl2.6H2O (2.97 g, 17.89 mmol) and compound 24-2 (5 g, 10.03 mmol) in anhydrous MeOH (50 mL) were cooled at −50 °C under N2 atmosphere for 20 min. LiBH4 (50 mmol, 2 M, 25 mL) in THF was added dropwise at −50 °C and stirred for 3 h. Anhydrous MeOH (50 mL) was then added dropwise at −50 °C. The mixture was allowed to warm to room temperature and stirred overnight under N2 atmosphere. The mixture was concentrated in vacuo. The residue was partitioned between dichloromethane (250 mL) and water (150 mL), and the dichloromethane extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with DCM / MeOH = 15 / 1 to give compound 24-3 (1.8 g, 40% yield) as a pale yellow solid.

[0530] C 29 H 34 Calculated mass of N4O4: 502.2, Measured mass: 503.2 [M+H] + ,ESI.

[0531] 1H NMR (400MHz,DMSO-d6) δ 8.48 (d,J=5.2Hz ,2H),7.50-7.47 (m,1H),7.37-7.25 (m,12H),5.02 (s,2H),4.99 (s,2H),3.96 (d,J=12.4Hz ,2H),3.69-3.58 (m,2H),3.16 (d,J=14Hz,1H),2.94 (d,J=13.2Hz ,1H),2.63 (s,2H),1.93 (s,2H),1.77-1.68 (m,2H),1.26 (d,J=8.8Hz ,1H),0.86-0.77 (m,2H).

[0532] Compound 24-4: Compound 24-3 (2.1 g, 4.18 mmol), 5-(tert-butoxy)-5-oxopentanoic acid (943.7 mg, 5.01 mmol), HATU (3.15 g, 8.36 mmol), and EtN (1.27 g, 12.53 mmol) were dissolved in DCM (20 mL). The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was then diluted with CHCl (50 mL). The organic layer was washed with water (50 mL × 2), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with DCM / MeOH = 20 / 1 to give compound 24-4 (2.23 g, 81% yield) as a pale yellow solid.

[0533] C 38 H 48 Calculated mass of N4O7: 672.3, Measured mass: 673.3 [M+H] + ,ESI.

[0534] 1 H NMR (400MHz,DMSO-d6) δ 8.48 (d,J=5.2Hz,2H),7.83-7.79 (m,1H),7.36-7.21 (m,13H),5.01 (s,2H),4.98 (s,2H),3.96 (d,J=12.4Hz,2H),3.65-3.52 (m,4H),2.68-2.62 (m,2H),2.12-2.09 (m,4H),1.77-1.69 (m,5H),1.35 (s,9H),0.76-0.64 (m,2H).

[0535] Compound 24-5: PtO (1.21 g, 5.36 mmol) and compound 24-4 (1.8 g, 2.67 mmol) in HOAc (10 mL) were stirred under H atmosphere at room temperature overnight, and the mixture was filtered and the solvent was evaporated in vacuo to give crude product 24-5, which was used directly in the next step.

[0536] C 22 H 42 Calculated mass of N4O3: 410.3, Measured mass: 411.3 [M+H] + ,ESI.

[0537] Compound 24-6: A mixture of compound 1-7 (4.76 g, 8.52 mmol), TEA (1.48 g, 14.6 mmol), and HATU (2.94 g, 7.8 mmol) in DCM (15 mL) was stirred at room temperature for 30 min, and compound 24-5 (1 g, 2.44 mmol) was added and stirred at room temperature for 2 h. LC-MS showed complete conversion. The reaction mixture was diluted with another 20 mL of DCM, washed with water (50 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 24-6 (1 g, 20% yield) as a white solid.

[0538] C 97 H 156 N 10 O 36 Calculated mass: 2037.07, Measured mass: 1019.1 [M+2H] 2+ ,ESI.

[0539] 1H NMR (400MHz,DMSO-d6) δ 7.80 (d,J=9.2Hz,3H),7.73-7.63(m,6H),5.22 (d,J=3.2Hz,3H),4.97 (dd,J=11.2,3.2Hz,3H),4.50-4.47 (m,5H),4.08-4.01 (m,9H),3.91-3.86 (m,5H),3.84-3.70 (m,3H),3.43-3.40 (m,3H),3.07-3.05 (m,3H),2.81 (d,J=9.2Hz,2H),2.68-2.67(m,1H),2.34-2.23 (m,12H),2.18 (s,9H),2.16-2.11(m,5H),2.03 (s,9H),1.90 (s,9H),1.78 (s,9H),1.72-1.67 (m,14H),1.54-1.48 (m,18H),1.43-1.37 (m,13H),1.28-1.18 (m,12H).

[0540] Compound 24-7: A solution of compound 24-6 (1.0 g, 0.49 mmol) and TFA (12 mL) in DCM (30 mL) was stirred at room temperature for 4 h. LC-MS showed complete conversion. The solution was concentrated in vacuo and basified with TEA. Crude compound 24-7 was used directly in the next step without purification.

[0541] C 93 H 148 N 10 O 36 Calculated mass: 1981.0, Measured mass: 991.4 [M+2H] 2+ ,ESI.

[0542] Compound 24-8: A mixture of compound 24-7 (400 mg, 0.21 mmol), TEA (61.26 mg, 0.61 mmol), and HATU (252.26 mg, 0.40 mmol) in DCM (5 mL) was stirred at room temperature for 1 h, and then compound 11-2 (115.16 mg, 0.20 mmol) was added and stirred at room temperature overnight. LC-MS showed complete conversion. The reaction mixture was diluted with another 5 mL of DCM, washed with water (20 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 24-8 (200 mg, 39% yield) as a white solid.

[0543] 1 H NMR (400MHz,DMSO-d6) δ 7.83 (d,J=9.2Hz,3H),7.76-7.66 (m,5H),7.40-7.30 (m,4H),7.26-7.22 (m,5H),6.92-6.88 (m,4H),5.22 (d,J=3.2Hz ,3H),4.99-4.95 (m,3H),4.66 (t,J=5.6Hz ,1H),4.48 (d,J=8.4Hz ,4H),4.43-4.42 (m,1H),4.05-3.97 (m,9H),3.91-3.86 (m,5H),3.74-3.62 (m,11H),3.51(s,1H),3.43-3.38 (m,5H),3.06-2.92 (m,13H),2.86-2.82 (m,2H),2.34-2.22 (m,6H),2.11 (s,9H),2.08-2.06 (m,3H),2.05-2.02 (m,8H),2.00 (s,9H),1.96-1.94 (m,3H),1.89 (s,9H),1.85-1.82 (m,3H),1.78 (s,9H),1.72-1.62 (m,5H),1.52-1.42 (m,18H),1.39-1.33 (m,8H),1.28-1.22 (m,9H),0.95 (t,J=8.4Hz,1H).

[0544] Example 25 [ka]

[0545] Compound 25-1: A solution of N-Boc-piperidine-4-pyrrolecarboxaldehyde (50 g, 234.44 mmol), malononitrile (18.59 g, 281.33 mmol), and diisopropylamine (11.86 g, 117.21 mmol) in HO (200 mL) and EtOH (800 mL) was stirred at room temperature for 2 h. LC-MS showed complete conversion. The reaction mixture was washed with water (50 mL), dried over NaSO, concentrated, and purified by silica gel column chromatography (0% to 50% EA in PE) to give compound 25-1 (30.00 g, 46% yield).

[0546] C 14 H 19 Calculated mass of N3O2: 261.1, Measured mass: 260.2 [MH] - ,ESI.

[0547] 1 H NMR (400MHz,DMSO-d6) δ 7.84 (d,J=10.2Hz,1H),3.97-3.89 (m,2H),2.94-2.72 (m,3H),1.69-1.59 (m,2H),1.45-1.34 (m,13H).

[0548] Compound 25-2: Compound 25-1 (30 g, 114.80 mmol) was stirred in MeOH (450 mL) at −5° C. NaBH (4.34 g, 114.80 mmol) was added portionwise to the solution and stirred for 3 h. The mixture was concentrated in vacuo. The residue was partitioned between ethyl acetate (250 mL) and water (150 mL), and the ethyl acetate extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with PE / EA=3 / 1 to give compound 25-2 (19.4 g, 64% yield).

[0549] C 14 H 21 Calculated mass of N3O2: 263.2, Measured mass: 262.3 [MH] - ,ESI.

[0550] 1 H NMR (400MHz,DMSO-d6) δ 4.87 (t,J=7.6Hz,1H),3.95-3.87 (m,2H),2.82-2.61 (m,2H),1.98 (t,J=7.2Hz,2H),1.70-1.56 (m,3H),1.42-1.35 (m,9H),1.11-0.98 (m,2H).

[0551] Compound 25-3: A mixture of compound 25-2 (15 g, 56.96 mmol), tert-butyl 3-bromopropionate (17.86 g, 85.44 mmol), t-BuOK (8.31 g, 74.05 mmol), and KI (9.46 g, 56.96 mmol) in DMSO (250 mL) was stirred at room temperature for 3 h. LC-MS showed complete conversion. The mixture was partitioned between ethyl acetate (100 mL × 3) and water (150 mL × 3), and the ethyl acetate extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by column chromatography eluting with PE / EA = 7 / 1 to give compound 25-3 (17.4 g, 94% yield).

[0552] C 21 H 33 Calculated mass of N3O4: 391.2, Measured mass: 333.3 [M-Boc+MeCN+H] + ,ESI.

[0553] 1 H NMR (400MHz,DMSO-d6) δ 3.96-3.87(m,2H),2.76 (s,2H),2.55-2.50 (m,2H),2.36-2.31 (m,2H),2.05 (d,J=6.2Hz,2H),1.85-1.74 (m,3H),1.42 (s,9H),1.39 (s,9H),1.21-1.08 (m,2H).

[0554] Compound 25-4: Cobalt chloride hexahydrate (29.17 g, 122.60 mmol) was added to a solution of compound 25-3 (12 g, 30.65 mmol) in MeOH (350 mL), and sodium borohydride (23.19 g, 613.02 mmol) was slowly added to the reaction mixture at −20° C. and stirred for 1 h. The mixture was then stirred at room temperature for 1 h. The reaction mixture was concentrated to dryness and azeotropically dried with DMF. Crude compound 25-4 was used directly in the next step without purification.

[0555] C 21 H 41 Calculated mass of N3O4: 399.3, Measured mass: 400.4 [M+H] + ,ESI.

[0556] Compound 25-5: A solution of Z-6-aminocaproic acid (17.52 g, 66.04 mmol), TEA (9.10 g, 90.05 mmol), and HATU (28.31 g, 75.04 mmol) in DMF (240 mL) was stirred at room temperature for 30 min, and compound 25-4 (12 g, 30.03 mmol) was added and stirred at room temperature overnight. LC-MS showed complete conversion. Water (50 mL) and EA (50 mL) were added to the reaction mixture. The mixture was filtered, and the filtrate was partitioned between ethyl acetate (100 mL × 3) and water (150 mL × 3). The ethyl acetate extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by preparative HPLC (C18 column, ACN / water) to give compound 25-5 (4.08 g, 14% yield).

[0557] C 49 H 75 N5O 10 Calculated mass: 893.6, Measured mass: 894.7 [M+H] + ,ESI.

[0558] 1H NMR (400MHz,DMSO-d6) δ 7.68 (t,J=6.1Hz,2H),7.38-7.27 (m,10H),7.22 (t,J=5.5Hz,2H),4.99 (s,4H),3.89-3.79 (m,2H),3.00-2.93 (m,4H),2.92-2.85 (m,3H),2.73-2.56 (m,2H),2.23-2.16 (m,2H),2.13-2.06 (m,4H),1.61-1.42 (m,9H),1.42-1.34 (m,24H),1.28-1.18 (m,4H),1.05-0.99 (m,2H).

[0559] Compound 25-6: At room temperature, a mixture of compound 25-5 (3.0 g, 3.36 mmol), NH3.HO (15 mL), and Pd / C (1.20 g) in MeOH (60 mL) was stirred under a hydrogen gas atmosphere for 4 h. LC-MS showed complete conversion. The mixture was filtered, and the filtrate was concentrated in vacuo. Crude compound 25-6 was used directly in the next step without purification.

[0560] C 33 H 63 Calculated mass of N5O6: 625.5, Measured mass: 626.5 [M+H] + ,ESI.

[0561] Compound 25-7: A mixture of compound 1-4 (3.30 g, 7.38 mmol), TEA (1.02 g, 10.07 mmol), and HATU (3.04 g, 8.05 mmol) in DCM (15 mL) was stirred at room temperature for 30 min. Compound 25-6 (2.10 g, 3.36 mmol) was added and stirred at room temperature overnight. LC-MS showed complete conversion. The reaction mixture was diluted by adding DCM (20 mL) and washed with water (50 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 25-7 (3.14 g, 86% yield).

[0562] 1H NMR (400MHz,DMSO-d6) δ 7.82 (d,J=9.3Hz,2H),7.74-7.65 (m,4H),5.21 (d,J=3.4Hz,2H),4.99-4.93 (m,2H),4.48 (d,J=8.5Hz,2H),4.05-3.98 (m,6H),3.91-3.80 (m,4H),3.74-3.67 (m,2H),3.44-3.36 (m,2H),3.03-2.95 (m,4H),2.91-2.86 (m,3H),2.73-2.60 (m,2H),2.24-2.17 (m,2H),2.13-2.07 (m,10H),2.05-1.98 (m,10H),1.89 (s,6H),1.71 (s,6H),1.61-1.32 (m,41H),1.27-1.19 (m,4H),1.04-0.99 (m,2H).

[0563] Compound 25-8: A solution of compound 25-7 (1.0 g, 673.53 μmol) and TFA (10 mL) in DCM (20 mL) was stirred at room temperature for 4 h. LC-MS showed complete conversion. The solution was concentrated in vacuo and basified with TEA. Crude compound 25-8 was used directly in the next step without purification.

[0564] C 62 H 101 N7O 24 Calculated mass: 1327.7, Measured mass: 665.0 [M+2H] 2+ ,ESI.

[0565] Compound 25-9: A mixture of compound 1-7 (1.43 g, 2.56 mmol), TEA (777 mg, 7.68 mmol), and HATU (1.06 g, 2.82 mmol) in DCM (30 mL) was stirred at room temperature for 30 min. The solution was then added to compound 22-8 (3.4 g, 2.56 mmol) and stirred at room temperature overnight. LC-MS showed complete conversion. The reaction mixture was diluted by adding DCM (20 mL), washed with water (50 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 25-9 (2.5 g, 49% yield).

[0566] C 87 H 139 N9O 35 Calculated mass: 1869.9, Measured mass: 936.3 [M+2H] 2+ ,ESI.

[0567] 1 H NMR (400MHz,DMSO-d6) δ 7.96-7.90 (m,2H),7.87-7.75 (m,5H),7.71 (s,1H),5.21 (d,J=3.4Hz,3H),4.99-4.94 (m,3H),4.52-4.47 (m,3H),4.32-4.25 (m,1H),4.05-3.98 (m,9H),3.92-3.82 (m,3H),3.80-3.67 (m,5H),3.52-3.42 (m,4H),3.03-2.91 (m,10H),2.89-2.80 (m,2H),2.24 (t,J=7.5Hz,2H),2.20-2.13 (m,2H),2.13-2.07 (m,13H),2.05-1.96 (m,15H),1.89 (s,9H),1.77 (s,9H),1.68-1.55 (m,4H),1.54-1.32 (m,26H),1.28-1.18 (m,6H),1.04-0.98 (m,2H).

[0568] Compound 25-10: A mixture of compound 25-9 (750 mg, 400.84 μmol), DIEA (155 mg, 1.20 mmol), HOBT (217.12 mg, 1.60 mmol), and EDCI (307.36 mg, 1.06 mmol) in DCM (20 mL) was stirred for 30 min, and compound 11-2 (229.57 mg, 400.84 μmol) was added and stirred at room temperature for 3 h. LC-MS showed complete conversion. The reaction mixture was diluted by adding DCM (20 mL), washed with NaHCO (saturated aqueous solution, 30 mL) and water (30 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 25-10 (500 mg, 51% yield).

[0569] 1H NMR (400MHz,DMSO-d6) δ 7.83 (d,J=9.2Hz,3H),7.75-7.65 (m,6H),7.41-7.34 (m,2H),7.31 (t,J=7.1Hz,2H),7.27-7.18 (m,5H),6.93-6.84 (m,4H),5.22 (d,J=3.0Hz,3H),5.00-4.90 (m,3H),4.71-4.56 (m,1H),4.48 (d,J=8.4Hz,3H),4.28 (d,J=10.7Hz,1H),4.11-3.93 (m,10H),3.92-3.82 (m,3H),3.77-3.63 (m,12H),3.51 (s,1H),3.45-3.36 (m,6H),3.05-2.79 (m,15H),2.28-2.19 (m,2H),2.12-2.08 (m,12H),2.06-1.98 (m,17H),1.96-1.92 (m,3H),1.89 (s,9H),1.85-1.80 (m,2H),1.77 (s,9H),1.60-1.00 (m,47H).

[0570] Example 26 [ka]

[0571] Compound 26-1: A mixture of 5-(benzyloxy)-5-oxopentanoic acid (0.3 g, 1.35 mmol), compound 11-2 (773.14 mg, 1.35 mmol), DIEA (523.40 mg, 4.05 mmol), EDC (517.56 mg, 2.70 mmol), and HOBT (364.81 mg, 2.70 mmol) in DCM (20 mL) was stirred at room temperature for 3 h. LC-MS showed complete conversion. The reaction mixture was diluted by adding DCM (20 mL), washed with NaHCO (saturated aqueous solution, 150 mL) and water (150 mL), concentrated, and purified by column chromatography eluting with DCM / MeOH = 20:1 to give compound 26-1 (480 mg, 45% yield).

[0572] C 47 H56 Calculated mass of N2O8: 776.4, Measured mass: 799.3 [M+Na] + ,ESI.

[0573] Compound 26-2: A mixture of compound 26-1 (0.48 g, 0.629 mmol) and Pd / C (48 mg) in MeOH (20 mL) at room temperature was stirred under H for 3 h. LC-MS showed complete conversion. The reaction mixture was concentrated and purified by column chromatography, eluting with DCM / MeOH=10:1, to give compound 26-2 (280 mg, 65% yield).

[0574] C 47 H 56 Calculated mass of N2O8: 686.3, Measured mass: 725.3 [M+K] + ,ESI 1 H NMR (400MHz,DMSO-d6) δ 7.79-7.75 (m,1H),7.40-7.35 (m,2H),7.34-7.30 (m,2H),7.27-7.20 (m,5H),6.92-6.89 (m,4H),3.98 (s,1H),3.68 (d,J=6.4Hz,2H),3.51 (s,1H),3.40-3.38 (m,2H),3.00 (t,J=6.4Hz,2H),2.93-2.92 (m,2H),2.19 (t,J=7.4Hz,2H),2.09-2.05 (m,2H),2.03-1.88 (m,4H),1.85-1.80 (m,2H),1.71-1.68 (m,2H),1.42-1.33 (m,4H),1.24-1.18 (m,4H).

[0575] Compound 26-3: A mixture of compound 26-2 (3.1 g, 6.17 mmol) and Pd / C (2.97 g) in anhydrous MeOH (40 mL) at room temperature was stirred under H overnight. The mixture was filtered, and the filtrate was concentrated under reduced pressure to give crude compound 26-3 (1.4 g, 97% yield) as a white solid, which was used without purification.

[0576] Compound 26-4: A mixture of compound 26-3 (1.50 g, 6.40 mmol), compound 1-7 (11.12 g, 19.84 mmol), EDCI (7.34 g, 38.41 mmol), HOBT (5.19 g, 38.41 mmol), and DIEA (7.45 g, 57.61 mmol) in anhydrous DCM (50 mL) was stirred under N atmosphere for 3 h at room temperature. The mixture was concentrated in vacuo and extracted with dichloromethane (100 mL x 3), washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by preparative HPLC (C18 column, ACN / water) to give compound 26-4 (6 g, 50% yield) as a pale yellow solid.

[0577] C 88 H 136 N 10 O 33 Calculated mass: 1860.9, Measured mass: 931.5 [M+2H] 2+ ,ESI.

[0578] Compound 26-5: A mixture of compound 26-4 (1.01 g, 0.53 mmol) and PtO (0.243 g, 1.07 mmol) in AcOH (20 mL) was stirred under H overnight. The reaction mixture was filtered and concentrated in vacuo, and the residue was purified by preparative HPLC (C column, ACN / water) to give compound 26-5 (640 mg, 64% yield) as a white solid.

[0579] C 88 H 142 N 10 O 33 Calculated mass: 1867.0, Measured mass: 934.5 [M+2H] 2+ ,ESI.

[0580] 1H NMR (400MHz,DMSO-d6) δ 7.86-7.84 (m,3H),7.75-7.73 (m,3H),7.68-7.61 (m,2H),5.22 (d,J=3.3Hz,3H),4.97 (q,J=3.3Hz,3H),4.50-4.43 (m,4H),4.03 (s,9H),3.91-3.84 (m,4H),3.75-3.70 (m,3H),3.43-3.38 (m,11H),3.06-2.99 (m,12H),2.83-2.77 (m,1H),2.46-2.42 (m,2H),2.27-2.23 (m,4H),2.11-2.09 (m,13H),2.07-2.00 (m,16H),1.90 (s,9H),1.78 (s,9H),1.68-1.62 (m,5H),1.49-1.46 (m,22H),1.39-1.36 (m,9H),1.25-1.20(m,9H).

[0581] Compound 26-6: A mixture of compound 26-5 (0.543 g, 0.29 mmol), compound 26-2 (200 mg, 2.12 mmol), DIEA (112 mg, 0.87 mmol), EDC (111 mg, 0.58 mmol), and HOBT (80 mg, 0.58 mmol) in DCM (20 mL) was stirred at room temperature for 3 h. LC-MS showed complete conversion. The reaction mixture was diluted by adding DCM (20 mL), washed with NaHCO (saturated aqueous solution, 150 mL) and water (150 mL), concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 26-6 (0.15 g, 20% yield).

[0582] Calculated mass of C121H179O39N11: 3411.7, Measured mass: 1117.2 [M-DMTr+2H] 2+ ,ESI.

[0583] 1H NMR (400MHz, DMSO-d6) δ 7.84 (d,J=9.3Hz,3H),7.78-7.72 (m,5H),7.65 (s,2H),7.40-7.37 (m,2H),7.32 (t,J=7.1Hz,2H),7.26-7.20 (m,6H),6. 92-6.89 (m,4H),5.22 (d,J=3.4Hz,2H),4.98-4.95 (m,2H),4.65 (t,J=5.0Hz,1H),4.48 (d,J=8.4Hz,2H),4.45-4.42 (m,2H),4.05-4.03 (m,9H),3.98 (s,2H),3.91-3.84 (m,5H),3.74 (s,7H),3.71-3.67 (m,5H),3.51 (s,1H),3.43-3.39 (m,6H),3.07-2.97 (m,13H),2.92 (s,2H),2.81-2.78 (m,2H),2.34-2.22 (m,8H),2.13-2.07 (m,16H),2.05-1.96 (m,20H),1.89 (s,11H),1.79-1.77 (m,10H),1.70-1.62 (m,7H),1.47-1.41 (m,23H),1.40-1.35 (m,14H),1.24-1.22 (m,14H).

[0584] Example 27

change

[0585] Compound 27-1: A mixture of compound 11-6 (15 g, 45.81 mmol), Boc-8-aminooctanoic acid (13.07 g, 50.39 mmol), EtN (6.95 g, 68.72 mmol), and HATU (19.01 g, 50.39 mmol) was stirred at room temperature for 1 h. Diatomaceous earth (15 g), water (300 mL), and EA (400 mL) were added to the mixture. The reaction was stirred for 30 min and then filtered. The filtrate was extracted with EA (400 mL). The organic phase was washed with water (500 mL x 2) and brine (300 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance silica gel column chromatography (0% to 10% MeOH) to give compound 27-1 (15 g, 57% yield).

[0586] C 32 H 48 Calculated mass of N4O5: 568.3, Measured mass: 569.4 [M+H] + ,ESI.

[0587] 1 H NMR (400MHz,DMSO-d6) δ 8.49-8.48 (m,4H),7.46-6.77 (m,6H),3.89 (t,J=6.4Hz,2H),2.91-2.86 (m,2H),2.33-2.29 (m,2H),1.98-1.92 (m,4H),1.38 (s,22H),1.32-1.24 (m,6H).

[0588] Compound 27-2: To compound 27-1 (14.5 g, 25.49 mmol) in AcOH (120 mL) was added PtO2 (8 g, 35.23 mmol). The reaction was stirred under a 0.4 MPa hydrogen gas atmosphere for 88 h, and the clear liquid of the reaction mixture was poured off and concentrated in vacuo. The pH was adjusted to 7-8 with saturated NaHCO3. The aqueous phase was concentrated in vacuo. THF (300 mL) was added to the residue and stirred for 30 min. The mixture was filtered and concentrated in vacuo to give crude compound 27-2 (15.32 g). 32 H 60 Calculated mass of N4O5: 580.5, Measured mass: 581.6 [M+H] + ,ESI.

[0589] Compound 27-3: A mixture of Boc-6-aminocaproic acid (12.80 g, 55.38 mmol), HATU (23.87 g, 63.29 mmol), and TEA (8.0 g, 79.11 mmol) in DCM (60 mL) was stirred at room temperature for 1 h. Compound 27-2 (15.32 g, 26.37 mmol) in DCM (60 mL) was added to the reaction mixture and stirred at room temperature for 1.5 h. The reaction was quenched with water (200 mL) and extracted with DCM (200 mL x 3). The combined organic phase was washed with brine (200 mL), dried over Na2SO4, filtered, concentrated in vacuo, and purified by high-performance silica gel column chromatography (0% to 10% MeOH) to give compound 27-3 (23 g, 75% yield).

[0590] C 54 H 98 NO 11 Calculated mass: 1006.7, Measured mass: 907.7 [M+H-Boc] + ,ESI.

[0591] 1 H NMR (400MHz,DMSO-d6) δ 7.44-6.76 (m,4H),4.46 (d,J=11.6Hz,2H),3.89 (d,J=12.0Hz,2H),3.06-2.86 (m,10H),2.40-2.23 (m,12H),1.70-1.16 (m,68H).

[0592] Compound 27-4: Compound 27-3 (10 g, 9.93 mmol) was dissolved in DCM (54 mL), and TFA (59 mL) was added to the mixture. The reaction was stirred at 30 °C for 3 h. The reaction was concentrated in vacuo to give compound 27-4 (6.64 g) without further purification.

[0593] C 35 H 66 Calculated mass of N6O5: 650.5, Measured mass: 651.6 [M+H] + ,ESI.

[0594] Compound 27-5: A mixture of compound 1-4 (13.32 g, 29.77 mmol), HATU (13.10 g, 34.73 mmol), and TEA (5.02 g, 49.62 mmol, 6.92 mL) in DCM (50 mL) was stirred at room temperature for 2 h. Compound 27-4 was added to the mixture, and the reaction was stirred at room temperature for an additional 4 h. The reaction was concentrated in vacuo and purified by preparative HPLC to give compound 27-5 (13 g, 67% yield).

[0595] C 92 H 147 N9O 35 Calculated mass: 1938.0, Measured mass: 970.1 [M+2H] 2+ ,ESI.

[0596] 1 H NMR (400MHz,DMSO-d6) δ 12.01 (s,1H),7.86-7.50 (m,7H),5.22-4.96 (m,6H),4.50-4.48 (m,4H),4.03-3.69 (m,17H),3.41-3.32 (m,6H),3.01-2.60 (m,8H),2.46-2.21 (m,4H),2.15-1.78 (m,42H),1.68-1.23 (m,46H),0.95 (t,J=7.6Hz,6H).

[0597] Compound 27-6: A mixture of compound 27-5 (2.75 g, 1.42 mmol), DIEA (383.61 mg, 2.97 mmol, 517.00 μL), EDCI (426.76 mg, 2.23 mmol), and HOBT (200.53 mg, 1.48 mmol) in DCM (30 mL) was stirred at room temperature for 30 min. Compound 11-2 (0.85 g, 1.48 mmol) was added to the reaction mixture. The reaction was stirred at room temperature for 2 h. The reaction was quenched with water (50 mL) and extracted with DCM (50 mL x 2). The combined organic phase was concentrated in vacuo and purified by preparative HPLC to give compound 27-6 (1.2 g, 32% yield).

[0598] C 127 H189 O 39 N 11 Calculated mass: 2493.9, Measured mass: 1270.0 [M+2Na] 2+ ,ESI.

[0599] 1 H NMR (400MHz,DMSO-d6) δ 7.84-7.72 (m,7H),7.44-7.23 (m,10H),6.92-6.88 (m,4H),5.22 (d,J=3.6Hz,3H),4.99-4.95 (m,3H),4.66-4.45 (m,6H),4.03-3.69 (m,26H),3.41-3.36 (m,6H),3.01-2.86 (m,14H),2.46-2.21 (m,6H),2.15-1.78 (m,52H),1.68-1.23 (m,52H).

[0600] Example 28 [ka]

[0601] Compound 28-1: A mixture of 8-(Fmoc-amino)octanoic acid (1.27 g, 3.59 mmol), TEA (495.41 mg, 4.90 mmol), and HATU (1.35 g, 3.59 mmol) in DCM (15 mL) was stirred for 20 min, and then compound 2-10 (1.5 g, 3.26 mmol) was added to the reaction mixture and stirred for 4 h. The mixture was partitioned between DCM (50 mL) and water (35 mL), and the DCM extract was washed with brine (100 mL), dried over sodium sulfate, concentrated in vacuo, and purified by high-performance AlO column chromatography (DCM / MeOH = 0% to 6%) to give compound 28-1 (600 mg, 23% yield) as a white foamy solid.

[0602] 1H NMR (400MHz,DMSO-d6) δ 7.87 (d,J=7.6Hz,2H),7.68 (d,J=7.4Hz,2H),7.44-7.35 (m,4H),7.34-7.28 (m,4H),7.27-7.17 (m,6H),6.89 (d,J=7.6Hz,4H),4.64 (td,J=5.0,1.6Hz,1H),4.28 (d,J=6.9Hz,2H),4.20 (t,J=6.8Hz,1H),3.96 (s,1H),3.73 (d,J=3.8Hz,6H),3.67 (d,J=10.4Hz,2H),3.50 (s,1H),3.39 (t,J=5.9Hz,2H),2.96 (t,J=6.6Hz,2H),2.91 (s,2H),2.06-1.74 (m,6H),1.47-1.31 (m,4H),1.26-1.13 (m,6H).

[0603] Compound 28-2: Piperidine (0.4 mL) was added to a solution of compound 28-1 (600 mg, 0.75 mmol) in MeOH (4 mL). After stirring overnight, the mixture was concentrated in vacuo to give crude compound 28-2 (600 mg) as a white solid, which was used without further purification.

[0604] C 35 H 44 Calculated mass of N2O5: 600.4, Measured mass: 601.4 [M+H] + ,ESI.

[0605] Compound 28-3: Compound 11-11 (1.75 g, 915.47 μmol) was dissolved in DCM (30 mL). At 0 °C, DIEA (355 mg, 2.75 mmol), EDCI (351 mg, 1.83 mmol), and HOBT (247 mg, 1.83 mmol) were added to the mixture. The reaction was stirred at 0 °C for 30 min. Compound 28-2 (550 mg, 915.47 μmol) was added to the reaction mixture. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was quenched with saturated NaHCO solution (40 mL), extracted with DCM (30 mL × 2), washed with brine (30 mL), dried over NaSO, concentrated, and purified by preparative HPLC (C18 column, ACN / water) to give compound 28-3 (1.1 g, 48% yield) as a white foamy solid.

[0606] 1 H NMR (400MHz,DMSO-d6) δ 7.86-7.76 (m,4H),7.73 (t,J=5.4Hz,3H),7.46 (s,1H),7.40-7.35 (m,2H),7.31 (t,J=7.6Hz,2H),7.27-7.18 (m,5H),6.93-6.85 (m,4H),5.21 (d,J=3.4Hz,3H),4.95 (dd,J=11.2,3.4Hz,3H),4.65 (t,J=5.1Hz,1H),4.50-4.40 (m,5H),4.10-3.94 (m,10H),3.93-3.80 (m,5H),3.70-3.64 (m,11H),3.50 (s,1H),3.45-3.36 (m,5H),3.08-3.75 (m,14H),2.39-2.20 (m,6H),2.15-1.92 (m,31H),1.92-1.73 (m,21H),1.67-1.13 (m,52H).

[0607] Example 29 [ka]

[0608] Compound 29-1: A mixture of compound 27-5 (2.74 g, 1.41 mmol), DIEA (365.70 mg, 2.83 mmol, 492.86 μL), EDCI (406.83 mg, 2.12 mmol), and HOBT (191.17 mg, 1.41 mmol) in DCM (30 mL) was stirred at room temperature for 30 min. Compound 28-2 (0.85 g, 1.41 mmol) was added to the mixture. The reaction was continued to stir at room temperature for 2 h. The reaction was quenched with water (50 mL) and extracted with DCM (50 mL x 2). The combined organic phase was concentrated in vacuo and purified by preparative HPLC to give compound 29-1 (1.1 g, 29% yield).

[0609] C 129 H 193 O 39 N 11 Calculated mass: 2520.4, Measured mass: 1284.0 [M+2Na] 2+ ,ESI.

[0610] 1 H NMR (400MHz,DMSO-d6) δ: 7.84-7.72 (m,7H),7.44-7.23 (m,10H),6.92-6.88 (m,4H),5.22 (d,J =3.6Hz,3H),4.99-4.95 (m,3H),4.66-4.45 (m,6H),4.03-3.69 (m,26H),3.41-3.36 (m,6H),3.01-2.86 (m,14H),2.46-2.21 (m,6H),2.15-1.78 (m,52H),1.68-1.23 (m,56H).

[0611] Example 30 [ka]

[0612] Compound 30-1: A mixture of benzylamine (25 g, 233.31 mmol), polyformaldehyde (42.03 g, 1.40 mol) and K2CO3 (32.24 g, 233.31 mmol) in MeOH (30 mL) was stirred at room temperature overnight.

[0613] The reaction mixture was filtered and concentrated in vacuo. PE:EA=1:1 (100 mL) was added to the residue, and the mixture was filtered and concentrated in vacuo to give crude compound 30-1 (45.56 g) as a colorless oil.

[0614] 1 H NMR (400MHz,DMSO-d6) δ: 7.33-7.27 (m,5H),4.27 (s,4H),4.04 (s,2H),3.30 (s,6H).

[0615] Compound 30-2: A mixture of 3-((benzyloxy)methyl)cyclobutanone (23.38 g, 122.92 mmol), compound 30-1 (24 g, 122.92 mmol) in MeCN (200 mL) (in one dropping funnel), and trimethylchlorosilane (26.70 g, 245.84 mmol) in MeCN (200 mL) (in another dropping funnel) was added dropwise to acetonitrile (200 mL) with stirring at 40 °C within 3 h. The reaction was stirred overnight at 20 °C. The pH was adjusted to 7-8 with saturated NaHCO3, and the ACN was removed under vacuum. The aqueous layer was extracted with EA (200 mL x 3). The combined organic phases were concentrated under vacuum. The residue was purified by C18 reverse-phase column and high-performance column chromatography to give 30-2 (1.5 g, 4% yield).

[0616] C 21 H 23 Calculated mass of O2N: 321.2, Measured mass: 322.1 [M+H] + ,ESI.

[0617] 1 H NMR (400MHz,DMSO-d6) δ 7.35-7.24 (m,10H),4.48 (s,2H),3.61 (s,2H),3.40 (d,J=6.8Hz,2H),3.33-3.08 (m,4H),2.88 (d,J=2.0Hz,2H),2.24 (t,J=6.8Hz,1H).

[0618] Compound 30-3: Methoxymethyl(triphenyl)phosphonium chloride (2.88 g, 8.40 mmol) was dissolved in THF (30 mL). KOtBu (1.05 g, 9.33 mmol) was added to the mixture at 0 °C. The reaction mixture was stirred at 0 °C for an additional 30 min. Compound 30-2 (1.5 g, 4.67 mmol) was added to the mixture. The mixture was allowed to warm to room temperature and stirred at room temperature overnight. The reaction mixture was quenched with saturated citric acid and the pH was adjusted to 6-7. The reaction mixture was extracted with EA (50 mL x 3), washed with brine (20 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance silica gel column chromatography (10%-30% MeOH in DCM) to give compound 30-3 (1.5 g, 92% yield) as an oil.

[0619] Calculated mass of C23H27O2N: 349.20, Measured mass: 350.2 [M+H] + ,ESI.

[0620] 1 H NMR (400MHz,DMSO-d6) δ 7.37-7.26 (m,10H),6.02 (s,1H),4.47 (s,2H),3.85 (s,2H),3.54 (d,J=7.6Hz,2H),3.46 (s,3H),3.13-3.09 (m,4H),2.88 (d,J=2Hz,2H),2.24 (t,J=6.8Hz,1H).

[0621] Compound 30-4: 2,2,2-Trichloroacetic acid (883.64 mg, 5.41 mmol) in water (15 mL) was added to compound 30-3 (1.5 g, 4.29 mmol) in ACN (45 mL). The reaction was stirred at room temperature overnight. The reaction was quenched with saturated NaHCO3 and the pH was adjusted to 7-8. The reaction mixture was extracted with EA (20 mL x 3), washed with brine (10 mL), dried over Na2SO4, concentrated in vacuo, and purified by high-performance silica gel column chromatography (10%-30% EA in PE) to give compound 30-4 (600 mg, 42% yield) as an oil.

[0622] C22 H 25 Calculated mass of O2N: 335.25, Measured mass: 336.2 [M + H] + ,ESI.

[0623] 1 H NMR (400MHz,DMSO-d6) δ 9.90 (s,1H),7.37-7.26 (m,10H),4.41(s,2H),3.85 (s,2H),3.44 (d,J=7.6Hz,2H),3.03-2.89 (m,4H),2.86 (d,J=4Hz,1H),2.69 (s,2H),2.04 (t,J=6.8Hz,1H).

[0624] Compound 30-5: Compound 30-4 (600 mg, 1.79 mmol) was dissolved in MeOH (18 mL) and added slowly in portions to NaBH (148.88 mg, 3.94 mmol). The reaction was stirred at room temperature for 1 h. The reaction was quenched with water. The pH was adjusted to 6-7 with saturated citric acid. The reaction was concentrated in vacuo to remove MeOH. The residue was extracted with DCM (20 mL x 3), washed with brine (10 mL), dried over NaSO, and concentrated in vacuo to give compound 30-5 (600 mg).

[0625] Calculated mass of C22H27NO2: 337.15, Measured mass: 338.2 [M+H] + ,ESI.

[0626] 1H NMR (400MHz,DMSO-d6) δ 7.37-7.26 (m,10H),4.47 (s,2H),3.90 (s,2H),3.69 (d,J=7.6Hz,2H),3.62-3.59 (m,4H),3.11 (d,J=10.8Hz,2H),2.61-2.56 (m,2H),2.19-2.04 (m,2H).

[0627] Compound 30-6: A mixture of compound 30-5 (200 mg, 592.67 μmol), Pd / C (100.00 mg, 823.38 μmol) in MeOH (6 mL) was stirred under 0.4 MPa H for 88 h. The mixture was filtered, concentrated in vacuo, and purified by preparative HPLC to give compound 30-6 (70 mg, 46% yield).

[0628] Calculated mass of C13H23NO2: 257.2, Measured mass: 158.2 [M-Boc+H] + ,ESI.

[0629] 1H NMR (400MHz, CDCl3) δ 3.96 (d,J=8.0Hz,4H),3.70-3.68 (m,4H),3.25-3.17 (m,4H),2.36-2.30 (m,2H),2.00-1.95 (m,2H),1.49 (s,9H).

[0630] Compound 30-7: Compound 30-6 (1 g, 3.89 mmol) was dissolved in HCl / 1,4-dioxane (4 M, 10 mL). The reaction mixture was stirred at room temperature for 3 h. The reaction mixture was concentrated in vacuo to give crude product 30-7 (610 mg), which was used in the next step without purification.

[0631] Calculated mass of C8H15NO2: 157.2, Measured mass: 158.1 [M+H] + ,ESI.

[0632] Compound 30-8: A mixture of DIEA (1.25 g, 9.70 mmol, 1.69 mL), HOBT (629.15 mg, 4.66 mmol), EDCI (892.59 mg, 4.66 mmol), and Fmoc-6-aminocaproic acid (1.37 g, 3.88 mmol) in DCM (30 mL) was stirred at 0 °C for 30 min. Compound 30-7 (610 mg, 3.88 mmol) was added to the reaction mixture and stirred at room temperature overnight. The reaction was quenched with water, washed with 10% citric acid (10 mL), saturated NaHCO solution (10 mL), and brine (10 mL), dried over NaSO, concentrated in vacuo, and purified by high-performance silica gel column chromatography (0% to 10% MeOH) to give compound 30-8 (1.55 g, 81% yield).

[0633] C 29 H 36 Calculated mass of N2O5: 492.3, Measured mass: 493.3 [M+H] + ,ESI.

[0634] 1 H NMR (400MHz,DMSO-d6) δ 7.90-7.68 (m,4H),7.44-7.25 (m,5H),4.56 (t,J=5.2Hz,2H),4.31-4.20 (m,3H),3.70-3.67 (m,4H),3.55 (s,2H),3.31 (s,4H),2.99-2.95 (m,2H),2.29-2.21 (m,2H),1.71 (t,J=6.0Hz,2H),1.53-1.24 (m,6H).

[0635] Compound 30-9: Compound 30-8 (1.55 g, 3.15 mmol), DMAP (38.44 mg, 314.65 μmol), and DIEA (610.00 mg, 4.72 mmol, 822.10 μL) were dissolved in DCM (50 mL). DMTrCl (1.17 g, 3.46 mmol) was added portionwise to the reaction mixture at 0 °C. The reaction was stirred overnight at room temperature. The reaction mixture was concentrated in vacuo and purified by high-performance AlO column chromatography (20% to 50% EA in PE) to give compound 30-9 (1 g, 40% yield).

[0636] C 50 H 54 Calculated mass of N2O7: 794.4, Measured mass: 817.4 [M+Na] + ,ESI.

[0637] 1 H NMR (400MHz,DMSO-d6) δ 7.90-7.68 (m,4H),7.44-7.25 (m,14H),6.90 (d,J=8.8Hz,4H),4.56 (t,J=5.2Hz,1H),4.31-4.20 (m,3H),3.74 (s,6H),3.70-3.67 (m,4H),3.55 (s,2H),3.31 (s,4H),2.99-2.95 (m,2H),2.29-2.21 (m,2H),1.89-1.67 (m,2H),1.53-1.24 (m,6H).

[0638] Compound 30-10: Compound 30-9 (700 mg, 880.54 μmol) was dissolved in MeOH (14 mL), and piperidine (1.4 mL) was added to the mixture. The reaction mixture was stirred at room temperature overnight. The reaction mixture was concentrated in vacuo and purified by high-performance AlO column chromatography (0% to 10% MeOH) to give compound 30-10 (300 mg, 59% yield) as a white foamy solid.

[0639] C 35 H 44 Calculated mass of N2O5: 572.3, Measured mass: 595.3 [M+Na] + ,ESI.

[0640] Compound 30-11: A mixture of compound 11-11 (1.00 g, 523.80 μmol), DIEA (169.25 mg, 1.31 mmol, 228.09 μL), HOBT (84.93 mg, 628.57 μmol), and EDCI (120.50 mg, 628.57 μmol) in DCM (50 mL) was stirred at 0 °C for 30 min. Compound 30-10 (300 mg, 523.80 μmol) was added to the mixture. The reaction was then stirred at room temperature overnight. The reaction mixture was quenched with water (20 mL), extracted with DCM (25 mL × 2), washed with brine (50 mL), dried over NaSO, concentrated in vacuo, and purified by HPLC to give compound 30-11 (595 mg, 46% yield).

[0641] C 125 H 185 N 11 O 39 Calculated mass: 2464.3, Measured mass: 1255.2 [M+2Na] 2+ ,ESI.

[0642] 1 H NMR (400MHz,DMSO-d6) δ 7.83-7.69 (m,7H),7.43 (s,1H),7.37-7.20 (m,9H),6.91-6.89 (m,J=8.8Hz,4H),5.22 (d,J=3.2Hz,3H),4.99-4.95 (m,3H),4.49-4.46 (m,6H),4.03 (s,9H),3.91-3.85 (m,5H),3.74 (s,6H),3.74-3.26 (m,9H),3.01-2.99 (m,10H),2.90-2.87 (m,2H),2.27-2.20 (m,9H),2.12 (s,11H),2.06-2.02 (m,8H),2.02(s,11H),1.89 (s,11H),1.78 (s,9H),1.62-1.21 (m,52H).

[0643] Example 31 [ka]

[0644] Compound 31-1: A mixture of compound 11-11 (3.17 g, 1.66 mmol), HOBT (448.34 mg, 3.32 mmol), EDCI (954.11 mg, 4.98 mmol), and DIEA (857.66 mg, 6.64 mmol) in DCM (20 mL) was stirred for 15 min, and then compound 9-9 (1.00 g, 1.66 mmol) was added to the reaction mixture and stirred for 4 h. The mixture was partitioned between DCM (50 mL) and water (35 mL), and the DCM extract was washed with brine (100 mL), dried over sodium sulfate, and concentrated in vacuo. The residue was purified by reverse-phase column chromatography (C18 column) to give compound 31-1 (2.25 g, 54% yield).

[0645] 1 H NMR (400MHz,DMSO-d6) δ 7.85-7.78 (m,4H),7.72 (t,J=5.4Hz,3H),7.45 (s,1H),7.27-7.20 (m,6H),6.91-6.85 (m,6H),5.21 (d,J=3.4Hz,3H),4.99-4.94 (m,3H),4.64 (t,J=5.1Hz,1H),4.50-4.41 (m,5H),4.05-3.95 (m,10H),3.91-3.83 (m,5H),3.75-3.65 (m,14H),3.51 (s,1H),3.44-3.31 (m,5H),3.06-2.94 (m,10H),2.90 (s,2H),2.89-2.78 (m,2H),2.41-2.30 (m,2H),2.28-2.21 (m,4H),2.10 (s,9H),2.08-2.00 (m,10H),1.99 (s,11H),1.96-1.92 (m,2H),1.89 (s,9H),1.86-1.80 (m,2H),1.77 (s,9H),1.66-1.31 (m,35H),1.30-1.13 (m,13H).

[0646] Compound 31-2: To a solution of compound 31-1 (150 mg, 0.06 mmol) in anhydrous DCM (1.0 mL) was added DMAP (14 mg, 0.12 mmol) and TEA (24 mg, 0.24 mmol), followed by succinic anhydride (20 mg, 0.2 mmol). The reaction mixture was stirred at room temperature for 3 h, and LCMS showed that the starting material was completely consumed. The reaction mixture was diluted with DCM (10 mL), washed with HO (3 mL x 4), and brine (3 mL x 4). The organic layer was concentrated to give compound 31-2 (130 mg, 97% yield) as a white solid.

[0647] C 130 H 191 N 11 O 43 Calculated mass: 2594.31, Measured mass: 1297.4 [M+2H] 2+ ,ESI.

[0648] 1 HNMR (600MHz,DMSO-d6) δ 7.92-7.69 (m,7H),7.50-7.41 (m,1H),7.31-7.12 (m,9H),6.92-6.89 (m,6H),5.21(d,J=6.0Hz,3H),4.98-4.95 (m,3H),4.52-4.41 (m,5H),4.07-4.01 (m,12H),3.90-3.83 (m,5H),3.80-3.64 (m,14H),3.49-3.25 (m,17H),3.05-2.84 (m,14H),2.47-2.23 (m,8H),2.12-1.77 (m,52H)1.61-1.21 (m,46H).

[0649] Solid support 31-3: Native amino-LCAA-CPG (loading value: 75 umol / g, 1000 Å) was washed with ACN (100 mL×2), DMF (100 mL×2) and DCM (100 mL×2) and dried under high vacuum overnight.

[0650] To a solution of succinate ester 31-2 (130 mg, 0.05 mmol) and HBTU (53 mg, 0.14 mmol) in anhydrous DMF (1.5 mL) was added DIPEA (30 mg, 0.23 mmol). The reaction mixture was shaken at room temperature for 10 min, and then natural amino-LCAA-CPG (300 mg, loading 75 μmol / g) was added. The suspension was shaken at room temperature for 20 h, filtered, and washed with DMF (20 mL x 5), ACN (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 2 h to give 300 mg of solid support. The unreacted amino groups on the solid support were blocked by stirring with AcO / pyridine / N-methylimidazole (90 μL / 1.0 mL / 80 μL) at room temperature for 1 h, and then washed with DMF (20 mL x 5), CHCl (20 mL x 5), and DCM (20 mL x 5) until TLC showed no eluate spot at 254 nm. The solid support was dried under vacuum for 15 h to obtain solid support 31-3 (300 mg). For loading calculation, 5.3 mg of loaded dried CPG was taken and 20 mL of 3% DCA in DCM was added. The solution was shaken, and the UV absorbance at 482 nm was measured. The absorbance value was ensured to be less than 1.0 unit to ensure the signal was not saturated. Loading (umol / g) = (total amount of DCA added (mL)) * (absorbance at 482 nm) * 1000) / 78.3 * (mg of CPG taken) Total amount of DCA added (mL) = 20 mL Absorbance value at 482 nm = 0.681 mg of CPG taken = 5.3mg The following equation was applied: Loading (umol / g) = ((20)*(0.681)*1000) / 78.3*(5.3) = 32.82umol / g.

[0651] Example 32 Synthesis of GalNAc-conjugated and unconjugated oligonucleotides and siRNA GalNAc-conjugated phosphoramidite: The synthesis of all other GalNAc-conjugated phosphoramidites is carried out according to the procedures described in Examples 2-7, 9 and 11.

[0652] GalNAc conjugated succinate loaded onto solid support: The synthesis of all other GalNAc conjugated succinates loaded onto solid supports is carried out according to the procedures described in Examples 2, 4, 9-11 and 31. siRNA sequence and chemical modifications to target human proprotein convertase subtilisin / kexin type 9 (hPCSK9): Sense strand (5'-3'): (1) CmsUmsAmGmAmCmCfUmGfUmdTUmUmGmCmUmUmUmUmGmUm- GalNAc: (2) GalNAc-CmUmAmGmAmCmCfUmGfUmdTUmUmGmCmUmUmUmUm sGmsUm (3) GalNAc-CmUmAmGmAmCmCfUmGfUmdTUmUmGmCmUmUmUmUm GmUm-GalNAc Antisense strand (5'-3'): AmsCfsAmAfAfAfGmCfAmAfAmAfCmAfGmGfUmCfUmAmGmsAmsAm siRNA sequence and chemical modifications for targeting mouse complement component 3 (mC3): Sense strand (5'-3'): (1) UmsGmsGmUmCmAmAfGfGfUmCmUmUmCmUmCmUmCmUm-GalNAc (2) GalNAc-UmGmGmUmCmAmAfGfGfUmCmUmUmCmUmCmUmsCmsUm Antisense strand (5'-3'): (E)-VP-UmGfAmGfAmGfAmAfGmAfCmCfUmUfGmAfCmsCfsAm siRNA sequences and chemical modifications for targeting mouse transthyretin (mTTR): Sense strand (5'-3'): (1) AfsAmsCfAmGfUmGfUmUfCfUfUmGfCmUfCmUfAmUfAmAf-GalNAc (2) GalNAc-AfAmCfAmGfUmGfUmUfCfUfUmGfCmUfCmUfAmUfsAmsAf Antisense strand (5'-3'): UmsUfAmUfAmGfAmGfCmAfAmGmAmAfCmAfCmUfGmUfUmsUmsUm s: phosphorothioate or phosphodiester, m:2'-OMe, f:2'-F, (E)-VP: (E)-vinyl phosphonate.

[0653] General manufacturing procedure: 1. Loading: GalNAc or nucleoside CPG (0.19 g, 500 A, approximately 10 μmol) was preloaded into a 5 mL syringe.

[0654] 2. Washing: acetonitrile (2.0 mL, 0.3 min, room temperature, repeated twice).

[0655] 3. Detriphenylmethylation: 3% trichloroacetic acid in dichloromethane (2.0 mL, 0.7 min, room temperature, repeated four times).

[0656] 4. Washing: acetonitrile (2.0 mL, 0.3 min, room temperature, repeated twice).

[0657] 5. Coupling: 0.067 M reactant monomer (1.0 mL) in acetonitrile and 0.30 M 5-(benzylthio)-1H-tetrazole (BTT) (1.0 mL) in acetonitrile were used as the activating agent (7.0 min, room temperature, repeated three times).

[0658] 6. Sulfurization or oxidation: N,N-dimethyl-N'-(3-thio-3H-1,2,4-dithiazol-5-yl)formamidine (DDTT, 4.80 M, in pyridine / acetonitrile = 2 / 1, 2.0 mL, 1 min, room temperature, twice) or 0.05 M I2 (in pyridine / HO = 80 / 20 (v / v), 2.0 mL, 1 min, room temperature, twice).

[0659] 7. Block: 1-methylimidazole (NMI) / acetonitrile = 15 / 85 (v / v) (2.0 mL) and acetic anhydride / acetonitrile = 20 / 80 (v / v) (0.9 mL, 1 min, room temperature, 1 time).

[0660] 8. Washing: acetonitrile (2.6 mL, 0.3 min, room temperature, repeated twice).

[0661] 9. The synthesis procedure was cycled automatically 19 times.

[0662] 10. The solid support was immersed in 10% DEA for 20 min. The solid support was suspended in NH3·H2O (5 mL) and stirred in a 48 mL sealed tube at 40 °C for 16 h. The reaction mixture was cooled to 25 °C. The solid support was then filtered, and the aqueous phase was concentrated in vacuo to give a yellow solution.

[0663] 11. 40 mL of ethanol was added to the filtrate (10 mL), followed by 0.3 mL of NaCl (3 M). The tube was placed at -20°C for 20 min. The tube was then centrifuged. The supernatant was discarded, and the remaining solid was collected.

[0664] 12. The white solid was purified by preparative HPLC (column: O-C18 150*40mm *10μm, mobile phase: [0.1 M TEAB-ACN], B%: 14%~24%, 30min).

[0665] 13. After lyophilization, the desired compound was obtained as a white solid.

[0666] Annealing step: 1. Calculate the molar value of double strand (e.g., 2 mg double strand, molar value = 2 mg / molecular weight of double strand, free acid), i.e., the molar value of single strand.

[0667] 2. The sense strand and antisense strand were dissolved in ultrapure water (free of DNA enzymes and RNA enzymes, sterilized) at 25°C. The concentrations of the oligonucleotides were quantified using ultraviolet-visible light (UV-vis).

[0668] 3. The two solutions were mixed in a 1:1 molar ratio.

[0669] 4. The mixed sample was left at room temperature for 10 minutes and tested by HPLC to monitor whether the ratio was appropriate.

[0670] 5. The solution was aliquoted into tubes and lyophilized to obtain the siRNA samples.

[0671] [Table 1-1] [Table 1-2] [ka] [ka] [ka] [ka] [ka] [ka]

[0672] Biological assays In this study, GalNAc-conjugated siRNAs of human proprotein convertase subtilisin / kexin type 9 (hPCSK9), mouse complement component 3 (mC3), or mouse transthyretin (mTTR) genes were tested for free uptake in primary human hepatocytes (PHH), primary mouse hepatocytes (PMH), and wild-type mice. Real-time quantitative RT-PCR assays were used to determine efficacy based on reductions in hPCSK9, mC3, or mTTR mRNA levels.

[0673] Furthermore, we detected the competitive binding activity of the GalNAc-conjugated siRNA against the hPCSK9 gene of the present invention with reporter gene siRNA-8 (GalNAc-1-conjugated siRNA labeled with Cy3 dye) to the asialoglycoprotein receptor (ASGPR) in the human hepatoma cell line HepG2, as determined by a decrease in mean fluorescence intensity in the cells (measured by flow cytometry).

[0674] 1. Cell culture Human HepG2 cells were purchased from ATCC and passaged at 70% confluency in the medium DMEM (Invitrogen), which was supplemented with 10% fetal bovine serum (FBS, Invitrogen).

[0675] Cryovial primary human hepatocytes (PHH) purchased from Invitrogen were thawed in Cryopreserved Hepatocyte Recovery Medium (CHRM, Gibco) and plated at approximately 1.0 x 10 cells per well on a collagen I-coated 96-well plate (Gibco, A1142803) using plating medium (William Medium E, Gibco, A1217601) supplemented with a Hepatocyte Plating Supplement Kit (Gibco, CM3000). 5Cells were plated at a density of 100 μl of medium per well for 4–6 hours, and then the plating medium was replaced with incubation medium (Williams Medium E (Gibco, A1217601) supplemented with Hepatocyte Maintenance Supplement Kit (Gibco, CM4000)) and treated with GalNAc-conjugated siRNA to allow for free uptake.

[0676] Cryovial PMH purchased from Xenotech were thawed in OptiThaw Hepatocyte Medium and plated at approximately 1.0 x 10 cells / well on a collagen I-coated 96-well plate (Gibco, A1142803) using plating medium (OptiPlate Hepatocyte Medium). 5 Cells were plated at a density of cells / 100 μl medium / well for 4–6 hours, after which the plating medium was replaced with incubation medium (OptiCulture medium) and treated with GalNAc-conjugated siRNA to allow for free uptake.

[0677] 2. siRNA for hPCSK9, mC3, and mTTR (Example 32) siRNA for hPCSK9 is synthesized by solid phase oligonucleotide synthesis based on the sequence disclosed below: Sense strand 5'-3': CUAGACCUGUTUUGCUUUUGU Antisense strand 3'-5': AAGAUCUGGACAAAACGAAAACA siRNA for mC3 is synthesized by solid phase oligonucleotide synthesis based on the sequence disclosed below: Sense strand 5'-3': UGGUCAAGGUCUUCUCUCU Antisense strand 3'-5': ACCAGUUCCAGAAGAGAGU siRNA for mTTR is synthesized by solid phase oligonucleotide synthesis based on the sequence disclosed below: Sense strand 5'-3': AACAGUGUUCUUGCUCUAUAA Antisense strand 3'-5': UUUUGUCACAAGAACGAGAUAUU 3. Free Intake Plating medium for PHH or PMH cells, as indicated, was replaced with prewarmed incubation medium containing siRNA at final concentrations of 100, 20, 4, 0.8, 0.16, 0.032, 0.0064, 0.00128, and 0.000256 nM. After 48 h of incubation, mRNA was extracted and subjected to RT-qPCR.

[0678] 4. mRNA Isolation Dynabeads (商標) mRNA DIRECT (商標) PHH or PMH mRNA was isolated using a purification kit (Invitrogen, catalog number 61012). The incubation medium was discarded, and 100 μl of the lysis / binding buffer provided in the kit was added to the cells. After 15–30 min of incubation at room temperature, the cell lysate was collected and then mixed with magnetic Dynabeads. After a 5-min incubation, the Dynabeads were washed with the buffer provided in the kit, air-dried, and then subjected to cDNA synthesis.

[0679] 5. cDNA synthesis After mRNA isolation, reverse transcription was immediately performed using the SuperScript VILO cDNA synthesis kit (Invitrogen life technologies).

[0680] 6. Gene expression analysis (RT-qPCR).

[0681] All probes for RNA quantification were obtained from Life Technologies using their TaqMan gene expression system with dual-labeled probes. Target gene expression in each well was normalized to TATA-box binding protein (TBP) as a control. Ct values ​​were measured using a Quantstudio 5 real-time PCR system (Invitrogen Life Technologies). Real-time data were compared to calculate relative fold changes. T The TaqMan probes were analyzed by the method and normalized to the relative target mRNA levels in untreated cells. Target gene: Human PCSK9-FAM (Assay ID: Hs00545399_m1) Mouse C3-FAM (Assay ID: Mm01232779_m1) Mouse TTR-FAM (Assay ID: Mm00443267_m1) Housekeeping genes: Human TBP-VIC (Assay ID: Hs00427620_m1) Mouse TBP-VIC (Assay ID: Mm01277042_m1) Example 1. Tri-antennary GalNAc-siRNA free uptake assay in PHH Tri-antennary GalNAc-conjugated siRNA targeting hPCSK9 mRNA was assayed to determine its target mRNA knockdown activity in PHH. Plateable cryopreserved primary human hepatocytes were purchased from Gibco (catalog number: HMCPUS, lot number: Hu8115). Cells were thawed at 37°C immediately after removal from liquid nitrogen and transferred to prewarmed thawing medium (Gibco, CM7000) before complete thawing. Cells were centrifuged at 100g for 10 min at room temperature, the thawing medium was removed, and plating medium (Williams E Medium, Gibco, A1217601) supplemented with a Hepatocyte Plating Supplement Kit (Gibco, CM3000) was added. The cells were then plated onto collagen I-coated 96-well plates (Gibco, A1142803) at a density of approximately 1.0 x 10 cells. 5 Cells / 100ul medium / well. After 4 hours of incubation at 37°C, the plating medium was replaced with incubation medium (Williams Medium E (Gibco, A1217601) supplemented with Hepatocyte Maintenance Supplement Kit (Gibco, CM4000)) containing novel GalNAc-conjugated siRNA (5-fold dilution reduced from 100nM to 0.000256nM, with the exception of siRNA-14 and siRNA-16, which reduced from 100nM to 0.01nM with 3-fold dilution). Data were collected in duplicate. 48 hours after siRNA addition, cells were harvested and transfected with Dynabeads according to the manufacturer's instructions. (商標) mRNA DIRECT (商標)mRNA isolation was performed using a purification kit (Invitrogen, catalog number 61012), and cDNA synthesis was performed using the SuperScript VILO cDNA Synthesis Kit (Invitrogen Life Technologies). hPCSK9 mRNA levels in each well were measured using TaqMan Gene Expression Assays (ThermoFisher) and normalized to hTBP mRNA. Real-time qPCR was performed in duplicate on a Quantstudio 5 Real-Time PCR System (Invitrogen Life Technologies). Data were calculated using the Δ-ΔCt method and normalized to the relative target mRNA levels in untreated cells. Dose-response curves were plotted in GraphPad Prism version 9.3.1 using a four-parameter logistic model.

[0682] The data showed the maximal effect of the novel GalNAc conjugate on hPCSK9 mRNA levels. The GalNAc moiety L96 (siRNA-1) was used as a positive control in the assay. If the residual hPCSK9 mRNA level in the GalNAc conjugate treatment was lower than L96, the novel GacNAc was considered superior to siRNA-1. Otherwise, the novel GacNAc was inferior to siRNA-1. The ranking of all tri-antennary GalNAcs shown in Table 2 is determined by the average maximal effect at 100 nM in two biological replicates. The maximal fold effect was calculated by dividing the percentage of remaining mRNA in siRNA-1-treated cells by the percentage in other GalNAc-siRNA treatments. According to the free uptake assay results in PHH, the maximal effect of the designed tri-antennary GalNAc was approximately 35% of the remaining target mRNA, comparable to siRNA-1.

[0683] [Table 2]

[0684] Example 2. (1+1+1) Trivalent GalNAc-siRNA Free Uptake Assay in PHH (1+1+1) trivalent GalNAc-conjugated siRNA targeting hPCSK9 mRNA was assayed to determine its target mRNA knockdown activity in PHHs. The methods and procedures for PHH free uptake, mRNA isolation, and RT-qPCR were identical to those for the tri-antennary GalNAc-conjugated siRNAs described above. The ranking of the (1+1+1) trivalent GalNAc conjugates is shown in Table 3. The ranking is based on the maximum effect on the percentage of remaining target mRNA. Data from 100 nM siRNA-treated cells showed the maximum effect of the novel GalNAc conjugates on hPCSK9 mRNA levels. Positive controls were siRNA-2 and siRNA-29.

[0685] [Table 3]

[0686] Based on the results of the free uptake assay in PHH, the designed (1 + 1 + 1) trivalent GalNAc conjugate (which has the greatest effect on the remaining target mRNA after less than 50% knockdown) is more effective than siRNA-2 and siRNA-29 (control). Compared to the others, siRNA-5 and siRNA-3 have the same siRNA sequence and chemical modification, but show less than 30% inhibition of the target mRNA.

[0687] Example 3. Competitive assay to detect GalNAc uptake activity in HepG2 cells.

[0688] GalNAc is a high-affinity ligand for ASGPR. To further compare the ASGPR-mediated uptake and efficacy of different GalNAc-conjugated siRNAs, we used Cy3-labeled GalNAc-siRNA (siRNA-8) as a reporter gene, mixed it with different concentrations of GalNAc-siRNA, and measured the internalization of siRNA-8 in hepatocytes by flow cytometry. With increasing amounts of GalNAc-siRNA, the internalization of the reporter gene decreased. We performed a competition assay by selecting siRNAs with higher or lower GalNAc efficiency compared to the positive control in the PHH free uptake assay. HepG2 cells (1 x 10) were seeded into 384-well plates. 4 Cells (cells / well) were allowed to attach and equilibrate at 37°C for at least 16 h. Cy3-labeled GalNAc-siRNA (siRNA-8) was mixed with an 8-point, 3-fold diluted designed GalNAc-siRNA in culture medium. HepG2 cells were placed on ice and siRNA treatment was performed. The old culture medium of HepG2 cells was replaced with siRNA-containing medium, and the cells were continuously cultured at 37°C for 2 h. After incubation, cycling cells were placed on ice, washed three times with cold PBS (pH = 7.4, Thermo Fisher Scientific), and digested with trypsin at 37°C for 10 min. Trypsinization was stopped with cold culture medium. The cells were then transferred to a new 96-well plate, and the medium was washed with EasySep™ on ice. TM The buffer was exchanged into BD LSR Fortessa (Stemcell Technologies). TM The mean fluorescence intensity of cells was analyzed by flow cytometry using an X-20 (BD Biosciences). Internalized siRNA was expressed as mean fluorescence intensity (MFI). Dose-response curves were plotted in GraphPad Prism version 9.3.1 using a four-parameter logistic model.

[0689] [Table 4]

[0690] [Table 5]

[0691] Additionally, the binding affinity of GalNAc-siRNA to ASGPR was tested by surface plasmon resonance (SPR) assay on a Biacore 8K machine (Biacore AB, equipped with a NiHC200M chip). A homemade His-tagged human ASPGR1 CRD domain of the H1 subunit (aa 154-281) was immobilized on the chip. The binding affinity results are also shown in Tables 4 and 5.

[0692] The results of the competition assay showed that all tri-antennary GalNAc conjugates were able to inhibit siRNA-8 internalization (36% to 47%) at 6 uM, and SPR studies showed that they had similar binding affinities to ASGPR.

[0693] The results of the competition assay showed that siRNA-2 could not inhibit the internalization of Cy3-labeled GalNAc-siRNA (siRNA-8) at 6 uM, but could inhibit all other siRNAs with different (1+1+1) trivalent GalNAc, and SPR studies showed that it had similar binding affinity to ASGPR.

[0694] Example 4. Tri-antennary and (1+1+1) trivalent GalNAc-siRNA in PMH free uptake assay We selected two tri-antennary GalNAc conjugates (GalNAc-6 at the 3' end of the sense strand and GalNAc-7 at the 3' end of the sense strand) for further analysis in PMH free uptake assays. siRNA-24 and siRNA-27 (conjugated with GalNAc-6 at the 3' end of the sense strand) targeted mC3 and mTTR mRNAs, respectively. siRNA-25 and siRNA-28 (conjugated with GalNAc-7 at the 3' end of the sense strand) targeted mC3 and mTTR mRNAs, respectively.

[0695] We further analyzed three (1 + 1 + 1) trivalent GalNAc conjugates (GalNAc-3 and GalNAc-5 at the 5' end of the sense strand) in PMH free uptake assays. The three (1 + 1 + 1) trivalent GalNAc conjugates were conjugated to siRNA-37 and siRNA-38 (targeting mTTR mRNA), respectively.

[0696] Tri-antennary or (1+1+1) trivalent GalNAc-conjugated siRNA targeting mC3 mRNA or mTTR was assayed to determine its target mRNA knockdown activity in PMH. Cells were thawed at 37°C immediately after removal from liquid nitrogen and transferred to prewarmed OptiThaw hepatocyte medium before complete thawing. Cells were centrifuged at 100g for 10 min at room temperature, the thawing medium was removed, OptiPlate hepatocyte medium was added, and cells were plated onto collagen I-coated 96-well plates (Gibco, A1142803) at a density of approximately 1.0 x 10 5 After 4 hours of incubation at 37°C, the plating medium was replaced with OptiCulture medium (containing novel GalNAc-conjugated siRNA, diluted 5-fold from 100 nM to 0.000256 nM). 48 hours after siRNA addition, cells were harvested and plated onto Dynabeads according to the manufacturer's instructions. (商標) mRNA DIRECT (商標)mRNA isolation was performed using a purification kit (Invitrogen, catalog number 61012), and cDNA synthesis was performed using the SuperScript VILO cDNA Synthesis Kit (Invitrogen Life Technologies). mC3 mRNA levels in each well were measured using TaqMan Gene Expression Assays (Thermo Fisher Scientific), normalized to mTBP mRNA, and performed in duplicate by real-time qPCR on a Quantstudio 5 Real-Time PCR System (Invitrogen Life Technologies). Data were calculated using the Δ-ΔCt method and normalized to the relative target mRNA levels in untreated cells. Dose-response curves were plotted in GraphPad Prism version 9.3.1 using a four-parameter logistic model.

[0697] [Table 6]

[0698] [Table 7]

[0699] [Table 8]

[0700] The results in Tables 6 and 7 show that the designed tri-antennary GalNAc is more effective than the controls (siRNA-23 and siRNA-26), and the results in Table 8 show that the designed (1+1+1) trivalent GalNAc is more effective than the control (siRNA-40).

[0701] Example 5. In vivo studies of tri-antennary and (1+1+1) trivalent GalNAc-siRNA In vivo study procedures Male C57BL / 6 mice, approximately 6-8 weeks old, were obtained from Jackson Laboratories. Animals were weighed and distributed to groups to ensure similar mean body weights and weight changes. Test articles (GalNAc-conjugated siRNA) were prepared at 1 mg / mL in sterile phosphate-buffered saline (PBS). siRNA concentration and mass were measured using a QIAxpert (Qiagen). Mice were subcutaneously administered 5 mL / kg of siRNA or PBS control (vehicle). Blood was collected using a retroorbital bleeding procedure, and serum was prepared. After serum was obtained, it was transferred to 1.5 mL tubes and stored at -80°C. A baseline blood sample was collected two days before injection. Blood was collected again on day 7 post-injection. Animals were sacrificed on day 14, after which blood was collected and livers were obtained. One lobe of the liver was stored in 2.5 mL of RNAlater (Thermo Fisher Scientific) and stored at 4°C for later RNA extraction. Another lobe of the liver was quickly frozen and stored at -80°C.

[0702] Regarding serum proteins, mTTR levels were measured using an ELISA kit from LS Bio (catalog number LS-F7530), and mC3 levels were measured using an ELISA kit from Abcam (catalog number ab263884).

[0703] For liver gene expression, liver tissue was homogenized in RNAlater and purified using Dynabeads. (登録商標) mRNA DIRECT (商標) mRNA was isolated using a SuperScript purification kit (Thermo Fisher Scientific). (商標) IV VILO (商標) cDNA generation was performed with Master Mix (Thermo Fisher Scientific). Real-time PCR reactions were performed with gene-specific TaqMan assays (Thermo Fisher Scientific).

[0704] Summary of in vivo results After administration, siRNA-23, siRNA-24, and siRNA-25 demonstrated a sustained reduction in serum mC3 protein until the final checkpoint (day 14). In the siRNA-24 or siRNA-25-treated groups, mC3 protein levels on days 7 and 14 were statistically significantly lower than those in the vehicle-treated group. Compared with siRNA-23, siRNA-24 and siRNA-25 demonstrated a trend toward better mC3 knockdown (Figure 1). Furthermore, compared with the vehicle group, siRNA-24 and siRNA-25 significantly reduced mC3 mRNA levels in the liver on day 14 (Figure 2). [Table 9]

[0705] Similarly, persistent knockdown of mTTR protein was observed by siRNAs -37, -38, -39, and -40 on day 14. Compared with the vehicle-treated group, all siRNAs significantly reduced mTTR protein levels on days 7 and 14, and mTTR mRNA levels on day 14. [Table 10]

[0706] Our data showed that the designed GalNAc conjugates had good expression knockdown.

Claims

1. A targeting ligand having the structure shown in formula (III-b), (III-c) or (III-d): 【Chemistry 1】 R １ is hydrogen or a protecting group, R ２ is hydrogen, or a solid support optionally linked via a linker group, or a phosphoramidite; R is a carbohydrate or derivative thereof having a hydroxy protecting group, linked via a linker group; m is independently selected from 0, 1, 2, 3, 4, and 5; n is independently selected from 1, 2, 3, 4 and 5; each of r, s, and t is independently selected from 0, 1, and 2; A targeting ligand, wherein m1 and n1 are each independently selected from 0, 1, 2, 3, and 4.

2. A targeting ligand having the structure shown in formula (III) or (III-a): 【Chemistry 2】 【Transformation 3】 is a single or double bond, R １ is hydrogen or a protecting group, R ２ is hydrogen, or a solid support optionally linked via a linker group, or a phosphoramidite; R is a carbohydrate or derivative thereof having a hydroxy protecting group, linked via a linker group; R ｂ is independently selected from the group consisting of hydrogen and oxo; each of m and n is independently selected from 1, 2, 3, 4, and 5; A targeting ligand, wherein m1 and n1 are each independently selected from 0, 1, 2, 3, and 4.

3. R has a structure shown in formula (IV), (IV-a), (IV-b) or (IV-c), 【Chemistry 4】 A is C ３－１０ a cycloalkyl group or a 4- to 12-membered heterocyclyl group; L １ , L ２ , L ３ , L ４ and L ５ are each independently selected from the group of substituents consisting of absent, O, S, S—S, NH, CO, CONH, NHCO, and a 4- to 10-membered heterocyclyl group; R ４ , R ６ , R ７ and R ８ each independently represents CH ２ , OCH ２ CH ２ and CH ２ CH ２ O; R ５ are independently absent, CH ２ , OCH ２ , C.H. ２ O, OCH ２ CH ２ , C.H. ２ CH ２ O, NHCH ２ , C.H. ２ NH, NHCH ２ CH ２ , C.H. ２ CH ２ N.H., C. ０－６ Alkyl (C ３－８ cycloalkyl) and C ０－６ is selected from the group of substituents consisting of alkyl (4- to 10-membered heterocyclyl); R ９ is a carbohydrate, 3. The targeting ligand of claim 1 or 2, wherein each of t1, t2, t3, t4 and t5 is independently selected from 0, 1, 2, 3, 4, 5 and 6.

4. R has a structure represented by formula (IV-1), (IV-a-1), (IV-b-1) or (IV-c-1), 【Transformation 5】 where: A is, 【Transformation 6】 and L １ , L ３ , L ４ and L ５ is independently selected from the group of substituents consisting of: absent, O, S, S—S, NH, CO, CONH, and NHCO; L ２ is absent, and O, S, S—S, NH, CO, CONH, NHCO and 【Transformation 7】 and R ５ are independently absent, CH ２ , C.H. ２ O, CH ２ N.H., C. ３－６ Cycloalkyl group, C ３－６ Cycloalkyl C １－３ alkyl, 4- to 8-membered heterocyclyl groups containing 1, 2 or 3 heteroatoms selected from N or O, and 4- to 8-membered heterocyclyl C containing 1, 2 or 3 cycloheteroatoms selected from N or O １－３ 4. The targeting ligand of claim 3, wherein the substituent is selected from the group consisting of alkyl.

5. The R ５ are independently —OCH ２ --NHCH ２ -, 【Transformation 8】 4. The targeting ligand of claim 3, selected from:

6. R ９ are galactose, galactosamine, N-acetylgalactosamine (GalNAc), D-galactosaminol, mannose, mannosamine, mannose-6-phosphate, glucose, glucosamine, N-acetyl-glucosamine (GluNAc), glucose-6-phosphate, glucoseaminol, glucose-glyceraldehyde, fucose, fucosamine, fuculose, lactose, allose, altrose, arabinose, cladinose, erythritol, and erythritol. R is selected from the group consisting of glycerol, erythrulose, fructose, D-fucitol, L-fucitol, L-glycerol-D-mannose-heptose, glycerol, glycerone, gulose, idose, lyxose, psicose, quinose, quinosamine, rhamnose, rhamnitol, rhamnosamine, ribose, ribulose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose, xylose and xylulose, and preferably R is selected from the group consisting of glycerol, erythrulose, fructose, D-fucitol, L-fucitol, L-glycerol-D-mannose-heptose, glycerol, glycerone, gulose, idose, lyxose, psicose, quinose, quinosamine, rhamnose, rhamnitol, rhamnosamine, ribose, ribulose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose, xylose and xylulose. ９ The targeting ligand of claim 3, wherein is N-acetylgalactosamine.

7. R has a structure represented by formula (IV-d), (IV-e), (IV-f), (IV-da), (IV-ea) or (IV-fa), 【Chemistry 9】 【Chemistry 10】 【Chemistry 11】 where: R ５ are independently OCH ２ , NHCH ２ and a 4-6 membered heterocyclyl group containing 1 or 2 heteroatoms selected from N or O; m is independently selected from 0, 1, 2, 3, 4, 5, and 6; n is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; and 4. The targeting ligand of claim 3, wherein r is independently selected from 0, 1, 2, 3, 4, and 5.

8. wherein R is as follows: 【Chemistry 12】 【Chemistry 13】 【Chemistry 14】 s is independently selected from 0, 1, 2 and 3; r is independently selected from 0, 1, 2, 3, 4 and 5; 4. The targeting ligand of claim 3, wherein n is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

9. The targeting ligand is: 【Chemistry 15】 【Chemistry 16】 【Chemistry 17】 R ｐ is H or a hydroxy protecting group, preferably the hydroxy protecting group is an acetyl group; X is O or S; each of m and n is independently selected from 1 or 2; 4. The targeting ligand of claim 3, wherein each of m1 and n1 is independently selected from 1, 2, or 3.

10. R １ is hydrogen or a substituted or unsubstituted triphenylmethylhydroxy protecting group, preferably R １ teeth, [Chemistry 18] 10. The targeting ligand of claim 9, wherein:

11. R ２ is hydrogen, 【Chemistry 19】 and 【Chemistry 20】 is a solid support.

12. The targeting ligand is: 【Chemistry 21】 【Chemistry 22】 【Chemistry 23】 【Chemistry 24】 【Chemistry 25】 【Chemistry 26】 【Chemistry 27】 【Chemistry 28】 【Chemistry 29】 【Transformation 30】 【Chemistry 31】 【Chemistry 32】 【Transformation 33】 【Transformation 34】 【Chemistry 35】 【Transformation 36】 【Chemistry 37】 【Transformation 38】 【Chemistry 39】 【Chemistry 40】 【Chemistry 41】 【Chemistry 42】 【Chemistry 43】 【Chemistry 44】 【Chemistry 45】 【Chemistry 46】 【Chemistry 47】 【Chemistry 48】 【Chemistry 49】 [Transformation 50] 【Chemistry 51】 【Chemistry 52】 【Chemistry 53】 【Chemistry 54】 【Transformation 55】 【Transformation 56】 【Chemistry 57】 【Chemistry 58】 【Chemistry 59】 【Transformation 60】 【Chemistry 61】 【Transformation 62】 【Transformation 63】 【Chemistry 64】 【Transformation 65】 【Chemical Formula 66】 【Transformation 67】 【Transformation 68】 【Transformation 69】 【Transformation 70】 【Chemistry 71】 【Chemistry 72】 4. The targeting ligand of claim 3, wherein X is O or S.

13. The targeting ligand of claim 1 or 2, wherein the targeting ligand is linked to a therapeutic agent and used as a drug.

14. 3. A therapeutic compound or a pharmaceutically acceptable salt thereof, wherein the therapeutic compound or the pharmaceutically acceptable salt thereof comprises at least one therapeutic oligonucleotide, and the oligonucleotide is conjugated to a targeting ligand according to claim 1 or 2.

15. The therapeutic compound is as follows: 【Transformation 73】 【Chemistry 74】 【Chemistry 75】 【Transformation 76】 【Chemical 77】 【Transformation 78】 【Chemistry 79】 【Chemistry 80】 【Chemistry 81】 【Chemistry 82】 NA is an oligonucleotide, 15. The therapeutic compound of claim 14, or a pharmaceutically acceptable salt thereof, wherein X is O or S.

16. 15. The therapeutic compound of claim 14, wherein the oligonucleotide is an antisense oligonucleotide, preferably the oligonucleotide is an siRNA.

17. 15. A pharmaceutical composition comprising the therapeutic compound of claim 14 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier, diluent, or excipient.

18. 15. A method of treating a disease or condition that may benefit from the administration of a therapeutic compound of claim 14 or a pharmaceutically acceptable salt thereof.

19. 15. A method of synthesizing a therapeutic compound of claim 14, the method comprising:

3. A method comprising providing a targeting ligand according to claim 1 or 2 and conjugating the targeting ligand to an oligonucleotide, preferably the targeting ligand is conjugated to the 3' or 5' end of the oligonucleotide, more preferably the oligonucleotide is an siRNA.

20. A compound having formula (V-a), (V-b), or (V-c), or a tautomer or pharmaceutically acceptable salt thereof, 【Chemistry 83】 【Chemical 84】 is a single or double bond, R ｂ is independently selected from the group consisting of hydrogen and oxo; each of m and n is independently selected from 1, 2, 3, 4, and 5; A compound, or a tautomer or a pharmaceutically acceptable salt thereof, wherein each of m1 and n1 is independently selected from 0, 1, 2, 3 and 4.

21. A compound having the formula (VI-a), (VI-b), or (VI-c), or a tautomer or a pharmaceutically acceptable salt thereof, 【Chemical 85】 m is independently selected from 0, 1, 2, 3, 4, and 5; n is independently selected from 1, 2, 3, 4 and 5; each of r, s, and t is independently selected from 0, 1, and 2; A compound, or a tautomer or a pharmaceutically acceptable salt thereof, wherein each of m1 and n1 is independently selected from 0, 1, 2, 3 and 4. 【Request Item 22】 【Chemistry 86】 【Transformation 87】 【Chemical 88】 【Chemistry 89】 [Chemical 90] or a tautomer or a pharmaceutically acceptable salt thereof.

Images