Application of tetracyclic compounds in tumor therapy

Abstract

The present invention relates to the application of tetracyclic compounds in tumor treatment. The compounds of the present invention have excellent and precise therapeutic effects on tumors with low or no expression of NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of NNMT gene and / or tumors with hypermethylation of DNA CpG sites in NNMT gene region. Specifically, the present invention provides the use of a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, for the manufacture of a composition or formulation for use in the prevention and / or treatment of tumors.

Description

[Technical field]

[0001] The present invention relates to the technical field of medicine, in particular to the application of tetracyclic compounds in tumor treatment. [Background technology]

[0002] Tumors, as a common disease that seriously endangers the health of mankind, have also brought about a constant upward trend in the mortality rate of malignant tumors. Due to the heterogeneity of tumors, simply using the same treatment or the same drug according to their origin and pathological characteristics will easily cause problems caused by inappropriate treatment, which will delay the important treatment time and opportunity for patients. Therefore, there seems to be a great need to adopt precision treatment for various tumor situations. With the development of biological technology, tumors have a continuous genotype distribution at the molecular level of genes and proteins, and changes in the expression and activity of tumor-related genes and proteins have been discovered one after another, and the changes in the expression and activity of tumor-related genes and proteins play an important role in the development of malignant tumors. The discovery and application of biomarkers provides precise guidance for the application of related drugs and enables precision treatment of tumors, thereby achieving targeted dosing, greatly improving the therapeutic effect, and reducing the drug dosage and toxic side effects.

[0003] Therefore, there is an urgent need in the art to develop drugs that can precisely treat tumors. Summary of the Invention [Problem to be solved by the invention]

[0004] The present invention aims to provide a compound that has a more precise therapeutic effect on tumors with low or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. [Means for solving the problem]

[0005] [ka]

[0006] Here, R 1 , R 2 , R 3 and R 4 each independently represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R 5 represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group; R 6 -OR 15 Or -N(R 16 R 17 ) ; R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkoxy group, or a substituted or unsubstituted C1-C8 halogenated alkoxy group; R 8 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom; R 9 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom; R 10 represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 alkyl group-substituted or unsubstituted C6-C12 aryl group-C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 halogenated alkoxy group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 halogenated alkyl group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted C1-C6 alkoxy group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-; R 11 and R 14each independently represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R 12 and R 13 are joined to form a substituted or unsubstituted 3-10 membered heterocycloalkyl ring;

[0007] [ka]

[0008] R 16 and R 17 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group, or a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C4 alkyl group-; R 18 represents a substituted or unsubstituted C1-C8 alkyl group; R 19 represents a substituted or unsubstituted C1-C10 alkylidene group.

[0009] [ka]

[0010] [ka]

[0011] In another preferred example, the heteroaryl group and the heterocycloalkyl ring each independently have 1 to 4 (preferably 1, 2 or 3) heteroatoms selected from N, O and S on the heterocycle.

[0012] In another preferred example, there are 1 to 4 (preferably 1, 2 or 3) heteroatoms each independently selected from N, O and S on the heterocyclic ring of the heterocycloalkyl ring.

[0013] In another preferred example, there are 1 to 4 (preferably 1, 2 or 3) heteroatoms each independently selected from N, O and S on the heterocyclic ring of the heteroaryl group.

[0014] In another preferred example, the optional "substitution" refers to one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or on the atomic group being each independently replaced by a substituent.

[0015] In another preferred embodiment, the heterocycloalkyl group contains 1 or 2 C=C cyclic double bonds.

[0016] In another preferred example, the halogenated alkoxyl group is a trifluoromethoxy group.

[0017] In another preferred example, the halogenated alkyl group is a trifluoromethyl group.

[0018] Another favorable example is R 1 , R 2 , R 3 and R 4 each independently represents a hydrogen atom, or a substituted or unsubstituted C1-C4 alkyl group.

[0019] Another favorable example is R 1 , R 2 , R 3 and R 4 each independently represents a hydrogen atom.

[0020] Another favorable example is R 1 represents a hydrogen atom.

[0021] Another favorable example is R 2 represents a hydrogen atom.

[0022] Another favorable example is R 3 represents a hydrogen atom.

[0023] Another favorable example is R4 represents a hydrogen atom.

[0024] Another favorable example is R 5 represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C3-C8 cycloalkyl group.

[0025] Another favorable example is R 5 represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a substituted or unsubstituted C3-C8 cycloalkyl group.

[0026] Another favorable example is R 5 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a substituted or unsubstituted C4-C7 cycloalkyl group.

[0027] Another favorable example is R 5 represents a hydrogen atom, a substituted or unsubstituted C3-C10 alkyl group, or a substituted or unsubstituted C3-C8 cycloalkyl group.

[0028] Another favorable example is R 5 represents a hydrogen atom, a substituted or unsubstituted C3-C10 alkyl group, or a substituted or unsubstituted C4-C6 cycloalkyl group.

[0029] Another favorable example is R 5 represents a hydrogen atom, a substituted or unsubstituted C4-C8 alkyl group, or a substituted or unsubstituted C4-C7 cycloalkyl group.

[0030] Another favorable example is R 5 represents a hydrogen atom, a substituted or unsubstituted C4-C8 alkyl group, or a substituted or unsubstituted C4-C6 cycloalkyl group.

[0031] Another favorable example is R 5 represents a hydrogen atom, an ethyl group, a butyl group, a hexyl group, or a cycloamyl group.

[0032] Another favorable example is R 7represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkoxyl group, or a substituted or unsubstituted C1-C6 halogenated alkoxyl group.

[0033] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C2 alkoxyl group, or a substituted or unsubstituted C1-C6 halogenated alkoxyl group.

[0034] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C2 alkoxyl group, or a substituted or unsubstituted C1-C4 halogenated alkoxyl group.

[0035] Another favorable example is R 7 represents a hydrogen atom, a methoxy group, or a halogenated propoxy group.

[0036] Another favorable example is R 7 represents a hydrogen atom, a methoxy group or a chlorinated propoxy group.

[0037] Another favorable example is R 8 represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a halogen atom.

[0038] Another favorable example is R 8 represents a hydrogen atom or a halogen atom.

[0039] Another favorable example is R 8 represents a hydrogen atom or a bromine atom.

[0040] Another favorable example is R 9 represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a halogen atom.

[0041] Another favorable example is R 9 represents a hydrogen atom or a halogen atom.

[0042] Another favorable example is R 9 represents a hydrogen atom or a bromine atom.

[0043] Another favorable example is R 10 represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 alkyl group-substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 halogenated alkoxy group-substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 halogenated alkyl group-substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted C1-C6 alkoxy group-substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C6 alkyl group-.

[0044] Another favorable example is R 10 represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group (e.g., a substituted or unsubstituted C4-C14 alkyl group), a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C1-C6 alkyl group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C1-C4 halogenated alkoxy group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C1-C4 halogenated alkyl group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted C1-C4 alkoxy group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-.

[0045] Another favorable example is R 10represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group (e.g., a substituted or unsubstituted C4-C14 alkyl group), a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C1-C6 alkyl group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted C1-C4 halogenated alkoxy group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted C1-C4 halogenated alkyl group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, or a substituted or unsubstituted C1-C4 alkoxy group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-.

[0046] Another favorable example is R 10 represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group (e.g., a substituted or unsubstituted C4-C14 alkyl group, or a substituted or unsubstituted C1-C14 alkyl group), a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C1-C4 alkyl group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted C1-C2 halogenated alkoxy group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted C1-C2 halogenated alkyl group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, or a substituted or unsubstituted C1-C2 alkoxy group-substituted or unsubstituted C6-C8 aryl group-C1-C4 alkyl group-.

[0047] Another favorable example is R 10is a hydrogen atom, a substituted or unsubstituted butyl group-substituted or unsubstituted phenyl group-substituted or unsubstituted methyl group, a substituted or unsubstituted propyl group-substituted or unsubstituted phenyl group-substituted or unsubstituted methyl group, a substituted or unsubstituted ethyl group, a substituted or unsubstituted propyl group, a substituted or unsubstituted butyl group, a substituted or unsubstituted amyl group, a substituted or unsubstituted hexyl group, a substituted or unsubstituted heptyl group, a substituted or unsubstituted octyl group, a substituted or unsubstituted decyl group, a substituted or unsubstituted dodecyl ... decyl group, substituted or unsubstituted tetradecyl group, substituted or unsubstituted phenyl group-substituted or unsubstituted ethyl group-, substituted or unsubstituted phenyl group-substituted or unsubstituted propyl group-, trifluoromethoxy group-substituted or unsubstituted phenyl group-substituted or unsubstituted methyl group-, trifluoromethyl group-substituted or unsubstituted phenyl group-substituted or unsubstituted methyl group-, or substituted or unsubstituted methoxy group-substituted or unsubstituted phenyl group-substituted or unsubstituted propyl group-.

[0048] Another favorable example is R 10 represents a hydrogen atom or a substituted or unsubstituted C5-C14 alkyl group.

[0049] In another preferred example, the substituted or unsubstituted C5-C14 alkyl group is a substituted or unsubstituted amyl group, a substituted or unsubstituted dodecyl group, or a substituted or unsubstituted tetradecyl group.

[0050] Another favorable example is R 10 represents a hydrogen atom, butyl-phenyl-methyl, propyl-phenyl-methyl, ethyl, propyl, butyl, amyl, hexyl, heptyl, octyl, decyl, dodecyl, tetradecyl, phenyl-ethyl, phenyl-propyl, trifluoromethoxy-phenyl-methyl, trifluoromethyl-phenyl-methyl, or methoxy-phenyl-propyl.

[0051] Another favorable example is R 11 and R 14 each independently represents a hydrogen atom, or a substituted or unsubstituted C1-C4 alkyl group.

[0052] Another favorable example is R 11 and R 14 each independently represents a hydrogen atom.

[0053] Another favorable example is R 12 and R 13 are joined to form a substituted or unsubstituted 3-8 membered heterocycloalkyl ring.

[0054] Another favorable example is R 12 and R 13 are joined to form a substituted or unsubstituted 3-membered heterocycloalkyl ring, a substituted or unsubstituted 4-membered heterocycloalkyl ring, a substituted or unsubstituted 5-membered heterocycloalkyl ring, a substituted or unsubstituted 6-membered heterocycloalkyl ring, a substituted or unsubstituted 7-membered heterocycloalkyl ring, or a substituted or unsubstituted 8-membered heterocycloalkyl ring.

[0055] Another favorable example is R 12 and R 13 are joined to form a substituted or unsubstituted 5-membered heterocycloalkyl ring.

[0056] [ka]

[0057] [ka]

[0058] Another favorable example is W 1 represents O or S.

[0059] Another favorable example is W 2 represents O or S.

[0060] [ka]

[0061] [ka]

[0062] Another favorable example is W 3 represents O or S.

[0063] Another favorable example is W 4 represents O or S.

[0064] [ka]

[0065] [ka]

[0066] [ka]

[0067] In another preferred example, the substituted or unsubstituted C6-C10 alkyl group is a substituted or unsubstituted hexyl group, a substituted or unsubstituted octyl group, or a substituted or unsubstituted decyl group.

[0068] In another preferred embodiment, the halogenated hexyl group is a chlorinated hexyl group or a brominated hexyl group.

[0069] In another preferred embodiment, the halogenated ethyl group is a brominated ethyl group, a chlorinated ethyl group, or a fluorinated ethyl group.

[0070] In another preferred embodiment, the halogenated propyl group is a brominated propyl group or a chlorinated propyl group.

[0071] [ka]

[0072] [ka]

[0073] [ka]

[0074] [ka]

[0075] Another favorable example is R 16 and R 17 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-.

[0076] Another favorable example is R 16 and R 17 each independently represents a hydrogen atom, a substituted or unsubstituted C4-C10 alkyl group, or a substituted or unsubstituted C6-C8 aryl group -substituted or unsubstituted C1-C4 alkyl group-.

[0077] Another favorable example is R 16 and R 17 each independently represents a hydrogen atom, a substituted or unsubstituted C6-C10 alkyl group, or a substituted or unsubstituted C6-C8 aryl group -substituted or unsubstituted C1-C2 alkyl group-.

[0078] Another favorable example is R 16 and R 17 each independently represents a hydrogen atom, an octyl group, or a phenyl group -ethyl group-.

[0079] Another favorable example is R 18 represents a substituted or unsubstituted C1-C6 alkyl group.

[0080] Another favorable example is R 18 represents a substituted or unsubstituted C2-C6 alkyl group.

[0081] Another favorable example is R 18 represents a butyl group.

[0082] Another favorable example is R 18 represents a tert-butyl group.

[0083] [ka]

[0084] Another favorable example is R 19 represents a substituted or unsubstituted C1-C8 alkylidene group.

[0085] Another favorable example is R 19 represents a substituted or unsubstituted C4-C8 alkylidene group.

[0086] Another favorable example is R 19 represents a hexamethylidene group.

[0087] Another favorable example is R 19 represents an n-hexamethylidene group.

[0088] [ka]

[0089] Another favorable example is R 20 represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a substituted or unsubstituted C3-C8 cycloalkyl group.

[0090] Another favorable example is R 20 represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0091] Another favorable example is R 20 represents a hydrogen atom.

[0092] Another favorable example is R 21 , R 22 , R 23 and R 24 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a substituted or unsubstituted C3-C8 cycloalkyl group.

[0093] Another favorable example is R 21 , R 22 , R 23 and R 24 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0094] Another favorable example is R 21 , R 22 , R 23 and R 24 each independently represents a hydrogen atom.

[0095] In another preferred example, the halogen atom is a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

[0096] In another preferred embodiment, the aryl group refers to a phenyl group.

[0097] In another preferred example, the halogenation refers to 1-position halogenation, 2-position halogenation, 3-position halogenation or full halogenation.

[0098] In another preferred example, the chlorination refers to 1-position chlorination, 2-position chlorination, 3-position chlorination or total chlorination.

[0099] In another preferred example, the bromination refers to 1-position bromination, 2-position bromination, 3-position bromination or total bromination.

[0100] In another preferred example, the fluorination refers to 1-position fluorination, 2-position fluorination, 3-position fluorination or full fluorination.

[0101] In another preferred example, the deuteration refers to 1-position deuteration, 2-position deuteration, 3-position deuteration or full deuteration.

[0102] In another preferred embodiment, the halogenation refers to fluorination, chlorination, bromination or iodination.

[0103] In another preferred embodiment, in the substituted or unsubstituted phenyl group, the substituted or unsubstituted phenyl group refers to a mono-substituted or unsubstituted phenyl group.

[0104] In another preferred embodiment, in said substituted or unsubstituted phenyl group, said substituted or unsubstituted phenyl group refers to a mono-substituted or unsubstituted phenyl group, and substitution refers to ortho-, para- or meta-substitution of the phenyl group.

[0105] In another preferred embodiment, the substituted or unsubstituted phenyl group refers to a mono-, di-, tri- or unsubstituted phenyl group.

[0106] In another preferred embodiment, the substituted or unsubstituted phenyl group refers to a mono-, di-, tri- or unsubstituted phenyl group, and substitution refers to ortho-, para- or meta-substitution of the phenyl group.

[0107] In another preferred embodiment, the chemical structure of the phenyl group-O-butyl group- is as follows:

[0108] [ka]

[0109] In another preferred embodiment, the brominated ethyl group is a 1-position brominated ethyl group.

[0110] In another preferred embodiment, the chemical structure of the brominated ethyl group is as follows:

[0111] [ka]

[0112] In another preferred embodiment, the chlorinated ethyl group is a 1-position chlorinated ethyl group.

[0113] In another preferred embodiment, the chemical structure of the chlorinated ethyl group is as follows:

[0114] [ka]

[0115] In another preferred embodiment, the fluorinated ethyl group is a 1-position fluorinated ethyl group.

[0116] In another preferred embodiment, the chemical structure of the fluorinated ethyl group is as follows:

[0117] [ka]

[0118] In another preferred embodiment, the brominated propyl group is a 1-position brominated propyl group.

[0119] In another preferred embodiment, the chemical structure of the brominated propyl group is as follows:

[0120] [ka]

[0121] In another preferred embodiment, the chlorinated propyl group is a 1-position chlorinated propyl group.

[0122] In another preferred embodiment, the chemical structure of the chlorinated propyl group is as follows:

[0123] [ka]

[0124] In another preferred embodiment, the chlorinated hexyl group is a 1-position chlorinated hexyl group.

[0125] In another preferred embodiment, the chemical structure of the chlorinated hexyl group is as follows:

[0126] [ka]

[0127] In another preferred embodiment, the brominated hexyl group is a 1-position brominated hexyl group.

[0128] In another preferred embodiment, the chemical structure of the brominated hexyl group is as follows:

[0129] [ka]

[0130] In another preferred embodiment, the chemical structure of the chlorinated propoxy group is as follows:

[0131] [ka]

[0132] In another preferred embodiment, the chemical structure of the hexanoyl group is as follows:

[0133] [ka]

[0134] In another preferred embodiment, the chemical structure of the valeryl group is as follows:

[0135] [ka]

[0136] In another preferred embodiment, the dodecanoyl group has the following chemical structure:

[0137] [ka]

[0138] In another preferred embodiment, the chemical structure of the cyclodecyl group-acetyl group- is as follows:

[0139] [ka]

[0140] In another preferred embodiment, the chemical structure of the butenyl group-ethyl group-propenyl group-methyl group is as follows:

[0141] [ka]

[0142] In another preferred embodiment, the propyl group is an n-propyl group or an isopropyl group.

[0143] [ka]

[0144] In another preferred embodiment, the butyl group is an n-butyl group or a tert-butyl group.

[0145] [ka]

[0146] [ka]

[0147] In another preferred embodiment, the hexyl group is an n-hexyl group.

[0148] [ka]

[0149] In another preferred embodiment, the heptyl group is an n-heptyl group.

[0150] [ka]

[0151] In another preferred embodiment, the octyl group is an n-octyl group.

[0152] [ka]

[0153] In another preferred embodiment, the decyl group is an n-decyl group.

[0154] [ka]

[0155] In another preferred embodiment, the dodecyl group is an n-dodecyl group.

[0156] [ka]

[0157] In another preferred embodiment, the tetradecyl group is an n-tetradecyl group.

[0158] In another preferred embodiment, the chemical structure of the tetradecyl group is as follows:

[0159] [ka]

[0160] In another preferred embodiment, the pentadecyl group is an n-pentadecyl group.

[0161] [ka]

[0162] In another preferred embodiment, the hexadecyl group is an n-hexadecyl group.

[0163] [ka]

[0164] In another preferred embodiment, the chemical structure of the cycloamyl group is as follows:

[0165] [ka]

[0166] In another preferred embodiment, the chemical structure of the propyl group-phenyl group-methyl group is as follows:

[0167] [ka]

[0168] In another preferred embodiment, the chemical structure of the butyl group-phenyl group-methyl group is as follows:

[0169] [ka]

[0170] In another preferred embodiment, the chemical structure of the phenyl group-ethyl group is as follows:

[0171] [ka]

[0172] In another preferred embodiment, the chemical structure of the phenyl group-propyl group- is as follows:

[0173] [ka]

[0174] In another preferred embodiment, the chemical structure of the trifluoromethoxy group-phenyl group-methyl group is as follows:

[0175] [ka]

[0176] In another preferred embodiment, the chemical structure of the trifluoromethyl group-phenyl group-methyl group is as follows:

[0177] [ka]

[0178] In another preferred embodiment, the chemical structure of the methoxy group-phenyl group-propyl group is as follows:

[0179] [ka]

[0180] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0181] [ka] Here, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9, R 10 , R 11 , R 14 , W 1 , W 2 and R 20 are each independently as defined above.

[0182] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0183] [ka]

[0184] Here, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 and R 14 are each independently as defined above.

[0185] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0186] [ka]

[0187] Here, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , R 14 , W 3 , W 4 , R 21 , R 22 , R 23 and R24 are each independently as defined above.

[0188] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0189] [ka]

[0190] Here, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , R 14 , R 21 , R 22 , R 23 and R 24 are each independently as defined above.

[0191] In another preferred embodiment, the chemical structure of the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is as follows:

[0192] [ka]

[0193] [ka]

[0194] [ka]

[0195] [ka]

[0196] [ka]

[0197] In another preferred embodiment, the pharma- ceutically acceptable salts of the compounds of formula I include salts of the compounds of formula I formed with an acid.

[0198] In another preferred example, the acid comprises one or more of hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid.

[0199] In another preferred example, the pharma- ceutically acceptable salts of the compounds of formula I include salts formed by the compounds of formula I with one or more of hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid.

[0200] In another preferred embodiment, the pharma- ceutically acceptable salts of the compounds of formula I include salts formed by the compounds of formula I with hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, or glutamic acid.

[0201] In another preferred embodiment, the base of the pharma- ceutically acceptable salt of the compound of formula I is a phenyl group in which the acid is one H + This includes bases formed by loss of

[0202] In another preferred embodiment, the base of the pharma- ceutically acceptable salt of the compound of formula I is hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, or glutamic acid. + This includes bases formed by loss of

[0203] In another preferred embodiment, the base of the pharma- ceutically acceptable salt of the compound of formula I is - , Cl - , Br - , I - , H.C.O.O. - , C.H. 3 COO - , S.O. 4 2- Or NO 3 - Includes.

[0204] In another preferred embodiment, the pharma- ceutically acceptable salt of the compound of formula I is:

[0205] [ka]

[0206] Where X - represents a base.

[0207] Another favorable example is X - is an anionic base.

[0208] Another favorable example is X - is an acid with one H + This includes bases formed by loss of

[0209] Another good example is X - is hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid or glutamic acid with one H + In another preferred embodiment, X - is F - , Cl - , Br - , I - , H.C.O.O. - , C.H. 3 COO - , S.O. 4 2- Or NO 3 - Includes.

[0210] In another preferred embodiment, the tumor is of human origin.

[0211] In another preferred embodiment, the tumor is a human tumor.

[0212] In another preferred embodiment, the tumor comprises a tumor in which the NNMT gene is underexpressed or not expressed.

[0213] In another preferred embodiment, the tumor comprises a tumor in which DNA methyltransferase is highly expressed.

[0214] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0215] In another preferred embodiment, the tumor comprises a tumor in which DNMT1 is highly expressed.

[0216] In another preferred embodiment, the tumor comprises a tumor in which DNMT3a is highly expressed.

[0217] In another preferred embodiment, the tumor comprises a tumor in which DNMT3b is highly expressed.

[0218] In another preferred embodiment, the tumor comprises a tumor in which UHRF1 is highly expressed.

[0219] In another preferred embodiment, the tumor comprises a tumor with hypermethylation of nucleotide sites in the NNMT gene and / or hypermethylation of DNA CpG sites in the NNMT gene region.

[0220] In another preferred embodiment, the tumor comprises a tumor in which the nucleotide site in the NNMT gene is hypermethylated.

[0221] In another preferred embodiment, said methylation at a nucleotide site in the NNMT gene refers to methylation at a cytosine nucleotide site in the NNMT gene.

[0222] In another preferred embodiment, said methylation at a nucleotide site in the NNMT gene refers to methylation of a cytosine at the nucleotide site in the NNMT gene.

[0223] In another preferred embodiment, said methylation of the nucleotide site of the NNMT gene refers to methylation of the 5th carbon atom on the cytosine of the nucleotide of the NNMT gene.

[0224] In another preferred embodiment, the tumor comprises a tumor in which NNMT gene region DNA CpG sites are hypermethylated.

[0225] In another preferred embodiment, said methylation of the NNMT gene region DNA CpG site refers to methylation of the cytosine nucleotide site of the NNMT gene region DNA CpG site.

[0226] In another preferred embodiment, said methylation of the NNMT gene region DNA CpG site refers to the methylation of the cytosine of the nucleotide of the NNMT gene region DNA CpG site.

[0227] In another preferred embodiment, said methylation of the NNMT gene region DNA CpG site refers to methylation of the 5th carbon atom on the cytosine of the nucleotide of the NNMT gene region DNA CpG site.

[0228] In another preferred embodiment, the NNMT gene is a human-derived NNMT gene.

[0229] In another preferred embodiment, the NNMT gene is a human NNMT gene.

[0230] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 10 μg of protein extracted from the tumor, more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 100 μg of protein extracted from the tumor, and more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 1000 μg of protein extracted from the tumor.

[0231] In another preferred embodiment, the tumor in which the NNMT gene is underexpressed or not expressed refers to a tumor in which the expression level of the NNMT gene in tumor cells is lower than the expression level of the NNMT gene in similar cells or normal cells (e.g., cancerous bladder tissue cells).

[0232] In another preferred example, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in tumor cells and the expression level E0 of the NNMT gene in similar cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0.

[0233] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0234] In another preferred embodiment, the certain cell comprises a tumor cell.

[0235] In another preferred embodiment, identical cells refer to similar cells.

[0236] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0237] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0238] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0239] In another preferred embodiment, said allogeneic cells refer to cells in which the NNMT gene is normally expressed or highly expressed (allogeneic tumor cells).

[0240] In another preferred embodiment, said allogeneic cells refer to cells of the same type, yet in which the NNMT gene is normally expressed or highly expressed.

[0241] In another preferred embodiment, the normal cells refer to normal tissue cells in which the NNMT gene is normally expressed (eg, cells derived from tumor cells, cells adjacent to tumors, or cancerous bladder tissue cells).

[0242] In another preferred embodiment, E0 is the expression level of the NNMT gene in cells where the NNMT gene is normally expressed or highly expressed.

[0243] In another preferred embodiment, the cells in which the NNMT gene is normally expressed or highly expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0244] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed refers to a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.01 μg of protein extracted from the tumor.

[0245] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed refers to a tumor in which the expression level of DNA methyltransferase in tumor cells is greater than the expression level of DNA methyltransferase in related cells or normal cells (e.g., cancerous bladder tissue cells).

[0246] In another preferred embodiment, the tumor with high expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in similar cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0247] In another preferred embodiment, identical cells refer to similar cells.

[0248] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0249] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0250] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0251] In another preferred embodiment, the allogeneic cells refer to cells in which DNA methyltransferase is normally expressed or under-expressed (eg, allogeneic tumor cells).

[0252] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which DNA methyltransferase is normally expressed or under-expressed.

[0253] In another preferred embodiment, the allogeneic cells refer to normal tissue cells in which DNA methyltransferase is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0254] In another preferred embodiment, A0 is the expression level of DNA methyltransferase in cells in which DNA methyltransferase is normally expressed or under-expressed.

[0255] In another preferred embodiment, said cells in which DNA methyltransferase is normally expressed or under-expressed comprise cells which are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0256] In another preferred embodiment, the tumor in which DNMT1 is highly expressed refers to a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 0.01 μg of protein extracted from the tumor.

[0257] In another preferred embodiment, the tumor in which DNMT1 is highly expressed refers to a tumor in which the expression level of DNMT1 in tumor cells is greater than the expression level of DNMT1 in related cells or normal cells (e.g., cancerous bladder tissue cells).

[0258] In another preferred embodiment, the tumor in which DNMT1 is highly expressed refers to a tumor in which the ratio (B1 / B0) between the expression level B1 of DNMT1 in tumor cells and the expression level B0 of DNMT1 in similar cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0259] In another preferred embodiment, identical cells refer to similar cells.

[0260] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0261] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0262] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0263] In another preferred embodiment, the allogeneic cells refer to cells in which DNMT1 is normally expressed or under-expressed (eg, allogeneic tumor cells).

[0264] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which DNMT1 is normally expressed or under-expressed.

[0265] In another preferred embodiment, the normal cells refer to normal tissue cells in which DNMT1 is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0266] In another preferred embodiment, B0 is the expression level of DNMT1 in cells where DNMT1 is normally expressed or under-expressed.

[0267] In another preferred embodiment, the cells in which DNMT1 is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0268] In another preferred embodiment, the tumor in which DNMT3a is highly expressed refers to a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 0.01 μg of protein extracted from the tumor.

[0269] In another preferred embodiment, the tumor with high DNMT3a expression refers to a tumor in which the expression level of DNMT3a in tumor cells is greater than that in similar cells or normal cells (e.g., cancerous bladder tissue cells).

[0270] In another preferred embodiment, the tumor in which DNMT3a is highly expressed refers to a tumor in which the ratio (C1 / C0) between the expression level C1 of DNMT3a in tumor cells and the expression level C0 of DNMT3a in similar cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0271] In another preferred embodiment, identical cells refer to similar cells.

[0272] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0273] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0274] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0275] In another preferred embodiment, the allogeneic cells refer to cells in which DNMT3a is normally expressed or under-expressed (eg, allogeneic tumor cells).

[0276] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which DNMT3a is normally expressed or under-expressed.

[0277] In another preferred embodiment, the normal cells refer to normal tissue cells in which DNMT3a is normally expressed (e.g., cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0278] In another preferred embodiment, C0 is the expression level of DNMT3a in cells where DNMT3a is normally expressed or under-expressed.

[0279] In another preferred embodiment, the cells in which DNMT3a is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0280] In another preferred embodiment, the tumor in which DNMT3b is highly expressed refers to a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 0.01 μg of protein extracted from the tumor.

[0281] In another preferred embodiment, the tumor with high expression of DNMT3b refers to a tumor in which the expression level of DNMT3b in tumor cells is greater than the expression level of DNMT3b in related cells or normal cells (e.g., cancerous bladder tissue cells).

[0282] In another preferred embodiment, the tumor in which DNMT3b is highly expressed refers to a tumor in which the ratio (D1 / D0) between the expression level D1 of DNMT3b in tumor cells and the expression level D0 of DNMT3b in similar cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0283] In another preferred embodiment, identical cells refer to similar cells.

[0284] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0285] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0286] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0287] In another preferred embodiment, said allogeneic cells refer to cells in which DNMT3b is normally expressed or under-expressed (allogeneic tumor cells).

[0288] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which DNMT3b is normally expressed or under-expressed.

[0289] In another preferred embodiment, the normal cells refer to normal tissue cells in which DNMT3b is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0290] In another preferred embodiment, D0 is the expression level of DNMT3b in cells where DNMT3b is normally expressed or under-expressed.

[0291] In another preferred embodiment, the cells in which DNMT3b is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0292] In another preferred embodiment, the tumor in which UHRF1 is highly expressed refers to a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 0.01 μg of protein extracted from the tumor.

[0293] In another preferred embodiment, the tumor in which UHRF1 is highly expressed refers to a tumor in which the expression level of UHRF1 in tumor cells is greater than the expression level of UHRF1 in related cells or normal cells (eg, cancerous bladder tissue cells).

[0294] In another preferred embodiment, the tumor in which UHRF1 is highly expressed refers to a tumor in which the ratio (F1 / F0) between the expression level F1 of UHRF1 in tumor cells and the expression level F0 of UHRF1 in similar cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0295] In another preferred embodiment, identical cells refer to similar cells.

[0296] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0297] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0298] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0299] In another preferred embodiment, said allogeneic cells refer to cells in which UHRF1 is normally expressed or under-expressed (allogeneic tumor cells).

[0300] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which UHRF1 is normally expressed or under-expressed.

[0301] In another preferred embodiment, the normal cells refer to normal tissue cells in which UHRF1 is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0302] In another preferred embodiment, F0 is the expression level of UHRF1 in cells where UHRF1 is normally expressed or under-expressed.

[0303] In another preferred embodiment, the cells in which UHRF1 is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0304] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is greater than the methylation level of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell).

[0305] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0306] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is ≧1%, preferably ≧3%, ≧5%, ≧10%, ≧15% or ≧20%, and more preferably ≧25%, ≧30%, ≧40% or ≧50%.

[0307] In another preferred embodiment, the certain cell comprises a tumor cell.

[0308] In another preferred embodiment, identical cells refer to similar cells.

[0309] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0310] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0311] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0312] In another preferred embodiment, said allogeneic cells refer to cells in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated (allogeneic tumor cells).

[0313] In another preferred embodiment, said allogeneic cells refer to cells of the same type, yet in which the nucleotide site in the NNMT gene is normally methylated or hypomethylated.

[0314] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which the nucleotide site of the NNMT gene is normally methylated.

[0315] In another preferred embodiment, the cells in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0316] In another preferred example, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level (M%) of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is ≧3% and less than M1%, where M1 is any positive integer between 3 and 100.

[0317] In another preferred embodiment, M1 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0318] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene refers to the ratio between the number of methylated nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region.

[0319] In another preferred embodiment, said methylation level of a nucleotide site in the NNMT gene comprises a methylation level of a nucleotide site in the NNMT gene promoter region.

[0320] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1.

[0321] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene comprises the methylation level of a nucleotide site within a region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene.

[0322] In another preferred embodiment, the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene is positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0323] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene comprises the methylation level of a nucleotide site within a region from 1050 bp prior to the transcription start site of the NNMT gene to 193 bp prior to the transcription start site.

[0324] In another preferred embodiment, the region from 1050 bp prior to the transcription initiation site of the NNMT gene to 193 bp prior to the transcription initiation site is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0325] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene comprises the methylation level of a nucleotide site within a region from 840 bp prior to the transcription start site of the NNMT gene to 469 bp prior to the transcription start site.

[0326] In another preferred embodiment, the region from 840 bp prior to the transcription initiation site of the NNMT gene to 469 bp prior to the transcription initiation site is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0327] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of a nucleotide site within a region between any two of positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 (including these two positions themselves).

[0328] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide at one or more (e.g., 2, 3, 4, 5, 6 or 7) sites among positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 of human chromosome 11.

[0329] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide of a site selected from position 114165695 of human chromosome 11, position 114165730 of human chromosome 11, position 114165769 of human chromosome 11, position 114165804 of human chromosome 11, position 114165938 of human chromosome 11, position 114166050 of human chromosome 11, position 114166066 of human chromosome 11, or a combination thereof.

[0330] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide site within a region between any two of the following positions of the nucleotide sequence of SEQ ID NO:1: 1161, 1196, 1235, 1270, 1404, 1516, and 1532 (including these two positions themselves).

[0331] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of one or more (e.g., 2, 3, 4, 5, 6 or 7) of the nucleotide sites 1161, 1196, 1235, 1270, 1404, 1516 and 1532 of the nucleotide sequence of SEQ ID NO:1.

[0332] In another preferred embodiment, said methylation level of the DNA CpG site of the NNMT gene region comprises the methylation level of the nucleotide at the site selected from the sites 1161, 1196, 1235, 1270, 1404, 1516, 1532 or any combination thereof of the nucleotides of the nucleotide sequence of SEQ ID NO:1.

[0333] In another preferred embodiment, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the methylation level of the DNA CpG site in the NNMT gene region in a certain cell (e.g., a tumor cell) is greater than the methylation level of the DNA CpG site in the NNMT gene region in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell).

[0334] In another preferred embodiment, the tumor in which the DNA CpG site of the NNMT gene region is hypermethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG site of the NNMT gene region of a certain cell (e.g., a tumor cell) and the methylation level W0 of the DNA CpG site of the NNMT gene region of a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0335] In another preferred embodiment, the tumor in which the NNMT gene region DNA CpG site is hypermethylated refers to a tumor in which the methylation level of the NNMT gene region DNA CpG site in a certain cell (e.g., tumor cell) is ≧1%, preferably ≧3%, ≧5%, ≧10%, ≧15% or ≧20%, and more preferably ≧25%, ≧30%, ≧40% or ≧50%.

[0336] In another preferred embodiment, the certain cell comprises a tumor cell.

[0337] In another preferred embodiment, identical cells refer to similar cells.

[0338] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0339] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0340] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0341] In another preferred embodiment, the allogeneic cells refer to cells in which the NNMT gene region DNA CpG sites are normally methylated or hypomethylated (eg, allogeneic tumor cells).

[0342] In another preferred embodiment, said related cells refer to cells of the same type, yet in which the NNMT gene region DNA CpG sites are normally methylated or hypomethylated.

[0343] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which the DNA CpG sites in the NNMT gene region are normally methylated.

[0344] In another preferred embodiment, the cells in which the NNMT gene region DNA CpG sites are normally methylated or hypomethylated include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0345] In another preferred example, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the methylation level (M%) of the DNA CpG site in the NNMT gene region of a certain cell (e.g., a tumor cell) is ≧3% and less than M2%, where M2 is any positive integer between 3 and 100.

[0346] In another preferred embodiment, M2 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0347] In another preferred embodiment, the methylation level of a CpG site refers to the ratio between the number of methylated CpG nucleotides in a certain gene region and the number of all nucleotides in the gene region.

[0348] In another preferred embodiment, said methylation level of the NNMT gene region DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region.

[0349] In another preferred embodiment, the methylation level of a CpG site refers to the ratio between the number of methylated CpG nucleotides in a gene region and the number of all CpG nucleotides in the gene region.

[0350] In another preferred embodiment, said methylation level of the NNMT gene region DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all CpG nucleotides in the NNMT gene region.

[0351] In another preferred embodiment, said methylation level of DNA CpG sites refers to the ratio between the number of methylated CpG sites in a region of DNA and the number of all CpG sites in said region of DNA.

[0352] In another preferred embodiment, said methylation level of DNA CpG sites refers to the ratio between the number of methylated CpG nucleotides in a region of DNA and the number of all nucleotides in said region of DNA.

[0353] In another preferred embodiment, said methylation level of DNA CpG sites refers to the ratio between the number of methylated CpG nucleotides in a region of DNA and the number of all CpG nucleotides in said region of DNA.

[0354] In another preferred embodiment, said methylation level of NNMT gene region DNA CpG sites refers to the ratio between the number of methylated CpG sites in NNMT gene region DNA and the number of all CpG sites in NNMT gene region DNA.

[0355] In another preferred embodiment, said methylation level of NNMT gene region DNA CpG sites refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region DNA and the number of all CpG nucleotides in the NNMT gene region DNA.

[0356] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites in the NNMT gene promoter region.

[0357] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1.

[0358] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene.

[0359] In another preferred embodiment, the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene is positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0360] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene.

[0361] In another preferred embodiment, the region from 1050 bp prior to the transcription initiation site of the NNMT gene to 193 bp prior to the transcription initiation site is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0362] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene.

[0363] In another preferred embodiment, the region from 840 bp prior to the transcription initiation site of the NNMT gene to 469 bp prior to the transcription initiation site is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0364] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites within the region between any two of positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 (including these two positions themselves).

[0365] In another preferred embodiment, the methylation level of the NNMT gene region DNA CpG sites includes the methylation level of one or more (e.g., 2, 3, 4, 5, 6 or 7) sites among positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 of human chromosome 11.

[0366] In another preferred embodiment, the methylation level of the DNA CpG site of the NNMT gene region comprises the methylation level of a site selected from position 114165695 of human chromosome 11, position 114165730 of human chromosome 11, position 114165769 of human chromosome 11, position 114165804 of human chromosome 11, position 114165938 of human chromosome 11, position 114166050 of human chromosome 11, position 114166066 of human chromosome 11, or a combination thereof.

[0367] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region between any two of the following positions of the nucleotide sequence of SEQ ID NO:1: 1161, 1196, 1235, 1270, 1404, 1516 and 1532 (including these two positions themselves).

[0368] In another preferred embodiment, the methylation level of the NNMT gene region DNA CpG sites comprises the methylation level of one or more (e.g., 2, 3, 4, 5, 6 or 7) of the sites at positions 1161, 1196, 1235, 1270, 1404, 1516 and 1532 of the nucleotide sequence of SEQ ID NO:1.

[0369] In another preferred embodiment, the methylation level of the NNMT gene region DNA CpG site comprises the methylation level of the site selected from the sites at positions 1161, 1196, 1235, 1270, 1404, 1516, 1532 or any combination thereof of the sites of SEQ ID NO:1.

[0370] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed can be treated by administering an inhibitor of the NNMT gene.

[0371] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed can be treated by administering a promoter of DNA methyltransferase.

[0372] In another preferred embodiment, the tumor in which DNMT1 is highly expressed can be produced by administering a promoter of DNMT1.

[0373] In another preferred embodiment, the tumor in which DNMT3a is highly expressed can be produced by administering a promoter of DNMT3a.

[0374] In another preferred embodiment, the tumor in which DNMT3b is highly expressed can be produced by administering a promoter of DNMT3b.

[0375] In another preferred embodiment, the tumor in which UHRF1 is highly expressed can be produced by administering a promoter of UHRF1.

[0376] In another preferred embodiment, said tumor in which the nucleotide site of the NNMT gene is hypermethylated can be treated by administering an agent that enhances methylation of the nucleotide site of the NNMT gene.

[0377] In another preferred embodiment, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated can be treated by administering an agent for promoting methylation of the DNA CpG site in the NNMT gene region.

[0378] In another preferred embodiment, the inhibitor comprises an inhibitor having specificity.

[0379] In another preferred embodiment, the enhancer comprises an enhancer having specificity.

[0380] In another preferred embodiment, said inhibitor of the NNMT gene comprises an inhibitor capable of causing under-expression or non-expression of the NNMT gene in tumors.

[0381] In another preferred embodiment, said promoter of DNA methyltransferase comprises a promoter that allows high expression of DNA methyltransferase in tumors.

[0382] In another preferred embodiment, said promoter of DNMT1 comprises a promoter capable of high expression of DNMT1 in tumors.

[0383] In another preferred embodiment, said promoter of DNMT3a comprises a promoter capable of high expression of DNMT3a in tumors.

[0384] In another preferred embodiment, the promoter of DNMT3b comprises a promoter capable of high expression of DNMT3b in tumors.

[0385] In another preferred embodiment, said promoter of UHRF1 comprises a promoter that allows high expression of UHRF1 in tumors.

[0386] In another preferred embodiment, said promoter of methylation of a nucleotide site in the NNMT gene comprises a promoter capable of hypermethylating a nucleotide site in the NNMT gene in a tumor.

[0387] In another preferred embodiment, said promoter of methylation of DNA CpG sites in the NNMT gene region comprises a promoter capable of hypermethylating DNA CpG sites in the NNMT gene region in tumors.

[0388] In another preferred embodiment, the tumor is selected from lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain cancer, liver cancer, prostate cancer, or a combination thereof.

[0389] In another preferred embodiment, the lung cancer is selected from non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0390] In another preferred embodiment, the lung cancer cells comprise NCI-H82 cells.

[0391] In another preferred embodiment, the colon cancer comprises colon adenocarcinoma.

[0392] In another preferred embodiment, the colon cancer cells comprise SW48 cells.

[0393] In another preferred embodiment, the colon cancer cells comprise MDA-MB-453 cells.

[0394] In another preferred embodiment, the breast cancer comprises triple-negative breast cancer.

[0395] In another preferred embodiment, the lymphoma is selected from B cell lymphoma, T cell lymphoma, or a combination thereof.

[0396] In another preferred embodiment, the lymphoma comprises diffuse large B-cell lymphoma.

[0397] In another preferred embodiment, the brain tumor is selected from glioblastoma, glioma, medulloblastoma, neuroblastoma, or a combination thereof.

[0398] In another preferred embodiment, the brain medulloblastoma comprises a cerebellar medulloblastoma.

[0399] In another preferred embodiment, the glioblastoma comprises glioblastoma multiforme.

[0400] In another preferred embodiment, the brain tumor comprises a medulloblastoma.

[0401] In another preferred embodiment, the brain tumor cells comprise one or more of GB-1 cells, SF126 cells, D341 Med cells, Kelly cells, and NB-1 cells.

[0402] In another preferred embodiment, the renal cancer is selected from renal clear cell adenocarcinoma, renal cancer Wilms, or a combination thereof.

[0403] In another preferred embodiment, the renal cancer comprises renal clear cell adenocarcinoma.

[0404] In another preferred embodiment, the renal cancer comprises Wilms renal cancer.

[0405] In another preferred embodiment, the renal cancer cancer cells comprise renal cancer Wilms cells.

[0406] In another preferred embodiment, the renal cancer cancer cells include one or more of G-401 cells and 786-O cells.

[0407] In another preferred embodiment, the pancreatic cancer comprises pancreatic ductal adenocarcinoma.

[0408] In another preferred embodiment, the pancreatic cancer cells comprise CFPAC-1 cells.

[0409] In another preferred embodiment, the leukemia is selected from T lymphocytic leukemia, myeloid leukemia, or a combination thereof.

[0410] In another preferred embodiment, the T lymphocytic leukemia comprises acute T lymphocytic leukemia.

[0411] In another preferred embodiment, the myeloid leukemia comprises M4 AML acute myeloid leukemia.

[0412] In another preferred embodiment, the myeloid leukemia comprises FAB M4 AML acute myeloid leukemia.

[0413] In another preferred embodiment, said expression comprises protein expression and / or mRNA expression.

[0414] In another preferred embodiment, the composition or formulation is a pharmaceutical composition or formulation.

[0415] In another preferred embodiment, the composition or formulation further comprises a pharma- ceutically acceptable carrier.

[0416] In another preferred embodiment, said expression is mRNA expression or protein expression.

[0417] In another preferred embodiment, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0418] In another preferred embodiment, the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0419] In another preferred embodiment, the injectable formulation is an intravenous injection formulation.

[0420] In another preferred embodiment, the composition or preparation is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill, or a coating.

[0421] A second aspect of the present invention provides a marker for determining whether the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for the prevention and / or treatment of tumor in a tumor patient, the marker comprising an expression level of the NNMT gene, an expression level of DNA methyltransferase, an expression level of UHRF1, a methylation level of a nucleotide site of the NNMT gene, and / or a methylation level of a DNA CpG site in the NNMT gene region.

[0422] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites in the NNMT gene promoter region.

[0423] In another preferred embodiment, when the NNMT gene is under-expressed or not expressed, the DNA methyltransferase is over-expressed, the UHRF1 is over-expressed, the nucleotide site of the NNMT gene is hypermethylated, and / or the DNA CpG site of the NNMT gene region is hypermethylated in the tumor cells of a tumor patient, said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in said tumor patient.

[0424] In another preferred embodiment, in tumor cells of a tumor patient, high expression of NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of NNMT gene, and / or low methylation of DNA CpG sites in NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes unsuitable for the prevention and / or treatment of tumors in said tumor patient.

[0425] In another preferred embodiment, the content that said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is suitable for preventing and / or treating a tumor in said tumor patient means that tumor cells of the tumor patient are sensitive to said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0426] In another preferred embodiment, the content that said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is not suitable for the prevention and / or treatment of tumors in said tumor patient means that tumor cells of the tumor patient are insensitive to said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0427] In another preferred embodiment, the tumor in which the NNMT gene is underexpressed or not expressed is a tumor according to the first aspect of the present invention.

[0428] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0429] In another preferred embodiment, the tumour in which DNA methyltransferase (eg DNMT1) is highly expressed is a tumour according to the first aspect of the invention.

[0430] In another preferred embodiment, the tumor in which UHRF1 is highly expressed is a tumor according to the first aspect of the present invention.

[0431] In another preferred embodiment, said tumor in which the nucleotide site of the NNMT gene is hypermethylated is a tumor according to the first aspect of the invention.

[0432] In another preferred embodiment, the tumor in which the NNMT gene region DNA CpG site is hypermethylated is a tumor according to the first aspect of the present invention.

[0433] In another preferred embodiment, the tumor in which the NNMT gene is highly expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0434] In another preferred embodiment, the tumor with low expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in similar cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0435] In another preferred embodiment, the tumor in which DNMT1 is underexpressed refers to a tumor in which the ratio (B1 / B0) between the expression level B1 of DNMT1 in tumor cells and the expression level B0 of DNMT1 in similar cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0436] In another preferred embodiment, the tumor in which DNMT3a is underexpressed refers to a tumor in which the ratio (C1 / C0) between the expression level C1 of DNMT3a in tumor cells and the expression level C0 of DNA methyltransferase in similar cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0437] In another preferred embodiment, the tumor in which DNMT3b is underexpressed refers to a tumor in which the ratio (D1 / D0) between the expression level D1 of DNMT3b in tumor cells and the expression level D0 of DNA methyltransferase in similar cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0438] In another preferred example, the tumor in which UHRF1 is underexpressed refers to a tumor in which the ratio (F1 / F0) between the expression level F1 of UHRF1 in tumor cells and the expression level F0 of UHRF1 in similar cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0439] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypomethylated refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0440] In another preferred embodiment, the tumor in which the NNMT gene region DNA CpG site is hypomethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the NNMT gene region DNA CpG site of a certain cell (e.g., a tumor cell) and the methylation level W0 of the NNMT gene region DNA CpG site of a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0441] A third aspect of the present invention provides a detection reagent kit, comprising:

[0442] (i) A detection reagent is provided for detecting the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region.

[0443] In another preferred embodiment, the detection sample of the detection reagent kit includes tumor cells.

[0444] In another preferred embodiment, the level comprises a protein level and / or an mRNA level.

[0445] In another preferred embodiment, said expression comprises mRNA and / or protein expression.

[0446] A fourth aspect of the present invention provides the use of a detection reagent kit according to the third aspect of the present invention for the manufacture of a concomitant diagnostic kit for determining whether the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for the prevention and / or treatment of tumors in tumor patients.

[0447] In another preferred embodiment, the companion detection reagent kit further comprises instructions or a label.

[0448] In another preferred embodiment, the instructions or label include:

[0449] The present invention describes that when the NNMT gene is under-expressed or not expressed, the DNA methyltransferase is over-expressed, the UHRF1 is over-expressed, the nucleotide site of the NNMT gene is hypermethylated, and / or the DNA CpG site of the NNMT gene region is hypermethylated in the tumor cells of a tumor patient, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0450] In another preferred embodiment, the instructions or label include: The present invention relates to a method for treating tumors comprising administering to a patient a therapeutically effective amount of said compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, in which the compound is a compound of formula I or an optical isomer or racemate thereof, or a solvate thereof, or a pharma-ceutically acceptable salt thereof, or a deuterated compound thereof is unsuitable for the prevention and / or treatment of tumors in said tumor patients, when there is high expression of NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of NNMT gene, and / or low methylation of DNA CpG sites of NNMT gene region in tumor cells of said tumor patients.

[0451] In another preferred embodiment, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, being suitable for the prophylaxis and / or treatment of tumors in tumor patients, has the meaning according to the second aspect of the present invention.

[0452] In another preferred embodiment, the content that said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof is not suitable for the prophylaxis and / or treatment of tumors in said tumor patients has the meaning according to the second aspect of the present invention.

[0453] A fifth aspect of the invention provides a medical kit.

[0454] The medical kit comprises: (i) a detection agent used to detect the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region; (ii) comprising the compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0455] In another preferred embodiment, the above content of the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site in the NNMT gene region means the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site in the NNMT gene region in tumor cells.

[0456] In another preferred embodiment, the sample for detection comprises a tumor.

[0457] In another preferred embodiment, the medical kit further comprises instructions or a label.

[0458] In another preferred embodiment, the instructions or label include:

[0459] The present invention describes that when the NNMT gene is under-expressed or not expressed, the DNA methyltransferase is over-expressed, the UHRF1 is over-expressed, the nucleotide site of the NNMT gene is hypermethylated, and / or the DNA CpG site of the NNMT gene region is hypermethylated in the tumor cells of a tumor patient, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0460] In another preferred embodiment, the instructions or label include: The present invention relates to a method for treating tumors comprising administering to a patient a therapeutically effective amount of said compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, in which the compound is a compound of formula I or an optical isomer or racemate thereof, or a solvate thereof, or a pharma-ceutically acceptable salt thereof, or a deuterated compound thereof is unsuitable for the prevention and / or treatment of tumors in said tumor patients, when there is high expression of NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of NNMT gene, and / or low methylation of DNA CpG sites of NNMT gene region in tumor cells of said tumor patients.

[0461] A sixth aspect of the present invention provides a method for the prevention and / or treatment of tumors comprising administering to a subject to be treated said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0462] In another preferred embodiment, the tumor is a tumor according to the first aspect of the invention.

[0463] In another preferred embodiment, the subject to be treated is a human or non-human mammal (eg, rodents, rabbits, monkeys, livestock, dogs, cats).

[0464] In another preferred embodiment, the method further comprises: First, the tumor to be treated is caused to have low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of nucleotide sites of NNMT gene, and / or high methylation of DNA CpG sites in the NNMT gene region, and then the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof is administered to prevent and / or treat the tumor.

[0465] In another preferred embodiment, the method further comprises: First, an inhibitor of the NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of methylation of the nucleotide site of the NNMT gene and / or an accelerator of methylation of the DNA CpG site of the NNMT gene region are administered to the subject to prevent and / or treat the tumor of the subject, so that the tumor of the subject shows low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide site of the NNMT gene and / or high methylation of the DNA CpG site of the NNMT gene region, and then the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof is administered to the subject to prevent and / or treat the tumor.

[0466] In another preferred embodiment, the above-mentioned contents of an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site in the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the first aspect of the present invention.

[0467] A seventh aspect of the present invention provides an apparatus or system.

[0468] The device or system includes: (i) a detection module used to detect the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site of the NNMT gene region; (ii) an output module.

[0469] The output module includes: information that, in tumor cells of a tumor patient, low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, said compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in said tumor patient; and / or When there is high expression of NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of NNMT gene, and / or low methylation of DNA CpG sites in NNMT gene region in tumor cells of a tumor patient, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for tumor prevention and / or treatment in the tumor patient.

[0470] In another preferred embodiment, the sample for detection comprises a tumor.

[0471] In another preferred embodiment, the device comprises a gene detector or a protein detector.

[0472] In another preferred embodiment, the device or system further comprises a sample delivery module.

[0473] In another preferred embodiment, the sample supply module is used to supply a tumor cell extract.

[0474] In another preferred embodiment, the device or system further comprises a data processing module.

[0475] In another preferred embodiment, the data processing module processes the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site of the NNMT gene and / or the methylation level of a DNA CpG site in the NNMT gene region to obtain their numerical ranges.

[0476] In another preferred embodiment, the data processing module processes the expression level of the NNMT gene and / or the methylation level of DNA CpG sites in the NNMT gene promoter region to obtain their numerical ranges.

[0477] An eighth aspect of the present invention provides the use of an inhibitor of the NNMT gene, a promoter of DNA methyltransferase, a promoter of UHRF1, a promoter of methylation of a nucleotide site in the NNMT gene and / or a promoter of methylation of a DNA CpG site in the NNMT gene region to manufacture a composition or formulation for use in enhancing the antitumor effect of an antitumor drug.

[0478] In another preferred embodiment, said inhibitor of the NNMT gene comprises an inhibitor capable of causing under-expression or non-expression of the NNMT gene in tumors.

[0479] In another preferred embodiment, said promoter of DNA methyltransferase comprises a promoter that allows high expression of DNA methyltransferase in tumors.

[0480] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0481] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT1.

[0482] In another preferred embodiment, said promoter of DNMT1 comprises a promoter capable of high expression of DNMT1 in tumors.

[0483] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT3a.

[0484] In another preferred embodiment, said promoter of DNMT3a comprises a promoter capable of high expression of DNMT3a in tumors.

[0485] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT3b.

[0486] In another preferred embodiment, the promoter of DNMT3b comprises a promoter capable of high expression of DNMT3b in tumors.

[0487] In another preferred embodiment, said promoter of UHRF1 comprises a promoter that allows high expression of UHRF1 in tumors.

[0488] In another preferred embodiment, said promoter of methylation of a nucleotide site in the NNMT gene comprises a promoter capable of hypermethylating a nucleotide site in the NNMT gene in a tumor.

[0489] In another preferred embodiment, said promoter of methylation of DNA CpG sites in the NNMT gene region comprises a promoter capable of hypermethylating DNA CpG sites in the NNMT gene region in tumors.

[0490] In another preferred embodiment, the inhibitor comprises an inhibitor having specificity.

[0491] In another preferred embodiment, the enhancer comprises an enhancer having specificity.

[0492] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0493] In another preferred embodiment, the tumor is a tumor according to the first aspect of the invention.

[0494] In another preferred embodiment, the composition or formulation is a pharmaceutical composition or formulation.

[0495] In another preferred embodiment, the composition or formulation further comprises a pharma- ceutically acceptable carrier.

[0496] In another preferred embodiment, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0497] In another preferred embodiment, the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0498] In another preferred embodiment, the injectable formulation is an intravenous injection formulation.

[0499] In another preferred embodiment, the composition or preparation is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill, or a coating.

[0500] A ninth aspect of the invention provides an active ingredient combination comprising:

[0501] (1) a first active ingredient comprising an antitumor drug; and

[0502] (2) a second active ingredient comprising an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region.

[0503] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0504] In another preferred embodiment, the above-mentioned contents of an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site of the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the eighth aspect of the present invention.

[0505] In another preferred embodiment, the molar ratio between the first active ingredient and the second active ingredient is 0.01-600:1, preferably 0.05-500:1, and more preferably 0.1-400:1, 0.2-200:1, 0.5-100:1, 0.5-80:1 or 1-50:1.

[0506] In another preferred embodiment, the combination of active ingredients comprises at least one independent active ingredient.

[0507] In another preferred embodiment, the combination of active ingredients includes a first active ingredient and a second active ingredient that are independent of each other.

[0508] A tenth aspect of the present invention provides a composition comprising the following components:

[0509] (1) a first active ingredient comprising an antitumor drug; and (2) a second active ingredient comprising an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region.

[0510] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0511] In another preferred embodiment, the above-mentioned contents of an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site of the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the eighth aspect of the present invention.

[0512] In another preferred embodiment, the composition is a pharmaceutical composition.

[0513] In another preferred embodiment, the pharmaceutical composition further comprises a pharma- ceutically acceptable carrier.

[0514] In another preferred embodiment, the content of said first active ingredient relative to the total weight of active ingredients of the composition is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and more preferably 1-99 wt%, 10-99 wt% or 20-99 wt%.

[0515] In another preferred embodiment, the content of said second active ingredient relative to the total weight of active ingredients of the composition is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and more preferably 1-99 wt%, 10-99 wt% or 20-99 wt%.

[0516] An eleventh aspect of the invention provides a medical kit comprising the following formulation:

[0517] (A) a first formulation having a first active ingredient comprising an antitumor drug; and

[0518] (B) A second formulation having a second active ingredient comprising an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region.

[0519] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0520] In another preferred embodiment, the above-mentioned contents of an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site of the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the eighth aspect of the present invention.

[0521] In another preferred embodiment, the medical kit further comprises an instruction manual.

[0522] In another preferred embodiment, the first formulation and the second formulation are independent of each other.

[0523] In another preferred embodiment, the first and second formulations are combined.

[0524] In another preferred embodiment, the instructions include instructions to use the first formulation in combination with the second formulation to enhance the antitumor activity of the antitumor drug.

[0525] In another preferred embodiment, the combination method comprises first administering a second active ingredient comprising an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, an promoter of methylation of a nucleotide site in the NNMT gene and / or an promoter of methylation of a DNA CpG site in the NNMT gene region, and then administering an anti-tumor drug.

[0526] A twelfth aspect of the invention provides a method for inhibiting tumour cells, said method comprising contacting tumour cells with said compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, to inhibit said tumour cells.

[0527] In another preferred embodiment, the method is performed in vitro or is an in vitro method.

[0528] In another preferred embodiment, the method is an in vitro, non-therapeutic, non-diagnostic method.

[0529] In another preferred embodiment, the contacting is performed in an in vitro culture.

[0530] In another preferred embodiment, the tumor is a tumor according to the first aspect of the invention.

[0531] In another preferred embodiment, the method further comprises: First, the tumor cells are caused to have low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of nucleotide sites of the NNMT gene, and / or high methylation of DNA CpG sites in the NNMT gene region, and then the tumor cells are contacted with the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, to inhibit the tumor cells.

[0532] In another preferred embodiment, the method further comprises: First, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, a promoter of methylation at the nucleotide site of the NNMT gene and / or a promoter of methylation at the DNA CpG site of the NNMT gene region are administered to the tumor cells so that the tumor cells have low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide site of the NNMT gene and / or high methylation of the DNA CpG site of the NNMT gene region, and then the tumor cells are contacted with the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof to inhibit the tumor cells.

[0533] In another preferred embodiment, the above-mentioned contents of an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site of the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the eighth aspect of the present invention.

[0534] A thirteenth aspect of the present invention provides the use of the medical kit according to the fifth aspect of the present invention for the manufacture of a pharmaceutical kit for use in the prevention and / or treatment of tumors.

[0535] In another preferred embodiment, the pharmaceutical kit further comprises instructions or a label.

[0536] In another preferred embodiment, the instructions or label state that when the NNMT gene is under-expressed or not expressed, the DNA methyltransferase is over-expressed, the UHRF1 is over-expressed, the nucleotide site of the NNMT gene is hypermethylated, and / or the DNA CpG site of the NNMT gene region is hypermethylated in the tumor cells of a tumor patient, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0537] In another preferred embodiment, the instructions or label state that high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of the NNMT gene, and / or low methylation of DNA CpG sites in the NNMT gene region in tumor cells of a tumor patient renders the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, unsuitable for the prevention and / or treatment of tumors in the tumor patient.

[0538] A fourteenth aspect of the invention provides a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0539] [ka]

[0540] Here, R 1 , R 2 , R 3 and R 4 each independently represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R 5represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group; R 6 -OR 15 Or -N(R 16 R 17 ) ; R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkoxy group, or a substituted or unsubstituted C1-C8 halogenated alkoxy group; R 8 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom; R 9 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom; R 10 represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 alkyl group-substituted or unsubstituted C6-C12 aryl group-C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 halogenated alkoxy group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 halogenated alkyl group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted C1-C6 alkoxy group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-; R 11 and R 14 each independently represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R 12 and R 13 are joined to form a substituted or unsubstituted 3-10 membered heterocycloalkyl ring;

[0541] [ka]

[0542] R 16and R 17 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group, or a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C4 alkyl group-; R 18 represents a substituted or unsubstituted C1-C8 alkyl group; R 19 represents a substituted or unsubstituted C1-C10 alkylidene group.

[0543] In another preferred embodiment, said compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is as described in the first aspect of the invention.

[0544] In another preferred embodiment, the chemical structure of the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is as follows:

[0545] [ka]

[0546] Within the scope of the present invention, each of the above technical features of the present invention may be combined with the following specific technical features (embodiments) to form new or preferred technical solutions, which will not be repeated here due to the limited size of the full text. [Brief description of the drawings]

[0547]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

[0548] As a result of long-term and in-depth research, the present inventors have unexpectedly found for the first time a compound with excellent and precise therapeutic effects on tumor cells with low or no expression of the NNMT gene, tumor cells with high expression of DNA methyltransferase, tumor cells with high expression of UHRF1, tumor cells with hypermethylation of the nucleotide site of the NNMT gene, and / or tumor cells with hypermethylation of the DNA CpG site in the NNMT gene region. The expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene promoter region serve as markers for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients. The present inventors have achieved the present invention based on this.

[0549] term

[0550] As used herein, the terms "including," "comprising," and "having" may be used interchangeably and have closed definitions as well as semi-closed and open definitions. In other words, the terms have the meaning "consisting of" or "consisting essentially of."

[0551] As used herein, "there is hypermethylation of DNA CpG sites", "there is hypermethylation of DNA CpG sites", and "DNA CpG sites are hypermethylated" may be used interchangeably.

[0552] As used herein, "there is hypomethylation of DNA CpG sites", "there is hypomethylation of DNA CpG sites", and "DNA CpG sites are hypomethylated" may be used interchangeably.

[0553] As used herein, "there is hypermethylation at a nucleotide site", "the nucleotide site becomes hypermethylated", and "the nucleotide site is hypermethylated" may be used interchangeably.

[0554] As used herein, "there is hypomethylation at a nucleotide site," "the nucleotide site becomes hypomethylated," and "the nucleotide site is hypomethylated" may be used interchangeably.

[0555] As used herein, "IC50" and "IC 50 The term "50% inhibiting concentration" may be used interchangeably and refers to the concentration of an inhibitor at which 50% of the inhibitory effect is achieved.

[0556] As used herein, "methylation of DNA CpG sites," "methylation of CpG nucleotides," and "CpG methylation" may be used interchangeably.

[0557] As used herein, the term "P / S" refers to the addition of Penicillin and Streptomycin to the relevant media.

[0558] As used herein, the term "a cell" refers to a cell (e.g., a single tumor cell) or a group of cells including multiple similar cells (e.g., a tumor tissue).

[0559] As used herein, "the compound of the present invention is suitable for a tumor patient" means that the tumor of the tumor patient is sensitive to the compound of the present invention, and so on.

[0560] As used herein, "the compounds of the present invention are not suitable for tumor patients" means that the tumors of the tumor patients are insensitive to the compounds of the present invention, and the like.

[0561] As used herein, "the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region" refers to one or more of the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and the methylation level of the DNA CpG site in the NNMT gene region.

[0562] As used herein, "low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region" refers to one or more of low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and hypermethylation of DNA CpG sites in the NNMT gene region.

[0563] As used herein, "high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region" refers to one or more of high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and hypomethylation of DNA CpG sites in the NNMT gene region.

[0564] As used herein, the English name of the term "NNMT" is Nicotinamide N-Methyltransferase.

[0565] As used herein, the term "bp" refers to base pair.

[0566] As used herein, the term "SST" refers to the transcription start site.

[0567] As used herein, the term "Chr11" refers to human chromosome 11 defined according to the human genome version GCF_000001405.25 (GRCh37.p13).

[0568] As used herein, the term "human chromosome 11" refers to human chromosome 11 defined according to the human genome version GCF_000001405.25 (GRCh37.p13).

[0569] As used herein, the terms "before the transcription start site" and "after the transcription start site" do not include the transcription start site itself.

[0570] As used herein, "position 114165695 of human chromosome 11" refers to the nucleotide at position 114165695 of human chromosome 11; "position 114165730 of human chromosome 11" refers to the nucleotide at position 114165730 of human chromosome 11; "position 114165769 of human chromosome 11" refers to the nucleotide at position 114165769 of human chromosome 11; "position 114165804 of human chromosome 11" refers to the nucleotide at position 114165804 on human chromosome 11; "position 114165938 on human chromosome 11" refers to the nucleotide at position 114165938 on human chromosome 11; "position 114166050 on human chromosome 11" refers to the nucleotide at position 114166050 on human chromosome 11; and "position 114166066 on human chromosome 11" refers to the nucleotide at position 114166066 on human chromosome 11.

[0571] As used herein, gene expression includes protein expression of the gene and / or mRNA expression of the gene, and the like.

[0572] As used herein, the term "DNMT3a" refers to DNA methyltransferase 3a, which may be used interchangeably with "DNMT3A."

[0573] As used herein, the term "DNMT3b" refers to DNA methyltransferase 3b, which may be used interchangeably with "DNMT3B."

[0574] As used herein, the term "DNMT1" refers to DNA methyltransferase 1.

[0575] As used herein, the term "UHRF1" refers to ubiquitin-related tau protein 1 that contains a PHD and a RING finger domain.

[0576] As used herein, the term "MS-ESI" refers to electrospray ionization mass spectrometry.

[0577] As used herein, "1H NMR" and " 1 The term “H NMR” may be used interchangeably and refers to nuclear magnetic resonance hydrogen spectroscopy.

[0578] As used herein, "deuteration" refers to the replacement of one or more hydrogen atoms in a compound or group of atoms with a deuterium atom. Deuteration can be 1-deuteration, 2-deuteration, 3-deuteration or full deuteration.

[0579] As used herein, the term "solvate" refers to a complex formed when a compound coordinates with solvent molecules in a specific ratio.

[0580] It should be understood that one skilled in the art can select the substituents and substitution patterns on the compounds of the present invention to produce chemically stable compounds, and can synthesize said compounds using techniques known in the art and the methods described below. When substituted with one or more (multiple) substituents, it should be understood that these substituents can be located on the same carbon or on different carbons, so long as a stable structure is produced.

[0581] As used herein, the terms "substitution" or "substituted" refer to the replacement of hydrogen atoms on a group with non-hydrogen atom groups as necessary to satisfy their valences and which produce chemically stable compounds, i.e., compounds that do not spontaneously undergo transformations such as cyclization or elimination.

[0582] As used herein, "R 1 ", "R1" and "R 1 " have the same meaning, may be used interchangeably, and have the same meaning as other similar definitions.

[0583] [ka]

[0584] As used herein, the term "alkyl group" refers to a straight-chain (i.e., unbranched) or branched saturated hydrocarbon group containing only carbon and hydrogen atoms, or a group of atoms that combines straight and branched chains. A carbon number specified before the alkyl group (e.g., C1-C6 alkyl group) refers to the alkyl group having the specified number of carbon atoms (e.g., 1 to 6), for example, C1-C4 alkyl group refers to an alkyl group containing 1 to 4 carbon atoms. Representative examples of these alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, s-butyl, t-butyl, or similar groups.

[0585] As used herein, the term "alkylidene group" refers to an atomic group formed by removing one hydrogen atom from an alkyl group. The alkyl group is as defined above. An alkylidene group specified by the number of carbon atoms (e.g., a C1-C6 alkylidene group) refers to an alkylidene group having the specified number of carbon atoms (e.g., 1 to 6), for example, a C1-C4 alkylidene group refers to an alkylidene group containing 1 to 4 carbon atoms. Representative examples of these alkylidene groups include, but are not limited to, a methylidene group, an ethylidene group, a propylidene group, an isopropylidene group, a butylidene group, an isobutylidene group, an s-butylidene group, a t-butylidene group, or similar atomic groups.

[0586] As used herein, the term "alkenyl group" refers to a hydrocarbyl group formed by removing one hydrogen atom connected to a double bond from a straight or branched chain molecule having one or more double bonds. The alkenyl group specified by the number of carbon atoms before the alkenyl group (e.g., C2-C6 alkenyl group) refers to the alkenyl group having the specified number of carbon atoms (e.g., 1 to 6), for example, C2-C4 alkenyl group refers to an alkenyl group containing 2 to 4 carbon atoms. Representative examples of these alkenyl groups include vinyl groups (CH 2=CH-), butenyl group (C(CH 3 ) 2 ═CH—) or similar atomic groups, but are not limited to these.

[0587] In the present invention, the term "halogen atom" refers to a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

[0588] In the present invention, the term "halogenated" refers to substitution with a halogen atom.

[0589] As used herein, the term "halogenated alkyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three or four) hydrogen atoms of an alkyl group with halogen atoms. The alkyl group and halogen atom are as defined above. A halogenated alkyl group specified by the number of carbon atoms (e.g., C1-C8 halogenated alkyl group) refers to a halogenated alkyl group having the specified number of carbon atoms (e.g., 1 to 8), for example, a C1-C6 halogenated alkyl group refers to a halogenated alkyl group containing 1 to 6 carbon atoms. Representative examples of these halogenated alkyl groups include -CF 3 , -CHF 2 , monofluorinated isopropyl group, difluorinated butyl group or similar atomic groups.

[0590] As used herein, the term "cycloalkyl group" refers to a saturated or partially saturated monocyclic, bicyclic or polycyclic (fused, bridged or spiro) ring group. A carbon number specified before the cycloalkyl group (e.g., C3-C12) refers to the cycloalkyl group having the specified number of ring carbon atoms (e.g., 3 to 12). In some embodiments, the term "C3-C8 cycloalkyl group" refers to a saturated or partially saturated monocycloalkyl or dicycloalkyl group having 3 to 8 ring carbon atoms, including cyclopropyl, cyclobutyl, cycloamyl, cycloheptyl or similar groups. A "spirocycloalkyl group" refers to a bicyclic or polycyclic group sharing a carbon atom (called a spiro atom) between the monocyclic rings, which may contain one or more double bonds, but in which none of the rings have a completely conjugated pi-electron system. "Fused cycloalkyl group" refers to a bicyclic or polycyclic group of atoms in which each ring in the system shares all of the carbon atoms of an adjacent pair of carbon atoms with another ring in the system, where one or more rings may contain one or more double bonds, but none of the rings have a completely conjugated pi-electron system.

[0591] [ka]

[0592] As used herein, the term "halogenated cycloalkyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three or four) hydrogen atoms of a cycloalkyl group with a halogen atom. The cycloalkyl group and the halogen atom are as defined above. A cycloalkyl group limited by the number of carbon atoms (e.g., C3-C8 halogenated cycloalkyl group) refers to a cycloalkyl group having the corresponding number of ring carbon atoms (e.g., 3 to 8), for example, a C3-C8 halogenated cycloalkyl group refers to a halogenated cycloalkyl group containing 3 to 8 ring carbon atoms. Representative examples of these halogenated cycloalkyl groups include, but are not limited to, a monofluorinated cyclopropyl group, a monochlorinated cyclobutyl group, a monofluorinated cycloamyl group, a difluorinated cycloheptyl group or similar atomic groups.

[0593] As used herein, the term "alkoxyl group" refers to an R-O-atom group, where R is an alkyl group. Alkyl groups are as defined above. An alkoxyl group that is specified by the number of carbon atoms before the alkoxyl group (e.g., a C1-C8 alkoxyl group) refers to an alkoxyl group in which the alkyl group has the specified number of carbon atoms (e.g., 1 to 8). Representative examples of these alkoxyl groups include, but are not limited to, methoxy, ethoxy, N-propoxy, isopropoxy, t-butoxy, or similar groups.

[0594] As used herein, the term "halogenated alkoxyl group" refers to a halogenated alkyl group -O-, the halogenated alkyl group being as defined above. For example, a C1-C6 halogenated alkoxyl group refers to a halogenated alkoxyl group having 1 to 6 carbon atoms. Representative examples of these halogenated alkoxyl groups include monofluorinated methoxyl groups, monofluorinated ethoxyl groups, difluorinated butoxyl groups, F 3 This includes, but is not limited to, CO- or similar groups.

[0595] As used herein, the term "cycloalkoxyl group" refers to an R-O-atom group, where R is a cycloalkyl group. Cycloalkyl groups are as defined above. A cycloalkoxyl group that is specified by the number of carbon atoms before the cycloalkoxyl group (e.g., a C3-C8 cycloalkoxyl group) refers to a cycloalkyl group in the cycloalkoxyl group that has the specified number of carbon atoms (e.g., 3 to 8). Representative examples of these cycloalkoxyl groups include, but are not limited to, a cyclopropoxy group, a cyclobutoxy group, or similar groups.

[0596] As used herein, the term "heterocycloalkyl ring" refers to a fully saturated or partially unsaturated ring (including, but not limited to, a 3- to 7-membered monocyclic ring, a 7- to 11-membered bicyclic ring, or an 8- to 16-membered tricyclic ring) in which at least one heteroatom is present in a ring having at least one carbon atom. The number of members preceding the heterocycle refers to the number of ring atoms in the heterocycloalkyl ring. For example, a 3- to 16-membered heterocycle refers to a heterocycle having 3 to 16 ring atoms. Each heterocycle having a heteroatom may have one or more (e.g., 1, 2, 3, or 4) heteroatoms, each of which is independently selected from a nitrogen atom, an oxygen atom, or a sulfur atom, where the nitrogen atom or sulfur atom may be oxidized, and the nitrogen atom may also be quaternized. Representative examples of these monocyclic heterocycloalkyl rings include, but are not limited to, an azetidinyl ring, an oxetane ring, a tetrahydrofuranyl ring, a piperidine ring, and a piperazine ring. Multicyclic heterocycloalkyl rings include piperazine rings having spiro, fused and bridged rings, where the associated spiro, fused and bridged heterocycles are optionally connected to other rings by single bonds or are further fused to other cycloalkyl and heterocycles through any two or more atoms on the ring.

[0597] As used herein, the term "aryl group" refers to an all-carbon atom monocyclic or fused polycyclic (rings sharing adjacent pairs of carbon atoms) atomic group having a conjugated π-electron system, which is an atomic group of an aromatic cyclic hydrocarbon compound. The aryl group specified by the number of carbon atoms before the aryl group (e.g., C6-C12 aryl group) refers to the aryl group having the specified number of ring carbon atoms (e.g., 6 to 12). Representative examples of these aryl groups include phenyl and naphthoyl groups.

[0598] As used herein, the term "heteroaryl group" refers to an aromatic heterocyclic group having one or more (preferably one, two, three or four) heteroatoms. The group may be a single ring (monocyclic) or multiple rings (bicyclic, tricyclic or polycyclic) that are fused or covalently bonded, and each heterocyclic ring that includes a heteroatom may have one or more (e.g., one, two, three or four) heteroatoms independently selected from oxygen, sulfur and nitrogen atoms. The number of members in the heteroaryl group refers to the number of ring atoms in the heteroaryl group. For example, a 5-12 membered heteroaryl group refers to a heteroaryl group having 5 to 12 ring atoms. Representative examples of these heteroaryl groups include, but are not limited to, pyrrolyl, pyrazole, imidazole, thiazole, furan, pyridine, pyrimidine, and the like.

[0599] As used herein, the term "aryloxy group" refers to the group R-O-, where R is an aryl group, as defined above. Representative examples of aryloxy groups include, but are not limited to, phenoxy, naphthyloxy, or similar groups.

[0600] [ka]

[0601] [ka]

[0602] [ka]

[0603] [ka]

[0604] In the present invention, "prevention" refers to a method of preventing the onset of a disease and / or its associated symptoms or protecting a subject from contracting the disease. As used herein, "prevention" also refers to delaying the onset of a disease and / or its associated symptoms, as well as reducing the subject's risk of contracting the disease.

[0605] "Treatment" according to the present invention means slowing and terminating the progression of the disease or eliminating the disease, but does not require 100% inhibition, elimination or reversal. In some embodiments, the tumor and its complications are reduced, inhibited and / or reversed by at least about 10%, 30%, 50%, 80%, 90% or 100%, etc. under the action of the compound of the present invention, compared to the levels observed in the absence of the compound of the present invention.

[0606] compound

[0607] As used herein, "a compound of the present invention", "a tetracyclic compound of the present invention", "said compound of the present invention", "a compound of formula I of the present invention", or "a compound of formula I" may be used interchangeably and refer to a compound having the chemical structure of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof. This term should be understood to include mixtures of the above components.

[0608] [ka]

[0609] In particular, the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is described in the first aspect of the invention.

[0610] Typically, the compounds of formula I of the present invention are the specific compounds prepared in the examples of the present invention (including their salt forms or in the free form after removal of the salt radical).

[0611] The compounds of formula I of the present invention may be prepared by organic synthesis methods known in the art.

[0612] According to the present study, the compounds of the present invention have more obvious inhibitory effect on tumor cells with low or no expression of NNMT gene, tumor cells with high expression of DNA methyltransferase, tumor cells with high expression of UHRF1, tumor cells with hypermethylation of nucleotide site of NNMT gene and / or tumor cells with hypermethylation of DNA CpG site of NNMT gene region.Tumor cells with low or no expression of NNMT gene, tumor cells with high expression of DNA methyltransferase, tumor cells with high expression of UHRF1, tumor cells with hypermethylation of nucleotide site of NNMT gene and / or tumor cells with hypermethylation of DNA CpG site of NNMT gene region are sensitive to the compounds of the present invention.

[0613] In the present invention, the term "pharmaceutical acceptable salt" refers to a salt that is suitable for use as a drug when the compound of the present invention forms with an acid or base. Pharmaceutically acceptable salts include inorganic salts and organic salts. A preferred type of salt is a salt formed by the compound of the present invention with an acid, and the acid suitable for forming the salt includes, but is not limited to, inorganic acids such as hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, and phosphoric acid, organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, and benzenesulfonic acid, and acidic amino acids such as aspartic acid and glutamic acid. One preferred class of salts is the metal salts formed by the compounds of the present invention with bases, and bases suitable for forming such salts include, but are not limited to, inorganic bases such as sodium hydroxide, potassium hydroxide, sodium carbonate, sodium bicarbonate, and sodium phosphate, and organic bases such as ammonia, triethylamine, and diethylamine.

[0614] The present invention may convert the compounds of formula I into their pharma- ceutically acceptable salts in a conventional manner, for example, by adding a solution of a suitable acid to a solution of the compound, and removing the solvent after complete salification, the suitable salt of the compound of the present invention can be obtained.

[0615] NNMT gene

[0616] In the present invention, the English name of NNMT is Nicotinamide N-Methyltransferase. Different databases have different identification numbers for NNMT gene, such as HGNC:7861; Entrez Gene:4837; Ensembl:ENSG00000166741; OMIM:600008; UniProtKB:P40261.

[0617] According to the human genome version GCF_000001405.25 (GRCh37.p13), the NNMT gene region is located from bp 114,128,528 to bp 114,184,258 on human chromosome 11, and is a DNA sequence with a total length of 55,731 bp. This region includes the NNMT gene promoter region, the NNMT gene exon region and the NNMT gene intron region, and the NNMT gene transcription start site is at bp 114,166,535.

[0618] The NNMT gene promoter region is the nucleotide sequence from bp 114,164,535 to bp 114,167,034 on human chromosome 11, i.e., the sequence from 2000 bp (bold) before the transcription start site of the NNMT gene to the transcription start site itself and 499 bp (underlined) after it. The NNMT gene promoter region has a total length of 2500 bp, and its nucleotide sequence is shown in the following SEQ ID NO:1.

[0619] SEQ ID NO: 1: GAGGAGGTGCTTGCCAGACACTGGGTCATGGCAGTGGTCGGTGAAGCTGCAGTTGCCTAGGGCAGGGATGGAGAGAGAGTCTGGGCATGAGGAGAGGGTCTCGGGATGTTTGGCTGGACTAGATTTTACAGAAAGCCTTATCCAGGCTTTTAAAATTACTCTTTCCAGACTTCATCTGAGACTCCTTCTTCAGCCAACATTCCTTAGCCCTGAATACATTTCCTATCCTCATCTTTCCCTTCTTTTTTTTCCTTTCTTTTACATGTTTAAATTTAAACCATTCTTCGTGACCCCTTTTCTTGGGAGATTCATGGCAAGAACGAGAAGAATGATGGTGCTTGTTAGGGGATGTCCTGTCTCTCTGAACTTTGGGGTCCTATGCATTAAATAATTTTCCTGACGAGCTCAAGTGCTCCCTCTGGTCTACAATCCCTGGCGGCTGGCCTTCATCCCTTGGGCAAGCATTGCATACAGCTCATGGCCCTCCCTCTACCATACCC .

[0620] In the present invention, the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site is positions 951-2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0621] In the present invention, the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site is positions 951-1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0622] In the present invention, the region from 840 bp before the transcription start site of the NNMT gene to 469 bp before the transcription start site is positions 1161-1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0623] In the present invention, the sites of the nucleotide sequence of SEQ ID NO:1 corresponding to positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 of human chromosome 11 are shown in Table 1, respectively.

[0624] [Table 1]

[0625] DNA methylation

[0626] DNA methylation is a form of chemical modification of DNA that alters gene expression without changing the DNA sequence. Many studies have shown that DNA methylation may alter chromatin structure, DNA morphology, DNA stability, and DNA-protein interaction patterns, thereby regulating gene expression.

[0627] DNA methylation is one of the first and most thoroughly studied epigenetic regulators. In the broad sense, DNA methylation refers to the chemical modification process in which specific bases in DNA sequences acquire one methyl group via covalent bond with S-adenosyl methionine as the methyl donor under the catalysis of DNA methyltransferase 1. This DNA methylation modification can occur at the C-5 position of cytosine, the N-6 position of adenine, and the N-7 position of guanine. In general research, DNA methylation refers to the process in which the fifth carbon atom of cytosine in CpG dinucleotides is methylated. The product is called 5-methylcytosine (5-mC), which is the main form of DNA methylation in eukaryotes such as plants and animals. DNA methylation, as a relatively stable modification, can be inherited to new generations of DNA during the DNA replication process under the action of DNA methyltransferases, making it an important regulator of epigenetic inheritance.

[0628] DNA methylation reactions can be divided into two types: in the first type, DNA with two unmethylated strands is methylated, called de novo methylation, and in the second type, double-stranded DNA with one methylated strand is methylated on the other unmethylated strand, called maintenance methylation.

[0629] Typically, DNA methylation is the methylation of DNA CpG sites. CpG dinucleotides are distributed very unevenly in the human genome, and some segments of the genome have CpGs at higher than normal rates. Enriched regions of CpG sites (also called CpG islands) are mainly located in promoter and exon regions of genes, and are some regions that enrich for CpG dinucleotides, among which more than 60% of gene promoters contain CpG islands. Here, CpG is an abbreviation of cytosine (C)-phosphate (p)-guanine (G).

[0630] Intracellular gene expression is subject to various types of regulation by signal transduction pathways, transcription factors, and epigenetic modifications. DNA methylation modification is an important method by which epigenetic modifications regulate gene expression. The DNA methylation level in a specific gene region always affects the expression level of that gene. Compared with the regulation of gene expression by signal transduction pathways and transcription factors, DNA methylation modification, an epigenetic modification, has a more stable effect on gene expression and is less susceptible to the extracellular environment. DNA methylation modification is an ideal biomarker because it can be easily detected by existing technologies.

[0631] tumor

[0632] According to the present study, the compounds of the present invention are useful for the prevention and / or treatment of tumors.

[0633] In the present invention, the terms "tumor," "carcinosis," "cancer," and "mass" may be used interchangeably.

[0634] In a preferred embodiment of the present invention, the "tumor" described in the present invention includes tumors in which the NNMT gene is underexpressed or not expressed. As a representative example, the tumors in which the NNMT gene is underexpressed or not expressed described in the present invention are as described in the first aspect of the present invention.

[0635] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which DNA methyltransferase is highly expressed. As a representative example, the tumor in which DNA methyltransferase is highly expressed according to the present invention is as described in the first aspect of the present invention.

[0636] The DNA methyltransferase according to the present invention includes, but is not limited to, DNMT1, DNMT3a, DNMT3b, or a combination thereof. Preferably, the DNA methyltransferase according to the present invention includes DNMT1.

[0637] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which DNMT1 is highly expressed. As a representative example, the tumor in which DNMT1 is highly expressed according to the present invention is as described in the first aspect of the present invention.

[0638] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which DNMT3a is highly expressed. As a representative example, the tumor in which DNMT3a is highly expressed according to the present invention is as described in the first aspect of the present invention.

[0639] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which DNMT3b is highly expressed. As a representative example, the tumor in which DNMT3b is highly expressed according to the present invention is as described in the first aspect of the present invention.

[0640] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which UHRF1 (ubiquitin-related tau protein 1 containing PHD and ring finger domain) is highly expressed. As a representative example, the tumor in which UHRF1 according to the present invention is highly expressed is as described in the first aspect of the present invention.

[0641] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which the nucleotide site of the NNMT gene is hypermethylated. As a representative example, the tumor in which the nucleotide site of the NNMT gene according to the present invention is hypermethylated is as described in the first aspect of the present invention.

[0642] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which the NNMT gene region DNA CpG site is hypermethylated. As a representative example, the tumor in which the NNMT gene region DNA CpG site is hypermethylated according to the present invention is as described in the first aspect of the present invention.

[0643] Typically, the tumor according to the invention is as described in the first aspect of the invention.

[0644] In the present invention, representative tumor types corresponding to various tumor cell lines are shown in Table 2 below.

[0645] [Table 2]

[0646] Antitumor drugs

[0647] In the present invention, the antitumor drug can be the compound of formula I of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0648] use

[0649] The present invention provides the use of the compounds of the invention in the prevention and / or treatment of tumors.

[0650] In particular, the compound of the present invention has excellent therapeutic effect on tumors with low or no expression of NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of NNMT gene and / or tumors with hypermethylation of DNA CpG sites in NNMT gene region, i.e., tumors with low or no expression of NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of NNMT gene and / or tumors with hypermethylation of DNA CpG sites in NNMT gene region are sensitive to the compound of the present invention. The expression level of NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of NNMT gene and / or the methylation level of DNA CpG sites in NNMT gene region serve as markers for determining whether the compound of the present invention is suitable for the treatment of tumor cells. The marker can effectively identify tumor patients who are sensitive to the compound of the present invention and improve the therapeutic efficacy thereof, and may also avoid administering the compound of the present invention to tumor patients who are not sensitive thereto, thereby realizing precise tumor treatment.

[0651] The present invention provides a method for preventing and / or treating a tumor, which comprises administering the compound of the present invention to a subject.

[0652] The compound of the present invention has excellent and precise therapeutic effects on tumors with low or no expression of NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in NNMT gene region. In the process of preventing and / or treating tumors, first, an inhibitor of NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, a promoter of methylation of nucleotide sites of NNMT gene, and / or a promoter of methylation of DNA CpG sites in NNMT gene region are given to the subject of treatment so that the tumor of the subject of treatment has low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of NNMT gene, and / or hypermethylation of DNA CpG sites in NNMT gene region, and then the compound of the present invention is given to prevent and / or treat tumors. Therefore, a compound capable of significantly enhancing the antitumor effect by combining an NNMT gene inhibitor, a DNA methyltransferase promoter, a UHRF1 promoter, a promoter of methylation at the nucleotide site of the NNMT gene, and / or a promoter of methylation at the DNA CpG site in the NNMT gene region has been developed. The compound of the present invention can be combined with an NNMT gene inhibitor, a DNA methyltransferase promoter, a UHRF1 promoter, a promoter of methylation at the nucleotide site of the NNMT gene, and / or a promoter of methylation at the DNA CpG site in the NNMT gene region, thereby significantly enhancing the therapeutic effect of the compound of the present invention against tumors.

[0653] In another preferred embodiment, the subject to be treated is a human or non-human mammal (eg, rodents, rabbits, monkeys, livestock, dogs, cats).

[0654] In the present invention, the method for achieving low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region in a tumor is not particularly limited, and for example, low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region in a tumor can be achieved specifically through means such as gene insertion, gene knockout, and gene suppression (e.g., introducing shRNA).

[0655] marker

[0656] The present invention provides a marker for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients, the marker comprising an expression level of the NNMT gene, an expression level of DNA methyltransferase, an expression level of UHRF1, a methylation level of a nucleotide site of the NNMT gene, and / or a methylation level of a DNA CpG site in the NNMT gene region.

[0657] In one embodiment, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site of the NNMT gene promoter region serve as markers for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients. The method includes:

[0658] In tumor cells of a tumor patient, when the NNMT gene is under-expressed or not expressed, the DNA methyltransferase is over-expressed, the UHRF1 is over-expressed, the nucleotide site of the NNMT gene is over-methylated, and / or the DNA CpG site of the NNMT gene region is over-methylated, the compound of the present invention is suitable for preventing and / or treating tumors in tumor patients; and / or

[0659] This includes, but is not limited to, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites in the NNMT gene, and / or low methylation of DNA CpG sites in the NNMT gene region in tumor cells of a tumor patient, making the compounds of the present invention unsuitable for tumor prevention and / or treatment in tumor patients.

[0660] Specifically, tumors in which the NNMT gene is under-expressed or not expressed, tumors in which DNA methyltransferase (e.g., DNMT1) is highly expressed, tumors in which UHRF1 is highly expressed, tumors in which nucleotide sites in the NNMT gene are hypermethylated, and / or tumors in which DNA CpG sites in the NNMT gene region are hypermethylated are as described in the first aspect of the present invention.

[0661] In one preferred embodiment of the present invention, the tumor with high expression of the NNMT gene, the tumor with low expression of a DNA methyltransferase (e.g., DNMT1), the tumor with low expression of UHRF1, the tumor with hypomethylation of nucleotide sites in the NNMT gene and / or the tumor with hypomethylation of DNA CpG sites in the NNMT gene region are as described in the second aspect of the present invention.

[0662] The present invention further provides the use of the marker (or the expression level thereof) or detection agent, which is used to manufacture a detection agent kit, which is used to determine whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients.

[0663] Compositions or formulations, combinations of active ingredients and medical kits, and methods of administration

[0664] Preferably, the composition according to the present invention is a pharmaceutical composition, and the composition according to the present invention may comprise a pharma- ceutically acceptable carrier.

[0665] As used herein, "pharmaceutical acceptable carrier" refers to one or more compatible solid, semi-solid, liquid and gel fillers that are suitable for human or animal use and must be of sufficient purity and sufficiently low toxicity. "Compatibility" refers to the fact that each component in the drug composition and the active ingredient of the drug can be mixed and mixed together without significantly decreasing the efficacy of the drug.

[0666] In the present invention, it should be understood that the pharma- ceutically acceptable carrier is not particularly limited and may be selected from materials commonly used in the art, prepared by a conventional method, or purchased from the market. Some representative examples of pharma-ceutically acceptable carriers include cellulose and its derivatives (e.g., methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, etc.), gelatin, talc, solid lubricants (e.g., stearic acid and magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyhydric alcohols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (e.g., Tween), wetting agents (e.g., sodium lauryl sulfate), buffers, chelating agents, thickeners, pH adjusters, penetration enhancers, colorants, flavorings, stabilizers, antioxidants, preservatives, bacteriostatic agents, heat-free raw water, etc.

[0667] In a preferred embodiment of the present invention, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0668] In a preferred embodiment of the present invention, the type of the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0669] Representative examples of the composition or preparation include tablets, injections, infusions, ointments, gels, solutions, pills, and coatings.

[0670] The drug formulation should be consistent with the dosage regimen. The drug of the present invention may also be used with other synergistic therapeutic agents (before, during, or after use). When using a drug composition or formulation, a safe and effective amount of drug is administered to the subject (e.g., a human or non-human mammal). The safe and effective amount is usually at least about 10 μg / kg of body weight, and in most cases, less than about 8 mg / kg of body weight, preferably about 10 μg / kg to about 1 mg / kg of body weight. Of course, the specific dosage should be determined in consideration of conditions such as the route of administration and the health condition of the patient, but these conditions are taken into account by a skilled physician.

[0671] The present invention mainly has the following excellent technical effects.

[0672] 1. The present invention has unexpectedly found a compound that has a significantly better refinement therapeutic effect on tumors with low or no expression of NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in NNMT gene region. Tumors with low or no expression of NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in NNMT gene region are highly sensitive to the compound of the present invention, that is, the compound of the present invention has a better refinement therapeutic effect on tumors with low or no expression of NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in NNMT gene region. Therefore, the compound of the present invention may improve the therapeutic effect of the refinement treatment on tumors with low or no expression of NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of NNMT gene and / or tumors with hypermethylation of DNA CpG sites in NNMT gene region, and avoid administering the compound of the present invention to tumor patients who are not sensitive to it. Therefore, the compound of the present invention, which has a significantly better refinement therapeutic effect on tumors with low or no expression of NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites of NNMT gene and / or tumors with hypermethylation of DNA CpG sites in NNMT gene region, has the advantages of better preventive and therapeutic effect on tumors, low drug dosage, small side effects, etc., and improves the preventive and therapeutic effect of the compound of the present invention on tumors, reduces side effects, and improves patient compliance with medication.

[0673] 2. The compounds of the present invention have excellent drug discovery potential.

[0674] The present invention will now be further described in conjunction with specific examples. It should be understood that these embodiments are intended only to illustrate the present invention, without limiting the scope of the present invention. In the following examples, the experimental methods without specific conditions are usually in accordance with general conditions or manufacturer's recommendations. Unless otherwise specified, percentages and ratios are calculated by weight.

[0675] Working Example

[0676] DNMT3a refers to DNA methyltransferase 3a, and its English name is DNA methyltransferase 3a, NCBI entrez gene:1788; Uniprotkb / Swiss-port: Q9Y6K1.

[0677] DNMT3b refers to DNA methyltransferase 3b, and its English name is NDNA methyltransferase 3b, CBI entrez gene:1789; Uniprotkb / Swiss-port: Q9UBC3.

[0678] DNMT1 refers to DNA methyltransferase 1, and its English name is DNA methyltransferase 1, NCBI entrez gene:1786; Uniprotkb / Swiss-port: P26358.

[0679] UHRF1 refers to ubiquitin-related tau protein 1 containing PHD and RING finger domains, and its English name is NCBI entrez gene:29128; Uniprotkb / Swiss-port:Q96T88.

[0680] The English name of the NNMT gene is Nicotinamide N-Methyltransferase.

[0681] The nucleotide sequence of the promoter region of the NNMT gene is shown in SEQ ID NO:1.

[0682] The region extending from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene corresponds to positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0683] The region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0684] The region from 840 bp before the transcription start site of the NNMT gene to 469 bp before the transcription start site is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0685] Example 1 Synthesis of compound AB31706

[0686] The chemical structure of the compound AB31706 is as follows:

[0687] [ka]

[0688] Compound 1 (337 mg, 1 mmol) was dissolved in tetrahydrofuran (20 mL), followed by compound 2 (2 mL, 3 mmol / L) and stirred at room temperature overnight. After detecting a new compound by thin layer chromatography, the reaction was quenched with water, the product was filtered through diatomaceous earth, the filtrate was concentrated under reduced pressure to remove the organic solvent, and the excess aqueous phase was then filtered off to give compound 3 as a solid (weight 190 mg, yield 36.55%). Step (2):

[0689] [ka]

[0690] Compound 3 (190 mg, 0.52 mmol) was dissolved in acetic acid (510 mL) and heated to 120 °C, followed by the addition of liquid bromine (83.2 mg, 0.52 mmol) in acetic acid (1 mL) and stirring for 1 h. When a new compound was detected by thin layer chromatography, the reaction was quenched with water, the product was filtered through diatomaceous earth, the filtrate was concentrated under reduced pressure to remove the organic solvent, and the excess aqueous phase was then filtered off to give compound AB31706 (68.2 mg) as a solid.

[0691] MS-ESI calculated value [M-Br - ] + : 364.42, actual value: 364.10. 1 H NMR(400 MHz, DMSO-d6) :δ 8.78(s, 1H), 8.16(d, J = 9.1 Hz, 1H), 7.99(d, J = 9.1 Hz, 1H), 7.71(s, 1H), 7.08(s, 1H), 6.14(s, 2H), 4.84 - 4.76(m, 2H), 4.03(d, J = 3.9 Hz, 6H), 3.78(s, 2H), 3.14(d, J = 5.3 Hz, 2H), 1.43(s, 3H).

[0692] Example 2 Synthesis of compound AB31707

[0693] The chemical structure of the compound AB31707 is as follows:

[0694] [ka]

[0695] Compound 1 (337 mg, 1 mmol) was dissolved in tetrahydrofuran (20 mL), followed by the addition of compound 2 (2 mL, 3 mmol / L) and stirring at room temperature overnight. When a new compound was detected by thin layer chromatography, the reaction was quenched with water, the product was filtered through diatomaceous earth, the filtrate was concentrated under reduced pressure to remove the organic solvent, and the excess aqueous phase was then filtered off to give compound 3 (230 mg) as a solid. Step (2):

[0696] [ka]

[0697] Compound 3 (50 mg, 0.12 mmol) was dissolved in acetic acid (5 mL) and heated to 120 °C, followed by addition of liquid bromine (20 mg, 0.12 mmol) in acetic acid (1 mL) and stirring for 1 h. When a new compound was detected by thin layer chromatography, the reaction was quenched with water, the product was filtered through diatomaceous earth, the filtrate was concentrated under reduced pressure to remove the organic solvent, and the excess aqueous phase was then filtered off to give compound AB31707 (68.2 mg) as a solid.

[0698] MS-ESI calculated value [M-Br - ] + : 392.47, actual value: 392.05. 1 H NMR(400 MHz, DMSO-d6) :δ 8.77(s, 1H), 8.16(d, J = 9.1 Hz, 1H), 7.98(d, J = 9.1 Hz, 1H), 7.70(s, 1H), 7.08(s, 1H), 6.13(s, 2H), 4.78(s, 1H), 4.02(d, J = 11.2 Hz, 6H), 3.73(d, J = 9.9 Hz, 2H), 3.13(s, 3H), 1.75(s, 2H), 1.57(d, J = 7.3 Hz, 2H), 1.20(s, 2H), 0.98(t, J = 7.3 Hz, 3H).

[0699] Example 3 Synthesis of compound AB31711

[0700] The chemical structure of the compound AB31711 is as follows:

[0701] [ka]

[0702] Compound 1 (200 mg, 0.508 mmol) was dissolved in acetic acid (10 mL) and heated to 120 °C, followed by the addition of liquid bromine (488 mg, 3.05 mmol) in acetic acid (1 mL) and stirring for 1 h. When a new compound was detected by thin layer chromatography, the reaction was quenched with water, the product was filtered through diatomaceous earth, the filtrate was concentrated under reduced pressure to remove the organic solvent, and the excess aqueous phase was then filtered off to give compound AB31711 as a solid.

[0703] MS-ESI calculated value [M-Br - ] + : 471.37, actual value: 472.00. 1H NMR (400 MHz, DMSO-d6) δ 8.52(s, 1H), 8.41(s, 1H), 7.74(s, 1H), 7.11(s, 1H), 6.15(s, 2H), 4.81(t, J = 7.4 Hz, 2H), 4.07(s, 3H), 4.02(s, 3H), 3.71(s, 2H), 3.12(s, 2H), 1.75(s, 2H), 1.57(d, J = 7.1 Hz, 2H), 0.98(t, J = 7.3 Hz, 3H).

[0704] Example 4 Synthesis of compound AB31716

[0705] The chemical structure of the compound AB31716 is as follows:

[0706] [ka]

[0707] Compound 1 (322 mg, 1 mmol) was dissolved in N,N-dimethylformamide (8 mL), then compound 2 (884.4 mg, 4 mmol) was added, and after stirring at 80°C for 16 hours, the complete reaction was confirmed by LCMS check, the reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, combined, filtered, and concentrated under reduced pressure to remove the organic solvent, and finally purified by column chromatography (DCM / MeOH=20 / 1) to obtain solid compound AB31716 (122.9 mg).

[0708] MS-ESI calculated value [M-Br - ] + : 462.60, actual value: 462.25. 1H NMR (400 MHz, DMSO-d6) :δ 9.72(s, 1H), 8.90(s, 1H), 8.17(d, J = 9.1 Hz, 1H), 7.97(s, 1H), 7.77(s, 1H), 7.07(s, 1H), 6.15(s, 2H), 4.91(s, 2H), 4.25(t, J = 6.7 Hz, 2H), 4.02(s, 3H), 3.18(s, 2H), 1.89 - 1.79(m, 2H), 1.44(s, 2H), 1.23(s, 12H), 0.82(d, J = 7.0 Hz, 3H).

[0709] Example 5 Synthesis of compound AB31717

[0710] The chemical structure of the compound AB31717 is as follows:

[0711] [ka]

[0712] Compound 1 (322 mg, 1 mmol) was dissolved in N,N-dimethylformamide (8 mL), then compound 2 (996.92 mg, 4 mmol) was added, and after stirring at 80°C for 16 hours, the complete reaction was confirmed by LCMS check, the reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, combined, filtered, and concentrated under reduced pressure to remove the organic solvent, and finally, the solid compound AB31717 (144.5 mg) was obtained through column chromatography (DCM / MeOH=20 / 1).

[0713] MS-ESI calculated value [M-Br - ] + : 490.65, actual value: 490.25. 1H NMR (400 MHz, DMSO-d6) :δ 9.71(s, 1H), 8.90(s, 1H), 8.16(d, J = 8.9 Hz, 1H), 7.95(d, J = 9.3 Hz, 1H), 7.76(s, 1H), 7.06(s, 1H), 6.14(s, 2H), 4.91(s, 2H), 4.25(s, 2H), 4.02(s, 3H), 3.17(s, 2H), 1.84(s, 2H), 1.44(s, 2H), 1.21(s, 16H), 0.81(d, J = 6.8Hz, 3H).

[0714] Example 6 Synthesis of compound AB31718

[0715] The chemical structure of the compound AB31718 is as follows:

[0716] [ka]

[0717] Compound 1 (322 mg, 1 mmol) was dissolved in N,N-dimethylformamide (8 mL), then compound 2 (916.44 mg, 4 mmol) was added, and after stirring at 80°C for 16 hours, the complete reaction was confirmed by LCMS check, the reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, combined, filtered, and concentrated under reduced pressure to remove the organic solvent, and finally, the solid compound AB31718 (83.9 mg) was obtained through column chromatography (DCM / MeOH=20 / 1).

[0718] MS-ESI calculated value [M-Br - ] + : 470.54, actual value: 470.10. 1H NMR (400 MHz, DMSO-d6) δ 9.74(s, 1H), 8.90(s, 1H), 8.16(s, 1H), 7.96(d, J = 9.0 Hz, 1H), 7.77(s, 1H), 7.25(s, 2H), 7.06(s, 1H), 6.90(d, J = 8.2 Hz, 3H), 6.14(s, 2H), 4.90(s, 2H), 4.33(s, 2H), 4.05(s, 2H), 4.01(s, 3H), 3.17(s, 2H), 1.97(d, J = 22.8Hz, 4H).

[0719] Example 7 Synthesis of compound AB31721

[0720] The chemical structure of the compound AB31721 is as follows:

[0721] [ka]

[0722] Compound 1 (161 mg, 0.5 mmol) was dissolved in N,N-dimethylformamide (8 mL), then compound 2 (400 mg, 2 mmol) was added, and after stirring at 80°C for 16 hours, the complete reaction was confirmed by LCMS check, the reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, combined, filtered, and concentrated under reduced pressure to remove the organic solvent, and finally, the solid compound AB31721 (122.9 mg) was obtained through column chromatography (DCM / MeOH=20 / 1).

[0723] MS-ESI calculated value [M-Br - ] + : 443.31, actual value: 444.10. 1H NMR (400 MHz, DMSO-d6): δ 9.76(s, 1H), 8.90(s, 1H), 8.17(d, J = 9.2 Hz, 1H), 7.98(d, J = 9.2 Hz, 1H), 7.76(s, 1H), 7.06(s, 1H), 6.14(s, 2H), 4.91(s, 2H), 4.38(t, J = 6.1 Hz, 2H), 4.03(s, 4H), 3.79(t, J = 6.6 Hz, 3H), 3.19(d, J = 5.5 Hz, 3H), 2.42 - 2.35(m, 2H).

[0724] Example 8 Synthesis of compound AB31722

[0725] The chemical structure of the compound AB31722 is as follows:

[0726] [ka]

[0727] Compound 1 (100 mg, 0.3 mmol) was dissolved in acetonitrile (10 mL), compound 2 (100 mg, 3 mmol) was added at room temperature, and the mixture was stirred at room temperature for 2 hours. When a new compound was detected by thin layer chromatography, the reaction solution was quenched with methanol (2 mL), concentrated, and the concentrate was triturated with dichloromethane to obtain solid compound AB31722 (70 mg).

[0728] MS-ESI calculated value [M-Br - ] + : 420.48, actual value: 420.10. 1H NMR(400 MHz,DMSO-d6) δ 9.60(s, 1H), 9.01(s, 1H), 8.27(d, J = 9.4 Hz, 1H), 8.18(d, J = 9.1 Hz, 1H), 7.79(s, 1H), 7.07(s, 1H), 6.15(s, 2H), 4.90(s, 2H), 3.99(s, 3H), 3.19(s, 2H), 2.78(s, 1H), 1.88 - 1.79(m, 2H), 1.75(d, J = 6.8 Hz, 2H), 1.03(t, J = 7.4Hz, 6H).

[0729] Example 9 Synthesis of compound AB31723

[0730] The chemical structure of the compound AB31723 is as follows:

[0731] [ka]

[0732] Compound 1 (322 mg, 1 mmol) was dissolved in acetonitrile (10 mL), compound 2 (360 mg, 3 mmol) was added at room temperature, and the mixture was stirred at room temperature for 2 hours. When a new compound was detected by thin layer chromatography, the reaction solution was quenched with methanol (2 mL), concentrated, and the concentrate was triturated with dichloromethane to obtain solid compound AB31723 (204.1 mg).

[0733] MS-ESI calculated value [M-Br - ] + : 406.45, actual value: 406.10. 1H NMR (400 MHz, DMSO-d6) δ 9.80(s, 1H), 8.97(s, 1H), 8.23(s, 1H), 8.19(s, 1H), 7.77(s, 1H), 7.06(s, 1H), 6.14(s, 2H), 4.88(s, 2H), 3.99(s, 3H), 3.19(s, 2H), 2.82(t, J = 7.4 Hz, 2H), 1.70(s, 2H), 1.44(d, J = 7.5 Hz, 2H), 0.94(t, J = 7.4 Hz, 3H).

[0734] Example 10 Synthesis of compound AB31731

[0735] The chemical structure of the compound AB31731 is as follows:

[0736] [ka]

[0737] Compound 1 (322 mg, 1 mmol) was dissolved in N,N-dimethylformamide (8 mL), then compound 2 (620.28 mg, 4 mmol) was added, and after stirring at 80°C for 16 hours, the complete reaction was confirmed by LCMS check, the reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, combined, filtered, and concentrated under reduced pressure to remove the organic solvent, and finally, the solid compound AB31731 (35.4 mg) was obtained through column chromatography (DCM / MeOH=20 / 1).

[0738] MS-ESI calculated value [M-Br - ] + : 440.94, actual value: 440.15. 1H NMR (400 MHz, DMSO-d6) :δ 9.71(s, 1H), 8.90(s, 1H), 8.16(d, J = 9.1 Hz, 1H), 7.95(d, J = 9.4 Hz, 1H), 7.76(s, 1H), 7.06(s, 1H), 6.14(s, 2H), 4.91(s, 2H), 4.26(t, J = 6.8 Hz, 2H), 4.02(s, 3H), 3.63(t, J = 6.6 Hz, 2H), 3.17(s, 2H), 1.85(s, 2H), 1.74(s, 2H), 1.48(s, 4H).

[0739] Example 11 Synthesis of compound AB31737

[0740] The chemical structure of the compound AB31737 is as follows:

[0741] [ka]

[0742] Compound 1 (322 mg, 1 mmol) was dissolved in N,N-dimethylformamide (8 mL), then compound 2 (868.6 mg, 4 mmol) was added, and after stirring at 80°C for 16 hours, the complete reaction was confirmed by LCMS check, the reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, combined, filtered, and concentrated under reduced pressure to remove the organic solvent, and finally, the solid compound AB31737 (31.1 mg) was obtained through column chromatography (DCM / MeOH=20 / 1).

[0743] MS-ESI calculated value [M-Br - ] + : 458.58, actual value: 458.20. 1H NMR (400 MHz, DMSO-d6) :δ 9.78(s, 1H), 8.91(s, 1H), 8.16(d, J = 9.1 Hz, 1H), 7.96(d, J = 8.8 Hz, 1H), 7.77(s, 1H), 7.06(s, 1H), 6.15(s, 2H), 4.92(s, 3H), 4.85(d, J = 7.2 Hz, 2H), 4.04(s, 3H), 3.17(s, 2H), 1.94(s, 4H), 1.61(s, 3H), 1.54(s, 3H), 1.46(s, 3H), 1.20(s, 2H).

[0744] Example 12 Synthesis of compound AB31739

[0745] The chemical structure of the compound AB31739 is as follows:

[0746] [ka]

[0747] Compound 1 (300 mg, 0.89 mmol) was dissolved in ethanol (20 mL), then compound 2 (4.17 g, 32.27 mmol) was added, and the mixture was stirred at 78°C overnight. The reaction was confirmed to be complete by LCMS. The reaction mixture was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and concentrated under reduced pressure to remove the organic solvent. Solid compound AB31739 (31.8 g) was obtained through purification.

[0748] MS-ESI calculated value [M-Br - ] + : 433.25, actual value: 433.40. 1H NMR(399 MHz, cd3od) δ 9.60(s, 1H), 8.52(s, 1H), 8.47(s, 1H), 7.84(d, J = 8.8 Hz, 1H), 7.58(s, 2H), 6.91(s, 1H), 6.07(s, 2H), 4.03(s, 4H), 3.60(t, J = 7.3 Hz, 3H), 3.21(s, 3H), 1.68(s, 3H), 1.41(s, 3H), 1.28(d, J = 11.4 Hz, 10H), 0.87(d, J = 4.4 Hz, 4H).

[0749] Example 13 Synthesis of compound AB31740

[0750] The chemical structure of the compound AB31740 is as follows:

[0751] [ka]

[0752] Compound 1 (200 mg, 0.6 mmol) was dissolved in ethanol (10 mL), and then compound 2 (726 mg, 6 mmol) was added. After stirring at 78°C overnight, a new compound was detected by thin layer chromatography. The reaction solution was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent, and the solid compound AB31740 (7.3 mg) was obtained through a purification process. MS-ESI calculated value [M-Br - ] + : 425.19, actual value: 425.15. 1H NMR(400 MHz, cd3od) δ 9.33(s, 1H), 8.48(s, 1H), 7.84(d, J = 8.7 Hz, 1H), 7.61(d, J = 10.2 Hz, 2H), 7.26 -7.16(m, 5H), 6.92(s, 1H), 6.08(s, 2H), 4.71- 4.67(m, 2H), 4.58(s, 1H), 4.00(s, 3H), 3.86(t, J = 6.8 Hz, 2H), 3.22 - 3.18(m, 2H), 2.95(t, J = 6.8 Hz, 2H).

[0753] Example 14 Synthesis of compound AB31748

[0754] The chemical structure of the compound AB31748 is as follows:

[0755] [ka]

[0756] Compound 1 (337 mg, 1 mmol) was dissolved in 80% ethanol (5 mL), then acetic acid (4 mL) and compound 2 (1.20 g, 10 mmol) were added, and the mixture was stirred at 90°C for 4 hours. After that, a new compound was detected by thin layer chromatography. When the reaction was completed, an appropriate amount of hydrochloric acid was added to the reaction solution to replace the hydrochloride salt, the reaction solution was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and concentrated under reduced pressure to remove the organic solvent. Finally, the solid compound AB31748 was obtained through column chromatography (DCM / MeOH=20 / 1).

[0757] MS-ESI calculated value [M-Cl - ] + : 482.59, actual value: 482.30. 1H NMR(400 MHz, DMSO-6) :δ 9.96(s, 1H), 8.06(d, J = 9.6 Hz, 1H), 7.75(d, J = 9.4 Hz, 1H), 7.34(d, J = 8.4 Hz, 2H), 7.13(s, 1H), 7.05(d, J = 7.7 Hz, 2H), 6.96(s, 1H), 6.04(s, 2H), 4.83(s, 2H), 4.66(s, 2H), 4.08(s, 3H), 3.98(s, 3H), 3.12(s, 2H), 1.23(s, 9H).

[0758] Example 15 Synthesis of compound AB31757

[0759] The chemical structure of the compound AB31757 is as follows:

[0760] [ka]

[0761] Compound 1 (200 mg, 0.59 mmol) was dissolved in ethanol (5 mL), followed by the addition of acetic acid (4 mL) and butyraldehyde (424.8 mg, 5.9 mmol). After stirring at 90°C for 4 hours, a new compound was detected by thin layer chromatography. The reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent, and the solid compound AB31757 (23.8 mg) was obtained via column chromatography. MS-ESI calculated value [M-Cl - ] + : 392.47, actual value: 392.65. 1H NMR (400 MHz, DMSO-6) :δ 9.86(s, 1H), 8.17(s, 2H), 7.26(s, 1H), 7.13(s, 1H), 6.15(s, 2H), 4.76(s, 2H), 4.06(d, J = 2.6 Hz, 6H), 3.05(s, 2H), 1.72(s, 2H), 1.38(d, J = 6.7 Hz, 2H), 1.13(s, 2H), 0.88(t, J = 7.1 Hz, 3H).

[0762] Example 16 Synthesis of compound AB31758

[0763] The chemical structure of the compound AB31758 is as follows:

[0764] [ka]

[0765] Compound 1 (200 mg, 0.59 mmol) was dissolved in 80% ethanol (5 mL), then valeraldehyde (507.4 mg, 5.9 mmol) and glacial acetic acid (4 mL) were added, and the mixture was heated to 90°C and stirred for 4 hours. After that, a new compound was detected by thin-layer chromatography. The reaction mixture was diluted with water, and the organic phase was extracted with ethyl acetate. The mixture was combined and filtered, and then concentrated under reduced pressure to remove the organic solvent. The purification process (equipment: Shimadzu PREP-HPLC system; column: Sharpsil-U C18 (250 mm x 30 x 10 um, 100 Å); mobile phase: 0.1% hydrochloric acid aqueous solution / acetonitrile; mobile phase: 5%-25% acetonitrile in the 1 min-20 min interval, 25%-35% acetonitrile in the 20 min-50 min interval; column temperature: 25 ℃; detection wavelength: 224 / 254 nm; flow rate: 30 mL / min; injection volume: 2.0 mL; sample concentration: 25 mg / mL to obtain solid compound AB31748.

[0766] MS-ESI calculated value [M-Cl - ]+ : 406.49, actual value: 406.10. 1H NMR (400 MHz, DMSO-6) δ 9.85(s, 1H), 8.17(s, 2H), 7.24(s, 1H), 7.13(s, 1H), 6.15(s, 2H), 4.76(s, 2H), 4.06(d, J = 3.1 Hz, 6H), 3.31 - 3.28(m, 2H), 3.05(s, 2H), 1.80 - 1.64(m, 2H), 1.38 - 1.24(m, 4H), 0.83(t, J = 7.0 Hz, 3H).

[0767] Example 17 Synthesis of compound AB31759

[0768] The chemical structure of the compound AB31759 is as follows:

[0769] [ka]

[0770] Compound 1 (200 mg, 0.59 mmol) was dissolved in ethanol (5 mL), followed by the addition of acetic acid (4 mL) and caproaldehyde (590 mg, 5.9 mmol). After stirring at 90°C for 4 hours, a new compound was detected by thin layer chromatography. The reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent, and the solid compound AB31759 (56.9 mg) was obtained via column chromatography.

[0771] MS-ESI calculated value [M-Cl - ] + : 420.52, actual value: 420.20. 1H NMR (400 MHz, DMSO-6) δ 9.85(s, 1H), 8.17(s, 2H), 7.25(s, 1H), 7.13(s, 1H), 6.15(s, 2H), 4.75(s, 2H), 4.06(d, J = 2.4 Hz, 6H), 3.28 - 3.26(m, 2H), 3.04(s, 2H), 1.72(s, 2H), 1.35(s, 2H), 1.22(s, 4H), 0.83(d, J = 6.8 Hz, 3H).

[0772] Example 18 Synthesis of compound AB31760

[0773] The chemical structure of the compound AB31760 is as follows:

[0774] [ka]

[0775] Compound 1 (200 mg, 0.59 mmol) was dissolved in ethanol (5 mL), followed by the addition of acetic acid (4 mL) and heptaldehyde (590 mg, 5.9 mmol). After stirring at 90°C for 4 hours, a new compound was detected by thin layer chromatography. The reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent, and the solid compound AB31760 (15.6 mg) was obtained via column chromatography.

[0776] MS-ESI calculated value [M-Cl - ] + : 434.55, actual value: 434.30. 1H NMR (400 MHz, DMSO-6) δ 9.86(s, 1H), 8.17(s, 2H), 7.26(s, 1H), 7.13(s, 1H), 6.15(s, 2H), 4.76(s, 2H), 4.06(d, J = 2.0 Hz, 6H), 3.05(s, 2H), 1.72(s, 2H), 1.34(s, 2H), 1.20(s, 8H), 0.82(t, J = 6.7 Hz, 3H).

[0777] Example 19 Synthesis of compound AB31761

[0778] The chemical structure of the compound AB31761 is as follows:

[0779] [ka]

[0780] Compound 1 (337 mg, 1 mmol) was dissolved in 80% ethanol (5 mL), then acetic acid (4 mL) and octylaldehyde (1.56 g, 10 mmol) were added, and the mixture was stirred at 90°C for 4 hours. After that, a new compound was detected by thin layer chromatography. The reaction solution was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and concentrated under reduced pressure to remove the organic solvent. Solid compound AB31761 (30.3 mg) was obtained through column chromatography (DCM / MeOH=20 / 1).

[0781] MS-ESI calculated value [M-Cl - ] + : 448.57, actual value: 448.45. 1H NMR(400 MHz, DMSO-6) δ 9.86(s, 1H), 8.17(s, 2H), 7.26(s, 1H), 7.13(s, 1H), 6.16(s, 2H), 4.76(s, 2H), 4.06(d, J = 2.1 Hz, 6H), 3.05(s, 2H), 1.71(s, 2H), 1.34(s, 2H), 1.20(s, 10H), 0.82(t, J = 6.7 Hz, 3H).

[0782] Example 20 Synthesis of compound AB31762

[0783] The chemical structure of the compound AB31762 is as follows:

[0784] [ka]

[0785] Compound 1 (338 mg, 1 mmol) was dissolved in 80% ethanol (5 mL), then acetic acid (4 mL) and compound 2 (1.56 g, 10 mmol) were added, and the mixture was stirred at 90°C for 4 hours. After that, a new compound was detected by thin layer chromatography. When the reaction was completed, an appropriate amount of hydrochloric acid was added to the reaction solution to replace the hydrochloride salt, the reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, and the mixture was combined and filtered, and then concentrated under reduced pressure to remove the organic solvent. Finally, the solid compound AB31762 (110.9 mg) was obtained through column chromatography (DCM / MeOH=20 / 1).

[0786] MS-ESI calculated value [M-Cl - ] + : 476.63, actual value: 476.20. 1H NMR (400 MHz, DMSO-d6) δ 9.86(s, 1H), 8.16(s, 2H), 7.26(s, 1H), 7.13(s, 1H), 6.15(s, 2H), 4.76(s, 2H), 4.06(d, J = 2.3 Hz, 6H), 3.04(s, 2H), 1.19(s, 18H), 0.81(d, J = 6.9 Hz, 3H).

[0787] Example 21 Synthesis of compound AB31763

[0788] The chemical structure of the compound AB31763 is as follows:

[0789] [ka]

[0790] Compound 1 (337 mg, 1 mmol) was dissolved in 80% ethanol (5 mL), then acetic acid (4 mL) and compound 2 (1.86 g, 10 mmol) were added, and the mixture was stirred at 90°C for 4 hours. After that, a new compound was detected by thin layer chromatography. The reaction mixture was diluted with water, and the organic phase was extracted with ethyl acetate. The mixture was then combined and filtered, and concentrated under reduced pressure to remove the organic solvent. Finally, the mixture was purified by column chromatography (DCM / MeOH=20 / 1) to obtain solid compound AB31763 (36.7 mg).

[0791] MS-ESI calculated value [M-Cl - ] + :504.68, actual value:504.40. 1H NMR (400 MHz, DMSO-d6) δ 9.85(s, 1H), 8.17(s, 2H), 7.26(s, 1H), 7.13(s, 1H), 6.15(s, 2H), 4.75(s, 2H), 4.06(d, J = 2.0 Hz, 6H), 3.05(s, 2H), 1.20(s, 22H), 0.82(s, 3H).

[0792] Example 22 Synthesis of compound AB31765

[0793] The chemical structure of the compound AB31765 is as follows:

[0794] [ka]

[0795] Compound 1 (200 mg, 0.59 mmol) was dissolved in 80% ethanol (5 mL), then isovaleraldehyde (507.4 mg, 5.9 mmol) and glacial acetic acid (4 mL) were added, and the mixture was heated to 90°C and stirred for 4 hours. A new compound was detected by thin layer chromatography. The reaction mixture was diluted with water, and the organic phase was extracted with ethyl acetate. The mixture was then combined and filtered, and concentrated under reduced pressure to remove the organic solvent. After purification, solid compound AB31765 (23.2 mg) was obtained.

[0796] MS-ESI calculated value [M-Cl - ] + : 406.49, actual value: 406.15. 1H NMR(399 MHz, DMSO-6) δ 9.87(s, 1H), 8.16(q, J = 9.6 Hz, 2H), 7.30(s, 1H), 7.13(s, 1H), 6.15(s, 2H), 4.76(s, 2H), 4.06(d, J = 3.5 Hz, 6H), 3.29(s, 2H), 3.05(s, 2H), 1.67(s, 2H), 1.07(d, J = 6.8 Hz, 1H), 0.91(d, J = 5.9 Hz, 6H).

[0797] Example 23 Synthesis of compound AB31766

[0798] The chemical structure of the compound AB31766 is as follows:

[0799] [ka]

[0800] Compound 1 (322 mg, 1 mmol) was dissolved in N,N-dimethylformamide (8 mL), then compound 2 (875.04 mg, 4 mmol) was added, and after stirring at 80°C for 16 hours, the complete reaction was confirmed by LCMS check, the reaction solution was diluted with water, the organic phase was extracted with ethyl acetate, combined, filtered, and concentrated under reduced pressure to remove the organic solvent, and finally, the solid compound AB31766 (100 mg) was obtained through column chromatography (DCM / MeOH=20 / 1).

[0801] MS-ESI calculated value [M-Br - ] + :504.64, actual value:504.30. 1H NMR(400 MHz,DMSO-d6) δ 9.82(s, 1H), 8.99(s, 1H), 8.26(d, J = 9.2 Hz, 1H), 8.17(d, J = 9.0 Hz, 1H), 7.78(s, 1H), 7.08(s, 1H), 6.15(s, 2H), 4.89(t, J = 6.6 Hz, 2H), 4.00(s, 3H), 3.18(d, J = 7.1 Hz, 2H), 2.82(t, J = 7.4 Hz, 2H), 1.71(t, J = 8.5 Hz, 2H), 1.47 - 1.36(m, 2H), 1.25(dd, J = 24.0, 12.7 Hz, 14H), 0.83(t, J = 6.7 Hz, 3H).

[0802] Example 24 Synthesis of compound AB31767

[0803] The chemical structure of the compound AB31767 is as follows:

[0804] [ka]

[0805] Compound 1 (100 mg, 0.31 mmol) was dissolved in tetrahydrofuran (20 mL), followed by the addition of compound 2 (1 mL, 1 mmol / L) and stirring overnight at room temperature. When a new compound was detected by thin layer chromatography, the reaction was quenched with water, the product was filtered through diatomaceous earth, the filtrate was concentrated under reduced pressure to remove the organic solvent, and the excess aqueous phase was then filtered off to give compound 3 (100 mg) as a solid.

[0806] [ka]

[0807] Compound 3 (100 mg, 0.31 mmol) was dissolved in acetic acid (2 mL) and heated to 120 °C, followed by addition of liquid bromine (50 mg, 0.31 mmol) in acetic acid (1 mL) and stirring for 1 h. When a new compound was detected by thin layer chromatography, the reaction was quenched with water, the product was filtered through diatomaceous earth, the filtrate was concentrated under reduced pressure to remove the organic solvent, and the excess aqueous phase was then filtered off to give compound AB31767 (27 mg) as a solid.

[0808] MS-ESI calculated value [M-Br - ] + : 420.53, actual value: 420.15. 1H NMR(400 MHz,DMSO-d6) δ 8.77(s, 1H), 8.16(s, 1H), 8.00(s, 1H), 7.71(s, 1H), 7.09(s, 1H), 6.15(s, 2H), 4.79(s, 2H), 4.03(s, 6H), 3.74(s, 2H), 3.17 - 3.12(m, 2H), 1.76(s, 2H), 1.56(s, 2H), 1.36(s, 4H), 0.90(s, 3H).

[0809] Example 25 Synthesis of compound AB31771

[0810] The chemical structure of the compound AB31771 is as follows:

[0811] [ka] Compound 1 (190 mg, 1 mmol) was dissolved in dichloromethane (10 mL) and o Add oxalyl chloride (254 mg, 2 mmol) at C, add 2 drops of N,N-dimethylformamide, and stir at room temperature for 2 hours. Concentrate the solution under reduced pressure to remove the organic solvent and obtain solid compound 2 (210 mg). [ka]

[0812] Dissolve compound 2 (210 mg, 1 mmol) in acetonitrile (10 mL), add compound 3 (100 mg, 0.31 mmol), and stir at room temperature for 2 hours. Concentrate the solution under reduced pressure to remove the organic solvent, and obtain solid compound AB31771 via column chromatography (DCM / MeOH=30 / 1).

[0813] MS-ESI calculated value [M-Cl - ] + : 498.60, actual value: 498.20. 1H NMR(400 MHz, DMSO) δ 9.85(s, 1H), 9.00(s, 1H), 8.26(d, J = 9.2 Hz, 1H), 8.17(d, J = 9.3 Hz, 1H), 7.78(s, 1H), 7.07(s, 1H), 6.15(s, 2H), 4.90(s, 2H), 4.01(s, 3H), 3.19(s, 2H), 2.54(s, 2H), 1.99(s, 3H), 1.76(s, 4H), 1.70 - 1.63(m, 6H), 1.54(s, 2H).

[0814] Example 26 Synthesis of compound AB31780

[0815] The chemical structure of the compound AB31780 is as follows:

[0816] [ka]

[0817] Compound 1 (337 mg, 1 mmol) was dissolved in 80% ethanol (5 mL), then acetic acid (4 mL) and compound 2 (1.20 g, 10 mmol) were added, and the mixture was stirred at 90°C for 4 hours. After that, a new compound was detected by thin layer chromatography. The reaction mixture was diluted with water, and the organic phase was extracted with ethyl acetate. The mixture was then combined and filtered, and concentrated under reduced pressure to remove the organic solvent. Finally, the mixture was purified by column chromatography (DCM / MeOH=20 / 1) to obtain solid compound AB31780 (64.2 mg).

[0818] MS-ESI calculated value [M-Cl - ] + : 440.51, actual value: 440.35. 1H NMR(400 MHz, DMSO-d6) :δ 9.83(s, 1H), 8.34(d, J = 9.3 Hz, 1H), 8.20(d, J = 9.4 Hz, 1H), 7.39(s, 1H), 7.16(d, J = 7.2 Hz, 3H), 7.02(d, J = 17.1 Hz, 3H), 6.13(s, 2H), 4.69(s, 2H), 4.08(s, 6H), 3.72(s, 2H), 2.98(s, 2H), 2.83(s, 2H).

[0819] Example 27 Synthesis of compound AB31781

[0820] The chemical structure of the compound AB31781 is as follows:

[0821] [ka]

[0822] Compound 1 (337 mg, 1 mmol) was dissolved in 80% ethanol (5 mL), then acetic acid (4 mL) and phenylpropylaldehyde (1.20 g, 10 mmol) were added, and the mixture was stirred at 90°C for 4 hours. After that, a new compound was detected by thin layer chromatography. When the reaction was completed, an appropriate amount of hydrochloric acid was added to the reaction solution to replace the hydrochloride salt, the reaction solution was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent. Finally, the solid compound AB31781 (215.4 mg) was obtained by purification through column chromatography (DCM / MeOH=20 / 1).

[0823] MS-ESI calculated value [M-Cl - ] + : 454.54, actual value: 454.30. 1HNMR(400 MHz, DMSO-6) δ 9.85(s, 1H), 8.13(s, 2H), 7.25-7.19(m, 3H), 7.14(dd, J = 12.6, 7.2 Hz, 4H), 6.14(s, 2H), 4.75(s, 2H), 4.05(d, J = 1.2 Hz, 6H), 3.32(s, 2H), 3.07 -3.02(m, 2H), 2.66(t, J = 7.0 Hz, 2H), 2.08 - 1.96(m, 2H).

[0824] Example 28 Synthesis of compound AB31787

[0825] The chemical structure of the compound AB31787 is as follows:

[0826] [ka]

[0827] Compound 1 (322 mg, 1.0 mmol) was dissolved in N,N-dimethylformamide (10 mL), compound 2 (975 mg, 4.0 mmol) was added, and the mixture was stirred at 80°C overnight. A new compound was detected by thin layer chromatography. The reaction mixture was diluted with water, and the organic phase was extracted with ethyl acetate. The mixture was combined, filtered, and then concentrated under reduced pressure to remove the organic solvent. After column chromatography, the concentrate was triturated with ethyl acetate to obtain solid compound AB31787 (27.3 mg, 0.05 mmol; yield: 5.6%).

[0828] MS-ESI calculated value [M-Br - ] + : 485.39, actual value: 486.05. 1H NMR (400 MHz, DMSO-d6) δ 9.70(s, 1H), 8.89(s, 1H), 8.16(d, J = 9.1 Hz, 1H), 7.96(d, J = 8.9 Hz, 1H), 7.76(s, 1H), 7.06(s, 1H), 6.14(s, 3H), 4.90(s, 2H), 4.25(t, J = 6.6 Hz, 2H), 4.02(s, 3H), 3.17(s, 3H), 1.83(s, 4H), 1.47(s, 4H).

[0829] Example 29 Synthesis of compound AB31788

[0830] The chemical structure of the compound AB31788 is as follows:

[0831] [ka]

[0832] Compound 1 (337 mg, 1 mmol) was dissolved in 80% ethanol (5 mL), then acetic acid (4 mL) and compound 2 (1.20 g, 10 mmol) were added, and the mixture was stirred at 90°C for 4 hours. A new compound was detected by thin layer chromatography. When the reaction was completed, an appropriate amount of hydrochloric acid was added to the reaction solution to replace the hydrochloride salt, the reaction solution was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent. Finally, the solid compound AB31788 (17.5 mg) was obtained by purification through column chromatography (DCM / MeOH=20 / 1).

[0833] MS-ESI calculated value [M-Cl - ] + :510.48, actual value:510.25. 1H NMR(400 MHz, dmso) δ 10.00(s, 1H), 8.07(d, J = 9.2 Hz, 1H), 7.75(d, J = 9.0 Hz, 1H), 7.33(d, J = 8.2 Hz, 2H), 7.27(s, 2H), 7.14(s, 1H), 6.87(s, 1H), 6.05(s, 2H), 4.79(d, J = 29.0 Hz, 4H), 4.08(s, 3H), 3.99(s, 3H), 3.12(s, 2H).

[0834] Example 30 Synthesis of compound AB31789

[0835] The chemical structure of the compound AB31789 is as follows:

[0836] [ka]

[0837] Compound 1 (337 mg, 1 mmol) is dissolved in 80% ethanol (10 mL), then acetic acid (8 mL) and compound 2 (1.20 g, 10 mmol) are added, and the mixture is stirred at 90°C for 4 hours. A new compound is detected by thin layer chromatography. When the reaction is complete, an appropriate amount of hydrochloric acid is added to the reaction solution to replace the hydrochloride salt, the reaction solution is diluted with water, the organic phase is extracted with ethyl acetate, the mixture is combined and filtered, and then concentrated under reduced pressure to remove the organic solvent. Finally, the solid compound AB31789 is obtained by purification using column chromatography (DCM / MeOH=20 / 1).

[0838] MS-ESI calculated value [M-Cl - ] + : 468.56, actual value: 468.35. 1H NMR(400MHz, DMSO-6) δ 9.97(s, 1H), 8.06(d, J = 9.4 Hz, 1H), 7.75(d, J = 9.5 Hz, 1H), 7.20(d, J = 8.1 Hz, 2H), 7.13(s, 1H), 7.04(d, J = 7.7 Hz, 2H), 6.96(s, 1H), 6.04(s, 2H), 4.83(s, 2H), 4.66(s, 2H), 4.08(s, 3H), 3.99(s, 3H), 3.11(s, 2H), 2.84(s, 1H), 1.16(s, 3H), 1.14(s, 3H).

[0839] Example 31 Synthesis of compound AB31790

[0840] The chemical structure of the compound AB31790 is as follows:

[0841] [ka]

[0842] Compound 1 (5 g, 41 mmol) was dissolved in aqueous sodium hydroxide solution (10 mL, 2 mol / L), compound 2 (10 mL) was added, and the mixture was stirred at 60°C for 2 hours. A new compound was detected by thin layer chromatography. When the reaction was completed, an appropriate amount of water and ethyl acetate were added to the reaction solution, and the organic phase was extracted, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent, obtaining compound 3 (6 g).

[0843] [ka]

[0844] Compound 3 (1 g, 6.25 mmol) was dissolved in tetrahydrofuran (40 mL), then pyrrolidone trihydrobromide (2.2 g, 12.5 mmol) was added, and the mixture was stirred at room temperature for 16 hours. When a new compound was detected by thin layer chromatography, the reaction was completed, and an appropriate amount of water and ethyl acetate were added to the reaction solution, and the organic phase was extracted, combined, filtered, and concentrated under reduced pressure to remove the organic solvent, and finally compound 4 (440 mg) was obtained through column chromatography (DCM / MeOH=30 / 1).

[0845] [ka]

[0846] Compound 4 (470 mg, 2 mmol) is dissolved in acetonitrile (20 mL), compound 5 (322 g, 1 mmol) is added, and the mixture is stirred at 80 °C for 16 hours. A new compound is detected by thin layer chromatography, and the mixture is filtered to obtain solid compound AB31790 (356 mg).

[0847] MS-ESI calculated value [M-Cl - ] + : 480.53, actual value: 480.30. 1H NMR (400 MHz, DMSO-d6) δ 9.99(s, 1H), 8.91(s, 1H), 8.15(d, J = 9.0 Hz, 1H), 7.96(d, J = 9.1 Hz, 1H), 7.78(s, 1H), 7.63(dd, J = 19.8, 12.1 Hz, 3H), 7.24(d, J = 8.2 Hz, 2H), 7.09 - 6.97(m, 2H), 6.15(s, 2H), 5.39(s, 2H), 4.91(s, 2H), 3.98(s, 3H), 3.19(s, 2H), 2.31(s, 3H).

[0848] Example 32 Synthesis of compound AB31794

[0849] The chemical structure of the compound AB31794 is as follows:

[0850] [ka]

[0851] Compound 1 (200 mg, 0.6 mmol) was dissolved in DMF (5 mL), compound 2 (759 mg, 2.5 mmol) was added, and the mixture was stirred at 90 ° C for 4 hours. After that, a new compound was detected by thin layer chromatography. When the reaction was completed, an appropriate amount of water and ethyl acetate were added to the reaction solution, and the organic phase was extracted, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent. Finally, the solid compound AB31794 (213.1 mg) was obtained through column chromatography (DCM / MeOH=30 / 1).

[0852] MS-ESI calculated value [M-Cl - ] + :546.76, actual value:546.50. 1H NMR (400 MHz, DMSO-d6) δ 9.72(s, 1H), 8.90(s, 1H), 8.17(d, J = 9.1 Hz, 1H), 7.95(d, J = 9.2 Hz, 1H), 7.77(s, 1H), 7.06(s, 1H), 6.15(s, 2H), 4.91(s, 2H), 4.25(t, J = 6.8 Hz, 2H), 4.02(s, 3H), 3.17(s, 2H), 1.88 - 1.79(m, 2H), 1.44(s, 2H), 1.20(s, 24H), 0.82(t, J = 6.8 Hz, 3H).

[0853] Example 33 Synthesis of compound AB31795

[0854] The chemical structure of the compound AB31795 is as follows:

[0855] [ka]

[0856] Compound 1 (3.38 g, 10 mmol) was dissolved in 80% ethanol (50 mL), then acetic acid (40 mL) and compound 2 (18.42 g, 100 mmol) were added, and the mixture was stirred at 90°C for 4 hours. After that, a new compound was detected by thin layer chromatography. When the reaction was completed, an appropriate amount of hydrochloric acid was added to the reaction solution to replace the hydrochloride salt, the reaction solution was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent. Finally, the solid compound 3 (3 g, 5.95 mmol) was obtained by purification through column chromatography (DCM / MeOH=20 / 1).

[0857] MS-ESI calculated value [M-Br - ] + :504.68, actual value:504.69.

[0858] [ka]

[0859] Compound 3 (3 g, 5.95 mmol) was heated to 190° C. and the reaction was carried out for 1 hour to obtain solid compound 4 (2.5 g, 5.1 mmol).

[0860] MS-ESI calculated value [M-Br - ] + : 490.66, actual value: 490.66.

[0861] [ka]

[0862] Compound 4 (490 mg, 1 mmol) was dissolved in N,N-dimethylformamide (10 mL), then compound 5 (2.2 g, 10 mmol) was added, and the mixture was purged with nitrogen three times and stirred at 80° C. for 4 hours. The complete reaction was confirmed by LCMS inspection, and the reaction solution was diluted with water, and the organic phase was extracted with dichloromethane three times, combined, washed with saturated saline, dried, filtered, concentrated, and finally purified from the concentrate via column chromatography (DCM / MeOH=20 / 1) to obtain solid compound AB31795 (164.8 mg).

[0863] MS-ESI calculated value [M-Br - ] + : 630.93, actual value: 630.45. 1H NMR (400 MHz, DMSO-d6) δ 9.73(s, 1H), 8.16(s, 2H), 7.26(s, 1H), 7.14(s, 1H), 6.16(s, 2H), 4.78(s, 2H), 4.24(d, J = 6.5 Hz, 2H), 4.04(s, 4H), 3.05(s, 3H), 1.83(d, J = 7.4 Hz, 2H), 1.72(s, 2H), 1.44(s, 2H), 1.20(s, 27H), 0.83(s, 6H).

[0864] Example 34 Synthesis of compound AB31796

[0865] The chemical structure of the compound AB31796 is as follows:

[0866] [ka]

[0867] Compound 1 (490 mg, 1 mmol) was dissolved in N,N-dimethylformamide (10 mL), then compound 2 (800 mg, 4 mmol) was added, and the mixture was purged with nitrogen three times and stirred at 80° C. for 16 hours. The complete reaction was confirmed by LCMS inspection, and the reaction solution was diluted with water, and the organic phase was extracted with dichloromethane three times, combined, washed with saturated saline, dried, filtered, concentrated, and finally purified from the concentrate via column chromatography (DCM / MeOH=50 / 1) to obtain solid compound AB31796 (322 mg).

[0868] MS-ESI calculated value [M-Br - ] + : 602.88, actual value: 602.45. 1H NMR (400MHz, DMSO-d6) δ 9.72(s, 1H), 8.15(s, 2H), 7.26(s, 1H), 7.13(s, 1H), 6.15(s, 2H), 4.77(s, 2H), 4.24(t, J = 6.8 Hz, 2H), 4.03(s, 3H), 3.04(s, 2H), 1.89 - 1.78(m, 2H), 1.72(s, 2H), 1.44(s, 2H), 1.34 - 1.14(m, 28H), 0.82(t, J = 6.6 Hz, 6H).

[0869] Example 35 Synthesis of compound AB31797

[0870] The chemical structure of the compound AB31797 is as follows:

[0871] [ka]

[0872] Compound 1 (490 mg, 1 mmol) was dissolved in N,N-dimethylformamide (10 mL), then compound 2 (700 mg, 4 mmol) was added, and the mixture was purged with nitrogen three times and stirred at 80° C. for 16 hours. The complete reaction was confirmed by LCMS inspection, and the reaction solution was diluted with water, and the organic phase was extracted with dichloromethane three times, combined, washed with saturated saline, dried, filtered, concentrated, and finally purified from the concentrate via column chromatography (DCM / MeOH=20 / 1) to obtain solid compound AB31797 (354 mg; yield: 61.67%).

[0873] MS-ESI calculated value [M-Br - ] + :574.83, actual value:574.40. 1H NMR (400 MHz, DMSO-d6) δ 9.73(s, 1H), 8.16(s, 2H), 7.26(s, 1H), 7.13(s, 1H), 6.15(s, 2H), 4.78(s, 2H), 4.25(t, J = 6.8 Hz, 2H), 4.04(s, 3H), 3.05(s, 2H), 1.89 -1.79(m, 2H), 1.72(s, 2H), 1.45(s, 2H), 1.32(s, 6H), 1.20(s, 18H), 0.83(dd, J = 15.7, 9.6Hz, 6H).

[0874] Example 36 Synthesis of compound AB31800

[0875] The chemical structure of the compound AB31800 is as follows:

[0876] [ka]

[0877] Compound 1 (338 mg, 1 mmol) was dissolved in 80% ethanol (5 mL), then acetic acid (40 mL) and compound 2 (2.12 g, 10 mmol) were added, and the mixture was stirred at 90°C for 4 hours. After that, a new compound was detected by thin layer chromatography. When the reaction was completed, an appropriate amount of hydrochloric acid was added to the reaction solution to replace the hydrochloride salt, the reaction solution was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent. Finally, the solid compound AB31800 (204 mg) was obtained by purification through column chromatography (DCM / MeOH=20 / 1).

[0878] MS-ESI calculated value [M-Cl - ] + :532.74, actual value:532.60. 1H NMR (400 MHz, DMSO-d6) δ 9.87(s, 1H), 8.17(s, 2H), 7.26(s, 1H), 7.13(s, 1H), 6.15(s, 2H), 4.76(s, 2H), 4.07(s, 6H), 3.05(s, 2H), 1.71(s, 2H), 1.34(s, 2H), 1.20(s, 22H), 0.81(d, J = 6.9 Hz, 3H).

[0879] Example 37 Synthesis of compound AB31805

[0880] The chemical structure of the compound AB31805 is as follows:

[0881] [ka]

[0882] Compound 1 (10 g, 26.88 mmol) was dissolved in methanol (100 mL), followed by the addition of potassium carbonate (11.13 g, 80.64 mmol) and sodium borohydride (326.86 mg, 8.6 mmol). After stirring at room temperature for 1 hour, a new compound was detected by thin layer chromatography. The reaction solution was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent, and filtered to obtain solid compound 2 (8.5 g).

[0883] [ka]

[0884] Compound 2 (337 mg, 1 mmol) was dissolved in 80% ethanol (5 mL), then acetic acid (40 mL) and compound 3 (1.20 g, 10 mmol) were added, and the mixture was stirred at 90°C for 4 hours. After that, a new compound was detected by thin layer chromatography. When the reaction was completed, an appropriate amount of hydrochloric acid was added to the reaction solution to replace the hydrochloride salt, the reaction solution was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent. Finally, the solid compound AB31805 (28.2 mg) was obtained by purification through column chromatography (DCM / MeOH=20 / 1).

[0885] MS-ESI calculated value [M-Cl - ] + : 494.48, actual value: 494.60. 1H NMR (400 MHz, DMSO-6) δ 10.04(s, 1H), 8.07(d, J = 9.5 Hz, 1H), 7.75-7.68(m, 3H), 7.39(s, 2H), 7.15(s, 1H), 6.84(s, 1H), 6.06(s, 2H), 4.83(s, 4H), 4.09(s, 3H), 4.00(s, 3H), 3.13(s, 2H).

[0886] Example 38 Synthesis of compound AB31808

[0887] The chemical structure of the compound AB31808 is as follows:

[0888] [ka]

[0889] Compound 1 (200 mg, 0.6 mmol) was dissolved in N,N-dimethylformamide (10 mL), compound 2 (348 mg, 1.2 mmol) was added, and the mixture was stirred at 80°C overnight. A new compound was detected by thin layer chromatography. The reaction mixture was diluted with water, and the organic phase was extracted with ethyl acetate. The mixture was combined, filtered, and then concentrated under reduced pressure to remove the organic solvent. After column chromatography, solid compound AB31808 (73.8 mg, 0.1 mmol) was obtained.

[0890] MS-ESI calculated value [M-Br - ] + :521.62, actual value:521.50. 1H NMR (400 MHz, DMSO-d6) δ 9.72(s, 1H), 8.91(s, 1H), 8.17(d, J = 9.4 Hz, 1H), 7.96(d, J = 9.2 Hz, 1H), 7.77(s, 1H), 7.06(s, 1H), 6.76(s, 1H), 6.14(s, 2H), 4.92(s, 2H), 4.25(s, 2H), 4.02(s, 3H), 3.18(s, 2H), 2.89(d, J = 5.9 Hz, 2H), 1.83(s, 2H), 1.42(d, J = 22.7 Hz, 4H), 1.33(s, 9H), 1.20(s, 2H).

[0891] Example 39 Synthesis of compound AB31809

[0892] The chemical structure of the compound AB31809 is as follows:

[0893] [ka]

[0894] Compound 1 (2.0 g, 12.03 mmol) is dissolved in dichloromethane (10 mL), then Dess-Martin oxidant (6.12 g, 14.53 mmol) is added in an ice bath, and the mixture is stirred at 0 °C for 2 hours. When a new compound is detected by thin layer chromatography, the reaction is terminated and filtered, the filtrate is quenched with sodium thiosulfate, the organic phase is extracted, centrifuged, and finally, compound 2 (1.7 g) is obtained via column chromatography (petroleum ether / ethyl acetate = 50 / 1).

[0895] [ka]

[0896] Compound 2 (1.7 g, 10.36 mmol) was dissolved in 80% ethanol (5 mL), then acetic acid (40 mL) and compound 3 (381 mg, 1.036 mmol) were added, and the mixture was stirred at 90°C for 4 hours. After that, a new compound was detected by thin layer chromatography. When the reaction was completed, an appropriate amount of hydrochloric acid was added to the reaction solution to replace the hydrochloride salt, the reaction solution was diluted with water, and the organic phase was extracted with ethyl acetate, combined, filtered, and then concentrated under reduced pressure to remove the organic solvent. Finally, the solid compound AB31809 (220 mg) was obtained by purification through column chromatography (DCM / MeOH=20 / 1).

[0897] MS-ESI calculated value [M-Cl - ] + : 484.57, actual value: 484.90. 1H NMR(400 MHz,DMSO-d6) δ 9.91(s, 1H), 8.13(d, J = 3.4 Hz, 2H), 7.14(d, J = 16.0 Hz, 2H), 7.03(d, J = 8.1 Hz, 2H), 6.77(d, J = 8.2 Hz, 2H), 6.13(s, 2H), 4.78(s, 2H), 4.06(d, J = 2.5 Hz, 6H), 3.67(s, 3H), 3.29(s, 2H), 3.05(s, 2H), 2.59(s, 2H), 1.98(s, 2H).

[0898] Example 40 Synthesis of compound AB35511

[0899] The chemical structure of the compound AB35511 is as follows:

[0900] [ka]

[0901] The synthesis process is as follows.

[0902] [ka]

[0903] Compound 1 (1 g, 2.79 mmol, 1 eq) was dissolved in N,N-dimethylformamide (20 mL), compound 2 (1.7 g, 13.95 mmol, 5 eq) was added, and the reaction was allowed to proceed at 70 °C overnight. The reaction mixture was diluted with water, and the organic phase was extracted twice with dichloromethane. The combined organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain the crude product, compound AB 35511 (136.5 mg), as a yellow solid, via flash chromatography (DCM / MeOH = 50 / 1 to 30 / 1).

[0904] MS-ESI: Theoretical value [M+H] + : 364.15, measured value [M]+ :364.10. 1 H NMR (400 MHz, CDCl 3 ) δ 10.18(s, 1H), 8.31(s, 1H), 7.85-7.73(m, 2H), 7.34(s, 1H), 6.77(s, 1H), 6.05(s, 2H), 5.27-5.24(m, 2H), 4.45-4.42(m, 2H), 4.01(s, 3H), 3.34-3.30(m, 2H), 2.07-2.01(m, 2H), 1.12-1.08(m, 3H).

[0905] Example 41 Synthesis of compound AB36412

[0906] The chemical structure of the compound AB36412 is as follows:

[0907] [ka]

[0908] The synthesis process is as follows.

[0909] [ka]

[0910] Compound 1 (500 mg, 1.4 mmol, 1.0 eq) was dissolved in N,N-dimethylformamide (10 mL), compound 2 (1.9 g, 11.2 mmol, 8.0 eq) was added, and the reaction was carried out at 70 °C for 16 h. The reaction solution was concentrated and purified by flash chromatography (DCM / MeOH=20 / 1) to obtain the crude product as a yellow solid, compound AB36412 (78.5 mg).

[0911] MS-ESI: Theoretical value [M+H] + : 350.14, measured value [M] + :350.05. 1H NMR(400 MHz, DMSO-d6) δ 9.77(s, 1H), 8.89(s, 1H), 8.16(d, J= 4.0 Hz, 1H), 7.95(d, J= 4.0 Hz, 1H), 7.76(s, 1H), 7.06(s, 1H), 6.14(s, 2H), 4.93-4.90(m, 2H), 4.35-4.30(m, 2H), 4.02(s, 3H), 3.19-3.16(m, 2H), 1.43-1.40(m, 3H).

[0912] Example 42 Synthesis of compound AB31755 by conventional methods

[0913] The chemical structure of the compound AB31755 is as follows:

[0914] [ka]

[0915] Compound AB31755 1 H NMR (400 MHz, DMSO-d6) is shown in Figure 1.

[0916] Example 43

[0917] Synthesis of compound AB31756 by conventional methods

[0918] The chemical structure of the compound AB31756 is as follows:

[0919] [ka]

[0920] Compound AB31756 1 H NMR (400 MHz, DMSO-d6) is shown in Figure 2.

[0921] Example 44 Synthesis of compound AB35595

[0922] The chemical structure of the compound AB35595 is as follows:

[0923] [ka]

[0924] The synthesis process is as follows.

[0925] [ka]

[0926] Compound 1 (500 mg, 1.4 mmol, 1.0 eq) was dissolved in N,N-dimethylformamide (10 mL), compound 2 (2.1 g, 11.2 mmol, 8.0 eq) was added, and the reaction was carried out at 70 °C for 16 h. The reaction solution was concentrated and purified by flash chromatography (DCM / MeOH=20 / 1) to obtain the crude product as a yellow solid, compound AB35595 (33.1 mg).

[0927] MS-ESI: Theoretical value [M+H] + : 428.05, actual value: 428.15. 1 H NMR(400 MHz, DMSO-d6) δ 9.85(s, 1H), 8.95(s, 1H), 8.20(d, J= 8.0 Hz, 1H), 8.02(d, J= 8.0 Hz, 1H), 7.79(s, 1H), 7.09(s, 1H), 6.17(s, 2H), 4.95-4.92(m, 2H), 4.62-4.59(m, 2H), 4.06(s, 3H), 3.98-3.95(m, 2H), 3.23-3.20(m, 2H)

[0928] Example 45 Synthesis of compound AB36404

[0929] The chemical structure of the compound AB36404 is as follows:

[0930] [ka]

[0931] The synthesis process is as follows.

[0932] [ka]

[0933] Compound 1 (1 g, 2.79 mmol, 1.0 eq) was dissolved in N,N-dimethylformamide (30 mL), compound 2 (2.2 g, 22.36 mmol, 8.0 eq) was added, and the reaction was carried out at 70 °C for 16 h. The reaction solution was concentrated and purified by flash chromatography (DCM / MeOH=20 / 1) to obtain the crude product as a yellow solid, compound AB36404 (35.5 mg).

[0934] MS-ESI: Theoretical value [M+H] + :384.10, actual value:384.00. 1 H NMR(400 MHz, DMSO-d6) δ 9.82(s, 1H), 8.94(s, 1H), 8.22-8.01(m, 2H), 7.78(s, 1H), 7.09(s, 1H), 6.17(s, 2H), 4.98-4.89(m, 2H), 4.57-4.55(m, 2H), 4.13-4.10(m, 2H), 4.07(s, 3H), 3.26-3.17(m, 2H).

[0935] Example 46 Synthesis of compound AB35483

[0936] The chemical structure of the compound AB35483 is as follows:

[0937] [ka]

[0938] Compound AB35483 1 H NMR (400 MHz, DMSO-d6) is shown in Figure 3.

[0939] Example 47 Synthesis of compound AB35532

[0940] The chemical structure of the compound AB35532 is as follows:

[0941] [ka]

[0942] The synthesis process is as follows.

[0943] [ka]

[0944] Compound 1 (200 mg, 0.56 mmol, 1 eq) was dissolved in N,N-dimethylformamide (10 mL), compound 2 (692 mg, 2.8 mmol, 5 eq) was added, and the reaction was allowed to proceed at 80 °C overnight. The reaction solution was diluted with water, and the organic phase was extracted twice with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain the crude compound AB35532 (18.1 mg) as a yellow solid via flash chromatography (DCM / MeOH=50 / 1 to 30 / 1). MS-ESI: Theoretical value [M] + : 488.19, measured value [M] + :488.15. 1H NMR(400 MHz, DMSO-d6) δ 9.76(s, 1H), 8.91(s, 1H), 8.21(d, J= 8.0 Hz, 1H), 7.97(d, J= 8.0 Hz, 1H), 7.75(s, 1H), 7.64-7.62(m, 6H), 7.48-7.33(m, 3H), 7.06(s, 1H), 6.15(s, 2H), 5.38(s, 2H), 4.92-4.89(m, 2H),4.08(s, 3H), 3.18-3.14(m, 2H).

[0945] Example 48 Synthesis of compound AB36425

[0946] The chemical structure of the compound AB36425 is as follows:

[0947] [ka] The synthesis process is as follows. [ka]

[0948] Compound 1 (160 mg, 0.43 mmol, 1 eq) was dissolved in N,N-dimethylformamide (5 mL), compound 2 (511 mg, 2.18 mmol, 5 eq) was added, and the reaction was carried out at room temperature under nitrogen gas protection for 16 hours. The reaction solution was cooled, and the filtrate was centrifuged and purified by flash chromatography (DCM / MeOH=50 / 1) to obtain compound AB36425 (39 mg) as a yellow solid from the crude product. MS-ESI: Theoretical value [M] + : 398.12, measured value [M] + :398.20. 1H NMR(400 MHz, DMSO-d6) δ 9.90(s, 1H), 8.95(s, 1H), 8.23-7.97(m, 2H), 7.80(s, 1H), 7.09(s, 1H), 6.18(s, 2H), 4.95-4.92(m, 2H), 4.43-4.40(m, 2H), 4.12(s, 3H), 3.90-3.87(m, 2H), 3.22-3.19(m, 2H), 2.33-2.27(m, 2H).

[0949] Example 49 Synthesis of compound AB31815

[0950] The chemical structure of the compound AB31815 is as follows:

[0951] [ka]

[0952] The synthesis process is as follows.

[0953] [ka]

[0954] Compound 1 (300 mg, 0.70 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and hexylmagnesium bromide (3.5 mL, 3.50 mmol, 5 eq, 1M / L) was added at 0°C under the protection of nitrogen gas. The mixture was allowed to warm to room temperature for 0.5 hours, and the reaction was checked by TLC. The complete reaction was confirmed by LCMS. The mixture was quenched with saturated aqueous ammonium chloride solution, and the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31880 (160 mg) as a yellow solid from the crude product through thin layer chromatography (DCM / MeOH=50 / 1). MS-ESI: Theoretical value [M+H] + : 436.24, actual value: 436.20. 1 H NMR (400 MHz, CDCl 3 ) δ 7.19(s, 1H), 6.75-6.68(m, 2H), 6.62(s, 1H), 5.81(s, 1H), 4.70-4.67(m, 1H), 4.26(s, 4H), 3.87(s, 3H), 3.84(s, 3H), 3.46-3.45(m, 1H), 3.31-3.29(m, 1H), 2.87-2.78(m, 2H), 1.75-1.50(m, 4H), 1.38-1.26(m, 6H), 0.82-0.79(m, 3H).

[0955] [ka]

[0956] Compound AB31880 (80 mg, 0.18 mmol, 1 eq) was dissolved in acetic acid (3 mL), 3 drops of bromine were added, and the reaction was carried out at 120 °C for 1 hour. The complete reaction was confirmed by LCMS inspection, and the reaction solution was centrifuged and purified by reverse phase column chromatography to obtain compound AB31815 (3.6 mg) as a yellow solid from the crude product. ESI-MS: Theoretical value [M] + : 434.23, actual value: 434.20. 1 H NMR (400 MHz, CDCl 3 ) δ 7.19(s, 1H), 6.75-6.70(m, 2H), 6.62(s, 1H), 5.81(s, 1H), 4.70-4.67(m, 1H), 4.26(s, 4H), 3.87(s, 3H), 3.84(s, 3H), 3.46-3.44(m, 1H), 3.31-3.28(m, 1H), 2.87-2.81(m, 2H), 1.81(s, 4H), 1.65(s, 2H), 1.37-1.26(m, 4H), 0.82-0.79(m, 3H).

[0957] Example 50 Synthesis of compound AB36508

[0958] The chemical structure of the compound AB36508 is as follows:

[0959] [ka]

[0960] The synthesis process is as follows.

[0961] [ka]

[0962] Compound 1 (200 mg, 0.49 mmol, 1.0 eq) was dissolved in acetic acid (10 mL), bromine (118 mg, 0.74 mmol, 1.5 eq) was added, and the reaction was carried out at 100 ° C for 1 hour. The reaction solution was centrifuged and subjected to reverse phase column chromatography (acetonitrile / water + 0.1% formic acid) to obtain compound AB36508 (24 mg) as a yellow solid from the crude product. ESI-MS: Theoretical value [M] + : 407.20, actual value: 407.25. 1 H NMR(400 MHz, DMSO-d6) δ 8.81(s, 1H), 8.18(d, J= 12.0 Hz, 1H), 8.00(d, J= 8.0 Hz, 1H), 7.77(s, 1H), 7.11(s, 1H), 6.17(s, 2H), 5.04-4.99(m, 1H), 4.67-4.64(m, 2H), 3.18-3.16(m, 2H), 2.23-2.16(m, 4H), 2.08-2.04(m, 2H), 1.88-1.81(m, 2H).

[0963] Example 51 Synthesis of compound AB36484

[0964] The chemical structure of the compound AB36484 is as follows:

[0965] [ka]

[0966] The synthesis process is as follows.

[0967] [ka]

[0968] Compound 1 (1g, 2.79 mmol, 1 eq) was dissolved in DMF (20 mL), compound 2 (2.4g, 13.97 mmol, 5 eq) was added, and the mixture was stirred at 70 °C for 16 h. The mixture was then concentrated and purified with FCC (DCM / MeOH = 50 / 1) to give compound AB36484 (98.4 mg) as a yellow solid. ESI-MS: Theoretical value [M] + : 368.13, measured value [M] + :368.00. 1 H NMR(400 MHz, DMSO-d6) δ 9.79(s, 1H), 8.94(s, 1H), 8.23-8.00(m, 2H), 7.80(s, 1H), 7.09(s, 1H), 6.17(s, 2H), 4.95-4.92(m, 3H), 4.84-4.82(m, 1H), 4.61-4.59(m, 1H), 4.53-4.51(m, 1H), 4.07(s, 3H), 3.22-3.19(m, 2H).

[0969] Example 52 Synthesis of compound AB31811

[0970] The chemical structure of the compound AB31811 is as follows:

[0971] [ka]

[0972] Compound AB31811 1H NMR (400 MHz, DMSO-d6) is shown in Figure 4.

[0973] Example 53

[0974] The inhibitory effect of the compounds of the present invention on various tumor cell lines is detected using cell activity detection agents.

[0975] Experimental background: Cell vitality was detected by Promega CellTiter-Glo kit, which directly measures the intracellular ATP content and reflects the activity of cells. This experiment demonstrated that the compounds of the present invention have IC 50 Detect the value.

[0976] Experimental method and results: Various tumor cells were cultured in the relevant medium, and after subculture, various compounds of the present invention were added in serial dilutions. After 3 days of culture, the median inhibitory concentration IC 50 The names, origins and culture conditions of each tumor cell line are as follows:

[0977] cell line NCI-H82 (ATCC, no. HTB-175), cultured in RPMI1640 medium + P / S with 10% fetal bovine serum; cell line G-401 (ATCC, no. CRL-1441) cultured in McCoy's 5a medium + P / S with 10% fetal bovine serum; cell line MDA-MB-453 (ATCC, no. HTB-131) cultured in Leibovitz's L-15 medium + P / S with 10% fetal bovine serum; cell line SW48 (ATCC, no. CCL-231) cultured in Leibovitz's L-15 medium + P / S with 10% fetal bovine serum; cell line CFPAC-1 (ATCC, no. CRL-1918) cultured in IMDM medium + P / S with 10% fetal bovine serum; cell line 786-O (ATCC, no. CRL-1932) cultured in RPMI1640 medium + P / S with 10% fetal bovine serum; cell line GB-1 (JCRB, no. IFO50489) cultured in DMEM medium + P / S with 10% fetal bovine serum; Cell line SF126 (JCRB, no. IFO50286) cultured in EMEM medium + P / S with 10% fetal bovine serum.

[0978] The experimental results are shown in Table 3 below.

[0979] [Table 3-1] [Table 3-2] [Table 3-3]

[0980] Note: IC 50 stands for 50% inhibiting concentration, ie, the concentration of the inhibitor when 50% of the inhibitory effect is achieved.

[0981] As can be seen from Table 3, by detecting the sensitivity of the compound of the present invention to various cells, NCI-H82 (human small cell lung cancer cells), G-401 (human renal cancer Wilms cells), MDA-MB-453 (breast cancer cells), and SW48 (human colon adenocarcinoma cells) were found to be sensitive to the compound of the present invention (IC 50 Although GB-1 (human brain glioblastoma cells), CFPAC-1 (human pancreatic cancer cells), SF126 (human brain tumor cells), and 786-O (renal clear cell adenocarcinoma cells) are sensitive to the compounds of the present invention (IC 50 It is insensitive to (high values).

[0982] Example 54

[0983] By performing gene expression analysis experiments using RT-qPCR, the mRNA transcription levels of the NNMT gene were detected for four tumor cell lines that were sensitive to the compound of the present invention and four tumor cell lines that were insensitive to it, and the expression status of the NNMT gene in each of these tumor cell lines was measured. The experimental results are shown in Figure 5.

[0984] As can be seen from FIG. 5, when performing gene expression analysis experiments by RT-qPCR to detect the mRNA transcription level of the NNMT gene for four tumor cell lines (NCI-H82, G-401, MDA-MB-453, SW48) that are sensitive to the compound of the present invention and four tumor cell lines (786-O, CFPAC-1, GB-1, SF126) that are insensitive to the compound of the present invention, the NNMT gene is low expressed in sensitive cells (NCI-H82, G-401, MDA-MB-453 and SW48) and high expressed in insensitive cells (786-O, CFPAC-1, GB-1 and SF126).

[0985] Therefore, as seen from Figure 5, the inhibitory effect of the compound of the present invention on the tumor cell line that expresses NNMT gene at low level is obviously stronger than that of the tumor cell line that expresses NNMT gene at high level, that is, the expression of NNMT gene in tumor cell is inversely correlated with the sensitivity to the compound of the present invention.Therefore, the tumor that expresses NNMT gene at low level has high sensitivity to the compound of the present invention, and the compound of the present invention has excellent therapeutic effect on the tumor that expresses NNMT gene at low level.

[0986] Example 55

[0987] For the promoter region of the NNMT gene of four tumor cell lines (NCI-H82, G-401, MDA-MB-453, SW48) that are sensitive to the compound of the present invention and four tumor cell lines (786-O, CFPAC-1, GB-1, SF126) that are insensitive to the compound of the present invention, the region from 1050bp before the transcription start site of the NNMT gene to 499bp after the transcription start site, and the region from 1050bp before the transcription start site of the NNMT gene to 193bp before the transcription start site are sequenced by DNA bisulfite conversion to detect the methylation level of DNA CpG sites in the relevant regions. Genomic DNA is treated by DNA bisulfite conversion, and unmethylated cytosine is deaminated to uracil, but methylated cytosine is not deaminated, so that the sequencing sample treated by DNA bisulfite conversion is compared with the untreated sequencing sample to find the methylation site. The experimental results are shown in Figs.

[0988] As shown in FIG. 6 (promoter region of NNMT gene), FIG. 7 (region from 1050bp before the transcription start site of NNMT gene to 499bp after the transcription start site) and FIG. 8 (region from 1050bp before the transcription start site of NNMT gene to 193bp before the transcription start site), the compound of the present invention has a strong inhibitory effect on tumor cells in which DNA CpG sites are hypermethylated in the promoter region of NNMT gene, the region from 1050bp before the transcription start site of NNMT gene to 499bp after the transcription start site, and the region from 1050bp before the transcription start site of NNMT gene to 193bp before the transcription start site, but has a weak inhibitory effect on tumor cells in which DNA CpG sites are hypomethylated in the promoter region of NNMT gene, the region from 1050bp before the transcription start site of NNMT gene to 499bp after the transcription start site, and the region from 1050bp before the transcription start site of NNMT gene to 193bp before the transcription start site. This shows that the methylation level of DNA CpG sites in the promoter region of the NNMT gene, the region from 1050bp before the transcription start site of the NNMT gene to 499bp after the transcription start site, and the region from 1050bp before the transcription start site of the NNMT gene to 193bp before the transcription start site of the NNMT gene in tumor cells is positively correlated with sensitivity to the compound of the present invention.Therefore, tumor cells that hypermethylate DNA CpG sites in the promoter region of the NNMT gene, the region from 1050bp before the transcription start site of the NNMT gene to 499bp after the transcription start site, and the region from 1050bp before the transcription start site of the NNMT gene to 193bp before the transcription start site of the NNMT gene are highly sensitive to the compound of the present invention, and the compound of the present invention has an excellent refined therapeutic effect on tumors that hypermethylate DNA CpG sites in the promoter region of the NNMT gene, the region from 1050bp before the transcription start site of the NNMT gene to 499bp after the transcription start site, and the region from 1050bp before the transcription start site of the NNMT gene to 193bp before the transcription start site of the NNMT gene.

[0989] Example 56

[0990] In this experiment, the methylation of specific DNA CpG sites within the region from 840 bp before the transcription start site of the NNMT gene (position 114165695 on human chromosome 11) to 469 bp before the transcription start site (position 114166066 on human chromosome 11) in three tumor cell lines sensitive to the compounds of the invention (NCI-H82, G-401, SW48) and three tumor cell lines insensitive to the compounds of the invention (786-O, CFPAC-1, SF126) is studied.

[0991] First, genomic DNA is treated by means of DNA bisulfite conversion such that unmethylated cytosines are deaminated to uracil, but methylated cytosines are not deaminated, thereby allowing methylation sites to be found by comparing a sequencing sample treated by means of DNA bisulfite conversion with a sequencing sample that has not been treated, and then PCR amplification and sequencing analysis is performed with primers on this region to detect the methylation level of CpG sites within this DNA region.

[0992] Analysis revealed that seven CpG sites (positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11) were almost all methylated in tumor cell lines (NCI-H82, G-401, and SW48) that were sensitive to the compounds of the present invention, but none of these seven CpG sites were methylated in tumor cell lines (786-O, CFPAC-1, and SF126) that were insensitive to isoquinoline compounds. The methylation status of the relevant sites is shown in Figure 9.

[0993] The portions of the nucleotide sequence of SEQ ID NO:1 corresponding to positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 are shown below, respectively.

[0994] [Table 3-4]

[0995] Example 57

[0996] The inhibitory effect of the compounds of the present invention on various brain tumor cell lines is detected using cell activity detection agents.

[0997] Experimental background: Cell vitality was detected by Promega CellTiter-Glo kit, which directly measures the intracellular ATP content and reflects the activity of cells. This experiment demonstrated that the compounds of the present invention have IC50 values ​​that suppress the activity of various brain tumor cell lines. 50 Detect the value.

[0998] Experimental method and results: Various brain tumor cells were cultured in the relevant medium, and after subculture, serially diluted various compounds of the present invention were added. After 3 days of culture, the median inhibitory concentration IC 50 The names, origins and culture conditions of each tumor cell line are as follows:

[0999] cell line D341 Med (ATCC, no. HTB-187), cultured in EMEM medium + P / S with 20% fetal bovine serum; cell line ATN-1 Kelly (ECACC, no. 92110411), cultured in RPMI1640 medium + P / S with 10% fetal bovine serum and 2 mM glutamine; Cell line NB-1 (ATCC, no. HTB-131) cultured in Leibovitz's L-15 medium + P / S with 10% fetal bovine serum.

[1000] The experimental results are shown in Tables 8, 9, 10 and 11 below.

[1001] The experimental results are shown in Table 4 below.

[1002] [Table 4-1] [Table 4-2]

[1003] Note: IC 50 is the half inhibitory concentration (50% inhibiting concentration), i.e., the concentration of inhibitor at which 50% inhibitory effect is achieved.

[1004] As can be seen from Table 4, by detecting the sensitivity of the compound of the present invention to various brain tumor cells, D341 Med (cerebellar medulloblastoma), Kelly (neuroblastoma), and NB-1 (neuroblastoma) were found to be sensitive to isoquinoline compounds (IC 50 GB-1 (human brain glioblastoma cell line) and SF126 (human brain tumor cell line) are sensitive to the compounds of the present invention (IC 50 It is insensitive to (high values).

[1005] Example 58

[1006] By performing gene expression analysis experiments using RT-qPCR, the mRNA transcription levels of the NNMT gene are detected for three brain tumor cell lines (D341 Med, Kelly, NB-1) that are sensitive to the compounds of the present invention and two brain tumor cell lines (GB-1, SF126) that are insensitive to the compounds of the present invention, and the expression status of the NNMT gene in each of these tumor cell lines is measured. The experimental results are shown in Figure 10.

[1007] As can be seen from FIG. 10, when a gene expression analysis experiment was performed by RT-qPCR to detect the mRNA transcription level of the NNMT gene in three brain tumor cell lines (D341 Med, Kelly, NB-1) that are sensitive to the compound of the present invention and two brain tumor cell lines (GB-1, SF126) that are insensitive to the compound of the present invention, the NNMT gene was lowly expressed in the sensitive cells (D341 Med, Kelly, NB-1) and highly expressed in the insensitive cells (GB-1, SF126).

[1008] Therefore, as seen from Figure 10, the inhibitory effect of the compound of the present invention on the brain tumor cell line that expresses NNMT gene at low level is obviously stronger than that on the brain tumor cell line that expresses NNMT gene at high level, that is, the expression of NNMT gene in brain tumor cell is inversely correlated with the sensitivity to the compound of the present invention.Therefore, the brain tumor that expresses NNMT gene at low level has high sensitivity to the compound of the present invention, and the compound of the present invention has excellent therapeutic effect on the brain tumor that expresses NNMT gene at low level.

[1009] Example 59

[1010] For the promoter region of the NNMT gene, the region from 1050bp before the transcription start site of the NNMT gene to 499bp after the transcription start site, and the region from 1050bp before the transcription start site of the NNMT gene to 193bp before the transcription start site of the NNMT gene in three brain tumor cell lines (D341 Med, Kelly, NB-1) that are sensitive to the compound of the present invention and two brain tumor cell lines (GB-1, SF126) that are not sensitive to the compound of the present invention, sequencing is performed by means of DNA bisulfite conversion to detect the methylation level of DNA CpG sites in the relevant regions. Genomic DNA is treated by means of DNA bisulfite conversion, and unmethylated cytosine is deaminated to uracil, but methylated cytosine is not deaminated, so that the methylation site is found by comparing the sequencing sample treated by means of DNA bisulfite conversion with the sequencing sample that is not treated. The experimental results are shown in Figures 11, 12, and 13.

[1011] As shown in FIG. 11 (promoter region of NNMT gene), FIG. 12 (region from 1050bp before the transcription start site of NNMT gene to 499bp after the transcription start site) and FIG. 13 (region from 1050bp before the transcription start site of NNMT gene to 193bp before the transcription start site), the compound of the present invention has a strong inhibitory effect on brain tumor cells in which DNA CpG sites are hypermethylated in the promoter region of NNMT gene, the region from 1050bp before the transcription start site of NNMT gene to 499bp after the transcription start site, and the region from 1050bp before the transcription start site of NNMT gene to 193bp before the transcription start site, but has a weak inhibitory effect on brain tumor cells in which DNA CpG sites are hypomethylated in the promoter region of NNMT gene, the region from 1050bp before the transcription start site of NNMT gene to 499bp after the transcription start site, and the region from 1050bp before the transcription start site of NNMT gene to 193bp before the transcription start site. This indicates that the methylation levels of DNA CpG sites in the promoter region of the NNMT gene, the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site, and the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site in brain tumor cells are positively correlated with sensitivity to the compounds of the present invention. Therefore, brain tumor cells that hypermethylate DNA CpG sites in the promoter region of the NNMT gene, the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site, and the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site of the NNMT gene are highly sensitive to the compounds of the present invention, and the compounds of the present invention have excellent precise therapeutic effects on brain tumors that hypermethylate DNA CpG sites in the promoter region of the NNMT gene, the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site, and the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site of the NNMT gene.

[1012] Example 60

[1013] The methylation level of cellular DNA is maintained by DNA methyltransferases DNMT3a, DNMT3b and DNMT1, and DNMT3a and DNMT3b perform de novo methylation on DNA, while DNMT1 replicates and maintains methylated DNA with the help of the protein UHRF1 (ubiquitin-like tau protein 1 containing PHD and RING finger domains). This example detects the correlation between NNMT expression in tumors and DNMT1, UHRF1, DNMT3a and DNMT3b expression.

[1014] Experimental method and results: Obtain the expression data of NNMT gene, DNMT1, UHRF1, DNMT3a and DNMT3b in various cells from public database (Cancer Cell Line Encyclopedia, CCLE, a total of 1019 cell lines), then use bioinformatics to analyze the correlation between NNMT expression and DNMT1, UHRF1, DNMT3a and DNMT3b expression in these cells, and the correlation between the expression level of NNMT gene in each cell and the expression level of DNMT1, UHRF1, DNMT3a and DNMT3b. The experimental results are shown in Figure 14.

[1015] As can be seen from Figure 14, the expression of NNMT in each cell is inversely correlated with the expression of DNA methyltransferase and UHRF1. Therefore, tumor cells with high expression of DNA methyltransferase and UHRF1 are highly sensitive to the compound of the present invention, and the compound of the present invention has excellent therapeutic effect on tumors with high expression of DNA methyltransferase and UHRF1.

[1016] Example 61

[1017] In this example, the sensitivity of various compounds prepared in the examples to the expression levels of NNMT and DNMT1 in NCI-H82 cells is examined.

[1018] Experimental method and results: NCI-H82 cells with high expression of NNMT protein (ov-NNMT NCI-H82 cells) were obtained by overexpressing NNMT protein in NCI-H82 cells by introducing NMT gene into NCI-H82 cells via viral vector. NCI-H82 cells with low expression of NMT protein (sh-DNMT1 NCI-H82 cells) were obtained by knocking down the expression of DNMT1 in NCI-H82 cells by introducing shRNA (nucleotide sequence of shRNA is GATCCGGATGAGTCCATCAAGGAAGATTCAAGAGATCTTCCTTGATGGACTCATCCTTTTTTG) (SEQ ID No: 2)) into NCI-H82 cells via viral vector. NCI-H82 cells with low expression of NMT protein (sh-DNMT1 NCI-H82 cells) were obtained by introducing NNMT gene into empty viral vector without shRNA (Con-NCI-H82 cells) as a control group. The results of the DNMT1 protein content in Con-NCI-H82 cells and ov-NNMT NCI-H82 cells detected by Western Blot experiment, and the DNMT1 protein content in Con-NCI-H82 cells and sh-DNMT1 NCI-H82 cells detected by Western Blot experiment are shown in Figure 15 and Figure 16. As can be seen from Figure 15 and Figure 16, compared with Con-NCI-H82 cells, NNMT protein is highly expressed in ov-NNMT NCI-H82 cells, and DNMT1 protein is knocked down, i.e., low expressed, in sh-DNMT1 NCI-H82 cells.

[1019] Promega CellTiter-Glo kit (which reflects cell vitality by examining the intracellular ATP content) was used to detect cell vitality of Con-NCI-H82 cells, ov-NNMT NCI-H82 cells and sh-DNMT1 NCI-H82 cells, and the results are shown in Figure 17 and Figure 18. From Figure 17 and Figure 18, the cell vitality of on-NCI-H82 cells, ov-NNMT NCI-H82 cells and sh-DNMT1 NCI-H82 cells is almost the same. The difference in cell vitality has no statistical significance.

[1020] The inhibitory effects (IC) of various compounds prepared in this example on Con-NCI-H82 cells, ov-NNMT NCI-H82 cells and sh-DNMT1 NCI-H82 cells were measured using Promega CellTiter-Glo kit, that is, by detecting the cell vitality by examining the intracellular ATP content through the kit. 50 ) was detected, and the results are shown in Table 5.

[1021] [Table 5-1] [Table 5-2] [Table 5-3]

[1022] Note: IC 50 represents the half inhibitory concentration (50% inhibiting concentration), i.e., the concentration of the inhibitor when achieving 50% inhibitory effect. Con-NCI-H82 represents the control group of NCI-H82 cells with an empty viral vector that does not have the NNMT gene and shRNA. ov-NNMT NCI-H82 represents the experimental group of NCI-H82 cells with a viral vector that has the NNMT gene, and the NNMT protein in the ov-NNMT NCI-H82 cells is highly expressed. sh-DNMT1 NCI-H82 represents the experimental group of NCI-H82 cells with a viral vector that has shRNA, and the NNMT protein in the ov-NNMT NCI-H82 cells is knocked down (i.e., low expressed).

[1023] From Table 5, this embodiment further verifies that the compound of the present invention has a significant inhibitory effect on tumor cells that express NNMT gene low or not express and express DNMT1 highly, but has a poor inhibitory effect on tumor cells that express NNMT gene high and express DNMT1 highly; the inhibitory effect of the compound of the present invention is enhanced by reducing the expression of NNMT gene in tumors or increasing the expression of DNMT1 in tumors; the expression level of NNMT in tumor cells is significantly inversely correlated with the sensitivity to the compound of the present invention, but the expression level of DNMT1 in tumor cells is significantly positively correlated with the sensitivity to the compound of the present invention. Therefore, the compound of the present invention has a significant inhibitory effect on tumor cells that express DNMT gene low or not express and express DNMT1 highly, and the tumor cells that express DNMT gene low or not express and express DNMT1 highly have high sensitivity to the compound of the present invention, so that the compound of the present invention has an excellent and precise therapeutic effect on tumor cells that express DNMT gene low or not express and express DNMT1 highly.

[1024] All documents mentioned in the present invention are incorporated by reference in this application as if they were incorporated by reference individually. It should also be understood that after reading the above content of the present invention, those skilled in the art may make various modifications or alterations to the present invention, and that the equivalents thereof are also included within the scope of the claims.

Claims

1. Use of a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, characterized in that it is used for the manufacture of a composition or formulation for use in the prevention and / or treatment of tumors. 【Chemistry 1】 (R １ , R ２ , R ３ and R ４ each independently represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R ５ represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group; R ６ is -O-R １５ Or -N(R １６ R １７ ) represents; R ７ represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkoxyl group, or a substituted or unsubstituted C1-C8 halogenated alkoxyl group; R ８ represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom; R ９ represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom; R １０ represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 alkyl group-substituted or unsubstituted C6-C12 aryl group-C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 halogenated alkoxy group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 halogenated alkyl group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted C1-C6 alkoxy group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-; R １１ and R １４ each independently represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R １２ and R １３ are joined to form a substituted or unsubstituted 3-10 membered heterocycloalkyl ring; R １５ is a substituted or unsubstituted C1-C18 alkyl group, a C1-C18 deuterated alkyl group, a substituted or unsubstituted C6-C12 aryl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C8 alkyl group-, a substituted or unsubstituted C6-C12 aryl group-O-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C10 halogenated alkyl group-, a substituted or unsubstituted C2- C16 acyl group-, substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C3-C14 cycloalkyl group-substituted or unsubstituted C2-C6 acyl group-, substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C2-C8 alkenyl group-C(O)-substituted or unsubstituted C1-C4 alkyl group-, or 【Chemistry 2】 represents; R １６ and R １７ each independently represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group, or a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C4 alkyl group-; R １８ represents a substituted or unsubstituted C1-C8 alkyl group; R １９ represents a substituted or unsubstituted C1-C10 alkylidene group; said heteroaryl group and said heterocycloalkyl ring each independently have from 1 to 4 (preferably 1, 2 or 3) heteroatoms selected from N, O and S on the heterocycle; The optional "substitution" mentioned above means that one or more (preferably one, two, three or four) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C6 alkyl group, a C2-C6 alkenyl group, a halogen atom, a C3-C6 cycloalkyl group, a C1-C6 halogenated alkyl group, a C1-C6 alkoxyl group, a C1-C6 halogenated alkoxyl group, a C3-C6 cycloalkoxyl group, a C2-C6 acyl group, a C6-C12 aryl group, a 5-12 membered heteroaryl group, a C6-C12 aryl group -O-, and 【Chemistry 3】 is substituted with a substituent selected from

2. The compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, has the following chemical structure:

2. The use according to claim 1 . 【Chemistry 4-1】 【Chemistry 4-2】 【Chemistry 4-3】 【Chemistry 4-4】 【Chemistry 4-5】

3. The tumor is Tumors in which the NNMT gene is underexpressed or not expressed; Tumors with high expression of DNA methyltransferases, Tumors in which UHRF1 is highly expressed, Tumors in which the nucleotide site of the NNMT gene is hypermethylated, and / or Tumors in which the NNMT gene region DNA CpG sites are hypermethylated, 2. The use according to claim 1 .

4. the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b or a combination thereof; and / or The methylation level of the DNA CpG site of the NNMT gene region includes the methylation level of the DNA CpG site of the NNMT gene promoter region; 4. The use according to claim 3.

5. The tumor is selected from lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain cancer, liver cancer, prostate cancer, or a combination thereof; 2. The use according to claim 1 .

6. A marker used to determine whether a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for tumor prevention and / or treatment in a tumor patient, comprising: The expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region, A marker characterized by:

7. 2. The compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, for use in the manufacture of a companion diagnostic kit for determining whether a tumor patient is suitable for the prevention and / or treatment of a tumor, (i) Use of a detection reagent kit comprising a detection reagent used to detect the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene and / or the methylation level of a DNA CpG site in the NNMT gene region.

8. (i) a detection agent used to detect the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site of the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region; (ii) a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, A medical kit comprising:

9. Administering to a subject for treatment a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof; A method for preventing and / or treating a tumor, comprising:

10. (i) a detection module used to detect the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site of the NNMT gene region; (ii) information that when the NNMT gene is under-expressed or not expressed, the DNA methyltransferase is over-expressed, the UHRF1 is over-expressed, the nucleotide site of the NNMT gene is over-methylated, and / or the DNA CpG site of the NNMT gene region is over-methylated in the tumor cells of a tumor patient, the compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in said tumor patient; and / or and an output module for outputting information that when high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of the nucleotide site of the NNMT gene, and / or low methylation of the DNA CpG site of the NNMT gene region in tumor cells of a tumor patient, the compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for tumor prevention and / or treatment for the tumor patient. An apparatus or system comprising:

11. A compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof. 【Chemistry 5】 (R １ , R ２ , R ３ and R ４ each independently represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R ５ represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group; R ６ is -O-R １５ Or -N(R １６ R １７ ) represents; R ７ represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkoxyl group, or a substituted or unsubstituted C1-C8 halogenated alkoxyl group; R ８ represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom; R ９ represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom; R １０ represents a hydrogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 alkyl group-substituted or unsubstituted C6-C12 aryl group-C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 halogenated alkoxy group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 halogenated alkyl group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted C1-C6 alkoxy group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-; R １１ and R １４ each independently represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R １２ and R １３ are joined to form a substituted or unsubstituted 3-10 membered heterocycloalkyl ring; R １５ is a substituted or unsubstituted C1-C18 alkyl group, a C1-C18 deuterated alkyl group, a substituted or unsubstituted C6-C12 aryl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C8 alkyl group-, a substituted or unsubstituted C6-C12 aryl group-O-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C10 halogenated alkyl group-, a substituted or unsubstituted C2- C16 acyl group-, substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C3-C14 cycloalkyl group-substituted or unsubstituted C2-C6 acyl group-, substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C2-C8 alkenyl group-C(O)-substituted or unsubstituted C1-C4 alkyl group-, or 【Chemistry 6】 represents; R １６ and R １７ each independently represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group, or a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C4 alkyl group-; R １８ represents a substituted or unsubstituted C1-C8 alkyl group; R １９ represents a substituted or unsubstituted C1-C10 alkylidene group; said heteroaryl group and said heterocycloalkyl ring each independently have from 1 to 4 (preferably 1, 2 or 3) heteroatoms selected from N, O and S on the heterocycle; The optional "substitution" mentioned above means that one or more (preferably one, two, three or four) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C6 alkyl group, a C2-C6 alkenyl group, a halogen atom, a C3-C6 cycloalkyl group, a C1-C6 halogenated alkyl group, a C1-C6 alkoxyl group, a C1-C6 halogenated alkoxyl group, a C3-C6 cycloalkoxyl group, a C2-C6 acyl group, a C6-C12 aryl group, a 5-12 membered heteroaryl group, a C6-C12 aryl group -O-, and 【Chemistry 7】 is substituted with a substituent selected from

12. 12. A compound of formula I according to claim 11, characterized in that it has the following chemical structure: or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof. 【Chemistry 8】

Images