Fusogenic adeno-associated viruses and uses thereof

Abstract

The present invention relates to the field of biological medicine. The present invention discloses a fusion adeno-associated virus and its use in ear disease and ophthalmic disease. The fusion adeno-associated virus contains a fusion peptide fragment formed by fusing peptide fragments of serotypes AAV1, AAV2, AAV6 and AAV7 or their mutants, and can efficiently infect the RPE layer for the treatment of ophthalmic disease. The fusion adeno-associated virus is expected to be widely applied in the treatment of ophthalmic disease as a safe vector.

Description

[Technical field]

[0001] Technical Field The present invention relates to the field of biopharmaceuticals, and to fusion adeno-associated viruses and their uses, in particular for the prevention and / or treatment of ear and / or eye diseases. [Background technology]

[0002] background There are approximately 7,000 known human diseases to date, of which approximately 80% are caused by genetic problems, and more than 300 million people worldwide are seriously afflicted by genetic diseases. Currently, fewer than 500 human diseases can be treated with chemotherapy and protein therapy, and treatments for diseases caused by genetic problems are generally insufficient. Therefore, the development of new drugs and treatments is needed.

[0003] Gene therapy is a new treatment that delivers functional genes into the patient's body to counteract or replace dysfunctional genes, and can treat diseases without chemical, radiotherapy or surgery. Gene therapy introduces genetic material into target cells via viral or non-viral vectors to correct or replenish defective genes, thereby treating or preventing diseases, and the effects of the treatment last for a long time without repeated intervention. Ex vivo gene therapy involves taking target cells from a patient, modifying their genes, and returning them to the patient. In vivo gene therapy involves administering genetic material directly into the patient's target organ or tissue. Currently, various types of transfer strategies are used to treat various diseases, such as cancer, blindness, immune diseases, and neurological diseases.

[0004] Viral vectors are the most commonly used gene therapy delivery vectors due to their high efficiency of entering cells and introducing genetic material, including adenoviruses, retroviruses, lentiviruses, and adeno-associated viruses (AAVs). Currently, AAV vectors have achieved excellent results in in vivo gene therapy clinical trials, and retroviral and lentiviral vectors have become the preferred vectors for in vitro gene therapy clinical trials. The main factors behind the success of AAV as a therapeutic gene delivery vector are its low immunogenicity and lack of pathogenicity. The approval of several marketed drugs and ongoing clinical trials have demonstrated that AAV vectors have become one of the main gene delivery tools for gene therapy. In 2012, Glybera was the first AAV therapy approved in Europe for the treatment of lipoprotein lipase deficiency. The availability of these drugs on the market clearly demonstrates the safety and efficacy of AAV-based treatments. Subsequently, Luxturna for the treatment of Leber congenital amaurosis was approved by the US Food and Drug Administration (FDA) in 2017, and Zolgensa for the treatment of spinal muscular atrophy (SMA) was approved in 2019. Current clinical research focuses on the treatment of single-gene diseases by gene replacement, gene silencing or gene editing. AAVs are expected to be used to treat various diseases such as cancer, blindness, immune disorders, and neurological disorders, as well as for the development of vaccines.

[0005] AAV is characterized by low immunogenicity and low pathogenicity, and gene therapy using AAV has also been surprisingly successful, but up to 50% of patients are currently excluded from this treatment due to the presence of neutralizing antibodies to natural AAV capsid proteins in the human immune system. To avoid such immune disorders, methods can be adopted to avoid existing neutralizing antibodies using engineered AAV capsids or to temporarily remove neutralizing antibodies before treatment. Engineered AAV capsids can not only avoid neutralizing antibodies but also target AAV to expected tissue cell types, thereby achieving precise treatment goals. Directed evolution is a powerful tool for the current modification of AAV capsids. In principle, directed evolution uses high-throughput technical means to introduce mutations into genes and their encoded proteins, simulating natural evolution to greatly accelerate the protein diversification and selection process. This method involves three basic steps: establishing a sequence diversity library of target genes, screening from the protein library encoded by the mutant gene library, and amplifying the gene sequence encoding the desired character. These three steps constitute one round of directed evolution, and multiple rounds of evolutionary screening can be performed iteratively until a specific gene / protein with improved properties is obtained.

[0006] However, the current use of adeno-associated virus as a vector for auditory system gene therapy has drawbacks such as low tissue specificity and low infection efficiency, for example, adeno-associated virus vectors are known to infect hair cells as well as supporting cells, and supporting cells and hair cells express different pathogenic genes, respectively, and the non-specificity of vector infection has a negative impact on disease treatment. Therefore, in order to achieve precise gene therapy, a novel recombinant adeno-associated virus vector that is both efficient and specific is needed. Summary of the Invention

[0007] overview The present invention aims to overcome the shortcomings of the prior art and provides a novel adeno-associated virus vector that can efficiently and specifically introduce genes into the cochlea, ocular retina, and other tissues for gene therapy. The present invention infects the mouse cochlea in vivo with a modified novel adeno-associated virus vector, and allows the target gene to be specifically expressed in cochlear supporting cells, thereby specifically labeling or controlling the supporting cells. The novel adeno-associated virus has a wide range of application value and market prospects, such as structural and functional analysis of cochlear supporting cells, establishment of disease models, and gene therapy. Meanwhile, when the virus was injected into the mouse eyeball through the vitreous body, it was found to have superior infection characteristics compared to existing vectors, and to have a wide range of application value and market prospects, such as structural and functional analysis of ocular cells, establishment of disease models, and gene therapy.

[0008] One object of the present invention is to provide a fusion adeno-associated virus capsid protein comprising a fusion peptide fragment of a peptide fragment of serotypes AAV1, AAV2, AAV6 and AAV7, or a variant thereof.

[0009] Another object of the present invention is to provide a nucleic acid encoding the above-mentioned fusion adeno-associated virus capsid protein.

[0010] Another object of the present invention is to provide a construct comprising the above nucleic acid.

[0011] Another object of the present invention is to provide a host cell comprising a construct or genome incorporating an exogenous nucleic acid as described above, or a host cell comprising the fusion adeno-associated virus as described above.

[0012] Another object of the present invention is to provide a fusion adeno-associated virus, the capsid structure of the fusion adeno-associated virus comprising any one of the fusion adeno-associated virus capsid proteins described above.

[0013] A host cell transformed with the above-mentioned fusion adeno-associated virus.

[0014] Another object of the present invention is to provide a fusion adeno-associated virus vector system comprising a packaging plasmid containing the above-mentioned nucleic acid or nucleic acid fragment.

[0015] Another object of the present invention is to provide a fusion adeno-associated virus obtained by virus packaging of the above fusion adeno-associated virus vector system.

[0016] Another object of the present invention is to provide a pharmaceutical composition comprising the above-mentioned fusion adeno-associated virus and a pharma- ceutically acceptable auxiliary material.

[0017] Another object of the present invention is to provide the use of the above-mentioned fusion adeno-associated virus capsid protein, nucleic acid, construct, fusion adeno-associated virus, host cell, fusion adeno-associated virus vector system, pharmaceutical composition or conjugate in the preparation of a medicament for treating a disease; preferably, a medicament for gene therapy of a disease.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) providing a novel supporting cell-specific adeno-associated virus vector that can mediate specific expression of a target gene in cochlear supporting cells of newborn mice; (2) providing a novel adeno-associated virus vector that can mediate specific expression of a target gene in cochlear hair cells of adult mice; (3) providing a novel adeno-associated virus vector that can mediate specific expression of a target gene in the retinal RPE layer of adult mice; (4) the novel adeno-associated virus vector mediates target gene expression more flexibly, safely, conveniently, and cost-effectively than conventional transgenic methods; and (5) the novel specific adeno-associated virus vector enables the development of gene therapy to precisely treat otolaryngological and ophthalmological related diseases. [Brief description of the drawings]

[0019] [Figure 1]FIG. 1 shows the in vivo screening procedure for DNA family shuffling libraries. [Diagram 2] Figure 2 shows a computer-simulated diagram of the AAV-M9 structure. [Diagram 3] Figure 3 shows the infection characteristics of adeno-associated virus in neonatal mice. Figure 3a shows the immunostaining photographs of green fluorescent EGFP and hair cell specific marker protein Myo7a after the cochlea tissue is excised and dissected 14 days after the cochlea of ​​neonatal mice is injected with AAV-ie and AAV-M9. The photograph of the hair cell layer is selected. Figure 3b shows the immunostaining photographs of green fluorescent EGFP and hair cell specific marker protein Myo7a after the cochlea tissue is excised and dissected 14 days after the cochlea of ​​neonatal mice is injected with AAV-ie and AAV-M9. The photograph of the supporting cell layer is selected. Figure 3c shows the data statistics of hair cells and dieters cells in Figures 3a and 3b. [Figure 4] Figure 4 shows the safety of adeno-associated virus in neonatal mice. Figure 4a shows immunostaining pictures of hair cell-specific marker protein Myo7a after injecting AAV-M9 into the cochlea of ​​neonatal mice and normal mouse cochlea tissues and then dissecting and extracting the cochlear tissues 14 days later. Figure 4b shows the data statistics of the outer and inner hair cells in Figure 4a. [Diagram 5] Figure 5 shows the infection characteristics of adeno-associated viruses in adult mice. Figure 5a shows the immunostaining photographs of green fluorescent EGFP and hair cell specific marker protein Myo7a after the cochlea tissue was excised and dissected 14 days after AAV-ie and AAV-M9 were injected into the cochlea of ​​adult mice. Figure 5b shows the data statistics for the outer hair cells of Figure 5a. Figure 5c shows the data statistics for the inner hair cells of Figure 5a. [Figure 6]Figure 6 shows the safety of adeno-associated virus in adult mice. Figure 6a shows immunostaining pictures of hair cell-specific marker protein Myo7a after extracting and dissecting cochlear tissue 14 days after injecting AAV-M9 into the cochlea of ​​adult mice and normal mouse cochlea tissue. Figure 6b shows the data statistics of outer hair cells and inner hair cells in Figure 6a. [Figure 7] FIG. 7 shows infection of AAV-M9-CMV-EGFP in the RPE layer of the eye. [Figure 8] FIG. 8 shows the characterization of AAV-M9-CMV-EGFP for ocular transfection in non-primates. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] Detailed Description Hereinafter, the present invention will be described in detail with reference to specific examples, and other advantages and effects of the present invention will be readily apparent to those skilled in the art from the disclosure of this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0021] The present invention provides fusion adeno-associated virus capsid proteins comprising peptide fragments (fusion peptide fragments or chimeric peptide fragments) formed by fusion of peptide fragments of serotypes AAV1, AAV2, AAV6 and AAV7 or variants thereof.

[0022] In some preferred embodiments, in the fusion adeno-associated virus capsid protein, the fusion peptide fragment comprises a first peptide fragment, a second peptide fragment, a third peptide fragment, a fourth peptide fragment and a fifth peptide fragment linked in sequence; the first peptide fragment comprises a peptide fragment derived from AAV1, the second peptide fragment comprises a peptide fragment derived from AAV7, the third peptide fragment comprises a peptide fragment derived from AAV2, the fourth peptide fragment is derived from a peptide fragment comprising AAV1, and the fifth peptide fragment is derived from a peptide fragment comprising AAV6. Preferably, the first peptide fragment comprises an amino acid fragment from position 1 to position 262 of SEQ ID NO:2 (SEQ ID NO:3), the second peptide fragment comprises an amino acid fragment from position 263 to position 325 of SEQ ID NO:2 (SEQ ID NO:4), the third peptide fragment comprises an amino acid fragment from position 326 to position 417 of SEQ ID NO:2 (SEQ ID NO:5), the fourth peptide fragment comprises an amino acid fragment from position 418 to position 583 of SEQ ID NO:2 (SEQ ID NO:6), the fifth peptide fragment comprises an amino acid fragment from position 584 to position 736 of SEQ ID NO:2 (SEQ ID NO:7), and the fusion adeno-associated virus capsid protein comprises an S430I mutation.

[0023] [Table 1-1] [Table 1-2]

[0024] In the fusion adeno-associated virus capsid proteins of the invention, the peptide fragments are directly fused to each other.

[0025] In the fusion adeno-associated virus capsid protein of the present invention, the peptide fragments of serotypes AAV1 and AAV6 are assembled in the protrusion of the 3-fold symmetry axis of the capsid protein. The peptide fragments of serotypes AAV2, AAV6 and AAV7 are assembled in the channel of the 5-fold symmetry axis of the capsid protein. The peptide fragment of serotype AAV6 forms a recess in the 2-fold symmetry axis of the capsid protein, and the computer simulation structure is shown in FIG. 2.

[0026] Under an electron microscope, the nucleocapsid of an adeno-associated virus is generally suborbicular. A suborbicular capsid is actually a closed icosahedral symmetric hollow capsid composed of multiple protein capsomeres, within which the genomic nucleic acid is encased. One icosahedral symmetric structure is composed of three rotational symmetry modes: three-fold symmetry, two-fold symmetry, and five-fold symmetry. That is, the symmetric three-dimensional structure has a three-fold axis of symmetry passing through the center points of two opposite sides of the virus particle, around which the capsomeres rotate three times and reset, forming a triangular surface; a two-fold axis of symmetry (edge), around which the capsomeres rotate twice and reset, forming two intersecting triangular surfaces; and a five-fold axis of symmetry passing through two opposite vertices, around which the capsomeres rotate five times and reset, forming a pentamel. Thus, a capsid with icosahedral symmetry is composed of 20 equilateral triangular faces, with every two triangular faces intersecting to form an edge, for a total of 30 edges.

[0027] In some preferred embodiments, the capsid protein comprises: a) the amino acid sequence shown in SEQ ID NO:2; or b) A polypeptide fragment having 90% or more sequence identity with SEQ ID NO:2 and having the function of the amino acid sequence shown in SEQ ID NO:2. Includes.

[0028] The polypeptide fragment of b) specifically means a polypeptide fragment obtained by substituting, deleting or adding one or more amino acids (specifically, 1-50, 1-30, 1-20, 1-10, 1-5, 1-3, 1, 2 or 3) to the amino acid sequence shown in SEQ ID NO: 2, or a polypeptide fragment obtained by adding one or more amino acids (specifically, 1-50, 1-30, 1-20, 1-10, 1-5, 1-3, 1, 2 or 3) to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO: 2, which has the function of the amino acid sequence shown in SEQ ID NO: 2, and the amino acid sequence of a) may have a sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more to SEQ ID NO: 2.

[0029] In some preferred embodiments, the nucleic acid sequence of the gene encoding the capsid protein comprises the nucleotide sequence set forth in SEQ ID NO: 1, preferably, the nucleic acid sequence of the gene encoding the capsid protein is set forth in SEQ ID NO: 1. In some preferred embodiments, the nucleic acid sequence of the gene encoding the capsid protein comprises a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity to SEQ ID NO: 1.

[0030] The present invention also provides a nucleic acid encoding a fusion adeno-associated virus capsid protein as described above.

[0031] The present invention also provides a construct comprising the above-mentioned nucleic acid. The construct can generally be obtained by inserting the above-mentioned nucleic acid into a suitable expression vector, and the suitable expression vector can be selected by a person skilled in the art.

[0032] The present invention further provides a host cell, wherein the host cell comprises the construct described above, or wherein the genome of the host cell has integrated the exogenous nucleic acid described above, or wherein the host cell comprises the fusion adeno-associated virus described in any one of the above.

[0033] Representative examples of suitable host cells include mammalian cells (such as CHO or COS), plant cells, human cells (human embryonic kidney cells such as HEK293FT), bacterial cells (such as E. coli, Streptomyces, Salmonella typhimurium, etc.), fungal cells (such as yeast), insect cells (such as Sf9), etc. One skilled in the art can select an appropriate host following the teachings of this specification. Preferably, the host cell is an animal cell, more preferably a human cell. The host cell may be a cultured cell or a primary cell, i.e., a cell directly isolated from an organism such as a human. The host cell may be an adherent cell or a suspension cell, i.e., a cell grown in suspension.

[0034] The present invention also provides a fusion adeno-associated virus comprising any one of the fusion adeno-associated virus capsid proteins described above.

[0035] In addition, the fusion adeno-associated virus further comprises a heterologous nucleotide sequence encoding a product of interest, and the heterologous nucleotide sequence encoding the product of interest can be encapsulated and carried by various capsid proteins. The heterologous nucleotide sequence encoding the product of interest may generally be a construct, which may generally be composed of a nucleic acid encoding the product of interest. The construct is generally obtained by inserting the nucleic acid encoding the product of interest into a suitable expression vector. A suitable expression vector may be selected by one skilled in the art. For example, the expression vector includes, but is not limited to, pAAV-CAG, pAAV-TRE, pAAA-EF1a, pAAV-GFAP promoter, pAAA-Lgr5 promoter, pAAA-Sox2 promoter expression vector, etc. In the present invention, when the fusion adeno-associated virus comprises a heterologous nucleotide sequence encoding a product of interest, the fusion adeno-associated virus comprises a capsid, the viral vector carries a transgene encoding a gene product, and the transgene is regulated by a regulatory sequence that induces expression in a host cell. In some preferred embodiments, the amino acid sequence of the capsid protein is shown in SEQ ID NO:2.

[0036] Furthermore, the product of interest may be a nucleic acid or a protein, where nucleic acids include, but are not limited to, small guide RNA (sgRNA), interfering RNA (RNAi), etc., and protein-encoding genes include, but are not limited to, prestin and Atoh1.

[0037] The fusion adeno-associated virus can be used as a vector material for introducing foreign genes into the cells of a test individual, and compared to adeno-associated viruses such as AAV-ie, it can specifically infect supporting cells in juvenile individuals and inner hair cells in mature individuals.

[0038] The present invention also provides an engineered host cell obtained by transformation with a fusion adeno-associated virus. The engineered host cell comprises a fusion adeno-associated virus. The host cell is a eukaryotic and / or prokaryotic cell.

[0039] Representative examples of suitable host cells include mammalian cells (such as CHO or COS), plant cells, human cells (human embryonic kidney cells such as HEK293FT), bacterial cells (such as E. coli, Streptomyces, Salmonella typhimurium, etc.), fungal cells (such as yeast), insect cells (such as Sf9), etc. Appropriate hosts can be selected by those skilled in the art following the teachings of this specification. Preferably, the host cells are animal cells, more preferably human cells. The host cells may be cultured cells or primary cells, i.e., cells directly isolated from an organism such as a human. The host cells may be adherent cells or suspension cells, i.e., cells grown in suspension.

[0040] The present invention also provides a fusion adeno-associated virus vector system, which comprises a packaging plasmid, the packaging plasmid comprising the above-described nucleic acid or nucleic acid fragment.

[0041] Additionally, the packaging plasmid further comprises an adeno-associated virus rep gene fragment, wherein the rep gene fragment includes an intron containing a transcription termination sequence.

[0042] In addition, the adeno-associated virus vector system further comprises an expression plasmid comprising a heterologous nucleotide encoding a product of interest.Furthermore, the product of interest may be a nucleic acid or a protein, where the nucleic acid includes, but is not limited to, small guide RNA (sgRNA), interfering RNA (RNAi), etc., and the protein-encoding gene includes, but is not limited to, prestin and Atoh1.

[0043] In addition, the adeno-associated virus vector system further comprises a helper virus plasmid or a helper virus.In addition, the adeno-associated virus vector system further comprises a host cell.

[0044] The packaging plasmid, expression plasmid and helper virus plasmid are transfected into the host cell, and all nucleic acid sequences are integrated into the host cell to produce fusion adeno-associated virus.In some embodiments, all nucleic acid sequences are integrated together into a single locus in the cellular genome of the host cell.In some embodiments, the nucleic acid sequences encoding various genes are present as separate expression cassettes, preventing the risk of recombination to form a replicable virus; the nucleic acid sequences encoding rep and cap genes are present in the same expression cassette.

[0045] The present invention also provides a fusion adeno-associated virus obtained by viral packaging of the fusion adeno-associated virus vector system as described above.

[0046] The present invention also provides a pharmaceutical composition comprising the above-mentioned fusion adeno-associated virus and pharma- ceutical acceptable auxiliary materials.The fusion adeno-associated virus or pharmaceutical composition provided by the present invention can be adapted to a suitable administration mode, and can be injected into the cochlea, eye, muscle, nervous system or blood circulation.Those skilled in the art can select a suitable dosage according to the administration mode.

[0047] Auxiliary materials may contain various excipients and diluents that are not essential active ingredients themselves and do not have excessive toxicity after administration. Auxiliary materials are well known to those skilled in the art. Acceptable carriers include, for example, sterilized water or physiological saline, stabilizers, excipients, antioxidants (such as ascorbic acid), buffers (such as phosphoric acid, citric acid, other organic acids), preservatives, surfactants (such as PEG, Tween), chelating agents (such as EDTA), adhesives, etc. In addition, they may contain other low molecular weight polypeptides; proteins such as serum albumin, gelatin, and immunoglobulin; amino acids such as glycine, glutamine, asparagine, arginine, and lysine; sugars or carbohydrates such as polysaccharides and monosaccharides; sugar alcohols such as mannitol and sorbitol, etc. When preparing an injectable aqueous solution such as physiological saline, an isotonic solution containing glucose or other auxiliary drugs, for example, D-sorbitol, D-mannose, D-mannitol, sodium chloride, etc., and a suitable solubilizing agent such as alcohols (ethanol, etc.), polyols (propylene glycol, PEG, etc.), nonionic surfactants (Tween 80, HCO-50), etc., can be used in combination.

[0048] In the pharmaceutical composition provided by the present invention, the fusion adeno-associated virus AAV-M9 can be a single active ingredient, or can be combined with one or more other active ingredients useful for the treatment of hearing impairment or ophthalmological disease to form a combined preparation.The other active ingredients can be various other drugs that can be used for the treatment of hearing impairment or ophthalmological disease. The amount of the active ingredient in the composition is generally a safe and effective amount, and the safe and effective amount should be adjustable by those skilled in the art. For example, the amount of the active ingredient of the fusion adeno-associated virus AAV-M9 and pharmaceutical composition generally varies depending on the patient's weight, the type of administration, the state and severity of the disease. For example, the amount of the dual-functional compound as an active ingredient may generally be 1-1000 mg / kg / day, 1-3 mg / kg / day, 3-5 mg / kg / day, 5-10 mg / kg / day, 10-20 mg / kg / day, 20-30 mg / kg / day, 30-40 mg / kg / day, 40-60 mg / kg / day, 60-80 mg / kg / day, 80-100 mg / kg / day, 100-200 mg / kg / day, 200-500 mg / kg / day, or 500 mg / kg / day or more.

[0049] The present invention also provides a conjugate comprising the fusion adeno-associated virus AAV-M9 or a biologically active polypeptide linked as described above.

[0050] The present invention also provides the use of fusion adeno-associated virus AAV-M9 capsid protein, nucleic acid, construct, fusion adeno-associated virus AAV-M9, host cell, fusion adeno-associated virus vector system, pharmaceutical composition or conjugate in the manufacture of medicine for preventing and / or treating disease.Preferably, the present invention provides the use of fusion adeno-associated virus AAV-M9 capsid protein, nucleic acid, construct, fusion adeno-associated virus AAV-M9, host cell, fusion adeno-associated virus vector system, pharmaceutical composition or conjugate in the manufacture of medicine for preventing and / or treating disease.The disease includes, but is not limited to, one or more of hearing loss disease, ophthalmological disease, inflammation, tumor, metabolic disease, pain, neurodegenerative inflammatory disease, etc.

[0051] The hearing impairment is selected from mild hearing loss, deafness and tinnitus.

[0052] Ophthalmic diseases include, but are not limited to, dry AMD, wet AMD, or choroidal neovascularization (CNV), such as age-related macular degeneration (AMD), choroidal neovascularization (CNV), choroidal neovascular membrane (CNVM), cystoid macular edema (CME), epiretinal membrane (ERM), and macular hole; myopia-related choroidal neovascularization, vascular stripes, retinal detachment, diabetic retinopathy, diabetic macular edema (DME), atrophic lesions of the retinal pigment epithelium (RPE), hypertrophic lesions of the retinal pigment epithelium (RPE), retinal vein occlusion, choroidal retinal vein occlusion, macular edema; hypoxia-related Corneal neovascularization, pterygium conjunctiva, subretinal edema and intraretinal edema; or one or more of retinal vein occlusion, retinitis pigmentosa, Stargardt disease, glaucoma, inflammatory disease, cataract, intractable abnormality, keratoconus, retinopathy of prematurity, preocular neovascularization, corneal neovascularization after keratitis, corneal transplantation, macular edema due to keratoplasty; for example, Leber's congenital amaurosis (LCA), retinitis pigmentosa, Stargardt disease due to RPE cell-related gene mutation, etc. In a preferred embodiment, the ophthalmic disease refers to an RPE layer-related disease, i.e., gene therapy of ophthalmic disease can be achieved by infecting the RPE layer with a virus.

[0053] The inflammation is selected from the group consisting of skin inflammation, vascular inflammation, allergy, autoimmune disease, fibrosis, scleroderma or transplant rejection, and the autoimmune disease is selected from the group consisting of rheumatoid arthritis, systemic sclerosis, systemic lupus erythematosus, Sjogren's syndrome, polymyositis, and the like.

[0054] The cancer is selected from lymphoma, hematological tumors, or solid tumors, specifically, adrenal cortical carcinoma, urothelial carcinoma of the bladder, breast cancer, squamous cell carcinoma of the cervix, adenocarcinoma of the cervix, bile duct carcinoma, adenocarcinoma of the colon, lymphatic tumors, diffuse large B-cell lymphoma, esophageal cancer, glioblastoma multiforme, squamous cell carcinoma of the head and neck, renal pigment cell carcinoma, renal clear cell carcinoma, papillary cell renal carcinoma, acute myeloid leukemia, low-grade brain glioma, and hepatocellular carcinoma. The tumor is selected from one or more of the following tumor cells: lung adenocarcinoma, lung squamous cell carcinoma, medium cell carcinoma, ovarian cancer, pancreatic cancer, pheochromocytoma and paraganglioma, prostate cancer, rectal cancer, malignant sarcoma, melanoma, gastric cancer, testicular germ cell tumor, thyroid cancer, thymic carcinoma, endometrial cancer, uterine sarcoma, uveal melanoma, multiple myeloma, acute lymphocytic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, T-cell lymphoma, B-cell lymphoma. Preferably, the tumor is one or more of colorectal cancer and / or melanocytoma, etc.

[0055] The metabolic disease is selected from diabetes, including type I and type II diabetes, and diseases and conditions related to diabetes.The metabolic disease includes, but is not limited to, one or more of atherosclerosis, cardiovascular disease, nephropathy, neuropathy, retinopathy, beta cell dysfunction, dyslipidemia, hyperglycemia, insulin resistance, chronic obstructive pulmonary disease, etc.

[0056] In a more preferred embodiment, gene therapy refers to the treatment of hearing loss diseases. The fusion adeno-associated virus or pharmaceutical composition can achieve the treatment of hearing loss by delivering a product of interest to the hair cells and / or supporting cells of an individual.

[0057] In the use of the fusion adeno-associated virus AAV-M9, host cell, vector system, pharmaceutical composition or conjugate of the present invention for delivering a product of interest to hair cells and / or supporting cells of an individual, the delivery of the product of interest may be a non-diagnostic treatment, for example, the delivery of a product of interest to hair cells and / or supporting cells in vitro or ex vivo. The hair cells generally include outer hair cells and / or inner hair cells, and preferably the hair cells are inner hair cells of an adult individual.

[0058] Furthermore, the product of interest is a nucleic acid or a protein, and the nucleic acid may be a small guide RNA (sgRNA), an interfering RNA (RNAi), and the like.

[0059] In the present invention, hearing impairment disease can be caused by damage to the cochlea caused by environmental factors.Therefore, the present invention also provides the use of the above-mentioned fusion adeno-associated virus in medicines for treating hearing impairment caused by individual environmental factors.

[0060] Furthermore, the hearing loss disease is hair cell and / or supporting cell-related disease. In some preferred embodiments, for juvenile individuals, the hearing loss disease is preferably a supporting cell-related disease. In some preferred embodiments, for adult individuals, the hearing loss disease is preferably an inner ear cell-related disease. In some preferred embodiments, the hearing loss disease is prevented or treated by inducing inner ear cell regeneration. In another preferred embodiment, the hearing loss disease is prevented or treated by overexpressing Wnt2b and Atoh1 to induce inner ear cell regeneration.

[0061] Further, the hearing impairment disease may be a disease associated with a genetic defect, environmental damage or aging, for example, a disease associated with a genetic mutation, for example, a disease associated with noise or drugs, for example, a disease associated with aging.

[0062] Furthermore, the hearing loss disease may be an associated disease such as cell damage, specifically, cochlear hair cell damage, supporting cell damage, etc., and more specifically, cochlear hair cell damage due to genetic mutation, supporting cell damage due to genetic mutation, cell damage due to noise, cell damage due to drugs, cell damage due to aging, etc.

[0063] Additionally, fusogenic adeno-associated viruses are used as vectors to deliver products of interest.

[0064] The present invention also provides a method for treating hearing loss diseases, comprising administering to a subject in need thereof an effective amount of the fusion adeno-associated virus, host cell, vector system, or pharmaceutical composition or conjugate of the present invention. Typically, a physician can determine the actual dosage that will be most suitable for a patient, and may vary according to the age, weight, and response of the particular individual.

[0065] In the present invention, the patient can be administered the fusion adeno-associated virus or host cell or vector system or pharmaceutical composition of the present invention. A person skilled in the art can determine the appropriate mode and dosage of administration.

[0066] Delivery of one or more therapeutic genes by the fusion adeno-associated viruses described herein can be used alone or in combination with other therapeutic methods or components.

[0067] The fusion adeno-associated viruses of the invention are used to infect cells to deliver genes and / or linked (e.g., covalently linked) biologically active polypeptides to the cells. Thus, the invention provides a method of delivering a transgene to a cell by infecting the cell with one or more of the fusion adeno-associated viruses or conjugates of the invention, where the fusion adeno-associated viruses or conjugates comprise one or more transgenes.

[0068] The present invention also provides a method for producing a stable cell line that produces a fusion adeno-associated viral vector, comprising the steps of: Introducing a fusion adeno-associated viral vector as defined herein into a culture of mammalian host cells; and selecting within said culture mammalian host cells having the nucleic acid sequence encoded by the vector integrated into an endogenous chromosome of said mammalian host cell; Includes A method is provided.

[0069] The AAV vector producing cell is a mammalian cell.In some embodiments, the mammalian cell is selected from HEK293 cell, CHO cell, Jurkat cell, K562 cell, PerC6 cell, HeLa cell or their derivatives.In some embodiments, the mammalian host cell is HEK293 cell or derived from HEK293 cell.In some embodiments, the HEK293 cell is HEK293T cell.

[0070] The genome sequences of various serotypes of AAV, and the sequences of natural ITR, Rep protein, capsid protein are known in the art.Such sequences can be found in literature or public databases such as GenBank.The disclosures thereof are incorporated herein by reference for use in AAV nucleic acid and amino acid sequences.

[0071] In the compounds and uses of the present invention, when the fusion adeno-associated virus is used in combination with other therapeutic agents, the active compound is co-administered with the other therapeutic agents. "Co-administration" means simultaneous administration in the same formulation, or administration in two different formulations by the same or different routes, or sequential administration by the same or different routes. "Sequential" administration means that there is a time difference of a few seconds, minutes, hours or days between the administration of two or more different compounds.

[0072] In certain embodiments, the fusion adeno-associated viruses and methods of the present invention can be used to prevent hearing loss and can be administered as a prophylactic treatment prior to hearing loss or a period of time after exposure to an environment that predisposes to hearing loss.

[0073] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly known to one of ordinary skill in the art.

[0074] The term "vector" refers to a polymer or combination of polymers that contains or is associated with a polypeptide and can be used to mediate delivery of the polypeptide into a cell. Exemplary vectors include, for example, plasmids, viral vectors, liposomes, or other gene delivery vectors.

[0075] The term "AAV" is an abbreviation for adeno-associated virus and is used to refer to the virus itself or its derivatives.

[0076] The term "recombinant AAV vector" refers to an AAV vector that contains a heterologous polynucleotide sequence, which is usually a sequence of interest for the genetic transformation of a cell. Generally, the heterologous polynucleotide is flanked at both ends by at least one, and typically two, AAV inverted terminal repeats (ITRs).

[0077] The term "AAV virus" or "AAV viral particle" or "AAV vector particle" refers to a viral particle of an AAV vector that contains at least one AAV capsid protein and an encapsulated polynucleotide.

[0078] The term "packaging" refers to a series of intracellular processes that result in the assembly and encapsulation of AAV particles.

[0079] AAV "rep" and "cap" genes refer to polynucleotide sequences that encode the replication and encapsidation proteins of the adeno-associated virus. As used herein, AAV rep and cap are referred to as AAV "packaging genes."

[0080] AAV "helper virus" refers to a virus that enables AAV to replicate and be packaged in a mammalian cell. Such AAV helper viruses include adenoviruses, herpes viruses, and pox viruses (such as vaccinia), and are known in the art.

[0081] The term "infectious" virus or viral particle is one that is capable of delivering polynucleotide components into cells that have the parental viral properties of the viral species. This term does not necessarily imply that the virus is replication-competent.

[0082] The term "producer cell" refers to a cell line that contains the AAV packaging genes (rep and cap genes), any desired helper virus genes, and the DNA genome of a recombinant AAV vector (e.g., a target transgene flanked by two AAV inverted terminal repeats (ITRs)) stably integrated into the host cell genome.

[0083] The terms "including" and "including" and the like are to be understood to be inclusive and not exclusive or exhaustive, i.e., "including, but not limited to."

[0084] The term "subject" generally includes humans, non-human primates, such as mammals, dogs, cats, horses, sheep, pigs, cows, etc., that may benefit from treatment with a formulation, kit, or combination.

[0085] The term "therapeutically effective amount" generally means an amount that can achieve the effect of treating the above-mentioned diseases after an appropriate administration period.

[0086] The terms "therapeutic" and "prophylactic" are understood in the broadest sense. The term "treatment" does not necessarily mean to treat a mammal until it is completely cured. Similarly, "prophylactic" does not necessarily mean that the subject will not eventually contract the disease state. Thus, treatment and prophylaxis include alleviating symptoms, preventing the onset, or reducing the risk of a particular disease. The term "prophylaxis" is also understood to mean reducing the severity of onset of a particular disorder. Treatment may also reduce the severity of an existing condition or reduce the frequency of acute episodes.

[0087] In the present invention, the subject or individual to be treated therapeutically or prophylactically is preferably a mammal, such as, but not limited to, a human, a primate, a livestock animal (e.g., sheep, cow, horse, donkey, pig), a pet (e.g., dog, cat), a laboratory test animal (e.g., mouse, rabbit, rat, guinea pig, hamster) or a captive wild animal (e.g., fox, deer). Preferably, the subject is a primate. Most preferably, the subject is a human.

[0088] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the following specific embodiments. It should also be understood that the terms used in the examples of the present invention are for describing specific embodiments and are not intended to limit the scope of protection of the present invention. In addition, in the specification and claims of the present invention, the singular forms "a", "an" and "the" include the plural forms unless the context clearly indicates otherwise.

[0089] When the embodiment shows a range of values, it should be understood that the two endpoints of each value range and any value between the two endpoints are arbitrary unless otherwise specified by the present invention.Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art.In addition to the specific methods, devices and materials used in the embodiment, any method, device and material similar or equivalent to the method, device and material described in the embodiment of the present invention can be used to implement the present invention according to the knowledge of the prior art and the description of the present invention by those skilled in the art.

[0090] Unless otherwise indicated, all experimental, detection and preparative methods disclosed in the present invention employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and related techniques, which are well described in the existing literature. EXAMPLES

[0091] Example 1. Obtaining the novel adeno-associated virus AAV-M9 (also called AAV-WM01) a. Construction of DNA family shuffling libraries DNA family shuffling was performed using the capsid sequences of 13 AAV serotypes (AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13) found in humans and non-human primates as parents. A total of 4 μg of parent capsid sequences were mixed in an equimolar ratio for DNA family shuffling and treated with 0.04 U DNase I at 25 °C for 30 s to randomly cleave the complete parent capsid sequence into fragments of different lengths. DNA fragments of 100 to 500 bp were collected and purified, and 500 ng of the DNA fragments were subjected to primerless PCR to elongate to a complete chimeric capsid sequence. After sufficient chimeric capsid sequences were obtained by amplification, the chimeric capsid sequences were recombined into a library vector containing the AAV2 Rep gene and terminal repeat sequences. The recombinant products were transformed into competent cells by electroporation, and a portion of the bacterial solution was inoculated onto a plate to count the colonies that grew on the plate. The colonies were identified by sequencing to examine the colony diversity. The remaining bacterial solution was inoculated into 500 mL of medium and cultured overnight at 37°C. The plasmid extracted the next day was the plasmid of the DNA family shuffling library. The in vivo screening procedure for the DNA family shuffling library is shown in Figure 1.

[0092] b. Packaging of DNA family shuffling library viruses The obtained DNA family shuffling library plasmid and adenovirus helper plasmid pHelper (the full-length sequence of the plasmid is shown in SEQ ID NO: 12 of AAV-ie patent document CN110437317A) were co-transfected into HEK-293T cells in appropriate amounts. Each 15 cm dish of cells was transfected with 20 ng of DNA family shuffling library plasmid alone.

[0093] The medium was harvested after 72 hours of transfection, and cells and medium were harvested after a further 48 hours. The cells were lysed with 110 mM citrate buffer (pH 4.2) to release the AAV, and the virus-containing supernatant was centrifuged and neutralized with 1 / 5 volume of 2 M HEPES. Polyethylene glycol 8000 (final concentration 8%) and 500 mM sodium chloride were added to precipitate the virus overnight at 4°C. After centrifugation, the precipitate was diluted with 2 mM Mg 2+ The virus was resuspended in PBS containing 100 U / mL benzonase and the nucleic acids were digested at least 1 hour at 37° C. The virus suspension was purified by ultracentrifugation on an iodixanol density gradient (15%, 25%, 40% and 60%), and the virus titer was measured by qPCR using AAV2 Rep gene-specific primers (WPRE-F: GTCAGGCAACGTGGCGTGGTGTG (SEQ ID NO: 8); WPRE-R: GGCGATGAGTTCCGCCGTGGC (SEQ ID NO: 9)).

[0094] c. In vivo screening We screened for novel adeno-associated viruses that efficiently infect cochlear cells by in vivo injection into mouse cochleae. Approximately 1E + 10 to 11 vg of library virus was injected into the cochlea of ​​a 2-3 day old mouse through the oval window, and 7-10 days after injection, the mouse was euthanized and the cochlea was collected. At this time, AAV that was able to infect cochlear cells among the library viruses entered the cells, and AAV that could not infect the cells was eliminated by the immune system and circulatory system. Therefore, the present invention can recover the capsid gene of AAV-infected cells from the total DNA of tissue cells. Total tissue DNA was extracted with Trizol, and the AAV capsid gene was recovered from the total DNA using PCR, completing the in vivo screening of the AAV library. The fragment obtained by PCR was cloned into the library vector to obtain the next library plasmid, and the library plasmid was packaged again into a virus to repeat the in vivo screening, and after 3 to 5 rounds of screening, the recovered AAV capsid gene was subjected to third generation sequencing. In this way, information on the capsid genes of some AAV mutants enriched in cochlear cells was obtained, and some AAV mutants with high abundance could theoretically transduce cochlear cells efficiently. The obtained AAV-M9 is one of the high abundance mutants, as shown in SEQ ID NO:1.

[0095] Sequencing revealed that AAV-M9 was a chimera of AAV1, 2, 6 and 7 and contained the S430I mutation. A 3D homology model of the AAV-M9 capsid was created using residues from the VP3 region by amino acid sequence alignment with its parent serotypes. Both the inner (B) and outer (C) surfaces of the capsid show the presence of capsid fragments from the four parent AAVs, with the protrusion of the three-fold symmetry axis of AAV-M9 being composed of AAV1 and AAV6, AAV2, 6 and 7 forming a channel of the five-fold symmetry axis, and AAV6 forming a depression of the two-fold symmetry axis (Figure 2). The sequence of the coding gene of AAV-M9 is shown as SEQ ID NO:1, and the amino acid sequence as SEQ ID NO:2. A computer-simulated structural diagram of AAV-M9 is shown in Figure 2.

[0096] Example 2. Biological validation of the novel adeno-associated virus AAV-M9-CMV-EGFP in the auditory system 2.1 Construction of adeno-associated virus AAV-M9-CMV-EGFP The base sequence of the coding gene of AAV-M9 obtained from the above base sequence determination was synthesized by GENEWIZ to obtain the Rep-Cap plasmid of AAV-M9, i.e., pAAV-M9. The obtained Rep-Cap plasmid of AAV-M9, pAAV-CMV-EGFP, a genome plasmid expressing green fluorescent protein EGFP, and pHelper plasmid were co-transfected into HEK-293T cells in appropriate amounts, and AAV was purified by iodixanol gradient ultrafast centrifugation to obtain an appropriate concentration of 1E+12-1E+13GC / mL virus titer, stored at -80℃, and used later.

[0097] 2.2 Infection characteristics of adeno-associated virus AAV-M9-CMV-EGFP in newborn mice The same titers of AAV-ie and AAV-M9-CMV-EGFP were injected into the cochleae of 2-3-day-old C57BL / 6J mice through the oval window. 10-14 days after complete virus infection and EGFP expression, the mice were sacrificed by cervical dislocation, and the cochleae of the injected ears were excised and placed in 4% paraformaldehyde and fixed at room temperature for 2 h. They were washed three times with PBS for 5 min each time. The cochleae were decalcified with 0.5 mM EDTA and softened by immersion at room temperature for 2 h. Under a stereomicroscope, the basement membrane was peeled off with an ophthalmic scalpel. Cochlear samples were prepared for immunofluorescence staining, and hair cells were labeled with anti-Myo7a antibody. Imaging with a confocal laser scanning microscope showed green fluorescent protein expression in the nuclei of virus-infected cells. The wavelengths of excitation light were 488 nm and 647 nm, respectively. The biopsy results are shown in Figures 3a and 3b. Figure 3a shows a patch diagram of the hair cell layer of the cochlea injected with AAV-ie and AAV-M9-CMV-EGFP viruses, and Figure 3b shows a patch diagram of the supporting cell layer of the cochlea injected with AAV-ie and AAV-M9-CMV-EGFP viruses. The hair cell marker protein Myo7a is shown in purple, and the fluorescent protein expressed by the virus-infected cells is shown in green. Figure 3c shows statistical data of hair cells and Deiters cells (supporting cells) injected with AAV-ie and AAV-M9-CMV-EGFP viruses. Figure 3c shows statistical data of hair cells and Deiters cells (supporting cells) injected with AAV-ie and AAV-M9-CMV-EGFP viruses. These results show that AAV-M9-CMV-EGFP specifically infects supporting cells in the cochlea of ​​young mice, but does not show infectious properties in hair cells. Deiters cells are considered to be the supporting cells with the most regenerative potential, therefore AAV-M9 has great potential for gene therapy of supporting cells and hair cell regeneration.

[0098] 2.3 Safety of the adeno-associated virus AAV-M9-CMV-EGFP in newborn mice AAV-M9-CMV-EGFP was injected into the cochleae of 2-3 day old C57BL / 6J mice through the oval window. 10-14 days after complete infection and expression of the virus, the mice were sacrificed by cervical dislocation, and the cochleae of the injected ear were removed. Meanwhile, the cochleae of age-matched C57BL / 6J mice were harvested as controls, and the cochleae were placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. They were washed three times with PBS for 5 minutes each time. The cochleae were decalcified with 0.5 mM EDTA and softened by immersion at room temperature for 2 hours. The basement membrane was peeled off with an ophthalmic scalpel under a stereomicroscope. The cochlear samples were prepared for immunofluorescence staining, and hair cells were labeled with anti-Myo7a antibody. Imaging with a laser confocal microscope showed that green fluorescent protein was expressed in the nuclei of virus-infected cells. The biopsy results are shown in Figures 4a and 4b. Statistical results showed that the number and morphology of cochlear cells in mice injected with AAV-M9 virus were consistent with those in normal mice, indicating that AAV-M9 virus was not toxic to neonatal mice.

[0099] 2.4 Infectivity of the adeno-associated virus AAV-M9-CMV-EGFP in adult mice AAV-ie and AAV-M9-CMV-EGFP were injected into the cochleae of 30-day-old C57BL / 6J mice through the posterior semicircular canal. After 10–14 days of complete virus infection and EGFP expression, the mice were sacrificed by cervical dislocation, and the cochleae of the injected ears were excised and placed in 4% paraformaldehyde and fixed at room temperature for 2 h. They were washed three times with PBS for 5 min each time. The cochleae were decalcified with 0.5 mM EDTA and softened by soaking overnight at room temperature. Under a stereomicroscope, the basement membrane was peeled off with an ophthalmic scalpel. Cochlear samples were prepared for immunofluorescence staining, and hair cells were labeled with anti-Myo7a antibody. Green fluorescent protein was expressed in the nuclei of virus-infected cells by imaging with a laser confocal microscope. The wavelengths of excitation light were 488 nm and 647 nm, respectively. The biopsy results are shown in Figure 5a. This figure shows the patch diagram of the cochlea injected with AAV-ie and AAV-M9-CMV-EGFP viruses. The labeled protein Myo7a in hair cells is shown in purple, and the fluorescent protein expressed by the virus-infected cells is shown in green. The results show that AAV-M9 specifically infects the inner hair cells of the cochlea of ​​adult mice, but does not have infectious properties in the outer hair cells. The statistical results show that the infection rate of AAV-M9 in the outer hair cells of adult mice was 0.33% ± 0.333, and the infection rate of AAV-ie in the outer hair cells of adult mice was 56.33% ± 1.202 (shown in Figure 5b). The infection rate of AAV-M9 in the inner hair cells of adult mice was 98.67% ± 0.667, and the infection rate of AAV-ie in the inner hair cells of adult mice was 100% ± 0, as shown in Figure 5c. AAV-M9 has high infection efficiency and specificity for the inner hair cells of the cochlea of ​​adult mice, and can therefore be used for gene therapy of inner hair cells.

[0100] 2.5 Safety of the adeno-associated virus AAV-M9-CMV-EGFP in adult mice AAV-M9-CMV-EGFP was injected into the cochleae of 30-day-old C57BL / 6J mice through the oval window. 10–14 days after complete infection and expression of the virus, the mice were killed by cervical dislocation, and the cochleae of the injected ear were removed. Meanwhile, the cochleae of age-matched C57BL / 6J mice were harvested as controls, and the cochleae were placed in 4% paraformaldehyde and fixed at room temperature for 2 h. They were washed three times with PBS for 5 min each time. The cochleae were decalcified with 0.5 mM EDTA and softened by immersion at room temperature for 2 h. Under a stereomicroscope, the basement membrane was peeled off with an ophthalmic scalpel. Cochlear samples were prepared for immunofluorescence staining, and hair cells were labeled with anti-Myo7a antibody. Imaging with a confocal laser scanning microscope revealed green fluorescent protein expression in the nuclei of virus-infected cells. Biopsy results are shown in Figures 6a and 6b. The statistical results indicate that the number and morphology of cochlear cells in mice injected with AAV-M9 virus were consistent with those in normal mice, and the AAV-M9 virus was not toxic to adult mice.

[0101] Example 3. Biological validation of adeno-associated virus AAV-M9-CMV-EGFP in the auditory system Anesthetized adult mice were placed under a microscope, and 1-2 drops of tropicamide eye drops were dropped onto the eyeball to dilate the pupil. The eyeball was lifted from the visual target with elbow tweezers held in the left hand and fixed, and the cornea was punctured with a 1 mL syringe or glass needle held in the right hand to reduce intraocular pressure. Fluids around the eye were wiped off with a paper towel. The eyeball was fixed with tweezers in the left hand, and the adeno-associated virus AAV-M9-CMV-EGFP constructed in 2.1 of Example 2 was slowly injected into the posterior edge of the cornea at 50° to the iris surface using a glass needle holding 2 μL of virus in the right hand, with a titer of 1.5E13gc / mL. After injection, the glass needle was held for 30 seconds and slowly withdrawn. After applying erythromycin ointment to the wound, the mouse was placed in a cage in a water bath at 41 °C to keep it warm, and after the mouse woke up, it was transferred to a mouse breeding room and fed. After 10 days, the eyecups were removed. Mice were sacrificed by cervical dislocation, the eyeballs were enucleated, and the cornea was punctured with a 1 mL syringe to release aqueous humor. The eyeballs were placed in a small culture dish filled with PBS solution and dissected under a microscope. The cornea was held down with sharp tweezers, ophthalmic scissors were pierced through the corneal wound, the cornea was cut circumferentially, and the lens was removed with tweezers, leaving about 2 mm of the optic nerve. The eyecups were fixed in 4% PFA for 12 hours at 4°C. The fixed eyecups were dehydrated in 30% sucrose for 12 hours at 4°C. After frozen sectioning, sections with staining effect and intact tissues were extracted under a fluorescent microscope. The immunofluorescence results show that AAV-M9 can infect the RPE layer. The bioscopy results are shown in Figure 7. This figure shows a retinal section injected with AAV-M9-CMV-EGFP virus. In addition, AAV-M9-CMV-EGFP was shown to have high infectivity for the retinal RPE layer, indicating its potential use in ophthalmic gene therapy.

[0102] Example 4. Characterization of ocular transfection of AAV-M9-CMV-EGFP using non-human primates In this study, 50 μL of adeno-associated virus AAV-M9-CMV-EGFP was injected into the vitreous of both eyes of healthy adult male rhesus macaques. The viral titer was 3.89 × 1012 vg / mL. On day 63 (D63) after virus injection, the animals were euthanized, the eyes were enucleated, and the retina and choroid were subjected to pathological sectioning and staining to analyze the transfection characteristics of the ocular tissues. The results are shown in Figure 8. GFP is mainly expressed in the rod and cone layer (RCL) and pigment epithelium layer (RPE) of the retina, and is also expressed in some vascular endothelial cells of the choroid and sclera.

[0103] The fusion adeno-associated virus AAV-M9 of the present invention and its use in the prevention and / or treatment of ear or eye diseases effectively overcome various drawbacks of the prior art and are of great industrial value.

[0104] The above examples are intended to illustrate aspects of the present disclosure and should not be construed as limiting the present disclosure. Moreover, various modifications and variations of the methods and compositions of the present invention described herein will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been described in detail in connection with various specific preferred embodiments thereof, it should be understood that the present invention should not be limited to these specific examples. Indeed, various modifications such as those described above that would be apparent to those skilled in the art should be encompassed within the scope of the present invention.

Claims

1. A fusion adeno-associated virus capsid protein, characterized in that it comprises a fusion peptide fragment of a peptide fragment derived from serotypes AAV1, AAV2, AAV6 and AAV7, or a mutant thereof.

2. The fusion peptide fragment is characterized in that it comprises a first peptide fragment, a second peptide fragment, a third peptide fragment, a fourth peptide fragment and a fifth peptide fragment linked in order, wherein the first peptide fragment comprises a peptide fragment derived from AAV1, the second peptide fragment comprises a peptide fragment derived from AAV7, the third peptide fragment comprises a peptide fragment derived from AAV2, the fourth peptide fragment is derived from a peptide fragment containing AAV1, and the fifth peptide fragment is derived from a peptide fragment containing AAV6. The fusion adeno-associated virus capsid protein of claim 1.

3. The fusion adeno-associated virus capsid protein of claim 1, characterized in that the first peptide fragment comprises the amino acid fragment set forth in SEQ ID NO:3, the second peptide fragment comprises the amino acid fragment set forth in SEQ ID NO:4, the third peptide fragment comprises the amino acid fragment set forth in SEQ ID NO:5, the fourth peptide fragment comprises the amino acid fragment set forth in SEQ ID NO:6, and the fifth peptide fragment comprises the amino acid fragment set forth in SEQ ID NO:

7.

4. 1) Peptide fragments of serotypes AAV1 and AAV6 are assembled into protrusions on the 3-fold symmetry axis of the capsid protein; 2) Peptide fragments of serotypes AAV2, AAV6, and AAV7 assemble into channels along the 5-fold symmetry axis of the capsid protein; 3) The peptide fragment of serotype AAV6 forms a cleft on the 2-fold symmetry axis of the capsid protein. The fusion adeno-associated virus capsid protein according to claim 1, characterized in that it comprises at least one of the following:

5. a) the amino acid sequence shown in SEQ ID NO:2; b) A polypeptide fragment having 90% or more sequence identity with SEQ ID NO:2 and having the function of the amino acid sequence shown in SEQ ID NO:

2. The fusion adeno-associated virus capsid protein of claim 1, comprising:

6. A nucleic acid, characterized in that it codes for a fusion adeno-associated virus capsid protein according to any one of claims 1 to 5.

7. A construct comprising the nucleic acid of claim 6.

8. A fusion adeno-associated virus, characterized in that the capsid structure of the fusion adeno-associated virus comprises a fusion adeno-associated virus capsid protein according to any one of claims 1 to 5.

9. The fusion adeno-associated virus of claim 8, further comprising a heterologous nucleotide sequence encoding a product of interest, preferably said product of interest being a nucleic acid or a protein, more preferably said nucleic acid comprising a small guide RNA or an interfering RNA.

10. A host cell, characterized in that the host cell comprises a construct of claim 7, the genome of the host cell incorporates an exogenous nucleic acid of claim 6, the host cell comprises a fusion adeno-associated virus capsid protein of any one of claims 1 to 5, or the host cell is transformed with a fusion adeno-associated virus of claim 8 or 9.

11. A fusion adeno-associated virus vector system, comprising a packaging plasmid containing the nucleic acid of claim 6.

12. The fusion adeno-associated virus vector system of claim 11, wherein the packaging plasmid further comprises an adeno-associated virus rep gene fragment.

13. The fusion adeno-associated virus vector system of claim 12, characterized in that the adeno-associated virus vector system further comprises an expression plasmid comprising a heterologous nucleotide encoding a product of interest, preferably the product of interest is a nucleic acid or a protein, more preferably the nucleic acid comprises a small guide RNA or an interfering RNA.

14. The fused adeno-associated virus vector system according to any one of claims 11 to 13, characterized in that the adeno-associated virus vector system further comprises a helper virus plasmid or a helper virus, and the adeno-associated virus vector system further comprises a host cell.

15. A fusion adeno-associated virus obtained by viral packaging of the fusion adeno-associated virus vector system according to any one of claims 11 to 14.

16. A pharmaceutical composition or conjugate, characterized in that the pharmaceutical composition comprises a fusion adeno-associated virus according to any one of claims 8, 9 and 15 and a pharma- ceutical acceptable auxiliary substance, and the conjugate comprises a fusion adeno-associated virus according to any one of claims 8, 9 and 15 and a physiologically active polypeptide linked thereto.

17. Use of a fusion adeno-associated virus capsid protein according to any one of claims 1 to 5, a nucleic acid according to claim 6, a construct according to claim 7, a fusion adeno-associated virus according to any one of claims 8, 9 and 15, a host cell according to claim 10, a fusion adeno-associated virus vector system according to any one of claims 11 to 14, or a pharmaceutical composition or conjugate according to claim 16 in the preparation of a medicament for the prevention and / or treatment of a disease.

18. 18. Use according to claim 17, characterized in that the disease is selected from one or more of the following: hearing impairment diseases, ophthalmological diseases, inflammation, tumors, metabolic diseases, pain and neurodegenerative inflammatory diseases.

19. The ocular disease is selected from the group consisting of dry age-related macular degeneration (AMD), wet AMD, and RPE layer-related diseases such as choroidal neovascularization (CNV), e.g., age-related macular degeneration (AMD), choroidal neovascularization (CNV), choroidal neovascular membrane (CNVM), cystoid macular edema (CME), epiretinal membrane (ERM), and macular hole; myopia-related choroidal neovascularization, vascular stripes, retinal detachment, diabetic retinopathy, diabetic macular edema (DME), atrophic lesions of the retinal pigment epithelium (RPE), hypertrophic lesions of the retinal pigment epithelium (RPE), retinal vein occlusion, choroidal retinal plexus, and the like.

19. The use according to claim 18, characterized in that the RPE layer-related disease can be selected from the group consisting of retinal vein occlusion, macular edema, corneal neovascularization due to hypoxia, pterygium conjunctiva, subretinal edema, intraretinal edema, retinal vein occlusion, retinitis pigmentosa, Stargardt disease, glaucoma, inflammatory diseases, cataracts, intractable abnormalities, keratoconus, retinopathy of prematurity, preocular neovascularization, corneal neovascularization after keratitis, corneal transplantation, and macular edema due to keratoplasty, for example, Leber's congenital amaurosis (LCA), retinitis pigmentosa, and Stargardt disease due to RPE cell-related gene mutations, etc.

20. 18. The use according to claim 17, characterized in that the medicament is used in the gene therapy of a disease.

21. 1) Hearing impairment refers to cochlear supporting cell-related hearing impairment in young adults; 2) hearing loss refers to cochlear inner hair cell-related hearing loss in adults; 3) using medications to induce regeneration of inner hair cells; 4) the eye disease is a disease associated with the RPE layer; 5) Hearing loss is caused by damage to the cochlea; 6) Hearing loss is a disease related to cell damage; 7) Hearing impairment is a related disorder caused by a gene deletion; 8) the hearing loss disorder is an associated disorder caused by an environmental factor, the environmental factor being selected from noise or a toxic drug; or 9) Hearing loss is an age-related disorder.

18. The use according to claim 17, characterized in that it comprises at least one of the following:

Images