Targeting Ligands for Tau Pathology

Abstract

Methods and compositions for detecting tau pathology are described. The composition for detecting tau pathology comprises a targeting ligand that specifically binds to a cell surface marker of tau pathology, and the targeting ligand is linked to a liposome that comprises an imaging agent. The composition can be used in a method for imaging tau pathology in a subject, comprising administering an effective amount of the composition to the subject and imaging at least a portion of the subject to determine whether the portion of the subject shows tau pathology. The composition can also be used to detect tau pathology in a biological sample obtained from the subject.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Patent Application No. 17 / 739,031, filed May 6, 2022, which is incorporated by reference in its entirety.

[0002] Sequence Listing The Sequence Listing has been submitted electronically in XML format and is incorporated herein by reference in its entirety. The XML copy created on May 3, 2023 is named Alzeca-ADx-002-PCTW-SequenceListing_ST26.xml and is 36,730 bytes in size. [Background technology]

[0003] The microtubule-associated protein tau, encoded by the MAPT gene, is abundant in the brain and is present in neurons, glia, and other cell types. Expressed in six isoforms, tau has a vast number of post-translational modifications, including glycosylation, glycation, nitration, ubiquitination, and over 80 potential phosphorylation sites that expand the complexity of its role in health and disease. A defining feature of many neurodegenerative diseases, including Alzheimer's disease (AD), frontotemporal lobar degeneration (FTLD), and Parkinson's disease (PD) (collectively referred to as "tauopathies"), is the presence of intracellular aggregated fibrillar tau.

[0004] The transition from physiological soluble to insoluble tau is mainly associated with a change in its phosphorylation state, resulting in oligomeric tau and tau fibrils known as paired helical fragments (PHFs) that form characteristic neurofibrillary tangles (NFTs). Tau aggregates can also "infect" healthy cells, inducing further misfolding, aggregation and neurotoxicity. Studies of cell-to-cell transmission have demonstrated the passage of an extracellular phase that progresses throughout the brain.

[0005] The National Institute of Aging-Alzheimer's Association (NIA-AA) Research Framework identifies extracellular deposits of amyloid beta (A), the presence of intraneuronal hyperphosphorylated tau (T), and markers of neurodegeneration or neuronal damage (N) as hallmarks of AD. Each biomarker is scored as either positive or negative. To be on the AD continuum, A+ (amyloid positive) is required, and a positive diagnosis of AD requires A+ and T+. Biomarker detection is determined by (i) positron emission tomography (PET) imaging of amyloid and tau; (ii) Aβ 42 Decreased and / or high Aβ 40 / Aβ 42as well as cerebrospinal fluid (CSF) detection of high phosphorylated tau and total tau; or (iii) neuronal damage or degeneration as demonstrated by structural brain magnetic resonance imaging (MRI). Tracking of brain pathology in longitudinal studies suggests that tau pathology may precede Aβ accumulation but is undetectable based on current biomarker detection threshold levels and devastatingly amplified by independent Aβ deposition. Thus, diagnosis based on the ATN research framework for AD is limited by tau pathology detection. Other factors to consider in the development of tau detection methods include the invasiveness of CSF sampling, which requires lumbar puncture, and in the case of PET imaging, exposure to ionizing radiation, high cost, well-documented side effects, irregular availability in primary care settings, as well as the uneven geographic availability of PET scanners and isotopes. The short half-life of PET agents also poses challenges to the detection of intracellular tau at the early stages of tau pathology formation. Although blood-based markers are very promising, they only provide indirect measures that cannot provide information on the localization of tau pathology in the brain. Therefore, methods for detecting early tau pathology that avoid these pitfalls are highly desirable. Summary of the Invention

[0006] The onset of tau pathology is characterized by abnormal phosphorylation of tau. The hyperphosphorylated state in neurons can result in unique surface markers, which are consistent with a change in the balance of kinase-phosphatase activity resulting in high levels of hyperphosphorylated tau species. The utility of such surface markers lies in the fact that imaging agents can bind to them without the need to penetrate the cell membrane, a limitation that currently prevents tau-PET agents.

[0007] Reverse-phase protein array (RPPA) analysis of a cell-based model of tau hyperphosphorylation identified several proteins that are up- or downregulated by the onset of the hyperphosphorylated state. An iterative Cell-SELEX process was used to identify DNA thioaptamers that specifically bind to such cells. High T1 relaxivity PEGylated liposomes bearing macrocyclic Gd-chelates were modified to carry the thioaptamer on their surface, thus enabling targeting of the particles to the surface of hyperphosphorylated cells for contrast-enhanced MRI.

[0008] Thus, in one embodiment, a new generation of molecular imaging probes is provided for the in vivo detection of cells undergoing aberrant phosphorylation, which represents an early stage of p-tau formation, allowing for very early diagnosis of AD. In one embodiment, a novel nanoparticle formulation that binds to such aberrantly phosphorylated cells and allows for in vivo visualization of the hyperphosphorylated state by MRI. The results demonstrate the potential of this novel platform to diagnose the development of future tau pathology, with implications for very early diagnosis of Alzheimer's disease.

[0009] At the molecular level, we identified binding targets for the thioaptamer, such as vimentin, a normal intracellular protein specifically expressed on the surface of cells under hyperphosphorylated conditions, representing a potential biomarker of pathological hyperphosphorylation seen in AD. Cell surface vimentin was found to be present at high levels on hyperphosphorylated SH-SY5Y and ReN-VM cells that exhibit high p-tau levels. Such cells were also found to be specifically bound by the thioaptamer. In 2-month-old P301S transgenic mice, elevated vimentin levels were found in hippocampal cells that also had elevated p-tau levels, whereas non-transgenic siblings showed neither elevated p-tau nor vimentin. To demonstrate vimentin as a specific target for the DNA thioaptamer, withaferin A, a small molecule vimentin ligand, was conjugated to Gd-containing liposomes. When injected intravenously into 2-month-old P301S mice, thioaptamers targeted Gd-containing liposomes and withaferin targeted Gd-containing liposomes specifically produced MRI signal enhancement in the brains of transgenic mice but not in the brains of non-transgenic siblings. Non-targeted Gd-containing liposomes did not show signal enhancement in either group of mice. Virtually 100% of transgenic mice develop overt tau pathology by 8 months of age or later. Thus, targeted Gd-containing liposomes serve as M-MRI agents that can identify the development of future tau pathology in a pre-pathological state.

[0010] In one embodiment, a composition for identifying tau pathology is provided, the composition comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, the targeting ligand being linked to a liposome that comprises an imaging agent, e.g., an MRI contrast enhancing agent. In some embodiments, the targeting ligand comprises an aptamer or a stabilized aptamer. In some embodiments, the targeting ligand comprises a thioaptamer. In some embodiments, the targeting ligand comprises Tau_1 (SEQ ID NO:5) (hereinafter sometimes referred to as "DONGYBM"), Tau_3 (SEQ ID NO:6) (hereinafter sometimes referred to as "MUSQD"), Tau_9 (SEQ ID NO:7), Tau_11 (SEQ ID NO:8), Tau_10 (SEQ ID NO:9), Tau_13 (SEQ ID NO:10), Tau_8 (SEQ ID NO:11), Tau_4 (SEQ ID NO:12), Tau_17 (SEQ ID NO:13), Tau_5 (SEQ ID NO:14), Tau_21 (SEQ ID NO:15), Tau_22 (SEQ ID NO:16), Tau_23 (SEQ ID NO:17), Tau_24 (SEQ ID NO:18), Tau_25 (SEQ ID NO:26), Tau_26 (SEQ ID NO:27), Tau_28 (SEQ ID NO:29), Tau_30 (SEQ ID NO:30), Tau_31 (SEQ ID NO:31), Tau_32 (SEQ ID NO:32), Tau_33 (SEQ ID NO:33), Tau_34 (SEQ ID NO:34), Tau_35 (SEQ ID NO:35), Tau_36 (SEQ ID NO:36), Tau_37 (SEQ ID NO:37), Tau_38 (SEQ ID NO:38), Tau_39 (SEQ ID NO:39), Tau 5), Tau_25 (SEQ ID NO:16), Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQ ID NO:26), and Tau_102 (SEQ ID NO:27).

[0011] In some embodiments, the cell surface marker of tau pathology comprises a cell surface marker of tau hyperphosphorylation. In some embodiments, the cell surface marker of tau pathology comprises a protein selected from keratin 6A (KRT6A), keratin 6B (KRT6B), heat shock protein (HSP), and vimentin (VIM). In some embodiments, the targeting ligand is determined to specifically bind to the cell surface marker of tau pathology using systematic evolution of ligands by exponential enrichment (SELEX) method. In some embodiments, the targeting ligand is linked to polyethylene glycol that is conjugated to phospholipids associated with liposomes. In some embodiments, the liposome comprises a membrane comprising a first phospholipid, a sterically bulky excipient capable of stabilizing the liposome, a second phospholipid derivatized with a first polymer, a third phospholipid derivatized with a second polymer, the second polymer being conjugated to a targeting ligand, and an imaging agent that is encapsulated by or associated with the membrane.

[0012] In another embodiment, a method of imaging tau pathology in a subject is provided, comprising administering to the subject a detectably effective amount of a targeting ligand-liposome conjugate comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, the targeting ligand being conjugated to a liposome comprising an imaging agent, and imaging at least a portion of the subject to determine whether the portion of the subject exhibits tau pathology. In some embodiments, the portion of the subject comprises a portion of the brain of the subject. In some embodiments, the imaging shows a level of tau pathology sufficient to diagnose the subject as having early stage AD. In some embodiments, the method further comprises providing a prophylactic or therapeutic treatment for AD to the subject. In some embodiments, the imaging agent is an MRI contrast enhancing agent, and the level of binding is determined using MRI.

[0013] In another aspect, a method for detecting tau pathology is provided, comprising contacting a biological sample with an effective amount of a targeting ligand-liposome conjugate comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, where the targeting ligand is conjugated to a liposome comprising a detectable label, washing the biological sample to remove unbound targeting ligand-liposome conjugate, and detecting tau pathology in the biological sample by determining the amount of detectable label remaining in the biological sample. In some aspects, the biological sample is a sample containing neuronal cells.

[0014] In another aspect, a targeting composition is provided that includes a phospholipid linked to a polymer that is linked to a targeting ligand that specifically binds to a cell surface marker of tau pathology. In some aspects, the targeting ligand is an aptamer or stabilized aptamer. In some aspects, the targeting ligand is a thioaptamer. In some aspects, the aptamer or stabilized aptamer is selected from the group consisting of tau_1 (SEQ ID NO:5; DONGYBM), tau_3 (SEQ ID NO:6; MUSQD), tau_9 (SEQ ID NO:7), tau_11 (SEQ ID NO:8), tau_10 (SEQ ID NO:9), tau_13 (SEQ ID NO:10), tau_8 (SEQ ID NO:11), tau_4 (SEQ ID NO:12), tau_17 (SEQ ID NO:13), tau_5 (SEQ ID NO:14), tau_21 (SEQ ID NO:15), tau_25 (SEQ ID NO:16), tau_30 (SEQ ID NO:30), tau_40 (SEQ ID NO:31), tau_41 (SEQ ID NO:32), tau_42 (SEQ ID NO:33), tau_43 (SEQ ID NO:4), tau_44 (SEQ ID NO:45), tau_45 (SEQ ID NO:46), tau_46 (SEQ ID NO:47), tau_48 (SEQ ID NO:49), tau_50 (SEQ ID NO:50), tau_51 (SEQ ID NO:51), tau_52 (SEQ ID NO:52), tau_53 (SEQ ID NO:53), tau_54 (SEQ ID NO:54), tau_55 (SEQ ID NO:55), SEQ ID NO:16), Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQ ID NO:26), and Tau_102 (SEQ ID NO:27).

[0015] In some embodiments, the aptamer or stabilized aptamer is selected from the group consisting of tau_1 (SEQ ID NO:5; DONGYBM), tau_3 (SEQ ID NO:6; MUSQD), tau_9 (SEQ ID NO:7), tau_11 (SEQ ID NO:8), tau_10 (SEQ ID NO:9), tau_13 (SEQ ID NO:10), tau_8 (SEQ ID NO:11), tau_4 (SEQ ID NO:12), tau_17 (SEQ ID NO:13), tau_5 (SEQ ID NO:14), tau_21 (SEQ ID NO:15), tau_25 (SEQ ID NO:16), tau_ In one embodiment, an aptamer or stabilized aptamer is provided comprising a DNA nucleotide sequence selected from one or more of Tau_1, Tau_2, Tau_3, Tau_4, Tau_5, Tau_6, Tau_7, Tau_31, Tau_42, Tau_14, Tau_19, Tau_15, Tau_56, Tau_34, Tau_23, Tau_99, Tau_16, Tau_17, Tau_20, Tau_32, Tau_33, Tau_44, Tau_46, Tau_59, Tau_60, Tau_61, Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQ ID NO:26), and Tau_102 (SEQ ID NO:27). [Brief description of the drawings]

[0016] [Figure 1A] Figure 1A shows (A) SH-SY5Y cells when treated for 10 days with 30 μM retinoic acid (RA) to differentiate into a neuron-like phenotype with axonal and dendritic structures (B). These cells develop long cell bodies and begin to form neurite-like processes.

[0017] [Figure 1B] Figure 1B shows SH SY5Y cells after treatment with okadaic acid (OA), demonstrating that the cells avidly phosphorylate tau. The top row shows that differentiated cells exhibit pTau Thr205 / Ser202 (early stage of phosphorylation) primarily in the perinuclear region. The bottom row shows that after exposure to 30 nM OA for 24 hours, the cells exhibit significant levels of pTau Ser396 (late stage of phosphorylation) throughout the cytoplasm.

[0018] [Figure 1C]Figure 1C shows the presence of p-tau396 in SHSY5Y cells under hyperphosphorylation conditions. Cells were differentiated with 30 μM RA for 10 days and exposed to 30 nM OA for 24 hours. Under these hyperphosphorylation conditions, tau is overexpressed and hyperphosphorylated.

[0019] [Figure 2A] FIG. 2A shows a diagrammatic representation of the cell-SELEX process.

[0020] [Figure 2B] Figure 2B shows the abundances of the top 23 sequences from SELEX cycles 1-26 showing their evolution. The fractions are low until about cycle 10, where they increase sharply. The abundances of tau_1 (SEQ ID NO:5; DONGYBM) and tau_3 (SEQ ID NO:6; MUSQD) increase continuously as the cycle number increases.

[0021] [Figure 2C] FIG. 2C shows hyperphosphorylated (OA) SH-SY5Y cells stained with 50 nM Cy5-labeled tau_1 (SEQ ID NO: 5; DONGYBM) or tau_3 (SEQ ID NO: 6; MUSQD) aptamers for 2 hours at 4° C.

[0022] [Figure 2D] FIG. 2D shows tau_1 (SEQ ID NO: 5; DONGYBM) and tau_3 (SEQ ID NO: 6; MUSQD) secondary structures using Mfold.

[0023] [Figure 2E] FIG. 2E shows a cladogram illustrating the relationships between the top 23 tau aptamer sequences and aptamer families.

[0024] [Diagram 3] FIG. 3 shows saturation binding curves generated using Cy5-labeled tau_1 (SEQ ID NO: 5; DONGYBM) and tau_3 (SEQ ID NO: 6; MUSQD) after serial dilution of aptamer solutions in target hyperphosphorylated SH-SY5Y and non-target differentiated SH-SY5Y and ReN-VM cells.

[0025] [Figure 4A] 4A shows an exemplary liposome-Gd nanoparticle contrast agent. As shown, the liposome bilayer incorporates DSPE-DOTA-Gd for MR contrast, lissamine rhodamine for fluorescence imaging, DSPEmPEG2000 for enhanced circulatory half-life, DSPEPEG3400 for non-targeted (control / stealth) liposomes, and DSPE-PEG3400-aptamer (Tau_1 (SEQ ID NO:5; DONGYBM) or Tau_3 (SEQ ID NO:6; MUSQD)) for targeted ADx-002 (or "TauX") nanoparticles.

[0026] [Figure 4B] FIG. 4B shows the synthesis of lipidated withaferin A (WNP).

[0027] [Figure 5A] Figure 5A shows T1-weighted spin echo (T1w-SE) and fast spin echo inversion recovery (FSE-IR) pre- and post-contrast images demonstrating signal enhancement in delayed post-contrast scans of transgenic (Tg) P301S mice treated with ADx-002 compared to age-matched wild-type (WT) controls. Tg animals showed high enhancement in the cortical and hippocampal regions (as indicated by arrows). Tg animals show no signal enhancement 4 days after injection of untargeted contrast agent (UC).

[0028] [Figure 5B] Figure 5B shows box plots demonstrating signal enhancement in Tg animals compared to WT counterparts and UC-treated Tg animals for both T1w-SE and FSE-IR sequences (*p<0.05; **p<0.005). The dotted line indicates the signal threshold for determining sensitivity (2 standard deviations above the baseline noise, approximately 6%).

[0029] [Figure 5C]Figure 5C shows the receiver operating characteristic (ROC) curve plotting the true positive rate (TPF) against the false positive rate (FPF), demonstrating the accuracy of ADx-002 in identifying young Tg animals. The fitted curve connects the observed operating points. The area under the curve (AUC) was calculated using the fitted curve to enumerate the sensitivity (true positive rate) and specificity (true negative rate) of both formulations.

[0030] [Figure 5D] FIG. 5D shows the results of immunofluorescence studies on brain sections taken after MRI scanning of P301S mice treated with ADx-002 nanoparticles.

[0031] [Figure 6A] Figure 6A shows the presence of thioaptamer binding to its target on SHSY5Y cells, undifferentiated and hyperphosphorylated OA (24 h, 30 nM) and QA (24 h, 100 nM) co-stained with VIM (D21H3) and p-tau (AT100) antibodies.

[0032] [Figure 6B] Figure 6B shows the presence of aptamer binding to targets on undifferentiated and hyperphosphorylated OA (24 hr, 30 nM) and QA (24 hr, 100 nM) SHSY5Y cells; stained with cell surface (CS) VIM (clone 84-1) antibody and aptamer tau_1 sequence number 5; DONGYBM (50 nM), and nuclei counterstained with DAPI.

[0033] [Figure 6C] FIG. 6C shows expression of VIM in P301STG and WT frozen mouse tissue sections stained with VIM (SP20) and pTau (AT100) antibodies and in DAPI-stained nuclei.

[0034] [Figure 7]Figure 7 shows the results of an in vitro binding study of withaferin nanoparticles. Differentiated hyperphosphorylated SH SY5Y cells were incubated with rhodamine-labeled withaferin nanoparticles (WNPs) for 30 min at 37°C. Binding is specific to cells under hyperphosphorylated conditions.

[0035] [Figure 8A] Figure 8A shows pre- and post-contrast MRI images for T1-weighted spin echo (T1w-SE) and fast spin echo inversion recovery (FSE-IR) demonstrating signal enhancement in delayed post-contrast scans of WNP-treated Tg P301S and APP / PSEN1 mice compared to age-matched WT controls.

[0036] [Figure 8B] Figure 8B shows box plots demonstrating signal enhancement in Tg P301S and APP / PSEN1 mice treated with WNP compared to their WT counterparts and UC-treated Tg animals for both T1w-SE and FSE-IR sequences. The dotted line indicates the signal threshold for determining sensitivity (2 standard deviations above the baseline noise, approximately 6%).

[0037] [Figure 8C] Figure 8C shows the ROC curve plotting true positive TPF against FPF, demonstrating the WNP accuracy in identifying young Tg animals. The fitted curve connects the observed operating points. The AUC was calculated using the fitted curve, and the sensitivity (true positive rate) and specificity (true negative rate) are listed.

[0038] [Figure 9] Figure 9 shows the phosphorylation status of tau in WNP-treated P301S mice. Two-month-old P301S mice treated with WNP were sacrificed immediately after MR image acquisition, and intact brains were collected for immunofluorescence. Frozen brain tissue sections were stained with AT8 antibody. Positive signals in Tg mouse sections but not in WT confirm the presence of phosphorylated tau in Tg mice.

[0039] [Figure 10] Figure 10 shows cell surface VIN expression in 2-month-old P301S mice. Mice were perfused with heparin / PBS and formalin, and brains were isolated and processed for immunolabeling of frozen sections with a cell surface VIM antibody (clone 84-1, Abnova), which specifically stains VIM translocated to the cell surface. Tg mice showed higher expression compared to WT mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0040] The present disclosure provides a method and composition for detecting tau pathology. The composition for detecting tau pathology comprises a targeting ligand that specifically binds to a cell surface marker of tau pathology, and the targeting ligand is linked to a liposome that comprises an imaging agent. The composition can be used in a method for imaging tau pathology in a subject, comprising administering an effective amount of the composition to the subject and imaging at least a portion of the subject to determine whether the portion of the subject exhibits tau pathology. The composition can also be used to detect tau pathology in a biological sample obtained from the subject.

[0041] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control.

[0042] Unless otherwise specified, "a," "an," "the," "one or more of," and "at least one" are used interchangeably. The singular forms "a," "an," and "the" include their plural forms.

[0043] The recitation of numerical ranges by endpoints includes all numbers subsumed within that range (eg, 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0044] The term "about" when referring to a value or amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass a ±10% variation from the specified amount.

[0045] The terms "comprising" and "including" are intended to be equivalent and open-ended.

[0046] The phrase "consisting essentially of" means that a composition or method may include additional components and / or steps, but only if the additional components and / or steps do not materially alter the basic and novel characteristics of the claimed composition or method.

[0047] The phrase "selected from the group consisting of" is meant to include mixtures of the listed groups and combinations thereof.

[0048] An "effective" or "detectably effective amount" of a composition means an amount sufficient to detect the presence of a cell surface marker associated with tau pathology or to obtain an acceptable image using equipment available for clinical use. A detectably effective amount of a detection or imaging agent may be administered in two or more injections. A detectably effective amount of a detection or imaging agent may vary depending on factors such as the degree of sensitivity of the individual, the age, sex and weight of the individual, the individual's idiosyncratic response, and dosimetry. A detectably effective amount of a detection or imaging agent may also vary depending on equipment and film-related factors. Optimization of such factors is well within the level of one of ordinary skill in the art. The amount of imaging agent used for diagnostic purposes and the duration of the imaging study will depend on the particular imaging agent used, the patient's weight, the nature and severity of the condition being treated, the nature of the therapeutic treatment the patient has undergone, and the patient's idiosyncratic response. Ultimately, the attending physician will determine the amount of imaging agent administered to an individual patient and the duration of the imaging study.

[0049] The term "diagnosis" can include determining the nature of a disease in a subject, as well as determining the severity and likely outcome of a disease or episode of disease, the chances of recovery (prognosis), or both. "Diagnosis" can also include diagnosis in the context of rational treatment, where diagnosis guides treatment, including initial selection of treatment, modification of treatment (e.g., adjustment of dosage and / or dosing regimen), and the like.

[0050] The term antigen refers to a molecule or a part of a molecule that can be bound by a targeting ligand. An antigen can also typically induce an animal to produce an antibody that can bind to the epitope of that antigen. An antigen can have one or more epitopes. The specific reaction above means that the antigen reacts in a highly selective manner with its corresponding antibody, rather than with a large number of other antibodies that can be induced by other antigens.

[0051] The term epitope refers to that portion of any molecule that can be recognized and bound by a targeting ligand such as an aptamer. In general, an epitope contains chemically active surface groups of molecules, such as amino acids or sugar side chains, and has a specific three-dimensional structure and specific charge characteristics.

[0052] The phrase "specifically binds" refers to a targeting ligand that binds to a target structure and binds to the target structure or a subunit thereof, but does not bind to biological molecules that are not the target structure, or at least preferentially binds to the target structure. A targeting ligand that specifically binds to a target structure or a subunit thereof (e.g., a thioaptamer) may not cross-react with biological molecules outside the target structure family.

[0053] The term "polynucleotide" refers to nucleic acid sequences, including DNA, RNA, and microRNA, and can refer to markers that are either double-stranded or single-stranded. Polynucleotides can also refer to synthetic variants with alternative sugars, such as locked nucleic acids.

[0054] Compositions for identifying tau pathology In one aspect, a composition for identifying tau pathology is provided, comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, wherein the targeting ligand is linked to a liposome that comprises an imaging agent.

[0055] In some embodiments, the cell surface marker of tau pathology is a cell surface marker of tau hyperphosphorylation. Tau pathology refers to abnormal tau protein resulting in taupathology. Tau pathology results from hyperphosphorylation of tau protein. While normal tau contains 2-3 moles of phosphate / mol protein, hyperphosphorylated tau protein contains substantially higher levels of phosphate. Hyperphosphorylated tau leads to the formation of neurofibrillary tangles. Tau protein is present intracellularly and difficult to detect directly. However, certain cell surface markers (i.e., epitopes) are associated with the underlying tau pathology. In some embodiments, these cell surface markers are epitopes identified using the Cell-SELEX method, in which neurons or cell models of neurons exhibiting tau pathology are used as targets for targeting ligands (e.g., thioaptamers). In some embodiments, the cell surface marker of tau pathology comprises a protein selected from KRT6A, KRT6B, HSP, and VIM.

[0056] Targeting Ligands As used herein, the term "targeting ligand" includes any molecule that can be linked to a liposome to engage a specific target, specifically to recognize tau pathology. Examples of suitable targeting ligands include, but are not limited to, antibodies, antibody fragments, thioaptamers, aptamers, and stabilized aptamers. In some embodiments, the targeting ligand can be a thioaptamer that specifically binds to a cell surface marker of tau pathology.

[0057] The targeting ligand specifically binds to cells exhibiting tau pathology. Specific binding refers to binding that distinguishes between the selected target and other potential targets and binds to the selected target with substantial affinity. Substantial affinity is at least about 10 -8 mol / m 3 In another embodiment, the targeting ligand has a binding dissociation constant of at least about 10. -9 mol / m 3 , about 10 -10 mol / m 3 , about 10 -11 mol / m 3 , or at least about 10 -12 mol / m 3 The binding dissociation constant can be

[0058] In some embodiments, the targeting ligand is an aptamer. An aptamer is a nucleic acid that binds with high specificity and affinity to a particular target molecule or cellular structure through interactions other than Watson-Crick base pairing. Suitable aptamers can be single-stranded RNA, DNA, modified nucleic acids, or mixtures thereof. Aptamers can be in linear or circular form. In some embodiments, the aptamer is single-stranded DNA, while in other embodiments, the aptamer is single-stranded RNA.

[0059] The function of aptamers is independent of the nucleotide sequence itself, but rather is based on the secondary / tertiary structure formed by the polynucleotide, and therefore aptamers are best thought of as non-coding sequences. The binding of a nucleic acid ligand to a target molecule is determined by the three-dimensional structure of the aptamer, not by nucleic acid base pairing. In solution, the chain of nucleotides forms intramolecular interactions that fold the molecule into a complex three-dimensional shape. The shape of the nucleic acid ligand allows it to bind strongly to the surface of its target molecule. In addition to exhibiting remarkable specificity, nucleic acid ligands generally bind their targets with very high affinity, e.g., the majority of anti-protein nucleic acid ligands have equilibrium dissociation constants in the femtomolar to low nanomolar range.

[0060] The length of an aptamer suitable for use as a targeting ligand is not particularly limited, and includes aptamers containing about 10 to about 200 nucleotides, about 100 nucleotides or less, about 50 nucleotides or less, about 40 nucleotides or less, or about 35 nucleotides or less. In some embodiments, the aptamer has a size of about 15 to about 40 nucleotides. Furthermore, in almost all known cases, various structural motifs involved in non-Watson-Crick type interactions involved in aptamer binding, such as hairpin loops, symmetric and asymmetric bulges, and pseudoknots, can be formed with nucleic acid sequences of 30 nucleotides or less.

[0061] In some embodiments, the aptamers are stabilized aptamers that contain chemical modifications to enhance their stability. Modifications include, but are not limited to, those that provide additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interactions and other chemical groups that incorporate fluxionality to the nucleic acid ligand bases or the entire nucleic acid ligand. Such modifications include, but are not limited to, sugar modifications at the 2-position, pyrimidine modifications at the 5-position, purine modifications at the 8-position, modifications with exocyclic amines, substitutions of 4-thiouridine, substitutions of 5-bromo or 5-iodo-uracil, backbone modifications, phosphorothioate or alkylphosphate modifications, methylation, unusual base pairing combinations such as isobases isocytidine and isoguanidine, and the like. Modifications can also include 3' and 5' modifications such as capping. In certain embodiments, the nucleic acid ligand comprises an RNA molecule that is 2'-fluoro (2'-F) modified on the sugar moiety of the pyrimidine residue.

[0062] Suitable stabilized aptamers may further include nucleotide analogs such as xanthine or hypoxanthine, 5-bromouracil, 2-aminopurine, deoxyinosine, or methylated cytosine, such as 5-methylcytosine, N4-methoxydeoxycytosine, etc. Also included are bases of polynucleotide mimetics such as methylated nucleic acids, e.g., 2'-O-methRNA, peptide nucleic acids, locked nucleic acids, modified peptide nucleic acids, and any other structural moiety that acts substantially like a nucleotide or base, e.g., by exhibiting base complementarity with one or more bases present in DNA or RNA.

[0063] In some embodiments, the stabilized aptamer comprises a thioaptamer. A thioaptamer is an aptamer in which one or both of the non-bridging oxygen atoms are replaced with sulfur. The oxygen-sulfur replacement not only increases the stability of the aptamer, but also increases its binding affinity in some cases.

[0064] Typically, a targeting ligand (e.g., an aptamer) is linked to a liposome that contains an imaging agent. However, the aptamer itself is novel and useful. Examples of suitable aptamers include tau_1 (SEQ ID NO:5), tau_3 (SEQ ID NO:6), tau_9 (SEQ ID NO:7), tau_11 (SEQ ID NO:8), tau_10 (SEQ ID NO:9), tau_13 (SEQ ID NO:10), tau_8 (SEQ ID NO:11), tau_4 (SEQ ID NO:12), tau_17 (SEQ ID NO:13), tau_5 (SEQ ID NO:14), tau_21 (SEQ ID NO:15), tau_25 (SEQ ID NO:16), tau_7 (SEQ ID NO:17), tau_31 (SEQ ID NO:18), tau_4 (SEQ ID NO:19), tau_5 (SEQ ID NO:19), tau_6 (SEQ ID NO:20), tau_7 (SEQ ID NO:21), tau_8 (SEQ ID NO:22), tau_9 (SEQ ID NO:23), tau_10 (SEQ ID NO:24), tau_11 (SEQ ID NO:25), tau_12 (SEQ ID NO:26), tau_13 (SEQ ID NO:27), tau_14 (SEQ ID NO:28), tau_15 (SEQ ID NO:29), tau_16 (SEQ ID NO:30), tau_17 (SEQ ID NO:31), tau_18 (SEQ ID NO:32), tau_19 (SEQ ID NO:33), tau_21 (SEQ ID NO:34), tau_22 (SEQ ID NO:3 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQ ID NO:26), and Tau_102 (SEQ ID NO:27), and in some cases, those comprising a DNA nucleotide sequence selected from the group consisting of these.

[0065] In some embodiments, the aptamer is placed between two primer nucleotide sequences that facilitate the amplification of the aptamer sequence, for example, by polymerase chain reaction (PCR). For example, in some embodiments, the DNA nucleotide sequence of the aptamer is placed between the sequences GATATGTCTAGAGCCTCAGATCA (SEQ ID NO: 1) and CGGAGTTATGTTAGCAGTAGC (SEQ ID NO: 2). In other embodiments, the DNA nucleotide sequence of the aptamer is placed between the sequences CGC TCG ATA GAT CGA GCT TCG (SEQ ID NO: 3) and GTC GAT CAC GCT CTA GAG CAC (SEQ ID NO: 4).

[0066] Verification of cell surface changes under hyperphosphorylation conditions SH-SY5Y, a human neuroblastoma cell line that can be differentiated into neuron-like cells by a change in culture medium, was used to model cell surface changes under hyperphosphorylation conditions. As shown in Figure 1A-1C, RA was used to induce cell differentiation characterized by time-dependent changes in morphology, including the formation and extension of neurites, as well as a large increase in the levels of intracellular tau. An imbalance in kinase and phosphatase activity leading to hyperphosphorylation, simulating the early stages of tauopathy, was induced by the use of the cell-permeable neurotoxin OA (30 nM, 24 h) and confirmed by an increase in phosphorylated tau S396 (see Figure 1B and 1C). In parallel experiments, a milder agent, the exotoxin quinolinic acid (QA) 1 μM, was used to induce hyperphosphorylation.

[0067] RPPA analysis performed on lysates of both RA-treated and untreated SH-SY5Y cells, which resulted in hyperphosphorylation by either OA (30 nM, 24 h) or QA (1 μM, 24 h), demonstrated notable changes in hyperphosphorylated cells. 98 nonphosphorylated and 36 phosphorylated proteins were tested that showed significant changes in their expression under different conditions. Uniprot protein associations showed that 44 plasma membrane-associated proteins, 10 peripheral membrane, and 12 single-pass membrane proteins were significantly altered under hyperphosphorylated conditions. In summary, RPPA analysis demonstrated notable cell surface changes in hyperphosphorylated cells, including overexpression of cell surface receptors.

[0068] Screening for aptamers that bind to cells in a hyperphosphorylated state Aptamer screening was performed using a cell-SELEX approach on differentiated SH-SY5Y cells in a hyperphosphorylated state. Figures 2A-2E describe how cell-SELEX was used to identify biomarkers of AD onset. Using OA-treated differentiated SH-SY5Y cells as a surrogate for hyperphosphorylated neurons, we screened for DNA aptamers that specifically recognize differences between the surfaces of treated and untreated cells using a cell-SELEX methodology modified to capture membrane-bound aptamers. A total of 26 cell-SELEX cycles were performed. To remove thioaptamers bound to common cell surface molecules that are not specific for the hyperphosphorylated state, negative selection was introduced in cycles 12 and 13 using differentiated non-hyperphosphorylated cells (i.e., without OA treatment). Anticipating that the selected thioaptamers would be delivered systemically as nanoparticle imaging agents and that their primary toxicity would be driven by hepatocyte uptake, another round of negative selection was performed in cycles 20 and 21 using the hepatocyte cell line THLE-3 to remove oligonucleotides that showed enhanced uptake by hepatocytes.

[0069] Tau_1 and tau_3 aptamers specifically bind to hyperphosphorylated cells Sequencing of all selected pools using the Ion Torrent sequencing platform revealed the evolution of the family of DNA sequences, with enrichment especially evident after 10 rounds of SELEX. Negative selection eliminated certain sequences that were not specific for the hyperphosphorylated state or had a propensity for hepatocyte uptake. However, the relative abundance of key sequences steadily increased throughout the process. The 23 most abundant sequences in round 26 were identified and their abundance throughout the SELEX process calculated using AptaAligner is shown in Figure 2B. The sequence tau_1 (SEQ ID NO:5; DONGYBM) was the most common in cycle 26, accounting for 20.6% of the thioaptamers present. A single base difference from this sequence, tau_3 (SEQ ID NO:6; MUSQD), was the second most represented sequence (10.4%). Binding studies using Cy5-labeled tau_1 (SEQ ID NO:5; DONGYBM) or tau_3 (SEQ ID NO:6; MUSQD) incubated with 99 hyperphosphorylated SH-SY5Y cells showed increased levels of binding to hyperphosphorylated cells (Figure 2C). The secondary structures of aptamers tau_1 (SEQ ID NO:5; DONGYBM) and tau_3 (SEQ ID NO:6; MUSQD) calculated using mfold are shown in Figure 2D. The sequences present in the final round were grouped by hierarchical clustering and sequence homology using the multiple sequence alignment code MAFFT showing five different families and also presented as a cladogram (using Clustal Omega) showing the common ancestor between these five aptamer families (Figure 2E).

[0070] Apparent equilibrium dissociation constant (Kd app ) was measured by serial dilution of the aptamer solution with target hyperphosphorylated SH-SY5Y cells, non-target differentiated SH-SY5Y cells and undifferentiated SH-SY5Y cells. The affinity of these aptamers was also tested in another immortal neural progenitor stem cell line, ReN-VM, under hyperphosphorylated and non-hyperphosphorylated conditions. The Kd of tau_1 (SEQ ID NO: 5; DONGYBM) and tau_3 (SEQ ID NO: 6; MUSQD) with hyperphosphorylated SHSY5Y cells was appare 0.167 ± 0.015 nM and 0.194 ± 0.032 nM, and for ReN-VM cells, they are 318.15 ± 46.2 nM and 234.24 ± 38.6 nM, respectively (Figure 3).

[0071] Sequencing After identification, the aptamer can be sequenced. Sequencing can be by any method known in the art. DNA sequencing techniques include classical dideoxy sequencing reaction (Sanger method) using labeled terminator or primer and gel separation in slab or capillary, sequencing by synthesis using reversibly terminated labeled nucleotides, pyrosequencing, 454 sequencing, allele-specific hybridization to a labeled oligonucleotide probe library, sequencing by synthesis using allele-specific hybridization to a library of labeled clones followed by ligation, real-time monitoring of the incorporation of labeled nucleotides during polymerization process, polony sequencing, and SOLiD sequencing. Sequencing can be by any method known in the art. See, e.g., Sanger et al. (Proc Natl Acad Sci USA, 74(12):5463 67, 1977), Maxam et al. (Proc. Natl. Acad. Sci., 74:560-564, 1977), and Drmanac, et al. (Nature Biotech., 16:54-58, 1998), which references describe examples of conventional ensemble sequencing techniques. Also see Lapidus et al. (U.S. Patent No. 7,169,560), Quake et al. (U.S. Patent No. 6,818,395), Harris (U.S. Patent No. 7,282,337), Quake et al. (U.S. Patent Application No. 2002 / 0164629), and Braslaysky, et al., (PNAS (USA), 100:3960-3964, 2003) (which describe examples of single molecule sequencing by synthesis techniques). The contents of each of these references are incorporated herein by reference in their entirety.

[0072] Disclosed herein are several aptamers that specifically bind to tau pathology. Examples of these aptamers are listed in Table 1. Thus, in some embodiments, the aptamer or stabilized aptamer is selected from the group consisting of Tau_1 (SEQ ID NO:5; DONGYBM), Tau_3 (SEQ ID NO:6; MUSQD), Tau_9 (SEQ ID NO:7), Tau_11 (SEQ ID NO:8), Tau_10 (SEQ ID NO:9), Tau_13 (SEQ ID NO:10), Tau_8 (SEQ ID NO:11), Tau_4 (SEQ ID NO:12), Tau_17 (SEQ ID NO:13), Tau_5 (SEQ ID NO:14), Tau_21 (SEQ ID NO:15), Tau_25 (SEQ ID NO:16), Tau_30 (SEQ ID NO:30), Tau_31 (SEQ ID NO:31), Tau_32 (SEQ ID NO:32), Tau_33 (SEQ ID NO:33), Tau_34 (SEQ ID NO:34), Tau_35 (SEQ ID NO:35), Tau_36 (SEQ ID NO:36), Tau_37 (SEQ ID NO:37), Tau_38 (SEQ ID NO:38), Tau_39 (SEQ ID NO:39), Tau_40 (SEQ ID NO:40), Tau_41 (SEQ ID NO:41), Tau_42 (SEQ ID NO:42), Tau_43 (SEQ ID NO:43), Tau_44 (SEQ ID NO:44), Tau_45 (SEQ ID NO:45), Tau_46 (SEQ ID NO:46), Tau_47 (SEQ ID NO:47), Tau_48 (SEQ ID NO:48), Tau_49 (SEQ ID NO:49), Tau_50 In a further embodiment, the aptamer or stabilized aptamer comprises the DNA nucleotide sequence selected from the group consisting of Tau_1 (SEQ ID NO:5; DONGYBM), Tau_3 (SEQ ID NO:6; MUSQD), or both. [Table 1]

[0073] Targeted Ligand Conjugates In some embodiments, a targeting ligand (e.g., an aptamer) is linked to a liposome or other vehicle for targeted delivery of an imaging or detection agent. For example, an imaging or detection agent can be encapsulated in a liposome. Using such technology, a tau pathology-specific aptamer conjugated to a liposome vesicle can provide targeted delivery of an imaging or detection agent to cells expressing tau pathology. In some embodiments, a single targeting ligand is linked to a liposome. In other embodiments, a targeting ligand (e.g., tau_1 (SEQ ID NO: 5; DONGYBM) and tau_3 (SEQ ID NO: 6; MUSQD)) is linked to a liposome.

[0074] As used herein, the term "liposome" refers to a vesicular structure composed of lipids. The lipids typically have a tail group containing a long hydrocarbon chain and a hydrophilic head group. The lipids are configured to form a lipid bilayer (i.e., membrane) with an internal aqueous environment suitable for containing an agent to be delivered (e.g., an imaging agent). Such liposomes present an outer surface that may contain an appropriate targeting ligand that specifically binds to a cell surface marker of tau pathology. A suitable liposome platform may be, for example, the "ADx" platform from Alzeca Biosciences, which includes hydrogenated soy L-α-phosphatidylcholine (HSPC), cholesterol (Chol), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-(methoxy(polyethylene glycol)-2000) (DSPE-mPEG2000) and Gd(III)-DSPE-DOTA (a macrocyclic gadolinium imaging moiety conjugated to a phospholipid, Gd(III)-DOTA, 1,2-distearoyl-sn-glycero-3-phosphorylethanolamine, DSPE), as well as the entities used to conjugate the targeting ligand DSPE-PEG-3400 (1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)-3400]). See, for example, U.S. Patent No. 11,116,854, International Patent Publication No. WO2020154623A1, and International Patent Publication No. WO2021163585A1 (each of which is incorporated by reference in its entirety into this specification).

[0075] In some embodiments, the membrane of the liposome may comprise at least three kinds of phospholipids. The membrane may comprise a first phospholipid that may be unmodified. Suitable first phospholipids include those disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649, each of which is incorporated herein by reference in its entirety. In one embodiment, the first phospholipid is HSPC. The membrane may comprise a second phospholipid that may be derivatized with a first polymer. Suitable polymer-derivatized second phospholipids include those disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649. In one embodiment, the second phospholipid that is derivatized with a first polymer is DSPE-mPEG2000. The membrane may comprise a third phospholipid that is derivatized with a second polymer, which is ultimately conjugated to a targeting ligand. Suitable polymer-derivatized third phospholipids include those disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649. In one embodiment, the second polymer-derivatized third phospholipid is DSPE-PEG-3400.

[0076] In some embodiments, the membrane can comprise a sterically bulky excipient that can stabilize liposome.Suitable excipients include those disclosed in U.S. Patent No. 7,785,568 and U.S. Patent No. 10,537,649.In one embodiment, the sterically bulky excipient that can stabilize liposome is cholesterol.

[0077] In some embodiments, the phospholipid portion in the phospholipid-polymer targeting ligand conjugate has the following structural formula: [ka] It can be represented by: The variable m can be one of 12, 13, 14, 15, 16, 17, or 18. For example, m can be 14 or 16. In various embodiments, the phospholipid moiety in any of the first phospholipid, the second phospholipid, and the phospholipid-polymer targeting ligand conjugate can be one of HSPC, DPPC, DSPE, DSPC, or DPPE.

[0078] In some embodiments, the polymer moiety in the phospholipid-polymer targeting ligand conjugate is a polyol. Structural units forming polyol-containing polymers include monomeric polyols such as pentaerythritol, ethylene glycol, and glycerin. Examples of polyol-containing polymers include polyesters, polyethers, and polysaccharides. Examples of suitable polyethers include, but are not limited to, diols, such as diols having the general formula HO-(CH2CHO)pH with p≧1, such as polyethylene glycol, polypropylene glycol, and poly(tetramethylene ether) glycol. Suitable polysaccharides include, but are not limited to, cyclodextrin, starch, glycogen, cellulose, chitin, and β-glucan. Suitable polyesters include, but are not limited to, polycarbonate, polybutyrate, and polyethylene terephthalate, all of which are terminated with hydroxyl end groups. Exemplary polymers containing polyols include polymers with molecular weights of about 500,000 Da or less, including about 300 to about 100,000 Da.

[0079] In some embodiments, the polymer moiety in the phospholipid-polymer targeting ligand conjugate comprises a hydrophilic poly(alkylene oxide) polymer. The hydrophilic poly(alkylene oxide) may comprise about 10 to about 100 repeating units, and may have a molecular weight ranging from about 500 to 10,000 Da, for example. The hydrophilic poly(alkylene oxide) may comprise, for example, poly(ethylene oxide), poly(propylene oxide), and the like. The polymer moiety in the phospholipid-polymer targeting ligand conjugate may be conjugated to the phospholipid moiety via an amide or carbamate group. The polymer moiety in the phospholipid-polymer targeting ligand conjugate may be conjugated via an amide, carbamate, poly(alkylene oxide), triazole, combinations thereof, and the like. For example, the polymer moiety in the phospholipid-polymer targeting ligand conjugate may be represented by one of the following structural formulas: [ka] The variable n can be any integer from about 10 to about 100, such as, for example, about 60 to about 100, about 70 to about 90, about 75 to about 85, or about 77.

[0080] In some embodiments, the phospholipid-polymer portion in the phospholipid-polymer targeting ligand conjugate may be represented by one of the following structural formulas: [ka] The variable n can be any integer from about 10 to about 100, e.g., about 60 to about 100, about 70 to about 90, about 75 to about 85, or about 77. The variable m can be one of 12, 13, 14, 15, 16, 17, or 18. For example, n can be 77 and m can be 14. In another example, n can be 77 and m can be 16.

[0081] In some embodiments, the third phospholipid that is derivatized with a second polymer, which in turn is conjugated to a targeting ligand, is selected from the following: [ka] or a salt thereof (e.g., ammonium phosphate salt). In some embodiments, the variable n can be any integer from about 10 to about 100, e.g., about 60 to about 100, about 70 to about 90, about 75 to about 85, about 77, or about 79. The variable m can be one of 12, 13, 14, 15, 16, 17, or 18. For example, n can be 77 and m can be 14. n can be 79 and m can be 14. n can be 77 and m can be 16. n can be 79 and m can be 16.

[0082] The targeting ligand (e.g., aptamer) can be linked to one or more polymer (e.g., PEG) moieties of the phospholipid-polymer targeting ligand conjugate by one or more linkers or without linkers. The PEG moiety can be any type of PEG moiety (linear, branched, multi-branched, star-shaped, comb-shaped, or dendrimer) and can have any molecular weight. The same or different PEG moieties can be connected to the aptamer using the same or different linkers or without linkers. Commonly known linkers include, but are not limited to, amines, thiols, and azides, and can include phosphate groups. For example, in some embodiments, the targeting ligand is linked to polyethylene glycol that is conjugated to the phospholipid that is associated with the liposome.

[0083] In some embodiments, the liposome comprises a membrane, the membrane comprising a first phospholipid selected from HSPC, DPPC, DSPE, DSPC, and DPPE; cholesterol; DPPC, DSPE, DSPC, and / or DPPE derivatized with PEG; DPPC, DSPE, DSPC, and / or DPPE derivatized with PEG; a targeting ligand that specifically binds to a cell surface marker of tau pathology; and an imaging agent that is encapsulated by or bound to the membrane. In further embodiments, the targeting ligand is a thioaptamer and the imaging agent is an MRI contrast enhancing agent.

[0084] In some embodiments, a targeting composition is provided. In some embodiments, the targeting composition comprises a phospholipid linked to a polymer that is linked to a targeting ligand that specifically binds to a cell surface marker of tau pathology. The phospholipid can be any of the phospholipids described herein. In some embodiments, the phospholipid comprises one or more of DPPC, DSPE, DSPC and DPPE. Similarly, the polymer can be any of the polymers (e.g., polyols) described herein. In some embodiments, the polymer is polyethylene glycol.

[0085] Imaging or Detection Agents The composition for detecting tau pathology described herein may include an imaging or detection agent. The imaging or detection agent is generally associated with the liposome portion of the composition. The imaging or detection agent may be retained within the liposome or may be conjugated to the liposome. In one aspect, the imaging or detection agent is linked to a polymer that is linked to a phospholipid that associates with the membrane that forms the liposome.

[0086] The liposome composition comprises a macrocyclic Gd-based imaging agent. In some embodiments, the macrocyclic gadolinium-based imaging agent is Gd(III)-DOTA conjugated to a phospholipid, e.g., [ka] or a salt thereof (e.g., sodium salt). In some embodiments, the variable x can be one of 12, 13, 14, 15, 16, 17, or 18. In one embodiment, the variable x is 16 and the conjugate is Gd(III)-DOTA-DSPE. The preparation of Gd(III)-DOTA-DSPE is described in U.S. Pat. No. 11,116,854.

[0087] In other embodiments, the macrocyclic gadolinium-based imaging agent comprises: [ka]

[0088] In one embodiment, the imaging or detection agent is linked to a polymer that is linked to a phospholipid that associates with the membrane forming the liposome containing Gd(III)-DOTA-DSPE.

[0089] In some embodiments, the composition for detecting tau pathology comprises a detection agent. Examples of detection agents include dyes such as GFP, biotin, cholesterol, fluorescent dyes, electrochemically active reporter molecules, and compositions comprising radioactive moieties, such as radionuclides suitable for PET (positron emission tomography) detection, such as 18F, 11C, 13N, 15O, 82Rb, or 68Ga.

[0090] In some embodiments, the composition for detecting tau pathology comprises imaging agent.Imaging agent is different from detection agent in that it is suitable for use in imaging method that can make and display the image of the area of ​​tissue that shows tau pathology, not only shows the presence of tau pathology.Examples of imaging agent include near-infrared imaging agent, positron emission tomography imaging agent, single photon emission tomography agent, fluorescent composition, radioisotope, and MRI contrast agent.

[0091] In some embodiments, the imaging agent is an MRI contrast enhancing agent. Disease detection using MRI is often difficult because disease areas have similar signal intensity compared to surrounding healthy tissue. In the case of MRI, the imaging agent can also be referred to as a contrast agent. The MRI contrast enhancing agent can be a non-radioactive MRI contrast enhancing agent that can be at least one of encapsulated by a membrane and bound to a membrane. For example, the non-radioactive MRI contrast enhancing agent can be encapsulated by a membrane and bound to a membrane, for example, to provide a dual contrast agent liposome. The liposomal composition can be characterized by a relaxivity per particle at least about one or more of about 100,000, 125,000, 150,000, 165,000, 180,000, 190,000, and 200,000 MM-1 s-1. Detecting the liposomal formulation can include detecting using MRI in a magnetic field range of, for example, about 1T to about 3.5T, or about 1.5 to about 3T. Non-radioactive MRI contrast enhancing agents may include gadolinium. Suitable non-radioactive MRI contrast enhancing agents may include Gd(III)-DOTA-DSPE and (diethylenetriaminepentaacetic acid)-bis(stearylamide), gadolinium salt (Gd-DTPA-BSA). Gadolinium paramagnetic chelates such as GdDTPA, GdDOTA, GdHPDO3A, GdDTPA-BMA, and GdDTPA-BSA are also suitable known MRI contrast agents. See U.S. Patent No. 5,676,928 issued to Klaveness et al., which is incorporated herein by reference in its entirety.

[0092] Methods for Imaging or Detecting Tau Pathology In another aspect, a method of imaging tau pathology in a subject is provided, the method comprising administering to the subject a detectably effective amount of a targeting ligand-liposome conjugate comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, where the targeting ligand is conjugated to a liposome comprising an imaging agent, and imaging at least a portion of the subject to determine whether the portion of the subject exhibits tau pathology.

[0093] In some embodiments, a method of imaging tau pathology in a subject is provided, the method comprising: (i) administering to the subject a detectably effective amount of a targeting ligand-liposome conjugate comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, the targeting ligand being conjugated to a liposome comprising an imaging agent; and (ii) imaging at least a portion of the subject to determine whether the portion of the subject exhibits tau pathology. The targeting ligand may comprise an aptamer. The targeting ligand may comprise a stabilized aptamer. The targeting ligand may comprise a thioaptamer. The targeting ligands are tau_1 (SEQ ID NO:5; DONGYBM), tau_3 (SEQ ID NO:6; MUSQD), tau_9 (SEQ ID NO:7), tau_11 (SEQ ID NO:8), tau_10 (SEQ ID NO:9), tau_13 (SEQ ID NO:10), tau_8 (SEQ ID NO:11), tau_4 (SEQ ID NO:12), tau_17 (SEQ ID NO:13), tau_5 (SEQ ID NO:14), tau_21 (SEQ ID NO:15), tau_25 (SEQ ID NO:16), tau The portion may comprise a DNA nucleotide sequence selected from the group consisting of Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQ ID NO:26), and Tau_102 (SEQ ID NO:27). The portion may comprise a portion of the subject's brain. The imaging may indicate a level of tau pathology sufficient to diagnose the subject as having early stage Alzheimer's disease. The imaging agent may be an MRI contrast enhancing agent, and the level of binding may be determined using MRI. The cell surface marker of tau pathology may comprise a protein selected from KRT6A, KRT6B, HSP, and VIM.The liposome may comprise a membrane comprising a first phospholipid, a sterically bulky excipient capable of stabilizing the liposome, a second phospholipid derivatized with a first polymer, a third phospholipid derivatized with a second polymer, the second polymer being conjugated to a targeting ligand, and an imaging agent that is encapsulated by or bound to the membrane.

[0094] In some embodiments, a method for detecting tau pathology is provided, the method comprising contacting a biological sample with an effective amount of a targeting ligand-liposome conjugate comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, the targeting ligand being conjugated to a liposome comprising a detectable label, washing the biological sample to remove unbound targeting ligand-liposome conjugate, and detecting tau pathology in the biological sample by determining the amount of detectable label remaining in the biological sample. The biological sample may comprise a neuronal cell. The targeting ligand may comprise an aptamer. The targeting ligand may comprise a stabilized aptamer. The targeting ligand may comprise a thioaptamer. The targeting ligands are tau_1 (SEQ ID NO:5; DONGYBM), tau_3 (SEQ ID NO:6; MUSQD), tau_9 (SEQ ID NO:7), tau_11 (SEQ ID NO:8), tau_10 (SEQ ID NO:9), tau_13 (SEQ ID NO:10), tau_8 (SEQ ID NO:11), tau_4 (SEQ ID NO:12), tau_17 (SEQ ID NO:13), tau_5 (SEQ ID NO:14), tau_21 (SEQ ID NO:15), tau_25 (SEQ ID NO:16), tau The biological sample may comprise a DNA nucleotide sequence selected from the group consisting of Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQ ID NO:26), and Tau_102 (SEQ ID NO:27). The method may further comprise obtaining a biological sample from the subject.

[0095] The term "subject" refers to an animal, such as a vertebrate or an invertebrate. In some embodiments, the subject is a mammal, including but not limited to primates, including monkeys and humans, equines (e.g., horses), canines (e.g., dogs), felines, various livestock (e.g., ungulates, such as swine, pigs, goats, sheep, etc.), as well as domesticated pets and animals kept in zoos. In some embodiments, the subject is a human subject. In some embodiments, the subject is a subject with an increased risk of developing AD. Risk factors for Alzheimer's disease include genetic predisposition, smoking, diabetes, history of head trauma, depression, and hypertension. See Burns A, Iliffe S., BMJ., 338:b158 (2009).

[0096] The targeting ligand-liposome conjugate may include any of the features described herein. For example, in some embodiments, the targeting ligand is an aptamer or stabilized aptamer, and in further embodiments, the targeting ligand is a thioaptamer. In still further embodiments, the aptamer or stabilized aptamer used in the method is selected from the group consisting of tau_1 (SEQ ID NO:5; DONGYBM), tau_3 (SEQ ID NO:6; MUSQD), tau_9 (SEQ ID NO:7), tau_11 (SEQ ID NO:8), tau_10 (SEQ ID NO:9), tau_13 (SEQ ID NO:10), tau_8 (SEQ ID NO:11), tau_4 (SEQ ID NO:12), tau_17 (SEQ ID NO:13), tau_5 (SEQ ID NO:14), tau_21 (SEQ ID NO:15), tau_25 (SEQ ID NO:16), tau_30 (SEQ ID NO:17), tau_41 (SEQ ID NO:18), tau_42 (SEQ ID NO:19), tau_53 (SEQ ID NO:20), tau_44 (SEQ ID NO:21), tau_45 (SEQ ID NO:22), tau_46 (SEQ ID NO:23), tau_48 (SEQ ID NO:24), tau_49 (SEQ ID NO:25), tau_54 (SEQ ID NO:26), tau_55 (SEQ ID NO:27), tau_56 (SEQ ID NO:28), tau_57 (SEQ ID NO:29), tau_60 (SEQ ID NO:30), tau_61 (SEQ ID NO:31), tau_62 (SEQ ID NO:32), tau No. 16), Tau_7 (SEQ ID NO: 17), Tau_31 (SEQ ID NO: 18), Tau_42 (SEQ ID NO: 19), Tau_14 (SEQ ID NO: 20), Tau_19 (SEQ ID NO: 21), Tau_15 (SEQ ID NO: 22), Tau_56 (SEQ ID NO: 23), Tau_34 (SEQ ID NO: 24), Tau_23 (SEQ ID NO: 25), Tau_99 (SEQ ID NO: 26), and Tau_102 (SEQ ID NO: 27).

[0097] In some embodiments, a method is provided for generating an image of a tissue region of a subject by administering a detectably effective amount of a composition for detecting tau pathology to a subject and generating an image of a portion of the subject (i.e., a tissue region) in which the composition comprising an imaging agent is distributed. To generate an image of a tissue region, a detectably effective amount of the imaging agent must reach the tissue region of interest, but the imaging agent need not be solely localized in this region. However, in some embodiments, the composition comprising the imaging agent is targeted or locally administered to be primarily present in the tissue region of interest. Examples of images include two-dimensional cross-sectional views and three-dimensional images. In some embodiments, a computer is used to analyze data generated by the imaging agent to generate a visual image. The tissue region or portion of the subject can be an organ of the subject, such as the brain, heart, lungs, or blood vessels. In other embodiments, the portion of the subject can be a tissue region known to contain neural cells, such as the brain. Imaging methods include optical imaging, fluorescence imaging, computed tomography, positron emission tomography, single-photon emission computed tomography, and MRI. Any other suitable type of imaging method known to those skilled in the art is contemplated.

[0098] In some embodiments, the imaging agent is an MRI contrast enhancing agent, and the level of binding is determined using MRI. MRI is a medical application of nuclear magnetic resonance, which uses strong magnetic fields, magnetic field gradients, and radio waves to form pictures of the body's anatomical structures and physiological processes to produce an image of a portion of a subject. MRI is commonly used for neuroimaging, cardiovascular imaging, musculoskeletal imaging, liver imaging, and gastrointestinal imaging. MRI for imaging of anatomical structures or blood flow does not require a contrast agent, as the various properties of tissue or blood provide natural contrast. However, for more specific types of imaging, exogenous contrast agents may be administered. For a review of neuroimaging techniques, see Mehrabian et al. (Front Oncol., 9:440 (2019)).

[0099] In another aspect, a method of detecting tau pathology is provided, comprising contacting a biological sample with an effective amount of a targeting ligand-liposome conjugate comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, where the targeting ligand is conjugated to a liposome comprising a detectable label, washing the biological sample to remove unbound targeting ligand-liposome conjugate, and detecting tau pathology in the biological sample by determining the amount of detectable label remaining in the biological sample.

[0100] The targeting ligand-liposome conjugate may include any of the features described herein. For example, in some embodiments, the targeting ligand is an aptamer or stabilized aptamer, and in further embodiments, the targeting ligand is a thioaptamer. In still further embodiments, the aptamer or stabilized aptamer used in the method is selected from the group consisting of tau_1 (SEQ ID NO:5; DONGYBM), tau_3 (SEQ ID NO:6; MUSQD), tau_9 (SEQ ID NO:7), tau_11 (SEQ ID NO:8), tau_10 (SEQ ID NO:9), tau_13 (SEQ ID NO:10), tau_8 (SEQ ID NO:11), tau_4 (SEQ ID NO:12), tau_17 (SEQ ID NO:13), tau_5 (SEQ ID NO:14), tau_21 (SEQ ID NO:15), tau_25 (SEQ ID NO:16), tau_30 (SEQ ID NO:17), tau_41 (SEQ ID NO:18), tau_42 (SEQ ID NO:19), tau_53 (SEQ ID NO:20), tau_44 (SEQ ID NO:21), tau_45 (SEQ ID NO:22), tau_46 (SEQ ID NO:23), tau_48 (SEQ ID NO:24), tau_49 (SEQ ID NO:25), tau_54 (SEQ ID NO:26), tau_55 (SEQ ID NO:27), tau_56 (SEQ ID NO:28), tau_57 (SEQ ID NO:29), tau_60 (SEQ ID NO:30), tau_61 (SEQ ID NO:31), tau_62 (SEQ ID NO:32), tau No. 16), Tau_7 (SEQ ID NO: 17), Tau_31 (SEQ ID NO: 18), Tau_42 (SEQ ID NO: 19), Tau_14 (SEQ ID NO: 20), Tau_19 (SEQ ID NO: 21), Tau_15 (SEQ ID NO: 22), Tau_56 (SEQ ID NO: 23), Tau_34 (SEQ ID NO: 24), Tau_23 (SEQ ID NO: 25), Tau_99 (SEQ ID NO: 26), and Tau_102 (SEQ ID NO: 27).

[0101] Means for detecting the label are well known to those skilled in the art. Thus, for example, when the label is a radioactive label, means for detection include a scintillation counter or a photographic film as in autoradiography. When the label is a fluorescent label, it can be detected by exciting the fluorescent dye with light of an appropriate wavelength and detecting the resulting fluorescence. Fluorescence can be detected visually, by photographic film, by using an electronic detector such as a charge-coupled device (CCD) or a photomultiplier tube. Similarly, an enzyme label can be detected by providing an appropriate substrate for the enzyme and detecting the resulting reaction product. The level of the detected label can be compared with a control level to determine whether the biological sample shows an elevated level of cell surface marker for tau pathology.

[0102] The biological sample may be from an external or archived source, such as mammalian bodily fluids, serum, such as blood (including whole blood and its plasma and serum), CSF (spinal fluid), urine, sweat, saliva, tears, lung secretions, breast aspirates, prostatic fluid, semen, stool, cervical scrapings, cysts, amniotic fluid, intraocular fluid, mucus, moisture in exhaled air, animal tissue, cell lysates, tumor tissue, hair, skin, buccal scrapings, nails, bone marrow, cartilage, prions, bone powder, ear wax, etc., or even tumor samples (i.e., fresh, frozen, or paraffin-embedded). Samples such as bodily fluids or serum obtained during the course of a clinical trial may be appropriate. In some embodiments, the biological sample includes CSF or a sample containing neural cells, such as a neural (e.g., brain) tissue sample.

[0103] The biological sample may be fresh or preserved. The sample may be preserved for various times, such as for one hour, one day, one week, one month, or more than one month. The biological sample may be obtained expressly for use, or may be a sample obtained for another purpose that may be subsampled. In some embodiments, it may be useful to filter, centrifuge, or otherwise pretreat the biological sample to remove impurities or other undesirable substances that may interfere with the analysis of the biological sample.

[0104] In some embodiments, the method comprises obtaining a biological sample from a subject.The method of obtaining a biological sample varies according to the type of biological sample obtained, and such methods are well known to those skilled in the art.For example, a sample of brain tissue can be obtained using stereotactic needle biopsy, and a sample of cerebrospinal fluid can be obtained via lumbar puncture.

[0105] ADx-002 Nanoparticles for MRI Two aptamer-targeted nanoparticles were developed as molecular MRI contrast agents (ADx-002) for in vivo imaging of hyperphosphorylation status in living mouse brains. One displayed the tau_1 (SEQ ID NO:5; DONGYBM) aptamer and the other the tau_3 (SEQ ID NO:6; MUSQD) aptamer. PEGylated liposomal nanoparticles were synthesized using a lipid mixture containing lipid-tethered Gd-DOTA for MR imaging and cholesterol for liposomal stability. Lipidated rhodamine was also included to study the ex vivo microscopic distribution of liposomal nanoparticles in brain tissue using fluorescence microscopy. The ADx-002 composition also contained DSPE-mPEG2000 to increase in vivo circulation time. The particles had a hydrodynamic diameter of approximately 150 nm, approximately 86,000 Gd chelates per liposome, and approximately 500 aptamers conjugated to the outer leaflet of each liposomal nanoparticle (Figure 4A).

[0106] In vivo molecular MRI using ADx-002 for detection of hyperphosphorylated cells Studies were performed in 2-3 month old P301S transgenic mice and age-matched wild type mice. At this age, transgenic animals do not show obvious tau pathology (i.e., neurofibrillary tangles), but virtually all develop tau pathology by approximately 8 months of age. Animals underwent baseline, pre-contrast MRI. Animals were then administered MRI contrast agents (ADx-002-tau_1 (SEQ ID NO: 5; DONGYBM) or ADx-002-tau_3 (SEQ ID NO: 6; MUSQD) or non-targeted control stealth liposomes intravenously. Delayed post-contrast MRI was performed 4 days later. MR images were acquired using T1w-SE and FSE-IR sequences. Tg mice administered ADx-002-tau_1 (SEQ ID NO: 5; DONGYBM) or ADx-002-tau_3 (SEQ ID NO: 6; MUSQD) showed tau pathology in the cortical and hippocampal regions of the brain. We demonstrated signal enhancement in the brain (Figure 5A). WT mice administered ADx-002-tau_1 (SEQ ID NO: 5; DONGYBM) or ADx-002-tau_3 (SEQ ID NO: 6; MUSQD) did not show signal enhancement in the brain. Similarly, Tg mice administered non-targeted liposomal-Gd contrast agent did not show signal enhancement in the cortex or hippocampus. These regions of interest were further quantitatively analyzed and the signal enhancement between Tg and WT mice was found to be statistically significant (p<0.05) (Figure 5B).

[0107] A baseline enhancement threshold of approximately 6% (=2x standard deviation of the signal in the baseline scan) was used as the classification threshold. Animals that showed signal enhancement above the threshold were identified as positive. ROC curves were generated on a 6-point ordinal scale to evaluate the sensitivity and specificity for detecting genotypes using ADx-002-tau_1 (SEQ ID NO:5; DONGYBM) or ADx-002-tau_3 (SEQ ID NO:6; MUSQD) contrast agents and were constructed across the entire study group, including controls. The aptamer-targeted nanoparticle contrast agents, ADx-002-tau_1 (SEQ ID NO:5; DONGYBM) and ADx-002-tau_3 (SEQ ID NO:6; MUSQD), showed an overall AUC and accuracy of approximately 0.95. ADx-002-tau_3 (SEQ ID NO:6; MUSQD) showed higher sensitivity than ADx-002-tau_1 (SEQ ID NO:5; DONGYBM) (Figure 5C).

[0108] Postmortem brain analysis was performed in 2-3 month old transgenic and wild type mice. Immunofluorescence analysis using AT8 antibody staining revealed the presence of hyperphosphorylated tau species in transgenic mice but not in wild type mice (Figure 5D). 100% concordance was observed between AT8 positivity and animal genotype. In summary, the in vivo studies demonstrated that ADx-002 enabled in vivo molecular MRI of the hyperphosphorylated state several months before overt tau pathology, i.e. the presence of neurofibrillary tangles, became evident in Tg mice.

[0109] Aptamer target identification To characterize the binding targets of the aptamers, aptamer-based immunoprecipitation was performed followed by aptamer-based pull-down assays with mass spectrometry. The assays were performed for both tau_1 (SEQ ID NO: 5; DONGYBM) and tau_3 (SEQ ID NO: 6; MUSQD) aptamers. Ranking of the abundance scores of the identified proteins revealed keratin 6a, keratin 6b and VIM as possible binding targets. Surface expression of keratin 6a, 6b was similar in wild-type and transgenic tissue sections, while VIM expression was higher in Tg mice (Figure 6C). Undifferentiated and differentiated SH-SY5Y cells under hyperphosphorylated conditions showed increased levels of VIM (Figure 6A, Figure 6B), further suggesting that it is a potential target of the aptamers tau_1 (SEQ ID NO: 5; DONGYBM) and tau_3 (SEQ ID NO: 6; MUSQD) specific for the hyperphosphorylated state.

[0110] VIM-targeted WNPs for MRI VIM-targeted liposomal nanoparticles were prepared using withaferin A, a small molecule that binds to the conserved cysteine ​​382 residue on tetrameric VIM in a binding pocket that contains Gln 324 and Asp 331. DSPE-PEG3400-withaferin A was synthesized and used in place of carboxy-PEG in the aptamer-targeted ADx-002 formulation to yield WNPs with approximately 600 withaferin A molecules per liposomal nanoparticle (Figure 4B). Specific binding of WNPs to neuronally differentiated SH-SY5Y cells under hyperphosphorylation conditions is shown in Figure 7.

[0111] Two-month-old P301S and APP / PSEN1 mice were injected with WNPs and imaged using the same T1-weighted sequence used for ADx-002 nanoparticles. While no signal enhancement was observed in the WT mouse model, Tg mice (P301S and APP / PSEN1) showed clear signal enhancement in the cortical and hippocampal regions and were identified as positive (Figure 8A and 8B). Group statistical analysis (Figure 8B and Figure 8C) revealed that the VIM-targeted WNP contrast agent showed an overall AUC and precision of approximately 1.00. Tau phosphorylation status in transgenic mice was confirmed by immunofluorescence (Figure 9).

[0112] Alzheimer's disease In some embodiments, imaging shows a level of tau pathology sufficient to diagnose the subject as having AD. In further embodiments, the method shows that the subject has early AD, an increased risk of developing AD, or both. A level of tau pathology sufficient to diagnose the subject as having AD or early AD can result from the presence of an increased level of cell surface marker that reflects an increased level of tau phosphorylation (e.g., hyperphosphorylation) in cells (e.g., neuronal cells). Examples of cell surface markers that reflect an increased level of tau phosphorylation include KRT6A, KRT6B, HSP, and VIM.

[0113] AD is a chronic neurodegenerative disease that usually begins slowly and gradually worsens over time, and is responsible for 60-70% of dementia cases. AD is characterized by loss of neurons and synapses in the cerebral cortex and certain subcortical regions. This loss results in gross atrophy of affected areas, including degeneration of the temporal and parietal lobes, as well as parts of the frontal cortex and cingulate gyrus. AD is a protein misfolding disease (proteopathy) caused by plaque accumulation of abnormally folded amyloid beta and tau proteins in the brain.

[0114] Diagnosis of AD is most often made at the moderate stage. Typically, symptoms of AD are cognitive impairment or deficits, including dementia confirmed by medical and psychological testing, problems in at least two areas of mental function, and progressive loss of memory and other mental functions, particularly if symptoms begin between the ages of 40-90, the dementia is not explained by other disorders, and there are no other conditions that may mimic dementia (including hypothyroidism, overmedication, drug interactions, vitamin B12 deficiency, and depression). As the disease progresses, symptoms may include language problems, disorientation (including being easily lost), mood swings, loss of motivation, not managing self-care, and behavioral problems. In some embodiments, the methods and compositions described herein provide for detection of early AD, which may be present before one or more of these symptoms appear. Thus, in some embodiments, the methods are used to diagnose subjects who do not exhibit any other symptoms of AD.

[0115] In some embodiments, the method further comprises providing to the subject a prophylaxis or treatment of AD. Prevention of AD includes lifestyle and dietary changes that reduce the risk of developing AD.

[0116] Several medications have also been identified that can be used to treat the cognitive problems associated with AD. These include acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine and donepezil, as well as the NMDA receptor antagonist memantine. Huperzine A is a promising agent for treating AD, and atypical antipsychotics can be used to reduce aggression and psychosis in people with AD.

[0117] Pharmaceutical Compositions In some embodiments, the compositions described herein are delivered as pharmaceutical compositions. Pharmaceutical compositions are prepared according to standard techniques and may further include a pharma- ceutically acceptable carrier. Generally, saline is used as a pharma- ceutically acceptable carrier. Other suitable carriers include, for example, water, buffered water, isotonic solutions (e.g., dextrose), 0.4% saline, 0.3% glycine, and the like, and include glycoproteins, such as albumin, lipoproteins, globulins, and the like, to enhance stability. These compositions may be sterilized by conventional, well-known sterilization techniques. The resulting aqueous solutions may be packaged for use or filtered under aseptic conditions and lyophilized, and the lyophilized preparations are combined with a sterile aqueous solution before administration. The compositions may contain pharma- ceutically acceptable auxiliary substances required to approximate physiological conditions, such as pH adjusting and buffering agents, isotonicity adjusting agents, and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, and the like. In addition, the liposome composition may be suspended in a suspension containing a lipid protective agent that protects lipids from free radical and lipid peroxidation damage during storage. Lipophilic free-radical quenchers such as α-tocopherol and water-soluble iron-specific chelators such as ferrioxamine are suitable.

[0118] The concentration of the liposome composition in the pharmaceutical formulation can vary widely, for example, from less than about 0.05% by weight, typically or at least about 2-5% by weight, up to 10-30% by weight, and is selected primarily by fluid volume, viscosity, etc., according to the particular mode of administration selected. For example, the concentration may be increased to reduce the fluid load associated with the treatment. The amount of the composition administered will depend on the particular aptamer used, the disease state being treated, and the judgment of the clinician. Generally, the amount of the composition administered will be sufficient to deliver a therapeutically effective dose of the nucleic acid. The amount of the composition required to deliver a therapeutically effective dose can be determined by one of skill in the art. Typical dosages are generally about 0.01 to about 50 mg of nucleic acid per kilogram of body weight, about 0.1 to about 10 mg of nucleic acid per kg of body weight, or about 2.0 to about 5.0 mg of nucleic acid per kg of body weight. For administration to mice, the dosage is typically 50 to 100 μg per 20 g of mouse.

[0119] kit In some embodiments, a kit is provided for preparing liposome complexes / compositions. Such kits can be prepared from readily available materials and reagents, as described above. For example, such kits can include any one or more of the following materials: liposomes, nucleic acids (condensed or non-condensed), hydrophilic polymers, hydrophilic polymers derivatized with targeting ligands, such as aptamers, and instructions. Depending on the intended user of the kit and the needs of the user, a wide variety of kits and components can be prepared. For example, the kit can include any one of the targeting moieties for targeting the complex to a specific cell type, as described above.

[0120] Instruction materials for the preparation and use of the liposome complexes can be included. Instruction materials typically include, but are not limited to, written or printed materials. Any medium capable of storing such instructions and communicating them to an end user is contemplated. Such media include, but are not limited to, electronic storage media (e.g., magnetic disks, tapes, cartridges, chips), optical media (e.g., CD-ROMs), and the like. Such media may include addresses to internet sites that provide such instruction materials.

[0121] In various embodiments, the instructions can instruct the user to carry out any of the method steps described herein.For example, the instructions can instruct the user to diagnose the risk of a subject developing AD by detecting the presence of tau pathology using the targeted liposome composition described herein.

[0122] Examples are included to more clearly illustrate certain aspects of the invention, however, there are a wide variety of other aspects within the scope of the invention which should not be limited to the examples provided herein. EXAMPLES

[0123] example material and method Cell lines. SH-SY5Y cells (ATCC, Manassas, VA, #CRL-2266™) were obtained from the laboratory of Dr. Jason Shohet at Texas Children's Hospital, Houston. Immortalized human hepatocytes (THLE-3) were purchased from American Type Culture Collection (ATCC, Manassas, VA, #CRL-11233™). Both were cultured according to ATCC instructions. ReN cell™ VM (#SCC008) were cultured according to instructions using Neural Stem Cell Maintenance Medium (#SCM005) and growth factors EGF (GF001) and bFGF (#GF005), all from Millipore Sigma, Burlington, MA.

[0124] Differentiation. SH-SY5Y cells were exposed to 30 μM all-trans retionic acid (Sigma-Aldrich, St. Louis, MO, #R2625) in serum-free cell culture medium for 10 days, with medium changed every other day. ReN cell VMs were differentiated by removing growth factors from their culture medium for 10 days.

[0125] Hyperphosphorylation. Hyperphosphorylation was induced in SH-SY5Y cells by adding 30 nM OA (Sigma Aldrich, St. Louis, MO, #459620) in growth medium containing 30 μM RA for 24 hours. ReN cell VM was hyperphosphorylated with 100 nM QA (Sigma Aldrich, St. Louis, MO, #P63204) in culture medium for 24 hours.

[0126] Synthesis of primers and TA DNA library. All primers, Cy5, and amine-labeled selection aptamers were purchased from Integrated DNA Technologies (IDT, Coralville, Iowa). The ssDNA library used in Cell-SELEX contains the sequence 5'-CGCTCGATAGATCGAGCTTCG (SEQ ID NO: 28)-(N) 30 The PCR primer region contained a central randomized sequence of 30 nucleotides to allow PCR amplification of -GTCGATCACGCTCTAGAGCACTG-3' (SEQ ID NO: 29). The chemically synthesized DNA library was converted to a phosphorothioate-modified library by PCR amplification with dATP(αS), resulting in DNA sequences in which the 3' phosphate of each residue was replaced with a monothiophosphate group. The reverse primer was labeled with biotin to separate the sense strand from the antisense strand by streptavidin-coated Sepharose beads (PureBiotech, Middlesex, NJ, #MSTR0510) for the next round of selection. The concentration of the TA library was determined by measuring the UV absorbance at 260 nm using a NanoDrop™ 2000.

[0127] Cell-SELEX. 150 pmoles of the initial ssDNA library were dissolved in a total volume of 350 μl of binding buffer. It was denatured by heating at 95°C for 5 min and renatured by quick cooling on ice for 10 min. SH-SY5Y cells treated at approximately 90% confluence in 100 mm culture plates were washed twice with washing buffer and subsequently incubated with 150 pmoles of the ssDNA library at 4°C for 2 h. After incubation, for positive selection, the supernatant was discarded and the cells were washed three times with washing buffer to remove unbound sequences. The cells were scraped and transferred to nuclease-free water after three additional nuclease-free water washes. The cells in nuclease-free water were centrifuged at 300 × g for 5 min. The cell membrane fraction was eluted by introducing a QIAamp DNA Mini and Blood Mini kit (Qiagen, Germantown, MD, #51104). The cell membrane fraction was PCR amplified to monitor the presence of cell-binding potency in each cycle. In the case of negative selection, the supernatant was simply pipetted out of the flask and processed for the next selection cycle. The desired compartment was amplified by PCR and used to prepare TA for the next selection round. Two different negative selections were performed. One was SH-SY5Y cells with only differentiation treatment at cycles #12 and #13. Another was hepatocyte THLE-3 cells at cycles #20 and #21. A total of 26 cycles of Cell-SELEX were performed, including the two different types of negative selections mentioned above.

[0128] Next-generation sequencing (NGS). For the test cycles, membrane fractions were isolated and the recovered TA sequences were amplified by PCR. Equimolar amounts of the recovered TA sequences across the range were pooled together and sequenced by Next-Gen DNA sequencing using an Ion318 chip (ThermoFisher, Waltham, MA). A four-base sequence was introduced during PCR amplification to serve as a unique "barcode" to distinguish the cycles investigated. Sequencing results were analyzed by Aptalinger, which uses Markov model probability theory to find the optimal alignment of sequences.

[0129] Aptamer binding studies. Aptamer binding studies were performed with undifferentiated, differentiated, and hyperphosphorylated SH SY5Y and ReN cell VM grown in 96-well plates seeded at 10000 per well. Kd app was measured by saturation binding experiments using GraphPad Prism 9 (San Diego, CA) with the formula Y=BmaxX / (Kd+X). Cells were incubated with various concentrations of Cy5-labeled aptamers in a 100 μl volume of binding buffer containing cells, incubated for 30 minutes, washed twice, resuspended in 100 μl buffer, and analyzed by a molecular probe microplate reader equipped with appropriate excitation and emission filters. All data points were collected in triplicate.

[0130] Immunocytochemistry. Eight-well glass plates were coated with a solution of 100 μg / ml collagen type I (Thermofisher Scientific, Waltham, MA, #A1064401) dissolved in 0.01 N HCl, air-dried, washed with PBS, air-dried again, and then seeded with 20,000 SH-SY5Y cells per well. Aptamer staining at 100 nM was performed for 2 hours at 4°C in binding buffer with live cells and washed twice with wash buffer. Cells were fixed by incubation in 4% formaldehyde in PBS at room temperature for 15 minutes. Nonspecific binding was blocked with blocking buffer (G-Biosciences, St. Louis, MO, #786195) for 1 h and incubated with rabbit p-tau primary antibody (1:100) (Santa Cruz Biotechnology, #:sc-101815) overnight at 4 °C, followed by washing with PBS and incubation with goat anti-rabbit IgG secondary antibody, Alexa Fluor 488 (Invitrogen, Carlsbad, CA, #A-11008) for 1 h at room temperature. Cytoskeletal actin filaments were stained with Alexa Fluor 594 phalloidin (Invitrogen, #A12381). Cells were covered with VECTASHIELD hardset mounting medium containing DAPI (Vector Laboratories, Burlingame, CA, #H-1500) for 5 min at room temperature. Images were visualized under an Olympus Fluoview FV1000 confocal microscope.

[0131] ADx-002 nanoparticle synthesis. L-α-phosphatidylcholine, hydrogenated (hydrogenated soy PC; HSPC) and cholesterol were purchased from Lipoid Inc. (Newark, NJ, USA). 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DSPE-mPEG2000) was purchased from Corden Pharma (Riestal, Switzerland). DSPE-PEG3400-COOH and Gd-DOTA-DSPE were synthesized in-house, lis-rhodamine-DHPE from ThermoFisher Scientific. HSPC, cholesterol, DSPE-PEG3400-COOH, DSPE-mPEG2000, Gd-DOTA-DSPE, lis-rhodamine-DHPE in a molar ratio of 31.4:40:0.5:3:25:0.1 were dissolved in ethanol to achieve a total concentration of 100 mM. For non-targeted control stealth liposomes, carboxy-terminated PEG was not included in the lipid mixture. The ethanol solution of lipids was hydrated with 150 mM saline at 65° C. for 30 minutes to form multilamellar liposomes. The mixture was then extruded in a 10 ml Lipex extruder (Northern Lipids Inc., Burnaby, Canada) using a 400 nm polycarbonate track-etched polycarbonate filter (three passes), followed by a 200 nm filter (three passes), and finally a 100 nM filter. The suspension was diafiltered using MicroKros cross-flow diafiltration cartridges (500 kDa cutoff) from Repligen (Rancho Dominguez, CA), and the external buffer was exchanged with phosphate-buffered saline (PBS, pH 7.2) for 15 volume exchanges. To form aptamer-conjugated liposomes, liposomes bearing lipid-PEG-COOH were reacted with amine-terminated aptamers using carbodiimide chemistry. Carboxyl groups on the liposomes were activated with 5 mM EDC and 10 mM sulfo-NHS at approximately pH 6 for 5-10 min. The activated liposomes were then immediately reacted with amine-terminated aptamers, and the pH was raised to approximately 7.3-7.6 by titrating with μl volumes of 5 N NaOH.The final concentration of aptamer used in the reaction is approximately 140 μM. The reaction was mixed at room temperature for 1 h, and then the reaction was carried out overnight at 4 °C. The liposomes were dialyzed against PBS to remove unconjugated aptamer using a 300 kDa dialysis membrane. The dialysate (external phase) was concentrated using a 10 kD centrifuge device and washed with PBS to remove residual EDC / s-NHS. The concentrated dialysate was analyzed by a NanoDrop spectrophotometer (ThermoFisher Sci., Waltham, MA, USA) to determine the unconjugated aptamer fraction and to estimate the aptamer density per nanoparticle in the ADx-002 formulation. Inductively coupled plasma atomic emission spectroscopy (ICP-AES) was used to measure the Gd and phosphorus concentrations of the ADx-002 formulation. The hydrodynamic diameter of the liposomal nanoparticles in the ADx-002 formulation was determined using a dynamic light scattering instrument.

[0132] Withaferin A nanoparticle (WNP) synthesis. The allylic alcohol of withaferin A was selectively activated by exposure to 4-nitrophenyl chloroformate (1.1 equiv.) at 0°C for 8 h to give the intermediate compound in excellent yield. It was then reacted with DSPE-PEG-NH2-3400 at room temperature for 24 h. The crude product was dialyzed against water for 2 days and lyophilized to give DSPE-PEG-3400-withaferin A. The structures of the intermediate and final products were confirmed by NMR and MALDI. Liposomal nanoparticles containing withaferin A on their surface were produced by using the ADx-002 composition, which replaced carboxy PEG with the synthesized DSPE-PEG3400-withaferin A to give WNP (Figure 4B).

[0133] Mice. All procedures were performed with approval from the Institutional Animal Care and Use Committee (IACUC) of Baylor College of Medicine. Mice were housed under a 12-hour light / dark cycle, and food and water were available ad libitum. PS19 mice, B6;C3-Tg(Prnp-MAPT*P301S)PS19Vle / J stock number: 008169 from Jackson Laboratories (Bar Harbor, ME), were used for experiments at 2 months of age. Tg mice develop neurofibrillary tangles by 5 months of age. Age-matched non-transgenic WT mice were used as controls. APP / PS1 mice, B6.Cg-Tg(APPswe,PSEN1dE9)85Dbo / Mmjax MMRRC stock number 34832-JAX from Jackson Laboratories were also used for experiments with WNP. These mice develop amyloid plaques by 6 weeks in the cortex and by 2-4 months in the hippocampus without any reported mature tau tangles, although the presence of hyperphosphorylated tau neurites has been observed surrounding the plaques.

[0134] Magnetic Resonance Imaging (MRI). MRI was performed in a 1 T permanent magnet scanner (M7, Aspect Imaging, Shoham, Israel). Mice underwent a pre-contrast baseline scan. Mice were then administered one of three nanoparticle MR contrast agents (tau_1 (SEQ ID NO: 5; DONGYBM), tau_3 (SEQ ID NO: 6; MUSQD), or non-targeted control liposomes) intravenously via the tail vein at a dose of 0.15 mmol Gd / kg body weight. Delayed post-contrast MRI was performed 4 days after contrast injection. T1w-SE and FSE-IR sequences were used to acquire pre-contrast and delayed post-contrast MR images with the following parameters: SE parameters: TR=600ms, TE=11.5ms, slice thickness=1.2mm, matrix=192x192, FOV=30mm, slices=16, NEX=4; FSE-IR parameters: TR=13500ms, TE=80ms, TI=2000ms, slice thickness=2.4mm, matrix=192x192, FOV=30mm, slices=6, NEX=6. Coil calibration, RF calibration, and shimming were performed at the beginning of the study for each subject. The pre-contrast scan provides a baseline for the calculation of signal enhancement from the resulting post-contrast scan. Two standard deviations above the mean variation within WT control animals was used as the cutoff signal intensity to identify tau-positive animals. Six Tg mice and six WT mice were used for testing each nanoparticle contrast agent formulation. ROC curves were generated on a 6-point ordinal scale by plotting TPF against FPF based on imaging-based identification of tau-positive animals using a cutoff signal intensity and comparing with histological confirmation of tau pathology as the gold standard. Fitted curves were generated for the empirical points plotted on the graph. Qualitative and quantitative analysis of MRI images was performed in OsiriX (version 5.8.5, 64-bit, Pixmeo SARL, Geneva, Switzerland) and MATLAB® (version 2015a, MathWorks, Natick, MA).

[0135] Immunohistochemistry. After the last MRI scan, mice were euthanized and perfused extensively with 0.9% saline followed by 4% paraformaldehyde for 15 min. Brains were then immersion fixed in 4% formaldehyde for 48 h at 4 °C, transferred to 30% sucrose for cryoprotection, and embedded in OCT. Phenotypic confirmation of the presence of phosphorylated tau and VIM was performed on 25 μm thick brain sections. Antigen retrieval in citrate buffer at pH = 8.5 was performed in a 1200W GE microwave for 15 min. After cooling for 15 min, 25 μL of a 1:50 dilution of primary p-tau antibodies, either AT8, AT100, or AT180, which recognize different p-tau species, were incubated in a tray designed for microwave-enhanced immunostaining procedures (RPI, Mount Prospect, IL, #248270) for 3 min at power level 3. After cooling for 2 min, sections were washed with PBS and incubated with a 1:100 dilution of the appropriate secondary antibody for 3 min. DAPI staining was developed after 2 min of cooling and PBS washing. Slides were mounted using ProGold Antifade (Invitrogen, Carlsbad, CA #P36030) and visualized with an Olympus Fluoview LV100. Whole sections were also scanned using a Biotek Cytation 5 slide scanning microscope. Antibodies-AT8 (#MN1020) and Vimentin SP20 (#MA516409) were purchased from Thermo Fisher Scientific (Waltham, MA), Vimentin D21H3 from Cell Signaling Technology (Beverly, MA), #5741T and cell surface vimentin from Abnova (Taipei, Taiwan), #H00007431-M08J.

[0136] Target Identification. Protein targets of tau_1 (sequence number 5; DONGYBM), tau_3 (sequence number 6; MUSQD), tau-4, and tau-5 were identified by affinity pull-down using selected aptamers as capture reagents followed by mass spectrometry. Scrambled DNA sequence R2 was used as a control. Hyperphosphorylated SH-SY5Y cells at 90–95% confluence were washed with cold PBS buffer and incubated with 25 mmol / l biotinylated selected aptamers in PBS at 4 °C, respectively. After 2 h of gentle agitation, SH-SY5Y cells were cross-linked with 1% formaldehyde for 10 min at room temperature. Formaldehyde cross-linking was quenched with glycine. Cells were scraped off the plate, washed, lysed with lysis buffer (Thermofisher Scientific, #87787), and treated with protease inhibitor mixture. Lysates were freeze-thawed on ice for 30 min and clarified by centrifugation at 10,000 × g for 2 min at 4 °C. To pull down crosslinked proteins, equal amounts of cell lysates were incubated with prewashed streptavidin magnetic beads for 1 h at room temperature with continuous rotation. On-bead protein digestion was performed to isolate targeted proteins and processed for mass spectrometry. Each sample was analyzed in triplicate. Raw data files were processed to generate Mascot generic format with Mascot Distiller and searched against the SwissProt_2012_01(Human) database using licensed Mascot search engine v2.3.02 (Matrix Science, Boston, MA) running on an in-house server.

[0137] The ATN research framework suggests the need for biomarkers to diagnose and classify AD. Under this framework, CSF-based detection of Aβ and tau (total and phosphorylated) has been reported, but only in the prodromal stage of the disease in patients with mild cognitive impairment. Non-invasive neuroimaging tools such as structural MRI to diagnose and monitor neurodegeneration show conclusive correlation with cognitive decline and visualize atrophic areas depicting neuronal damage in late disease. However, reliable markers of early disease in the prodromal stage have yet to be described.

[0138] The role of Aβ and tau in the development of AD, and the mechanisms of transition from prodromal to symptomatic AD, are still unclear, although the timescale of the transition is generally accepted to span a period of 10–20 years. Although Aβ deposits are considered the initiation of neurodegeneration, recent studies have shown that tau pathology shows a stronger correlation with disease progression, suggesting that a limitation of current tests is the inability to identify pathological tau at early stages. CSF presence of hyperphosphorylated tau species p-181 and p-217 is associated with Aβ deposits preceding positive tau PET, but with only 50%–70% concordance. Overall, the role of Aβ and tau deposition in disease progression, as well as the role of Aβ in the spread of early tau aggregates, strongly suggest that biomarkers of pathological tau in the prodromal phase of the disease are likely to advance detection by several years, which constitutes the motivation for this research.

[0139] Early tau aggregation is believed to be caused by an imbalance in cellular homeostasis caused by dysregulated phosphorylation. Several kinases can theoretically phosphorylate tau at 85 different positions, of which at least 45 have been observed experimentally. In combination with reduced phosphatase activity in AD, the altered balance of kinase phosphatases leads to a hyperphosphorylated state that causes abnormal hyperphosphorylation of tau. Disruption of the normal function of tau, which regulates microtubule dynamics by reducing its binding capacity, increases the levels of cytoplasmic free tau, leading to tau aggregation and fibrillation that spreads throughout the connected brain, seeding the lesion. This early process of hyperphosphorylation may be associated with changes in the surface of hyperphosphorylated cells. Through this study, these surrogate markers of tau hyperphosphorylation that are indicative of future tau pathology were identified.

[0140] Using SH-SY5Y cells as a model of neuronal hyperphosphorylation, RPPA analysis was used to demonstrate elevated levels of surface molecules specific to the hyperphosphorylated state. Cell-SELEX, which captures the difference between the surface of hyperphosphorylated and normal cells, allowed the selection of phosphorothioate-modified short DNA aptamers that bound with high affinity and specificity to hyperphosphorylated cells (Figure 2A). Having identified unique aptamers that bind to such markers, MR molecular imaging contrast agents were developed that recognize the surface of cells in a hyperphosphorylated state. SH-SY5Y cells are not true neurons, but rather a cell line derived from neuroblastoma, a tumor of embryological neural crest origin. However, they can be induced to differentiate into a neuronal phenotype (as in the current study). While primary neuronal cultures or immortalized neuronal cells, such as ReN-VM, may provide an alternative model of neurons, aptamer hits from the SELEX screen have been functionally tested in a Tg mouse model of tau deposition. Their performance has been validated, supporting the position that the choice of cell model was appropriate to identify suitable markers of tau hyperphosphorylation.

[0141] The possible binding targets of the aptamer have been narrowed down and data suggest that cell surface VM is a likely target. The specific presence of cell surface VIM on the SH-SY5Y cell surface and on P301S mouse brain slices in a hyperphosphorylated state has been confirmed. VIM is an intermediate filament protein that undergoes constant assembly and / or remodeling and is normally associated with mesenchymal cells. The assembly state of the filaments is related to their phosphorylation state, with phosphorylation promoting disassembly. VIM contains more than 35 phosphorylation sites that are targeted by multiple kinases and phosphatases, allowing it to adjust IF dynamics depending on its environment. Mechanical, chemical (toxins, hypoxia) and microbial stresses upregulate VIM and its phosphorylation allows cells to adjust their mechanical properties. The balance of the various oligomeric forms influences dynamic cellular processes including adhesion, migration and invasion (including stress-induced signaling). Distributed throughout the cell by association with microtubules (tubulin, 24 nm) that regulate cell migration and microfilaments (actin, 7 nm) that regulate cell contractility, Vim IFs (~10 nm) form a cytoskeletal network and provide mechanical support for the plasma membrane at the sites where it contacts other cells or the extracellular matrix. During epithelial-mesenchymal transition, a biological process in which nonmotile polarized epithelial cells transform into motile invasive nonpolarized mesenchymal cells, cells also undergo cytoskeletal reorganization, including changes in plasma membrane integrity, degradation of junctional proteins, increased stress fiber formation, and changes in cell surface protein expression. Changes in protein localization are a hallmark of this pathological process. The observation that VIM is upregulated and translocated to the cell surface during early stages of tau hyperphosphorylation suggests a possible role for EMT-related processes at the onset of the slow progression to AD pathology.

[0142] PET is the leading modality for clinical molecular imaging driven by its high contrast sensitivity, but suffers from low spatial resolution of around 5-10 mm, high cost, limited access to radiotracers, and radiation exposure. Nanoparticle-enhanced MR imaging overcomes all these obstacles but has historically not achieved sufficiently high sensitivity. Liposomal nanoparticles have been demonstrated to exhibit numerous Gd-chelates in the outer bilayer leaflet with hyper-T1 relaxivity properties that result in contrast sensitivity comparable to nuclear imaging.

[0143] An often-mentioned concern regarding the use of nanoparticles for brain imaging centers on whether these particles can penetrate the blood-brain barrier (BBB). The concept of the BBB arose primarily in relation to the delivery of relatively large amounts of therapeutic molecules to brain tumors. However, for imaging, relatively small amounts of contrast agents need to be delivered. Furthermore, convective and diffusive transport of molecular and particle species through the porous choroid plexus is well known. Transport of liposomal nanoparticles via this route to the CSF has been demonstrated. Amyloid plaque-targeted liposomal MRI agents have been demonstrated that successfully cross the BBB after intravenous injection, bind to plaques, and allow accurate imaging of amyloid pathology with T1-weighted MRI.

[0144] In P301S mice, the earliest reported histopathological study was at 2.5 months of age, with no reported tau pathology. "Tau seeding," the cell-to-cell transfer of pathogenic tau aggregates, has been reported using brain homogenates from 1.5 months of age. Thus, 2-month-old P301S mice were selected for these studies, the age at which tau seeding should occur, but no obvious tau pathology should be present. Mice were injected with ADx-002 nanoparticles targeting either the tau_1 (SEQ ID NO: 5; DONGYBM) or tau_3 (SEQ ID NO: 6; MUSQD) aptamers. Signal enhancement was observed in the cortical and hippocampal regions of the brain when imaged by T1-weighted MRI sequences designed to optimize the signal from Gd-chelation-induced T1 relaxation caused by liposomal-Gd nanoparticles. Hyperphosphorylation conditions were confirmed by postmortem IF staining with the AT8 antibody, which recognizes S202 and T305 p-tau species. No signal enhancement was observed in non-Tg mice or in Tg mice injected with non-targeted nanoparticles, confirming the specificity of tau_1 (sequence number 5; DONGYBM)- and tau_3 (sequence number 6; MUSQD)-loaded nanoparticles binding to the target.

[0145] We provide herein validation of VIM-bound ADx-002 nanoparticles by the use of the small molecule withaferin A, known to bind VIM at its highly conserved cysteine ​​residue in the coiled-coil 2B domain. Intravenously injected WPNs showed binding in the same brain regions as ADx-002, maintaining specificity and sensitivity to phosphorylation status, with signal enhancement observed only in Tg mice, but not in WT mice. Furthermore, similar results are shown in another mouse model (APP / PSEN1). Taken together, this in vivo data further supports the use of such particles as detectors of hyperphosphorylation, which leads to the initiation of tau pathology in AD. Higher expression of CSV was confirmed in 2-month-old transgenic P301S mice by immunofluorescence (Figure 10).

[0146] Although PET is central to molecular imaging and exhibits remarkable sensitivity, there are several limitations posed by this methodology. Access to PET imaging is limited even in the relatively well-served United States, disproportionately to dense urban areas. PET costs are very high due to the need for same-day radiosynthesis and rapid decay of the isotope. Longer half-life isotopes cause higher radiation exposure. This trade-off between half-life and radiation exposure greatly limits the reach of PET to a broader patient population. Current PET tau tracers recognize tau β-sheets in PHFs and NFTs present in tauopathies. This conformation is not unique to tau, and in vivo specificity is circumspect, limiting its interpretation. Flortaucipir, an approved tau PET agent, binds to the MAO-B enzyme in the brain, and thus off-target binding has been reported. Moreover, the majority of pathological tau is intracellular, posing a significant barrier for PET tracers that must navigate to sites of tau pathology, bind to their targets, and have all unbound tracer molecules cleared from the brain before the radioactive signal decays. The choice of MRI as a detection modality is based on the hyper-T1 relaxivity properties of nanoparticles with surface-conjugated Gd-chelates, bringing detection sensitivity in the same range as nuclear imaging, and the MRI agent does not suffer from the rapid signal decay of PET agents, allowing sufficient time for unbound tracer to be cleared from the brain before imaging. The choice of a cell surface surrogate marker of tau hyperphosphorylation circumvents the need to bind intracellular targets. Finally, MRI imaging is already included in AD management and can be tailored with agents such as ADx-002 nanoparticles to constitute a highly sensitive and specific test for future tau pathology.

Claims

1. A composition for identifying tau pathology, said composition comprising Compound I: 【Chemistry 1】 and a targeting ligand represented by the targeting ligand specifically binds to a cell surface marker of tau pathology; the targeting ligand is linked to a liposome that includes an imaging agent; composition.

2. The composition of claim 1 , wherein the cell surface marker of tau pathology comprises a cell surface marker of tau hyperphosphorylation.

3. The composition of claim 1 , wherein the cell surface marker of tau pathology comprises the protein vimentin.

4. The composition of claim 1 , wherein the imaging agent comprises a magnetic resonance imaging (MRI) contrast enhancing agent.

5. The liposome comprises a membrane, the membrane comprising: A first phospholipid; a sterically bulky excipient capable of stabilizing the liposome; a second phospholipid derivatized with a first polymer; and a third phospholipid derivatized with a second polymer, said second polymer being conjugated to said targeting ligand; and the imaging agent being encapsulated by or bound to the membrane; The composition of claim 1 comprising:

6. the first phospholipid comprises HSPC; the sterically bulky excipient capable of stabilizing the liposome comprises cholesterol; the second phospholipid derivatized with a first polymer comprises DSPE-PEG; the third phospholipid derivatized with a second polymer, said second polymer conjugated to said targeting ligand, comprises DSPE-PEG conjugated to Compound I; the imaging agent comprises DSPE-DOTA-Gd; The composition of claim 5.

7. the first phospholipid comprises HSPC; the sterically bulky excipient capable of stabilizing the liposome comprises cholesterol; the second phospholipid derivatized with a first polymer comprises DSPE-PEG2000; the third phospholipid derivatized with a second polymer, said second polymer conjugated to said targeting ligand, comprises DSPE-PEG3400 conjugated to Compound I; the imaging agent encapsulated by or bound to the membrane comprises DSPE-DOTA-Gd; The composition of claim 5.

8. The composition of claim 5 comprising about 600 molecules of conjugated Compound I.

9. 1. A targeting composition, the targeting composition comprising a phospholipid linked to a polymer linked to a targeting ligand, the targeting ligand being selected from Compound I: 【Chemistry 2】 is represented by wherein the targeting ligand specifically binds to a cell surface marker of tau pathology; Targeted composition.

10. 10. The targeting composition of claim 9, wherein the cell surface marker of tau pathology comprises vimentin.

11. 10. The targeted composition of claim 9, wherein the targeted composition is a component of a liposome.

12. The targeted composition of claim 11 , wherein the liposome further comprises an imaging agent.

13. 13. The targeted composition of claim 12, wherein the imaging agent comprises a magnetic resonance imaging (MRI) contrast enhancing agent.

14. The targeting composition is a component of a liposome, the liposome comprising: A first phospholipid; a sterically bulky excipient capable of stabilizing the liposome; a second phospholipid derivatized with a first polymer; and Membrane-encapsulated or membrane-bound imaging agents 10. The targeted composition of claim 9, further comprising:

15. the first phospholipid comprises HSPC; the sterically bulky excipient capable of stabilizing the liposome comprises cholesterol; the second phospholipid derivatized with a first polymer comprises DSPE-PEG; the imaging agent comprises DSPE-DOTA-Gd; 15. The targeted composition of claim 14.

16. the first phospholipid comprises HSPC; the sterically bulky excipient capable of stabilizing the liposome comprises cholesterol; the second phospholipid derivatized with a first polymer comprises DSPE-PEG2000; the imaging agent comprises DSPE-DOTA-Gd; 15. The targeted composition of claim 14.

17. 10. The targeting composition of claim 9, wherein the phospholipid linked to a polymer linked to a targeting ligand comprises DSPE-PEG conjugated to Compound I.

18. 10. The targeted composition of claim 9, wherein the phospholipid linked to a polymer linked to a targeting ligand comprises DSPE-PEG3400 conjugated to Compound I.

19. The phospholipid linked to a polymer linked to a targeting ligand, 【Chemistry 3】 10. The targeting composition of claim 9, comprising:

20. 20. The targeting composition of claim 19, comprising about 600 molecules of conjugated Compound I.

21. the third phospholipid derivatized with a second polymer, said second polymer being conjugated to said targeting ligand; 【Chemistry 4】 The composition of claim 5 , comprising:

Images