Antisense oligonucleotide targeting the region between the CFP-ELK1 genes

Abstract

The present invention relates to an antisense oligonucleotide that is complementary to the ELK1-CFP pre-mRNA transcript and that results in a decrease in the level of said transcript in a cell. The present invention further relates to conjugates, salts and pharmaceutical compositions thereof, and to methods for the treatment of diseases associated with an increase in the level of ELK1-CFP pre-mRNA transcript, including amyotrophic lateral sclerosis.

Description

Technical Field

[0001] Field of the Invention The present invention relates to antisense oligonucleotides that are complementary to the transcribed human CFP-ELK1 intergenic region. These antisense oligonucleotides can result in a decrease in the level of ELK1-CFP pre-mRNA transcripts in cells. The present invention further relates to conjugates, salts and pharmaceutical compositions thereof, and methods for the treatment of diseases associated with increased levels of ELK1-CFP pre-mRNA transcripts, including amyotrophic lateral sclerosis.

Background Art

[0002] Background TAR DNA-binding protein 43 (TDP-43) is encoded by TARDBP and plays a role in transcriptional repression, pre-mRNA splicing and translational regulation. This also includes polyadenylation of RNA transcripts. Thus, by removing or decreasing the expression of TDP-43, the poly(A) tail can be excluded from the pre-mRNA transcript.

[0003] TDP-43 depletion is shown in various diseases called TDP-43 pathologies, including, for example, amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), progressive supranuclear palsy (PSP), primary lateral sclerosis, progressive muscular atrophy, Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine diseases such as spinocerebellar ataxia type 3, myopathy and chronic traumatic encephalopathy.

[0004] ALS, also known as motor neuron disease or Lou Gehrig's disease, is a neurodegenerative disorder that results in the progressive loss of motor neurons in the brain and spinal cord. Mutations in TARDBP are associated with ALS, similar to mutations in the C9orf72, SOD1, and FUS genes (Edgar et al. 2021, Neurobiol Aging, 108). Currently, there is no known cure for ALS, which can affect individuals of any age. It can occur in families with a disease history or sporadically in individuals without a family history of the disease. Typical treatments include forms of assisted ventilation, which can extend the lifespan of the individual but do not cure the disease. Currently available drugs, such as riluzole (US Patent No. 5,527,81), similarly do not provide a cure and can only extend lifespan for a short period.

[0005] The present invention aims to devise a new treatment for neurodegenerative disorders such as ALS.

[0006] The CFP gene encodes properdin, a plasma glycoprotein that plays a role in the activation of the complement system of the innate immune system. The expression of CFP triggers the complement cascade and is typically expressed only in the liver. Properdin enables the formation of stable C3 and C5 convertase attack complexes through binding to the human cell membrane. Subsequently, the formation of the attack complex can lead to the lysis of dead cells. Overexpression of CFP in other locations in the body may be associated with neurodegenerative diseases. In particular, increased complement activation in the central nervous system is associated with neurodegenerative diseases including amyotrophic lateral sclerosis (ALS) (Kjaeldgaard et al. 2018, Mol. Immunol. 102).

[0007] The present invention seeks to provide an antisense oligonucleotide that improves the effect of TDP-43 depletion by targeting CFP. Summary of the Invention

[0008] Summary of the Invention The present invention relates to antisense oligonucleotides that are complementary to the transcribed human CFP-ELK1 intergenic region.

[0009] The ELK1 gene encodes an ETS Like-1 protein that functions as a transcriptional activator. This is adjacent to the complement factor properdin gene (CFP). The inventors have surprisingly determined that the absence of TDP-43 causes the removal of the poly(A) tail of the ELK1 pre-mRNA transcript. This then results in the transcription of ELK1, followed by the adjacent CFP gene, and the transcription of a single combined pre-mRNA ELK1-CFP transcript. This transcript contains mRNA transcribed from both genes and the intergenic region between them.

[0010] The combined pre-mRNA ELK1-CFP transcript was expected to undergo nonsense-mediated (NMD) decay due to the presence of exon-exon splice junctions more than 50 bases downstream of the stop codon. However, the inventors have surprisingly determined that this does not always occur and instead can lead to an increase in CFP expression.

[0011] Since properdin protein can be translated from the combined ELK1-CFP transcript, the absence or reduced level of TDP-43 can lead to an increase in CFP expression in the brain. In this way, the absence or reduced level of TDP-43 is associated with neurodegenerative diseases including ALS. The object of the present invention is to provide antisense oligonucleotides that improve the effect of TDP-43 depletion by targeting the ELK1-CFP intergenic region.

[0012] The present invention provides antisense oligonucleotides that are complementary to the ELK1-CFP intergenic region. These antisense oligonucleotides may be capable of reducing the level of ELK1-CFP pre-mRNA in cells.

[0013] The antisense oligonucleotide of the present invention can reduce the level of ELK1-CFP pre-mRNA by binding to the ELK1-CFP pre-mRNA.

[0014] The antisense oligonucleotide of the present invention is thought to bind to the post-transcriptional ELK1-CFP pre-mRNA and recruit RNase H1, resulting in the cleavage of the ELK1-CFP pre-mRNA. The cleaved ELK1-CFP pre-mRNA transcript is thought to be degraded. Therefore, the level of the ELK1-CFP pre-mRNA transcript in cells is reduced.

[0015] Therefore, the antisense oligonucleotide of the present invention can be used to remove or reduce the level of ELK1-CFP pre-mRNA in cells.

[0016] In one aspect, the present invention provides an antisense oligonucleotide having a continuous nucleotide sequence of at least 8 nucleotides in length and being 8 to 40 nucleotides in length and complementary to the transcribed human CFP-ELK1 intergenic region.

[0017] In some embodiments, the antisense oligonucleotide complementary to the transcribed human CFP-ELK1 intergenic region may comprise a continuous nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or completely complementary to the transcribed human ELK1-CFP intergenic region.

[0018] In some embodiments, the transcribed human ELK1-CFP intergenic region is within the human ELK1-CFP pre-mRNA transcript.

[0019] In some embodiments, the continuous nucleotide sequence is 8 to 40 nucleotides in length.

[0020] In some embodiments, the antisense oligonucleotide is single-stranded.

[0021] In some embodiments, the antisense oligonucleotide comprises one or more modified nucleosides.

[0022] In some embodiments, the antisense oligonucleotide is capable of recruiting RNase H1.

[0023] In some embodiments, the antisense oligonucleotide is a gapmer.

[0024] In some embodiments, the antisense oligonucleotide may comprise at least one modified internucleoside linkage.

[0025] In some embodiments, one or more, or all, of the modified internucleoside linkages may comprise phosphorothioate linkages.

[0026] In some embodiments, all of the internucleoside linkages present within the antisense oligonucleotide may be phosphorothioate internucleoside linkages.

[0027] In some embodiments, the antisense oligonucleotide can reduce the level of ELK1-CFP pre-mRNA transcript in cells by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% as compared to a control.

[0028] In some embodiments, the control can be cells not exposed to the antisense oligonucleotide.

[0029] In some embodiments, the antisense oligonucleotide may be covalently attached to at least one conjugate moiety.

[0030] In some embodiments, the antisense oligonucleotide can be in the form of a pharmaceutically acceptable salt.

[0031] In some embodiments, the salt can be a sodium salt or a potassium salt.

[0032] In some embodiments, the antisense oligonucleotide may be encapsulated in a lipid-based delivery vehicle, may be covalently linked or encapsulated in a dendrimer, or may be conjugated to an aptamer.

[0033] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant.

[0034] In some embodiments, the pharmaceutical composition may contain an aqueous diluent or solvent, such as phosphate-buffered saline.

[0035] The present invention provides an in vivo or in vitro method for reducing the level of ELK1-CFP pre-mRNA transcript in cells that transcribe ELK1-CFP pre-mRNA, the method comprising exposing the cells to an effective amount of the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention.

[0036] In some embodiments, the cell can be either a human cell or a mammalian cell.

[0037] In some embodiments, the level of human ELK1-CFP pre-mRNA transcript can be reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% compared to a control.

[0038] In some embodiments, the control is a cell that has not been exposed to the antisense oligonucleotide.

[0039] The invention also provides a method of treating or preventing a disease, the method comprising administering a therapeutically effective amount or a prophylactically effective amount of the antisense oligonucleotide of the invention, or a pharmaceutical composition of the invention, to a subject suffering from or susceptible to the disease.

[0040] The invention also provides an antisense oligonucleotide of the invention, or a pharmaceutical composition of the invention, for use as a medicament for treating or preventing a disease in a subject.

[0041] The invention also provides the use of an antisense oligonucleotide of the invention, or a pharmaceutical composition of the invention, for the preparation of a medicament for treating or preventing a disease in a subject.

[0042] In some embodiments, the disease may be associated with an increased level of the human ELK1-CFP pre-mRNA transcript.

[0043] In some embodiments, the disease may be amyotrophic lateral sclerosis (ALS). BRIEF DESCRIPTION OF THE DRAWINGS

[0044]

Figure 1

Figure 2

Figure 3

[0045] DETAILED DESCRIPTION OF THE INVENTION The present invention is based on the determination that in TDP-43 depleted cells, transcription of the ELK1 gene follows the adjacent CFP gene, resulting in a single combined pre-mRNA ELK1-CFP transcript. This transcript contains mRNA transcribed from both genes and the intergenic region between them.

[0046] The inventors have identified that by targeting the ELK1-CFP pre-mRNA with antisense oligonucleotides, the level of the ELK1-CFP pre-mRNA transcript can be reduced. This can reduce CFP expression in the brain, which can be used to treat neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS).

[0047] Described herein are target sites present in the human ELK1-CFP pre-mRNA transcript that can be targeted by antisense oligonucleotides. In some embodiments, the antisense oligonucleotide may be capable of reducing the level of the ELK1-CFP pre-mRNA transcript.

[0048] The inventors have surprisingly determined that targeting the intergenic region of the human ELK1-CFP pre-mRNA transcript can be particularly effective in reducing CFP expression, for example, in the brain.

[0049] Although not wishing to be bound by theory, it is believed that the antisense oligonucleotides of the present invention can reduce the level of ELK1-CFP pre-mRNA transcripts by binding to the ELK1-CFP pre-mRNA transcripts. Binding of the antisense oligonucleotides of the present invention to the intergenic region of the ELK1-CFP pre-mRNA transcript results in the recruitment of RNase H1 to the ELK1-CFP pre-mRNA transcript, which is believed to result in cleavage of the ELK1-CFP pre-mRNA transcript and subsequent degradation of the cleaved pre-mRNA. Thus, the level of the ELK1-CFP pre-mRNA transcript is reduced, and thus the expression of CFP is reduced. The reduction in CFP expression can occur in the brain or elsewhere.

[0050] A decrease in the levels of ELK1-CFP pre-mRNA transcripts and CFP expression is desirable for treating a series of disorders characterized by or caused by increased CFP expression in the brain. These include amyotrophic lateral sclerosis (ALS).

[0051] Antisense oligonucleotide As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of modulating the level of a target mRNA transcript by hybridizing to a target nucleic acid, particularly a contiguous sequence on the target nucleic acid. As used herein, the term "oligonucleotide" is defined as a molecule containing nucleosides linked by two or more covalent bonds that are complementary to the nucleotides of the mRNA target, as generally understood by those skilled in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers.

[0052] Antisense oligonucleotides are generally not double-stranded and are thus neither siRNA nor shRNA.

[0053] Antisense oligonucleotides are typically made in the laboratory by solid-phase chemical synthesis followed by purification and isolation. When referring to the sequence of an antisense oligonucleotide, reference is made to the sequence or order of the nucleobase portions of the nucleotides or nucleosides linked by covalent bonds, or to their modifications. The antisense oligonucleotides of the present invention are artificial, chemically synthesized, and typically purified or isolated. The antisense oligonucleotides of the present invention may include one or more modified nucleosides such as 2'-sugar modified nucleosides. The antisense oligonucleotides of the present invention may include one or more internucleotide linkages between modified nucleosides such as one or more phosphorothioate internucleosides.

[0054] In some embodiments, the antisense oligonucleotides of the present invention are single-stranded antisense oligonucleotides. The single-stranded antisense oligonucleotides of the present invention are understood to be capable of forming hairpin or intermolecular duplex structures (duplexes between two molecules of the same antisense oligonucleotide) as long as the degree of complementarity within or between themselves is less than approximately 50% over the entire length of the antisense oligonucleotide.

[0055] In some embodiments, the single-stranded antisense oligonucleotides of the present invention may not contain RNA nucleosides.

[0056] Advantageously, the antisense oligonucleotides of the present invention include one or more modified nucleosides or nucleotides, such as 2'-sugar modified nucleosides. Furthermore, in some antisense oligonucleotides of the present invention, it may be advantageous for the unmodified nucleosides to be DNA nucleosides.

[0057] In some embodiments, the antisense oligonucleotides of the present invention are 8 to 40 nucleotides in length.

[0058] In some embodiments, the antisense oligonucleotides of the present invention are 8 to 40 nucleotides in length and contain a continuous nucleotide sequence of at least 40 nucleotides, for example 8 to 40 nucleotides.

[0059] In some embodiments, the antisense oligonucleotides of the present invention are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

[0060] In some embodiments, the antisense oligonucleotides of the present invention are at least 12 nucleotides in length.

[0061] In some embodiments, the antisense oligonucleotides of the present invention are at least 14 nucleotides in length.

[0062] In some embodiments, the antisense oligonucleotides of the present invention are at least 16 nucleotides in length.

[0063] In some embodiments, the antisense oligonucleotides of the present invention are at least 18 nucleotides in length.

[0064] Preferably, the antisense oligonucleotides of the present invention are 16 to 20 nucleotides in length.

[0065] More preferably, the antisense oligonucleotides of the present invention are 18 to 20 nucleotides in length.

[0066] In some embodiments, the continuous nucleotide sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

[0067] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence.

[0068] In some embodiments, the antisense oligonucleotide consists of a contiguous nucleotide sequence.

[0069] In some embodiments, the antisense oligonucleotide is a contiguous nucleotide sequence.

[0070] Modified antisense oligonucleotide The antisense oligonucleotide according to the present invention can be a modified antisense oligonucleotide.

[0071] The term "modified antisense oligonucleotide" refers to an antisense oligonucleotide that includes one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term "chimeric oligonucleotide" is a term used in the literature to describe an antisense oligonucleotide that includes sugar-modified nucleosides and DNA nucleosides. In some embodiments, it may be advantageous for the antisense oligonucleotide according to the present invention to be a chimeric antisense oligonucleotide.

[0072] In some embodiments, the antisense oligonucleotide according to the present invention or its contiguous nucleotide sequence may include a modified nucleic acid base that functions as a typical nucleic acid base in base pairing. For example, 5-methylcytosine can be used instead of methylcytosine. Inosine can be used as a universal base.

[0073] It is understood that the contiguous nucleic acid base sequence (motif sequence) can be modified, for example, to increase nuclease resistance and / or binding affinity for the target nucleic acid.

[0074] The pattern in which modified nucleosides (such as high-affinity modified nucleosides) are incorporated into an antisense oligonucleotide sequence is generally referred to as antisense oligonucleotide design.

[0075] In one embodiment, the antisense oligonucleotide according to the present invention comprises at least 1 modified nucleoside, for example at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 modified nucleosides.

[0076] In some embodiments, all nucleosides of the antisense oligonucleotide can be modified nucleosides.

[0077] Suitable modifications are described herein under the headings "Modified Nucleosides", "High-Affinity Modified Nucleosides", "Sugar Modifications", "2'-Sugar Modifications" and "Locked Nucleic Acids (LNAs)".

[0078] Gapmer A gapmer is a short DNA antisense oligonucleotide having RNA mimicking segments at both ends of a central DNA region. The gapmer binds to a pre-mRNA transcript containing a sequence complementary to the sequence of the gapmer DNA, and the RNA mimicking segments ensure high binding affinity. The high binding affinity ensures a reduction in off-target effects, but hybridization between the gapmer and the pre-mRNA can prevent complete transcription of the pre-mRNA by RNA polymerase.

[0079] The gapmer also induces cleavage of pre-mRNA transcripts by recruiting RNase H, which cleaves RNA-DNA hybrids. Gapmers can be engineered to have increased nuclease resistance, decreased immunogenicity, and decreased toxicity, particularly through the use of locked nucleic acids. The pre-mRNA cleaved by RNase H is then degraded, preventing translation of the gapmer-targeted transcript. Thus, gapmers can be used as therapeutic agents to limit pre-mRNA levels of genes whose overexpression can cause or contribute to disease and negative patient outcomes. Accordingly, gapmers can be engineered and synthesized to target specific pre-mRNA transcripts in order to treat or prevent diseases caused by overexpression of a specified gene.

[0080] In some embodiments, the antisense oligonucleotides of the invention are gapmers.

[0081] As used herein, the term “gapmer” refers to an antisense oligonucleotide that includes a region (the gap) of an RNase H-recruiting oligonucleotide flanked 5′ and 3′ by one or more affinity-enhancing modified nucleosides (flanks). A variety of gapmer designs are described herein.

[0082] A headmer and a tailmer are antisense oligonucleotides that can recruit RNase H in which one of the flanks is missing, i.e., only one of the ends of the antisense oligonucleotide contains an affinity-enhancing modified nucleoside. In a headmer, the 3′ flank is missing (i.e., the 5′ flank contains the affinity-enhancing modified nucleoside), and in a tailmer, the 5′ flank is missing (i.e., the 3′ flank contains the affinity-enhancing modified nucleoside).

[0083] Within the scope of the invention, an antisense oligonucleotide can be a headmer or a tailmer.

[0084] The term "LNA gapmer" refers to a gapmer antisense oligonucleotide in which at least one affinity-enhancing modified nucleoside is an LNA nucleoside. Within the scope of the present invention, an antisense oligonucleotide can be an LNA gapmer.

[0085] The term "mixed wing gapmer" refers to an LNA gapmer in which the flank region contains at least one LNA nucleoside and at least one non-LNA modified nucleoside, for example, at least one 2'-substituted modified nucleoside, such as 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, the mixed wing gapmer has one flank (e.g., 5' or 3') containing LNA nucleosides and the other flank (3' or 5', respectively) containing 2'-substituted modified nucleosides. Within the scope of the present invention, an antisense oligonucleotide can be a mixed wing gapmer.

[0086] Design of Gapmers In a preferred embodiment, the antisense oligonucleotides of the present invention have a gapmer design or structure, also simply referred to herein as a "gapmer".

[0087] In a gapmer structure, the antisense oligonucleotide comprises at least three distinct structural regions: a 5'-flank, a gap, and a 3'-flank, i.e., F-G-F', in the 5'->3' direction. In this design, the adjacent regions F and F' (also called the wing regions) contain a continuous stretch of modified nucleosides that are complementary to the intergenic region of the ELK1-CFP pre-mRNA transcript target nucleic acid, while the gap region G contains a continuous stretch of nucleotides that enables the antisense oligonucleotide to recruit a nuclease, preferably an endonuclease such as RNase, for example RNase H, when the antisense oligonucleotide is duplexed with the target nucleic acid. Nucleosides that are capable of recruiting a nuclease, particularly RNase H, can be selected from the group consisting of DNA, alpha-L-oxy-LNA, 2'-fluoro-ANA, and UNA.

[0088] The regions F and F' adjacent to the 5'- and 3'-ends of the region G preferably contain non-nuclease-recruiting nucleosides (nucleosides having a 3'-end structure), more preferably one or more affinity-enhancing modified nucleosides.

[0089] In some embodiments, the 3'-flank contains at least one LNA nucleoside, preferably at least two LNA nucleosides. In some embodiments, the 5'-flank contains at least one LNA nucleoside, preferably at least two LNA nucleosides. In some embodiments, both the 5'-adjacent region and the 3'-adjacent region contain LNA nucleosides, preferably at least two LNA nucleosides. In some embodiments, all of the nucleosides in the adjacent regions are LNA nucleosides.

[0090] In other embodiments, the adjacent regions may contain both LNA nucleosides and other nucleosides (mixed flanks), such as DNA nucleosides and / or non-LNA modified nucleosides, such as 2'-substituted nucleosides. In this case, the gap is defined as a continuous sequence of at least five RNase H recruiting nucleosides (nucleosides having a 2'-end structure, preferably DNA) flanked by LNA, such as beta-D-oxy-LNA, at the 5' and 3' termini of an affinity enhancing modified nucleoside. As a result, the nucleosides of the 5' adjacent region and the 3' adjacent region proximal to the gap region are modified nucleosides, preferably non-nuclease recruiting nucleosides. In antisense oligonucleotides having mixed flanks containing DNA, the 5' and 3' nucleosides are modified nucleosides.

[0091] Nucleotides and Nucleosides Nucleotides and nucleosides are the building blocks of antisense oligonucleotides and polynucleotides and, for the purposes of the present invention, include both naturally occurring nucleotides and nucleosides and non-naturally occurring nucleotides and nucleosides. By nature, nucleotides such as DNA nucleotides and RNA nucleotides include a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers".

[0092] Modified Nucleosides The term "modified nucleoside" or "nucleoside modification" as used herein refers to a nucleoside modified by the introduction of one or more modifications to the sugar moiety or the (nucleic acid) base moiety as compared to an equivalent DNA or RNA nucleoside.

[0093] Advantageously, the antisense oligonucleotides according to the invention may contain one or more modified nucleosides.

[0094] In some embodiments, the continuous nucleic acid base sequence (motif sequence) can be modified, for example, to increase nuclease resistance and / or binding affinity for the target nucleic acid. Advantageously, highly affinity modified nucleosides are used.

[0095] Advantageously, one or more of the modified nucleosides of the antisense oligonucleotides according to the invention may comprise a modified sugar moiety. The term modified nucleoside may also be used interchangeably herein with the terms "nucleoside analogue" or modified "unit" or modified "monomer". Nucleosides having unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. Nucleosides having modifications in the base region of DNA or RNA nucleosides are still generally referred to as DNA or RNA if they are capable of Watson-Crick base pairing. Exemplary modified nucleosides that can be used in the antisense oligonucleotides according to the invention include LNA, 2'-O-MOE, 2'oMe and morpholino nucleoside analogues.

[0096] Locked nucleic acid nucleoside (LNA nucleoside) An "LNA nucleoside" is a 2'-modified nucleoside that contains a biradical (also referred to as a "2'-4' bridge") that links the C2' and C4' of the ribose sugar ring of the nucleoside, which sterically restricts or locks the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). The locking of the ribose steric structure is associated with an improvement in hybridization affinity (stabilization of the double strand) when LNA is incorporated into the antisense oligonucleotide of a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the antisense oligonucleotide / complementary double strand.

[0097] Non-limiting and exemplary LNA nucleosides are those of International Publication No. WO 99 / 014226, International Publication No. WO 00 / 66604, International Publication No. WO 98 / 039352, International Publication No. WO 2004 / 046160, International Publication No. WO 00 / 047599, International Publication No. WO 2007 / 134181, International Publication No. WO 2010 / 077578, International Publication No. WO 2010 / 036698, International Publication No. WO 2007 / 090071, International Publication No. WO 2009 / 006478, International Publication No. WO 2011 / 156202, International Publication No. WO 2008 / 154401, International Publication No. WO 2009 / 067647, International Publication No. WO 2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667, all of which are incorporated herein by reference in their entirety.

[0098] Additional non-limiting and exemplary LNA nucleosides are disclosed in Scheme 1. Scheme 1:

Chemical formula

[0099] Certain LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy LNA, such as (S)-6'-methyl-β-D-oxy-LNA (ScET) and ENA.

[0100] Particularly advantageous LNA is β-D-oxy-LNA.

[0101] Modified nucleoside linkages Advantageously, the antisense oligonucleotides according to the invention comprise one or more modified nucleoside linkages.

[0102] The term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) linkage that covalently conjugates two nucleosides together, as commonly understood by those skilled in the art. Thus, the antisense oligonucleotides of the present invention may include one or more modified internucleoside linkages such as one or more phosphorothioate internucleoside linkages.

[0103] In some embodiments, at least 50%, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 90% or more, of the internucleoside linkages in the antisense oligonucleotide according to the present invention, or in its contiguous nucleotide sequence, are phosphorothioates. In some embodiments, all of the internucleoside linkages in the antisense oligonucleotide of the present invention, or in its contiguous nucleotide sequence, are phosphorothioates.

[0104] In a further embodiment, the antisense oligonucleotide according to the present invention includes at least one modified internucleoside linkage. It is advantageous if at least 75%, such as all, of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages.

[0105] Advantageously, all of the internucleoside linkages in the contiguous nucleotide sequence of the antisense oligonucleotide according to the present invention may be phosphorothioates, or all of the internucleoside linkages of the antisense oligonucleotide according to the present invention may be phosphorothioate linkages.

[0106] Nucleobase The term "nucleobase" includes the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term "nucleobase" may differ from naturally occurring nucleobases, but also includes modified nucleobases that are functional during nucleic acid hybridization. In this context, "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl.37 1.4.1.

[0107] In some embodiments, the nucleobase moiety is modified by changing it to a nucleobase selected from modified purines or pyrimidines, such as substituted purines or substituted pyrimidines, such as isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0108] The nucleobase moiety may be represented by a character code for each corresponding nucleobase, for example, A, T, G, C, or U, and each character may optionally include a modified nucleobase of equivalent function. For example, in the exemplified antisense oligonucleotide, the nucleobase moiety is selected from A, T, G, C, and 5-methylcytosine. Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides may be used. 5-Methylcytosine may sometimes be denoted as "E".

[0109] High-affinity modified nucleoside A "high-affinity modified nucleoside" is a modified nucleoside that, when incorporated into an antisense oligonucleotide, enhances the affinity of the antisense oligonucleotide for its complementary target, as measured by, for example, the melting temperature (Tm). The high-affinity modified nucleosides of the present invention preferably result in an increase in melting temperature of +0.5 to +12 °C, more preferably +1.5 to +10 °C, and most preferably +3 to +8 °C per modified nucleoside. A number of high-affinity modified nucleosides are known in the art, including, for example, many 2'-substituted nucleosides and locked nucleic acids (LNA) (see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 203-213).

[0110] Sugar modification The antisense oligonucleotides according to the present invention may include one or more nucleosides having a modified sugar moiety, i.e., a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.

[0111] A number of nucleosides having a modification of the ribose sugar moiety have been made primarily for the purpose of improving certain properties of antisense oligonucleotides, such as affinity and / or nuclease resistance.

[0112] Such modifications include, for example, hexose rings (HNA), or typically bicyclic rings (LNA) having a biradicle bridge between the C2 and C4 carbons of the ribose ring, or typically unlinked ribose rings lacking a bond between the C2 and C3 carbons (e.g., UNA), in which the ribose ring structure is modified by replacement. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (International Publication No. WO 2011 / 017521) or tricyclic nucleic acids (International Publication No. WO 2013 / 154798). Modified nucleosides also include, for example, in the case of peptide nucleic acids (PNA) or morpholino nucleic acids, nucleosides in which the sugar moiety is replaced by a non-sugar moiety.

[0113] Sugar modifications also include modifications made by changing a substituent on the ribose ring to a group other than hydrogen, or by changing the 2'-OH group naturally present in DNA and RNA nucleosides. The substituent can be introduced, for example, at the 2', 3', 4', or 5' position.

[0114] 2'-sugar modified nucleoside A 2'-sugar modified nucleoside is a nucleoside having a substituent other than H or -OH at the 2' position (2'-substituted nucleoside), or a nucleoside containing a 2'-linked biradical capable of forming a bridge between the 2' carbon of the ribose ring and a second carbon, for example, an LNA (2'-4' biradical bridge) nucleoside.

[0115] In fact, the development of 2'-sugar substituted nucleosides has attracted much attention, and a number of 2'-substituted nucleosides have been found to have beneficial properties when incorporated into antisense oligonucleotides. For example, 2'-modified sugars can confer enhanced binding affinity and / or increased nuclease resistance to antisense oligonucleotides. Examples of 2'-substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA (2'oMe), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 203-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. The following are examples of some 2'-substituted modified nucleosides. [Chemical formula]

[0116] With respect to the present invention, 2'-substituted sugar-modified nucleosides do not include 2'-bridged nucleosides such as LNA.

[0117] In one embodiment, an antisense oligonucleotide according to the present invention comprises one or more sugar-modified nucleosides, such as 2'-sugar-modified nucleosides. Preferably, the antisense oligonucleotide according to the present invention comprises one or more 2'-sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA (2'oMe), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (2'MOE), 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides. It is advantageous if one or more of the modified nucleosides are locked nucleic acids (LNA).

[0118] Morpholino oligonucleotide In some embodiments, the antisense oligonucleotides of the invention comprise or consist of morpholino nucleosides (i.e., are morpholino oligomers, such as phosphorodiamidate morpholino oligomers (PMOs)). Morpholino antisense oligonucleotides that modulate splicing are approved for clinical use and are, for example, the 30 nt morpholino oligonucleotide targeting a frameshift mutation in DMD, eteplirsen, which is used to treat Duchenne muscular dystrophy. See, e.g., the following illustration of four consecutive morpholino nucleotides, a nuclease having a six-membered morpholine ring attached instead of ribose, such as a methylene morpholine ring linked via a phosphorodiamidate group.

Chemical formula

[0119] In some embodiments, the antisense oligonucleotides according to the invention can be morpholinos, for example 8 to 40 nucleotides in length, for example 16 to 20 nucleotides in length, for example 18 to 20 nucleotides in length.

[0120] Linker A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. The conjugate moiety can be attached to the antisense oligonucleotide directly or via a linking moiety (e.g., a linker or tether). The linker serves to covalently connect a third region, e.g., a conjugate moiety (region C), to a first region, e.g., an antisense oligonucleotide or contiguous nucleotide sequence (region A) that is complementary to the target nucleic acid.

[0121] In some embodiments of the present invention, the conjugate or antisense oligonucleotide of the present invention optionally comprises a linker region (second region or region B and / or region Y) located between an antisense oligonucleotide or contiguous nucleotide sequence (region A or first region) complementary to the target nucleic acid and a conjugate moiety (region C or third region).

[0122] Region B refers to a biodegradable linker that comprises, or consists of, a physiologically labile linkage that is cleavable under conditions normally encountered, or similar to those encountered, in the mammalian body. Conditions under which the physiologically labile linker undergoes chemical transformation (e.g., cleavage) include pH, temperature, oxidative or reductive conditions or chemical conditions such as oxidizing or reducing agents, and salt concentrations found in, or similar to those encountered in, mammalian cells. Intracellular conditions in mammalian cells also include the presence of enzyme activities normally present in mammalian cells such as proteolytic, hydrolytic or nuclease enzymes. In one embodiment, the biodegradable linker is susceptible to S1 nuclease cleavage. In some embodiments, the nuclease-sensitive linker comprises 1 to 5 nucleosides such as DNA nucleosides comprising at least two contiguous phosphodiester linkages. Biodegradable linkers containing phosphodiesters are described in more detail in WO 2014 / 076195.

[0123] Region Y refers to a linker that is not necessarily biocleavable but mainly serves to covalently connect the conjugate moiety (region C or the third region) to the antisense oligonucleotide (region A or the first region). The linker of region Y may include a chain structure or oligomer of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups. The antisense oligonucleotide of the present invention can be constructed from the following local elements A-C, A-B-C, A-B-Y-C, A-Y-B-C, or A-Y-C. In some embodiments, the linker (region Y) is an aminoalkyl such as a C2-C36 aminoalkyl group including, for example, a C6-C12 aminoalkyl group. In some embodiments, the linker (region Y) is a C6 aminoalkyl group.

[0124] Target The antisense oligonucleotide of the present invention is an oligonucleotide that targets the ELK1-CFP pre-mRNA transcript.

[0125] The antisense oligonucleotide of the present invention includes a continuous nucleotide sequence that is complementary to the transcribed human CFP-ELK1 intergenic region.

[0126] In some embodiments, the target sequence is the human ELK1-CFP pre-mRNA transcript.

[0127] The human ELK1-CFP pre-mRNA transcript may be referred to as the target sequence.

[0128] In some embodiments, the target sequence is the human ELK1-CFP pre-mRNA transcript that may be encoded by SEQ ID NO: 1, or a fragment thereof.

[0129] One aspect of the present invention relates to an antisense oligonucleotide comprising a continuous nucleotide sequence 8 to 40 nucleotides in length that is complementary to SEQ ID NO: 1, or a fragment thereof.

[0130] In one embodiment, the fragment can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0131] In some embodiments, the antisense oligonucleotides of the invention comprise a continuous sequence that is at least about 75% complementary to SEQ ID NO:1, such as at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or about 100% complementary, or a fragment thereof.

[0132] In some embodiments, the antisense oligonucleotides of the invention comprise a continuous sequence (i.e., the intergenic region between the human CFP-ELK1 genes) that can contain one or two mismatches between the continuous nucleotide sequence and the target nucleic acid.

[0133] In a preferred embodiment, the antisense oligonucleotide of the invention, or a continuous nucleotide sequence thereof, is completely complementary (i.e., about 100% complementary) to SEQ ID NO:1.

[0134] Aspects of the present invention refer to an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186 and SEQ ID NO: 187, or a continuous nucleotide sequence of 8 to 40 nucleotides in length that is complementary to a fragment thereof.

[0135] In one embodiment, the antisense oligonucleotide can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

[0136] In some embodiments, the antisense oligonucleotides of the present invention are at least about 75% complementary to a sequence selected from the group consisting of SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186 and SEQ ID NO: 187, or a fragment thereof, for example at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%,Comprising a continuous sequence that is at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or about 100% complementary.

[0137] In a preferred embodiment, the antisense oligonucleotide of the present invention, or a continuous nucleotide sequence thereof, is completely complementary (100% complementary) to a sequence selected from the group consisting of SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186 and SEQ ID NO: 187, or a fragment thereof.

[0138] In some embodiments, the antisense oligonucleotide of the present invention, or its contiguous nucleotide sequence, can reduce the expression of CFP to at least the level of untreated cells (100%).

[0139] In some embodiments, the antisense oligonucleotides of the invention are at least about 75% complementary, e.g., at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or about 100% complementary to a sequence selected from the group consisting of SEQ ID NO: 98, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 186, and SEQ ID NO: 187, or a fragment thereof, and include a continuous sequence that is complementary.

[0140] In a preferred embodiment, the antisense oligonucleotide of the present invention, or a continuous nucleotide sequence thereof, is completely complementary (100% complementary) to a sequence selected from the group consisting of SEQ ID NO: 98, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 186 and SEQ ID NO: 187, or a fragment thereof.

[0141] In some embodiments, the antisense oligonucleotide of the present invention, or a continuous nucleotide sequence thereof, can reduce the expression of CFP to up to 10% of the level in untreated cells.

[0142] In some embodiments, the antisense oligonucleotides of the present invention are at least about 75% complementary, such as at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or about 100% complementary to a sequence selected from the group consisting of SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 145, SEQ ID NO: 154, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 168, SEQ ID NO: 169, and SEQ ID NO: 172, or a fragment thereof, and include a continuous sequence.

[0143] In a preferred embodiment, the antisense oligonucleotide of the present invention, or a continuous nucleotide sequence thereof, is completely complementary (100% complementary) to a sequence selected from the group consisting of SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 145, SEQ ID NO: 154, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 168, SEQ ID NO: 169, and SEQ ID NO: 172, or a fragment thereof.

[0144] Antisense Oligonucleotide Design The antisense oligonucleotide of the present invention is an antisense oligonucleotide comprising a continuous nucleotide sequence of at least 8 nucleotides in length that is complementary to the transcribed human CFP-ELK1 intergenic region. The antisense oligonucleotide may be capable of reducing the level of ELK1-CFP pre-mRNA transcript in cells.

[0145] In some embodiments, the antisense oligonucleotide comprises a continuous nucleotide sequence and optionally further comprises a nucleotide linker region that can be used to attach additional nucleotides, such as functional groups (e.g., conjugate groups), to the continuous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. It is understood that the continuous nucleotide sequence of the antisense oligonucleotide cannot be longer than the antisense oligonucleotide itself and that the antisense oligonucleotide cannot be shorter than the continuous nucleotide sequence.

[0146] Continuous nucleotide sequence The term "continuous nucleotide sequence" refers to a region of an antisense oligonucleotide that can be or includes an antisense oligonucleotide motif sequence and is complementary to a target nucleic acid. This term is used interchangeably herein with the term "continuous nucleic acid base sequence".

[0147] The antisense oligonucleotide comprises a continuous nucleotide sequence and optionally further comprises a nucleotide linker region that can be used to attach additional nucleotides, such as functional groups (e.g., conjugate groups), to the continuous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.

[0148] It is understood that the continuous nucleotide sequence of the antisense oligonucleotide cannot be longer than the antisense oligonucleotide itself, and the antisense oligonucleotide cannot be shorter than the continuous nucleotide sequence.

[0149] In some embodiments, the entire nucleotide sequence of the antisense oligonucleotide of the present invention is a continuous nucleotide sequence.

[0150] The continuous nucleotide sequence is the nucleotide sequence in the antisense oligonucleotide of the present invention that is complementary to the target nucleic acid, target sequence, or target site sequence, and in some cases is completely complementary.

[0151] In some embodiments, the continuous nucleotide sequence is 8 to 40 nucleotides in length.

[0152] In some embodiments, the continuous nucleotide sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.

[0153] In some embodiments, the continuous nucleotide sequence is at least 12 nucleotides in length.

[0154] In some embodiments, the continuous nucleotide sequence is at least 14 nucleotides in length.

[0155] In some embodiments, the continuous nucleotide sequence is at least 16 nucleotides in length.

[0156] In some embodiments, the continuous nucleotide sequence is at least 18 nucleotides in length.

[0157] In preferred embodiments, the continuous nucleotide sequence is 16 to 20 nucleotides in length.

[0158] More preferably, the continuous nucleotide sequence is 18 to 20 nucleotides in length.

[0159] In some embodiments, the antisense oligonucleotide of the present invention consists of a continuous nucleotide sequence.

[0160] In some embodiments, the antisense oligonucleotide of the present invention is a continuous nucleotide sequence.

[0161] In some embodiments, the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93 and SEQ ID NO: 94, or a fragment thereof.

[0162] In some embodiments, the antisense oligonucleotide of the invention, or a continuous nucleotide sequence thereof, can reduce the expression of CFP to at least the level of untreated cells (100%).

[0163] In preferred embodiments, the continuous nucleotide sequence comprises a sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:93 and SEQ ID NO:94, or a fragment thereof.

[0164] In some embodiments, the antisense oligonucleotide of the invention, or a continuous nucleotide sequence thereof, can reduce the expression of CFP to 10% of the level of untreated cells.

[0165] In a preferred embodiment, the continuous nucleotide sequence comprises a sequence selected from the group consisting of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 75, SEQ ID NO: 76, and SEQ ID NO: 79, or a fragment thereof.

[0166] In some embodiments, the fragment can be at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 consecutive nucleotides of the continuous nucleotide sequence, preferably at least 10 consecutive nucleotides thereof.

[0167] Capable of reducing the level of ELK1-CFP pre-mRNA transcript The antisense oligonucleotides of the present invention may be capable of reducing the level of ELK1-CFP pre-mRNA transcript.

[0168] As used herein, the term "reducing the level" is to be understood as a general term for the ability of an antisense oligonucleotide to reduce the level of ELK1-CFP pre-mRNA transcript in a cell when compared to a control in which the cell has not been exposed to the antisense oligonucleotide of the present invention.

[0169] Without wishing to be bound by theory, the reduction brought about by the antisense oligonucleotide is thought to be related to its ability to reduce, eliminate, prevent, mitigate, decrease, or terminate the ELK1-CFP pre-mRNA transcript, for example, by degradation or removal of the ELK1-CFP pre-mRNA transcript, or by blocking or preventing polymerase activity associated with the ELK1-CFP pre-mRNA transcript.

[0170] In certain embodiments, the antisense oligonucleotides of the invention can reduce the level of ELK1-CFP pre-mRNA by at least about 10% compared to a control. More preferably, the antisense oligonucleotides of the invention can reduce the level of ELK1-CFP pre-mRNA by at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99% or about 100% compared to a control.

[0171] In some embodiments, the antisense oligonucleotides of the invention, or continuous nucleotide sequences thereof, can reduce the expression of CFP to at least the level of untreated cells (100%).

[0172] In some embodiments, the antisense oligonucleotides of the invention, or continuous nucleotide sequences thereof, can reduce the expression of CFP to less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, or less than 10% of the level of untreated cells.

[0173] In some embodiments, the antisense oligonucleotides of the invention, or continuous nucleotide sequences thereof, can reduce the expression of CFP to less than 10% of the level of untreated cells.

[0174] Preferably, the antisense oligonucleotides of the invention reduce the level of ELK1-CFP pre-mRNA transcripts in cells by degradation or removal of the ELK1-CFP pre-mRNA transcripts.

[0175] Control The term "control", when used with respect to measuring the effect of an antisense oligonucleotide, is generally understood to be a cell that has not been exposed to the antisense oligonucleotide.

[0176] Alternatively, the decrease in the level of the ELK1-CFP pre-mRNA transcript can be determined by reference to the level of the ELK1-CFP pre-mRNA transcript present in the cell prior to exposure to the antisense oligonucleotide.

[0177] In other embodiments, the control can be a cell treated with a non-target oligonucleotide.

[0178] In some embodiments, the control can be a mock transfection, for example, treating the cells with PBS.

[0179] Conjugate The present invention encompasses an antisense oligonucleotide of the present invention covalently bound to at least one conjugate moiety. In some embodiments, this can be referred to as a conjugate of the present invention.

[0180] The term "conjugate", as used herein, refers to an antisense oligonucleotide of the present invention covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region). The conjugate moiety may optionally be covalently linked to the antisense oligonucleotide of the present invention via a linker group such as region D' or D".

[0181] For antisense oligonucleotide conjugates and their synthesis, see the comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, which are incorporated herein by reference in their entirety.

[0182] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a carbohydrate (e.g., GalNAc), a cell surface receptor ligand, a prodrug, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0183] RNase H Activity and Recruitment The RNase H activity of an antisense oligonucleotide refers to the ability to recruit RNase H when in a duplex with a complementary RNA molecule. International Publication No. 01 / 23613 (incorporated herein by reference in its entirety) provides in vitro methods for determining RNase H activity that can be used to determine the ability to recruit RNase H.

[0184] Typically, an antisense oligonucleotide has the same nucleotide sequence as the modified antisense oligonucleotide being tested when a complementary target nucleic acid sequence is provided, but uses an oligonucleotide containing only DNA monomers having phosphorothioate linkages between all monomers in the antisense oligonucleotide, and has an initial velocity of at least 5%, for example at least 10%, at least 20% or more than 20% of the initial velocity determined when using the methodology provided by Examples 91-95 of WO 01 / 23613 (incorporated herein by reference), it is considered possible to recruit RNase H. Recombinant RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland for use in determining RNase H activity.

[0185] DNA antisense oligonucleotides are known to effectively recruit RNase H, such as gapmer antisense oligonucleotides that contain regions of DNA nucleosides flanked 5' and 3' by regions containing 2'-sugar modified nucleosides, typically high affinity 2'-sugar modified nucleosides such as 2-O-MOE and / or LNA.

[0186] Nuclease-mediated degradation In some embodiments, the antisense oligonucleotide can function via nuclease-mediated degradation of the target nucleic acid, and the antisense oligonucleotides of the invention are capable of recruiting nucleases, particularly endonucleases, preferably endoribonucleases (RNases), such as RNase H. Examples of antisense oligonucleotide designs that operate via nuclease-mediated mechanisms typically include antisense oligonucleotides that contain a region of at least 5 or 6 DNA nucleosides flanked on one or both sides by affinity-enhancing nucleosides such as gapmers, headmers and tailmers.

[0187] Complementarity The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. The Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U).

[0188] Antisense oligonucleotides may contain nucleosides with modified nucleobases. For example, 5-methylcytosine is often used in place of cytosine. Thus, it will be understood that the term complementarity encompasses Watson-Crick base pairing between unmodified and modified nucleobases (see, for example, Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl.37 1.4.1).

[0189] As used herein, the term "percent complementary" refers to the percentage (by number) of nucleotides in a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an antisense oligonucleotide) that is complementary to a reference sequence (e.g., a target sequence or sequence motif) over a contiguous nucleotide sequence. Thus, the percentage of complementarity is calculated by counting the number of aligned nucleic acid bases that are complementary (from Watson-Crick base pairs) between the two sequences (when the target sequence 5'-3' and the antisense oligonucleotide sequence from 3'-5' are aligned), dividing that number by the total number of nucleotides in the antisense oligonucleotide, and multiplying by 100. In such comparisons, nucleic acid bases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not tolerated in the calculation of percent complementarity of a contiguous nucleotide sequence. It will be understood that in determining complementarity, chemical modifications of nucleic acid bases are ignored so long as the nucleic acid base retains its functional ability to form Watson-Crick base pairs (e.g., 5'-methylcytosine is considered identical to cytosine for the purposes of calculating percent identity).

[0190] Within the scope of the present invention, the term "complementary" requires that the continuous nucleotide sequence is at least about 75% complementary, or at least about 80% complementary, or at least about 85% complementary, or at least about 90% complementary, or at least about 95% complementary to the human ELK1-CFP pre-mRNA transcript. In some embodiments, the continuous nucleotide sequence is at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% complementary to the human ELK1-CFP pre-mRNA transcript.

[0191] In other words, in some embodiments, the continuous nucleotide sequence of the antisense oligonucleotide according to the present invention may contain 1, 2, 3, 4, 5 or more mismatches, where a mismatch is a nucleotide within the continuous nucleotide sequence that does not base pair with its target.

[0192] The term "fully complementary" refers to 100% complementarity.

[0193] In some embodiments, the continuous nucleotide sequence is fully complementary to the human ELK1-CFP pre-mRNA transcript. In some embodiments, the human ELK1-CFP pre-mRNA transcript may have the sequence of SEQ ID NO: 1, or a fragment thereof.

[0194] It will be understood that the target ELK1-CFP pre-mRNA transcript can be an allelic variant of SEQ ID NO: 1, for example an allelic variant that contains one or more polymorphisms in the human ELK1-CFP pre-mRNA nucleic acid sequence.

[0195] Identity As used herein, the term "identity" refers to the percentage (expressed as a percentage) of nucleotides in a contiguous nucleotide sequence within a nucleic acid molecule (e.g., an antisense oligonucleotide) that is identical to a reference sequence (e.g., a sequence motif) over the contiguous nucleotide sequence.

[0196] Thus, the percentage of identity is calculated by counting the number of identical (matching) aligned nucleic acid bases between two sequences (in the contiguous nucleotide sequence of the compound of the invention and in the reference sequence), dividing that number by the total number of nucleotides in the antisense oligonucleotide, and multiplying by 100. Thus, the percentage of identity = (number of matches × 100) / length of the aligned region (e.g., contiguous nucleotide sequence). Insertions and deletions are not allowed in the calculation of the percentage of identity of contiguous nucleotide sequences. In determining identity, it will be understood that chemical modifications of nucleic acid bases are ignored as long as the nucleic acid base retains its functional ability to form Watson-Crick base pairs (e.g., 5'-methylcytosine is considered identical to cytosine for the purpose of calculating % identity).

[0197] Thus, it should be understood that there is a relationship between identity and complementarity such that the contiguous nucleotide sequences within the antisense oligonucleotides of the invention that are complementary to the target sequence also share a percentage of identity with the complementary sequence.

[0198] Hybridization The terms "hybridize" or "hybridizing", as used herein, are to be understood to mean that two nucleic acid strands (e.g., an antisense oligonucleotide and a target nucleic acid) form a duplex by forming hydrogen bonds between base pairs on opposing strands. The affinity of the bond between two nucleic acid strands is the strength of hybridization. This is often explained in terms of the melting temperature (Tm), which is defined as the temperature at which half of the antisense oligonucleotide forms a duplex with the target nucleic acid. Under physiological conditions, Tm is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔG° more accurately represents the binding affinity and is related to the dissociation constant (Kd) of the reaction by ΔG° = -RTln(Kd), where R is the gas constant and T is the absolute temperature. Thus, a very low ΔG° for the reaction between an antisense oligonucleotide and a target nucleic acid reflects strong hybridization between the antisense oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction where the aqueous solution concentration is 1 M, the pH is 7, and the temperature is 37°C. Hybridization of an antisense oligonucleotide to a target nucleic acid is a spontaneous reaction, and for a spontaneous reaction, ΔG° is less than zero. ΔG° can be measured experimentally, for example, by using the isothermal titration calorimetry (ITC) method described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. Those skilled in the art will know that commercially available devices are available for ΔG° measurement. ΔG° can also be estimated numerically using the nearest neighbor model described in SantaLucia, 1998, Proc Natl Acad Sci USA. 95:1460-1465, using appropriately obtained thermodynamic parameters described in Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405.

[0199] In some embodiments, the antisense oligonucleotides of the present invention hybridize to a target nucleic acid with an estimated ΔG° value of less than -10 kcal relative to an antisense oligonucleotide that is 10 to 30 nucleotides in length.

[0200] In some embodiments, the degree or strength of hybridization is measured by the Gibbs free energy ΔG° in the standard state. The antisense oligonucleotides of the present invention can hybridize to a target nucleic acid with an estimated ΔG° value less than the range of less than -10 kcal, such as less than -15 kcal, such as less than -20 kcal, and such as less than -25 kcal. In certain embodiments, the antisense oligonucleotides of the present invention have a ΔG° of less than -10 kcal, such as -10 to -60 kcal, such as -12 to -40, such as -15 to -30 kcal, or -16 to -27 kcal, such as -18 to -25 kcal, and hybridize to a subsequence of the target nucleic acid of SEQ ID NO: 1.

[0201] In some embodiments, the degree or strength of hybridization is measured by the Gibbs free energy ΔG° in the standard state. The antisense oligonucleotides of the present invention can hybridize to a target nucleic acid with an estimated ΔG° value less than the range of less than -10 kcal, such as less than -15 kcal, such as less than -20 kcal, and such as less than -25 kcal. In certain embodiments, the antisense oligonucleotides of the present invention have a ΔG° of less than -10 kcal, such as -10 to -60 kcal, such as -12 to -40, such as -15 to -30 kcal, or -16 to -27 kcal, such as -18 to -25 kcal, and hybridize to a subsequence of the target nucleic acid of SEQ ID NO: 1.

[0202] Delivery of Antisense Oligonucleotides The present invention provides an antisense oligonucleotide according to the invention, wherein the antisense oligonucleotide is encapsulated in a lipid-based delivery vehicle, covalently linked or encapsulated in a dendrimer, or conjugated to an aptamer.

[0203] This may be for the purpose of delivering the antisense oligonucleotide according to the invention to target cells and / or for improving the pharmacokinetics of the antisense oligonucleotide according to the invention.

[0204] Examples of lipid-based delivery vehicles include oil-in-water emulsions, micelles, liposomes and lipid nanoparticles.

[0205] Salt The term "salt" as used herein conforms to its generally known meaning, i.e., an ionic assembly of anions and cations.

[0206] The present invention provides a pharmaceutically acceptable salt of the antisense oligonucleotide according to the invention or of the conjugate according to the invention.

[0207] The present invention provides an antisense oligonucleotide according to the invention in the form of a pharmaceutically acceptable salt. In some embodiments, the pharmaceutically acceptable salt can be a sodium salt or a potassium salt.

[0208] The present invention provides a pharmaceutically acceptable sodium salt of the antisense oligonucleotide according to the invention.

[0209] The present invention provides a pharmaceutically acceptable potassium salt of the antisense oligonucleotide according to the invention.

[0210] Pharmaceutical composition In a further aspect, the present invention provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS), and pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts.

[0211] The present invention provides a pharmaceutical composition according to the present invention comprising the antisense oligonucleotide of the present invention and an aqueous diluent or solvent.

[0212] The present invention provides a solution such as an aqueous solution of phosphate buffered saline of the antisense oligonucleotide of the present invention. Suitably, the solution such as the aqueous solution of phosphate buffered saline of the present invention is a sterile solution.

[0213] WO 2007 / 031091 provides suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants (incorporated herein by reference). Suitable dosages, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, prodrug formulations are also provided in WO 2007 / 031091.

[0214] The oligonucleotides of the present invention can be mixed with pharmaceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on several criteria including, but not limited to, the route of administration, the degree of the disease, or the dosage administered.

[0215] In some embodiments, the antisense oligonucleotide or antisense oligonucleotide conjugate of the present invention is a prodrug. In particular, with respect to the oligonucleotide conjugate, when the prodrug is delivered to the site of action, e.g., the target cell, the conjugate moiety of the antisense oligonucleotide is cleaved.

[0216] target cell As used herein, the term "target cell" refers to a cell that expresses a target nucleic acid. In some embodiments, the target cell can be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell, such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell, such as a monkey cell or a human cell.

[0217] Use The antisense oligonucleotides of the present invention can be used, for example, as therapeutic and prophylactic agents, and research reagents.

[0218] Research reagent The antisense oligonucleotides of the present invention can be used as research reagents. In research, such antisense oligonucleotides can be used to specifically reduce the levels of ELK1-CFP pre-mRNA transcripts in cells (e.g., in vitro cell cultures) and experimental animals, thereby facilitating the functional analysis of the target or the evaluation of its usefulness as a target for therapeutic intervention.

[0219] Method for modulating ELK1-CFP pre-mRNA transcript levels The present invention provides a method for reducing, downregulating or removing ELK1-CFP pre-mRNA transcripts in a cell, such as a cell that transcribes ELK1-CFP pre-mRNA transcripts, or a cell that is deficient in or depleted of TDP-43, the method comprising exposing the cell to an effective amount of an antisense oligonucleotide of the present invention or a pharmaceutical composition of the present invention.

[0220] In some embodiments, the method is an in vitro method.

[0221] In some embodiments, the method is an in vivo method.

[0222] In some embodiments, the cell is either a human cell or a mammalian cell.

[0223] In some embodiments, the cell is or is derived from a subject that has or is predisposed to a disease associated with an increased level of the ELK1-CFP pre-mRNA transcript. Such diseases include, but are not limited to, amyotrophic lateral sclerosis (ALS).

[0224] Treatment As used herein, the term "treatment" refers to both the treatment of an existing disease (e.g., a disease or disorder mentioned herein) and the prevention of a disease, i.e., prophylaxis. Thus, it will be appreciated that the treatment referred to herein can, in some embodiments, be prophylactic.

[0225] The present invention provides a method for treating or preventing a disease, comprising administering a therapeutically effective amount or a prophylactically effective amount of an antisense oligonucleotide or a pharmaceutical composition of the present invention to a subject that has or is predisposed to the disease.

[0226] The present invention provides a method for treating or preventing a disease associated with an increased level of the ELK1-CFP pre-mRNA transcript, comprising administering a therapeutically effective amount or a prophylactically effective amount of an antisense oligonucleotide of the present invention or a pharmaceutical composition of the present invention to a subject that has or is predisposed to the disease associated with an increased level of the ELK1-CFP pre-mRNA transcript.

[0227] In some embodiments, the disease may be associated with a decreased level of TDP-43.

[0228] In one embodiment, the disease is amyotrophic lateral sclerosis (ALS).

[0229] In some embodiments, the subject is an animal, preferably a mammal, such as a mouse, rat, hamster, or monkey, or preferably a human.

[0230] The present invention provides the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention for use as a medicine.

[0231] Within the scope of the present invention, the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention is typically administered in an effective amount.

[0232] The present invention provides the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention for preparing a medicine.

[0233] The present invention provides the antisense oligonucleotide according to the present invention or the pharmaceutical composition according to the present invention for use in treatment.

[0234] The method of the present invention is preferably used for the treatment or prevention of diseases caused by abnormal levels of ELK1-CFP pre-mRNA transcripts. The diseases can be particularly caused by an increase in the level of ELK1-CFP pre-mRNA transcripts.

[0235] In some embodiments, the disease can be a disease associated with a decrease in the level of TDP-43.

[0236] The present invention further relates to the use of the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention as defined herein for manufacturing a medicine for the treatment of abnormal levels of ELK1-CFP pre-mRNA transcripts, particularly high levels of ELK1-CFP pre-mRNA transcripts.

[0237] The present invention provides the use of the antisense oligonucleotide of the present invention or the pharmaceutical composition of the present invention for preparing a medicine for the treatment or prevention of amyotrophic lateral sclerosis (ALS).

[0238] Administration The antisense oligonucleotides or pharmaceutical compositions of the present invention can be administered locally (e.g., to the skin, by inhalation, to the eye or ear) or enterally (e.g., orally or via the gastrointestinal tract) or parenterally (e.g., intravenously, subcutaneously, intramuscularly, intracranially, intraventricularly or intrathecally).

[0239] In a preferred embodiment, the antisense oligonucleotides of the present invention are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, e.g., intracerebral or intraventricular administration. In one embodiment, the antisense oligonucleotide is administered intracerebrally or intraventricularly. In another embodiment, the antisense oligonucleotides of the present invention are administered intrathecally.

[0240] Combination therapy In some embodiments, the antisense oligonucleotides or pharmaceutical compositions of the present invention are for use in combination treatment with another therapeutic agent.

[0241] Manufacturing method In a further aspect, the present invention provides a method for manufacturing the antisense oligonucleotides of the present invention, the method comprising reacting nucleotide units to thereby form contiguous nucleotide units linked by covalent bonds contained in the antisense oligonucleotide. Preferably, the method uses the chemistry of phosphoramidites of International Publication No. WO 2017 / 081223, PCT / EP2016 / 077383, which is incorporated herein by reference in its entirety (see, e.g., Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313).

[0242] In a further embodiment, the method further comprises reacting a continuous nucleotide sequence with a conjugate moiety (ligand). In a further aspect, there is provided a method of manufacturing a composition of the invention, the method comprising mixing an antisense oligonucleotide of the invention or a conjugated antisense oligonucleotide with a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

Example

[0243] Example 1 TDP-43 has been shown to affect mRNA splicing. To identify new genes whose mRNA is regulated by the presence of TDP-43, TDP-43 knockdown was performed in a neuronal cell model. RNA sequencing was performed on the cells and de novo transcript analysis was performed to identify affected genes with new splice patterns.

[0244] Human glutamatergic neurons (FUJIFILM) were plated at 60,000 live cells in a 96-well plate coated with laminin and poly(ethyleneimine) solution (Sigma Aldrich) in 200 μl of culture medium together with 10,000 live astrocytes (FUJIFILM) (-1 day).

[0245] To knockdown TDP-43, 5 μM of compound A (SEQ ID NO: 2) was added to the culture medium on day 0. In other wells, PBS was added as a control instead. Throughout the experiment, half of the cell culture medium (100 μl) was replaced three times a week (on days 2, 5, 7, 10, 12, 14, and 17). Cells were harvested on day 20 using Magnapure lysis buffer (Roche), and RNA was isolated using the MagNA pure 96 system (Roche) including a DNase treatment step according to the manufacturer's instructions. An NGS library was prepared from 100 ng of total RNA using the KAPA mRNA HyperPrep Kit Illumina Platforms (Roche). The library was subjected to paired-end sequencing on a NovaSeq 6000 sequencer (Illumina) with a read length of 150 bp. Data analysis was performed using CLC Genomics Workbench 21. The data were first analyzed by performing a large gap mapping analysis using the hg38 genome assembly, and transcripts were subsequently discovered. Changes in predicted novel transcripts were investigated by visual inspection to identify actual changes.

[0246] In the analysis, one of the predicted novel transcript changes as a result of TDP-43 depletion was a novel transcript immediately downstream of the gene ELK1 on the X chromosome (Figure 1, gray arrow). However, more detailed manual inspection revealed that the increased RNA expression from this region of the chromosome was due to the lack of proper polyadenylation of the ELK1 mRNA transcript, and it became clear that RNA polymerase continued to transcribe DNA. Interestingly, this lack of proper polyadenylation of ELK1 due to TDP-43 depletion was found to have been previously described in a conditional mouse TARDBP knockout model (Wu et al., 2019). This conservation of the mechanism across species is notable as TDP-43 mRNA targets are generally thought not to be highly conserved across species.

[0247] Furthermore, a clear 10-fold upregulation of the CFP gene was observed as a result of TDP-43 depletion in neurons. The CFP gene is located downstream of ELK1 in the same orientation (Figure 1). The increased expression of CFP mRNA is caused by read-through of RNA polymerase II starting from the ELK1 promoter, thereby presumably generating a long fusion transcript with two open reading frames. Normally, such mRNAs are predicted to undergo nonsense-mediated (NMD) decay due to the presence of exon-exon splice junctions more than 50 bases downstream of the stop codon. However, since an increase in the expression of spliced CFP mRNA and even a 2-fold upregulation of ELK1 mRNA are also observed, this long fusion transcript is translated in both open reading frames, thereby presumably causing a potential increase in the expression of CFP in neurons lacking TDP-43 expression in their nuclei.

[0248] Example 2 To show that a single mRNA containing both the ELK1 and CFP reading frames appears as a result of TDP43 depletion in neurons, the inventors designed a tiling gap ASO (antisense oligonucleotide) library complementary to the region containing the ELK1 gene, leading to the first exon of CFP via the intergenic region. If this region is expressed as a single mRNA, any functional ASOs in this region should result in downregulation of both genes, ELK1 and CFP.

[0249] Here, the inventors show that ASOs can downregulate the combined pre-mRNA ELK1-CFP transcript, which is thought to be the result of ELK1 escaping polyadenylation in TDP-43-depleted cells.

[0250] Human glutamate neurons (Fuji Film) were plated at 60,000 live cells in a 96-well plate coated with laminin and poly(ethyleneimine) solution (Sigma Aldrich) in 200 μl of culture medium together with 10,000 live astrocytes (Fuji Film) (-1 day).

[0251] To knockdown TDP-43, 5 μM of compound A (SEQ ID NO: 2) was added to the culture medium on day 0 (excluding 4 control wells per plate containing PBS). Throughout the experiment, half (100 μl) of the cell culture medium was changed three times a week (days 2, 5, 7, 9, 12, 14, 16 and 19). 1 μM of each ASO targeting the ELK1-CFP fusion transcript was added to the culture medium on day 5.

[0252] A total of 92 different ASOs (SEQ ID NOs: 3 - 94) were added. Only compound A (SEQ ID NO: 2) was placed in 88 wells to serve as a baseline reference. The compound table provides the ASOs used, their HELM sequences and native analogue sequences, and their target sequences.

[0253] Cells were harvested on day 20 using Magnapure lysis buffer (Roche), and RNA was isolated using the MagNA pure 96 system (Roche) including a DNase treatment step according to the manufacturer's instructions. The purified RNA was denatured at 90 °C for 30 seconds prior to cDNA synthesis. cDNA was made using the iScript Advanced cDNA Synthesis Kit (Biorad) for RT-qPCR according to the manufacturer's instructions.

[0254] Measurement of the expression level of the target gene was performed by droplet digital PCR using the QX1 system (Bio-Rad) together with the QX1 software standard version. The expression of two genes, ELK1 and CFP, was measured using a PCR-probe assay. This was normalized against the expression of HPRT1 mRNA, and finally the expression of TSRBP was measured to verify the effect of the knockdown.

[0255] The following PCR probe assays (obtained from Integrated DNA technologies) were used: TARDBP: Primer 1: CAGCTCATCCTCAGTCATGTC (SEQ ID NO: 188), Primer 2: GATGGTGTGACTGCAAACTTC (SEQ ID NO: 189), Probe: / 5Cy5 / CAGCGCCCCACAAACACTTTTCT / 3IAbRQSp / (SEQ ID NO: 190) ELK1 (exons 3-4): Primer 1: TCAGGGTAGGACACAAACTTG (SEQ ID NO: 191), Primer 2: GACCAACATGAATTACGACAAGC (SEQ ID NO: 192), Probe: / 5HEX / CAAGAACAT / ZEN / CATCCGCAAGGTGAGC / 3IABkFQ / (SEQ ID NO: 193) CFP (exons 9-10): Primer 1: CCTTGTAGCTCCTCACACC (SEQ ID NO: 194), Primer 2: GCCTCTGCACACCCTTG (SEQ ID NO: 195), Probe: / 56-FAM / CTTCTCGCC / ZEN / CTGACCTTCGACC / 3IABkFQ / (SEQ ID NO: 196)

[0256] The following CY5.5-labeled HPRT1 probe (obtained from BioRad) was used: dHsaCPE13136107

[0257] The data shown in Table 1 were normalized to the expression of the housekeeping gene HPRT1 and finally to the average expression value of four control (PBS) wells per plate that did not receive TDP-43 knockdown or CA repeat ASO.

[0258]

Table 1-1

Table 1-2

Table 1-3

Table 1-4

[0259] Since a 13-fold increase in CFP and a 3-fold increase in ELK1 expression were measured in wells with TDP-43 knockdown only, the data confirmed the observations described in Example 1.

[0260] All of the gapmer ASOs tested were able to downregulate both ELK1 and CFP transcripts from the average starting points of 305% for ELK1 and 1332% for CFP seen in TDP-43 depleted cells. Seventy-two out of 88 of the ASOs tested were able to reduce CFP expression to at least the level of untreated cells (100%), and 21 ASOs were able to reduce CFP expression to less than 10% of that seen in untreated cells.

[0261] Since even an ASO gapmer targeting intron 1 of ELK1 was able to dramatically reduce CFP expression, the data verify that the increased expression of CFP mRNA is caused by transcription from the ELK1 promoter (Figure 2). Similarly, ASOs targeting regions within the CFP mRNA were able to reduce ELK1 mRNA expression from the 305% seen in TDP-43 depleted cells (Figure 3).

[0262] In summary, these data demonstrate that ASOs targeting the intergenic space between ELK1 and CFP can enable selective knockdown of CFP and ELK1 only in diseased cells depleted of TDP-43 due to protein aggregation, and are not possible in the rest of the body's "healthy" cells where normal expression of ELK1 and CFP is required.

[0263] References Wu et al.(2019)Transcriptomopathies of pre-and postsymptomatic frontotemporal dementia-like mice with TDP-43 depletion in forebrain neurons,Acta Neuropathologica Communications 7(50)https: / / doi.org / 10.1186 / s40478-019-0674-x

[0264] SEQ ID NO:1 is the sequence of the ELK1->CFP fusion transcript. This sequence is shown below and is based on the Ensamble Havana v17 gene annotation: HG 38 Chr X:47,650,604→47,623,172, minus strand direction.

[0265] Compound Table Helm Annotation Key: [LR](G) is beta-D-oxy-LNA guanine nucleoside [LR](T) is beta-D-oxy-LNA thymine nucleoside [LR](A) is beta-D-oxy-LNA adenine nucleoside [LR]([5meC]) is beta-D-oxy-LNA 5-methylcytosine nucleoside [dR](G) is DNA guanine nucleoside [dR](T) is DNA thymine nucleoside [dR](A) is DNA adenine nucleoside [dR](C) is DNA cytosine nucleoside

[0266]

Table 2-1

Table 2-2

Table 2-3

Table 2-4

Table 2-5

Table 2-6

Table 2-7

Claims

1. An antisense oligonucleotide comprising a continuous nucleotide sequence of at least 8 nucleotides in length, which is 8 to 40 nucleotides in length and is complementary to the transcribed human CFP-ELK1 intergenic region.

2. The antisense oligonucleotide according to claim 1, wherein the continuous nucleotide sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

3. The antisense oligonucleotide according to claim 1 or 2, wherein the continuous nucleotide sequence is the same length as the antisense oligonucleotide.

4. The antisense oligonucleotide according to any one of claims 1 to 3, wherein the continuous nucleotide sequence is at least 75% complementary to the transcribed human ELK1-CFP intergenic region.

5. The antisense oligonucleotide according to claim 4, wherein the continuous nucleotide sequence is at least 80%, at least 85%, at least 90% or at least 95% complementary to the transcribed human ELK1-CFP intergenic region.

6. The antisense oligonucleotide according to claim 5, wherein the continuous nucleotide sequence is completely complementary to the transcribed human ELK1-CFP intergenic region.

7. The antisense oligonucleotide according to any one of claims 1 to 6, wherein the transcribed human ELK1-CFP intergenic region comprises SEQ ID NO: 1, or a fragment thereof.

8. The antisense oligonucleotide according to any one of claims 1 to 7, wherein the transcribed human ELK1-CFP intergenic region consists of SEQ ID NO: 1, or a fragment thereof.

9. The antisense oligonucleotide according to any one of claims 1 to 8, wherein the transcribed human ELK1-CFP intergenic region is SEQ ID NO: 1, or a fragment thereof.

10. The antisense oligonucleotide according to any one of claims 7 to 9, wherein the fragment is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

11. The antisense oligonucleotide according to any one of claims 1 to 10, wherein the transcribed human ELK1-CFP intergenic region is within the human ELK1-CFP pre-mRNA transcript.

12. The antisense oligonucleotide according to any one of claims 7 to 11, wherein the continuous nucleotide sequence is complementary to a sequence selected from the group consisting of SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186 and SEQ ID NO: 187, or a fragment thereof. [

13. ] The antisense oligonucleotide according to claim 12, wherein the continuous nucleotide sequence is complementary to a sequence selected from the group consisting of SEQ ID NO: 98, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 186 and SEQ ID NO: 187, or a fragment thereof.

14. The antisense oligonucleotide according to claim 13, wherein the continuous nucleotide sequence is complementary to a sequence selected from the group consisting of SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 145, SEQ ID NO: 154, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 168, SEQ ID NO: 169 and SEQ ID NO: 172, or a fragment thereof.

15. The antisense oligonucleotide according to any one of claims 12 to 14, wherein the fragment is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

16. The antisense oligonucleotide according to any one of claims 1 to 15, wherein the antisense oligonucleotide is single-stranded.

17. The continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93 and SEQ ID NO: 94, or an antisense oligonucleotide according to any one of claims 1 to 16, comprising at least 10 consecutive nucleotides thereof.

18. The antisense oligonucleotide according to claim 17, wherein the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 93, and SEQ ID NO: 94, or at least 10 consecutive nucleotides thereof.

19. The antisense oligonucleotide according to claim 18, wherein the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 75, SEQ ID NO: 76, and SEQ ID NO: 79, or at least 10 consecutive nucleotides thereof.

20. The antisense oligonucleotide according to any one of claims 1 to 19, comprising one or more modified nucleosides.

21. The antisense oligonucleotide according to claim 20, wherein the one or more modified nucleosides are independently selected from 2'-O-methyl-RNA and LNA nucleosides.

22. The antisense oligonucleotide according to claim 20 or claim 21, comprising any number of LNA at the 5'-end.

23. The antisense oligonucleotide according to claim 20 or claim 21, comprising any number of LNA at the 3'-end.

24. The antisense oligonucleotide according to claim 20 or claim 21, comprising any number of LNA at the 5'-end and any number of LNA at the 3'-end.

25. The antisense oligonucleotide according to any one of claims 1 to 24, capable of recruiting RNase H1.

26. The antisense oligonucleotide according to any one of claims 1 to 25, which is a gapmer.

27. The antisense oligonucleotide according to any one of claims 1 to 26, comprising at least one modified internucleoside linkage.

28. The antisense oligonucleotide according to any one of claims 1 to 27, wherein one or more or all of the modified internucleoside linkages comprise phosphorothioate linkages.

29. The antisense oligonucleotide according to claim 28, wherein all of the internucleoside linkages present within the antisense oligonucleotide are phosphorothioate internucleoside linkages.

30. The antisense oligonucleotide according to any one of claims 1 to 29, capable of reducing the level of ELK1-CFP pre-mRNA transcript by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% intracellularly as compared to a control.

31. The antisense oligonucleotide according to claim 30, wherein the control is a cell not exposed to the antisense oligonucleotide.

32. The antisense oligonucleotide according to any one of claims 1 to 31, covalently bound to at least one conjugate moiety.

33. The antisense oligonucleotide according to any one of claims 1 to 32, in the form of a pharmaceutically acceptable salt.

34. The antisense oligonucleotide according to claim 33, wherein the salt is a sodium salt or a potassium salt.

35. The antisense oligonucleotide according to any one of claims 1 to 34, which is encapsulated in a lipid-based delivery vehicle, covalently linked to or encapsulated in a dendrimer, or conjugated to an aptamer.

36. A pharmaceutical composition comprising the antisense oligonucleotide according to any one of claims 1 to 35 and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant.

37. The pharmaceutical composition according to claim 36, comprising an aqueous diluent or solvent, such as phosphate buffered saline.

38. An in vivo or in vitro method for reducing the level of ELK1-CFP pre-mRNA transcript in a target cell, the method comprising exposing the cell to an effective amount of the antisense oligonucleotide according to any one of claims 1 to 31 or the pharmaceutical composition according to claim 36 or claim 37.

39. The method according to claim 37, wherein the cell is either a human cell or a mammalian cell.

40. The method according to claim 38 or claim 39, wherein the level of the human ELK1-CFP pre-mRNA transcript is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared to a control.

41. The method according to claim 40, wherein the control is a cell not exposed to the antisense oligonucleotide.

42. A method for treating or preventing a disease, the method comprising administering a therapeutically effective amount or a prophylactically effective amount of the antisense oligonucleotide according to any one of claims 1 to 35 or the pharmaceutical composition according to claim 36 or claim 37 to a subject suffering from or susceptible to the disease.

43. The antisense oligonucleotide according to any one of claims 1 to 35 or the pharmaceutical composition according to claim 36 or claim 37 for use as a medicament for treating or preventing a disease in a subject.

44. Use of the antisense oligonucleotide according to any one of claims 1 to 35 or the pharmaceutical composition according to claim 36 or claim 37 for the preparation of a medicament for treating or preventing a disease in a subject.

45. The method according to claim 42, the antisense oligonucleotide or pharmaceutical composition for use according to claim 43, or the use according to claim 44, wherein the disease is associated with an increase in the level of human ELK1-CFP pre-mRNA transcript.

46. The method according to claim 42, the antisense oligonucleotide or pharmaceutical composition for use according to claim 44, or the use according to claim 45, wherein the disease is amyotrophic lateral sclerosis (ALS).

Images