An engineered receptor system targeting PSMA and CA9

Abstract

Provided herein are chimeric priming receptors that bind PSMA and chimeric antigen receptors that bind CA9. Also provided are systems of chimeric priming receptors that bind PSMA and chimeric antigen receptors that bind CA9, cells expressing such systems, and methods of their use.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 342,947, filed May 17, 2022, which is incorporated by reference in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted through the Patent Center and is hereby incorporated by reference in its entirety. The ASCII copy was created in XX / 20XX, is named XXXXXUS_sequencelisting.txt, and is X,XXX,XXX bytes in size. [Background technology]

[0003] background Cancer is a disease characterized by the uncontrolled growth of cells. Many approaches have been tried to treat cancer, including drugs and radiation therapy. Recent cancer treatments attempt to use the body's own immune cells to attack cancer cells. One promising approach uses T cells taken from the patient and genetically engineered to produce chimeric antigen receptors or CARs, receptor proteins that give T cells new abilities to target specific proteins. These receptors are chimeric because they combine antigen-binding and T-cell activation functions into a single receptor.

[0004] Immunotherapy using CAR T cells holds promise because the modified T cells have the potential to recognize cancer cells in order to more effectively target and destroy them.

[0005] After engineering T cells with CARs, the resulting CAR-T cells are introduced into the patient to attack tumor cells. CAR-T cells can either be derived from T cells in the patient's own blood (autologous) or from T cells of another healthy donor (allogeneic). When the CAR-T cells are infused into the patient, they come into contact with the target antigen on the cells. The CAR-T cells bind to the antigen and become activated. Upon antigen engagement, the CAR T cells can exponentially proliferate, initiate anti-tumor cytokine production, and target tumor cell killing.

[0006] However, some concerns and limitations remain for CAR T cell-based immunotherapy. Some CAR T cells may engage with normal cells that express low levels of target antigen, resulting in off-target toxicity. Therefore, additional therapies that reduce off-target toxicity are needed. Summary of the Invention

[0007] overview In one aspect, provided herein is a priming receptor comprising an extracellular antigen binding domain that specifically binds prostate-specific membrane antigen (PSMA), a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites, and an intracellular domain comprising a human or humanized transcriptional effector, wherein the extracellular antigen binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO:1, CDR-H2 comprises the sequence set forth in SEQ ID NO:2, CDR-H3 comprises the sequence set forth in SEQ ID NO:3, CDR-L1 comprises the sequence set forth in SEQ ID NO:4, CDR-L2 comprises the sequence set forth in SEQ ID NO:5, and CDR-L3 comprises the sequence set forth in SEQ ID NO:6.

[0008] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO:7.

[0009] In some embodiments, the VL comprises the sequence set forth in SEQ ID NO:8.

[0010] In some embodiments, the extracellular domain comprises the sequence set forth in SEQ ID NO:9.

[0011] In one aspect, provided herein is a chimeric antigen receptor (CAR) comprising an extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9), the extracellular antigen binding domain comprising a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, CDR-L1 comprises the sequence set forth in SEQ ID NO: 13, CDR-L2 comprises the sequence set forth in SEQ ID NO: 14, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 15.

[0012] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO:16.

[0013] In some embodiments, the VL comprises the sequence set forth in SEQ ID NO:17.

[0014] In some embodiments, the extracellular domain comprises the sequence set forth in SEQ ID NO:18.

[0015] In another aspect, a system is provided herein comprising a first chimeric polypeptide and a second chimeric polypeptide, wherein the first chimeric polypeptide comprises a priming receptor comprising a first extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA), the first extracellular antigen binding domain comprising a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6, and the second chimeric polypeptide comprises a chimeric antigen receptor (CAR).

[0016] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO:7.

[0017] In some embodiments, the VL chain sequence comprises the sequence set forth in SEQ ID NO:8.

[0018] In some embodiments, the first extracellular antigen binding domain comprises the sequence set forth in SEQ ID NO:9.

[0019] In some embodiments, the CAR comprises a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9).

[0020] In some embodiments, the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, CDR-L1 comprises the sequence set forth in SEQ ID NO: 13, CDR-L2 comprises the sequence set forth in SEQ ID NO: 14, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 15.

[0021] In some embodiments, the VH comprises the sequence set forth in SEQ ID NO:16.

[0022] In some embodiments, the VL comprises the sequence set forth in SEQ ID NO:17.

[0023] In some embodiments, the second extracellular domain comprises the sequence set forth in SEQ ID NO:18.

[0024] In another aspect, provided herein is a system comprising a first chimeric polypeptide and a second chimeric polypeptide, wherein the first chimeric polypeptide comprises a priming receptor, and the second chimeric polypeptide comprises a chimeric antigen receptor (CAR) comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9), wherein the extracellular antigen binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, CDR-L1 comprises the sequence set forth in SEQ ID NO: 13, CDR-L2 comprises the sequence set forth in SEQ ID NO: 14, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 15.

[0025] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO:16.

[0026] In some embodiments, the VL comprises the sequence set forth in SEQ ID NO:17.

[0027] In some embodiments, the second extracellular domain comprises the sequence set forth in SEQ ID NO:18.

[0028] In some embodiments, the priming receptor comprises a first extracellular antigen-binding domain that specifically binds prostate-specific membrane antigen (PSMA).

[0029] In some embodiments, the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO:1, CDR-H2 comprises the sequence set forth in SEQ ID NO:2, CDR-H3 comprises the sequence set forth in SEQ ID NO:3, CDR-L1 comprises the sequence set forth in SEQ ID NO:4, CDR-L2 comprises the sequence set forth in SEQ ID NO:5, and CDR-L3 comprises the sequence set forth in SEQ ID NO:6.

[0030] In some embodiments, the VH comprises the sequence set forth in SEQ ID NO:7.

[0031] In some embodiments, the VL comprises the sequence set forth in SEQ ID NO:8.

[0032] In some embodiments, the second extracellular domain comprises the sequence set forth in SEQ ID NO:9.

[0033] In one aspect, a system is provided herein comprising a first chimeric polypeptide and a second chimeric polypeptide, wherein the first chimeric polypeptide comprises a priming receptor comprising a first extracellular antigen binding domain that specifically binds to prostate specific membrane antigen (PSMA), and the second chimeric polypeptide comprises a CAR comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9).

[0034] In some embodiments, the first chimeric polypeptide comprises a priming receptor comprising a first extracellular antigen binding domain that specifically binds to prostate-specific membrane antigen (PSMA), the first extracellular antigen binding domain comprising a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO:1, CDR-H2 comprises the sequence set forth in SEQ ID NO:2, CDR-H3 comprises the sequence set forth in SEQ ID NO:3, CDR-L1 comprises the sequence set forth in SEQ ID NO:4, CDR-L2 comprises the sequence set forth in SEQ ID NO:5, and CDR-L3 comprises the sequence set forth in SEQ ID NO:6.

[0035] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO:7.

[0036] In some embodiments, the VL comprises the sequence set forth in SEQ ID NO:8.

[0037] In some embodiments, the extracellular domain comprises the sequence set forth in SEQ ID NO:9.

[0038] In some embodiments, the priming receptor comprises, from N-terminus to C-terminus, a first extracellular antigen-binding domain, a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites, and an intracellular domain comprising a human or humanized transcriptional effector, and binding of PSMA by the first extracellular antigen-binding domain results in cleavage at the one or more ligand-inducible proteolytic cleavage sites.

[0039] In some embodiments, the priming receptor further comprises a first hinge domain disposed between the first extracellular antigen-binding domain and the first transmembrane domain.

[0040] In some embodiments, the first hinge domain comprises a CD8α or a truncated CD8α hinge domain.

[0041] In some embodiments, the first hinge comprises the sequence set forth in SEQ ID NO:19.

[0042] In some embodiments, the first transmembrane domain comprises a Notch1 transmembrane domain.

[0043] In some embodiments, the first transmembrane domain comprises the sequence set forth in SEQ ID NO:20.

[0044] In some embodiments, the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain.

[0045] In some embodiments, the intracellular domain comprises the sequence set forth in SEQ ID NO:24.

[0046] In some embodiments, the priming receptor further comprises a stop-transfer-sequence or a juxtamembrane domain between the first transmembrane domain and the intracellular domain.

[0047] In some embodiments, the stop transport sequence or juxtamembrane domain comprises the sequence set forth in SEQ ID NO:21.

[0048] In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO:25.

[0049] In some embodiments, the CAR comprises, from N-terminus to C-terminus, a second extracellular antigen binding domain, a second transmembrane domain, an intracellular costimulatory domain, and an intracellular activation domain.

[0050] In some embodiments, the second extracellular antigen-binding domain specifically binds carbonic anhydrase IX (CA9), and the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, CDR-L1 comprises the sequence set forth in SEQ ID NO: 13, CDR-L2 comprises the sequence set forth in SEQ ID NO: 14, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 15.

[0051] In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO:16.

[0052] In some embodiments, the VL comprises the sequence set forth in SEQ ID NO:17.

[0053] In some embodiments, the extracellular domain comprises the sequence set forth in SEQ ID NO:18.

[0054] In some embodiments, the CAR comprises a second hinge domain.

[0055] In some embodiments, the second hinge domain comprises a CD8α or a truncated CD8α hinge domain.

[0056] In some embodiments, the second transmembrane domain comprises a CD8α transmembrane domain.

[0057] In some embodiments, the intracellular costimulatory domain comprises a 4-1BB domain.

[0058] In some embodiments, the intracellular activation domain comprises a CD3 zeta domain.

[0059] In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO:31.

[0060] In some embodiments, the priming receptor and the CAR are capable of binding to the same target cell if that target cell expresses PSMA and CA9.

[0061] In some embodiments, the target cell is a human cell.

[0062] In some embodiments, the target cell is a cancer cell.

[0063] In some embodiments, the cancer cells are solid cancer cells or liquid cancer cells.

[0064] In some embodiments, the cancer cells are renal cell carcinoma.

[0065] In one aspect, provided herein is one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a priming receptor disclosed herein, a CAR disclosed herein, and / or a system disclosed herein.

[0066] In one aspect, one or more recombinant nucleic acids are provided herein, the one or more recombinant nucleic acids encoding a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen binding domain that specifically binds prostate specific membrane antigen (PSMA); a second chimeric polypeptide comprising a CAR comprising a second extracellular antigen binding domain that specifically binds carbonic anhydrase IX (CA9); and at least one nucleic acid sequence at least 15 nucleotides in length, the nucleic acid sequence being selected from the group consisting of a nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; a nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40; and a nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0067] In some embodiments, the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO:1, CDR-H2 comprises the sequence set forth in SEQ ID NO:2, CDR-H3 comprises the sequence set forth in SEQ ID NO:3, CDR-L1 comprises the sequence set forth in SEQ ID NO:4, CDR-L2 comprises the sequence set forth in SEQ ID NO:5, and CDR-L3 comprises the sequence set forth in SEQ ID NO:6.

[0068] In some embodiments, the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, CDR-L1 comprises the sequence set forth in SEQ ID NO: 13, CDR-L2 comprises the sequence set forth in SEQ ID NO: 14, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 15.

[0069] In one aspect, one or more recombinant nucleic acids are provided herein, the one or more recombinant nucleic acids comprising a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen binding domain that specifically binds prostate-specific membrane antigen (PSMA), the first extracellular antigen binding domain comprising a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6. and a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and at least one nucleic acid sequence at least 15 nucleotides in length, the at least one nucleic acid sequence comprising one or more of: (1) a first nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:39; (2) a second nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding the human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40; and (3) a third nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding the human thymocyte selection-associated high mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0070] In one aspect, one or more recombinant nucleic acids are provided herein, the one or more recombinant nucleic acids comprising a first chimeric polypeptide comprising a priming receptor and a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9), wherein the second extracellular antigen binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, CDR-L1 comprises the sequence set forth in SEQ ID NO: 13, and CDR-L2 comprises the sequence set forth in SEQ ID NO: 14. and at least one nucleic acid sequence at least 15 nucleotides in length, the at least one nucleic acid sequence comprising one or more of: (1) a first nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding the human Fas cell-surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:39; (2) a second nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding the human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40; and (3) a third nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding the human thymocyte-selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0071] In some embodiments, the first extracellular antigen binding domain VH chain sequence comprises the sequence set forth in SEQ ID NO:7.

[0072] In some embodiments, the first extracellular antigen binding domain VL chain sequence comprises the sequence set forth in SEQ ID NO:8.

[0073] In some embodiments, the first extracellular antigen binding domain comprises the sequence set forth in SEQ ID NO:9.

[0074] In some embodiments, the second extracellular antigen binding domain VH chain sequence comprises the sequence set forth in SEQ ID NO:16.

[0075] In some embodiments, the second extracellular antigen binding domain VL chain sequence comprises the sequence set forth in SEQ ID NO:17.

[0076] In some embodiments, the second extracellular antigen binding domain comprises the sequence set forth in SEQ ID NO:18.

[0077] In some embodiments, the first nucleic acid sequence is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39.

[0078] In some embodiments, the second nucleic acid sequence is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40.

[0079] In some embodiments, the second nucleic acid sequence is complementary to nucleotides 1294 to 2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0080] In some embodiments, the at least one nucleic acid sequence comprises each of: (1) a first nucleic acid sequence that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; and (2) a second nucleic acid sequence that is complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40.

[0081] In some embodiments, at least one nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0082] In some embodiments, the at least one nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

[0083] In some embodiments, at least one nucleic acid sequence is an shRNA.

[0084] In some embodiments, the first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 42-71.

[0085] In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:49.

[0086] In some embodiments, the first nucleic acid reduces expression of FAS in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the nucleic acid.

[0087] In some embodiments, the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 72-97.

[0088] In some embodiments, the second nucleic acid comprises the sequence set forth in SEQ ID NO:82.

[0089] In some embodiments, the second nucleic acid reduces expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells that do not contain the nucleic acid.

[0090] In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs:98-125.

[0091] In some embodiments, the third nucleic acid comprises the sequence set forth in SEQ ID NO:99 or 104.

[0092] In some embodiments, the third nucleic acid reduces expression of TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0093] In some embodiments, at least one nucleic acid sequence is a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs:157-164.

[0094] In some embodiments, the at least one nucleic acid sequence is encoded in at least one intron region of the recombinant nucleic acid.

[0095] In one embodiment, provided herein is one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain that specifically binds PSMA, and a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds CA9.

[0096] In some embodiments, a recombinant nucleic acid comprises two or more nucleic acid fragments.

[0097] In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the CAR.

[0098] In some embodiments, the recombinant nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.

[0099] In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.

[0100] In some embodiments, the constitutive promoter is EF1α.

[0101] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, a constitutive promoter, a nucleotide sequence encoding a priming receptor, an inducible promoter, and a nucleotide sequence encoding a chimeric antigen receptor.

[0102] In some embodiments, the nucleic acid comprises, in the 5' to 3' direction, an inducible promoter, a nucleotide sequence encoding a chimeric antigen receptor, a constitutive promoter, and a nucleotide sequence encoding a priming receptor.

[0103] In some embodiments, the recombinant nucleic acid includes, in the 5' to 3' direction, a first constitutive promoter, a nucleotide sequence encoding a priming receptor, a second constitutive promoter, a nucleotide sequence encoding at least one nucleic acid complementary to human FAS, human PTPN2, or human TOX, an inducible promoter, and a nucleotide sequence encoding a chimeric antigen receptor.

[0104] In some embodiments, the recombinant nucleic acid includes, in the 5' to 3' direction, a first constitutive promoter, a nucleotide sequence encoding a priming receptor, a second constitutive promoter, a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS, a nucleotide sequence encoding a second or third nucleic acid that is complementary to human PTPN2 or TOX, an inducible promoter, and a nucleotide sequence encoding a chimeric antigen receptor.

[0105] In some embodiments, the recombinant nucleic acid includes, from the 5' to 3' direction, an inducible promoter, a nucleotide sequence encoding a chimeric antigen receptor, a second constitutive promoter, a nucleotide sequence encoding a first nucleic acid that is complementary to human FAS, a nucleotide sequence encoding a second or third nucleic acid that is complementary to human PTPN2 or TOX, the first constitutive promoter, and a nucleotide sequence encoding a priming receptor.

[0106] In some embodiments, the nucleotide sequence encoding the priming receptor comprises the sequence set forth in SEQ ID NO:26.

[0107] In some embodiments, the nucleotide sequence encoding the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO:32.

[0108] In some embodiments, the nucleotide sequence encoding the priming receptor and the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO:36.

[0109] In some embodiments, the nucleic acid further comprises 5' and 3' homology directed repair arms complementary to the insertion site in the host cell chromosome.

[0110] In some embodiments, the recombinant nucleic acid further comprises a nucleotide sequence encoding a self-cleaving 2A peptide (P2A).

[0111] In some embodiments, P2A is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor.

[0112] In some embodiments, P2A is at the 3' end of the nucleotide sequence encoding the priming receptor.

[0113] In some embodiments, the recombinant nucleic acid further comprises a woodchuck hepatitis virus post-translational regulatory element (WPRE).

[0114] In some embodiments, the WPRE is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor and at the 5' end of the nucleotide sequence encoding the priming receptor, or the WPRE is at the 3' end of the nucleotide sequence encoding the priming receptor and at the 5' end of the nucleotide sequence encoding the chimeric antigen receptor.

[0115] In some embodiments, the recombinant nucleic acid further comprises an SV40 polyA element.

[0116] In some embodiments, the nucleic acid is incorporated into an expression cassette or expression vector.

[0117] In some embodiments, the expression vector is a non-viral vector.

[0118] In one aspect, provided herein is an expression vector comprising a recombinant nucleic acid disclosed herein.

[0119] In some embodiments, the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell.

[0120] In some embodiments, the insertion site is located at the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0121] In one aspect, provided herein is an immune cell comprising the system disclosed herein, at least one recombinant nucleic acid disclosed herein, and / or a vector disclosed herein.

[0122] In some embodiments, the immune cells are primary human immune cells.

[0123] In some embodiments, the immune cells are allogeneic immune cells.

[0124] In some embodiments, the immune cells are autologous immune cells.

[0125] In some embodiments, the primary immune cells are natural killer (NK) cells, T cells, CD8+ T cells, CD4+ T cells, primary T cells, or T cell precursors.

[0126] In some embodiments, the primary immune cells are primary T cells.

[0127] In some embodiments, the primary immune cells are primary human T cells.

[0128] In some embodiments, the primary immune cells are virus-free.

[0129] In one aspect, provided herein is a primary immune cell comprising at least one recombinant nucleic acid comprising a priming receptor comprising a first extracellular antigen binding domain that specifically binds PSMA and a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds CA9, inserted into a target region of the genome of the primary immune cell, wherein the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell.

[0130] In one aspect, provided herein is a viable virus-free primary cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid comprises a priming receptor comprising a first extracellular antigen binding domain that specifically binds PSMA and a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds CA9, and wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell.

[0131] In some embodiments, the antibody further comprises at least one nucleic acid sequence at least 15 nucleotides in length, the at least one nucleic acid sequence comprising one or more of: (1) a first nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:39; (2) a second nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding the human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40; and (3) a third nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding the human thymocyte selection-associated high mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0132] In one aspect, provided herein is a population of cells comprising a plurality of the immune cells disclosed herein.

[0133] In one aspect, provided herein is a pharmaceutical composition comprising an immune cell disclosed herein or a population disclosed herein and a pharma- ceutically acceptable excipient.

[0134] In one aspect, provided herein is a pharmaceutical composition comprising a recombinant nucleic acid disclosed herein or a vector disclosed herein and a pharma- ceutically acceptable excipient.

[0135] In one aspect, provided herein is a method of editing an immune cell comprising providing a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and wherein the recombinant nucleic acid comprises a recombinant nucleic acid disclosed herein, and wherein the 5' and 3' ends of the recombinant nucleic acid comprise a nucleotide sequence that is homologous to a genomic sequence adjacent to an insertion site in the genome of the immune cell; non-virally introducing the RNP-recombinant nucleic acid complex into the immune cell, wherein the guide RNA specifically hybridizes to a target region of the genome of the primary immune cell and the nuclease domain cleaves the target region to create an insertion site in the genome of the immune cell; and editing the immune cell via insertion of the recombinant nucleic acid disclosed herein into the insertion site in the genome of the immune cell.

[0136] In some embodiments, the non-viral introducing step comprises electroporation.

[0137] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

[0138] In some embodiments, the target region of the cell's genome is the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0139] In some embodiments, the recombinant nucleic acid is a double-stranded recombinant nucleic acid or a single-stranded recombinant nucleic acid.

[0140] In some embodiments, the recombinant nucleic acid is a linear recombinant nucleic acid or a circular recombinant nucleic acid, optionally, the circular recombinant nucleic acid is a plasmid.

[0141] In some embodiments, the immune cells are primary human immune cells.

[0142] In some embodiments, the immune cells are autologous immune cells.

[0143] In some embodiments, the immune cells are allogeneic immune cells.

[0144] In some embodiments, the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

[0145] In some embodiments, the immune cells are primary T cells.

[0146] In some embodiments, the immune cells are primary human T cells.

[0147] In some embodiments, the immune cells are virus-free.

[0148] In some embodiments, the method further comprises obtaining immune cells from the patient and introducing the recombinant nucleic acid in vitro.

[0149] In one aspect, provided herein is a method of treating a disease in a subject, the method comprising administering to the subject an immune cell disclosed herein or a pharmaceutical composition disclosed herein.

[0150] In some embodiments, the disease is cancer.

[0151] In some embodiments, the cancer is a solid cancer or a liquid cancer.

[0152] In some embodiments, the cancer is renal cell carcinoma.

[0153] In some embodiments, administration of the immune cells enhances an immune response in the subject.

[0154] In some embodiments, the enhanced immune response is an adaptive immune response.

[0155] In some embodiments, the enhanced immune response is an innate immune response.

[0156] In some embodiments, the enhanced immune response is increased expression of at least one cytokine or chemokine.

[0157] In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ.

[0158] In some embodiments, the step includes administering immunotherapy to the subject either simultaneously with or after the immune cells.

[0159] In one aspect, provided herein is a method of inhibiting a target cell in a subject, the method comprising administering to the subject an immune cell disclosed herein, wherein the immune cell inhibits the target cell.

[0160] In some embodiments, the target cells express PSMA and CA9.

[0161] In some embodiments, the target cell is a cancer cell.

[0162] In one aspect, provided herein is a method of inducing expression of a chimeric antigen receptor in an immune cell with a priming receptor, the method comprising obtaining an immune cell comprising a system disclosed herein, a recombinant nucleic acid disclosed herein, and / or a vector disclosed herein, and contacting the immune cell with a target cell expressing PSMA and CA9, wherein binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor.

[0163] In one aspect, provided herein is a method of modulating the activity of an immune cell, the method comprising obtaining an immune cell comprising a system disclosed herein, a recombinant nucleic acid disclosed herein, and / or a vector disclosed herein, and contacting the immune cell with a target cell expressing PSMA and CA9, wherein binding of a priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of a chimeric antigen receptor, and binding of the chimeric antigen receptor to CA9 on the target cell modulates the activity of the immune cell.

[0164] In some embodiments, modulating immune cell activity comprises enhancing an immune response.

[0165] In some embodiments, the enhanced immune response is an adaptive immune response.

[0166] In some embodiments, the enhanced immune response is an innate immune response.

[0167] In some embodiments, the immune cell activity is increased expression of at least one cytokine or chemokine.

[0168] In some embodiments, the at least one cytokine or chemokine is IL-2 or IFNγ.

[0169] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description and accompanying drawings. [Brief description of the drawings]

[0170] [Figure 1A] 1 provides diagrams of CA9 and PSMA logic gate (LG) circuits. [Figure 1B] 1 shows expression of PSMA prime receptor (PrimeR) in primary human T cells. [Diagram 2]13 shows that engineered T cells induced CAR expression after co-culture with PSMA-expressing target cells. [Figure 3A] We show that engineered T cells secreted IFNg following co-culture with target cells expressing both PSMA and CA9, but not following co-culture with cells expressing only CA9. [Figure 3B] We show that engineered T cells secreted IL-2 following co-culture with target cells expressing both PSMA and CA9, but not following co-culture with cells expressing only CA9. [Figure 4] Expression of PSMA and CA9 on target cell lines K562s and 786-O expressing PSMA (K562), CA9 (K562), or both (786-O PSMA / CA9) is shown. MSLN antibody was used as a negative control in addition to isotype control. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0171] Detailed Description of the Invention definition Terms used in the claims and specification are defined as set forth below, unless otherwise specified.

[0172] As used herein, the term "gene" refers to the basic unit of heredity, consisting of a segment of DNA located along a chromosome that codes for a specific protein or segment of a protein. A gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns, and a 3' untranslated region. A gene may further include a terminator, an enhancer, and / or a silencer.

[0173] As used herein, the term "locus" refers to a specific, fixed physical location on a chromosome where a gene or genetic marker is located.

[0174] The term "safe harbor locus" refers to a locus at which a gene or genetic element may be integrated without disrupting the expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS). As used herein, safe harbor locus refers to an "integration site" or "knock-in site" at which a sequence encoding a transgene as defined herein may be inserted. In some embodiments, the insertion occurs with replacement of sequences located at the integration site. In some embodiments, the insertion occurs without replacement of sequences at the integration site. Examples of contemplated integration sites are provided in Table D.

[0175] As used herein, the term "insertion" refers to a nucleotide sequence that is integrated (inserted) into a target locus or a safe harbor site. Insertion can be used to refer to a gene or genetic element that is integrated into a target locus or a safe harbor site, for example, using homology-directed repair (HDR), CRISPR / Cas9 genome editing, or other methods for inserting nucleotide sequences into genomic regions known to those skilled in the art.

[0176] The term "insertion" refers to the manipulation of a nucleotide sequence to introduce a non-native sequence. This can be done, for example, by using restriction enzymes and ligases, whereby a DNA sequence of interest, usually encoding a gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with the appropriate restriction enzyme to create a compatible overlap, and then joining the molecules together using ligase. Those skilled in the art are very familiar with such manipulations, and examples can be found in Sambrook et al. (Sambrook, Fritsch, & Maniatis, "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, 1989), which is incorporated herein by reference in its entirety, including any figures, figures and tables.

[0177] "CRISPR / Cas" system refers to a broad class of bacterial systems for defense against foreign nucleic acids. CRISPR / Cas systems are found in a wide range of fungal and archaeal organisms. CRISPR / Cas systems include type I, type II, and type III subtypes. Wild-type type II CRISPR / Cas systems utilize an RNA-mediated nuclease, Cas9, in a complex with guide and activator RNAs to recognize and cleave foreign nucleic acids. Guide RNAs with both guide RNA and activator RNA activity are also known in the art. In some cases, such dual activity guide RNAs are referred to as small guide RNAs (sgRNAs).

[0178] Cas9 homologs are found in a wide variety of fungi, including but not limited to bacteria from the following taxa: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chloroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1;10(5):726-737, Nat.Rev.Microbiol. 2011 June;9(6):467-477, Hou, et al., Proc Natl Acad Sci US A. 2013 Sep 24;110(39):15644-9, Sampson et al., Nature. 2013 May 9;497(7448):254-7, and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21. The Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in the host cell.

[0179] As used herein, the term "Cas9" refers to an RNA-mediated nuclease (e.g., of or derived from bacterial or archaeal origin). Exemplary RNA-mediated nucleases include the aforementioned Cas9 protein and homologs thereof, including, but not limited to, CPF1 (see, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015). Similarly, as used herein, the term "Cas9 ribonucleoprotein" complex, etc., refers to a complex between a Cas9 protein and a crRNA (e.g., a guide RNA or a small guide RNA), a Cas9 protein and a trans-activating crRNA (tracrRNA), a Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex including a Cas9 protein, a tracrRNA, and a crRNA guide RNA).

[0180] As used herein, the phrase "immune cell" includes all cell types that can give rise to immune cells, including hematopoietic cells, such as hematopoietic stem cells, pluripotent stem cells, and induced pluripotent stem cells (iPSCs). In some embodiments, the immune cell is a B cell, a macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell precursor, or a dendritic cell. In some embodiments, the cell is an innate immune cell.

[0181] As used herein, the term "primary" in the context of primary cells or primary stem cells refers to cells that have not been transformed or immortalized. Such primary cells can be cultured, subcultured, or passaged a limited number of times (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times). In some cases, primary cells are adapted to in vitro culture conditions. In some cases, primary cells are isolated from an organism, system, organ, or tissue, optionally sorted, and utilized directly, e.g., without culture or subculture. In some cases, primary cells are stimulated, activated, or differentiated. For example, primary T cells can be activated by contact with (e.g., culturing in the presence of) CD3, CD28 agonist, IL-2, IFN-γ, or a combination thereof.

[0182] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to cells that have completed maturation in the thymus and have identified a particular foreign antigen in the body. These terms also refer to the major type of white blood cell that has various roles in the immune system, including activating and inactivating other immune cells. T cells can be any T cell, such as cultured T cells, e.g., primary T cells, or T cells from cultured T cell lines, e.g., Jurkat, SupT1, etc., or T cells from a mammal. T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., not cultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or subpopulations thereof. T cells can be CD3+ cells. T cells can be CD4+ cells. + , CD8 + , or CD4 + and CD8 +The T cell may be any type of T cell, CD4+ / CD8+ double positive T cell, CD4+ helper T cell (e.g., Th1 and Th2 cells), CD8+ T cell (e.g., cytotoxic T cell), peripheral, including but not limited to blood mononuclear cells (PBMC), peripheral blood leukocytes (PBL), tumor infiltrating lymphocytes (TIL), memory T cell, naive T cell, regulatory T cell, gamma delta T cell, and the like. It may be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Additional types of memory T cells include cells such as central memory T cells (Tcm cells), effector memory T cells (Tem cells and TEMRA cells). T cell may also refer to genetically modified T cells, such as T cells modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T cells can also be differentiated from stem or progenitor cells.

[0183] "CD4+ T cells" refers to a subset of T cells that express CD4 on their surface and are associated with cellular immune responses. CD4+ T cells are characterized by a post-stimulation secretion profile that can include secretion of cytokines such as IFN-γ, TNF-α, IL-2, IL-4, and IL-10. "CD4" is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but has also been found on other cells, including monocytes / macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and has been suggested as an associative recognition element in MHC (major histocompatibility complex) class II restricted immune responses. On T lymphocytes, the CD4 antigen defines a helper / inducer subset.

[0184] "CD8+ T cells" refers to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells. The "CD8" molecule is a differentiation antigen present on thymocytes, as well as on cytotoxic and suppressor T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is the associative recognition element in major histocompatibility complex class I restricted interactions.

[0185] As used herein, the phrase "hematopoietic stem cell" refers to a type of stem cell that can give rise to blood cells. Hematopoietic stem cells can give rise to myeloid or lymphoid cells, or a combination thereof. Although hematopoietic stem cells are found primarily in bone marrow, they can be isolated from peripheral blood, or fractions thereof. Various cell surface markers can be used to identify, select, or purify hematopoietic stem cells. In some cases, hematopoietic stem cells are expressed by the c-kit + and lin - In some cases, human hematopoietic stem cells are identified as CD34 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells are identified as CD34 -、 CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells express CD133 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, mouse hematopoietic stem cells express CD34 lo / - , SCA-1 + , Thy1 + / lo , CD38+ , C-kit + , lin - In some cases, hematopoietic stem cells are identified as CD150 + CD48 - CD244 - It is.

[0186] As used herein, the phrase "hematopoietic cells" refers to cells derived from hematopoietic stem cells. Hematopoietic cells may be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood, or a fraction thereof). Alternatively, hematopoietic stem cells may be isolated and hematopoietic cells may be obtained or provided by differentiating the stem cells. Hematopoietic cells include cells with limited potential to differentiate into further cell types. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage precursor cells, or megakaryocyte-erythroid precursor cells. Hematopoietic cells include lymphoid and myeloid cells, such as lymphocytes, erythrocytes, granulocytes, monocytes, and platelets.

[0187] With respect to the binding of an antibody to a target molecule, the terms "binds to," "specifically binds to," "specifically binds to," "specific for," "selectively binds to," and "selective for" a particular antigen (e.g., a polypeptide target) or epitope on a particular antigen refer to binding that is measurably different from nonspecific or nonselective interactions (e.g., with non-target molecules). For example, an antibody that "selectively binds to" or "specifically binds to" an antigen is an antigen-binding moiety that binds to the antigen with high affinity and does not bind significantly to other unrelated antigens. Specific binding can be measured, for example, by measuring binding to a target molecule and comparing it to binding to a non-target molecule. Specific binding can also be determined by competition with a control molecule that mimics the epitope recognized on the target molecule. In this case, specific binding is indicated when binding of the antibody to the target molecule is competitively inhibited by the control molecule. In some embodiments, the extracellular antigen-binding domain specifically binds to a prostate-specific membrane antigen. In some embodiments, the extracellular domain comprises an antigen-binding moiety that binds to a prostate-specific membrane antigen.

[0188] "Affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope). Unless otherwise indicated, as used herein, "affinity" refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen or epitope). The affinity of a molecule X with its partner Y is determined by the dissociation equilibrium constant (K D The kinetic components that contribute to the dissociation equilibrium constant are described in more detail below. Affinity can be measured by common methods known in the art, including but not limited to surface plasmon resonance (SPR) technology (e.g., BIACORE®) or biolayer interferometry (e.g., FORTEBIO®).

[0189] As used herein, the term "hypervariable region" or "HVR" refers to each of the regions of an antibody variable domain that are hypervariable in sequence and / or form structurally defined loops ("hypervariable loops"). Generally, a naturally occurring four-chain antibody comprises six HVRs, three in the VH (H1, H2, H3) and three in the VL (L1, L2, L3). The HVRs generally comprise amino acid residues from the hypervariable loops and / or from the complementarity determining regions (CDRs), the latter being of the highest sequence variability and / or involved in antigen recognition. With the exception of CDR1 in VH, the CDRs generally comprise the amino acid residues that form the hypervariable loops. The hypervariable regions (HVRs) are also referred to as "complementarity determining regions" (CDRs), and these terms are used interchangeably herein with respect to the portions of the variable regions that form the antigen binding region. This particular region is described by Kabat et al., USDept. of Health and Human Services, Sequences of Proteins of Immunological Interest (1983) and Chothia et al., J Mol Biol 196:901-917 (1987), and the definitions include overlapping or subsets of amino acid residues when compared with each other. However, application of either definition to refer to the CDR of an antibody or variant thereof is intended to be within the scope of the term as defined and used herein. The exact residue numbers that encompass a particular CDR vary depending on the sequence and size of the CDR. One skilled in the art can routinely determine which residues comprise a particular CDR given the variable region amino acid sequence of an antibody.

[0190] The amino acid sequence boundaries of the CDRs may be determined by one of skill in the art using any of several known numbering schemes, including those described in Kabat et al. supra (the "Kabat" numbering scheme), Al-Lazikani et al., 1997, J. Mol. Biol., 273:927-948 (the "Chothia" numbering scheme), Martin (Enhanced Chothia or AbM) Abhinandan and Martin, Mol Immunol. 2008 Aug;45(14):3832-9, MacCallum et al., 1996, J. Mol. Biol. 262:732-745 (the "Contact" numbering scheme), Lefranc et al., Dev. Comp. Immunol., 2003, 27:55-77 (the "IMGT" numbering scheme), and Honegge and Pluckthun, J. Mol. Biol., 2001, 309:657-70 ("AHo" numbering scheme), each of which is incorporated by reference in its entirety.

[0191] Table A provides the positions of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 as identified by the Kabat, Chothia, AbM, Contact, and IMGT schemes. For CDR-H1, residue numbering is provided using both the Kabat and Chothia numbering schemes.

[0192] CDRs can be assigned, for example, using antibody numbering software such as Abnum, available at bioinf.org.uk / abs / abnum / and described in Abhinandan and Martin, Immunology, 2008, 45:3832-3839, which is incorporated by reference in its entirety. A description of various antibody numbering schemes is available at bioinf.org.uk / abs / info.html.

[0193] [Table A]

[0194] The "EU numbering scheme" is generally used when referring to residues in antibody heavy chain constant regions (e.g., as reported in Kabat et al. supra). Unless otherwise stated, the EU numbering scheme is used to refer to residues in antibody heavy chain constant regions described herein.

[0195] As used herein, the term "single chain" refers to a molecule comprising amino acid monomers linearly linked by peptide bonds. In certain such embodiments, the C-terminus of the Fab light chain is connected to the N-terminus of the Fab heavy chain in the single chain Fab molecule. As described in more detail herein, an scFv has a variable domain of a light chain (VL), which is connected from its C-terminus to the N-terminus of the variable domain of a heavy chain (VH) by a polypeptide chain. Alternatively, an scFv comprises a polypeptide chain, and the C-terminus of the VH is connected to the N-terminus of the VL by a polypeptide chain.

[0196] The "Fab fragment" (also called fragment antigen binding) contains the constant domain of the light chain (CL) and the first constant domain of the heavy chain (CH1), as well as the variable domains VL and VH on the light and heavy chains, respectively. The variable domains contain the complementarity determining loops (CDRs, also called hypervariable regions) involved in antigen binding. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region.

[0197] "F(ab') 2 The F(ab') fragment contains two Fab' fragments linked by a disulfide bond near the hinge region. 2 Fragments can be produced, for example, by recombinant methods or by pepsin digestion of intact antibodies. F(ab') fragments can be dissociated, for example, by treatment with β-mercaptoethanol.

[0198] An "Fv" fragment comprises a non-covalently associated dimer of one heavy- and one light-chain variable domain.

[0199] A "single-chain Fv" or "scFv" comprises the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. In one embodiment, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains, which enables the scFv to form the desired structure for antigen binding. For a review of scFvs, see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994). HER2 antibody scFv fragments are described in WO93 / 16185, U.S. Patent No. 5,571,894 and U.S. Patent No. 5,587,458.

[0200] The term "single domain antibody" or "sdAb" refers to a molecule in which one variable domain of an antibody specifically binds to an antigen without the presence of other variable domains. Single domain antibodies and fragments thereof are described in Arabi Ghahroudi et al., FEBS Letters, 1998, 414:521-526 and Muyldermans et al., Trends in Biochem. Sci., 2001, 26:230-245, each of which is incorporated by reference in its entirety. Single domain antibodies are also known as sdAbs or nanobodies. sdAbs are fairly stable and easily expressed as fusion partners with the Fc chain of an antibody (Harmsen MM, De Haard HJ (2007). "Properties, production, and applications of camelid single-domain antibody fragments". Appl. Microbiol Biotechnol. 77(1): 13-22).

[0201] As used herein, the term "construct" refers to a macromolecule or complex of molecules that includes a polynucleotide.

[0202] As used herein, the term "integration" refers to the process of stably inserting one or more nucleotides of a construct into a cell genome, i.e., covalently linking to a nucleic acid sequence in the chromosomal DNA of a cell. It may also refer to a nucleotide deletion at the site of integration. If there is a deletion at the insertion site, "integration" may further include the replacement of the deleted endogenous sequence or nucleotide with one or more inserted nucleotides.

[0203] As used herein, the term "exogenous" refers to a molecule or activity that is introduced into a host cell and is not native to the cell. The molecule can be introduced, for example, by introduction of an encoding nucleic acid into the host genetic material, for example, by integration into a host chromosome, or as non-chromosomal genetic material such as a plasmid. Thus, when used in connection with expression of an encoding nucleic acid, the term refers to introducing the encoding nucleic acid into a cell in an expressible form. The term "endogenous" refers to a molecule or activity that is present in a host cell under natural, unedited conditions. Similarly, when used in connection with expression of an encoding nucleic acid, the term refers to expression of an encoding nucleic acid that is contained within the cell and not exogenously introduced.

[0204] The term "heterologous" refers to a nucleic acid or polypeptide sequence or domain that is not native to the flanking sequences, e.g., a heterologous sequence is not found in nature coupled to a nucleic acid or polypeptide sequence that occurs at one or both termini.

[0205] The term "homologous" refers to a nucleic acid or polypeptide sequence or domain that is natural to the adjacent sequence, e.g., a homologous sequence is found in nature coupled to a nucleic acid or polypeptide sequence occurring at one or both termini.

[0206] As used herein, a "polynucleotide donor construct" refers to a nucleotide sequence (e.g., a DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to the polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide. The polynucleotide donor construct can include prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, the polynucleotide donor construct can be an miRNA, an shRNA, a native polypeptide (i.e., a naturally occurring polypeptide) or a fragment thereof, or a variant polypeptide (e.g., a native polypeptide having less than 100% sequence identity with the native polypeptide) or a fragment thereof.

[0207] As used herein, the term "complementary" or "complementarity" refers to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are generally A and T (or A and U), and G and C. Guide RNAs described herein can include a sequence, e.g., a DNA target sequence that is fully complementary or substantially complementary (e.g., has 1-4 mismatches) to a genomic sequence in a cell.

[0208] As used herein, the term "transgene" refers to a polynucleotide that has been transferred from one organism to another, either naturally or by any of several genetic engineering techniques. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein. A "recombinant protein" is a protein that is encoded by a gene (recombinant DNA) and has been cloned in a system that supports expression of the gene and translation of messenger RNA (see expression system). The recombinant protein can be a therapeutic agent, e.g., a protein that treats a disease or disorder disclosed herein. As used, transgene can refer to a polynucleotide that encodes a polypeptide.

[0209] "Protein," "polypeptide," and "peptide" are used interchangeably herein.

[0210] As used herein, the term "operably linked" or "operably linked" refers to the association of nucleic acid sequences in a single nucleic acid fragment such that the function of one is affected by the function of the other. For example, a promoter is operably linked to a coding sequence or functional RNA if the promoter can affect its expression (i.e., the coding sequence or functional RNA is under the transcriptional control of the promoter). A coding sequence can be operably linked to a control sequence in both sense and antisense orientations.

[0211] As used herein, the term "developmental cell state" refers, for example, to when a cell is inactive, actively expressing, differentiating, senescent, etc. A developmental cell state can also refer to a cell in a precursor state (e.g., a T cell precursor).

[0212] As used, the term "encoding" refers to a nucleic acid sequence that codes for a protein or polypeptide of interest. The nucleic acid sequence can be either a DNA or an RNA molecule. In a preferred embodiment, the molecule is a DNA molecule. In another preferred embodiment, the molecule is an RNA molecule. When present as an RNA molecule, it contains a sequence that instructs the host cell's ribosomes to begin translation (e.g., a start codon, ATG), and a sequence that instructs the ribosomes to end translation (e.g., a stop codon). Between the start codon and the stop codon is an open reading frame (ORF). Such terms are known to those skilled in the art.

[0213] As used herein, the term "subject" refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs, and sheep. In certain embodiments, the subject is a human. In some embodiments, the subject has a disease or condition that can be treated with the engineered cells or populations thereof provided herein. In some aspects, the disease or condition is cancer.

[0214] As used herein, the term "promoter" refers to a nucleotide sequence (e.g., a DNA sequence) that can control the expression of a coding sequence or functional RNA. A promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. A promoter can be derived in its entirety from a native gene, can be composed of different elements from different promoters found in nature, and / or can include synthetic DNA segments. A promoter can be endogenous to the cell of interest, as contemplated herein, or can be exogenous to the cell of interest. It will be understood by those skilled in the art that different promoters can induce gene expression in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions. As known in the art, a promoter can be selected according to the strength of the promoter and / or the conditions under which the promoter is active, e.g., constitutive promoters, strong promoters, weak promoters, inducible / repressible promoters, tissue-specific or developmentally regulated promoters, cell cycle-dependent promoters, etc.

[0215] The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., a CMV promoter, a UBC promoter). In some embodiments, the promoter may be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell type-specific promoter, etc.). See, e.g., U.S. Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0216] As contemplated herein, gene editing may involve knocking in or knocking out a gene (or nucleotide sequence). As used herein, the term "knock-in" refers to the addition of a DNA sequence or a fragment thereof to a genome. Such DNA sequence to be knocked in may include an entire gene or multiple genes, and may include regulatory sequences associated with a gene or any portion or fragment of the foregoing. For example, a polynucleotide donor construct encoding a recombinant protein may be inserted into the genome of a cell carrying a mutant gene. In some embodiments, the knock-in strategy involves the replacement of an existing sequence with a provided sequence, e.g., the replacement of a mutant allele with a wild-type copy. On the other hand, the term "knock-out" refers to the removal of a gene or the expression of a gene. For example, a gene can be knocked out by either the deletion or addition of a nucleotide sequence leading to the disruption of the reading frame. As another example, a gene may be knocked out by replacing a portion of the gene with an unrelated (e.g., non-coding) sequence.

[0217] As used herein, the term "non-homologous end joining" or NHEJ refers to a cellular process in which the broken or nicked ends of a DNA strand are directly ligated without the need for a homologous template nucleic acid. NHEJ can result in the addition, deletion, substitution, or combination thereof of one or more nucleotides at the repair site.

[0218] As used herein, the term "homology-directed repair" or HDR refers to a cellular process in which the broken or nick ends of DNA strands are repaired by polymerization from a homologous template nucleic acid. Thus, the original sequence is replaced with the sequence of the template. The homologous template nucleic acid can be provided by a homologous sequence (sister chromatid, homologous chromosome, or repeated region on the same or different chromosome) elsewhere in the genome. Alternatively, an exogenous template nucleic acid can be introduced to obtain a specific HDR-induced change of sequence at the target site. In this way, a specific mutation can be introduced at the break site.

[0219] As used herein, single-stranded DNA template or double-stranded DNA template refers to the DNA oligonucleotide that can be used by cell as the template for HDR.Generally, single-stranded DNA template or double-stranded DNA template has at least one region of homology to target site.In some cases, single-stranded DNA template or double-stranded DNA template has two homologous regions adjacent to the region that contains the heterologous sequence that is inserted into the target cleavage site.

[0220] The terms "vector" and "plasmid" are used interchangeably and as used herein refer to a polynucleotide vehicle useful for introducing genetic material into a cell. A vector can be linear or circular. A vector can integrate into a target genome of a host cell or can replicate independently within a host cell. A vector can include, for example, an origin of replication, a multiple cloning site, and / or a selectable marker. An expression vector typically includes an expression cassette. Vectors and plasmids include, but are not limited to, integrating vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.

[0221] As used herein, the phrase "introduce" in the context of introducing a nucleic acid or a complex containing nucleic acid, such as an RNP-DNA template complex, refers to the translocation of a nucleic acid sequence or an RNP-DNA template complex from outside the cell to inside the cell.In some cases, introducing refers to the translocation of a nucleic acid or a complex from outside the cell to inside the nucleus of the cell.Various methods of such translocation are contemplated, including, but not limited to, electroporation, contact with nanowires or nanotubes, receptor-mediated internalization, translocation via cell-penetrating peptides, liposome-mediated translocation, etc.

[0222] As used herein, the term "expression cassette" refers to a recombinantly or synthetically produced polynucleotide construct that includes a regulatory sequence operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. For example, the regulatory sequence can facilitate transcription of the selected polynucleotide in a host cell, or transcription and translation of the selected polynucleotide in a host cell. The expression cassette can be, for example, integrated into the genome of the host cell or present in an expression vector.

[0223] As used herein, the phrase "subject in need thereof" refers to a subject who exhibits and / or has been diagnosed with one or more symptoms or signs of a disease or disorder described herein.

[0224] "Chemotherapeutic agents" refer to chemical compounds useful in the treatment of cancer. Chemotherapeutic agents include "anti-hormonal agents" or "endocrine therapeutic agents" that act to regulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.

[0225] The term "composition" refers to a mixture containing, for example, engineered cells or proteins as contemplated herein. In some embodiments, the composition may contain additional components, such as adjuvants, stabilizers, excipients, etc. The term "composition" or "pharmaceutical composition" refers to a preparation that is in a form that allows the biological activity of the active ingredients contained therein to be effective in treating a subject, and does not contain additional ingredients that are unacceptably toxic to a subject in the amounts provided in the pharmaceutical composition.

[0226] The term "in situ" refers to processes that occur within living cells that are grown isolated from an organism, for example, grown in tissue culture.

[0227] The term "in vivo" refers to a process that takes place within a living organism.

[0228] As used herein, the term "ex vivo" generally includes experiments or measurements performed in or on living tissue, preferably in an artificial environment outside the organism, preferably with minimal variation from natural conditions.

[0229] As used herein, the term "mammal" includes both humans and non-humans, including, but not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0230] The term "percent identity", in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have the same specified percentage of nucleotides or amino acid residues when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those of skill in the art) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the entire length of the two sequences being compared.

[0231] For sequence comparison, typically one sequence serves as a reference sequence to which test sequences are compared.When using sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated as necessary, and sequence algorithm program parameters are designated.The sequence comparison algorithm then calculates the percent sequence identity of test sequence(s) to the reference sequence based on the designated program parameters.

[0232] Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, 575 Science Dr., Madison, Wis.)), or by visual inspection (see generally, Ausubel et al., infra).

[0233] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0234] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example an amount sufficient to modulate protein aggregation in a cell.

[0235] The term "therapeutically effective amount" is an amount effective for ameliorating symptoms of the disease.

[0236] The term "ameliorate" refers to any therapeutically beneficial outcome in the treatment of a disease state, e.g., a cancer disease state, a reduction in its severity or progression, a remission thereof, or a cure thereof.

[0237] As used herein, the term "effective amount" refers to a sufficient amount of a compound (e.g., a composition described herein, a cell described herein) to produce a beneficial or desired result. An effective amount can be administered in one or more administrations, applications or dosages, and is not intended to be limited to a particular formulation or route of administration.

[0238] As used herein, the term "treating" includes any effect that results in the improvement of a condition, disease, disorder, etc. or improves the symptoms thereof, e.g., alleviating, reducing, modulating, ameliorating or eliminating.

[0239] The terms "modulate" and "modulation" refer to decreasing or inhibiting, or alternatively, activating or increasing, the recited variable.

[0240] The terms "increase" and "activate" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater increase in the recited variable.

[0241] The terms "reduce" and "inhibit" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater decrease in the recited variable.

[0242] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0243] Logic Gate System As used herein, "logic gate", "circuit", "circuit receptor", "system" or "system receptor" refers to a bipartite protein expression system that includes a priming receptor and a chimeric antigen receptor. The system can be encoded on at least one nucleic acid inserted into a cell, and the priming receptor is expressed in the cell. The intracellular domain of the priming receptor is cleaved from the transmembrane domain when the priming receptor binds to its target antigen. The intracellular domain can then translocate into the cell nucleus, where it induces expression of the chimeric antigen receptor.

[0244] In one embodiment, a system is provided herein that includes a priming receptor that binds PSMA and a chimeric antigen receptor that binds CA9, where the transcription factor of the intracellular domain of the priming receptor is capable of inducing the expression of the CAR. Such a system is alternatively referred to as a "logic gate" or "circuit." In some embodiments, the system is encoded by a nucleic acid transgene inserted into the immune cell. The system may be encoded on a single nucleic acid insert or fragment that includes both transgenes, or on two nucleic acids that individually encode the system transgenes. The priming receptor and the CAR of the system may be arranged on a single nucleic acid in any order. For example, the priming receptor may be at the 5' end and the CAR may be at the 3' end, or the CAR may be at the 5' end and the priming receptor may be at the 3' end.

[0245] The constitutive promoter may be operably linked to a nucleotide sequence encoding a priming receptor. The inducible promoter may also be operably linked to a nucleotide sequence encoding a CAR. In some embodiments, when the system is encoded on a single nucleic acid insert or fragment containing both transgenes, the nucleic acid may comprise, in a 5' to 3' direction, a constitutive promoter, a nucleotide sequence encoding a priming receptor, an inducible promoter, and a nucleotide sequence encoding a chimeric antigen receptor. Alternatively, the nucleic acid may comprise, in a 5' to 3' direction, an inducible promoter, a nucleotide sequence encoding a chimeric antigen receptor, a constitutive promoter, and a nucleotide sequence encoding a priming receptor.

[0246] In some embodiments, the system comprising a priming receptor that binds PSMA and a chimeric antigen receptor that binds CA9 comprises the sequences set forth in SEQ ID NOs: 25 and 31. In some embodiments, the nucleotide sequence encoding the priming receptor and the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 36.

[0247] Priming Receptors Provided herein is a priming receptor that comprises an extracellular antigen binding domain that specifically binds to prostate specific membrane antigen (PSMA). In some embodiments, the priming receptor comprises an extracellular antigen binding domain that specifically binds to prostate specific membrane antigen (PSMA). PSMA is also known as FOLH1 or folate hydrolase 1 (HGNC:3788, NCBI Entrez Gene:2346, Ensembl:ENSG00000086205, UniProtKB / Swiss-Prot:Q04609). The amino acid sequence of PSMA is provided in SEQ ID NO:37.

[0248] In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 25. In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 26. In some embodiments, the priming receptor comprises the sequence set forth in SEQ ID NO: 236.

[0249] In certain embodiments of the present disclosure, the priming receptor is a synthetic receptor based on the Notch protein. The binding of the natural Notch receptor to its cognate ligand, such as from the delta family of proteins, causes intramembrane proteolysis that cleaves the intracellular fragment of the Notch protein. This intracellular fragment is a transcription regulator that only functions when cleaved from Notch. Cleavage can occur by sequential proteolysis by ADAM metalloproteases and gamma-secretase complex. This intracellular fragment enters the nucleus of the cell and activates cell-cell signaling genes. In contrast to the natural Notch protein, the synthetic Notch priming receptor replaces the natural Notch intracellular fragment with one that causes the gene encoding the protein of choice, for example, CAR, to be transcribed upon release of the intracellular fragment from the priming receptor.

[0250] Notch receptors have a modular domain organization. The ectodomain of Notch receptors consists of a series of N-terminal epidermal growth factor (EGF)-like repeats that are responsible for ligand binding. In synthetic or priming Notch receptors, the Notch ligand-binding domain is replaced with a ligand-binding domain that binds a selected target ligand or antigen. The EGF repeats are followed by three LIN-12 / Notch repeat (LNR) modules, which are unique to Notch receptors and have been widely reported to be involved in preventing premature receptor activation. The heterodimerization (HD) domain of Notch1 is split by furin cleavage, whereby the N-terminal part terminates the extracellular subunit and its C-terminal half constitutes the beginning of the transmembrane subunit. Following the extracellular region, the receptor has a transmembrane segment and an intracellular domain (ICD) that contains transcriptional regulators.

[0251] Multiple forms of priming receptors can be used in the methods, cells, and nucleic acids described herein. One type of priming receptor contemplated for use in the methods and cells herein comprises a heterologous extracellular ligand-binding domain, a linked polypeptide having substantial sequence identity with a Notch receptor, including an NRR, a TMD, and an ICD. The "Fn Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linked polypeptide having substantial sequence identity with a Robo receptor (such as mammalian Robo1, Robo2, Robo3, or Robo4), followed by one, two, or three fibronectin repeats ("Fn"), a TMD, and an ICD. The "mini-Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linked polypeptide having substantial sequence identity with a Notch receptor (lacking an NRR), a TMD, and an ICD. A "minimal Linker Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide lacking substantial sequence identity with a Notch receptor (e.g., a synthetic (GGS)n polypeptide sequence), a TMD, and an ICD. A "hinge Notch" receptor comprises a hinge sequence comprising a heterologous extracellular ligand-binding domain, an oligomerization domain (i.e., a domain that promotes dimerization, trimerization, or higher order multimerization with synthetic receptors and / or existing host receptors), a TMD, and an ICD. All of these receptor classes are synthetic, recombinant, and do not occur in nature. In some embodiments, the non-naturally occurring receptors disclosed herein bind to a ligand displayed on the target cell surface that triggers proteolytic cleavage of the receptor, triggering release of a transcriptional regulator that regulates a custom transcriptional program within the cell. In some embodiments, the priming receptor does not comprise the LIN-12-Notch repeats (LNR) and / or the heterodimerization domain (HD) of a Notch receptor.

[0252] Priming receptor extracellular domain The priming receptor disclosed herein comprises an extracellular domain that specifically binds to prostate-specific membrane antigen (PSMA). In some embodiments, the extracellular domain comprises a ligand-binding portion of the receptor. In some embodiments, the extracellular domain comprises an antigen-binding portion that binds to one or more target antigens. In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody or a functional antigen-binding fragment thereof. In some embodiments, the antigen-binding portion is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, or a minibody, a F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv. The antigen-binding portion may comprise a naturally occurring amino acid sequence or may be engineered, designed, or modified to provide desired and / or improved properties, e.g., increased binding affinity.

[0253] Priming receptor CDR, VH, and VL domains Exemplary antibodies and antigen-binding fragments that bind PSMA that can be used in the priming receptors and systems of the present disclosure are provided in Table B1 below.

[0254] [Table B1] TIFF2025517359000004.tif161165

[0255] In some embodiments, provided herein is a priming receptor comprising a VH domain and a VL domain that binds PSMA, the VH domain comprising three heavy chain complementarity determining regions (CDRs) (CDR-H1, CDR-H2, and CDR-H3) and three light chain complementarity determining regions (CDRs) (CDR-L1, CDR-L2, and CDR-L3), wherein CDR-H1, CDR-H2, and CDR-H3 are derived from a heavy chain variable domain (VH) comprising the amino acid sequence set forth in SEQ ID NO: 220, 222, 224, 226, 227, 229, 230, 231, 232, or 234, and CDR-L1, CDR-L2, and CDR-L3 are derived from a light chain variable domain (VL) comprising the amino acid sequence set forth in SEQ ID NO: 221, 223, 225, 227, 233, or 235. In some embodiments, provided herein is a priming receptor that comprises a VH domain that binds PSMA, comprising three heavy chain complementarity determining regions (CDRs) (CDR-H1, CDR-H2, and CDR-H3), wherein CDR-H1, CDR-H2, and CDR-H3 are derived from a heavy chain variable domain (VH) comprising the amino acid sequence set forth in SEQ ID NO: 7, 220, 222, 224, 226, 227, 229, 230, 231, 232, or 234. In some embodiments, provided herein is a priming receptor comprising a VL domain that binds PSMA, comprising three light chain complementarity determining regions (CDRs) (CDR-L1, CDR-L2, and CDR-L3), wherein CDR-L1, CDR-L2, and CDR-L3 are derived from a light chain variable domain (VL) comprising the amino acid sequence set forth in SEQ ID NO: 7, 8221, 223, 225, 227, 233, or 235.

[0256] In some embodiments, CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3 are defined according to AbM. In some embodiments, CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3 are defined according to Kabat. In some embodiments, CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3 are defined according to Chothia. In some embodiments, CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3 are defined according to IMGT. In some embodiments, CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3 are defined according to Contact.

[0257] In some embodiments, the priming receptor extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 7. In some embodiments, the VL comprises the sequence set forth in SEQ ID NO: 8. In some embodiments, the extracellular domain comprises the sequence set forth in SEQ ID NO: 9.

[0258] In some embodiments, the CDR-H3 of the priming receptor extracellular antigen-binding domain has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H3 of SEQ ID NO:3, the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H2 of SEQ ID NO:2, and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H1 of SEQ ID NO:1. 90% or 95% identity to CDR-L3 of SEQ ID NO:6, CDR-L2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to CDR-L2 of SEQ ID NO:5, and CDR-L1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to CDR-L1 of SEQ ID NO:4. In some embodiments, the CDR-H3 is CDR-H3 of SEQ ID NO: 3 with a maximum of 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, the CDR-H2 is CDR-H2 of SEQ ID NO: 2 with a maximum of 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, the CDR-H1 is CDR-H1 of SEQ ID NO: 1 with a maximum of 1, 2, 3, 4 or 5 amino acid substitutions, the CDR-L3 is CDR-L3 of SEQ ID NO: 6 with a maximum of 1, 2, 3, 4 or 5 amino acid substitutions, the CDR-L2 is CDR-L2 of SEQ ID NO: 5 with a maximum of 1, 2, 3 or 4 amino acid substitutions, and the CDR-L1 is CDR-L1 of SEQ ID NO: 4 with a maximum of 1, 2, 3, 4, 5 or 6 amino acid substitutions.

[0259] In some embodiments, a priming receptor extracellular antigen binding domain provided herein comprises one to three CDRs of a VH domain set forth in SEQ ID NO:7. In some embodiments, an antigen binding domain provided herein comprises two to three CDRs of a VH domain set forth in SEQ ID NO:7. In some embodiments, an antigen binding domain provided herein comprises three CDRs of a VH domain set forth in SEQ ID NO:7. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0260] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity to the VH sequence set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding domain provided herein comprises a VH sequence provided in SEQ ID NO: 7 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to herein as "variants". In some embodiments, such variants are derived from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein, In some embodiments, such variants are not derived from the sequences provided herein, and may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0261] In some embodiments, a priming receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VL domain set forth in SEQ ID NO:8. In some embodiments, an antigen binding domain provided herein comprises two to three CDRs of the VL domain set forth in SEQ ID NO:8. In some embodiments, an antigen binding domain provided herein comprises three CDRs of the VL domain set forth in SEQ ID NO:8. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0262] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity to the VL sequence set forth in SEQ ID NO: 8. In some embodiments, the antigen-binding domain provided herein comprises a VL sequence provided in SEQ ID NO: 8 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants". In some embodiments, such variants are derived from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein, In some embodiments, such variants are not derived from the sequences provided herein, and may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0263] In some embodiments, the priming receptor extracellular antigen-binding domain provided herein comprises a sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the sequence set forth in SEQ ID NO:9. In some embodiments, the antigen-binding domain provided herein comprises a scFv sequence provided in SEQ ID NO:9 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some embodiments, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants". In some embodiments, such variants are derived from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0264] Table 2B provides the VH and VL CDR sequences of exemplary PSMA antigen-binding domains with the numbering scheme indicated.

[0265] [Table B2]

[0266] In some embodiments, the nucleotide sequence encoding the priming receptor comprises the sequence set forth in SEQ ID NO:34 or 26.

[0267] Transmembrane domain In some embodiments, the priming receptor comprises a hinge domain. In some embodiments, the hinge domain is a CD8 hinge. In some embodiments, the hinge domain comprises the sequence set forth in SEQ ID NO:19.

[0268] As described above, priming receptors contain a transmembrane domain (TMD) that contains one or more ligand-inducible proteolytic cleavage sites.

[0269] In some embodiments, the TMD comprises a Notch1 transmembrane domain. In some embodiments, the transmembrane domain comprises the sequence set forth in SEQ ID NO:20.

[0270] In general, a suitable TMD for the chimeric receptors disclosed herein can be any transmembrane domain of a type 1 transmembrane receptor that contains at least one gamma-secretase cleavage site. A detailed description of the structure and function of the gamma-secretase complex and its substrate proteins, including amyloid precursor protein (APP) and Notch, can be found, for example, in a recent review by Zhang et al., Frontiers Cell Neurosci (2014). Non-limiting suitable TMDs from type 1 transmembrane receptors include those from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, and IFNAR2, where the TMD comprises at least one gamma secretase cleavage site. Additional TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, YASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM. In some embodiments, the TMD of the chimeric polypeptide or Notch receptor of the present disclosure is a TMD derived from the TMD of a member of the calsyntenin family, such as alcadein alpha and alcadein gamma. In some embodiments, the TMD of the chimeric polypeptide or Notch receptor of the present disclosure is a known TMD for a Notch receptor. In some embodiments, the TMD of the chimeric polypeptide or Notch receptor of the present disclosure is a TMD derived from a different Notch receptor.For example, in a mini-Notch based on human Notch1, the Notch1 TMD can be replaced with Notch2 TMD, Notch3 TMD, Notch4 TMD, or a Notch TMD from a non-human animal such as zebrafish, Drosophila melanogaster, Xenopus laevis, or red jungle fowl.

[0271] In some embodiments, the priming receptor comprises a Notch cleavage site, such as S2 or S3. Additional proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, metalloproteinase cleavage sites of ADAM10, i.e., MMPs selected from collagenase-1, -2, and -3 (MMP-1, -8, and -13), gelatinase A and B (MMP-2 and -9), stromelysin 1, 2, and 3 (MMP-3, -10, and -11), matrilysin (MMP-7), and membrane metalloproteinases (MT1-MMP and MT2-MMP). Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, such as a urokinase plasminogen activator (uPA) or tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of cleavage sequences for uPA and tPA include sequences including Yal-Gly-Arg. Another example of a protease cleavage site that may be included in a proteolytically cleavable linker is the tobacco etch virus (TEV) protease cleavage site, e.g., Glu-Asn-Leu-Tyr-Thr-Gln-Ser, where the protease cleaves between glutamine and serine. Another example of a protease cleavage site that may be included in a proteolytically cleavable linker is the enterokinase cleavage site, e.g., Asp-Asp-Asp-Asp-Lys, where cleavage occurs after the lysine residue. Another example of a protease cleavage site that may be included in a proteolytically cleavable linker is the thrombin cleavage site, e.g., Leu-Val-Pro-Arg.Additional suitable linkers that contain a protease cleavage site include sequences cleavable by the following proteases: PreScission™ protease (a fusion protein comprising human rhinovirus 3C protease and glutathione-S-transferase), thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMPs, matrix metalloproteinase 2 (MMP-2), cathepsin L; Thepsin D, matrix metalloproteinase 1 (MMP-1), urokinase-type plasminogen activator, membrane type 1 matrix metalloproteinase (MT-MMP), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin-1, matrix metalloproteinase 13 (collagenase-3), tissue-type plasminogen activator (tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium-activated neutral protease). Proteases that are not native to the host cell in which the receptor is expressed (e.g., TEV) can be used as an additional regulatory mechanism, reducing receptor activation until the protease is expressed or otherwise provided. Additionally, the protease can be tumor-associated or disease-associated (expressed to a significantly higher extent than normal tissue) and function as an independent regulatory mechanism. For example, several matrix metalloproteases are highly expressed in certain cancer types.

[0272] In some embodiments, the amino acid substitution(s) in the TMD comprises one or more substitutions in the "GV" motif of the TMD. In some embodiments, at least one of such substitution(s) comprises a substitution to alanine. Additional sequences and substitutions are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0273] Intracellular domain In some embodiments, the priming receptor comprises one or more intracellular domains derived from or derived from a transcription regulator and / or a DNA binding domain. In some embodiments, the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain. In some embodiments, the intracellular domain comprises a sequence set forth in SEQ ID NO: 22, 23, or 24.

[0274] Transcriptional regulators activate or repress transcription from their cognate promoters. Transcriptional activators typically bind to nearby transcriptional promoters and recruit RNA polymerase to directly initiate transcription. Transcriptional repressors bind to transcriptional promoters and sterically inhibit transcription initiation by RNA polymerase. Other transcriptional regulators function as either activators or repressors, depending on where they bind and the cellular conditions. Thus, as used herein, a "transcriptional activation domain" refers to the domain of a transcription factor that interacts with transcriptional control elements and / or transcriptional regulatory proteins (i.e., transcription factors, RNA polymerase, etc.) to increase and / or activate transcription of one or more genes. Non-limiting examples of transcription activation domains include herpes simplex virus VP16 activation domain, VP64 (which is a tetrameric derivative of VP16), HIV TAT, NFkB p65 activation domain, p53 activation domains 1 and 2, CREB (cAMP response element binding protein) activation domain, E2A activation domain, NFAT (nuclear factor of activated T cells) activation domain, yeast Gal4, yeast GCN4, yeast HAP1, MLL, RTG3, GLN3, OAF1, PIP2, PDR1, PDR3, PHO4, LEU3 glucocorticoid receptor transcription activation domain, B-cell POU homeodomain protein Oct2, plant Ap2, or any others known to one of skill in the art. In some embodiments, the transcription regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-YP64, Gal4-KRAB, and HAP1-VP16. In some embodiments, the transcriptional regulator is Gal4-VP64. The transcriptional activation domain can comprise a wild-type or naturally occurring sequence, or can be a modified, mutated, or derivative version of the original transcriptional activation domain that has the desired ability to increase and / or activate transcription of one or more genes. In some embodiments, the transcriptional regulator can further comprise a nuclear localization signal.

[0275] In some embodiments, the priming receptor comprises one or more intracellular "DNA binding domains" (or "DB domains"). Such "DNA binding domains" refer to sequence-specific DNA binding domains that bind to specific DNA sequence elements. Thus, as used herein, a "sequence-specific DNA binding domain" refers to a protein domain portion that has the ability to selectively bind to DNA having a specific, predetermined sequence. The sequence-specific DNA binding domain can include a wild-type or naturally occurring sequence, or can be a modified, mutant, or derivative version of the original domain that has the desired ability to bind to the desired sequence. In some embodiments, the sequence-specific DNA binding domain is engineered to bind to the desired sequence. Non-limiting examples of proteins having sequence-specific DNA binding domains that can be used in the synthetic proteins described herein include HNF1a, Gal4, GCN4, reverse tetracycline receptor, THY1, SYN1, NSE / RU5', AGRP, CALB2, CAMK2A, CCK, CHAT, DLX6A, EMX1, zinc finger proteins or domains thereof, CRISPR / Cas proteins, such as Cas9, Cas3, Cas4, Cas5, Cas5e (or CasD), Cash, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas8a1, Cas8b2, Cas8c, Cas8b1, Cas8c2, Cas8b1, Cas8c2, Cas8b1, Cas8b ... These include as10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu196, as well as TALES.

[0276] In embodiments in which a CRISPR / Cas-like protein is used, the CRISPR / Cas-like protein can be a wild-type CRISPR / Cas protein, a modified CRISPR / Cas protein, or a fragment of a wild-type or modified CRISPR / Cas protein. The CRISPR / Cas-like protein can be modified to increase nucleic acid binding affinity and / or specificity, alter enzymatic activity, and / or change another property of the protein. For example, the nuclease (i.e., DNase, RNase) domain of the CRISPR / Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the system described herein. For example, a CRISPR enzyme used as a DNA-binding protein or domain thereof can be mutated with respect to the corresponding wild-type enzyme such that the mutated CRISPR or domain thereof lacks the ability to cleave a nucleic acid sequence that includes the DNA-binding domain target site. For example, the D10A mutation can be combined with one or more of the H840A, N854A, or N863A mutations to produce a Cas9 enzyme that lacks substantially all DNA cleavage activity.

[0277] Juxtamembrane domain The ECD and TMD, or the TMD and ICD, may be linked together with a linking polypeptide, such as a juxtamembrane domain. A "SynNotch" or synthetic Notch receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD (including an NRR), a TMD, and an ICD. A "Fn Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Robo receptor (such as a mammalian Robo1, Robo2, Robo3, or Robo4), followed by one, two, or three fibronectin repeats ("Fn"), a TMD, and an ICD. A "mini-Notch" receptor comprises a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD, but lacking an NRR (LIN-12-Notch repeat (LNR) module, and a heterodimerization domain), a TMD, and an ICD. A "minimal linker Notch" receptor comprises a heterologous extracellular ligand binding domain, a linking polypeptide that lacks substantial sequence identity with the Notch receptor (such as, but not limited to, synthetic (GGS) n A "hinge Notch" receptor comprises a hinge sequence, which comprises a heterologous extracellular ligand-binding domain, an oligomerization domain (i.e., a domain that promotes dimerization, trimerization, or higher order multimerization with synthetic receptors and / or pre-existing host receptors), a TMD, and an ICD.

[0278] In some embodiments, the priming receptor comprises a juxtamembrane domain (JMD) peptide between the extracellular domain and the transmembrane domain. In some embodiments, the priming receptor comprises a juxtamembrane domain (JMD) peptide between the transmembrane domain and the intracellular domain. In some embodiments, the JMD peptide comprises an LWF motif. The use of an LWF motif in a receptor construct is described in U.S. Pat. No. 10,858,443, which is incorporated herein by reference in its entirety. In some embodiments, the JMD peptide has substantial sequence identity to the JMD of Notch1, Notch2, Notch3, and / or Notch4. In some embodiments, the JMD peptide has substantial sequence identity to the Notch1, Notch2, Notch3, and / or Notch4 JMD, but does not include the LIN-12-Notch repeats (LNR) and / or heterodimerization domain (HD) of the Notch receptor. In some embodiments, the JMD peptide does not have substantial sequence identity to the Notch1, Notch2, Notch3, and / or Notch4 JMD. In some embodiments, the JMD peptide comprises an oligomerization domain that promotes the formation of receptor dimers, trimers, or higher order aggregates. Such JMD peptides are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0279] In mini-Notch receptors, the linking polypeptide is derived from the Notch JMD sequence after deletion of the NRR and HD domains. The Notch JMD sequence may be from Notch1, Notch2, Notch3, or Notch4, or may be derived from non-human homologs such as those from Drosophila, Junglefly, Danio, etc. The remaining 4-50 amino acid residues of the Notch sequence can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence is varied to modify the orientation and / or proximity of the ECD and TMD relative to each other to achieve a desired activity of the chimeric polypeptide, such as signal transduction levels upon ligand induction or in the absence of ligand.

[0280] In minimal linker Notch receptors, the linking polypeptide has no substantial sequence identity to a Notch JMD sequence (including Notch JMD sequences from Notch1, Notch2, Notch3, or Notch4, or non-human homologs thereof). Between 4 and 50 amino acid residues can be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence is varied to alter the orientation and / or proximity of the ECD and TMD relative to one another to achieve the desired activity of the chimeric polypeptide of the present disclosure. The minimal linker sequence can be designed to include or omit a protease cleavage site, and can include or omit a glycosylation site or multiple sites for other types of post-translational modifications. In some embodiments, the minimal linker does not include a protease cleavage site or a glycosylation site.

[0281] In some embodiments, the priming receptor further comprises a hinge. Hinge linkers that can be used in priming receptors can include an oligomerization domain (e.g., a hinge domain) that includes one or more polypeptide motifs that promote oligomerization of chimeric polypeptides through intermolecular disulfide bonds. In these cases, within the chimeric receptors disclosed herein, the hinge domain generally includes a flexible polypeptide connector region that is located between the ECD and the TMD. Thus, the hinge domain provides flexibility between the ECD and the TMD, and also provides a site for intermolecular disulfide bonds between two or more chimeric polypeptide monomers to form an oligomeric complex. In some embodiments, the hinge domain includes a motif that promotes dimerization of the chimeric polypeptides disclosed herein. In some embodiments, the hinge domain includes a motif that promotes trimerization of the chimeric polypeptides disclosed herein (e.g., a hinge domain from OX40). Hinge polypeptide sequences suitable for the compositions and methods of the present disclosure may be naturally occurring hinge polypeptide sequences (e.g., from naturally occurring immunoglobulins) or may be engineered, designed, or modified to provide desired and / or improved properties, such as transcriptional regulation properties. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses (e.g., IgG1 hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain), or functional variants thereof. In some embodiments, the hinge polypeptide sequence comprises one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence comprises one or more CPPC motifs.

[0282] The hinge polypeptide sequence may also be derived from the CD8α hinge domain, the CD28 hinge domain, the CD152 hinge domain, the PD-1 hinge domain, the CTLA4 hinge domain, the OX40 hinge domain, and functional variants thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the CD8α hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the OX40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from the IgG4 hinge domain or a functional variant thereof.

[0283] The Fn Notch linked polypeptide is derived from Robo1 JMD, which contains a fibronectin repeat (Fn) domain, with a short polypeptide sequence between the Fn repeat and the TMD. The Fn Notch linked polypeptide does not contain a Notch negative regulatory region (NRR) or a Notch HD domain. The Fn linked polypeptide may contain 1, 2, 3, 4, or 5 Fn repeats. In some embodiments, the chimeric receptor comprises an Fn linked polypeptide having about 1 to about 5 Fn repeats, about 1 to about 3 Fn repeats, or about 2 to about 3 Fn repeats. The short polypeptide sequence between the Fn repeat and the TMD may be about 2 to about 30 amino acid residues. In some embodiments, the short polypeptide sequence may be about 5 to about 20 amino acids of any sequence. In some embodiments, the short polypeptide sequence may be about 5 to about 20 naturally occurring amino acids of any sequence. In some embodiments, the short polypeptide sequence may be about 5 to about 20 amino acids of any sequence, but with no more than one proline. In some embodiments, the short polypeptide sequence can be from about 5 to about 20 amino acids, with about 50% or more of the amino acids being glycine. In some embodiments, the short polypeptide sequence can be from about 5 to about 20 amino acids, with the amino acids selected from glycine, serine, threonine, and alanine. In some embodiments, the length and amino acid composition of the Fn-linked polypeptide sequence is varied to alter the orientation and / or proximity of the ECD and TMD relative to one another to achieve a desired activity of the chimeric polypeptide of the present disclosure.

[0284] Stop transport sequence In some embodiments, the priming receptor further comprises a stop transport sequence (STS) between the transmembrane domain and the intracellular domain. The STS comprises a charged lipophobic sequence. Without being bound by any theory, it is believed that the STS functions as a membrane anchor and prevents the intracellular domain from passing through the plasma membrane. The use of the STS domain in the priming receptor is described in WO2021061872 (incorporated herein in its entirety by reference). Non-limiting exemplary STS sequences include APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNE1, KCNE2, CHL1, LRP1, LRP2, LRP18, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, S Examples of STS sequences include DC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKTFD1, NECTIN1, KL, IL6R, EFNB1, CD44, CLSTN1, LRP8, PCDHGC3, NRG1, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA4, IL1R2, KCNE4, SCN2B, Nradd, PTPRM, Notch1, Notch2, Notch3, and Notch4 STS sequences. In some embodiments, the STS is heterologous to the transmembrane domain. In some embodiments, the STS is homologous to the transmembrane domain. STS sequences are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0285] In some embodiments, the stop transfer sequence comprises the sequence set forth in SEQ ID NO:21.

[0286] Chimeric Antigen Receptor In another embodiment, a chimeric antigen receptor is provided herein that comprises an extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9). The recombinant CAR may be a human CAR that comprises a complete human sequence, for example, a natural human sequence. The amino acid sequence of CA9 (HGNC:1383, NCBI Entrez Gene:768, Ensembl:ENSG00000107159, UniProtKB / Swiss-Prot:Q16790) is provided in SEQ ID NO:38.

[0287] In some embodiments, the chimeric antigen receptor comprises an extracellular portion that comprises an antigen-binding domain. The antigen-recognition domain of a receptor, such as a CAR, can be linked to one or more intracellular signaling components, such as a signaling component that mimics activation through an antigen receptor complex, e.g., a TCR complex, in the case of a CAR, and / or to a signal through another cell surface receptor. Thus, in some embodiments, the extracellular binding component (e.g., a ligand-binding or antigen-binding domain) is linked to one or more transmembrane and intracellular signaling domains. In some embodiments, the transmembrane domain is fused to the extracellular domain. In one embodiment, one of the domains in the receptor, e.g., the transmembrane domain that naturally associates with the CAR, is used. In some cases, the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to transmembrane domains of the same or different surface membrane proteins and to minimize interactions with other members of the receptor complex.

[0288] In some embodiments, the chimeric antigen receptor comprises an extracellular portion comprising an antigen binding domain as described herein and an intracellular signaling domain. In some embodiments, the antibody or fragment comprises an scFv, VH, or single domain VH antibody, and the intracellular domain comprises an ITAM. In some embodiments, the intracellular signaling domain comprises the signaling domain of the zeta chain of the CD3-zeta (CD3) chain. In some embodiments, the chimeric antigen receptor comprises a transmembrane domain linking the extracellular domain and the intracellular signaling domain. In some embodiments, the extracellular domain comprises the ligand binding portion of the receptor.

[0289] In some embodiments, the extracellular domain comprises an antigen-binding portion that binds to one or more target antigens. In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody or a functional antigen-binding fragment thereof. In some embodiments, the antigen-binding portion is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, or a minibody, a F(ab')2 fragment, a Fab fragment, a single chain variable fragment (scFv), and a single domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv. The antigen-binding portion may comprise a naturally occurring amino acid sequence or may be engineered, designed, or modified to provide desired and / or improved properties, e.g., increased binding affinity.

[0290] In some embodiments, the transmembrane domain comprises a transmembrane portion of CD8a or CD28. The extracellular domain and the transmembrane may be directly or indirectly linked. In some embodiments, the extracellular domain and the transmembrane are linked by a spacer, such as any of those described herein. In some embodiments, the chimeric antigen receptor comprises an intracellular domain of a T cell costimulatory molecule, for example, between the transmembrane domain and the intracellular signaling domain. In some embodiments, the T cell costimulatory molecule is CD28 or 41BB. In some embodiments, the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 164.

[0291] Chimeric antigen receptor CDR, VH, VL domains Exemplary antibodies and antigen-binding fragments that bind CA9 that can be used in the chimeric antigen receptors and systems of the disclosure are provided in Table C1 below.

[0292] [Table C1] TIFF2025517359000007.tif156165

[0293] Additional CA9 antibodies and antigen-binding fragments are provided in US Pat. No. 9,957,330, which is incorporated by reference in its entirety.

[0294] In some embodiments, provided herein is a chimeric antigen receptor that comprises a VH domain that binds to CA9, the VH domain comprising three heavy chain complementarity determining regions (CDRs) (CDR-H1, CDR-H2, and CDR-H3) and three light chain complementarity determining regions (CDRs) (CDR-L1, CDR-L2, and CDR-L3), wherein CDR-H1, CDR-H2, and CDR-H3 are selected from the group consisting of SEQ ID NOs: 16, 198, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 202, 204, 206, 208, 210, 212, 214, 216, and 218, and CDR-L1, CDR-L2, and CDR-L3 are derived from a light chain variable domain (VL) comprising the amino acid sequences set forth in SEQ ID NOs: 17, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, and 219. In some embodiments, provided herein is a chimeric antigen receptor comprising a VH domain that binds CA9, comprising three heavy chain complementarity determining regions (CDRs) (CDR-H1, CDR-H2, and CDR-H3), wherein CDR-H1, CDR-H2, and CDR-H3 are derived from a heavy chain variable domain (VH) comprising the amino acid sequences set forth in SEQ ID NOs: 16, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, and 218. In some embodiments, provided herein is a chimeric antigen receptor comprising a VH domain that binds CA9, comprising three light chain complementarity determining regions (CDRs) (CDR-L1, CDR-L2, and CDR-L3), wherein CDR-L1, CDR-L2, and CDR-L3 are derived from a light chain variable domain (VL) comprising the amino acid sequences set forth in SEQ ID NOs: 17, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, and 219.

[0295] In some embodiments, CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3 are defined according to AbM. In some embodiments, CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3 are defined according to Kabat. In some embodiments, CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3 are defined according to Chothia. In some embodiments, CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3 are defined according to IMGT. In some embodiments, CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3 are defined according to Contact.

[0296] In some embodiments, the chimeric antigen receptor extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, CDR-L1 comprises the sequence set forth in SEQ ID NO: 12, CDR-L2 comprises the sequence set forth in SEQ ID NO: 14, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 15. In some embodiments, the VH chain sequence comprises the sequence set forth in SEQ ID NO: 16. In some embodiments, the VL comprises the sequence set forth in SEQ ID NO: 17. In some embodiments, the extracellular domain comprises the sequence set forth in SEQ ID NO: 18.

[0297] In some embodiments, the CDR-H3 of the chimeric antigen receptor extracellular antigen binding domain has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H3 of SEQ ID NO: 12, the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H2 of SEQ ID NO: 11, and the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to the CDR-H1 of SEQ ID NO: 10. 90% or 95% identity to CDR-L3 of SEQ ID NO: 15, CDR-L2 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to CDR-L2 of SEQ ID NO: 14, and CDR-L1 has at least about 50%, 75%, 80%, 85%, 90% or 95% identity to CDR-L1 of SEQ ID NO: 13. In some embodiments, CDR-H3 is CDR-H3 of SEQ ID NO: 12 with up to 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, CDR-H2 is CDR-H2 of SEQ ID NO: 11 with up to 1, 2, 3, 4, 5, 6, 7 or 8 amino acid substitutions, CDR-H1 is CDR-H1 of SEQ ID NO: 10 with up to 1, 2, 3, 4 or 5 amino acid substitutions, CDR-L3 is CDR-L3 of SEQ ID NO: 15 with up to 1, 2, 3, 4 or 5 amino acid substitutions, CDR-L2 is CDR-L2 of SEQ ID NO: 14 with up to 1, 2, 3 or 4 amino acid substitutions, and CDR-L1 is CDR-L1 of SEQ ID NO: 13 with up to 1, 2, 3, 4, 5 or 6 amino acid substitutions.

[0298] In some embodiments, a chimeric antigen receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VH domain set forth in SEQ ID NO: 16. In some embodiments, an antigen binding domain provided herein comprises two to three CDRs of the VH domain set forth in SEQ ID NO: 16. In some embodiments, an antigen binding domain provided herein comprises three CDRs of the VH domain set forth in SEQ ID NO: 16. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0299] In some embodiments, the chimeric antigen receptor extracellular antigen-binding domain provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity to the VH sequence set forth in SEQ ID NO: 16. In some embodiments, the antigen-binding domain provided herein comprises a VH sequence provided in SEQ ID NO: 16 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domain described in this paragraph is referred to herein as a "variant". In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0300] In some embodiments, a chimeric antigen receptor extracellular antigen binding domain provided herein comprises one to three CDRs of the VL domain set forth in SEQ ID NO: 17. In some embodiments, an antigen binding domain provided herein comprises two to three CDRs of the VL domain set forth in SEQ ID NO: 17. In some embodiments, an antigen binding domain provided herein comprises three CDRs of the VL domain set forth in SEQ ID NO: 17. In some embodiments, the CDRs are Kabat CDRs. In some embodiments, the CDRs are Chothia CDRs. In some embodiments, the CDRs are AbM CDRs. In some embodiments, the CDRs are Contact CDRs. In some embodiments, the CDRs are IMGT CDRs.

[0301] In some embodiments, the chimeric antigen receptor extracellular antigen-binding domain provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with the VL sequence set forth in SEQ ID NO: 17. In some embodiments, the antigen-binding domain provided herein comprises a VL sequence provided in SEQ ID NO: 17 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants". In some embodiments, such variants are derived from the sequences provided herein by, for example, affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0302] In some embodiments, the chimeric antigen extracellular antigen-binding domain provided herein comprises a sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to the sequence set forth in SEQ ID NO: 18. In some embodiments, the antigen-binding domain provided herein comprises a scFv sequence provided in SEQ ID NO: 18 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some aspects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to herein as "variants". In some embodiments, such variants are derived from the sequences provided herein, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described herein. In some embodiments, such variants are not derived from the sequences provided herein, but may be isolated de novo, for example, by the methods provided herein for obtaining antibodies or antigen-binding domains.

[0303] Table C2 provides exemplary CA9 antigen binding domain CDR sequences of VH of SEQ ID NO: 16 and VL of SEQ ID NO: 17 with the numbering scheme indicated.

[0304] [Table C2]

[0305] In some embodiments, the nucleotide sequence encoding the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 32 or 35. In some embodiments, the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 237.

[0306] CAR transmembrane domain The transmembrane domain in some embodiments is derived from either natural or synthetic sources. When the source is natural, in some aspects the domain is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (i.e., at least including the transmembrane region(s) of) the alpha, beta or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and / or CD154. Alternatively, the transmembrane domain in some embodiments is synthetic. In some aspects, synthetic transmembrane domains primarily comprise hydrophobic residues such as leucine and valine. In some aspects, triplets of phenylalanine, tryptophan and valine are found at each end of the synthetic transmembrane domain. In some embodiments, the linkage is by a linker, spacer, and / or transmembrane domain(s).

[0307] In some embodiments, the transmembrane domain of a receptor, e.g., a CAR, is the transmembrane domain of human CD28 or a variant thereof, e.g., the 27 amino acid transmembrane domain of human CD28 (Accession Number: P10747.1).

[0308] In some embodiments, the CAR comprises a CD8a TMD. In some embodiments, the CD8a TMD comprises the sequence set forth in SEQ ID NO:28.

[0309] CAR hinge In some embodiments, the CAR further comprises a spacer, which may be or may include at least a portion of an immunoglobulin constant region, or a variant or modified version thereof, such as a hinge region, e.g., CD8a hinge, IgG4 hinge region, and / or CH1 / CL and / or Fc region. In some embodiments, the constant region or portion is that of a human IgG, such as IgG4 or IgG1. In some aspects, a portion of the constant region functions as a spacer region between the antigen recognition component, e.g., scFv, and the transmembrane domain. The spacer may be of a length that results in increased responsiveness of the cell after antigen binding, compared to the absence of the spacer. In some examples, the spacer is about 12 amino acids in length, or is 12 amino acids or less in length. Exemplary spacers include those having at least about 10-229 amino acids, about 10-200 amino acids, about 10-175 amino acids, about 10-150 amino acids, about 10-125 amino acids, about 10-100 amino acids, about 10-75 amino acids, about 10-50 amino acids, about 10-40 amino acids, about 10-30 amino acids, about 10-20 amino acids, or about 10-15 amino acids, including any integer between any of the endpoints of the recited ranges. In some embodiments, the spacer region has about 12 amino acids or less, about 119 amino acids or less, or about 229 amino acids or less. Exemplary spacers include a CD8a hinge, an IgG4 hinge alone, an IgG4 hinge linked to a CH2 and CH3 domain, or an IgG4 hinge linked to a CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin.Cancer Res., 19:3153 or International Patent Publication No. WO2014031687. In some embodiments, the CAR hinge comprises a CD8a hinge. In some embodiments, the CD8a hinge comprises the sequence described in SEQ ID NO:27.

[0310] Some intracellular signaling domains mimic or approximate signaling through natural antigen receptors, signaling through such receptors in combination with costimulatory receptors, and / or signaling through costimulatory receptors alone. In some embodiments, a short oligo- or polypeptide linker, e.g., one that contains glycine and serine, e.g., a glycine-serine doublet, 2-10 amino acids in length, is present to form a link between the transmembrane domain and the cytoplasmic signaling domain of the receptor.

[0311] CAR intracellular domain In some embodiments, upon ligation of the CAR, the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one of the normal effector functions or responses of an immune cell, e.g., a T cell engineered to express the receptor. For example, in some contexts, the receptor induces a function of the T cell, such as cytolytic activity or T helper activity, such as secretion of cytokines or other factors. In some embodiments, a truncated portion of the intracellular signaling domain of an antigen receptor component or a costimulatory molecule is used in place of an intact immunostimulatory chain, e.g., when it transduces an effector function signal. In some embodiments, the intracellular signaling domain or intracellular signaling domains include the cytoplasmic sequence of a T cell receptor (TCR), as well as, in some aspects, that of a co-receptor that acts in concert with such receptor in a natural context to initiate signal transduction after antigen receptor engagement, and / or any derivative or variant of such molecule, and / or any synthetic sequence having the same functional capabilities.

[0312] In some embodiments, the receptor comprises a primary cytoplasmic signaling sequence that regulates the primary activation of the TCR complex. The primary cytoplasmic signaling sequence that acts in a stimulatory manner can comprise a signaling motif known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of ITAMs that comprise a primary cytoplasmic signaling sequence include those derived from TCR or CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, and CD66d. In some embodiments, the cytoplasmic signaling molecule(s) in the CAR comprises a cytoplasmic signaling domain, a portion thereof, or a sequence derived from CD3 zeta.

[0313] In some embodiments, the intracellular signaling domain comprises a human CD3 zeta stimulatory signaling domain or a functional variant thereof, such as the 112 AA cytoplasmic domain of human CD3.zeta isoform 3 (Accession Number: P20963.2) or a CD3 zeta signaling domain described in U.S. Pat. No. 7,446,190 or U.S. Pat. No. 8,911,993.

[0314] A receptor, e.g., a CAR, can include at least one intracellular signaling component or multiple intracellular signaling components. In some embodiments, the receptor includes an intracellular component of the TCR complex, such as the TCR CD3 chain, e.g., the CD3 zeta chain, which mediates T cell activation and cytotoxicity. Thus, in some embodiments, the extracellular domain is linked to one or more cell signaling modules. In some embodiments, the cell signaling module includes a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or other CD transmembrane domains. In some embodiments, the receptor, e.g., a CAR, further includes a portion of one or more additional molecules, such as Fc receptor-gamma, CD8, CD4, CD25, or CD16. For example, in some embodiments, the CAR includes a chimeric molecule between CD3-zeta or Fc receptor-gamma and CD8, CD4, CD25, or CD16. In some embodiments, the CAR includes a CD3 zeta activation domain that includes the sequence set forth in SEQ ID NO:30.

[0315] In some embodiments, the intracellular domain comprises the intracellular costimulatory signaling domain of 41BB, or a functional variant or portion thereof, such as the 42 amino acid cytoplasmic domain of human 4-1BB (Accession No. Q07011.1), or a functional variant or portion thereof.

[0316] In some embodiments, the receptor includes one or more, e.g., two or more, costimulatory domains and an activation domain, e.g., a primary activation domain, in the cytoplasmic portion. Exemplary receptors include CD3-zeta, CD28, and the intracellular component of 4-1BB. In some embodiments, the chimeric antigen receptor includes the intracellular domain of a T cell costimulatory molecule. In some aspects, the T cell costimulatory molecule is 4-1BB.

[0317] In some embodiments, the receptor comprises the signaling domain and / or transmembrane portion of a costimulatory receptor such as CD28, 4-1BB, OX40, DAP10, and ICOS, In some aspects, the same receptor comprises both an activating component and a costimulatory component.

[0318] In certain embodiments, the intracellular signaling domain comprises a CD8a transmembrane and signaling domain linked to a CD3 (e.g., CD3-zeta) intracellular domain. In some embodiments, the intracellular signaling domain comprises a 4-1BB (CD137, TNFRSF9) costimulatory domain linked to a CD3 zeta intracellular domain. In some embodiments, the CAR comprises a 4-1BB costimulatory domain. In some embodiments, the 4-1BB costimulatory domain comprises the sequence set forth in SEQ ID NO:29.

[0319] In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO: 31 or 32. In some embodiments, the CAR comprises the sequence set forth in SEQ ID NO: 31.

[0320] In some embodiments, the CAR or other antigen receptor further comprises a marker, such as a cell surface marker, which can be used to confirm the transduction or engineering of cells to express the receptor, such as a truncated version of a cell surface receptor, such as truncated EGFR (tEGFR). In some aspects, the marker comprises all or a portion (e.g., a truncated form) of CD34, nerve growth factor receptor (NGFR), or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably linked to a linker sequence, e.g., a cleavable linker sequence or a ribosomal skip sequence, e.g., a polynucleotide encoding T2A. See WO2014031687. In some embodiments, introduction of a construct encoding CAR and EGFRt separated by a T2A ribosomal switch can express two proteins from the same construct, such that EGFRt can be used as a marker to detect cells expressing such a construct. In some embodiments, the marker, and optionally the linker sequence, can be any, as disclosed in published patent application WO2014031687. For example, the marker can be a truncated EGFR (tEGFR), optionally linked to a linker sequence, such as a T2A ribosomal skip sequence.

[0321] In some embodiments, a marker is a molecule that is not naturally found on T cells or that is not naturally found on the surface of T cells, e.g., a cell surface protein, or portion thereof.

[0322] In some embodiments, the molecule is a non-self molecule, eg, a non-self protein, ie, a molecule that is not recognized as "self" by the immune system of the host into which the cells are adoptively transferred.

[0323] In some embodiments, the marker does not serve a therapeutic function and / or produce no effect other than being used as a marker for genetic engineering, e.g., to select successfully engineered cells. In other embodiments, the marker may be a therapeutic molecule, or a molecule that exerts some desired effect in other ways, e.g., a ligand for cells encountered in vivo, e.g., a co-stimulatory or immune checkpoint molecule to enhance and / or attenuate the response of cells upon adoptive transfer and upon encounter with the ligand.

[0324] CARs may contain one or more modified synthetic amino acids in place of one or more naturally occurring amino acids. Exemplary modified amino acids include aminocyclohexanecarboxylic acid, norleucine, α-amino n-decanoic acid, homoserine, S-acetylaminomethylcysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, (3-phenylserine, (3-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2, These include, but are not limited to, 3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentanecarboxylic acid, α-aminocyclohexanecarboxylic acid, α-aminocycloheptanecarboxylic acid, α-(2-amino-2-norbornane)-carboxylic acid, α,γ-diaminobutyric acid, α,γ-diaminopropionic acid, homophenylalanine, and α-tertbutylglycine.

[0325] For example, in some embodiments, a CAR comprises an antibody or fragment thereof comprising a single chain antibody (sdAb, e.g., containing only a VH region), a VH domain, and a scFv described herein, and a spacer, e.g., a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain. In some embodiments, a CAR comprises an antibody or fragment thereof comprising a sdAb and a scFv described herein, and a spacer, e.g., a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain.

[0326] The transgenes expressing the priming receptor and CAR system can be introduced into cells, e.g., T cells, using, for example, site-specific techniques. In the site-specific integration of the transgene (e.g., the priming receptor and CAR), the transgene can be targeted to a safe harbor locus or TRAC. Examples of site-specific techniques for integration into a safe harbor locus include, but are not limited to, homology-dependent engineering using nucleases and homology-independent targeted insertion using Cas9.

[0327] The engineered cells have applications in immuno-oncology. For example, priming receptors and CARs can be selected to target different specific tumor antigens. Examples of cancers that can be effectively targeted using such cells are blood cancers or solid cancers. In some embodiments, immune cell therapy can be used to treat solid tumors.

[0328] Recombinant Nucleic Acids and Vectors In another aspect, one or more recombinant nucleic acids are provided herein, the one or more recombinant nucleic acids encoding a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen binding domain that specifically binds prostate specific membrane antigen (PSMA); a second chimeric polypeptide comprising a CAR comprising a second extracellular antigen binding domain that specifically binds carbonic anhydrase IX (CA9); and at least one nucleic acid sequence at least 15 nucleotides in length, the nucleic acid sequence being selected from the group consisting of a nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39; a nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40; and a nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:41.

[0329] In another aspect, one or more recombinant nucleic acids are provided herein, the one or more recombinant nucleic acids comprising a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen binding domain that specifically binds prostate-specific membrane antigen (PSMA), the first extracellular antigen binding domain comprising a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5, and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6. and a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and at least one nucleic acid sequence at least 15 nucleotides in length, the at least one nucleic acid sequence comprising one or more of: (1) a first nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:39; (2) a second nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding the human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40; and (3) a third nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding the human thymocyte selection-associated high mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0330] In another aspect, one or more recombinant nucleic acids are provided herein, the one or more recombinant nucleic acids comprising a first chimeric polypeptide comprising a priming receptor and a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen binding domain that specifically binds to carbonic anhydrase IX (CA9), wherein the second extracellular antigen binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, CDR-L1 comprises the sequence set forth in SEQ ID NO: 13, and CDR-L2 comprises the sequence set forth in SEQ ID NO: 14. and at least one nucleic acid sequence at least 15 nucleotides in length, the at least one nucleic acid sequence comprising one or more of: (1) a first nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding the human Fas cell-surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:39; (2) a second nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding the human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40; and (3) a third nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding the human thymocyte-selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0331] RNA interference molecules The Fas cell surface death receptor (FAS) is a member of the apoptosis-inducing TNF receptor superfamily. Protein tyrosine phosphatase non-receptor type 2 (PTPN2) is a phosphatase that regulates interferon and many other signaling pathways. Thymocyte selection-associated high mobility group box (TOX) is a transcription factor that regulates the differentiation of exhausted T cells.

[0332] As used herein, a "target gene" refers to a nucleic acid sequence in a cell, the expression of which can be specifically and effectively regulated using the recombinant nucleic acid molecules and methods described herein. In certain embodiments, the target gene can be involved in the growth (proliferation), maintenance (survival) and / or immune behavior of an individual's immune cells. In some embodiments, the target gene is FAS. In some embodiments, the target gene is PTPN2. In some embodiments, the target gene is TOX. In some embodiments, two or more target genes are regulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, at least two target genes are regulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, the recombinant nucleic acid molecule(s) is an shRNA. In some embodiments, the target genes are at least FAS and PTPN2. In some embodiments, the target genes are at least FAS and TOX.

[0333] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39.

[0334] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence of at least 15 nucleotides in length that is complementary to nucleotides 518 to 559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO:40.

[0335] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence of at least 15 nucleotides in length that is complementary to nucleotides 1294 to 2141 of an mRNA encoding a human thymocyte-selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0336] In some embodiments, the recombinant nucleic acid comprises a first nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518-559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40.

[0337] In some embodiments, the recombinant nucleic acid comprises a first nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1294-2141 of an mRNA encoding human thymocyte-selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0338] In some embodiments, the recombinant nucleic acid comprises a first nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518-559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:40, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1294-2141 of an mRNA encoding human thymocyte-selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:41.

[0339] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 42-71. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 45. In some embodiments, the nucleic acid is capable of reducing expression of FAS in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to control cells not containing the nucleic acid.

[0340] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 72-97. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 82. In some embodiments, the nucleic acid is capable of reducing expression of PTPN2 in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell not containing the nucleic acid.

[0341] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 98-125. In some embodiments, the nucleic acid comprises a sequence set forth in SEQ ID NO: 99 or 104. In some embodiments, the nucleic acid is capable of reducing expression of TOX in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell not containing the nucleic acid.

[0342] In some embodiments, the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.

[0343] In some embodiments, at least one nucleic acid sequence is a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs:157-164.

[0344] In some embodiments, the nucleic acid is an RNA interference (RNAi) molecule.Exemplary RNAi molecules include short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotide.In some embodiments, the nucleic acid is a short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotide.In some embodiments, the nucleic acid is an shRNA.

[0345] Single stranded hairpin ribonucleic acid (shRNA) is a short double strand, in which the sense and antisense strands are connected by a hairpin loop. They consist of a stem-loop structure, which can be transcribed in cells from an RNA polymerase II or RNA polymerase III promoter on a plasmid construct. When expressed, the shRNA is processed into an RNAi species. The expression of shRNA from a plasmid is known to be relatively stable, thereby offering a strong advantage over the use of, for example, synthetic siRNA. The shRNA expression unit can be incorporated into various plasmids, liposomes, viral vectors, and other vehicles for delivery and integration into target cells. The expression of shRNA from a plasmid can be stably integrated for constitutive expression. The shRNA is synthesized in the nucleus of the cell, further processed, transported to the cytoplasm, and then integrated into the RNA-induced silencing complex (RISC) for activity. The shRNA is converted into an active siRNA molecule (capable of binding to, sequestering, and / or preventing the translation of the mRNA transcript encoded by the target gene).

[0346] The Argonaute family of proteins is the main component of RISC. Within the Argonaute family of proteins, only Ago2 contains endonuclease activity that can cleave and release passenger strand from the stem of shRNA molecule. The remaining three members of the Argonaute family, Ago1, Ago3 and Ago4, which do not have discernible endonuclease activity, also assemble to construct RISC and are thought to function through cleavage-independent manner. Therefore, RISC can be characterized as having cleavage-dependent and cleavage-independent pathways.

[0347] RNAi (e.g., antisense RNA, siRNA, microRNA, shRNA, etc.) is described in International Publication Nos. WO2018232356A1, WO2019084552A1, WO2019226998A1, WO2020014235A1, WO2020123871A1, and WO2020186219A1, each of which is incorporated by reference herein for all purposes.

[0348] Antisense oligonucleotide structure and chemical modifications are described in International PCT Publication No. WO20 / 132521, which is incorporated herein by reference.

[0349] dsRNA and shRNA molecules, as well as methods of use and production, are described in US Pat. No. 8,829,264, US Pat. No. 9,556,431, and US Pat. No. 8,252,526, each of which is incorporated herein by reference.

[0350] siRNA molecules, as well as methods of use and production, are described in US Pat. No. 7,361,752 and US Patent Application No. US20050048647, both of which are incorporated herein by reference.

[0351] Additional methods and compositions for RNA interference, e.g., shRNA, siRNA, dsRNA, and antisense oligonucleotides, are generally known in the art and are further described in U.S. Pat. No. 7,361,752, U.S. Pat. No. 8,829,264, U.S. Pat. No. 9,556,431, U.S. Pat. No. 8,252,526, International PCT Publication No. WO00 / 44895, International PCT Publication No. WO01 / 36646, International PCT Publication No. WO99 / 32619, International PCT Publication No. WO00 / 01846, International PCT Publication No. WO01 / 29058, International PCT Publication No. WO00 / 44914, and International PCT Publication No. WO04 / 030634, each of which is incorporated herein by reference.

[0352] The nucleic acid sequence (or construct) that can be used to encode the RNAi molecule, e.g., shRNA, described herein, can include a promoter that is operably linked (or connected) directly or indirectly to the sequence encoding the RNAi molecule. Such a promoter can be selected based on the host cell and the effect desired. Non-limiting examples of suitable promoters include constitutive and inducible promoters, e.g., EF1α or inducible RNA polymerase II (pol II)-based promoters. Non-limiting examples of suitable promoters further include tetracycline-inducible or repressible promoters, RNA polymerase I or III-based promoters, pol II-dependent viral promoters, e.g., CMV-IE promoter, and pol III U6 and H1 promoters. Also, the bacteriophage T7 promoter can be used (it will be understood that in this case, T7 polymerase must also be present). In particular, the nucleic acid sequence need not be limited to the use of any single promoter, since the nucleic acid sequence can include two or more shRNAs (i.e., combinations of effectors), including but not limited to integrated shRNA molecules. Each integrated promoter can control one or any combination of the shRNA molecule components.

[0353] In certain embodiments, the promoter may be preferentially active in the target cell, e.g., it may be desirable to preferentially express at least one recombinant nucleic acid in immune cells using an immune cell-specific promoter. Introduction of such constructs into a host cell may be performed under conditions in which two or more recombinant nucleic acids contained within a recombinant nucleic acid precursor transcript are initially present within a single primary transcript, whereby separate RNA molecules (e.g., shRNAs, each shRNA containing its own stem-loop structure) are subsequently excised from such precursor transcript by endogenous ribonucleases. The resulting mature recombinant nucleic acid (e.g., shRNA) may then induce degradation and / or translational repression of the target gene mRNA transcript produced in the cell. Alternatively, each of the precursor stem-loop structures may be produced as part of a separate transcript, in which case each recombinant nucleic acid sequence preferably includes its own promoter and transcription termination sequence. Additionally, multiple recombinant nucleic acid precursor transcripts may be present within a single primary transcript.

[0354] The stem-loop structure of the shRNA recombinant nucleic acid described herein may be about 40-100 nucleotides long, or preferably about 50-75 nucleotides long. The stem region may be about 15-45 nucleotides long (or more), or about 20-30 nucleotides long. In some embodiments, the stem region is 22 nucleotides long. In some embodiments, the stem region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides long.

[0355] The stem may contain a fully complementary duplex (but for either 3' tail), but a bulge or internal loop may be present on either arm of the stem. The number of such bulges and asymmetric internal loops is preferably small (e.g., 1, 2 or 3) and about 3 nucleotides or less in size. The terminal loop portion may contain about 4 or more nucleotides, but preferably about 25 or less. The loop portion is preferably 6 to 15 nucleotides in size.

[0356] As described herein, the stem region of shRNA comprises a passenger strand and a guide strand, whereby the guide strand comprises a sequence that is complementary to the target mRNA transcript encoded by the target gene(s).Preferably, the GC content and matching of the guide strand and the passenger strand are carefully designed for thermodynamically favorable strand unwinding activity with or without endonuclease cleavage.Furthermore, the specificity of the guide strand is preferably confirmed through BLAST search (www.ncbi.nim.nih.qov / BLAST).

[0357] The present invention provides that the expression levels of multiple target genes can be regulated using the methods and recombinant nucleic acids described herein. For example, the present invention provides that a first set of recombinant nucleic acids can be designed to include a sequence (guide strand) designed to reduce the expression level of a first target gene, and a second set of recombinant nucleic acids can be designed to include a sequence (guide strand) designed to reduce the expression level of a second target gene. The different sets of recombinant nucleic acids can be expressed and reside within the same or separate pre-transcripts. In certain embodiments, such a multiplex approach, i.e., the use of the recombinant nucleic acids described herein to regulate the expression levels of two or more target genes, can have an enhanced therapeutic effect on a patient. For example, when a patient is provided with cells expressing the recombinant nucleic acid molecules described herein to treat, prevent or ameliorate the effects of cancer, it may be desirable to provide the patient with two or more types of recombinant nucleic acid molecules designed to reduce the expression levels of multiple genes involved in immune cell activation or suppression.

[0358] The recombinant nucleic acid molecule(s) described herein may be capable of reducing target gene expression in a cell by at least about 50% or more compared to a control cell that does not contain the recombinant nucleic acid molecule(s). For example, the recombinant nucleic acid molecule(s) (e.g., shRNA) may be capable of reducing expression of a target gene selected from the group consisting of FAS, PTPN2, and TOX in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more compared to a control cell that does not contain the recombinant nucleic acid molecule(s). For example, the recombinant nucleic acid molecule(s) can be capable of reducing expression of a target gene selected from the group consisting of FAS, PTPN2 and TOX in an immune cell by at least about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55% or less compared to a control cell not containing the recombinant nucleic acid molecule(s). In some embodiments, the recombinant nucleic acid molecule(s) can reduce expression of FAS in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell not containing the recombinant nucleic acid molecule(s). In some embodiments, the recombinant nucleic acid molecule(s) are capable of reducing expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% as compared to control cells that do not contain the recombinant nucleic acid molecule(s). In some embodiments, the recombinant nucleic acid molecule(s) are capable of reducing expression of TOX in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% as compared to control cells that do not contain the recombinant nucleic acid molecule(s).

[0359] The recombinant nucleic acid molecule(s) can be chemically synthesized or in vitro transcribed and can further contain one or more modifications to the sugar phosphate backbone or nucleoside residues.

[0360] Other methods known in the art for introducing nucleic acids into cells may be used, such as lipid-mediated carrier transport and chemically-mediated transport, such as calcium phosphate. Thus, recombinant nucleic acid molecule(s) constructs may be introduced with components that perform one or more of the following activities: enhancing RNA uptake by cells, promoting annealing of duplexes for shRNA, stabilizing the annealed shRNA strands, or otherwise increasing inhibition of the target gene.

[0361] Additional Elements In some embodiments, the one or more recombinant nucleic acid(s) further comprises a 5' homology-directed repair arm and / or a 3' homology-directed repair arm, wherein the 5' homology-directed repair arm and / or the 3' homology-directed repair arm are complementary to the insertion site in the host cell chromosome. In some embodiments, the one or more recombinant nucleic acid(s) comprises a 5' homology-directed repair arm and a 3' homology-directed repair arm. In some embodiments, the one or more recombinant nucleic acid(s) is incorporated into an expression cassette or expression vector. In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the one or more recombinant nucleic acid(s).

[0362] In some embodiments, the priming receptor, the CAR, the first nucleic acid, and the second nucleic acid are integrated into a single expression cassette or a single expression vector. In some embodiments, the priming receptor, the CAR, the first nucleic acid, and the second nucleic acid are integrated into two or more expression cassettes or expression vectors. In some embodiments, the expression vector(s) is a non-viral vector.

[0363] One or more interfering nucleic acid sequences (e.g., one or more shRNAs) can be encoded in an intron region of a recombinant nucleic acid insert, a DNA template, a single expression cassette, or a single expression vector, which also encodes a priming receptor and / or a CAR. For example, when a DNA template includes a promoter, such as EF1α or an inducible promoter described herein, to drive expression of a CAR or a priming receptor, one or more nucleic acid sequences (e.g., shRNA sequences) can be encoded in a promoter intron region. In some embodiments, one or more nucleic acid sequences are encoded in at least one intron region of a recombinant nucleic acid insert or a DNA template. In some embodiments, one or more nucleic acid sequences are encoded in at least one EF1α intron region of a recombinant nucleic acid insert or a DNA template.

[0364] In some embodiments, the present disclosure contemplates a recombinant nucleic acid DNA template insert comprising one or more transgenes encoding a priming receptor and / or a CAR as described herein. In some embodiments, the DNA template insert encodes a priming receptor transgene. In some embodiments, the DNA template insert encodes a chimeric antigen receptor transgene. In some embodiments, the DNA template insert encodes a first nucleic acid that is complementary to at least 15 nucleotides of the human FAS mRNA sequence, and a second nucleic acid that is complementary to at least 15 nucleotides of the human PTPN2 or TOX mRNA sequence. In some embodiments, the DNA template insert comprises a priming receptor transgene and a chimeric antigen receptor transgene. In some embodiments, the DNA template insert comprises a priming receptor transgene, a chimeric antigen receptor transgene, a first nucleic acid that is complementary to at least 15 nucleotides of the human FAS mRNA sequence, and a second nucleic acid that is complementary to at least 15 nucleotides of the human PTPN2 or TOX mRNA sequence. In some embodiments, the DNA template insert comprises a priming receptor transgene, a chimeric antigen receptor transgene, a first nucleic acid that is complementary to at least 15 nucleotides of the human FAS mRNA sequence, and a second nucleic acid that is complementary to at least 15 nucleotides of the human PTPN2 mRNA sequence.

[0365] In some embodiments, one or more recombinant nucleic acid(s) are encoded on a single DNA template insert. In some embodiments, one or more recombinant nucleic acid(s) are encoded on multiple DNA template inserts. For example, one or more recombinant nucleic acid(s) can be encoded on two, three, or four DNA template inserts.

[0366] The DNA template insert can also include a self-cleaving peptide. Examples of self-cleaving peptides include, but are not limited to, self-cleaving viral 2A peptides, such as porcine teschovirus-1 (P2A) peptide, Thosea asigna virus (T2A) peptide, equine rhinitis A virus (E2A) peptide, or foot and mouth disease virus (F2A) peptide. Self-cleaving 2A peptides allow the expression of multiple gene products from a single construct. (See, for example, Chang et al. "Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells," MAbs 7(2):403-412 (2015)).

[0367] The DNA template insert can also include a WPRE element, which is generally described in Higashimoto, T., et al. Gene Ther 14, 1298-1304 (2007), and Zufferey, R., et al. J Virol. 1999 Apr; 73(4): 2886-92, both of which are incorporated herein by reference.

[0368] The DNA template insert can also include an SV40 polyA tail.

[0369] Recombinant cells Also provided herein is a recombinant immune cell comprising at least one DNA template that is non-virally inserted into a target region of the genome of a cell, the DNA template encoding the priming receptor and CAR system described herein.Also provided herein is a recombinant immune cell comprising a priming receptor that specifically binds to prostate specific membrane antigen (PSMA) and a chimeric antigen receptor that specifically binds to CA9.

[0370] A cell containing a DNA template insert at a target locus or safe harbor site as described in this disclosure may be referred to as an engineered cell. In some embodiments, the immune cell is any cell that can give rise to a pluripotent immune cell. In some embodiments, the immune cell is a primary immune cell. In some embodiments, the immune cell may be an induced pluripotent stem cell (iPSC) or a human pluripotent stem cell (HSPC). In some embodiments, the immune cell comprises a primary hematopoietic cell or a primary hematopoietic stem cell. In some embodiments, the engineered cell is a stem cell, a human cell, a primary cell, a hematopoietic cell, an adaptive immune cell, an innate immune cell, a natural killer (NK) cell, a T cell, a CD8+ cell, a CD4+ cell, or a T cell precursor. In some embodiments, the immune cell is a T cell. In some embodiments, the T cell is a regulatory T cell, an effector T cell, or a naive T cell. In some embodiments, the T cell is a CD8 + In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD4 + CD8 + T cells.

[0371] In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, hematopoietic stem cells, adaptive immune cells, innate immune cells, T cells, or T cell precursors. Non-limiting examples of immune cells contemplated in the present disclosure include T cells, B cells, natural killer (NK) cells, NKT / iNKT cells, macrophages, bone marrow cells, and dendritic cells. Non-limiting examples of stem cells contemplated in the present disclosure include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo-derived embryonic stem cells obtained by nuclear transfer (ntES; nuclear transfer ES), male germ cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem / progenitor stem cells (HSPCs), somatic cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells, and other cell (including bone cells, chondrocytes, muscle cells, cardiomyocytes, neurons, tendon cells, adipocytes, pancreatic cells, hepatocytes, kidney cells, and follicular cells, etc.) stem cells. In some embodiments, the engineered cells are T cells, NK cells, iPSCs, and HSPCs. In some embodiments, the engineered cells used in the present disclosure are human cell lines (e.g., intentionally immortalized cell lines, cancer cell lines, etc.) grown in vitro.

[0372] Also provided herein is a population of cells comprising a plurality of immune cells, in some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genomes of the cells comprise the priming receptor and CAR system described herein.

[0373] How to Treat Cancer CA9 is known to be overexpressed in glioblastoma, triple-negative breast cancer (TNBC), ovarian cancer, colorectal cancer, and non-small cell lung cancer (NSCLC). PSMA is known to be overexpressed in renal cell carcinoma, clear cell renal cell carcinoma (ccRCC), gastric cancer, colorectal cancer, urothelial carcinoma, hepatocellular carcinoma (HCC), triple-negative breast cancer (TNBC), non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC), and sarcoma.

[0374] In another aspect, the invention provides a method of treating an immune-related condition (e.g., cancer) in an individual, comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9. In another aspect, the invention provides a method of enhancing an immune response in an individual, comprising administering to the individual an effective amount of a cell comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9.

[0375] In some embodiments, the methods provided herein are useful for treating an immune-related condition in an individual. In certain embodiments, the individual is a human.

[0376] In some embodiments, the methods provided herein (such as methods of enhancing an immune response) are useful for the treatment of cancer, such that an individual receiving a system described herein has cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a liquid cancer. In some embodiments, the cancer is immune evasive. In some embodiments, the cancer is immune responsive. In some embodiments, the cancer is renal cell carcinoma. In certain embodiments, the cancer is clear cell renal cell carcinoma (ccRCC). In some embodiments, the cancer is papillary renal carcinoma.

[0377] In some embodiments, the treatment results in a decrease in cancer volume or size. In some embodiments, the treatment is effective in reducing the cancer volume compared to the cancer volume before administration of the antibody. In some embodiments, the treatment results in a decrease in cancer growth rate. In some embodiments, the treatment is effective in reducing the cancer growth rate compared to the cancer growth rate before administration of the antibody. In some embodiments, the treatment is effective in eliminating the cancer.

[0378] In some embodiments, CA9 and PSMA are expressed at higher levels in cancer compared to non-cancer cells.The level of CA9 and PSMA can be evaluated by any technique known in the art, including but not limited to protein or nuclear assay, such as FACS, Western blot, ELISA, immunoprecipitation, immunohistochemistry, immunofluorescence, radioimmunoassay, dot blotting, immunodetection method, HPLC, surface plasmon resonance, optical spectroscopy, mass spectrometry, HPLC, qPCR, RT-qPCR, multiplex qPCR or RT-qPCR, RNA-seq, microarray analysis, SAGE, MassARRAY technique, and FISH, and combinations thereof.

[0379] Methods of immunomodulation The method of administration of cells comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9 as described herein can result in modulation of the immune response. The modulation can be an increase or a decrease in the immune response. In some embodiments, the modulation is an increase in the immune response.

[0380] In one aspect, administration of cells comprising the system described herein, comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9, can result in the induction of proinflammatory molecules, such as cytokines or chemokines. In general, the induced proinflammatory molecules are present at levels above those achieved with isotype controls. Such proinflammatory molecules then result in the activation of antitumor immunity, including, but not limited to, T cell activation, T cell proliferation, T cell differentiation, M1-like macrophage activation, and NK cell activation. Thus, administration of a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9 can induce multiple antitumor immune mechanisms that result in tumor destruction.

[0381] In another aspect, provided herein is a method for increasing an immune response in an individual, comprising administering to the individual an effective amount of cells comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9. In some embodiments, the method for increasing an immune response in a subject comprises administering to the subject a cell comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9.

[0382] In some embodiments, the cells are present in a pharmaceutical composition that further comprises a pharma- ceutically acceptable excipient.

[0383] In any of the embodiments described herein for increasing an immune response, the increase or decrease or alteration of any aspect of the characteristic(s) or function(s) is compared to cells that do not contain a composition comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9.

[0384] Increasing the immune response can be both enhancing the immune response or inducing the immune response. For example, increasing the immune response encompasses both initiating or initiating an immune response or increasing or amplifying an ongoing or existing immune response. In some embodiments, the treatment induces an immune response. In some embodiments, the induced immune response is an adaptive immune response. In some embodiments, the induced immune response is an innate immune response. In some embodiments, the treatment enhances an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the treatment increases an immune response. In some embodiments, the increased immune response is an adaptive immune response. In some embodiments, the increased immune response is an innate immune response. In some embodiments, the immune response is started or initiated by administration of cells comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9. In some embodiments, the immune response is enhanced by administration of a cell comprising a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9.

[0385] In another aspect, the present application provides a method for gene editing a cell using a system comprising a priming receptor that specifically binds PSMA and a chimeric antigen receptor that specifically binds CA9, which results in modulation of the immune function of the cell. The modulation can be an increase in immune response. In some embodiments, the modulation is an increase in immune function. In some embodiments, the modulation of function results in expression of CA9 CAR. In some embodiments, the modulation of function results in activation of the cell comprising the system.

[0386] In some embodiments, the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

[0387] In some embodiments, modulation of a function of a cell comprising a priming receptor and a CAR system as described herein results in an increase in the ability of the cell to stimulate both naive and activated T cells, for example, by increasing cytokine or chemokine secretion by the cell expressing the priming receptor and the CAR system. In some embodiments, modulation of function enhances or increases the ability of the cell to produce a cytokine, a chemokine, a CAR, or a co-stimulatory or activating receptor. In some embodiments, modulation increases a T cell stimulatory function of a cell expressing a priming receptor and a CAR system, where T cell stimulatory function includes, for example, the ability of the cell to trigger T cell receptor (TCR) signaling, T cell proliferation, or T cell cytokine production.

[0388] In some embodiments, the increased immune response is secretion of cytokines and chemokines. In some embodiments, the priming receptor and CAR system induces increased expression of at least one cytokine or chemokine in the cells compared to isotype control cells. In some embodiments, the at least one cytokine or chemokine is selected from the group consisting of IL-2 and IFNγ. In some embodiments, the cytokine or chemokine is IL-2. In some embodiments, the cytokine or chemokine is IFNγ. In some embodiments, cytokine or chemokine secretion is increased by about 1-100 fold, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the chemokine is IL-2 and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody. In some embodiments, the cytokine is IFNγ and secretion is increased by about 1-100 fold, 1 fold, 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 1-10 fold, 10-20 fold, 20-30 fold, 30-40 fold, 40-50 fold, 50-60 fold, 60-70 fold, 70-80 fold, 80-90 fold, or 90-100 fold compared to untreated cells or cells treated with an isotype control antibody.

[0389] In some embodiments, the enhanced immune response is anti-tumor immune cell recruitment and activation.

[0390] In some embodiments, cells expressing the priming receptor and CAR system induce a memory immune response compared to isotype control cells. Generally, a memory immune response is a protective immune response upon subsequent exposure to a pathogen or antigen previously encountered by the immune system. Exemplary memory immune responses include immune responses following infection or vaccination with an antigen. Generally, memory immune responses are mediated by lymphocytes, e.g., T cells or B cells. In some embodiments, the memory immune response is a protective immune response to cancer, including cancer cell growth, proliferation, or metastasis. In some embodiments, the memory immune response inhibits, prevents, or reduces cancer cell growth, proliferation, or metastasis.

[0391] How to edit cells The term "gene editing" or "genome editing," as used herein, refers to a type of genetic engineering in which DNA is inserted, replaced, or removed from a genome using engineered nucleases or "molecular scissors." This is a useful tool for elucidating the function and effect of sequence-specific genes or proteins, or for modifying cellular behavior (e.g., for therapeutic purposes).

[0392] Currently available genome editing tools include zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) for integrating genes into safe harbor loci (e.g., the adeno-associated virus integration site 1 (AAVS1) safe harbor locus). The DICE (dual integrase cassette exchange) system, which utilizes phiC31 integrase and Bxb1 integrase, is a tool for targeted integration. Additionally, the clustered regularly interspaced short palindromic repeats / Cas9 (CRISPR / Cas9) technique can be used for targeted gene insertion.

[0393] Site-specific gene editing approaches can include homology-dependent or homology-independent mechanisms.

[0394] All methods known in the art for targeted insertion of gene sequences are contemplated in the methods described herein for inserting constructs into gene target or safe harbor loci.

[0395] Provided herein is a method for inserting a nucleotide sequence of more than about 5 kilobases in length into the genome of a cell in the absence of a viral vector. In some embodiments, a nucleotide sequence of more than about 5 kilobases in length can be inserted into the genome of a primary immune cell in the absence of a viral vector.

[0396] The integration of large nucleic acids, for example nucleic acids with a size of more than 5 kilobases, into cells can be limited by low integration efficiency, off-target effects, and / or loss of cell viability.Methods and compositions are described herein for achieving integration of nucleotide sequences, for example nucleotide sequences with a size of more than about 5 kilobases, into the genome of a cell.Some methods improve integration efficiency, reduce off-target effects, and / or reduce loss of cell viability.

[0397] The plasmid can be introduced into the immune cell using a nuclease, for example, a CRISPR-associated system (Cas). The nuclease can be introduced into a ribonucleoprotein format by a guide RNA (gRNA) that targets a specific site on the genome of the immune cell. The nuclease cuts the genomic DNA at this specific site. The specific site can be a portion of the genome that codes for an endogenous immune cell receptor. Thus, when the genome is cut at this site, the immune cell no longer expresses the endogenous immune cell receptor.

[0398] The plasmid may contain 5' and 3' homology-directed repair arms that are complementary to sequences at specific sites on the genome of the immune cell. The complementary sequences are on either side of the site cleaved by the nuclease, allowing the plasmid to be integrated into the designated insertion site on the genome of the immune cell. Once the plasmid is integrated, the cell expresses the priming receptor. However, as described, the design of the transgene cassette ensures that the non-viral delivery circuitry receptor does not express the CAR until the priming receptor binds its cognate ligand and releases the cleavable transcription factor.

[0399] First, T cells are activated. T cells can be obtained from a patient. Thus, the present disclosure provides a method in which immune cells, such as T cells, are harvested from a patient. Then, a plasmid encoding a CAR and a priming receptor is introduced into the T cells. Advantageously, the plasmid of the present disclosure can be introduced using electroporation. When introducing the plasmid via electroporation, a nuclease can also be introduced. By using electroporation, the method of the present disclosure avoids the use of viral vectors to introduce transgenes, which is a known bottleneck in immune cell engineering. Then, the T cells are expanded and co-cultured to generate sufficient amounts of engineered immune cells to be used as a therapeutic treatment.

[0400] A method for editing the genome of a cell can include a) providing a Cas9 ribonucleoprotein complex (RNP)-DNA template complex comprising: (i) an RNP, wherein the RNP comprises a Cas9 nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell, and wherein the Cas9 nuclease domain cleaves the target region to create an insertion site in the genome of the cell; and (ii) a double-stranded or single-stranded DNA template, wherein the size of the DNA template is greater than about 200 nucleotides, the 5' and 3' ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site, and wherein the molar ratio of RNP to DNA template in the complex is from about 3:1 to about 100:1; and b) introducing the RNP-DNA template complex into the cell.

[0401] In some embodiments, the methods described herein provide an efficiency of delivery of RNP-DNA template complexes of at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the efficiency is determined in terms of cells that are viable after introducing the RNP-DNA template into the cells. In some cases, the efficiency is determined in terms of the total number of cells (viable or non-viable) into which the RNP-DNA template is introduced.

[0402] As another example, the efficiency of delivery can be determined by quantifying the number of genome-edited cells in a cell population (compared to the total cells or total viable cells obtained after the introduction step). Various methods for quantifying genome editing can be utilized. These methods include, but are not limited to, the use of mismatch-specific nucleases such as T7 endonuclease I, sequencing one or more target loci (e.g., by Sanger sequencing of cloned target locus amplified fragments), and high-throughput large-scale sequencing.

[0403] In some embodiments, the loss of cell viability is reduced compared to the loss of cell viability after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these percentages. In some embodiments, the off-target effect of integration is reduced compared to off-target integration after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these percentages.

[0404] In some cases, the methods described herein provide high cell viability of cells into which the RNP-DNA template has been introduced. In some cases, the viability of cells into which the RNP-DNA template has been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the viability of cells into which the RNP-DNA template has been introduced is about 20% to about 99%, about 30% to about 90%, about 35% to about 85% or 90% or more, about 40% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 60% to about 85% or 90% or more, or about 70% to about 85% or 90% or more.

[0405] In the methods provided herein, the molar ratio of RNP to DNA template can be from about 3:1 to about 100:1. For example, the molar ratio can be from about 5:1 to about 10:1, from about 5:1 to about 15:1, from 5:1 to about 20:1, from 5:1 to about 25:1, from about 8:1 to about 12:1, from about 8:1 to about 15:1, from about 8:1 to about 20:1, or from about 8:1 to about 25:1.

[0406] In some embodiments, the DNA template is at a concentration of about 2.5 pM to about 25 pM. For example, the DNA template can be at a concentration of about 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM, or any concentration between these concentrations.

[0407] In some embodiments, the size or length of the DNA template is about 4.5kb, 5.0kb, 5.1kb, 5.2kb, 5.3kb, 5.4kb, 5.5kb, 5.6kb, 5.7kb, 5.8kb, 5.9kb, 6.0kb, 6.1kb, 6.2kb, 6.3kb, 6.4kb, 6.5kb, 6.6kb, 6.7kb, 6.8kb, 6.9kb, 7.0kb, 7.1kb, 7.2kb, 7.3kb, 7.4kb, 7.5kb, 7.6kb, 7.7kb, 7.8kb, 7.9kb, 8.0kb, 8.1kb, 8.2kb, 8.3kb, 8.4kb, 8.5kb, 8.6kb, 8.7kb, 8.8kb, 8.9kb, 9.0kb, 9.1kb, 9.2kb, 9.3kb, 9.4kb, 9.5kb, 9.6kb, 9.7kb, 9.8kb, 9.9kb, 10.0kb, 10.1kb, 10.2kb, 10.3kb, 10.4kb, 10.5kb, 10.6kb, 10.7kb, 10.8kb, 10.9kb, 10.8kb, 10.9kb, 11.0kb, 11.2kb, 11.4kb, 11.5kb, 11.6kb, 11. The DNA template may be greater than 5kb, 7.6kb, 7.7kb, 7.8kb, 7.9kb, 8.0kb, 8.1kb, 8.2kb, 8.3kb, 8.4kb, 8.5kb, 8.6kb, 8.7kb, 8.8kb, 8.9kb, 9.0kb, 9.1kb, 9.2kb, 9.3kb, 9.4kb, 9.5kb, 9.6kb, 9.7kb, 9.8kb, 9.9kb, or 10kb, or any size in between these sizes. For example, the size of the DNA template can be about 4.5 kb to about 10 kb, about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about 6 kb to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, or about 9 kb to about 10 kb.

[0408] In some embodiments, the amount of DNA template is about 1 μg to about 10 μg. For example, the amount of DNA template can be about 1 μg to about 2 μg, about 1 μg to about 3 μg, about 1 μg to about 4 μg, about 1 μg to about 5 μg, about 1 μg to about 6 μg, about 1 μg to about 7 μg, about 1 μg to about 8 μg, about 1 μg to about 9 μg, or about 1 μg to about 10 μg. In some embodiments, the amount of DNA template is about 2 μg to about 3 μg, about 2 μg to about 4 μg, about 2 μg to about 5 μg, about 2 μg to about 6 μg, about 2 μg to about 7 μg, about 2 μg to about 8 μg, about 2 μg to about 9 μg, or 2 μg to about 10 μg. In some embodiments, the amount of DNA template is about 3 μg to about 4 μg, about 3 μg to about 5 μg, about 3 μg to about 6 μg, about 3 μg to about 7 μg, about 3 μg to about 8 μg, about 3 μg to about 9 μg, or about 3 μg to about 10 μg. In some embodiments, the amount of DNA template is about 4 μg to about 5 μg, about 4 μg to about 6 μg, about 4 μg to about 7 μg, about 4 μg to about 8 μg, about 4 μg to about 9 μg, or about 4 μg to about 10 μg. In some embodiments, the amount of DNA template is about 5 μg to about 6 μg, about 5 μg to about 7 μg, about 5 μg to about 8 μg, about 5 μg to about 9 μg, or about 5 μg to about 10 μg. In some embodiments, the amount of DNA template is about 6 μg to about 7 μg, about 6 μg to about 8 μg, about 6 μg to about 9 μg, or about 6 μg to about 10 μg. In some embodiments, the amount of DNA template is about 7 μg to about 8 μg, about 7 μg to about 9 μg, or about 7 μg to about 10 μg. In some embodiments, the amount of DNA template is about 8 μg to about 9 μg, or about 8 μg to about 10 μg. In some embodiments, the amount of DNA template is about 9 μg to about 10 μg.

[0409] In some cases, the size of the DNA template is large enough and sufficient quantity to be lethal as naked DNA. In some embodiments, the DNA template encodes a heterologous protein or a fragment thereof. In some embodiments, the DNA template encodes at least one gene. In some embodiments, the DNA template encodes at least two genes. In some embodiments, the DNA template encodes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more genes.

[0410] In some embodiments, the DNA template comprises regulatory sequences, such as promoter and / or enhancer sequences, for regulating expression of the heterologous protein or fragment thereof after insertion into the genome of the cell.

[0411] In some cases, the DNA template is a linear DNA template. In some cases, the DNA template is a single-stranded DNA template. In some cases, the single-stranded DNA template is a pure single-stranded DNA template. As used herein, "pure single-stranded DNA" refers to single-stranded DNA that is substantially devoid of other or opposite strands of DNA. "Substantially devoid" refers to pure single-stranded DNA that is at least 100 times more devoid of one DNA strand than another DNA strand.

[0412] In some cases, the RNP-DNA template complex is formed by incubating the RNP with the DNA template for less than about 1 minute to about 30 minutes at a temperature of about 20° C. to about 25° C. For example, the RNP can be incubated with the DNA template at a temperature of about 20° C., 21° C., 22° C., 23° C., 24° C., or 25° C. for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, or any amount of time in between these times. In another example, the RNP can be incubated with the DNA template for less than about 1 minute to about 1 minute, less than about 1 minute to about 5 minutes, less than about 1 minute to about 10 minutes, about 5 minutes to 10 minutes, about 5 minutes to 15 minutes, about 10 minutes to about 15 minutes, about 10 minutes to about 20 minutes, or about 10 minutes to about 30 minutes at a temperature of about 20° C. to about 25° C. In some embodiments, the RNP-DNA template complex and the cells are mixed prior to introducing the RNP-DNA template complex into the cells.

[0413] In some embodiments, introducing the RNP-DNA template complex comprises electroporation. Methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in the Examples herein. Additional or alternative methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in WO / 2006 / 001614 or Kim, JA et al. Biosens. Bioelectron. 23, 1353-1360 (2008). Additional or alternative methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in U.S. Patent Application Publication Nos. 2006 / 0094095, 2005 / 0064596, or 2006 / 0087522. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Li, L Het al. Cancer Res. Treat. 1, 341-350 (2002), U.S. Patent Nos. 6,773,669, 7,186,559, 7,771,984, 7,991,559, 6485961, 7029916, and U.S. Patent Application Publication Nos. 2014 / 0017213 and 2012 / 0088842, all of which are incorporated herein by reference. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Geng, T. et al., J. Control Release 144, 91-100 (2010), and Wang, J., et al. Lab. Chip 10, 2057-2061 (2010), all of which are incorporated herein by reference.

[0414] In some embodiments, the Cas9 protein can be in an active endonuclease form, such that when bound to a target nucleic acid as part of a complex with a guide RNA or a complex with a DNA template, a double-stranded break is introduced into the target nucleic acid. The double-stranded break can be repaired by NHEJ to introduce random mutations, or can be introduced by HDR to introduce specific mutations. Various Cas9 nucleases can be utilized in the methods described herein. For example, a Cas9 nuclease that requires a NGG protospacer adjacent motif (PAM) immediately 3' of the region targeted by the guide RNA can be utilized. Such a Cas9 nuclease can target any region of the genome that contains an NGG sequence. As another example, a Cas9 protein with an orthogonal PAM motif requirement can be utilized to target a sequence that does not have an adjacent NGG PAM sequence. Exemplary Cas9 proteins with orthogonal PAM sequence specificity include, but are not limited to, CFP1, those described in Nature Methods 10, 1116-1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015 (both of which are incorporated herein by reference).

[0415] In some cases, Cas9 protein is a nickase, so that when it binds to a target nucleic acid as part of a complex with a guide RNA, it introduces a single-strand break or nick into the target nucleic acid.A pair of Cas9 nickases, each of which is bound to a structurally different guide RNA, can target two proximal sites in a target genomic region, and thus introduce a pair of proximal single-strand breaks into the target genomic region.Nickase pairs can increase specificity, since off-target effects are more likely to result in a single nick, which is generally repaired without lesions by base excision repair mechanisms.Exemplary Cas9 nickases include Cas9 nucleases with D10A or H840A mutations.

[0416] In some embodiments, the RNP comprises a Cas9 nuclease. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP-DNA template complex comprises at least two structurally distinct RNP complexes. In some embodiments, the at least two structurally distinct RNP complexes comprise structurally distinct Cas9 nuclease domains. In some embodiments, the at least two structurally distinct RNP complexes comprise structurally distinct guide RNAs. In some embodiments, where the at least two structurally distinct RNP complexes comprise structurally distinct guide RNAs, each of the structurally distinct RNP complexes comprises a Cas9 nickase, and the structurally distinct guide RNAs hybridize to opposite strands of the target region.

[0417] In some cases, multiple RNP-DNA templates containing structurally distinct ribonucleoprotein complexes are introduced into a cell. For example, a Cas9 protein can be complexed with multiple (e.g., 2, 3, 4, 5, or more, e.g., 2-10, 5-100, 20-100) structurally distinct guide RNAs to target insertion of the DNA template at multiple structurally distinct target genomic regions.

[0418] In the methods and compositions provided herein, the cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, and the like. Optionally, the cells are mammalian cells, e.g., human cells. The cells can be in vitro, ex vivo, or in vivo. The cells can also be primary cells, germ cells, stem cells, or progenitor cells. The progenitor cells can be, for example, pluripotent stem cells or hematopoietic stem cells. In some embodiments, the cells are primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the primary hematopoietic cells are immune cells. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD4+ In some embodiments, the T cells are CD8 + In some embodiments, the T cells are CD4 + CD8 + In some embodiments, the T cells are CD4 - CD8 - The modified cells are T cells. Also provided is a population of any of the cells modified by any of the methods described herein. In some embodiments, the method further comprises expanding the population of modified cells.

[0419] In some cases, cells are removed from a subject, modified using any of the methods described herein, and administered to a patient. In other cases, any of the constructs described herein are delivered to a patient in vivo. See, e.g., U.S. Pat. No. 9,737,604 and Zhang et al. "Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy," NPG Asia Materials Volume 9, page e441 (2017) (both of which are incorporated herein by reference).

[0420] In some embodiments, the RNP-DNA template complex is about 1×10 5 ~about 2×10 6 For example, the RNP-DNA template complex is introduced into approximately 1 × 10 5 ~Approx. 5×10 5 cells, approximately 1 x 10 5 ~Approx. 1×10 6 , 1×10 5 ~Approx. 1.5×10 6 , 1×10 5 ~about 2×10 6 , about 1×10 6 ~Approx. 1.5×10 6 cells, or approximately 1 x 10 6 ~about 2×10 6 can be introduced into

[0421] In some cases, the methods and compositions described herein can be used to generate, modify, use, or control recombinant T cells, such as chimeric antigen receptor T cells (CAR T cells). Such CAR T cells can be used to treat or prevent cancer, infectious disease, or autoimmune disease in a subject. For example, in some embodiments, one or more gene products are inserted or knocked-in into T cells to express a heterologous protein (e.g., a chimeric antigen receptor (CAR) or a priming receptor).

[0422] Insertion site Methods for editing the genome of a T cell specifically include methods of editing the genome of a human T cell comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of the TCR-α subunit (TRAC) in a human T cell. In some embodiments, the target region is in exon 1 of the constant domain of the TRAC gene. In other embodiments, the target region is in exon 1, exon 2, or exon 3 prior to the start of the sequence encoding the TCR-α transmembrane domain.

[0423] Methods for editing the genome of a T cell also include a method for editing the genome of a human T cell comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of a TCR-β subunit (TRBC) in a human T cell. In some embodiments, the target region is in exon 1 of the TRBC1 or TRBC2 gene.

[0424] Methods for editing the genome of a T cell specifically include methods of editing the genome of a human T cell comprising inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).

[0425] Gene editing therapy includes, for example, vector integration and site-specific integration. Site-specific integration is a promising alternative to random integration of viral vectors because it reduces the risk of insertional mutagenesis or insertional carcinogenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406, Porteus et al. Nat Biotechnol. 2005 23:967-973, Paques et al. Curr Gen Ther. 2007 7:49-66). However, site-specific integration continues to face challenges such as low knock-in efficiency, risk of insertional carcinogenesis, unstable and / or abnormal expression of adjacent genes or transgenes, and low accessibility (e.g., within 20 kB of adjacent genes). These challenges can be addressed, in part, by the identification and use of safe harbor loci or safe harbor sites (SHS), which are sites where genes or genetic elements can be integrated without disrupting the expression or regulation of adjacent genes.

[0426] The most widely used of the putative human safe harbor sites is the AAVS1 site on chromosome 19q, which was initially identified as a site for recurrent adeno-associated virus insertion. Other potential SHSs have been identified based on homology to sites originally identified in other species (e.g., the human homolog of the permissive mouse Rosa26 locus) or in a growing number of human genes that appear non-essential under some circumstances. One putative SHS of this type is the CCR5 chemokine receptor gene, which, when disrupted, confers resistance to human immunodeficiency virus infection. Additional potential genomic SHSs have been identified in humans and other cell types based on viral integration site mapping or gene trap analysis, as well as the original mouse Rosa26 locus. The top three SHSs, AAVS1, CCR5, and Rosa26, are in close proximity to many protein-coding genes and regulatory elements. (See Sadelain, M., et al. (2012). Safe harbours for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosure of which is incorporated herein by reference in its entirety).

[0427] AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (e.g., DNA transgenes) with expected functions. It is located at position 19q13.42. It has an open chromatin structure and is transcriptionally competent. The canonical SHS locus for AAVS1 is chr19:55,625,241-55,629,351. See Pellenz et al. “New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol.30,7(2019):814-828 (the relevant disclosure of which is incorporated herein by reference). Exemplary AAVS1-targeting gRNAs and target sequences are provided below. ●AAVS1-gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT ●AAVS1 target sequence: ggggccactagggacaggat

[0428] CCR5, located on chromosome 3 at position 3p21.31, encodes the major co-receptor for HIV-1. Disruption of this site in the CCR5 gene is beneficial in HIV / AIDS treatment and has prompted the development of zinc finger nucleases targeting its third exon. The canonical SHS locus of CCR5 is chr3:46,414,443-46,414,942. See Pellenz et al. “New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol.30,7(2019):814-828 (the relevant disclosure of which is incorporated herein by reference).

[0429] The mouse Rosa26 locus is particularly useful for genetic modification because it can be targeted with high efficiency and is expressed in most cell types tested. Irion et al. 2007 ("Identification and targeting of the ROSA26 locus in human embryonic stem cells." Nature biotechnology 25.12(2007):1477-1482, the relevant disclosure of which is incorporated herein by reference) identified the human homologue, human ROSA26, on chromosome 3 (position 3p25.3). The canonical SHS locus for human Rosa26 (hRosa26) is chr3:9,415,082-9,414,043. See Pellenz et al. "New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion." Human gene therapy vol.30,7(2019):814-828, the relevant disclosure of which is incorporated herein by reference.

[0430] Additional examples of safe harbor sites are provided in Pellenz et al. “New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30, 7 (2019): 814-828, the relevant disclosure of which is incorporated herein by reference. Additional examples of integration sites are provided in Table D.

[0431] In some embodiments, the safe harbor site allows for high transgene expression (sufficient to allow transgene functionality or treatment of the disease of interest) and stable expression of the transgene over days, weeks or months. In some embodiments, knockout of the gene at the safe harbor locus benefits the function of the cell or the gene at the safe harbor locus has no known function in the cell. In some embodiments, the safe harbor locus provides stable transgene expression in vitro with or without CD3 / CD28 stimulation, negligible off-target cleavage detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage compared to other loci detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and is located outside of cancer-associated genes.

[0432] When used, "nearby genes" can refer to genes that are within about 100 kB, about 125 kB, about 150 kB, about 175 kB, about 200 kB, about 225 kB, about 250 kB, about 275 kB, about 300 kB, about 325 kB, about 350 kB, about 375 kB, about 400 kB, about 425 kB, about 450 kB, about 475 kB, about 500 kB, about 525 kB, or about 550 kB of the safe harbor locus (integration site).

[0433] In some embodiments, the present disclosure contemplates an insert that includes one or more transgenes. The transgenes can code for therapeutic proteins, antibodies, peptides, or any other genes of interest. Transgene incorporation can result in, for example, improved therapeutic properties. These enhanced therapeutic properties, as used herein, refer to enhanced therapeutic properties of cells compared to typical immune cells of the same normal cell type. For example, T cells with "enhanced therapeutic properties" have enhanced, improved, and / or increased therapeutic outcomes compared to typical, unmodified, and / or naturally occurring T cells. Therapeutic properties of immune cells can include, but are not limited to, cell engraftment, trafficking, homing, viability, self-renewal, persistence, immune response control and regulation, survival, and cytotoxicity. Therapeutic properties of immune cells are also manifested by expression of antigen targeting receptors, HLA presentation or lack thereof, tolerance to intratumoral microenvironment, induction and immunomodulation of bystander immune cells, improved target specificity by reduction, and tolerance to treatments such as chemotherapy.

[0434] As used herein, "insert size" refers to the length of the nucleotide sequence to be integrated (inserted) into the target locus or safe harbor site. In some embodiments, the insert size comprises at least about 4.5 kilobase pairs (kb) to about 10 kilobase pairs (kb). In some embodiments, the insert size comprises about 5000 or more nucleotide base pairs. In some embodiments, the insert size comprises up to 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp (kilobase pairs), or any size therebetween. In some embodiments, the insert size is greater than 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp, or any size therebetween. In some embodiments, the insert size is in the range of 4.5-15 kbp, or any number within that range. In some embodiments, the insert size is in the range of 4.8-8.3 kbp, or any number within that range. In some embodiments, the insert size is in the range of 5-8.3 kbp, or any number within that range. In some embodiments, the insert size is in the range of 5-15 kbp, or any number within that range. In some embodiments, the insert size is in the range of 4.5-20 kbp, or any number within that range. In some embodiments, the insert size is 5-10 kbp. In some embodiments, the insert size is 4.5-10, 5-10, 6-10, 7-10, 8-10, 9-10 kbp. In some embodiments, the insert size is 4.5-11, 6-11, 7-11, 8-11, 9-11, or 10-11 kbp. In some embodiments, the insert size is 4.5-12, 6-12, 7-12, 8-12, 9-12, 10-12, or 11-12 kbp. In some embodiments, the insert size is 4.5-13, 6-13, 7-13, 8-13, 9-13, 10-13, 11-13, or 12-13 kbp.In some embodiments, the insert size is 4.5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14, or 13-14 kbp. In some embodiments, the insert size is 4.5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, or 14-15 kbp. In some embodiments, the insert size is 4.5-16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-16, 14-16, or 15-16 kbp. In some embodiments, the insert size is 4.5-17, 6-17, 7-17, 8-17, 9-17, 10-17, 11-17, 12-17, 13-17, or 14-17, 15-17, or 16-17 kbp. In some embodiments, the insert size is 4.5-18, 6-18, 7-18, 8-18, 9-18, 10-18, 11-18, 12-18, 13-18, 14-18, 15-18, 16-18, or 17-18 kbp. In some embodiments, the insert size is 4.5-19, 6-19, 7-19, 8-19, 9-19, 10-19, 11-19, 12-19, 13-19, 14-19, 15-19, 16-19, 17-19, or 18-19 kbp. In some embodiments, the insert size is 4.5-20, 6-20, 7-20, 8-20, 9-20, 10-20, 11-20, 12-20, 13-20, 14-20, 15-20, 16-20, 17-20, 18-20, or 19-20 kbp.

[0435] An insert in the present disclosure refers to a nucleic acid molecule or polynucleotide that is inserted into a target locus or a safe harbor site. In some embodiments, the nucleotide sequence is a DNA molecule, e.g., genomic DNA, or comprises deoxyribonucleotides. In some embodiments, the insert comprises smaller fragments of DNA, such as plastid DNA, mitochondrial DNA, or DNA isolated in the form of a plasmid, fosmid, cosmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), and / or any other subgenomic segment of DNA. In some embodiments, the insert is an RNA molecule or comprises ribonucleotides. The nucleotides in the insert are contemplated as naturally occurring nucleotides, non-naturally occurring nucleotides, and modified nucleotides. The nucleotides may be chemically or biochemically modified or may comprise non-natural or derivatized nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, labeling, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications. Polynucleotides can be in any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular conformations, and other three-dimensional conformations contemplated in the art.

[0436] The insert can have coding and / or non-coding regions. The insert can include non-coding sequences (e.g., control elements, e.g., promoter sequences). In some embodiments, the insert encodes a transcription factor. In some embodiments, the insert encodes an antigen binding receptor, e.g., a single receptor, a T cell receptor (TCR), a priming receptor, a CAR, a mAb, etc. In some embodiments, the insert is a human sequence. In some embodiments, the insert is a chimera. In some embodiments, the insert is a multi-gene / multi-module therapeutic cassette. A multi-gene / multi-module therapeutic cassette refers to an insert or cassette having one or more receptors (e.g., synthetic receptors), other exogenous protein coding sequences, non-coding RNA, transcriptional regulatory elements, and / or insulator sequences, etc.

[0437] In some embodiments, the nucleic acid sequence is inserted into the genome of T cells via non-viral delivery.In non-viral delivery methods, the nucleic acid can be naked DNA or in non-viral plasmid or vector.Non-viral delivery techniques can be site-specific integration techniques described herein or known to those skilled in the art.Examples of site-specific techniques for integration into safe harbor locus include, but are not limited to, homology-dependent engineering using nucleases and homology-independent targeted insertion using Cas9 or other CRISPR endonucleases.

[0438] In some embodiments, the insert is integrated into the safe harbor site by introducing into the engineered cell (a) a targeted nuclease that cleaves the target region of the safe harbor site to create an insertion site, and (b) a nucleic acid sequence (the insert), which is integrated into the insertion site, for example, by HDR. Examples of non-viral delivery techniques that can be used in the methods of the present disclosure are provided in U.S. Application Nos. 16 / 568,116 and 16 / 622,843, the relevant disclosures of which are incorporated herein by reference in their entireties.

[0439] Examples of contemplated integration sites are provided in Table D.

[0440] [Table D] TIFF2025517359000010.tif217165TIFF2025517359000011.tif217165TIFF2025517359000012.tif217165TIFF2025517359 000013.tif210165TIFF2025517359000014.tif218165TIFF2025517359000015.tif219165TIFF2025517359000016.tif59165

[0441] CRISPR / Cas editing One effective example of gene editing is the CRISPR-Cas approach (e.g., CRISPR-Cas9). This approach incorporates the use of a guide polynucleotide (e.g., a guide ribonucleic acid or gRNA) and a cas endonuclease (e.g., Cas9 endonuclease).

[0442] As used herein, a polypeptide referred to as a "Cas endonuclease" or having "Cas endonuclease activity" refers to a CRISPR-associated (Cas) polypeptide encoded by a Cas gene, which is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., U.S. Patent No. 8,697,359). This definition also includes variants of Cas endonucleases that retain guide polynucleotide-dependent endonuclease activity. The Cas endonucleases used in the donor DNA insertion methods detailed herein are endonucleases that introduce double-stranded breaks in DNA at target sites (e.g., within a target locus or at a safe harbor site).

[0443] As used herein, the term "guide polynucleotide" refers to a polynucleotide sequence that can complex with a Cas endonuclease and enable the Cas endonuclease to recognize and cleave a DNA target site. A guide polynucleotide can be a single molecule or a double molecule. A guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence). A guide polynucleotide that contains only ribonucleic acid is also referred to as a "guide RNA". In some embodiments, a polynucleotide donor construct is inserted into a safe harbor locus using a guide RNA (gRNA) in combination with a cas endonuclease (e.g., Cas9 endonuclease).

[0444] The guide polynucleotide comprises a first nucleotide sequence domain (also referred to as variable targeting domain or VT domain) that is complementary to a nucleotide sequence in the target DNA, and a second nucleotide that interacts with the Cas endonuclease polypeptide. It can be a double molecule (also referred to as double-stranded guide polynucleotide) that comprises a sequence domain (referred to as Cas endonuclease recognition domain or CER domain). The CER domain of this double molecule guide polynucleotide comprises two separate molecules that hybridize along the complementary region. The two separate molecules can be RNA sequences, DNA sequences and / or RNA-DNA combination sequences.

[0445] Genome editing using the CRISPR-Cas approach relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by RNA-guided Cas endonucleases (e.g., Cas9 endonuclease). Homology-directed repair (HDR) of these DSBs allows for precise editing of the genome by introducing defined genomic changes, including base substitutions, sequence insertions, and deletions. Conventional HDR-based CRISPR / Cas9 genome editing involves transfecting cells with Cas9, gRNA, and donor DNA that contain homologous arms matching the locus of interest.

[0446] HITI (homology-independent targeted insertion) uses a non-homologous end joining (NHEJ)-based homology-independent strategy, which can be more efficient than HDR. A guide RNA (gRNA) targets the insertion site. For HITI, the donor plasmid lacks homology arms and DSB repair does not occur via the HDR pathway. The donor polynucleotide construct can be engineered to contain Cas9 cleavage site(s) adjacent to the gene or sequence to be inserted. This results in Cas9 cleavage in both the donor plasmid and the genomic target sequence. Both the target and donor have blunt ends, and the linearized donor DNA plasmid is used by the NHEJ pathway, which results in integration into the genomic DSB site. (See, e.g., Suzuki, K., et al. (2016). In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration. Nature, 540(7631), 144-149, the relevant disclosure of which is incorporated herein in its entirety).

[0447] Methods for gene editing using CRISPR-Cas approach are known to those skilled in the art. (See, for example, US Application Nos. US16 / 312,676, US15 / 303,722, and US15 / 628,533, the disclosures of which are incorporated herein by reference in their entirety.) Additionally, the use of endonucleases to insert transgenes into safe harbor loci is described, for example, in US Application No. 13 / 036,343, the disclosures of which are incorporated herein by reference in their entirety.

[0448] The guide RNA and / or the mRNA (or DNA) encoding the endonuclease can be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Non-limiting examples of such moieties include lipid moieties such as cholesterol moieties, cholic acid, thioethers, thiocholesterol, aliphatic chains (e.g., dodecanediol or undecyl residues), phospholipids, e.g., dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-3-H-phosphonate, polyamines or polyethylene glycol chains, adamantane acetic acid, palmityl moieties, and octadecylamine or hexylamino-carbonyl-toxycholesterol moieties. See, e.g., U.S. Patent Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0449] therapeutic use For therapeutic applications, the engineered cells, populations thereof, or compositions thereof are administered in an effective amount to a subject, generally a mammal, generally a human. The engineered cells may be administered to a subject by infusion (e.g., continuous infusion over a period of time) or other modes of administration known to those of skill in the art.

[0450] The engineered cells provided herein find use in gene therapy as well as non-pharmaceutical uses, such as, for example, the production of animal models and the production of recombinant cell lines expressing a protein of interest.

[0451] The engineered cells of the present disclosure can be any cell, generally a mammalian cell, generally a human cell that has been modified by incorporating a transgene at a safe harbor locus as described herein. Exemplary cells are provided in the recombinant cell section.

[0452] The engineered cells, compositions, and methods of the disclosure are useful for therapeutic applications such as CAR T cell therapy and TCR T cell therapy. In some embodiments, insertion of a sequence encoding a transgene within a safe harbor locus maintains TCR expression relative to instances in which the insertion is absent, allowing transgene expression while maintaining TCR function.

[0453] In some embodiments, the present disclosure provides a method of treating a subject in need of treatment by administering to the subject a composition comprising any of the engineered cells described herein. In some embodiments, administration of the engineered cell composition results in a desired pharmacological and / or physiological effect. This effect can be a partial or complete cure of the disease and / or adverse effects resulting from the disease. In some embodiments, treatment encompasses any treatment of the disease in a subject (e.g., a mammal, e.g., a human). Additionally, treatment can stabilize or reduce undesirable clinical symptoms in a subject (e.g., a patient). The cells, populations thereof, or compositions thereof provided herein can be administered during or after the onset of the disease.

[0454] In certain embodiments, the subject has a disease, condition, and / or injury that can be treated and / or ameliorated by cell therapy. In some embodiments, the subject in need of cell therapy is a subject having an injury, disease, or condition that triggers cell therapy (e.g., therapy in which cellular material is administered to the subject). However, it is contemplated that the severity of at least one symptom associated with the injury, disease, or condition may be treated, ameliorated, and / or reduced.

[0455] Method of administration An effective amount of the immune cells comprising the system can be administered for the treatment of cancer. The appropriate dosage of the immune cells comprising the system can be determined based on the type of cancer being treated, the type of immune cells comprising the system, the severity and course of the cancer, the clinical condition of the individual, the individual's clinical history and response to treatment, and the judgment of the attending physician.

[0456] Pharmaceutical Compositions The engineered recombinant cells provided herein can be administered as part of a pharmaceutical composition. These compositions can include, in addition to one or more of the recombinant cells, pharma- ceutically acceptable excipients, carriers, buffers, stabilizers, or other materials known to those of skill in the art. Such materials should be non-toxic and should not interfere with the effectiveness of the active ingredient. The exact nature of the carrier or other materials may depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes. A pharmaceutical composition may include one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used, and one of skill in the art is capable of selecting a suitable pharmaceutical excipient. Thus, the pharmaceutical excipients provided below are intended to be exemplary and not limiting. Additional pharmaceutical excipients include, for example, those described in Handbook of Pharmaceutical Excipients, Rowe et al. (Eds.) 6th Ed. (2009), which is incorporated by reference in its entirety.

[0457] Various modes of administering the additional therapeutic agent are contemplated herein. In some embodiments, the additional therapeutic agent is administered by any suitable mode of administration.

[0458] The compositions may be administered alone or in combination with other treatments, either simultaneously or sequentially depending on the condition being treated.

[0459] Kits and Products The present application provides a kit comprising any one or more of the systems or cell compositions described herein and instructions for use. The instructions can be present in the kit as a package insert, on the label of the container of the kit or its components, or in digital form (e.g., on a CD-ROM, via a link on the Internet). The kit can include one or more of a genome-targeting nucleic acid, a polynucleotide encoding the genome-targeting nucleic acid, a site-directed polypeptide, and / or a polynucleotide encoding the site-directed polypeptide. Additional components in the kit are also contemplated, such as buffers (such as reconstitution buffers, stabilization buffers, dilution buffers, etc.), and / or one or more control vectors.

[0460] In some embodiments, the kit further comprises components selected from any of a secondary antibody, a reagent for immunohistochemistry analysis, a pharma- ceutically acceptable excipient, and instructions, and any combination thereof. In a specific embodiment, the kit comprises a pharmaceutical composition comprising any one or more of the antibody compositions described herein and one or more pharma- ceutically acceptable excipients.

[0461] The present application also provides an article of manufacture comprising any one of the antibody compositions or kits described herein. An example of an article of manufacture is a vial (including a sealed vial). EXAMPLES

[0462] Below are examples of specific embodiments for carrying out the present invention. The examples are provided for illustrative purposes only and are not intended to limit the scope of the present disclosure in any way. Efforts have been made to ensure accuracy with respect to the numbers used (e.g., amounts, temperatures, etc.), but it should be understood that some experimental error and deviation should be allowed for.

[0463] The practice of the present disclosure will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques, and pharmacology, within the skill of the art. Such techniques are fully explained in the literature, see, for example, TECreighton, Proteins: Structures and Molecular Properties (WH Freeman and Company, 1993); A. L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3rd Edition (East, Pennsylvania: Mack Publishing Company, 1992); rd Ed. (Plenum Press) Vols A and B (1992).

[0464] Example 1: Synthesis and characterization of PSMA primeR and CA9 CAR logic gates method T cell manipulation A PSMA / CA9 logic gate (LG) circuit was constructed to have PSMA primeR containing anti-PSMA J591 scFv (VL-VH orientation) and HNF1a-p65 transcription factor. PrimeR scFv also contained a MYC tag on the 5' end. The LG circuit also contains an inducible CAR containing anti-CA9 scFv clone G36 (VH-VL orientation). The CAR contains a FLAG tag at the 3' end to facilitate detection. The construct also contained an shRNA cassette targeting luciferase as a control gene. A diagram of the PSMA / CA9 LG construct is shown in Figure 1A.

[0465] Non-viral T cell engineering for in vitro studies T cells were enriched from peripheral blood mononuclear cells (PBMCs) obtained from normal donors using Leukopak (STEMCELL Technologies) using Lymphoprep (STEMCELL Technologies) and EasySep human T cell isolation kit (STEMCELL Technologies). T cells were then activated with CD3 / CD28 Dynabeads (ThermoFisher, 40203D) at a 1:1 bead-to-cell ratio in TexMACS medium (Miltenyi 130-197-196) supplemented with 3% human AB serum (Gemini Bio) and 12.5 ng / ml human IL-7 and IL-15 (Miltenyi premium grade) and cultured at 37°C, 5% CO2 for 48 hours before electroporation.

[0466] CRISPR RNPs were prepared by combining 120 μM sgRNA targeting the DNA sequence GAGCCATGCTTGGCTTACGA (GS94) (Synthego), 62.5 μM sNLS-SpCas9-sNLS (Aldevron) and P3 buffer (Lonza) in a volume ratio of 5:1:3:6 and incubated at room temperature for 15 min. The optimal amount of plasmid DNA (ranging from 0.5 to 3 micrograms), determined by dose titration experiments, was mixed with 3.5 μl of RNPs. T cells were counted, bead-depleted, centrifuged at 90×G for 10 min and resuspended in 10^6 cells / 14.5 μl P3 with supplement (Lonza). 14.5 μl of the T cell suspension was added to the DNA / RNP mixture, transferred to a Lonza 384-well nucleocuvette plate and pulsed with the Lonza HT Nucleofector system, code EH-115. The cells were allowed to rest for 15 min at room temperature before being transferred to a 96-well plate (Sarstedt) in TexMACS medium supplemented with 12.5 ng / ml human IL-7 and IL-15 (Miltenyi premium grade).

[0467] Transgene expression was detected by staining with anti-Myc (Cell Signaling Technology clone 9B11) and anti-Flag (RnD system, clone 1042E) antibodies and analyzed on an Attune NxT flow cytometer. Other antibodies used were live / dead Fixable Near-IR (Thermo Fisher), CD4 (BioLegend clone RPA-T4), and CD8 (BioLegend clone SK1).

[0468] FLAG tagged CA9 CAR1: anti-CA9 scFv-CD8a hinge-CD8a-TMD-4-1BB costimulatory domain-CD3z activation domain.

[0469] Myc-tagged PSMA priming receptor: anti-PSMA scFv-CD8a hinge-Notch1 TMD-Notch1 STS-HNF1a DBD-p65 activation domain.

[0470] T cell stimulation T cells from two donors were engineered to express the logic gate system of CA9 binder in CAR format combination with PSMA priming receptor using the in vitro method manufacturing process described above. On day 9 after activation, T cells expressing LG were counted and 3e3 edited T cells were seeded in 60 uL of medium without IL-7 and IL-15 per well of a 384-well round bottom plate. Engineered T cells were seeded with cell line (20 ul) at a 1:3 edited t cell:target cell ratio. After 72 hours of co-culture, T cells were stained for PrimeR and CAR expression using anti-myc PE and anti-FLAG APC, respectively, and analyzed by flow cytometry in an iQue Intellicyt.

[0471] PSMA PrimeR Expression Primary human T cells were isolated and activated, and two days later, T cells were electroporated with a plasmid containing RNP and PSMA+CA9 circuit DNA. RNP alone was used as a negative control. Seven days after T cell activation, cells were stained using Myc-PE antibody and myc expression was measured by flow cytometry (iQue Intellicyt). Myc expression was used to quantify circuit knock-in by detecting PrimeR constitutively expressed in the circuit.

[0472] CA9 CAR expression Engineered T cells expressing PSMA / CA9 LG were co-cultured with target K562 cells expressing either PSMA or CA9 antigens. After 72 hours, cells were stained with myc and flag antibodies to detect PrimeR and CAR by flow cytometry (Attune), respectively. To determine the degree of CAR induction, the number of edited cells expressing Flag was quantified. N=1 donor, technical replicates.

[0473] Cytokine secretion assay Target cell lines K562 and 786-O were transduced with lentivirus to express PSMA (K562), CA9 (K562), or both (786-O PSMA / CA9). Cell lines were sorted to include populations expressing the target antigens. Prior to assay setup, cells were stained with antibodies against CA9, PSMA, MSLN (negative control) or isotype control. Target protein expression was confirmed in stained samples by flow cytometry (Figure 4).

[0474] Engineered T cells expressing PSMA / CA9 LG were co-cultured with target cells expressing either CA9 alone (K562-CA9) or PSMA+CA9 antigen (786-O PSMA / CA9). 72 hours after co-culture setup, supernatants were collected and frozen. IL-2 and IFN-gamma were measured by Luminex kits run on a Flexmap according to the manufacturer's instructions. N=1 donor, technical replicate.

[0475] result As shown in Figure 1B, the engineered primary T cells expressed PSMA primeR molecules. Figure 1B shows two technical replicates in a representative donor. N=2 donors.

[0476] Co-culture of engineered T cells and PSMA-expressing target cells resulted in induction of CA9 CAR expression (Figure 2). PSMA-expressing K562 induced significantly more CA9 CAR expression than CA9-expressing K562, which did not express the PSMA priming antigen (Figure 2).

[0477] Engineered T cells expressed the cytokines IFNγ (Figure 3A) and IL-2 (Figure 3B) when co-cultured with target cells expressing both the priming (PSMA) and cytolytic antigen (CA9, 786-O PSMA / CA9 cell line), but not after co-culture with target cells expressing only the cytolytic antigen (K562-CA9).

[0478] While the present invention has been particularly shown and described with reference to preferred and various alternative embodiments, it will be understood by those skilled in the relevant art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention.

[0479] All references, issued patents, and patent applications cited within the body of this specification are hereby incorporated by reference in their entirety for all purposes.

[0480] Unofficial sequence listing TIFF2025517359000017.tif232165TIFF2025517359000018.tif229165TIFF2025517359000019.tif222165TIFF2025517359000020.tif118165TIFF2025517359000021.tif173165TIFF2025517359000022.tif202165TIFF2025517359000023.tif228165TIFF2025517359000024.tif238165TIFF2025517359000025.tif243165TIFF2025517359000026.tif193165TIFF2025517359000027.tif217165TIFF2025517359000028.tif228165TIFF2025517359000029.tif217165TIFF2025517359000030.tif197165TIFF2025517359000031.tif217165TIFF2025517359000032.tif233165TIFF2025517359000033.tif231165TIFF2025517359000034.tif219165TIFF2025517359000035.tif219165TIFF2025517359000036.tif193165TIFF2025517359000037.tif209165TIFF2025517359000038.tif219165TIFF2025517359000039.tif241165TIFF2025517359000040.tif203165TIFF2025517359000041.tif219165TIFF2025517359000042.tif219165TIFF2025517359000043.tif166165TIFF2025517359000044.tif166165TIFF2025517359000045.tif234165TIFF2025517359000046.tif38165

Claims

1. A system comprising a first chimeric polypeptide and a second chimeric polypeptide, a. the first chimeric polypeptide comprises a priming receptor comprising a first extracellular antigen binding domain that specifically binds to prostate specific membrane antigen (PSMA); and b. the second chimeric polypeptide comprises a CAR comprising a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9); The system.

2. further comprising at least one nucleic acid sequence at least 15 nucleotides in length, The nucleic acid sequence is selected from the group consisting of a nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, a nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40, and a nucleic acid sequence that is complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:

41. The system of claim 1 .

3. 3. The system of claim 2, wherein the at least one nucleic acid sequence is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:

39.

4. 3. The system of claim 2, wherein the at least one nucleic acid sequence is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:

40.

5. The system of any one of claims 2 to 4, wherein the at least one nucleic acid sequence comprises a first nucleic acid sequence that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence that is complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:

40.

6. The system of any one of claims 2 to 5, wherein the at least one nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

7. The system of any one of claims 2 to 6, wherein the at least one nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

8. The system of claim 7 , wherein the at least one nucleic acid sequence is an shRNA.

9. The system according to any one of claims 2 to 8, wherein the at least one nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 42 to 71.

10. The system of claim 9, wherein the at least one nucleic acid comprises the sequence set forth in SEQ ID NO:

49.

11. 11. The system of any one of claims 2 to 10, wherein the at least one nucleic acid reduces expression of FAS in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the nucleic acid.

12. The system according to any one of claims 2 to 8, wherein the at least one nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 72 to 97.

13. The system of claim 12, wherein the at least one nucleic acid comprises the sequence set forth in SEQ ID NO:

82.

14. The system of any one of claims 2-8, 12, and 13, wherein the at least one nucleic acid reduces expression of PTPN2 in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the nucleic acid.

15. The system of any one of claims 2 to 14, wherein the at least one nucleic acid sequence comprises a first nucleic acid sequence that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence that is complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:

40.

16. The system of claim 15, wherein the first nucleic acid comprises a sequence selected from the group consisting of sequences set forth in SEQ ID NOs: 42-71, and the second nucleic acid comprises a sequence selected from the group consisting of sequences set forth in SEQ ID NOs: 72-97.

17. 17. The system of claim 16, wherein the first nucleic acid comprises the sequence set forth in SEQ ID NO:49 and the second nucleic acid comprises the sequence set forth in SEQ ID NO:

82.

18. The system according to any one of claims 1 to 17, which is expressed in immune cells or primary immune cells.

19. The system of claim 18 , wherein the immune cells are primary human immune cells.

20. The system of claim 18 or 19, wherein the immune cells are allogeneic immune cells.

21. The system according to any one of claims 18 to 20, wherein the immune cells are autologous immune cells.

22. The system according to any one of claims 18 to 21, wherein the primary immune cells are natural killer (NK) cells, T cells, CD8+ T cells, CD4+ T cells, primary T cells, or T cell precursors.

23. The system according to any one of claims 18 to 22, wherein the primary immune cells are primary T cells.

24. The system according to any one of claims 18 to 23, wherein the primary immune cells are primary human T cells.

25. The system according to any one of claims 18 to 24, wherein the primary immune cells are virus-free.

26. The priming receptor is, from the N-terminus to the C-terminus: a. the first extracellular antigen-binding domain, b. a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and c. An intracellular domain comprising a human or humanized transcriptional effector Including, binding of PSMA by the first extracellular antigen binding domain results in cleavage at the one or more ligand-inducible proteolytic cleavage sites. A system according to any one of claims 1 to 25.

27. 27. The system of claim 26, wherein the priming receptor further comprises a first hinge domain disposed between the first extracellular antigen binding domain and the first transmembrane domain.

28. The system of claim 27, wherein the first hinge domain comprises CD8α or a truncated CD8α hinge domain.

29. 29. The system of claim 28, wherein the first hinge comprises the sequence set forth in SEQ ID NO:

19.

30. The system of any one of claims 1 to 29, wherein the first transmembrane domain comprises a Notch1 transmembrane domain.

31. The system of claim 30 , wherein the first transmembrane domain comprises the sequence set forth in SEQ ID NO:

20.

32. The system according to any one of claims 26 to 31, wherein the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain.

33. The system of claim 32, wherein the intracellular domain comprises the sequence set forth in SEQ ID NO:

24.

34. The system of any one of claims 1 to 33, wherein the priming receptor further comprises a stop-transfer-sequence or a juxtamembrane domain between the first transmembrane domain and the intracellular domain.

35. The system of claim 34, wherein the stop transport sequence or juxtamembrane domain comprises the sequence set forth in SEQ ID NO:

21.

36. The system of any one of claims 1 to 35, wherein the priming receptor comprises the sequence set forth in SEQ ID NO:

165.

37. The CAR is, from the N-terminus to the C-terminus, a. a second extracellular antigen-binding domain, b. a second transmembrane domain; c. an intracellular costimulatory domain, and d. Intracellular activation domain The system according to any one of claims 1 to 36, comprising:

38. The system of claim 37, wherein the CAR comprises a second hinge domain.

39. The system of claim 38, wherein the second hinge domain comprises CD8α or a truncated CD8α hinge domain.

40. The system of claim 39 , wherein the second hinge domain comprises the sequence set forth in SEQ ID NO:

27.

41. The system of any one of claims 37 to 39, wherein the second transmembrane domain comprises a CD8α transmembrane domain.

42. The system of claim 41 , wherein the second transmembrane domain comprises the sequence set forth in SEQ ID NO:

28.

43. The system of any one of claims 37 to 41, wherein the intracellular costimulatory domain comprises a 4-1BB domain.

44. The system of claim 43, wherein the intracellular costimulatory domain comprises the sequence set forth in SEQ ID NO:

29.

45. The system according to any one of claims 37 to 43, wherein the intracellular activation domain comprises a CD3 zeta domain.

46. The system of claim 45, wherein the intracellular activation domain comprises the sequence set forth in SEQ ID NO:

30.

47. The system of any one of claims 1 to 45, wherein the CAR comprises a sequence set forth in SEQ ID NO:

166.

48. The system of any one of claims 1 to 34, wherein the priming receptor and the CAR are capable of binding to the same target cell, if that target cell expresses PSMA and CA9.

49. The system of claim 48 , wherein the target cell is a human cell.

50. 50. The system of claim 48 or 49, wherein the target cell is a cancer cell.

51. The system of claim 50, wherein the cancer cells are solid cancer cells or liquid cancer cells.

52. 52. The system of claim 50 or 51, wherein the cancer cells are renal cell carcinoma or clear cell renal cell carcinoma (ccRCC).

53. One or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding the system of any one of claims 1 to 52.

54. below: a. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen binding domain that specifically binds to prostate specific membrane antigen (PSMA); b. a second chimeric polypeptide comprising a CAR comprising a second extracellular antigen-binding domain that specifically binds to carbonic anhydrase IX (CA9); and c. at least one nucleic acid sequence at least 15 nucleotides in length, said nucleic acid sequence being selected from the group consisting of a nucleic acid sequence complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, a nucleic acid sequence complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:40, and a nucleic acid sequence complementary to nucleotides 1294-2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:

41. One or more recombinant nucleic acids encoding the

55. 55. The recombinant nucleic acid of claim 54, wherein said at least one nucleic acid sequence is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:

39.

56. 56. The recombinant nucleic acid of claim 54 or 55, wherein the at least one nucleic acid sequence is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:

40.

57. 57. The recombinant nucleic acid of any one of claims 54 to 56, wherein the at least one nucleic acid sequence is complementary to nucleotides 1294 to 2141 of an mRNA encoding human TOX comprising the sequence set forth in SEQ ID NO:

41.

58. 57. The recombinant nucleic acid of any one of claims 54-56, wherein the at least one nucleic acid sequence comprises a first nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:39, and a second nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:

40.

59. 59. The recombinant nucleic acid of claim 58, wherein the first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 42-71, and the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 72-97.

60. 59. The recombinant nucleic acid of claim 58, wherein the first nucleic acid comprises the sequence set forth in SEQ ID NO:49 and the second nucleic acid comprises the sequence set forth in SEQ ID NO:

82.

61. 61. The recombinant nucleic acid of any one of claims 54 to 60, wherein the at least one nucleic acid sequence is at least 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.

62. 62. The recombinant nucleic acid of any one of claims 54-61, wherein the at least one nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

63. 63. The recombinant nucleic acid of claim 62, wherein the at least one nucleic acid sequence is an shRNA.

64. 64. The recombinant nucleic acid of any one of claims 54 to 63, wherein the at least one nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 42 to 71.

65. 65. The recombinant nucleic acid of claim 64, wherein the at least one nucleic acid comprises the sequence set forth in SEQ ID NO:

49.

66. 66. The recombinant nucleic acid of any one of claims 54-65, wherein the at least one nucleic acid reduces expression of FAS in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not containing the nucleic acid.

67. 64. The recombinant nucleic acid of any one of claims 54 to 63, wherein the at least one nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 72 to 97.

68. 68. The recombinant nucleic acid of claim 67, wherein said at least one nucleic acid comprises the sequence set forth in SEQ ID NO:

82.

69. 69. The recombinant nucleic acid of any one of claims 54-63, 67, or 68, wherein the at least one nucleic acid reduces expression of PTPN2 in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not containing the nucleic acid.

70. 64. The recombinant nucleic acid of any one of claims 54 to 63, wherein the at least one nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 98 to 125.

71. 71. The recombinant nucleic acid of claim 70, wherein the at least one nucleic acid comprises a sequence set forth in SEQ ID NO: 99 or 104.

72. 72. The recombinant nucleic acid of any one of claims 54-63, 70, or 71, wherein the at least one nucleic acid reduces expression of TOX in an immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not containing the nucleic acid.

73. 73. The recombinant nucleic acid of any one of claims 54 to 72, wherein the at least one nucleic acid sequence is a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 157 to 164.

74. 74. The recombinant nucleic acid of any one of claims 54 to 73, wherein the at least one nucleic acid sequence is encoded in at least one intron region of the recombinant nucleic acid.

75. At least one nucleic acid fragment comprising a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen binding domain that specifically binds to PSMA and a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds to CA9. One or more recombinant nucleic acids comprising:

76. 76. The recombinant nucleic acid of any one of claims 54 to 75, comprising two or more nucleic acid fragments.

77. The recombinant nucleic acid of any one of claims 54 to 76, further comprising an inducible promoter operably linked to the nucleotide sequence encoding the CAR.

78. 78. The recombinant nucleic acid of any one of claims 54 to 77, further comprising a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.

79. 79. The recombinant nucleic acid of any one of claims 54-78, further comprising an inducible promoter operably linked to a nucleotide sequence encoding said chimeric antigen receptor and a constitutive promoter operably linked to a nucleotide sequence encoding said priming receptor.

80. 80. The recombinant nucleic acid of any one of claims 54 to 79, wherein the constitutive promoter is EF1α.

81. In the 5' to 3' direction, a. the constitutive promoter, b. the nucleotide sequence encoding a priming receptor; c. the inducible promoter, and d. The nucleotide sequence encoding the chimeric antigen receptor The recombinant nucleic acid according to any one of claims 54 to 80, comprising:

82. In the 5' to 3' direction, a. the inducible promoter, b. the nucleotide sequence encoding a chimeric antigen receptor; c. the constitutive promoter, and d. The nucleotide sequence encoding a priming receptor The recombinant nucleic acid according to any one of claims 54 to 80, comprising:

83. In the 5' to 3' direction, a. a first constitutive promoter, b. the nucleotide sequence encoding the priming receptor; c. a second constitutive promoter; d. the nucleotide sequence encoding the at least one nucleic acid complementary to human FAS, human PTPN2, or human TOX; e. the inducible promoter, and f. The nucleotide sequence encoding the chimeric antigen receptor The recombinant nucleic acid according to any one of claims 54 to 80, comprising:

84. In the 5' to 3' direction, a. a first constitutive promoter, b. the nucleotide sequence encoding the priming receptor; c. a second constitutive promoter; d. the nucleotide sequence encoding the first nucleic acid that is complementary to human FAS; e. a nucleotide sequence encoding said second or third nucleic acid that is complementary to human PTPN2 or TOX; f. the inducible promoter, and g. The nucleotide sequence encoding the chimeric antigen receptor The recombinant nucleic acid according to any one of claims 54 to 80, comprising:

85. In the 5' to 3' direction, a. the inducible promoter, b. the nucleotide sequence encoding the chimeric antigen receptor, c. a second constitutive promoter; d. the nucleotide sequence encoding the first nucleic acid that is complementary to human FAS; e. a nucleotide sequence encoding said second or third nucleic acid that is complementary to human PTPN2 or TOX; f. a first constitutive promoter, and g. The nucleotide sequence encoding the priming receptor The recombinant nucleic acid according to any one of claims 54 to 80, comprising:

86. 86. The recombinant nucleic acid of any one of claims 54 to 85, further comprising 5' and 3' homology directed repair arms that are complementary to the insertion site in the host cell chromosome.

87. 87. The recombinant nucleic acid of any one of claims 54 to 86, further comprising a nucleotide sequence encoding a self-cleaving 2A peptide (P2A).

88. 88. The recombinant nucleic acid of any one of claims 54 to 87, wherein the P2A is at the 3' end of the nucleotide sequence encoding a chimeric antigen receptor.

89. The recombinant nucleic acid of any one of claims 54 to 87, wherein the P2A is at the 3' end of the nucleotide sequence encoding a priming receptor.

90. 90. The recombinant nucleic acid of any one of claims 54 to 89, further comprising a Woodchuck Hepatitis Virus post-translational regulatory element (WPRE).

91. 91. The recombinant nucleic acid of Claim 90, wherein the WPRE is at the 3' end of the nucleotide sequence encoding a chimeric antigen receptor and at the 5' end of the nucleotide sequence encoding a priming receptor, or wherein the WPRE is at the 3' end of the nucleotide sequence encoding a priming receptor and at the 5' end of the nucleotide sequence encoding a chimeric antigen receptor.

92. The recombinant nucleic acid of any one of claims 54 to 90, further comprising an SV40 polyA element.

93. The recombinant nucleic acid according to any one of claims 54 to 92, which is incorporated into an expression cassette or expression vector.

94. 94. The recombinant nucleic acid of claim 93, wherein the expression vector is a non-viral vector.

95. An expression vector comprising a recombinant nucleic acid according to any one of claims 53 to 94.

96. 96. The vector of claim 95, wherein the 5' end and the 3' end of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of a primary cell.

97. 97. The vector of claim 96, wherein the insertion site is located at the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

98. a. the system of any one of claims 1 to 52; b. A recombinant nucleic acid according to any one of claims 53 to 94, and / or c) The vector according to any one of claims 95 to 97. including, immune cells.

99. 99. The cell of claim 98, wherein the immune cell is a primary immune cell.

100. 100. The cell of claim 98 or 99, wherein the immune cell is a primary human immune cell.

101. The cell of any one of claims 98 to 100, wherein the immune cell is an allogeneic immune cell.

102. The cell according to any one of claims 98 to 100, wherein the immune cell is an autologous immune cell.

103. 103. The cell of any one of claims 98 to 102, wherein the immune cell or primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

104. The cell of any one of claims 98 to 103, wherein the immune cell or the primary immune cell is a primary T cell.

105. The cell of any one of claims 98 to 104, wherein the immune cell or the primary immune cell is a primary human T cell.

106. The cell of any one of claims 98 to 105, wherein the immune cell or the primary immune cell is virus-free.

107. a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to PSMA; a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds CA9, which is inserted into a target region of the genome of the primary immune cell; At least one recombinant nucleic acid comprising wherein the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell.

108. A viable virus-free primary cell containing a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, the RNP comprises a nuclease domain and a guide RNA, the recombinant nucleic acid comprises a priming receptor comprising a first extracellular antigen binding domain that specifically binds PSMA and a chimeric antigen receptor comprising a second extracellular antigen binding domain that specifically binds CA9, and the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell. The viable virus-free primary cells.

109. further comprising at least one nucleic acid sequence at least 15 nucleotides in length, The at least one nucleic acid sequence is (1) a first nucleic acid sequence that is complementary to nucleotides 1126-1364 of an mRNA encoding the human Fas cell surface death receptor (FAS), comprising the sequence set forth in SEQ ID NO:39; (2) a second nucleic acid sequence that is complementary to nucleotides 518-559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO:40; and (3) A third nucleic acid sequence that is complementary to nucleotides 1294 to 2141 of an mRNA encoding human thymocyte selection-associated high mobility group box (TOX), comprising the sequence set forth in SEQ ID NO:

41. including one or more of:

109. The primary cell of claim 107 or 108.

110. A population of cells comprising a plurality of immune cells according to any one of claims 98 to 109.

111. A pharmaceutical composition comprising an immune cell according to any one of claims 98 to 109 or a population of cells according to claim 110, and a pharma- ceutically acceptable excipient.

112. A pharmaceutical composition comprising a recombinant nucleic acid according to any one of claims 53 to 94 or a vector according to any one of claims 95 to 97, and a pharma- ceutically acceptable excipient.

113. 1. A method for editing immune cells, comprising: a. providing a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid comprises a recombinant nucleic acid according to any one of claims 53 to 94, and wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the immune cell; b. non-virally introducing the RNP-recombinant nucleic acid complex into the immune cell, wherein the guide RNA specifically hybridizes to a target region of the genome of a primary immune cell and the nuclease domain cleaves the target region to create the insertion site in the genome of the immune cell; c. Editing the immune cell via insertion of a recombinant nucleic acid of any one of claims 53-94 into the insertion site in the genome of the immune cell. The method comprising:

114. The method of claim 113, wherein the non-viral introducing step comprises electroporation.

115. 115. The method of claim 113 or 114, wherein the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

116. 116. The method of any one of claims 113 to 115, wherein the target region of the genome of the cell is the T-cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

117. The method according to any one of claims 113 to 116, wherein the recombinant nucleic acid is a double-stranded recombinant nucleic acid or a single-stranded recombinant nucleic acid.

118. 118. The method of any one of claims 113 to 117, wherein the recombinant nucleic acid is a linear recombinant nucleic acid or a circular recombinant nucleic acid, optionally wherein the circular recombinant nucleic acid is a plasmid.

119. The method of any one of claims 113 to 118, wherein the immune cells are primary human immune cells.

120. The method of any one of claims 113 to 119, wherein the immune cells are autologous immune cells.

121. 120. The method of any one of claims 113 to 119, wherein the immune cells are allogeneic immune cells.

122. 122. The method of any one of claims 113 to 121, wherein the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

123. The method of any one of claims 113 to 122, wherein the immune cells are primary T cells.

124. The method of any one of claims 113 to 123, wherein the immune cells are primary human T cells.

125. The method of any one of claims 113 to 124, wherein the immune cells are virus-free.

126. 126. The method of any one of claims 113 to 125, further comprising the steps of obtaining said immune cells from a patient and introducing said recombinant nucleic acid in vitro.

127. 13. A method for treating a disease in a subject, comprising administering to the subject an immune cell according to any one of claims 98 to 110 or a pharmaceutical composition according to claim 111 or 112.

128. 128. The method of claim 127, wherein the disease is cancer.

129. The method of claim 128, wherein the cancer is a solid cancer or a liquid cancer.

130. 130. The method of claim 128 or 129, wherein the cancer is renal cell carcinoma or clear cell renal cell carcinoma (ccRCC).

131. 131. The method of any one of claims 128-130, wherein said administration of said immune cells enhances an immune response in said subject.

132. 132. The method of claim 131, wherein the enhanced immune response is an adaptive immune response.

133. 132. The method of claim 131, wherein the enhanced immune response is an innate immune response.

134. The method of any one of claims 128 to 133, wherein the enhanced immune response is increased expression of at least one cytokine or chemokine.

135. 135. The method of claim 134, wherein the at least one cytokine or chemokine is IL-2 or IFNγ.

136. 131. The method of any one of claims 127-130, further comprising administering to the subject an immunotherapy either simultaneously with or after administering said immune cells.

137. 111. A method of inhibiting a target cell in a subject, comprising administering to the subject an immune cell according to any one of claims 98 to 110, wherein the immune cell inhibits the target cell.

138. The method of claim 137, wherein the target cells express PSMA and CA9.

139. 139. The method of claim 137 or 138, wherein the target cell is a cancer cell.

140. 1. A method for inducing expression of a chimeric antigen receptor in an immune cell with a priming receptor, comprising: a. i. a system according to any one of claims 1 to 52, ii. A recombinant nucleic acid according to any one of claims 53 to 94, and / or iii. The vector according to any one of claims 95 to 97. Obtaining immune cells comprising the b. contacting the immune cells with target cells expressing PSMA and CA9, wherein binding of the priming receptor to PSMA on the target cells induces activation of the priming receptor and expression of the chimeric antigen receptor. The method comprising:

141. 1. A method for modulating immune cell activity, comprising: a. i. a system according to any one of claims 1 to 52, ii. A recombinant nucleic acid according to any one of claims 53 to 94, and / or iii. The vector according to any one of claims 95 to 97. Obtaining immune cells comprising the b. contacting the immune cell with a target cell expressing PSMA and CA9, wherein binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor, and binding of the chimeric antigen receptor to CA9 on the target cell modulates activity of the immune cell. The method comprising:

142. The modulation of immune cell activity, Boosting the immune response 142. The method of claim 141, comprising:

143. 143. The method of claim 142, wherein the enhanced immune response is an adaptive immune response.

144. 143. The method of claim 142, wherein the enhanced immune response is an innate immune response.

145. 145. The method of any one of claims 141 to 144, wherein said immune cell activity is increased expression of at least one cytokine or chemokine.

146. 146. The method of claim 145, wherein the at least one cytokine or chemokine is IL-2 or IFNγ.

Images