Modified Adeno-Associated Virus Capsid Proteins and Methods Thereof

Abstract

The present invention relates to a modified recombinant adeno-associated virus (AAV) capsid protein and AAV particles thereof. In one aspect, the modified recombinant AAV particles provide an increase in transduction of retinal cells as compared to the effect of unmodified recombinant AAV particles. The present invention also relates to a nucleic acid encoding the modified AAV capsid protein and AAV particles thereof.

Description

Technical Field

[0001] Related Applications This application claims priority from Australian Provisional Patent Application No. AU2022901483, filed on May 31, 2022, the entire content of which is incorporated herein by reference.

[0002] The present invention relates to a modified recombinant adeno-associated virus (AAV) capsid protein and its AAV particles. In one aspect, the modified recombinant AAV particles provide an increase in transduction of retinal cells as compared to the effects of unmodified recombinant AAV particles. The present invention also relates to a nucleic acid encoding the modified AAV capsid protein and its AAV particles.

Background Art

[0003] Recombinant adeno-associated virus (AAV) vectors are an effective means of delivering gene therapy. The use of such recombinant AAV vectors has been steadily increasing in recent years due to (1) the ability to infect a variety of dividing and non-dividing cells, (2) the tendency to remain episomal rather than integrate into the target cell genome, (3) the ability to result in long-term expression of the therapeutic transgene, (4) the low likelihood of inducing an immune response compared to other viral vectors, (5) the inability to replicate and initiate productive infection without the help of a helper virus such as adenovirus or herpes simplex virus, and (6) the lack of association with any known disease (Wang et al., 2019).

[0004] Recombinant AAV vector design is based on the genetic engineering of wild-type AAV (Agbandje-McKenna, M. & Kleinschmidt 2011, Samilski et al., 2014). AAV has a single-stranded DNA genome that is approximately 4.7 kb in length and contains 5' and 3' inverted terminal repeats (containing cis-acting elements for replication and packaging), the rep gene, and the cap gene. The rep gene is transcribed and alternatively spliced to produce four different proteins responsible for genome replication and packaging, as well as transcriptional regulation. The cap gene is transcribed from a single promoter, has two translation start sites, and is alternatively spliced to produce three structural proteins (VP1, VP2, and VP3). These assemble to form an icosahedral capsid consisting of 50 units of VP3 and 10 units each of VP1 and VP2. Within the 5' end of the cap gene and outside the frame of the cap open reading frame is the AAP gene. This encodes an assembly activation protein that helps ensure efficient viral assembly. The cap gene affects the stability and tropism of the virus for specific tissues.

[0005] Depending on the target tissue or cell type, a given naturally occurring AAV vector serotype may be relatively ineffective in transducing the target tissue or cells. One such example is the transduction of retinal cells (e.g., retinal pigment epithelium and photoreceptors). Therefore, efforts have been made to engineer AAV capsid proteins. For example, individual amino acids of the capsid have been engineered to enhance virus stability and improve virus tropism. In one example, conserved tyrosine residues have been replaced with phenylalanine residues to avoid tyrosine phosphorylation and subsequent ubiquitin-mediated proteasomal degradation (Zhong et al., 2008). Similarly, conserved serine and threonine amino acids have been replaced with valine residues to extend the lifespan of AAV (Aslanidi et al., 2012, Aslanidi et al., 2013), and conserved lysine has been replaced with glutamic acid (Li et al., 2015). Recombinant AAV capsids with improved stability and enhanced tropism have been generated for some target cells or tissues, but problems such as neutralizing antibodies against AAV (Halbert et al., 2006) still remain highly diverse. For example, neutralizing antibodies against the AAV2 variant 7m8 have been previously reported (Dalkara et al., 2013).

[0006] Furthermore, with regard to the transduction of retinal cells of the eye, efficient transduction of the human retina remains a major challenge (Bordet et al., 2019). One example is the transduction of the human retina via intravitreal delivery. This route of administration is preferred over others because it is simpler and safer while providing a greater spread. However, the presence of AAV neutralizing antibodies in the vitreous, the physical barrier created by the inner limiting membrane of the retina, and the utilization of AAV with tropism suitable for photoreceptor cells or retinal pigment epithelium are major hurdles associated with the implementation of gene therapy for the eye.

[0007] There is a need for recombinant adeno-associated virus (AAV) that has improved transduction efficiency and / or is associated with a reduced immunogenic response in view of the above limitations. SUMMARY OF THE INVENTION

[0008] The inventors have demonstrated for the first time the production of recombinant adeno-associated virus (AAV) having a modified capsid that provides increased transduction efficiency and reduced immunogenicity compared to AAV without capsid modification. Advantageously, when these AAVs are packaged with an expression cassette, they improve the therapeutic use for diseases, conditions, or disorders that require gene therapy, including the treatment of eye disorders such as age-related macular degeneration.

[0009] Accordingly, in a first aspect of the invention, there is provided a recombinant adeno-associated virus (AAV) capsid protein comprising an insertion by the sequence set forth in SEQ ID NO: 1 or a functional equivalent thereof.

[0010] In another aspect of the invention, there is provided a recombinant adeno-associated virus (AAV) VP capsid protein which is an insertion by the sequence set forth in SEQ ID NO: 1 or a functional equivalent thereof, wherein the insertion optionally comprises the sequence set forth in SEQ ID NOs: 130 - 133 or 139 - 140 in one or more or all of the VP1, VP2, and VP3 capsid proteins, preferably in the VP3 capsid protein.

[0011] In one embodiment, the insertion is in loop IV, region 6, or variable region VIII (VR-VIII) of the AAV8 capsid protein or at the corresponding position of the capsid protein of an AAV serotype other than AAV8. In this embodiment, the insertion is relative to the parental AAV capsid protein.

[0012] In one embodiment, the insertion is preferably located at the position corresponding to amino acid 590 of the AAV8 capsid protein or at the corresponding position of the capsid protein of an AAV serotype other than AAV8.

[0013] In one embodiment, the insertion is with respect to the parental AAV capsid protein by the sequences set forth in SEQ ID NO: 121 or 125.

[0014] In one embodiment, the insertion comprises a sequence by any one of the sequences set forth in SEQ ID NOs: 2 to 108.

[0015] In one embodiment, the insertion has at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity, or 100% sequence identity with the sequence by the sequence set forth in SEQ ID NO: 1. In another embodiment, the insertion comprises a sequence that differs by only 1 or 2 or fewer amino acids when compared to the sequence by the sequence set forth in SEQ ID NO: 1.

[0016] In one embodiment, the insertion comprises a sequence by the sequence set forth in SEQ ID NO: 109 or SEQ ID NO: 110.

[0017] In one embodiment, the insertion comprises a linker adjacent to the 5' and / or 3' end of the insertion. Optionally, the linker comprises a sequence by SEQ ID NO: 111 (“TG”; e.g., encoded by ACCGGT) and / or SEQ ID NO: 112 (“GLS”; e.g., encoded by GTCTTTCGA). In one embodiment, the insertion comprises the sequence of SEQ ID NO: 129 and / or 138.

[0018] In one embodiment, the insertion is optionally in one or more or all of the VP1, VP2, and VP3 capsid proteins, preferably the VP3 capsid protein, comprising the sequences set forth in SEQ ID NOs: 130 to 133 or 139 to 140.

[0019] In one embodiment, the recombinant capsid protein comprises a mutation selected from one or more or all of Y447F, T494V, and Y733F. Preferably, the recombinant capsid protein optionally comprises each of Y447F, T494V, and Y733F in an AAV8 capsid protein comprising the sequence set forth in either SEQ ID NO: 135 or 142.

[0020] In one embodiment, the recombinant AAV capsid protein is selected from the group consisting of recombinant AAV2, AAV4, AAV7, or AAV10 capsid proteins.

[0021] In one aspect of the invention, recombinant AAV particles comprising the AAV capsid proteins described herein are provided. Preferably, the AAV particles are optionally packaged in the presence of an AAV2 rep gene encoding an AAV2 rep protein defined according to the sequence set forth in SEQ ID NO: 123.

[0022] In one aspect of the invention, there is provided an isolated nucleic acid encoding a recombinant adeno-associated virus (AAV) capsid protein as described herein, optionally comprising the sequence set forth in SEQ ID NO: 134 or 141.

[0023] In one aspect of the invention, there is provided an isolated nucleic acid encoding a recombinant adeno-associated virus (AAV) capsid protein having at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 134 or 141.

[0024] In one aspect of the invention, there is provided an isolated nucleic acid encoding a recombinant adeno-associated virus (AAV) particle as described herein, optionally comprising the sequence set forth in SEQ ID NO: 136 or 143.

[0025] In one aspect of the present invention, there is provided an isolated nucleic acid encoding a recombinant adeno-associated virus (AAV) particle having at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 136 or 143.

[0026] In one aspect of the present invention, there is provided an isolated nucleic acid encoding a recombinant adeno-associated virus (AAV) capsid protein having at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 124.

[0027] In one aspect of the present invention, there is provided an isolated nucleic acid encoding a recombinant adeno-associated virus (AAV) capsid VP3 protein, wherein the VP3 protein has at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NOs: 130 - 133 or 139 - 140.

[0028] In one embodiment, the nucleic acid encoding the recombinant AAV capsid protein comprises a p5 enhancer element, preferably the AAV2 p5 enhancer element. Preferably, the p5 enhancer element is located downstream of the AAV capsid gene. Optionally, the nucleic acid encoding the recombinant adeno-associated virus (AAV) capsid protein comprises the AAV8 3’UTR.

[0029] In one embodiment, the nucleic acid encoding the recombinant AAV particle optionally comprises an AAV2 rep nucleic acid sequence defined according to the sequence set forth in SEQ ID NO: 122. Optionally, the expression of the AAV2 rep nucleic acid sequence is driven by the p5 promoter.

[0030] In one embodiment, for the translation to start with an in-frame methionine in the downstream frame optionally according to the sequence defined according to SEQ ID NO: 114, the AAV2 rep gene contains a mutation from ATG to ACG at the start codon of the AAV2 rep gene.

[0031] In one embodiment, the nucleic acid encoding the recombinant AAV particle contains AAV2 inverted terminal repeats (ITRs).

[0032] In one embodiment, the recombinant AAV particle contains an expression cassette for expressing a therapeutic molecule. In a further embodiment, the therapeutic molecule is DNA, mRNA, cRNA, and cDNA, tRNA, siRNA, shRNA, and hpRNA. In a preferred embodiment, the therapeutic molecule is optionally for the treatment of an eye disease selected from the group consisting of retinitis pigmentosa, diabetic retinopathy, cystoid macular edema, clinically significant macular edema, uveitis, iritis, giant cell arteritis, vasculitis, peripheral uveitis, corneal transplant rejection, intraocular inflammation or lamellar corneal transplant rejection, macular degeneration, central retinal vein occlusion, branch retinal vein occlusion, and ocular angiogenesis.

[0033] In one embodiment, the therapeutic molecule inhibits angiogenesis and / or inflammation. In a further embodiment, the therapeutic molecule - contains endostatin, angiostatin, or a fusion of endostatin and angiostatin, - is a binding protein, - contains the antigen-binding site of an antibody, - is selected from the group consisting of ranibizumab, bevacizumab, and aflibercept, - inhibits inflammation, or - is interleukin 10 (IL-10), interleukin 1 receptor antagonist (IL-1RA), or a fusion of IL-10 and IL-1RA.

[0034] In further embodiments, the therapeutic molecule is an inhibitor of vascular endothelial growth factor (VEGF), placental growth factor (PIGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), TIE ligand (angiopoietin), ephrin, angiopoietin-like 3 (ANGPTL3), angiopoietin-like 4 (ANGPTL4), insulin-like growth factor-I (IGF-I), epidermal growth factor (EGF), connective tissue growth factor (CTGF), transforming growth factor alpha (TGF-α), transforming growth factor beta (TGF-β), or TNF-alpha (e.g., anti-inflammatory soluble TNF-R). In preferred embodiments, the therapeutic molecule is an inhibitor of vascular endothelial growth factor (VEGF), optionally selected from a VEGF antibody, a VEGF receptor antibody, or a VEGF siRNA.

[0035] In further embodiments, the expression cassette optionally includes a retinal-specific promoter for driving the expression of the therapeutic molecule, selected from the group consisting of rhodopsin, rhodopsin kinase, RPE65, and retinaldehyde-binding protein 1 (RLBP1), or any of the promoters listed in Table 5 herein.

[0036] In one embodiment, the expression cassette a) a kill switch comprising a first site-specific recombination sequence and a second site-specific recombination sequence; b) a regulatable element operably linked to a nucleic acid sequence encoding a therapeutic molecule, wherein the activity of the regulatable element is regulated by a regulator compound; c) a constitutive promoter operably linked to a nucleic acid sequence encoding a regulator compound-binding polypeptide capable of binding to the regulator compound, wherein upon binding to the regulator compound, the regulator compound-binding polypeptide regulates the expression of the therapeutic molecule and activation of the kill switch by recombination between the first site-specific recombination sequence and the second site-specific recombination sequence silences the expression of the nucleic acid encoding the therapeutic molecule from the cassette.

[0037] In one aspect of the present invention, there is provided a pharmaceutical composition comprising the AAV particles described herein and one or more carriers or excipients.

[0038] In one aspect of the present invention, there is provided a method for increasing the transduction efficiency of adeno-associated virus (AAV) particles in a target cell, tissue, or organ, the method comprising contacting the target cell, tissue, or organ with the AAV particles described herein under conditions sufficient for transduction of the AAV particles in the target cell, tissue, or organ, wherein the transduction efficiency is increased as compared to AAV particles without a capsid insertion.

[0039] In a preferred embodiment, the AAV particles comprise an expression cassette for expressing a therapeutic molecule. In this embodiment, the expression of the therapeutic molecule is increased as compared to AAV particles that contain the expression cassette and do not have a capsid insertion.

[0040] In this embodiment, the method is an ex vivo, in vitro, or in vivo method. In a further embodiment, the target cell is a retinal cell, the target tissue is retinal tissue, and the target organ is the eye.

[0041] In one embodiment, the transduction efficiency is increased by at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400% or more as compared to AAV particles without a capsid insertion.

[0042] In another embodiment, the transduction efficiency is increased by at least 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50-fold or more as compared to AAV particles without a capsid insertion.

[0043] In one aspect of the invention, a method for reducing an immune response to adeno-associated virus (AAV) particles in a target cell, tissue, or organ, the method comprising contacting the target cell, tissue, or organ with the AAV particles described herein under conditions sufficient for transduction of the AAV particles in the target cell, tissue, or organ, wherein the immune response is reduced as compared to AAV particles having no capsid insertions.

[0044] In one embodiment, the target cell is a retinal cell, the target tissue is retinal tissue, and the target organ is the eye.

[0045] In one aspect of the invention, a method for doing so in a subject in need of treating a condition, disorder, or disease, the method comprising administering to the subject the AAV particles or a composition thereof described herein, thereby treating the condition, disorder, or disease in the subject.

[0046] In one aspect of the invention, provided is the use of the AAV particles or a composition thereof described herein in the preparation of a medicament for doing so in a subject in need of treating a condition, disorder, or disease.

[0047] In one aspect of the invention, provided is the AAV particles or a composition thereof described herein for use in a subject in need of treating a condition, disorder, or disease.

[0048] In one embodiment, the condition, disorder, or disease is optionally an eye disease selected from the group consisting of retinitis pigmentosa, diabetic retinopathy, cystoid macular edema, clinically significant macular edema, uveitis, iritis, giant cell arteritis, vasculitis, peripheral uveitis, corneal transplant rejection, intraocular inflammation or lamellar corneal transplant rejection, macular degeneration, central retinal vein occlusion, branch retinal vein occlusion, and ocular angiogenesis.

[0049] In one embodiment, the subject has at least one symptom of an eye disorder selected from the group including a reduction in peripheral vision, a reduction in central vision, a reduction in night vision, and a loss of color vision.

[0050] In one embodiment, the AAV particles or a composition thereof administered to a subject in need of treating a condition, disorder, or disease comprises a modified capsid protein described herein and an expression cassette comprising a) a kill switch comprising a first site-specific recombination sequence and a second site-specific recombination sequence; b) an adjustable element operably linked to a nucleic acid sequence encoding a therapeutic molecule, wherein the activity of the adjustable element is regulated by a regulator compound; c) a constitutive promoter operably linked to a nucleic acid sequence encoding a regulator compound-binding polypeptide capable of binding to the regulator compound, wherein upon binding to the regulator compound, the regulator compound-binding polypeptide regulates the expression of the therapeutic molecule and the activation of the kill switch by recombination between the first site-specific recombination sequence and the second site-specific recombination sequence silences the expression of the nucleic acid encoding the therapeutic molecule from the cassette.

[0051] In this embodiment, the AAV particles can be administered intravitreally or subretinally, the kill switch can be activated by administering a site-specific recombinase or a nucleic acid encoding a site-specific recombinase, and the site-specific recombinase catalyzes recombination between the first site-specific recombination sequence and the second site-specific recombination sequence, thereby silencing the expression of the therapeutic molecule. In a further embodiment, the treatment comprises administering a regulator compound locally to the eye or as an eye drop.

[0052] In one embodiment, the methods or uses described herein include administration of an immunosuppressant. When administration of an immunosuppressant is contemplated, the immunosuppressant is preferably administered before or alternatively, simultaneously with the administration of the recombinant AAV or its composition. Preferably, the recombinant AAV or its composition is administered once, however, when an immunosuppressant is administered, the recombinant AAV or its composition may be administered two or more times.

[0053] In a further embodiment, the methods or uses described herein optionally include the administration of additional therapies selected from the group consisting of surgery, lens replacement with an intraocular lens, laser surgery, or drug therapy. Any additional therapeutic treatment including administration of an immunosuppressant may be administered one, two, three, or more times to achieve the desired therapeutic effect.

[0054] In one embodiment, the recombinant AAV particles or its composition as defined herein is administered intravitreally or subretinally. In one embodiment, the additional therapy and / or immunosuppressant is administered intravenously, orally, subcutaneously, or intramuscularly.

[0055] In one aspect of the invention, there is provided an isolated mammalian cell comprising the recombinant adeno-associated virus (AAV) particles described herein. In one embodiment, the mammalian cell is optionally a human cell, preferably a human retinal cell, selected from the group consisting of photoreceptor cells, retinal ganglion cells, bipolar cells, fiber columns, retinal pigment epithelial cells, amacrine cells, astrocytes, horizontal cells, microglia, or Müller glial cells.

[0056] In one aspect of the invention, there is provided a kit comprising the recombinant adeno-associated virus (AAV) particles or its composition described herein for preventing or treating a disease, condition, or disorder in a subject or for use in preventing or treating a disease, condition, or disorder in a subject. Optionally, the kit - comprises a recombinase or an expression cassette comprising a nucleic acid sequence encoding a recombinase, - An eye drop preparation or a topical preparation, - A recombinase or an expression cassette containing a nucleic acid sequence encoding a recombinase for silencing the expression of a nucleic acid encoding a therapeutic molecule, may be included.

[0057] In one aspect of the present invention, there is provided a method for increasing the titer of an adeno-associated virus (AAV) vector genome in a target cell, tissue, or organ, the method comprising contacting the target cell, tissue, or organ with the AAV particles or a composition thereof described herein under conditions sufficient for transduction of the AAV particles in the target cell, tissue, or organ, wherein the vector genome is increased as compared to AAV particles without a capsid insertion.

[0058] In one aspect of the present invention, there is provided a method for performing it in a subject in need of increasing the titer of an adeno-associated virus (AAV) vector genome, the method comprising administering to the subject the AAV particles or a composition thereof described herein, wherein the vector genome is increased as compared to a subject that has received AAV particles without a capsid insertion.

[0059] In another aspect of the present invention, there is provided the use of an AAV particle or a composition thereof in the preparation of a medicament for performing it in a subject in need of increasing the titer of an adeno-associated virus (AAV) vector genome, wherein the vector genome is increased as compared to a subject that has received AAV particles without a capsid insertion.

[0060] In another aspect of the present invention, there is provided an AAV particle or a composition thereof for use in performing it in a subject in need of increasing the titer of an adeno-associated virus (AAV) vector genome, wherein the vector genome is increased as compared to a subject that has received AAV particles without a capsid insertion.

[0061] Unless otherwise specified in this specification, any embodiment of this specification is considered to be applicable mutatis mutandis to any other embodiment.

[0062] The present invention is not limited in scope by the specific embodiments described herein, which are intended for illustrative purposes only. Functionally equivalent products, compositions, and methods are clearly within the scope of the present invention as described herein.

[0063] Throughout this specification, unless otherwise specified or required by context, references to a single step, composition of matter, group of steps, or group of compositions of matter shall be construed to include one and more (i.e., one or more) of these steps, compositions of matter, groups of steps, or groups of compositions of matter.

[0064] The present invention is described below by way of the following non-limiting examples and with reference to the accompanying drawings.

Brief Description of the Drawings

[0065]

Figure 1-1

Figure 1-2

Figure 2-1

Figure 2-2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9-1

Figure 9-2

Figure 10

Figure 11

Figure 12-1

Figure 12-2

Figure 13

Figure 14

Figure 15

[0066] Description of the Sequence Listing SEQ ID NO: 1 - Amino acid sequence, capsid insertion SEQ ID NOs: 2 - 108 - Amino acid sequence, capsid insertion SEQ ID NO: 109 - Amino acid sequence, capsid insertion SEQ ID NO: 110 - Amino acid sequence, capsid insertion SEQ ID NO: 111 - Amino acid linker sequence SEQ ID NO: 112 - Amino acid linker sequence SEQ ID NO: 113 - Nucleic acid sequence, wild - type AAV sequence containing AAV2 rep and AAV8 genes SEQ ID NO: 114 - Nucleic acid sequence, wild - type AAV sequence containing AAV2 rep and AAV8 genes, and p5 promoter Wild-type AAV sequence containing nucleic acid sequence of SEQ ID NO: 115, AAV2 rep and AAV8 genes, p5 promoter and p5 enhancer AAV sequence containing nucleic acid sequence of SEQ ID NO: 116, AAV2 rep and AAV8 genes, p5 promoter, p5 enhancer, and mutations Y447F, Y733F, T494V AAV sequence containing nucleic acid sequence of SEQ ID NO: 117, AAV2 rep and AAV8 genes, p5 promoter, p5 enhancer, and mutations Y447F, Y733F, T494V (parent vector used for construction of library with random insertion at N590) Nucleic acid sequence of SEQ ID NO: 118, p5 promoter Nucleic acid sequence of SEQ ID NO: 119, p5 enhancer Nucleic acid sequence of SEQ ID NO: 120, wild-type AAV8 cap Amino acid sequence of wild-type AAV8 cap Nucleic acid sequence of SEQ ID NO: 122, wild-type AAV2 rep Amino acid sequence of wild-type AAV2 rep Nucleic acid sequence of SEQ ID NO: 124, AAV8 cap with mutations Y447F, Y733F, T494V Amino acid sequence of AAV8 cap with mutations Y447F, Y733F, T494V SEQ ID NO: 126: Nucleic acid sequence, AAV8 cap with mutations Y447F, Y733F, T494V (with random insertion at N590) Amino acid sequence of AAV8 cap with mutations Y447F, Y733F, T494V (With random insertion at N590) Nucleic acid sequence of SEQ ID NO: 128, C1mut1 insertion by linker sequence Amino acid sequence of SEQ ID NO: 129, C1mut1 insertion by linker sequence Amino acid sequence of SEQ ID NO: 130, VP3 sequence containing insertion with mutations Y447F, Y733F, T494V Amino acid sequence of SEQ ID NO: 131, VP3 sequence containing insertion by linker sequence SEQ ID NO: 132 - Amino acid sequence, VP3 sequence containing C1mut1 insertion SEQ ID NO: 133 - Amino acid sequence, VP3 sequence containing C1mut1 insertion by a linker sequence SEQ ID NO: 134 - Nucleic acid sequence, AAV8 cap having mutations Y447F, Y733F, T494V, and C1mut1 insertion by a linker sequence SEQ ID NO: 135 - Amino acid sequence, AAV8 cap having mutations Y447F, Y733F, T494V, and C1mut1 insertion by a linker sequence SEQ ID NO: 136 - Nucleic acid sequence, AAV sequence having AAV2 rep sequence and AAV8 cap sequence, having mutations Y447F, Y733F, T494V, and C1mut1 insertion by a linker sequence SEQ ID NO: 137 - Nucleic acid sequence, C1mut2 insertion by a linker sequence SEQ ID NO: 138 - Amino acid sequence, C1mut2 insertion by a linker sequence SEQ ID NO: 139 - Amino acid sequence, VP3 sequence containing insertion C1mut2 and mutations Y447F, Y733F, T494V SEQ ID NO: 140 - Amino acid sequence, VP3 sequence containing insertion C1mut2 by a linker sequence and mutations Y447F, Y733F, T494V SEQ ID NO: 141 - Nucleic acid sequence, AAV8 capsid having insertion C1mut2 by a linker sequence and mutations Y447F, Y733F, T494V SEQ ID NO: 142 - Amino acid sequence, AAV8 capsid having insertion C1mut2 by a linker sequence and mutations Y447F, Y733F, T494V SEQ ID NO: 143 - Nucleic acid sequence, AAV sequence having AAV2 rep sequence and AAV8 cap sequence, having mutations Y447F, Y733F, T494V, and C1mut2 insertion by a linker sequence

Mode for Carrying Out the Invention

[0067] General Techniques and Definitions Unless otherwise specifically defined, all technical and scientific terms used in this specification shall be construed to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, cell biology, protein chemistry, and biochemistry).

[0068] Unless otherwise indicated, the molecular and statistical techniques utilized in this disclosure are standard procedures well known to those of ordinary skill in the art. Such techniques are described and explained throughout the literature, including J. Perbal, 1984, J. Sambrook et al., 1989, T.A. Brown (editor) 1991, D.M. Glover and B.D. Hames (editors) 1995 and 1996, and F.M. Ausubel et al. (editors) 1988, J.E. Coligan et al. (editors) (including all updates to date).

[0069] As used in this specification and the appended claims, the singular terms, as well as the singular forms of "a", "an", and "the", include, optionally, multiple referents unless the context clearly dictates otherwise. Thus, for example, a reference to "a therapeutic molecule" optionally includes one or more therapeutic molecules.

[0070] The term "and / or", e.g., "X and / or Y", is understood to mean either "X and Y" or "X or Y", and is construed to provide explicit support for both meanings or either meaning.

[0071] Throughout this specification, variations such as "comprise", "comprises", or "comprising" are to be understood to imply the inclusion of the stated element, integer, or step, or group of elements, integers, or steps, but not the exclusion of any other element, integer, or step, or group of elements, integers, or steps.

[0072] Generally, the use of the term "about" and ranges means that the understood number is not limited to the exact number recited herein, whether or not modified by the term "about", and is intended to refer to a range within the recited range that is substantially within the scope of the present invention without departing from the scope of the present invention. As used herein, "about" is understood by those of ordinary skill in the art and will vary to some extent depending on the context in which it is used. When there is a use of a term that is not clear to those of ordinary skill in the art, considering the context in which it is used, "about" means up to plus or minus 10% of the particular term, more preferably 5%, and even more preferably 1%.

[0073] Capsid modification The present invention is directed to the production of modified adeno-associated virus (AAV) capsid proteins that provide improved transduction and / or reduced immunogenicity in target cells.

[0074] The AAV shell is assembled from 60 copies of viral proteins (VPs), VP1 (87 kDa), VP2 (73 kDa), and VP3 (61 kDa). The conserved core of each VP subunit consists of an eight-stranded β-barrel motif and an α-helix (Xie et al., 2002). The outer surface of the capsid is formed by large loops that connect the strands of the β-barrel. For example, residues from amino acids 581-601 of AAV8 include the finger-like loops of the VP subunits, form VR-VIII, and are consistent with the nomenclature in Nam et al., 2007. The amino acid sequences and structural topologies of these loops have been reported to promote tissue tropism and transduction efficiency (Agbande-McKenna and Kleinschmidt, 2011). Further, these residues contribute to the upper part of the protrusion surrounding the icosahedral three-fold axis formed through symmetric interactions between VPs. Thus, this sequence holds a major position on the capsid. This region contains sites that have been shown to be important for heparin sulfate binding and cell uptake in some serotypes.

[0075] The AAV capsid consists of three overlapping coding sequences that vary in length due to alternative start codon usage and interact to form an icosahedral symmetric capsid. These variable proteins are referred to as VP1, VP2, and VP3, with VP1 being the longest and VP3 being the shortest. AAV particles consist of all three capsid proteins in a ratio of approximately 1:1:10 (VP1:VP2:VP3). VP3, which is included in VP1 and VP2 at the N-terminus, is the major structural component that builds the particle. Capsid proteins controlled by the same promoter, which shows P40, are translated from the same mRNA.

[0076] The capsid proteins described herein may be referred to using several different numbering systems. For convenience, as used herein, AAV sequences are referred to using the numbering of VP1 that starts with amino acid 1 of the first residue of VP1 and then is numbered sequentially (i.e., amino acids 2, 3, 4, 5, 6, etc.). However, the capsid proteins described herein include VP1, VP2, and VP3 (used interchangeably herein as vp1, vp2, and vp3) that have insertions in the corresponding regions of the protein. In AAV8, the variable proteins correspond to VP1 (amino acids 1 - 738), VP2 (amino acids 138 - 738), and VP3 (amino acids 203 - 738) using the numbering of full-length VP1. For clarity, when referring to an insertion, when using the first amino acid of a particular VP capsid sequence as amino acid 1, it generally refers to an insertion at amino acid 590 of VP1, amino acid 590 of VP2, or amino acid 590 of VP3 of AAV8.

[0077] In one embodiment, the insertion is in loop IV, region 6, or variable region VIII of the AAV8 capsid protein or at the corresponding position of the capsid protein of an AAV serotype other than AAV8. The numbering system, loop, region, and variable region designations are consistent with the nomenclature and naming used in Raupp et al., 2012, which is hereby incorporated by reference in its entirety.

[0078] In one embodiment, a wild-type AAV8 serotype capsid is used to generate the modified capsid protein of the present invention. An example of the amino acid sequence of the wild-type AAV8 serotype is shown according to SEQ ID NO: 121.

[0079] As used herein, the term "wild-type" refers to the native AAV sequence without the insertions of the capsid proteins of the present invention. This can be used interchangeably with the term "parent" and can include sequences containing other non-naturally occurring modifications. In other words, naturally occurring AAV can be the source of the wild-type sequence to be modified, while non-naturally occurring AAV includes, but is not limited to, recombinant, modified, or altered, chimeric, hybrid, synthetic, artificial, etc. AAV can be used as a starting material into which the insertions described herein are introduced. This includes AAV having insertions, mutations, or substitutions in regions of the capsid other than the subject matter of the present invention. For example, AAV can include one or more or all of the mutations Y447F Y733F T494V (e.g., the sequence according to SEQ ID NO: 125) that can be used as a sequence into which the recombinant capsid protein of the present invention is inserted.

[0080] When the use of a modified AAV capsid protein or AAV particle is contemplated, it will be understood that the term "modified" refers to an AAV capsid protein or AAV particle that includes the insertions described herein. However, the modified AAV capsid protein or AAV particle may contain other modifications (e.g., mutations), for example, for the purpose of improving transduction efficiency.

[0081] While AAV8 serotype is preferably used to generate the modified capsid protein, it will be understood that modifications in the homologous regions of other AAV serotype capsids are also encompassed by the present invention. For example, but not limited to, other AAVs useful as wild-type sequences include pi.1, pi.2, pi.3, rh.38:rh.40;rh.43;rh.49;rh.50, rh.51;rh.52;rh.53;rh.57;rh.58;rh.61;rh.64;hu.6;hu.17;hu.37;hu.39;hu.40;hu.41;hu.42;hu.66; and hu.67. Still other AAVs useful as wild-type sequences include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV9, and shH10AAV. In another embodiment, the AAV wild-type sequence is clade E AAV. In another embodiment, the AAV wild-type sequence is clade D AAV. A clade is a group of AAVs that are phylogenetically related to each other and is determined using the neighbor-joining algorithm with a bootstrap value of at least 75% (out of at least 1000 replicates) and a Poisson-corrected distance measure of 0.05 or less based on the alignment of the AAV vp1 amino acid sequences. The neighbor-joining algorithm is widely described in the literature. See, for example, M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York 2000).

[0082] Capsid E contains the aforementioned AAV8 (Gao et al., 2002), 43.1rh.2;44.2 / rh.10:rh.25;29.3 / bb.1; and 29.5 / bb.2, and is characterized by containing U.S. Patent Publication No. US2003 / 01387772A1. Additional Capsid E sequences are described in U.S. Patent No. 7,096,111, which is incorporated herein by reference. AAV7 belongs to Capsid D and is most closely related to Capsid E members AAV8 and AAV10 based on the VP1 or VP3 amino acid sequences within the range of 85 - 88% aa sequence identity. When AAV7 is superimposed on AAV8, the overall Cα RMSD is 0.75 Å and the structural identity is 93%, which is slightly lower compared to the aforementioned AAV2 with 0.92 Å (Mietzsch et al., 2021).

[0083] Since the transduction efficiency of AAV particles can be determined by the nature of the amino acid residues exposed on the surface of the capsid (Wu et al., 2006), manipulating the amino acids of the capsid protein is one approach to modify the transduction efficiency. However, substitution of specific amino acids in the capsid protein may cause the capsid protein to misfold. One approach to minimize misfolding is to perform modifications only in the variable regions within the capsid. As an example, the variable regions of the AAV8 capsid are listed in Table 1 below.

[0084]

Table 1

[0085] Screening of the AAV8 capsid library by the method described in the examples herein led to the identification of modified AAV8 variant capsid proteins that showed an increase in transduction efficiency and a reduction in immunogenicity when compared to AAV particles that do not contain the modified capsid protein.

[0086] In some embodiments, the modified recombinant AAV (e.g., AAV8) capsid protein has one or more amino acid insertions in any one variable region (VR) (e.g., VRI, VRII, VRIII, VRIV, VRV, VRVI, VRVII, VRVIII, or VRIX), preferably in VRVIII. In some embodiments, in addition to the insertions described herein, the recombinant rAAV (e.g., variant rAAV8) capsid protein may have one or more amino acid mutations in two or more variable regions (e.g., VRI and VRII, VRI and VRVII, VRV and VRVII, VRV and VRI and VRVII, or VRIV and VRII). It should be understood that the recombinant rAAV (e.g., recombinant rAAV8) capsid proteins disclosed herein may have one or more amino acid mutations in any combination of two or more variable regions and are not limited to the examples herein.

[0087] In one example, the recombinant rAAV (e.g., recombinant rAAV8) capsid protein has an insertion in any one of the variable regions of the AAV VP1, VP2, or VP3 protein, or any combination thereof. When encoded by a single gene, it is known in the art that VP1, VP2, and VP3 share most of their amino acids. Specifically, the entire VP3 sequence is also contained within VP2 and VP1. Thus, one of ordinary skill in the art will understand that although the capsid modifications described herein are made to VP3, the modifications are also applicable to VP1 and VP2 of the AAV capsid, preferably within VR-VIII of VP3, and most preferably at amino acid position 590 of VR-VIII of VP3. Preferably, the VP1, VP2, and VP3 capsid proteins belong to the AAV8 serotype.

[0088] One of ordinary skill in the art will understand how to determine the corresponding positions of the capsid proteins of AAV serotypes other than AAV8 based on known methods in the art. For example, sequence alignment of AAV amino acids can be performed to determine differences in amino acid sequences according to the approach employed by Nam et al., 2007. In one example, a multiple sequence alignment program such as ClustalW can be used.

[0089] The present invention preferably contemplates the use of recombinant AAV capsids comprising the modifications according to SEQ ID NO: 1, but it will be understood that amino acid sequences containing conservative variations that either maintain or increase transduction efficiency (or exhibit similar or increased immunogenicity) compared to the effects of recombinant AAV capsids comprising the modifications according to SEQ ID NO: 1 are also encompassed by the present invention. Sequences containing conservative variations that either maintain or increase transduction efficiency (or exhibit similar or increased immunogenicity) compared to SEQ ID NO: 1, SEQ ID NO: 109, or SEQ ID NO: 110 are considered functional equivalents that fall within the scope of the present invention. Thus, in one example, functional equivalents of SEQ ID NO: 1, SEQ ID NO: 109, or SEQ ID NO: 110 (i.e., those in which transduction efficiency is maintained or increased) fall within the scope of the present invention.

[0090] Details of such conservative amino acid changes are provided in Table 2. As one of ordinary skill in the art will recognize, such minor changes can reasonably be predicted not to alter the activity of the polypeptide when expressed in recombinant cells. Such sequences have at least one amino acid residue removed from the polypeptide molecule and a different residue inserted in its place. These sites are preferably substituted in a relatively conservative manner in order to maintain the desired activity.

[0091]

Table 2

[0092] Thus, in one embodiment, the modified recombinant AAV (e.g., recombinant rAAV8) capsid protein comprises any one or more of the modifications listed in Table 2 and thus has a sequence according to any one of SEQ ID NOs: 2-108.

[0093]

Table 3-1

[0094]

Table 3-2

[0095] One of ordinary skill in the art will understand that similar modifications can be made to sequences GNRVDAH (SEQ ID NO: 109) and GNRVDDF (SEQ ID NO: 110) by making conservative amino acid changes such as those outlined in Table 2.

[0096] The term "peptide" is used interchangeably with the term "polypeptide". A polypeptide or class of polypeptides can be defined by the degree of identity (%) of its amino acid sequence to a reference amino acid sequence, or by having a higher % identity to one reference amino acid sequence than another. The % identity of a polypeptide to a reference amino acid sequence is typically determined by GAP analysis (Needleman and Wunsch, 1970; GCG program) using parameters of gap creation penalty = 5 and gap extension penalty = 0.3. In one embodiment, the query sequence is at least 5 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 5 amino acids. In another embodiment, the query sequence is at least 6 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 6 amino acids. In another embodiment, the query sequence is at least 7 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 7 amino acids. Even more preferably, the GAP analysis aligns the two sequences over the full length of the reference amino acid sequence. A polypeptide or class of polypeptides can have the same activity, or different activity, or better activity than a reference polypeptide (e.g., SEQ ID NO: 1). In one embodiment, a modified recombinant AAV (e.g., recombinant rAAV8) capsid protein can contain an amino acid sequence having some degree of homology to any one or more of the modifications listed in Table 3.

[0097] For example, a recombinant AAV (e.g., recombinant rAAV8) capsid protein may include an amino acid sequence that is at least 35%, more preferably at least 40%, more preferably at least 45%, more preferably at least 50%, more preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 76%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant specified SEQ ID NO, preferably SEQ ID NO: 1. If a modified recombinant AAV (e.g., recombinant rAAV8) capsid protein may include an amino acid sequence having 100% identity to the specified SEQ ID NO, the amino acid sequence is identical to the specified SEQ ID NO.

[0098] In another example, a recombinant AAV (e.g., recombinant rAAV8) capsid protein may include one, two, or three amino acids different from the sequence defined according to SEQ ID NO: 1. Examples of suitable peptides are outlined in Table 3.

[0099] One of ordinary skill in the art will understand that the capsid insertion may contain a spacer. An example of a spacer suitable for use in the present invention is a linker. The term "linker" or "linker region" optionally refers to an oligo or polypeptide region of about 1 to 30 amino acids that covalently links any of the above capsid insertions within the capsid gene at a position corresponding to amino acid 590. Optionally, a short oligo or polypeptide linker, e.g., 2 to 10 amino acids in length, can form a covalent linkage between the capsid insertion and the sequence of the capsid gene. A glycine-serine duplex is an example of a suitable linker. For example, in one embodiment, the linker comprises the amino acid sequences of TG and / or GLS according to SEQ ID NOs: 111 and 112, respectively. In another example, the linker comprises the amino acid sequence of GGGS, GGGSGGGS, or GGGGSGGGGS. Preferably, the linker comprises a short sequence formed by amino acids G and A. One of ordinary skill in the art will understand that when determining a linker suitable for use in the present invention described herein, the linker will often be composed of G, A, and S amino acids, and the sequence can be determined based on their properties and interaction with the AAV plasticity loop.

[0100] Transduction efficiency and immunogenicity In one embodiment of the present invention, a method for increasing the transduction efficiency of AAV particles in target cells is provided. Transduction efficiency is understood to include the ability of the AAV particles of the present invention having a modified capsid to result in an increase in the expression of a gene contained within an expression cassette of an AAV particle that may contain, for example, a therapeutic molecule or a reporter gene. Alternatively, an increase in transduction efficiency can be determined, for example, by measuring the expression level of the AAV particle itself (i.e., by determining the expression of VP1, 2, or 3 proteins by Western blot), or by measuring the vector genome amount. The vector genome can be measured using methods known in the art or the methods described in the examples herein. For example, DNA can be isolated from target tissue (e.g., the eye) at the research endpoint and from vector copies (vector genomes) quantifiable by ddPCR using a Qiagen DNA kit.

[0101] The increase in transduction efficiency is intended to be evaluated by comparing AAV particles with modified capsids to parental AAV particles without the modified capsids in the same cell, tissue, or organ type. For example, if the use of AAV particles containing the AAV8 modified capsid gene described in Figure 2B is contemplated, the relative comparison is to the same AAV particles without the modified capsid. The evaluation of the increase in transduction efficiency may also be known as an increase in the infectivity of the target cells and can be determined by methods known in the art, including the methods outlined in the examples herein. In one example, measurement of the vector genome can be evaluated. In this case, by confirming an increase in the amount of vector genome in the target tissue, cell, or organ, an increase in transduction efficiency is shown when compared to the effect of AAV particles without capsid modification. In another method, if the AAV particles contain a reporter such as GFP, FACS can be utilized. In this case, by confirming an increase in the amount of GFP signal from the target tissue, cell, or organ, an increase in transduction efficiency is shown when compared to the effect of AAV particles without capsid modification. Additionally, as further examples, image cytometry or fluorescence microscopy using image analysis can be mentioned.

[0102] For transducing a target cell, tissue, or organ, any one of the AAV particles or compositions containing rAAV particles disclosed herein can be used. In some embodiments, the cells, tissues, or organs transduced using the AAV particles disclosed herein are transduced with the gene of interest contained within the expression cassette. In some cases, the gene is a therapeutic molecule having utility in the treatment of eye disorders. In some embodiments, the cells, tissues, or organs can be transduced in an in vitro setting, where the cells, tissues, or organs are incubated or perfused in a medium. The cell can be one of many cells cultured under certain conditions, or a part of a harvested organ, a part of an organoid, or an organism.

[0103] In some embodiments, cells, tissues, or organs are transduced in vivo, for example, for the purpose of treating a disease. In some embodiments, such rAAV particles contain a gene (i.e., a therapeutic molecule) for the purpose of encoding a therapeutic protein or RNA. In some embodiments, compositions for transducing cells or tissues of the eye (or both eyes) or the brain are provided. In some embodiments, specific tissues in the eye (or both eyes) or the brain are targeted. For example, the retina or one or more cell types of the retina can be targeted. In this case, target cells can include photoreceptors, retinal ganglion cells, bipolar cells, fiber columns, retinal pigment epithelial cells, amacrine cells, astrocytes, horizontal cells, microglia, or Müller glia.

[0104] As used herein, the term "eye cell" refers to any cell in or associated with the function of the eye. This term may refer to any one or more of the photoreceptor cells, including rods, cones, and photosensitive ganglion cells, retinal pigment epithelial (RPE) cells, Müller cells, bipolar cells, horizontal cells, and amacrine cells. In one embodiment, the eye cell is a bipolar cell. In another embodiment, the eye cell is a horizontal cell. In another embodiment, the eye cell is a ganglion cell.

[0105] In another example of the present invention, the AAV particle or its composition is useful in reducing the immune response (i.e., reducing immunogenicity) that may occur when the AAV particle or composition is administered to a target cell, tissue, or organ. In some cases, when the AAV particle has a high homology with the parental wild-type virus that has been shown to infect a high percentage of the human population, administration of the AAV particle can induce an immune response in the subject. This typically presents a limitation to the transduction efficiency of the AAV particle. Both humoral and cell-mediated immunity against wild-type AAV have been documented in healthy donors, and at least in the case of anti-AAV antibodies, it has been shown to potentially have a high impact on the outcome of gene transfer. Several factors can contribute to the overall immunogenicity of the rAAV vector, but vector design and total vector dose appear to be the cause of immune-mediated toxicity. By using AAV particles with the modified capsids described herein, a reduction in the immune response is expected to be observed when administered to a target cell, tissue, or organ, which can increase the transduction efficiency.

[0106] Reduction of the immune response or reduction of immunogenicity can be evaluated by comparing AAV particles with modified capsids to parental AAV particles without modified capsids in the same cell, tissue, or organ type. For example, when the use of AAV particles containing the AAV8 modified capsid gene described in Figure 2B is contemplated, the relative comparison is to the same AAV particle without the modified capsid. Evaluation of the reduction of immunogenicity can be determined by methods known in the art, including the methods outlined in the examples herein. In one example, a serum virus neutralization (SVN) assay can be used. In another example, evaluation of the functional ability of the immune response can be done by measuring specific cell functions ex vivo (i.e., in cells isolated and studied in short- or long-term culture).

[0107] AAV particle The term "AAV" includes AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), AAV type 9 (AAV9), Rh74, AAV9_hu14, AAVshH10, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAA, non-primate AAV, and ovine AAV, as well as other known AAV serotypes in the art.

[0108] AAV, a member of the parvovirus family, is a small non-enveloped icosahedral virus with a single-stranded linear DNA genome of 4.7 kilobases (kb). Since this virus was discovered as a contaminant in purified adenovirus stocks, AAV has been assigned to the genus Dependovirus (D.M. Knipe, P.M. Howley, Field’s Virology., Lippincott Williams & Wilkins, Philadelphia, ed. Sixth, 2013). As AAV is naturally replication-defective, in its wild-type state, AAV depends on a helper virus (typically an adenovirus) to provide the protein factors necessary for replication. The 4.7 kb genome of AAV is flanked by two inverted terminal repeats (ITRs) that fold into hairpin shapes important for replication.

[0109] In one aspect, the present invention contemplates the use of recombinant AAV particles containing a modified capsid and an expression cassette, typically for expressing a therapeutic molecule of interest, preferably for doing so in a subject in need of treatment for an eye disorder. The term "recombinant AAV particles" refers to molecules constructed or modified by recombinant DNA / RNA technology. For example, in one embodiment, the capsid of the AAV particle is modified and can be considered a recombinant in itself, but may form part of a larger AAV recombinant particle.

[0110] The recombinant AAV capsids of the present invention are typically contained within AAV particles for delivery to a target cell, tissue, or organ of interest. The term "AAV virion" or "AAV particle" or "AAV vector" refers to a viral particle composed of at least one AAV capsid polypeptide and typically includes a polynucleotide expression cassette encapsulated within the capsid. If the particle contains a heterologous nucleic acid (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene to be delivered to a mammalian cell), it may be referred to as an "AAV vector" or "AAV expression vector". The term "AAV particle" may include particles that do not contain a nucleic acid expression cassette containing the gene of interest, but typically relates to particles that contain a nucleic acid expression cassette containing the gene of interest. In some embodiments, the AAV particle includes the ITR of serotype AAV2 and / or the rep ORF. In other embodiments, the AAV particle may be a pseudotype that includes serotype AAV8 and a modified capsid protein from the ITR and / or rep ORF of serotype AAV2. An example of a suitable pseudotype AAV particle is according to the sequence of SEQ ID NO: 136 or 143.

[0111] When it is contemplated that the AAV particles described herein contain an "expression cassette", these terms refer to nucleic acid sequences encoding various nucleic acid sequences, including those that target expression to retinal cells of the eye upon expression. The expression cassette may also include a heterologous nucleic acid sequence that is not of AAV origin as part of the nucleic acid insertion. This heterologous nucleic acid sequence typically includes the sequence of interest for genetic transformation of the cell. Generally, the heterologous nucleic acid sequence is flanked by at least one, generally two AAV inverted terminal repeats (ITRs). In some cases, the ITRs may be of a serotype different from wild-type AAV. In these cases, the AAV vector may be considered a pseudotype vector.

[0112] Naturally replication-deficient and capable of transducing almost all cell types in the human body, AAV is a representative of an ideal vector for therapeutic use in gene therapy or vaccine delivery. In its wild-type state, the AAV life cycle includes a latent stage where the AAV genome integrates site-specifically into the host chromosome after infection, and an infectious stage where, after infection with either adenovirus or herpes simplex virus, the integrated genome is subsequently rescued, replicated, and packaged into infectious virus. When vectorized, the viral Rep and Cap genes of AAV are removed and provided in trans during virus production, with the ITRs being the only viral DNA that remains (Vasileva & Jessberger, Nature reviews. Microbiology (2005)). The Rep and Cap are then replaced with a series of possible transfer vector constructs for gene addition or gene targeting.

[0113] Such vectorized recombinant AAV (rAAV) transduces both dividing and non-dividing cells and shows robust and stable expression in quiescent tissues. The number of completed or ongoing rAAV gene therapy clinical trials for treating various genetic or acquired diseases has increased dramatically. Specifically, due to its properties of non-pathogenicity, broad host range infectivity including non-dividing cells, and potential site-specific chromosomal integration, AAV has become an attractive tool for gene transfer. The first rAAV-based gene therapy approved in Western countries (Glybera® for lipoprotein lipase deficiency, approved for use in the European Union in 2012) has stimulated the realistic possibility for the gene therapy community, investors, and regulatory authorities to move rAAV therapies into clinics worldwide.

[0114] One of ordinary skill in the art can manipulate AAV particles to have suitability for transducing target cells, tissues, or organs. For example, if a subject has a disease, disorder, or condition associated with the liver, one of ordinary skill in the art can utilize AAV serotypes (e.g., AAV7, AAV8, AAV9) that are effective for liver transduction. Similarly, if a subject has a disease, disorder, or condition associated with the cardiac striated muscle, one of ordinary skill in the art can utilize AAV serotypes (e.g., AAV1, AAV8, AAV9) that are effective for cardiac transduction. Examples of suitable serotypes depending on the cells, organs, or tissues to be transduced are outlined in Table 4 below.

[0115] In one example, the present invention contemplates the expression of a therapeutic molecule within AAV particles for delivery to cells of the retina. There are several approaches by which AAV particles can target cells of the retina. One example can be to use particles of any pseudotype of AAV1, AAV2, AAV4, AAV5, or AAV8 serotype.

[0116] [Table 4]

[0117] Additionally, the AAV particles can contain additional regulatory elements that limit expression in the target cells, tissues, or organs. In the case of the liver, a liver-specific promoter can be used. Similarly, in the treatment of cardiac conditions, diseases, or disorders, a heart-specific promoter can be used. When transduction of retinal cells is contemplated, expression can be limited by utilizing a retinal cell-specific promoter, including those listed in Table 5 below.

[0118] [Table 5-1]

[0119] [Table 5-2]

[0120] As used herein, the term "promoter" refers to a nucleic acid sequence that directly or indirectly controls the transcription of a corresponding nucleic acid coding sequence (e.g., a gene of interest or a therapeutic molecule) to which it is operably linked. "Operably linked" refers to the ability of a promoter or regulatory element to have a functional effect on the transgene to which it is linked.

[0121] A promoter can function alone to regulate transcription or can act in concert with one or more other regulatory sequences (e.g., an enhancer or silencer, or a regulatory element). In the context of the present invention, a promoter is typically operably linked to a gene of interest or a therapeutic molecule to regulate its transcription. When a promoter is operably linked to a gene of interest or a therapeutic molecule, the promoter can (1) confer a significant degree of cell, tissue, or organ-specific expression of the gene in vivo or in vitro (e.g., in retinal cells), and / or (2) increase the expression level of the gene in the target cell, tissue, or organ.

[0122] A promoter can be homologous (i.e., from the same species as the animal transfected with the nucleic acid expression cassette, specifically a mammal) or heterologous (i.e., from a source other than the species of the animal transfected with the expression cassette, particularly a non-mammalian source). Thus, the source of the promoter can be any virus, any unicellular prokaryotic or eukaryotic organism, any vertebrate or invertebrate organism, or even a synthetic promoter (i.e., having a sequence not found in nature), provided that the promoter is functional in combination with the regulatory elements described herein. In one embodiment, the promoter is a mammalian promoter, specifically a mouse or human promoter. Alternatively, the promoter can be an inducible promoter or a constitutive promoter. In one embodiment, the promoter is a chimeric promoter (i.e., containing elements from different species).

[0123] To minimize the length of the nucleic acid expression cassette, the regulatory element can be linked to a minimal promoter, or a truncated version of the promoters described herein. As used herein, a "minimal promoter" (also referred to as a basal promoter or core promoter) is part of a full-size promoter but lacks at least a portion of the sequences that contribute to the regulation (e.g., tissue-specific) of expression, yet is still capable of driving expression. This definition encompasses both promoters that lack (tissue-specific) regulatory elements and are capable of driving gene expression but have lost the ability to express that gene in a tissue-specific manner, as well as promoters that lack (tissue-specific) regulatory elements and are capable of driving (presumably reduced) gene expression but have not necessarily lost the ability to express that gene in a tissue-specific manner. Preferably, the promoters contained in the nucleic acid expression cassettes disclosed herein are 1000 nucleotides or less, 900 nucleotides or less, 800 nucleotides or less, 700 nucleotides or less, 600 nucleotides or less, 500 nucleotides or less, 400 nucleotides or less, 300 nucleotides or less, or 250 nucleotides or less in length.

[0124] An "inducible" promoter can be a promoter that is under environmental control and can be used in some embodiments of the present invention. Examples of environmental conditions that can initiate transcription by an inducible promoter include anaerobic conditions and the presence of light. In an inducible promoter, the rate of transcription increases in response to an inducer. Exemplary inducible promoters include, but are not limited to, the tetracycline-inducible expression system (or Tet response element (TRE) and tetO), as well as inducible promoters from steroid hormone genes whose transcriptional activity can be induced by glucocorticoid hormones.

[0125] According to certain embodiments, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the expression of the therapeutic molecule occurs within the target cell, tissue, or organ, preferably within the cells of the retina. Thus, according to certain embodiments, less than 25%, less than 10%, less than 5%, less than 2%, or even less than 1% of the expression of the therapeutic molecule occurs in organs or tissues other than the target cell, tissue, or organ, preferably other than the cells of the retina.

[0126] An approach for targeting expression to a target cell, tissue, or organ is to use a nucleic acid regulatory element to increase gene expression in the cell, tissue, or organ. As used herein, a "regulatory element" refers to a transcriptional control element capable of regulating and / or controlling the transcription of a gene, specifically, a non-coding cis-acting transcriptional control element. As used herein, a retina-specific regulatory element refers to a transcriptional control element capable of regulating and / or controlling the transcription of a gene within the retina, specifically, a non-coding cis-acting transcriptional control element.

[0127] A regulatory sequence, or control element, refers to a nucleotide sequence that affects the transcription, RNA processing, or stability of an associated coding sequence, or the timing and level / amount of translation. Examples of regulatory sequences include promoters, translation leader sequences, introns, enhancers, stem-loop structures, repressor binding sequences, termination sequences, polyadenylation recognition sequences, and the like. Certain regulatory sequences can be located upstream and / or downstream of the coding sequence to which they are operably linked. A regulatory element can include at least one transcription factor binding site (TFBS), more specifically, at least one binding site for a tissue-specific transcription factor.

[0128] Typically, regulatory elements as used herein increase or enhance gene expression as compared to the transcription of genes that do not contain the regulatory element. Thus, regulatory elements include, in particular, enhancer sequences, but it is understood that regulatory elements that increase transcription are not limited to typical far-upstream enhancer sequences and can occur at any distance from the gene they regulate. Indeed, it is known in the art that sequences that regulate transcription can be located either upstream (e.g., within the promoter region) or downstream (e.g., within the 3'UTR) of the gene they regulate in vivo, and can be located close to or further away from the gene. Notably, the regulatory elements disclosed herein typically include naturally occurring sequences, but combinations of such regulatory elements or some copies of the regulatory elements, i.e., regulatory elements (or parts thereof) that include non-naturally occurring sequences, are also envisioned as regulatory elements. Regulatory elements as used herein can constitute part of a larger sequence involved in transcriptional control, e.g., part of a promoter sequence. However, a regulatory element alone typically is not sufficient to initiate transcription and requires a promoter (which can itself be a regulatory element) for this purpose. The regulatory elements disclosed herein are provided as nucleic acid molecules, i.e., isolated nucleic acids, or isolated nucleic acid molecules or polynucleotides.

[0129] In the context of the present invention, nucleic acid regulatory elements typically include artificial sequences that contain regulatory elements and are obtained by rearranging transcription factor binding sites (TFBSs) present in recombinant AAV vectors. Nucleic acid regulatory elements for increasing gene expression in the retina are known in the art and can be utilized in the present invention.

[0130] The present invention also contemplates the use of an adjustable expression cassette for systematically controlling and silencing the expression of therapeutic molecules described in PCT / AU2019 / 050046, the entire content of which is incorporated herein by reference. In one example, the present invention contemplates the use of an expression cassette comprising a kill switch and an adjustable element operably linked to a nucleic acid sequence encoding a therapeutic molecule, wherein the activity of the adjustable element is regulated by a regulatory factor compound and activation of the kill switch silences the expression of the nucleic acid encoding the therapeutic molecule from the cassette. The expression cassette is preferably contained within a viral particle of the invention comprising a modified AAV capsid protein such as that defined in SEQ ID NO: 1 or a functional equivalent thereof.

[0131] The adjustable expression cassette encompassed by this disclosure includes a "kill switch". The term "kill switch" refers to an element(s) of the cassette as defined herein that can silence the expression of a nucleic acid encoding a therapeutic molecule(s) from the cassette. The term "silencing" is used in this context to refer to the complete and irreversible suppression of expression. In one example, silencing completely abrogates the expression of the nucleic acid encoding the therapeutic molecule from the expression cassette as defined herein.

[0132] In one example, the kill switch can facilitate removal of a nucleic acid sequence encoding a therapeutic molecule(s) or a portion thereof from the cassette. In another example, the kill switch can facilitate removal of some or all of the transcriptional machinery required for expression of a therapeutic molecule(s) from the cassette. In another example, the kill switch can facilitate removal of one or more promoters. In another example, the kill switch can facilitate removal of a transcriptional activator gene. In another example, the kill switch can facilitate removal of the entire expression cassette from a viral vector or AAV particle (i.e., all foreign genes and regulatory elements are removed). In another example, the kill switch can facilitate inversion of a sequence encoding one or more of the above elements. For example, the kill switch can facilitate inversion of some or all of a promoter(s), a therapeutic molecule(s), or a sequence(s) encoding a transcriptional activator.

[0133] In the context of the present invention, any intron can be utilized in the expression cassettes described herein. The term "intron" encompasses any portion of an entire intron that is large enough to be recognized and spliced by the nuclear splicing apparatus. Typically, short functional intron sequences are preferred to keep the size of the expression cassette as small as possible and to facilitate construction and manipulation of the expression cassette. In some embodiments, the intron is obtained from a gene encoding a protein encoded by a coding sequence within the expression cassette. The intron can be located 5' to the coding sequence, 3' to the coding sequence, or within the coding sequence. The advantage of placing the intron 5' to the coding sequence is to minimize the chance that the intron will interfere with the function of the polyadenylation signal. In embodiments, the nucleic acid expression cassettes disclosed herein further comprise an intron. Non-limiting examples of suitable introns are murine minute virus (MVM) intron, beta-globin intron (betaIVS-1), factor IX (FIX) intron A, simian virus 40 (SV40) small t intron, and beta-actin intron.

[0134] Any polyadenylation signal that directs the synthesis of a polyA tail is useful in the expression cassettes described herein, and examples thereof are well known to those skilled in the art. Exemplary polyadenylation signals include, but are not limited to, the polyA sequence derived from the Simian Virus 40 (SV40) late gene, the Bovine Growth Hormone (BGH) polyadenylation signal, the minimal rabbit beta-globin (mRBG) gene, and the synthetic polyA (SPA) site described in Levitt et al., 1989.

[0135] AAV vectors typically contain approximately 145 nt of inverted terminal repeats (ITRs) at either end, which contain the sequences necessary for DNA replication and packaging into virions for nucleic acid delivery. In one example, the ITRs of AAV serotype 2 are used. However, ITRs from other suitable serotypes may be selected. These ITRs or other AAV components can be readily isolated from AAV serotypes using techniques available to those skilled in the art (see WO2006 / 110689).

[0136] Because they are non-pathogenic and exhibit a broad range of tissue specificities, various recombinant AAV vector systems have been developed for nucleic acid delivery. AAV vectors can be readily constructed using techniques known in the art. See, for example, U.S. Patent Nos. 5,173,414 and 5,139,941, International Publication Nos. WO1992 / 01070 and WO1993 / 03769, Muzyczka., 1992, Kotin, 1994, and Zhou et al., 1994.

[0137] In another example, AAV is self-complementary AAV (sc-AAV) (see, for example, US2012 / 0141422). Self-complementary AAV vectors package an inverted repeat genome that can fold into dsDNA without the need for DNA synthesis or base pairing between multiple vector genomes.

[0138] In one embodiment, the recombinant AAV particles have a sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% identical to the sequence set forth in SEQ ID NO: 136 or 143, or is identical. One of ordinary skill in the art will understand that the sequences set forth in SEQ ID NO: 136 or 143 may be modified without substantially changing the function or structure of the sequences, including those described herein and known in the art.

[0139] AAV production Various methods for producing rAAV particles and nucleic acid vectors are known (see, e.g., Zolotukhin et al., 2002 and U.S. Patent Publications Nos. US20070015238 and US20120322861, which are incorporated herein by reference; plasmids and kits are available from ATCC and Cell Biolabs Inc). In some embodiments, an expression cassette (e.g., a plasmid) containing the gene of interest can be combined with one or more helper plasmids containing, for example, the rep gene (e.g., encoding Rep78, Rep68, Rep52, and Rep40) and the cap gene (encoding VP1, VP2, and VP3, including the modified VP regions described herein), and the nucleic acid expression cassette can be transfected into recombinant cells, referred to as helper or producer cells, such that the nucleic acid expression cassette is packaged within or encapsulated by the capsid and then purified.

[0140] Non-limiting examples of mammalian helper cells include HEK293 cells, COS cells, HeLa cells, BHK cells, or CHO cells (e.g., ATCC ( Registered trademark ) , CRL-1573 ( Trademark ) , ATCC ( Registered trademark ) , CRL1651 ( Trademark ), ATCC ( Registered Trademark ) , CRL-1650 ( Trademark ) , ATCC CCL-2, ATCC ( Registered Trademark ) , CCL-10 ( Trademark ) , or ATCC ( Registered Trademark ) CCL-61 ( Trademark ) (see). Helper cells may contain the rep and / or cap genes encoding the rep protein and / or cap protein. In some embodiments, the packaging is performed in vitro. In some embodiments, a nucleic acid expression cassette (e.g., a plasmid) containing the gene of interest is combined with one or more helper plasmids containing, for example, a first serotype rep gene and a cap gene of the same or a different serotype, and the helper cells are transfected such that rAAV particles are packaged. In some embodiments, the one or more helper plasmids include a first helper plasmid containing the rep gene and the cap gene, and a second helper plasmid containing one or more of the following helper genes: the Ela gene, the Elb gene, the E4 gene, the E2a gene, and the VA gene. The helper genes are genes encoding the helper proteins Ela, Elb, E4, E2a, and VA. Helper plasmids, and methods of making such plasmids, are known in the art and are commercially available (see, for example, pDF6, pRep, pDM, pDG, pDPlrs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E / R585E), and pDP8 from Vector Biolabs, Cellbiolabs, Agilent Technologies, and Addgene). Plasmids encoding the wild-type AAV coding region of a particular serotype are also known and available. For example, pSub201 is a plasmid containing the coding region of the wild-type AAV2 genome (Samulski et al., 1987).

[0141] ITR arrays and plasmids containing ITR arrays are known in the art and are commercially available (see, for example, products and services available from Vector Biolabs, Cellbiolabs, Agilent Technologies, and Addgene). Methods for the large-scale production of AAV using herpes virus-based systems are also known. See, for example, Clement et al., 2009. Methods for producing exosome-related AAVs that may be more resistant to neutralizing anti-AAV antibodies are also known.

[0142] Methods for producing and using pseudotyped rAAV vectors are also known in the art (see, for example, Duan et al., 2001, Halbert et al., 2000, Zolotukhin et al., 2002, and Auricchio et al., 2001).

[0143] Gene of interest The AAV particles or compositions thereof described herein can be used to deliver a gene of interest to a target cell, tissue, or organ for the treatment of a subject in need of treatment. In one example, the gene of interest can be a therapeutic molecule known to have utility in the treatment of a disease, disorder, or condition. In another example, the therapeutic molecule can be a gene encoding a desired RNA or protein. The therapeutic molecules of the present invention are contemplated to have a therapeutic effect in the cell, tissue, or organ to which the therapeutic molecule is delivered. When treating an eye disorder, the therapeutic effect of the therapeutic molecule can be to inhibit inflammation and / or angiogenesis in the target cell or tissue. The therapeutic molecules encompassed by the present disclosure are not particularly limited as long as they can be expressed from the expression cassettes disclosed herein or translated from the nucleic acids expressed therefrom.

[0144] As used herein, "nucleotide", "polynucleotide", or "nucleic acid", or "nucleic acid molecule" means a polymer of nucleotides, including genomic DNA, mRNA, cRNA, and cDNA, tRNA, siRNA, shRNA, and hpRNA. A given polynucleotide can be, for example, of cellular, genomic, or synthetic origin made by an automated synthesizer, can be combined with carbohydrates, lipids, proteins, or other materials, can be labeled with a fluorescent or other group, or can be bound to a solid support to perform a specific activity as defined herein, or can contain one or more modified nucleotides not naturally found and known to those skilled in the art. The polymer can be single-stranded, essentially double-stranded, or partially double-stranded. Base pairing refers to standard base pairing between nucleotides, including G:U base pairs. "Complementary" means that two polynucleotides are capable of base pairing (hybridization) along a part of their length or along the entire length of one or both.

[0145] The polynucleotide or nucleic acid sequence herein can be a deoxyribonucleic acid (DNA) sequence or a ribonucleic acid (RNA) sequence, and can include naturally occurring bases including adenine, guanine, cytosine, thymidine, and uracil. The sequence can also contain modified bases. Examples of such modified bases include aza and deaza adenine, guanine, cytosine, thymidine, and uracil; as well as xanthine and hypoxanthine. The nucleic acid can be either double-stranded or single-stranded, representing the sense strand or the antisense strand. Further, the term "nucleic acid" includes complementary nucleic acid sequences.

[0146] As used herein, the term "nucleic acid molecule" or derivative thereof is intended to include unmodified DNA or RNA, or modified DNA or RNA. For example, the nucleic acid molecules of the present disclosure can be composed of single-stranded and double-stranded DNA, DNA that is a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, and RNA that is a mixture of single-stranded and double-stranded regions, and hybrid molecules that can be single-stranded, or more typically double-stranded, or a mixture of single-stranded and double-stranded regions and contain DNA and RNA. Additionally, it can be useful for the nucleic acid molecules of the present disclosure to be composed of triple-stranded regions that include RNA or DNA, or both RNA and DNA. The nucleic acid molecules of the present disclosure can also contain one or more modified bases, or a DNA or RNA backbone that has been modified for stability or other reasons. Examples of "modified" bases include, for example, tritiated bases and unusual bases such as inosine. Various modifications can be made to DNA and RNA, and thus, "nucleic acid molecule" encompasses chemically, enzymatically, or metabolically modified forms. The term "polynucleotide" shall have the corresponding meaning.

[0147] The term "isolated polynucleotide" means a polynucleotide that is generally separated from the polynucleotide sequences with which it is associated or linked in its natural state when the polynucleotide is found in nature. Preferably, an isolated polynucleotide, when found in nature, contains less than 90% of the other components that are naturally associated. In one embodiment, the polynucleotide is not naturally occurring (chimeric polynucleotide), for example, by the covalent joining of two shorter polynucleotide sequences in a manner not found in nature.

[0148] A "chimeric gene" refers to any gene that contains covalently joined sequences that are not found joined in nature. Typically, a chimeric gene contains regulatory and transcriptional sequences, or protein-coding sequences, that are not found together in nature. Thus, a chimeric gene can contain regulatory and coding sequences from different sources, or regulatory and coding sequences from the same source but arranged in a manner different from that found in nature. The term "endogenous" is used herein to refer to substances that are present in an organism that is not normally modified at the same developmental stage as the organism under investigation, or that are produced in the organism. An "endogenous gene" refers to a native gene in its natural position in an organism's genome. As used herein, the terms "recombinant nucleic acid molecule", "recombinant polynucleotide", or variations thereof refer to nucleic acid molecules constructed or modified by recombinant DNA / RNA technology. Terms such as "exogenous polynucleotide", "foreign polynucleotide", or "heterologous polynucleotide" refer to any nucleic acid introduced into a cell's genome by experimental manipulation.

[0149] A foreign or exogenous gene can be a gene inserted into a non-native organism or cell, a native gene introduced into a new location within its natural host, or a chimeric gene. Alternatively, a foreign or exogenous gene can be the result of editing the genome of an organism or cell, or its descendants. A "transgene" is a gene that has been introduced into the genome by a transformation procedure.

[0150] The terms "genetically engineered", "genetically modified", "genetic modification", or variants thereof refer to any human genetic manipulation, including introducing a gene into a cell by transformation or transduction, gene editing, cisgenesis, mutating a gene in a cell, and changing or regulating the gene in the cell or organism in which these actions were performed, or its descendants.

[0151] Furthermore, the term "exogenous" in the context of a polynucleotide (nucleic acid) refers to a polynucleotide when it is present in a cell that does not naturally contain it. The cell can be a cell that contains a non-endogenous polynucleotide that results in a change in the amount of the encoded polypeptide produced, for example, a cell containing an exogenous polynucleotide that increases the expression of an endogenous polypeptide, or a cell that does not produce a polypeptide in its natural state. The increase in the production of the polypeptide of the present invention is also referred to herein as "overexpression". The exogenous polynucleotides of the present invention include polynucleotides that are not separated from the other components of the transgenic (recombinant) cell or cell-free expression system in which they are present, and such polynucleotides produced in such a cell or cell-free system that have been subsequently purified to remove at least some of the other components. An exogenous polynucleotide (nucleic acid) can be a naturally occurring, contiguous series of nucleotides, or can contain two or more contiguous series of nucleotides from different sources (naturally occurring and / or synthetic) joined together to form a single polynucleotide. Typically, such chimeric polynucleotides include at least an open reading frame encoding a polypeptide of the present invention operably linked to a promoter suitable for driving transcription of the open reading frame in a cell of interest.

[0152] The percent identity of polynucleotides is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) using a gap creation penalty = 5 and a gap extension penalty = 0.3. Preferably, the GAP analysis aligns the two sequences over their entire lengths.

[0153] It will be understood that preferred embodiments include polynucleotide sequences having a higher percent identity value than those provided above with respect to the defined polynucleotide. Thus, where applicable, in light of the minimum percent identity figures, the polynucleotide is at least 50%, at least 60%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, even more preferably at least 99.9% identical to the relevant specified SEQ ID NO.

[0154] It will be understood that when referring to polynucleotide identity herein, any given sequence identity is with reference to the open reading frame sequence.

[0155] In a further embodiment, the invention relates to polynucleotides that are substantially identical or identical to the polynucleotides specifically described herein. As used herein, with respect to polynucleotides, the term "substantially identical" means one or several (e.g., 2, 3, or 4) nucleotide substitutions while maintaining at least one activity of the native protein encoded by the polynucleotide. In addition, the term includes nucleotide additions or deletions, which result in an increase or decrease in the size of the native protein encoded by the polynucleotide by one or several (e.g., 2, 3, or 4) amino acids while maintaining at least one activity of the native protein encoded by the polynucleotide.

[0156] The present invention also relates to the use of oligonucleotides, for example, in methods of screening for the polynucleotides of the present invention or in methods of encoding the polypeptides of the present invention. As used herein, an "oligonucleotide" is a polynucleotide having a maximum length of 50 nucleotides. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on the nucleic acid molecule of the present invention. They can be RNA, DNA, or any combination or derivative thereof. Oligonucleotides are typically relatively short single-stranded molecules that are 10 to 30 nucleotides in length, generally 15 to 25 nucleotides in length. When used as a guide for genome editing, as a probe, or as a primer in an amplification reaction, the minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on the target nucleic acid molecule. Preferably, the oligonucleotide is at least 15 nucleotides in length, more preferably at least 18 nucleotides in length, more preferably at least 19 nucleotides in length, more preferably at least 20 nucleotides in length, more preferably at least 22 nucleotides in length, even more preferably at least 25 nucleotides in length. The oligonucleotides of the present invention used as probes are typically conjugated to a label such as a radioisotope, an enzyme, biotin, a fluorescent molecule, or a chemiluminescent molecule.

[0157] As those skilled in the art will appreciate, the sequences of the oligonucleotide primers described herein can vary to some extent without affecting their usefulness for the methods of the invention. "Variants" of the oligonucleotides disclosed herein that are useful for the methods of the invention (also referred to herein as "primers" or "probes" depending on their use) include molecules of a size that varies relative to the genome that is close to that of a particular oligonucleotide molecule defined herein, and / or that are capable of hybridizing to a genome that is close to it. For example, a variant can include additional nucleotides (such as 1, 2, 3, 4, or more), or fewer nucleotides as long as they still hybridize to the target region. Furthermore, some nucleotides can be substituted without affecting the ability of the oligonucleotide to hybridize to the target region. In addition, variants that hybridize close to the region of the genome to which a particular oligonucleotide defined herein hybridizes (e.g., but not limited to, within 50 nucleotides or within 100 nucleotides) can be readily designed.

[0158] The present invention includes oligonucleotides that can be used, for example, as guides for RNA-guided endonucleases, probes for identifying nucleic acid molecules, or primers for producing nucleic acid molecules. The probes and / or primers can be used to clone homologs of the polynucleotides of the present invention from other species. Furthermore, hybridization techniques known in the art can be used to screen genomic or cDNA libraries for such homologs.

[0159] The nucleotide sequence encoding the recombinant AAV particles described herein, which contains the modified capsid protein of the present invention, can also be defined by its ability to hybridize with the nucleotide sequence under moderate, or preferably stringent, hybridization conditions. Stringent hybridization conditions are herein defined as conditions that allow a nucleic acid sequence of at least about 25, preferably about 50 nucleotides, 75 or 100, most preferably about 200 or more nucleotides, to hybridize in a solution containing about 1 M salt at a temperature of about 65 °C, preferably 6×SSC, or any other solution having an equivalent ionic strength, and to be washed in a solution containing about 0.1 M salt or less, preferably 0.2×SSC, or any other 65 °C solution having an equivalent ionic strength. In one embodiment, stringent conditions are (1) using low ionic strength and high temperature for washing, e.g., 0.015 M NaCl / 0.0015 M sodium citrate / 0.1% NaDodSO 4 at 50 °C, (2) using a denaturant such as 50% (v / v) formamide, 750 mM NaCl, 50 mM sodium phosphate buffer at pH 6.5 containing 75 mM sodium citrate, 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone during hybridization at 42 °C, or (3) using 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5×Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.2×SSC and 0.1% SDS, and 0.1% SDS and 10% dextran sulfate in 0.1% SDS at 42 °C. Preferably, hybridization is carried out overnight, i.e., for at least 10 hours, and preferably washing is carried out for at least 1 hour while changing the washing solution at least twice. These conditions generally allow specific hybridization of sequences having at least about 90% or more sequence identity.

[0160] Moderate conditions, as used herein, are conditions that allow a nucleic acid sequence of at least 50 nucleotides, preferably at least about 200 nucleotides, to hybridize in a solution containing about 1 M salt at a temperature of about 45°C, preferably 6×SSC, or any other solution having an equivalent ionic strength, and to be washed in a solution containing about 1 M salt at room temperature, preferably 6×SSC, or any other solution having an equivalent ionic strength. Preferably, hybridization is carried out overnight, i.e., for at least 10 hours, and preferably, washing is carried out for at least 1 hour while changing the wash solution at least twice. These conditions typically allow specific hybridization of sequences having up to 50% sequence identity. One of ordinary skill in the art will be able to modify these hybridization conditions to specifically identify sequences having identities that vary between 50% and 90%.

[0161] As used herein, the term "transgene" refers to a specific nucleic acid sequence that encodes a polypeptide or a portion of a polypeptide that is expressed in a cell into which the nucleic acid sequence has been introduced. However, a transgene can also be expressed as RNA and can typically control (e.g., decrease) the amount of a specific polypeptide in the cell into which the nucleic acid sequence is inserted. A transgene can be homologous or heterologous to the promoter (and / or the animal into which it is introduced, specifically, a mammal, e.g., when a nucleic acid expression cassette is used for gene therapy).

[0162] The introduced gene may be a full-length cDNA or genomic DNA sequence, or any fragment, subunit, or variant thereof having at least some biological activity that is therapeutically effective in treating a subject in need of treatment for a condition, disorder, or disease. Specifically, the introduced gene can be a minigene, i.e., a gene sequence lacking some, most, or all of its intron sequences. Thus, the introduced gene can optionally contain an intron sequence. Optionally, the introduced gene can be a hybrid nucleic acid sequence, i.e., one constructed from homologous and / or heterologous cDNA and / or genomic DNA fragments.

[0163] When a "variant form" is contemplated, the nucleic acid sequence can contain one or more nucleotides that differ from the wild-type or naturally occurring sequence, i.e., the variant nucleic acid sequence contains one or more nucleotide substitutions, deletions, and / or insertions. Nucleotide substitutions, deletions, and / or insertions can result in a gene product (i.e., a protein or nucleic acid) whose amino acid / nucleic acid sequence differs from the wild-type amino acid / nucleic acid sequence. The preparation of such variants is known in the art. In the context of the present invention, any nucleotide substitutions, deletions, and / or insertions introduced into the introduced gene nucleotide sequence do not significantly adversely affect the function of the therapeutic effect of the introduced gene, but can enhance the function.

[0164] In one example, the AAV particle or a composition thereof contains a nucleic acid sequence encoding a therapeutic polypeptide. For example, the nucleic acid sequence can be expressed from the AAV particle as defined herein and translated by the cellular machinery to produce a therapeutic polypeptide.

[0165] Exemplary therapeutic polypeptides include binding proteins such as immunoglobulins, antibodies, and antigen-binding fragments. For example, therapeutic polypeptides include single-chain Fv fragments (scFv) linked to the constant region of an antibody, dimeric scFv (di-scFv), (scFv)n, scFv, or di-scFv, Fc or heavy chain constant domains (CH)2 and / or CH3, diabodies, triabodies, tetra-bodies, Fab, F(ab’)2, and antibodies. In one example, the therapeutic polypeptide is an antibody or a TRAP molecule. Examples of such therapeutic molecules include ranibizumab, bevacizumab, and aflibercept.

[0166] In another example, the therapeutic polypeptide comprises the antigen-binding site of an antibody.

[0167] In another example, the therapeutic molecule can be an inhibitory oligonucleotide. Exemplary inhibitory oligonucleotides include isolated or synthetic antisense RNA or DNA, siRNA or siDNA, miRNA, miRNA mimics, shRNA or DNA, and chimeric antisense DNA or RNA. As used herein, the term "antisense" means a nucleotide sequence that is complementary to a coding sequence and can thus bind to this coding sequence, which can be either the sequence of the strand of the DNA duplex that undergoes transcription or the sequence of a messenger RNA molecule. The term "short hairpin RNA" or "shRNA" refers to an RNA structure having a double region and a loop region. The term "small interfering RNA" (siRNA) is sometimes known as small interfering RNA or silencing RNA and is a class of double-stranded RNA molecules 20-25 base pairs in length. An siRNA that inhibits or prevents translation into a specific protein is denoted by the protein name combined with the term siRNA. Thus, an siRNA that interferes with the translation of VEGF is denoted by the expression "VEGF siRNA". The term "microRNA" (abbreviated miRNA) is a small non-coding RNA molecule (containing approximately 22 nucleotides) found in plants, animals, and some viruses and functions in RNA silencing and post-transcriptional regulation of gene expression. The prefix "miR" is followed by a dash and a number, and the number at the end often indicates the order of naming. Different miRNAs having substantially the same sequence except for one or two nucleotides are annotated with additional lower-case letters. A large number of miRNAs are known in the art (miRBase V.21 nomenclature; Kozomara et al., 2014, Griffiths-Jones, 2004). In another example, the inhibitory oligonucleotides encompassed by the present disclosure inhibit the activity of one or more miRNAs. Various species are suitable for this purpose. Examples include antagomirs, interfering RNAs, ribozymes, miRNA sponges, and miR masks.The term "antagomir" is used in the context of the present disclosure to refer to a chemically modified antisense oligonucleotide that binds to a target miRNA and inhibits miRNA function by preventing the binding of the miRNA to its cognate gene target.

[0168] In one example, the therapeutic molecule is an "anti-angiogenic molecule". The term "anti-angiogenic molecule" is used in the context of the present disclosure to refer to a molecule expressed from an AAV particle as defined herein that inhibits the development of blood vessels, e.g., inhibits angiogenesis, endothelial cell growth, blood vessel stability, and / or vasculogenesis. Anti-angiogenic molecules encompassed by the present disclosure include polynucleotide(s), polypeptide(s), antibody(ies), or conjugates or fusion proteins thereof. Exemplary anti-angiogenic molecules include inhibitors of VEGF and members of the VEGF family, PIGF, the PDGF family, the fibroblast growth factor family (FGF), the TIE ligand (angiopoietin), ephrin, ANGPTL3, and ANGPTL4. In other examples, the anti-angiogenic molecule inhibits growth hormones such as insulin-like growth factor I (IGF-I), VIGF, epidermal growth factor (EGF), CTGF and members of the CTGF family, TGF-α and TGF-β. Other examples of anti-angiogenic molecules include antibodies against VEGF, antibodies against VEGF receptors, and angiogenesis inhibitors such as angiostatin, endostatin, and fusions thereof. Thus, in one example, the therapeutic molecule comprises endostatin and / or angiostatin. In another example, the therapeutic molecule is a fusion of one or more of the molecules described herein. For example, the therapeutic molecule may comprise a fusion of endostatin and angiostatin.

[0169] In one example, the therapeutic molecule is an anti-inflammatory molecule. In one example, the anti-inflammatory molecule is an interleukin such as IL-10, IL-4, IL-6, IL-11, or IL-13. For example, the anti-inflammatory molecule can be IL-10. In another example, the anti-inflammatory molecule is an interleukin-1 receptor antagonist (IL-1RA), or a fusion of IL-10 and IL-1RA. In other examples, the anti-inflammatory molecule inhibits a pro-inflammatory cytokine such as IL-1, tumor necrosis factor alpha (TNF-α), or IL-18. In other examples, the anti-inflammatory molecule increases the production or number of CD14+CD16+ cells in a subject, reduces IL-6 levels, reduces TNF-alpha levels, and / or increases IL-10 levels.

[0170] In another example, the therapeutic molecule is a neurotrophic factor. Neurotrophic factors are thought to be responsible for the maturation of developing neurons and the maintenance of adult neurons. In this regard, neurotrophic factors can be used to inhibit or reverse neuronal degeneration and death. Examples of neurotrophic factors include, for example, brain-derived neurotrophic factor, nerve growth factor, transforming growth factor, glial cell line-derived neurotrophic factor, neurotrophin 3, neurotrophin 4 / 5, and interleukin 1-B.

[0171] In another example, the therapeutic molecule is cytotoxic to cancer cells. In other examples, the therapeutic molecule inhibits one or more of nuclear factor-kappa B (NFκB), c-kit (CD117, stem cell factor receptor), heat shock protein 90 (Hsp90), the Ras-Raf mitogen-activated protein kinase (MEK) pathway, Bcl-2, IL-2, or TNF-alpha (e.g., anti-inflammatory soluble TNF-R).

[0172] Treatment and prevention In one aspect of the invention, there is provided a method for treating or preventing a disease, condition, or disorder in a subject, comprising administering to the subject the AAV particles or compositions thereof described herein.

[0173] As used herein, the terms "patient" and "subject" to be treated are used interchangeably and refer to human or other mammalian patients and subjects, including any individual to be examined or treated using the methods of the present invention. Suitable mammals within the scope of the present invention include, but are not limited to, primates, companion animals (i.e., cats and dogs), laboratory animals (e.g., rabbits, mice, rats), and any other mammal suffering from a disease, condition, or disorder that can receive gene therapy.

[0174] When the present invention is intended to treat or prevent a disease, condition, or disorder that can receive gene therapy, it will be understood that the AAV capsids, particles, and AAV vectors of the present invention are useful in a wide range of diseases, conditions, or disorders. The AAV capsids, particles, and AAV vectors are preferably used to treat eye disorders, but the usefulness of the AAV capsids, particles, and AAV vectors has been demonstrated in various cell types including retinal cells, melanoma cells, and hepatocytes. Specifically, increased transduction efficiency has been shown for various cell types including retinal cells, melanoma cells, and hepatocytes. Thus, it will be understood that the therapeutic usefulness of the AAV capsids, particles, and AAV vectors is not limited to eye disorders.

[0175] In one example, the AAV capsids, particles, and AAV vectors of the present invention are directed to treating or preventing eye disorders. The term "eye disorder" is used in the context of the present disclosure to refer to disorders and abnormalities that affect the human eye and visual system. For example, eye disorders include, but are not limited to, congenital, developmental, inflammatory, infectious, vascular, obstructive, angiogenic, degenerative, neoplastic, pre-tumorigenic, iatrogenic, traumatic, glaucomatous, post-transplant complications, cataracts, and idiopathic diseases, or systemic predispositions, associations, or complications of these diseases (such as metastatic choroidal melanoma or multi-system effects in hereditary gene dystrophies).

[0176] Other exemplary eye disorders include diabetic retinopathy, cystoid macular edema, clinically significant macular edema, uveitis, iritis, giant cell arteritis, vasculitis, peripheral uveitis, corneal transplant rejection, intraocular inflammation, and lamellar corneal transplant rejection. Other examples of eye disorders encompassed by the present disclosure include macular degeneration, diabetic retinopathy, cystoid macular edema, clinically significant macular edema, central retinal vein occlusion, branch retinal vein occlusion, or ocular neovascularization. For example, the eye disorder can be an "intraocular neovascular disease." The term "intraocular neovascular disease" is used in the context of the present disclosure to refer to a disease characterized by neovascularization of the eye. Examples of intraocular neovascular diseases include, but are not limited to, for example, proliferative retinopathy, choroidal neovascularization (CNV), atrophic age-related macular degeneration (AMD), exudative age-related macular degeneration (AMD), diabetic and other ischemia-related retinopathies, diabetic macular edema, pathologic myopia, von Hippel-Lindau disease, ocular histoplasmosis, central retinal vein occlusion (CRVO), corneal neovascularization, and retinal neovascularization. For example, the methods of the present disclosure include treating exudative AMD. In another example, the methods of the present disclosure include treating CNV.

[0177] In one example, the methods of the present disclosure include inhibiting endothelial cell growth in the retina. For example, the methods of the present disclosure include inhibiting endothelial cell growth in the subretinal pigment epithelium and / or the subretinal space.

[0178] In another example, the eye disorder is an infectious disease.

[0179] In another example, the eye disorder is cancer. In one example, the cancer is uveal melanoma, ciliary body melanoma, iris melanoma, choroidal melanoma, intraocular lymphoma, retinoblastoma, or medulloepithelioma, choroidal hemangioma, choroidal metastasis, conjunctival Kaposi sarcoma, malignant conjunctival tumor, orbital or lacrimal gland lymphoma, conjunctival lymphoma, conjunctival melanoma or primary acquired melanosis with atypia, orbital malignant tumor, lacrimal gland malignant tumor, pigmented conjunctival tumor, conjunctival squamous cell carcinoma, conjunctival intraepithelial neoplasia, or ocular surface squamous intraepithelial neoplasia. In one example, the cancer is uveal melanoma.

[0180] In another example, the eye disorder is a choroidal nevus, choroidal osteoma, nevus of Ota, conjunctival nevus, epibulbar dermoid, lacrimal gland benign tumor, orbital benign tumor, symptoms of Graves' ophthalmopathy, pinguecula, or pterygium.

[0181] In another example, the eye disorder is a Leber congenital cataract due to RPE65, or an eye disorder caused by an RPE65 mutation. In another example, the eye disorder is retinitis pigmentosa caused by a mutation in MERTK, or RPGR, or PDE6B, or RLBP1, or another gene, or another disease caused by a mutation in MERTK, or RPGR, or PDE6B, or RLBP1. In another example, the eye disorder is choroideremia, or an eye disorder caused by a CHM mutation. In another example, the eye disorder is monochromacy, or an eye disorder caused by a mutation in the CNGA3, CNGB3, GNAT2, PDE6C, PDE6H, and ATF6 genes. In another example, it is X-linked retinoschisis, or an eye disorder caused by an RS1 mutation. In another example, the eye disorder is Leber hereditary optic neuropathy. In another example, the eye disorder is a complication of transplantation.

[0182] In one example, the method described herein includes administering the AAV vector or particle described herein. For example, the method mentioned above may include administering an AAV vector or particle comprising an expression cassette comprising a kill switch and a nucleic acid encoding a therapeutic molecule, wherein activation of the kill switch silences the expression of the nucleic acid encoding the therapeutic molecule. In one example, the expression cassette further comprises a regulatable element operably linked to the nucleic acid encoding the therapeutic molecule, and the activity of the regulatable promoter is regulated by administering a regulatory factor compound to the subject. In one example, the expression cassette further comprises a constitutive promoter operably linked to a regulatory factor compound binding molecule that binds to the regulatory factor compound, and upon binding to the regulatory factor compound, the regulatory factor binding polypeptide regulates the expression of the therapeutic molecule.

[0183] In another example, the regulatory factor compound binding molecule and the therapeutic molecule are expressed from separate expression cassettes.

[0184] The AAV capsids, particles, and AAV vectors described herein can also be administered in combination with additional therapies.

[0185] In one example, additional therapies can include surgery, lens replacement with an intraocular lens, laser surgery, or drug therapy.

[0186] In another example, the additional therapy can include an immunosuppressive agent to prevent a harmful immune response to the AAV particles or vectors in the subject. If administration of an immunosuppressive agent is contemplated, the therapy can be provided before or at the same time as administration of the AAV particles or vectors and can be for a period of time, e.g., 1 week, 2 weeks, 3 weeks, 4 weeks, or more, so as to achieve sufficient immunosuppression.

[0187] In one embodiment, the subject being treated exhibits one or more symptoms of a disease or disorder associated with an eye disorder described herein or known in the art.

[0188] For example, symptoms of an eye disorder can include - a reduction in peripheral vision, - a reduction in central vision, - a reduction in night vision, - a loss of color vision.

[0189] If the eye disease is age-related macular degeneration, non-limiting examples of symptoms can include - blurring or haziness of vision, - difficulty adapting vision from low light to bright light, - darkness or a defect in the visual field, - distortion of vision, among one or more of these.

[0190] Thus, a positive response to treatment with the AAV particles or vectors described herein may include improvement of one or more of the above symptoms or other symptoms known in the art. For example, an individual having a positive response to treatment with an AAV vector administered as a result of the methods described herein may have reduced blurring or haziness of vision, may have reduced difficulty adapting vision from dim to bright light, may have reduced darkness or deficits in the visual field, and / or may have reduced distortion of vision. Alternatively, the symptoms may all disappear.

[0191] In one embodiment, the subject has come to exhibit symptoms of an eye disorder. In another embodiment, the subject has 10% or more photoreceptor damage / loss. In another embodiment, the subject has 20% or more photoreceptor damage / loss. In another embodiment, the subject has 30% or more photoreceptor damage / loss. In another embodiment, the subject has 40% or more photoreceptor damage / loss. In another embodiment, the subject has 50% or more photoreceptor damage / loss. In another embodiment, the subject has 60% or more photoreceptor damage / loss. In another embodiment, the subject has 70% or more photoreceptor damage / loss. In another embodiment, the subject has 80% or more photoreceptor damage / loss. In another embodiment, the subject has 90% or more photoreceptor damage / loss. In another embodiment, the bipolar cell circuitry to the subject's ganglion cells and optic nerve remains undamaged.

[0192] "Therapeutically effective amount" is used herein to indicate any amount of a composition or AAV vector as defined herein that is capable of reducing one or more of the symptoms associated with a disease, condition, or disorder. A single administration of a therapeutically effective amount may be sufficient, or it may be applied repeatedly over a period of time, such as several times a day over several days or weeks. The amount of the active ingredient will vary depending on the condition being treated, the stage of progression of the condition, the age and type of the host, and the type and concentration of the formulation being applied. The appropriate amount in any given case will be readily apparent to those skilled in the art or can be determined by routine experimentation.

[0193] As used herein, the term "treating" or "treatment" includes the application or administration of a drug or compound for the purpose of delaying, retarding, stabilizing, curing, recovering, alleviating, removing, changing, relieving, reducing the worsening, improving, enhancing, or affecting a disease or condition, a symptom of a disease or condition, or the risk (or susceptibility) of a disease or condition. The term "treating" refers to any sign of success in the treatment or improvement of an injury, pathology, or condition, including weakening, remission, reduction in the rate of worsening, reduction in the severity of a disease, stabilization, reduction in symptoms, or making an injury, pathology, or condition more tolerable to a subject, retarding the rate of degeneration or decline, making the end point of degeneration less debilitating, or improving the physical or mental well-being of a subject, among other objective or subjective parameters.

[0194] As used herein, "preventing" or "prevention" is intended to refer to at least reducing the likelihood of the risk (or susceptibility) of acquiring a disease or disorder (i.e., not causing the onset of at least one of the clinical symptoms of the disease in a patient who may be exposed to the disease or have a predisposition to the disease but has not yet experienced or exhibited the symptoms of the disease). Biological and physiological parameters for identifying such patients are provided herein and are also well known to physicians. For example, in the case of age-related macular degeneration, a subject may have a family history of the disease, or may be a subject of an age predisposed to AMD, or may have a history of smoking, obesity, high cholesterol, or hypertension, and further exhibit any overt symptoms of the disease. In this case, the AAV vectors and their compositions described herein are contemplated to be useful for preventing the onset of one or more symptoms associated with AMD in a subject.

[0195] The present invention also contemplates a method for the identification or diagnosis of a subject in need of treatment or prevention of a disease, condition, or disorder. Preferably, the method includes identifying a subject in need of treatment of an eye disorder. As used herein, diagnosis refers to the determination that a subject or patient is in need of treatment or prevention of a disease, condition, or disorder. The types of diseases or disorders diagnosed by the methods described herein can be known in the art or any type described herein, preferably an eye disorder.

[0196] In one embodiment, the step of identifying a subject in need of treatment or prevention of an eye disorder includes an evaluation of the eye through one or more or all of the following: - Angiography (e.g., fluorescein angiography or indocyanine green angiography), - Electroretinogram, - Ultrasonography, - Pachymetry, - Optical coherence tomography, - Computed tomography (CT) and magnetic resonance imaging (MRI).

[0197] Formulations The AAV particles and other molecules described herein can be formulated as pharmaceutical compositions suitable for administration to a subject. Exemplary pharmaceutical compositions can include a pharmaceutically acceptable carrier, diluent, or excipient. Depending on the particular route of administration, various acceptable carriers known in the art, such as those described in Remington’s Pharmaceutical Sciences (Mack Publishing Co. N.J. USA, 1991), can be used.

[0198] Exemplary pharmaceutical compositions can also include pharmaceutically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution in a sterile injection solution or dispersion immediately prior to use. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.), and suitable mixtures thereof, vegetable oils, and injectable organic esters such as ethyl oleate. The compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents, or antibacterial and antifungal agents.

[0199] Various formulations have been developed to facilitate the use of rAAV particles. For example, for administration of an aqueous injection solution of rAAV particles, the solution can be suitably buffered if necessary, and the liquid diluent can be made isotonic initially with sufficient saline or glucose. In some embodiments, the compositions provided herein include one or more pluralities of any of the recombinant AAV particles disclosed herein. USP grade carriers and excipients are particularly useful for delivery of rAAV particles to human subjects. Such compositions can optionally further include liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres, or nanoparticles, or can be formulated for administration to the cells, tissues, organs, or body of a subject in need of treatment. Methods for making such compositions are well known and can be found, for example, in The Science and Practice of Pharmacy, 2 nd edition Pharmaceutical Press, 2012, or in Remington: The Science and Practice.

[0200] In another example, the AAV particles can be incorporated into a sustained release delivery system or a targeted delivery system. Exemplary sustained release systems include polymer matrices, liposomes, and microspheres. Liposomes can be biodegradable and amphiphilic drug delivery systems and can be formulated using phospholipids and cholesterol. Microspheres can be formulated using biodegradable and biocompatible polymers.

[0201] In one example, the modulatory factor compound is provided in a topical formulation. For example, the modulatory factor compound can be provided as an ophthalmic formulation. Suitable exemplary ophthalmic formulations include solutions, suspensions, ointments, gels, or foams. In one example, the ophthalmic formulation comprises a modulatory factor compound as defined herein and a suitable carrier. Exemplary carriers include aqueous saline solutions, water polyethers such as polyethylene glycol, polyvinyls such as polyvinyl alcohol and povidone, cellulose derivatives such as methylcellulose and hydroxypropylmethylcellulose, petroleum derivatives such as mineral oil and white petrolatum, animal fats such as lanolin, polymers of acrylic acid such as carboxypolymethylene gel, vegetable fats such as peanut oil, as well as polysaccharides such as dextran, and glycosaminoglycans such as sodium hyaluronate, and salts such as sodium chloride and potassium chloride.

[0202] In one example, the AAV vector or its particles are present within or on a device that allows for controlled or sustained release of the AAV vector or its particles, such as an ocular sponge, meshwork, mechanical reservoir, or mechanical implant. Implants such as implantable devices (see, e.g., U.S. 5,443,505, 4,853,224, and 4,997,652), devices (see, e.g., U.S. 5,554,187, 4,863,457, 5,098,443, and 5,725,493), e.g., mechanical reservoirs, intraocular devices or extraocular devices having intraocular ducts, or implants or devices composed of polymer compositions, are particularly useful for ocular administration of AAV vectors or their particles.

[0203] In one example, the AAV vector or its particles are formulated to enhance transduction efficiency, i.e., to enhance transduction of the AAV vector into host cells. Suitable compositions are further described in U.S. Patent Nos. 6,225,289 and 6,514,943.

[0204] Administration and Dosage In one example, the AAV particles or its compositions as defined herein are administered to a subject. In one example, the composition is administered via intravitreal injection. In another example, the composition is administered via subretinal injection. In one example, a vitrectomy is performed prior to subretinal injection. In another example, the composition is administered via subcutaneous injection. In another example, the composition is administered via intramuscular injection. In another example, the composition is administered via intravenous injection. In another example, the composition is administered as a food or beverage composition. In other examples involving the use of heat or light as modulating factor compounds, such compounds can be applied to the subject's eye as needed.

[0205] In one example, a pharmaceutical composition comprising an AAV vector or its particles is administered via an ophthalmic device for delivery to a specific region of the eye. The use of a specialized ophthalmic device ensures accurate administration of the AAV vector or its particles while minimizing damage to adjacent eye tissue. Delivery of the AAV vector or its particles to a specific region of the eye also limits exposure of non-affected cells to therapeutic molecules, thereby reducing the risk of side effects. One example of such an ophthalmic device is a combination of forceps and a subretinal needle or a sharply bent cannula.

[0206] If it is desired to use an adjustable element disclosed in WO2019144186, the entire content of which is incorporated herein by reference, the expression of the therapeutic molecule from the AAV vector or its particles can be regulated via administration of a regulatory factor compound to the subject. The expression of the therapeutic molecule can then be silenced by administering a kill switch activator to the subject or by administering an AAV vector or its particles comprising a nucleic acid sequence encoding the kill switch activator. Each of the AAV vector or its particles, the regulatory factor compound, and the kill switch activator can be administered to the subject as a pharmaceutical composition. The choice of administration route will depend on various factors such as, for example, the host, the immunogenicity of the AAV vector, and the desired duration of therapeutic molecule production.

[0207] In one example, a pharmaceutical composition comprising an AAV vector or its particles is administered by intravitreal or subretinal injection, a pharmaceutical composition comprising the regulatory factor compound(s) is then topically administered by eye drops, and the kill switch activator is then administered topically and / or by intravitreal or subretinal injection. If the use of eye drops is contemplated, the composition or a portion thereof can diffuse into the intraocular environment through the hydrophobic cornea.

[0208] In another example, the pharmaceutical composition is administered to the human retina via delivery to the vitreous (i.e., intravitreal administration). In the context of the present invention, this administration route is preferred because it is simpler and safer while providing a greater amount of diffusion. The presence of AAV neutralizing antibodies in the vitreous, along with the physical barrier created by the inner limiting membrane of the retina, is known to be a hurdle in selecting this administration. AAV particles or their compositions are particularly advantageous when administered to the vitreous because they are associated with increased transduction efficiency and reduced immune response. In another example, the composition can be administered orally. In another example, the composition can be administered intranasally.

[0209] One of ordinary skill in the art will understand that the dosage and route of administration can be selected to minimize loss of transgene expression due to the host immune system. For example, for in vivo contact with ocular cells, it may be advantageous to administer to the host a null-expression AAV vector (i.e., an AAV vector that does not contain a nucleic acid sequence encoding a therapeutic molecule) prior to performing the methods described herein. Pre-administration of the null-expression AAV vector can function to create immunity (e.g., tolerance) to the AAV vector or its particles in the host, thereby reducing the amount of AAV vector removed by the host immune system.

[0210] The compositions disclosed herein can also be administered systemically, for example, by intravenous or intraperitoneal administration. This route of administration is particularly suitable for administration of an immunosuppressive agent to suppress any potential harmful immune response to the AAV particles, if desired. Although it is contemplated that the AAV particles and their compositions can reduce immunogenicity in a subject, the use of an immunosuppressive agent may be combined to further suppress and / or optimize the immune response.

[0211] Kit The compositions according to the present disclosure can be provided in a kit or pack. For example, the compositions disclosed herein can be packaged in a suitable container together with written instructions for treating a disease, condition, or disorder. In one example, the composition can be provided in a single-dose container such as an eye dropper or a pre-filled syringe for the treatment of an ocular disorder.

[0212] The kits of the present disclosure can include a treatment system. Such a treatment system can provide pre-programmed, hands-free delivery of the composition at a rate established to meet a particular therapeutic need and over a period of time. This system can be designed, for example, to minimize patient intervention and optimize compliance with a prescribed regimen.

[0213] In one example, the kit comprises an AAV vector or a particle thereof as defined herein for treating a disease, condition, or disorder.

Examples

[0214] General materials and methods Statement regarding ethics Ethical review approval for this study was obtained from the Metro South Human Research Ethics Committee (HREC reference number: HREC / 18 / QPAH / 189). Informed consent for research on tissues from donors or next of kin was obtained prior to death by the Queensland Eye Bank. Human eye cups were harvested within 24 hours after death and stored at 4°C. Prior to collection, donor samples were tested and were negative for HIV as well as hepatitis B and C. The eye cups used in these investigations were transduced with AAV 48 - 72 hours after death.

[0215] Cell culture Human embryonic kidney 293 (HEK293) cells were cultured in RPMI 1640 medium (Gibco) containing 10% FBS (Gibco) and 1× Pen - strep (Gibco) at 37°C in 5% CO2 / 95% humidified air. Their identity was confirmed using short tandem repeat profiling and they were regularly tested for mycoplasma to ensure they were mycoplasma - free.

[0216] Plasmid construction pAAV2 / 8 was generated by cloning the AAV8 cap open reading frame (ORF) from AAV2 rep-AAV8 cap as a HindIII-PmeI restriction fragment between the HindIII and PmeI restriction sites of pAAV-RC2. pAAV2 / 8 p5 was generated by cloning the p5 promoter from 7m8 (Addgene plasmid #64839) as an XbaI-HindIII restriction fragment between the XbaI and HindIII restriction sites of pAAV2 / 8. pAAV2 / 8 p5-2 was generated by cloning the p5 promoter from Addgene plasmid #112864 as a PmeI-EcoRV restriction fragment into the PmeI restriction site of pAAV2 / 8 p5 downstream of the AAV8 cap ORF and was made to act as an enhancer.

[0217] The Y447F, T494V, and Y733F amino acid substitutions were introduced into the AAV8 cap ORF by overlapping PCR using KOD Hot Start DNA polymerase. The sequences of the oligonucleotides used for PCR are listed in Table 6. AAV2 rep-AAV8 cap was a gift from John Chiorini. 7m8 was a gift from John Flannery and David Schaffer (Addgene plasmid #64839).

[0218]

Table 6-1

[0219]

Table 6-2

[0220] AAV2 / 8 Random Peptide Display Library Construction By duplicating PCR using KOD Hot Start DNA polymerase, a pair of unique restriction sites was added to pAAV2 / 8 p5-2 (Y447F, T494V, Y733F) for the creation of a random peptide display library, introduced either by restriction digestion and ligation or using the NEBuilder kit. These were, respectively, 3' immediately after BglII / AflII of N590. A 9-base pair sequence encoding the RGD peptide was included between each pair of restriction sites. Three p5-AAV2rep-AAV8cap (Y447F, T494V, Y733F variant) N590BglII / AflII cassettes were cloned between the XbaI and PmeI restriction sites of ITR-AAV6 having the existing p5 promoter / enhancer 3' of the PmeI site to add the AAV2 inverted terminal repeat (ITR) sequence. To create a random peptide display plasmid library, oligonucleotides of the form: 21nt homologous sequence - restriction site 1 - N21 - restriction site 2 - 21nt homologous sequence were synthesized, converted to double-stranded DNA using a complementary reverse primer, gel purified, and ligated with vector DNA by homologous recombination using the NEBuilder kit (cut with the corresponding restriction enzyme pair). The ITR-containing plasmid and the N590 plasmid library were used for transformation and grown in NEB Stable E. coli cells. All other plasmids were grown in NEB 5α cells. The sequences of the oligonucleotides used for PCR are listed in Table 6.

[0221] AAV production AAV was produced from 70 - 80% confluent HEK293 cells transfected with 5 μg of pHelper, 2.5 μg of pAAV2 / 8 plasmid, and 2.5 μg of ITR-CMV-tdTomato in a 10 cm diameter Petri dish. The plasmid was first added to 500 μl of DMEM, followed by mixing by pipetting up and down 30 μl of linear polyethyleneimine 25000 kDa (Polysciences, US), incubating for 10 minutes at room temperature, adding dropwise to HEK293 cells in 10 ml of fresh medium, mixing gently by rocking, and incubating at 37°C. After 48 hours, the cells were dislodged into the cell culture medium using a cell scraper, transferred to a 15 ml tube, collected by centrifugation at 400 g for 5 minutes, washed with 1 ml of PBS, transferred to a 1.5 ml tube, and pelleted by centrifugation at 10,000 g for minutes. 600 μl of PBS was added to the cell pellet, and the cells were lysed to release AAV by 3 cycles of freezing in dry ice and thawing at 37°C. After the second thaw, the cell debris was dispersed by gently tapping the tube. After final centrifugation (7,000 g for 5 minutes, followed by 10,000 g for 2 minutes), the supernatant containing AAV was transferred to a fresh 1.5 ml tube. AAV titration was performed by qPCR as described at https: / / www.addgene.org / protocols / aav-titration-qpcr-using-sybr-green-technology / . An AAV random peptide display library was generated similarly, but using 5 μg of pHelper and 0.5 μg of ITR-adjacent random peptide display library plasmid.

[0222] Library selection ex vivo To identify novel AAV variants, a 5-round selection method of an initial AAV library was performed in human retina and subretinal tissue. In each step, the AAV library was added to postmortem retinas and RCS explants cultured in DMEM medium. After 12 hours of transduction, the medium was changed, and genomic DNA was extracted from the retina and subretinal explants at 48 hours. The successful virions were PCR amplified using the following primer plus strand 5’GTTTCCCTGCAGACAATGCG3’ and minus strand 5’TCAAAATGGAGACCCTGCGT3’. As a result, the PCR products containing the library cap gene were recloned into a bacterial plasmid containing the AAV-rep gene and ITR-2 and repackaged using AAV293 cells. Following the selection process, the novel AAV variants were recloned into a bacterial plasmid not containing the ITR-2 element, sequenced, and AAV vectors were produced using AAV293 cells for downstream processes.

[0223] Statistical analysis Unless otherwise specified, data are presented as mean and standard error of the mean. P < 0.05 was considered statistically significant.

[0224] Results Vector optimization to improve AAV titer Because of its unique tropism for infecting the human retina adjacent to blood vessels and because of the low prevalence of neutralizing antibodies against AAV8 in the human vitreous (Halbert et al., 2006), the inventors chose to investigate whether recombinant AAV2 / 8 could be modified for use as a gene therapy vector. First, the AAV8 cap gene was cloned into the pRC-AAV2 vector instead of the AAV2 cap gene to generate the recombinant plasmid pAAV2 / 8. The transcription of the viral replication (rep) gene in this plasmid was from a bacterial promoter. To investigate whether the AAV titer could be improved, the AAV2 p5 promoter was added upstream of the AAV2 rep gene and the initiating methionine was mutated from ATG to ACG so that translation would initiate at the downstream in-frame methionine. This has the effect of preventing the translation of the two largest Rep isoforms (p78 and p68) that negatively regulate AAV replication (Li et al., 1997). This resulted in a 1.67-fold increase in the AAV titer (Figure 1a). Additionally, the AAV2 p5 promoter was cloned downstream of the AAV8 cap gene to act as an enhancer element. This resulted in a further 1.74-fold increase in the viral titer (Figure 1a).

[0225] Substitutions of several conserved tyrosine and threonine residues in the AAV2 cap gene with similar (but non-phosphorylated) amino acids have been reported to increase AAV2 titers. Therefore, the three most important of these corresponding to Y447F, T494V, and Y733F in AAV8 (Petrs-Silva et al., 2009, Kay et al., 2013) were investigated for their effects on AAV8 virus titers. All AAV titers increased, with T494V (1.41-fold) and Y733F (1.33-fold) being the most effective (Figure 1b). The combination of all three substitutions increased virus titers 1.75-fold (Figure 1b). The plasmid map of the expression vector is shown in Figure 2c. In summary, these results indicate that changes to the plasmid cis-acting regulatory sequences and conserved AAV8 capsid residues produced vectors that could enhance the titers of recombinant AAV2 / 8 produced using HEK293 packaging cells.

[0226] Generation of an AAV2 / 8 Random Display Peptide Library The tropism of recombinant AAV2 / 2 vectors can be altered by inserting and positioning short peptide sequences into Loop IV of VP1-3 so that they are exposed on the surface of the vector capsid at sites important for virus binding to target cells (Nicklin et al., 2001, Grifman et al., 2001, Girod et al., 1999, Muller et al., 2003). The inventors reasoned that a similar strategy could be used with AAV2 / 8 to screen for novel recombinant capsid structures that enhance AAV targeting of the human retina. The AAV2 / 8 Y447F, T494V, Y733F triple mutant vector was engineered to display a random peptide library within Loop IV of the AAV2 / 8 capsid and was flanked by the p5 promoter and 3’ enhancer sequences with AAV2 inverted terminal repeats. The Loop IV site was chosen because of their positions within the AAV2 / 8 capsid domain involved in receptor binding.

[0227] The library displays a random 7-amino acid peptide with two additional fixed amino acids at the N-terminus and three fixed amino acids adjacent to the C-terminus (previously demonstrated to be compatible with peptide insertion) (Shi et al., 2001) (Figure 2a). DNA sequencing of three clones from the library verified that different random peptides were encoded by each clone (Figure 3a). The presence of the ITR was confirmed by SbfI digestion of each clone (Figure 3b). To target individual packaging cells to take up only a single plasmid from the library, HEK293 packaging cells were transfected at a high cell:plasmid ratio to generate an AAV library, and as a result, each AAV capsid displayed only the peptide sequence encoded by the ITR-adjacent library cap gene it contained.

[0228] Identification of AAV8 Variants Infecting the Human Retina from Vitreous by Directed Evolution To identify novel AAV variants, a 5-round selection method of the initial AAV library was performed in human retina and subretinal tissue. In each step, the AAV library was added to postmortem retina and RCS explants cultured in DMEM medium. After 12 hours of transduction, the medium was changed, and genomic DNA was extracted from the retina and subretinal explants at 48 hours. Successful virions were PCR amplified using the following primer plus strand 5’GTTTCCCTGCAGACAATGCG3’ and minus strand 5’TCAAAATGGAGACCCTGCGT3’. Subsequently, the PCR products containing the library cap gene were recloned into a bacterial plasmid containing the AAV-rep gene and ITR-2 and repackaged using AAV293 cells. Following the selection process, the novel AAV variants were recloned into a bacterial plasmid lacking the ITR-2 element and sequenced. The selected clones were AAV vectors produced using triple transfection in AAV293 cells and were used in functional assays.

[0229] Functional Evaluation of AAV8 Variants in the Immune System As a reporter, secNanoLuc luciferase was used to transduce Cos-7, LnCap, and Mel cells in 24-well and 96-well plates with recombinant AAV2 / 8 and AAV2 / 8 C1m1 vectors of the same titer. The AAV was diluted either in 250 μL of DMEM medium without FBS or in 250 μL of serum obtained from compatible donors at the indicated dilutions (1 / 10, 1 / 100, 1 / 1000) and pre-incubated at 37 °C for 1 hour. The AAV-transduced cells were incubated at 37 °C for 16 - 24 hours in a 5% CO 2 incubator. The medium containing the secreted luciferase was collected, stored at -80 °C, and measured at the endpoint. Luciferase expression was measured using a PHERAstar FSX (BMG-Labtech, Ortenberg, Germany) and a Nano-Glo luciferase assay system (Promega) according to the manufacturer's protocol. The AAV2 / 8 C1m1 variant efficiently escaped neutralization by anti-AAV8 antibodies present in the donor's serum (serum samples p146 and p261 are shown), while the unmodified AAV2 / 8 parental capsid was recognized by the antibodies present in the serum (Figures 5A - B).

[0230] Comparison of peptide insertions into loop IV of the AAV2 / 8 capsid ClustalO alignment (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ) of peptide insertions at position N590 of the capsid protein VP3 of AAV8. MView 1.63 was used for the graphical representation of the alignment (Brown et al., 1998). The insertions obtained after ex vivo selection of the AAV8 N590 library (Figure 6) were compared to the published sequences of insertions at N590 of wild-type AAV2 and AAV8 capsids: AAV-7m8 (Khabou et al., 2016), AAV2.NN, AAV2.GL (Pavlou et al., 2021), AAV8_lung, AAV8_breast (Buening and Srivastava, 2019), AAV8_libNG (Boerner et al., 2020).

[0231] Analysis of Reporter Fluorescence of Various AAV-GFP Optimization Clones ARPE19 cells were transduced three times with AAVs packaged with the AAV-CMV-GFP reporter plasmid (Addgene #67634) and the 7m8, AAV2 / 8 p5-2, C1m1, and C1m2 capsids. As described in (Kimura et al., 2019), the AAV vectors were prepared by triple transfection of the Rep / cap plasmids (AAV7m8, AAV2 / 8 p5-2, C1m1, and C1m2), the AAV-CMV-GFP reporter plasmid (Addgene #67634), and the pHelper plasmid 25 kDa (Polysciences, US) using linear polyethyleneimine (PEI), and AAV293 (Cell Biolabs) cells. For in vitro applications, the AAVs were purified according to the Kimura et al., (2019) protocol. The cells were seeded in 12-well plates at 5×10 4 cells / well in DMEM / F12 supplemented with 10% v / v fetal bovine serum (FBS) (Gibco), and 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies), and MOI: 1×10 4 ~1×10 5Transduced with the indicated AAV. Live cell imaging was performed at 48 and 72 hours using an EVOS Cell Imaging System (Thermo Fisher Scientific) or an Olympus IX73 inverted microscope (Olympus). Nuclear staining was performed using NucBlue™ Live ReadyProbes™ Reagent (Hoechst 33342) (Thermo Fisher). Shown are representative fluorescence microscopy images of ARPE19 cells transduced with the indicated AAV variants expressing GFP. Both the C1m1 AAV2 / 8 capsid and the C1m2 AAV2 / 8 capsid demonstrated GFP expression at 24 and 48 hours post-transduction and were shown to be as efficient as the “benchmarked” AAV2-7m8 variant in transducing ARPE19 cells and substantially more efficient than the parental AAV2 / 8 p5-2 capsid (Figure 7).

[0232] Testing of reporter fluorescence of various AAV-GFP optimized clones in primary retinal cell lines Human primary RPE mixed cultures (passages 4 - 7) were transduced three times with AAV containing a tdTomato reporter plasmid (tdTomato cloned into pAAV-MCS, Cell Biolabs), AAV containing an AAV-CMV-GFP reporter plasmid (Addgene #67634), and AAV packaged with 7m8, AAV2 / 8 p5-2, C1m1, and C1m2 capsids. Cells were seeded at 1×10 4 cells / well in DMEM / F12 supplemented with 10% v / v fetal bovine serum (FBS) (Gibco), and 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies) at an MOI of 1×10 4 ~1×10 5Transduced with the indicated AAV. Cells were fixed with 4% PFA and imaged using an IN Cell Analyzer 6500HS high-content imaging system. Nuclear staining was performed using NucBlue™ Live ReadyProbes™ Reagent (Hoechst 33342) (Thermo Fisher). Shown are representative fluorescence microscopy images of human primary RPE cells transduced with the indicated AAV variants expressing GFP or TdTomato. C1m1 AAV2 / 8 capsid and C1m2 AAV2 / 8 capsid demonstrated GFP and tdTomato expression 48 hours after transduction, showing that they are as efficient as the "benchmarked" AAV2-7m8 variant in transducing primary RPE cells (Figures 8A–B). The parental AAV2 / 8 p5-2 capsid was shown to abrogate transduction of primary RPE cell cultures.

[0233] Transduction Efficiency of Optimized AAV Vectors in Human Retinal Cell Lines and Explants First, the transduction efficiency was tested in human APRE19 cells. APE19 cells were transduced three times with AAVs containing the secNaNoLuc reporter and packaged with the 7m8, AAV2 / 8 p5-2, C1m1, and C1m2 capsids. The secreted NanoLuc luciferase (Promega) reporter gene was cloned into the pAAV-MCS (Cell Biolabs) plasmid. The expression cassette was adjacent to the AAV2 inverted terminal repeats. The SecNanoLuc reporter gene was expressed using the human cytomegalovirus (CMV) promoter. As described in (Kimura et al., 2019), AAV vectors were prepared by triple transfection of Rep / cap plasmids (AAV7m8, AAV2 / 8 p5-2, C1m1, and C1m2), secNanoLuc-pAAV-MCS, and the pHelper plasmid 25 kDa of linear polyethyleneimine (PEI) (Polysciences, US), and AAV293 (Cell Biolabs) cells. For in vitro application, AAV was purified according to the Kimura et al., (2019) protocol.

[0234] Cells were seeded in 24-well plates at 2 × 10 4 cells / well in DMEM / F12 supplemented with 10% v / v fetal bovine serum (FBS) (Gibco), and 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies), and MOI 1 × 10 4Transduced with AAV. Cells were transduced with AAV for 24 hours in DMEM / F12 supplemented with 1% v / v FBS. Subsequently, AAV-transduced cells were cultured in 500 μL of DMEM / F12 (without phenol red) medium supplemented with 10% FBS (Gibco), 100 U / mL penicillin, and 100 μg / mL streptomycin (Life Technologies). 50 μL aliquots of the medium were removed at the indicated time points and frozen at -80 °C. Aliquots were processed for the measurement of secNanoLuc activity using the Nano-Glo® Luciferase Assay System and a CLARIOstar Plus plate reader (BMG Labtech) as recommended by the manufacturer (Promega). Data at multiple time points were processed in Excel using a conversion (Promega) to calculate the total luminescence at each time point. The total calculated RLU was analyzed by GraphPad Prism9 software. Three independent biological replicates were used.

[0235] Primary human RPE cells at passages 6 - 8 were seeded in 24-well plates at 5×10 4 cells / well in DMEM / F12 supplemented with 10% v / v fetal bovine serum (FBS) (Gibco), 100 U / mL penicillin, and 100 μg / mL streptomycin (Life Technologies) and transduced with AAV at an MOI of 1×10 4 . Cells were processed for secNanoLuc activity using the Nano-Glo® Luciferase Assay System (Promega) as described in A).

[0236] Both C1m1 AAV2 / 8 capsid and C1m2 AAV2 / 8 capsid demonstrated robust expression of secNanoLuc luciferase in ARPE19 and primary RPE cells. The accumulation of luciferase on days 5 and 7 post-transduction was more efficient in transducing human retinal pigment cells compared to the AAV2-7m8 variant and the parental AAV2 / 8 p5-2 capsid. The relative transduction efficiency was particularly high for the C1m2 capsid on day 5 (up to 6-fold difference compared to the AAV2-7m8 variant). These differences were observed throughout the entire duration of the experiment (7 days). On day 7 post-transduction, cells transduced with C1m2 AAV2 / 8 had significantly higher luciferase activity than those transduced with the AAV2-7m8 variant (Figures 9A and B). Thus, peptide insertions C1m1 and C1m2 at N590 of the AAV8 capsid showed high transduction efficiency in human retinal cells.

[0237] Next, transduction efficiency was tested in human retinal explants. Postmortem human eye cups were dissected immediately upon receipt. After removing the vitreous humor, punch biopsies were performed on the eye wall using a disposable 3.5 mm (or 4 mm) biopsy punch (Livingstone International) to obtain retinal and retinal pigment epithelium, choroid, and sclera (RCS) explants. Up to 16 biopsies were obtained from each eye cup. Punch biopsies from the same eye cup were randomly grouped in a 24-well plate and incubated for 24 hours at 37°C in a 5% CO2 humidified air atmosphere in a nutrient mixture F-12 (DMEM / F12) supplemented with Dulbecco's modified Eagle medium: 10% v / v fetal bovine serum (FBS) (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies) to recover from hypoxia and hypothermia prior to AAV transduction.

[0238] The retinal explants were transduced three times with AAV containing the secNanoLuc reporter plasmid and packaged for 48 h with 7m8, AAV2 / 8 p5-2, C1m1, and C1m2 capsids in DMEM / F12 supplemented with 1% v / v FBS. secNanoLuc-AAV was added at 2×10 9 vg per explant. The secreted NanoLuc luciferase (Promega) reporter gene was cloned into the pAAV-MCS (Cell Biolabs) plasmid. The expression cassette was flanked by AAV2 inverted terminal repeats. The SecNanoLuc reporter gene was expressed using the human cytomegalovirus (CMV) promoter. As described in (Kimura et al., 2019), AAV vectors were prepared by triple transfection of Rep / cap plasmids (AAV7m8, AAV2 / 8 p5-2, C1m1, and C1m2), secNanoLuc-pAAV-MCS, and the pHelper plasmid 25 kDa linear polyethyleneimine (PEI) (Polysciences, US), and AAV293 (Cell Biolabs) cells. For in vitro applications, AAV was purified by the Kimura et al., (2019) protocol.

[0239] Subsequently, the AAV-transduced retinal explants were cultured in 500 μL of DMEM / F12 (phenol red-free) medium supplemented with 10% FBS (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies) in a 24-well plate. 50 μL aliquots of the medium were removed at the indicated time points and frozen at -80°C. The aliquots were processed for the measurement of secNanoLuc activity using the Nano-Glo® Luciferase Assay System and a CLARIOstar Plus plate reader (BMG Labtech) as recommended by the manufacturer (Promega). Data at multiple time points were processed in Excel using a conversion (Promega) to calculate the total luminescence at each time point. The total calculated RLU was analyzed by GraphPad Prism9 software.

[0240] Both the C1m1 AAV2 / 8 capsid and the C1m2 AAV2 / 8 capsid demonstrated robust expression of secNanoLuc luciferase on days 1 and 2 post-transduction and were shown to be more efficient in transducing human retinal explants compared to the AAV2-7m8 variant and the parental AAV2 / 8 p5-2 capsid (Figure 10A). The relative transduction efficiency was particularly high for the C1m2 capsid on day 2 (up to 20-fold difference compared to the AAV2-7m8 variant). These differences persisted throughout the duration of the experiment (14 days). On day 7 post-transduction, retinal explants transduced with C1m2 AAV2 / 8 had significantly higher luciferase activity than the AAV2-7m8 variant (Figure 10B). Thus, the peptide insertions C1m1 and C1m2 at N590 of the AAV8 capsid demonstrated high transduction efficiency in human retinal explants.

[0241] Next, transduction efficiency was tested in human epithelial, choroid, and sclera (RCS) explants. Postmortem human eye cups were incised immediately upon receipt. After removing the vitreous humor and retina, punch biopsies were performed on the eye wall using a disposable 4 mm biopsy punch (Livingstone International) to obtain RCS explants. Up to eight biopsies were obtained from each eye cup. Punch biopsies from the same eye cup were randomly grouped in 24-well plates and incubated for 24 hours at 37 °C in a 5% CO2 humidified air atmosphere in a nutrient mixture F-12 (DMEM / F12) supplemented with Dulbecco's modified Eagle's medium: 10% v / v fetal bovine serum (FBS) (Gibco), and 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies) to recover from hypoxia and hypothermia prior to AAV transduction.

[0242] RCS explants were transduced three times with AAVs containing the secNaNoLuc reporter plasmid and packaged with the 7m8, AAV2 / 8 p5-2, C1m1, and C1m2 capsids. RCS explants were transduced with AAVs for 48 hours in DMEM / F12 supplemented with 1% v / v FBS. secNanoLuc-AAV was added at 2 × 10 9 vg per explant.

[0243] Subsequently, the AAV-transduced retinal explants were cultured in 500 μL of DMEM / F12 (without phenol red) medium supplemented with 10% FBS (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies) in a 24-well plate. 50 μL aliquots of the medium were removed at the indicated time points and frozen at -80°C. The aliquots were processed for the measurement of secNanoLuc activity using the Nano-Glo® Luciferase Assay System and a CLARIOstar Plus plate reader (BMG Labtech) as recommended by the manufacturer (Promega). Data at multiple time points were processed in Excel using a conversion (Promega) to calculate the total luminescence at each time point. The total calculated RLU was analyzed by GraphPad Prism9 software.

[0244] Both the C1m1 AAV2 / 8 capsid and the C1m2 AAV2 / 8 capsid demonstrated secNanoLuc luciferase expression on days 1 and 2 post-transduction and were shown to be efficient in transducing human RCS explants to a similar extent as the "benchmarked" AAV2-7m8 variant and more efficient than the parental AAV2 / 8 p5-2 capsid (Figures 11A - B).

[0245] Next, the inventors attempted to determine the effects of the C1m1 and C1m2 AAV2 / 8 capsids in additional cell types. The uveal melanoma cell lines Mel290, 92-1 (Figure 12A), LX2 hepatic stellate cells, Huh7 hepatocellular carcinoma cells (Figure 12B), and transformed human umbilical vein endothelial cells (EA.hy926) (Figure 12C) were transduced three times with AAVs containing the secNanoLuc reporter and packaged with the 7m8, AAV2 / 8 p5-2, C1m1, and C1m2 capsids. The cells were cultured in DMEM / F12 supplemented with 10% v / v fetal bovine serum (FBS) (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies) at 2×10 4Cells were seeded in a 24-well plate at a density of 1×10 4 MOI in each well and transduced with AAV. Cells were transduced with AAV for 24 hours in DMEM / F12 supplemented with 1% v / v FBS. Subsequently, AAV-transduced cells were cultured in 500 μL of DMEM / F12 (without phenol red) medium supplemented with 10% FBS (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies). 50 μL aliquots of the medium were removed at the indicated time points and frozen at -80°C. Aliquots were processed for the measurement of secNanoLuc activity using the Nano-Glo® Luciferase Assay System and a CLARIOstar Plus plate reader (BMG Labtech) as recommended by the manufacturer (Promega). Data at multiple time points were processed in Excel using a conversion (Promega) to calculate the total luminescence at each time point. The total calculated RLU was analyzed using GraphPad Prism9 software.

[0246] Both the C1m1 AAV2 / 8 capsid and the C1m2 AAV2 / 8 capsid showed moderate tropism for uveal melanoma cells and hepatocellular carcinoma cells. Interestingly, the C1m2 capsid showed increased tropism in LX2 hepatic stellate cells (SV40-transformed cell line), a major cell type involved in liver fibrosis. The EA.hy926 cell line exhibits several characteristics characteristic of vascular endothelial cells and was efficiently transduced with the 7m8 capsid. However, both the C1m1 AAV2 / 8 capsid and the C1m2 AAV2 / 8 capsid showed low tropism in the EA.hy926 cell line.

[0247] New AAV8 variants with modified capsid sequences C1m1 and C1m2 are used to transduce rat retinal epithelium, choroid, and sclera (RCS) explants, as well as primary rat RPE cell lines.

[0248] The eyes of rats (Wistar) were incised and placed in D-PBS containing antibiotics. After removing the vitreous humor, punch biopsies were performed on the eye wall using a disposable 2 mm biopsy punch (Livingstone International) to obtain retinal pigment epithelium, choroid, and sclera (RCS) explants. Up to four biopsies were obtained from each eye. Punch biopsies from the same rat eye were randomly grouped in 24-well plates and cultured for 24 hours in DMEM / F12 supplemented with 10% v / v fetal bovine serum (FBS) (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies) at 37 °C in 5% CO 2 incubated at 37 °C in the incubator. Rat RCS explants were transduced three times with AAVs containing the secNanoLuc reporter and packaged with 7m8, AAV2 / 8 p5-2, C1m1, and C1m2 capsids. In DMEM / F12 supplemented with 1% v / v FBS, at 1×10 9 vg / well, the explants were transduced with AAV for 24 hours. Subsequently, the AAV-transduced cells were cultured in 500 μL of DMEM / F12 (without phenol red) medium supplemented with 10% FBS (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies). 50 μL aliquots of the medium were removed at the indicated time points and frozen at -80 °C. The aliquots were processed for the measurement of secNanoLuc activity using the Nano-Glo® Luciferase Assay System and the CLARIOstar Plus plate reader (BMG Labtech) as recommended by the manufacturer (Promega). The obtained values were adjusted to enable a direct comparison of the RLU between experiments using human and rat RCS explants. Data at multiple time points were processed in Excel using a conversion (Promega) to calculate the total luminescence at each time point. As shown in Figure 13A, transduction of RCS explants with AAVs containing C1m1 and C2m2 resulted in a significant increase in transduction efficiency compared to AAV7m8 over 3-day and 7-day treatments.

[0249] In addition, primary rat RPE mixed cell cultures were transduced three times with AAVs containing the secNanoLuc reporter and packaged with the 7m8, AAV2 / 8 p5-2, C1m1, and C1m2 capsids. Cells were seeded in 24-well plates at 5×10 4 cells / well in DMEM / F12 supplemented with 10% v / v fetal bovine serum (FBS) (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies), and transduced with AAV at an MOI of 1×10 4 . Cells were transduced with AAV for 24 hours in DMEM / F12 supplemented with 1% v / v FBS. Subsequently, AAV-transduced cells were cultured in 500 μL of DMEM / F12 (without phenol red) medium supplemented with 10% FBS (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies). 50 μL aliquots of the medium were removed at the indicated time points and frozen at -80 °C. Aliquots were processed for measurement of secNanoLuc activity using the Nano-Glo® Luciferase Assay System and CLARIOstar Plus plate reader (BMG Labtech) as recommended by the manufacturer (Promega). The obtained values were adjusted to enable direct comparison of RLU between experiments using human and rat cell cultures. Data at multiple time points were processed in Excel using a conversion (Promega) to calculate total luminescence at each time point. As shown in Figure 13B, transduction of rat RPE cells with AAVs containing C1m1 and C2m2 resulted in an increase in transduction efficiency over 3- and 7-day treatments.

[0250] Transduction assay with the potential therapeutic gene IL10 in primary RPE cell lines using the modified capsids C1m1 and C1m2.

[0251] Primary human RPE cells at passages 6 - 8 were transduced three times with AAVs containing the IL10 gene and packaged with 7m8, AAV2 / 8 p5-2, C1m1, and C1m2 capsids. The human cytomegalovirus (CMV) promoter was used to express the IL10 gene. AAV vectors were prepared by transfecting the Rep / cap plasmids (AAV7m8, AAV2 / 8 p5-2, C1m1, and C1m2), IL-10-pAAV, and Phelper plasmid into the AAV293 cell line (Cell Biolabs) three times. AAV-CMV-TdTomato was used as a non-specific control.

[0252] Cells were seeded at 5×10 4 cells / well in a 24-well plate in DMEM / F12 supplemented with 10% v / v fetal bovine serum (FBS) (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies) and transduced with AAV at an MOI of 1×10 4 . Cells were transduced with AAV for 24 h in DMEM / F12 supplemented with 1% v / v FBS. Subsequently, AAV-transduced cells were cultured in 500 μL of DMEM / F12 (without phenol red) medium supplemented with 10% FBS (Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies). 100 μL aliquots of the medium were removed at the indicated time points and frozen at -80 °C. The aliquots were processed for measurement of IL10 protein using an IL10 ELISA kit as recommended by the manufacturer (Thermo Fisher Scientific). Data at multiple time points were analyzed by GraphPad Prism9 software.

[0253] Both the C1m1 AAV2 / 8 capsid and the C1m2 AAV2 / 8 capsid demonstrated the expression of the IL10 gene in primary RPE cells. A substantial amount of IL10 protein on day 7 post-transduction indicated that the modified capsids were more efficient in transducing human retinal pigment cells compared to the parental AAV2 / 8 p5-2 capsid. IL10 expression was particularly high with the C1m2 capsid on day 7 and was equivalent to the AAV2-7m8 variant. On day 7 post-transduction, cells transduced with C1m2 AAV2 / 8 had significantly higher IL10 expression than those transduced with the AAV2 / 8 p5-2 capsid and the C1m1 capsid (Figure 14). Thus, the data indicate that the insertion of C1m1 or C1m2 at position N590 of the AAV8 capsid provides efficient delivery of IL10 as a therapeutic gene to human retinal cells.

[0254] Novel AAV8 variants with modified capsid sequences C1m1 and C1m2 that express an endostatin-angiostatin fusion protein regulate choroidal sprouting in human explants ex vivo.

[0255] Postmortem human eye cups were incised immediately upon receipt. After removing the vitreous humor, punch biopsies were performed using a disposable 2 mm biopsy punch (Livingstone International) to obtain retinal pigment epithelium, choroid, and sclera (RCS) explants. Up to 12 biopsies were obtained from each eye cup. Punch biopsies from the same eye cup were randomly grouped within a 24-well plate and incubated for 24 hours at 37 °C in 5% CO2 in a nutrient mixture F-12 (DMEM / F12) supplemented with Dulbecco's modified Eagle's medium: 10% v / v fetal bovine serum (FBS) (Gibco), and 100 U / ml penicillin, and 100 μg / ml streptomycin (Life Technologies) to recover from hypoxia and hypothermia prior to AAV transduction.

[0256] Retinal explants were transduced three times over 48 hours in DMEM / F12 supplemented with 1% v / v FBS with AAV containing the secretory endostatin-angiostatin fusion gene and packaged with C1m1 and C1m2 capsids. Endostatin-angiostatin AAV was added at 2×10 9 vg per explant. The secreted endostatin-angiostatin fusion gene was cloned into pAAV-MCS (Cell Biolabs). The secreted endostatin-angiostatin fusion gene was expressed using the human cytomegalovirus (CMV) promoter. Control explants were left untreated or treated with non-specific AAV containing a fluorescent reporter gene.

[0257] The ex vivo human choroidal outgrowth assay was adapted from the protocol for mouse eye explants (Shao et al., 2013). After transduction, choroidal explants were embedded in 30 μL of cold growth factor-reduced Geltrex (Thermo Fisher) in a 24-well glass-bottom plate for high-resolution imaging (Cellvis). The Geltrex "dome" was polymerized at +37 °C for 20 minutes in a TC incubator. The explants were grown in EBM-2 medium (Lonza) supplemented with 2.5% FBS, growth factors including VEGF165, ascorbic acid, and penicillin-streptomycin at 37 °C in 5% CO2. Choroidal buds derived from the explants were imaged on day 7 as shown in Figure 15A. Individual explants were imaged at 4× magnification using phase contrast optics on an Olympus IX73 microscope. Representative images of choroidal outgrowth are shown. The outgrowth area was quantified using FIJI / ImageJ (Schindelin et al., 2012) (Figure 15B). Quantification results of the outgrowth area after transduction with AAV-C1m2 expressing the endostatin-angiostatin fusion gene are shown (n = 3 biological replicates) (Figure 15C). As expected, choroidal buds derived from the explants were significantly inhibited in explants transduced with AAV containing the secretory endostatin-angiostatin fusion gene and packaged with C1m1 and C1m2 capsids.

[0258] References 1.Wang, D., et al., Adeno-associated virus vector as a platform for gene therapy delivery. Nat. Rev. Drug Discov. 18, 358 - 378 (2019). 2. Boutin, S. et al. Prevalence of serum IgG and neutralizing factors against adeno-associated virus (AAV) types 1, 2, 5, 6, 8, and 9 in the healthy population: implications for gene therapy using AAV vectors. Hum. Gene Ther. 21, 704 - 712 (2010). 3. Calcedo, R., Vandenberghe, L. H., Gao, G., Lin, J. & Wilson, J. M. Worldwide epidemiology of neutralizing antibodies to adeno-associated viruses. J. Infect. Dis. 199, 381 - 390 (2009). 4. Dong, J.-Y., Fan, P.-D. & Frizzell, R. A. Quantitative Analysis of the Packaging Capacity of Recombinant Adeno-Associated Virus. Hum. Gene Ther. 7, 2101 - 2112 (1996). 5. Agbandje-McKenna, M. & Kleinschmidt, J. AAV capsid structure and cell interactions. Methods Mol. Biol. Clifton NJ. 807, 47 - 92 (2011). 6. Samulski, R. J. & Muzyczka, N. AAV-Mediated Gene Therapy for Research and Therapeutic Purposes. Annu. Rev. Virol. 1, 427-451 (2014). 7. Zhong, L. et al., Next generation of adeno-associated virus 2 vectors: point mutations in tyrosines lead to high-efficiency transduction at lower doses. Proc. Natl. Acad. Sci. U.S.A. 105, 7827-7832 (2008). 8. Aslanidi, G. V. et al., High-efficiency transduction of human monocyte-derived dendritic cells by capsid-modified recombinant AAV2 vectors. Vaccine 30, 3908-3917 (2012). 9. Aslanidi, G. V. et al., Optimization of the capsid of recombinant adeno-associated virus 2 (AAV2) vectors: the final threshold? PloS One 8, e59142 (2013). 10. Li, B. et al. Site-Directed Mutagenesis of Surface-Exposed Lysine Residues Leads to Improved Transduction by AAV2, But Not AAV8, Vectors in Murine Hepatocytes In Vivo. Hum. Gene Ther. Methods 26, 211-220 (2015). 11. Shi, W., Arnold, G. S. & Bartlett, J. S. Insertional mutagenesis of the adeno-associated virus type 2 (AAV2) capsid gene and generation of AAV2 vectors targeted to alternative cell-surface receptors. Hum. Gene Ther. 12, 1697-1711 (2001). 12. Xie, Q. et al., The atomic structure of adeno-associated virus (AAV-2), a vector for human gene therapy. Proc. Natl. Acad. Sci. 99, 10405-10410 (2002). 13. Yang, L. et al., A myocardium tropic adeno-associated virus (AAV) evolved by DNA shuffling and in vivo selection. Proc. Natl. Acad. Sci. U.S.A. 106, 3946-3951 (2009). 14. Bartel, M. A., Weinstein, J. R. & Schaffer, D. V. Directed evolution of novel adeno-associated viruses for therapeutic gene delivery. Gene Ther. 19, 694-700 (2012). 15. Zinn, E. et al., In Silico Reconstruction of the Viral Evolutionary Lineage Yields a Potent Gene Therapy Vector. Cell Rep. 12, 1056-1068 (2015). 16. Bordet, T. & Behar-Cohen, F. Ocular gene therapies in clinical practice: viral vectors and nonviral alternatives. Drug Discov. Today 24, 1685 - 1693 (2019). 17. Ramlogan-Steel, C. A. et al., Gene therapy and the adeno-associated virus in the treatment of genetic and acquired ophthalmic diseases in humans: Trials, future directions and safety considerations. Clin. Experiment. Ophthalmol. 47, 521 - 536 (2019). 18. Wiley, L. A. et al., Assessment of Adeno-Associated Virus Serotype Tropism in Human Retinal Explants. Hum. Gene Ther. 29, 424 - 436 (2018). 19. Dalkara, D. et al., In Vivo-Directed Evolution of a New Adeno-Associated Virus for Therapeutic Outer Retinal Gene Delivery from the Vitreous. Sci. Transl. Med. 5, 189ra76 - 189ra76(2013). 20. Halbert, C. L. et al., Prevalence of Neutralizing Antibodies against Adeno-Associated Virus (AAV) Types 2, 5, and 6 in Cystic Fibrosis and Normal Populations: Implications for Gene Therapy using AAV Vectors. Hum. Gene Ther. 17, 440 - 447 (2006). 21. Li, J., Samulski, R. J. & Xiao, X. Role for highly regulated rep gene expression in adeno-associated virus vector production. J. Virol. 71, 5236 - 5243 (1997). 22. Petrs-Silva, H. et al., High-efficiency Transduction of the Mouse Retina by Tyrosine-mutant AAV Serotype Vectors. Mol. Ther. 17, 463 - 471 (2009). 23. Kay, C. N. et al., Targeting Photoreceptors via Intravitreal Delivery Using Novel, Capsid-Mutated AAV Vectors. PLOS ONE 8, e62097 (2013). 24. Nicklin, S. A. et al., Efficient and Selective AAV2-Mediated Gene Transfer Directed to Human Vascular Endothelial Cells. Mol. Ther. 4, 174 - 181 (2001). 25. Grifman, M. et al., Incorporation of Tumor-Targeting Peptides into Recombinant Adeno-associated Virus Capsids. Mol. Ther. 3, 964 - 975 (2001). 26. Girod, A. et al., Genetic capsid modifications allow efficient re-targeting of adeno-associated virus type 2. Nat. Med. 5, 1052 - 1056 (1999). 27. Mueller, O. J. et al. Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors. Nat. Biotechnol. 21, 1040 - 1046 (2003). 28. Kimura T. et al., Production of adeno-associated virus vectors for in vitro and in vivo applications. Sci Rep. 9(1):13601(2019). 29. Brown N. P. et al., MView: a web-compatible database search or multiple alignment viewer. Bioinformatics. 14(4):380 - 1(1998). 29. Khabou H. et al., Insight into the mechanisms of enhanced retinal transduction by the engineered AAV2 capsid variant -7m8. Biotechnol Bioeng. Dec;113(12):2712 - 2724(2016). 30. Buening, H., & Srivastava, A. Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors. Molecular therapy. Methods & Clinical Development, 12, 248 - 265(2019). 31. Pavlou M et al., Novel AAV capsids for intravitreal gene therapy of photoreceptor disorders. EMBO Mol Med., 13(4)(2021). 32. Boerner, K. et al., Pre-arrayed Pan-AAV Peptide Display Libraries for Rapid Single-Round Screening. Molecular therapy: the journal of the American Society of Gene Therapy, 28(4), 1016 - 1032(2020). 33. Raupp, C. et al., The Threefold Protrusions of Adeno-Associated Virus Type 8 Are Involved in Cell Surface Targeting as Well as Postattachment Processing. J Virol., 86(17):9396 - 9408(2012). 34. Nam et al., Structure of Adeno-Associated Virus Serotype 8, a Gene Therapy Vector, J Virol., v.81(22)(2007). 35. Mietzsch, M. et al., Completion of the AAV Structural Atlas: Serotype Capsid Structures Reveals Clade-Specific Features, Viruses, 13(1):101(2021). 36. Shao, Z., et al., Choroid sprouting assay: an ex vivo model of microvascular angiogenesis. PLoS One. Jul 26;8(7):e69552(2013). 37. Schindelin, J., et al., Fiji: an open-source platform for biological-image analysis. Nature Methods, 9(7), 676 - 682(2012). 38. Gao, G., et al., Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. PNAS, 99(18) 11854-11859 (2002). 39. Wu Z., et al., Single amino acid changes can influence titer, heparin binding, and tissue tropism in different adeno-associated virus serotypes. J Virol., 80(22) 11393-7 (2006). 40. Perbal, J., A Practical Guide to Molecular Cloning, John Wiley and Sons (1984). 41. Sambrook, J., et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989). 42. Brown T.A., (editor) Essential Molecular Biology: A Practical Approach. Volumes 1 and 2, IRL Press (1991). 43. Glover D.M., and Hames B.D., (editors), DNA Cloning: A Practical Approach. Volumes 1-4, IRL Press (1995 and 1996) 44. Ausubel F.M., et al., (editors), Current Protocols in Molecular Biology. Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), 45. Coligan J.E., et al. (editors) Current Protocols in Immunology. John Wiley & Sons (including all updates until present). 46. Nei M. and Kumar S., Molecular Evolution and Phylogenetics. Oxford University Press, New York (2000). 47. Needleman S.B., and Wunsch C.D., A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol 48(3):443 - 53(1970). 48. Knipe D.M., and Howley P.M., Clinical Infectious Dsieases, Field’s Virology. Lippincott Williams & Wilkins, Philadelphia, ed. Sixth(2013). 49. Vasileva & Jessberger, Precise hit: adeno - associated virus in gene targeting, Nature reviews. Microbiology, 3:837 - 847(2005). 50. Muzyczka, Use of adeno - associated virus as a general transduction vector for mammalian cells, Current Topics in Microbiol, and Immunol. 158:97 - 129(1992). 51. Kotin, Prospects for the use of adeno - associated virus as a vector for human gene therapy, Human Gene Therapy 5:793 - 801(1994). 52.Zhou et al.,Adeno-associated virus 2-mediated high efficiency gene transfer into immature and mature subsets of hematopoietic progenitor cells in human umbilical cord blood,J Exp.Med.179:1867-1875(1994). 53.Zolotukhin et al.,Production and purification of serotype 1,2,and 5 recombinant adeno-associated viral vectors.Methods 28:158-167(2002). 54.Samulski et al.,A recombinant plasmid from which an infectious adeno-associated virus genome can be excised in vitro and its use to study viral replication,J Virology,6:3096-3101(1987). 55.Clement et al.,Large-scale adeno-associated viral vector production using a herpesvirus-based system enables manufacturing for clinical studies,Hum Gene Ther.,20(8):796-806(2009). 56.Duan et al.,Enhancement of muscle gene delivery with pseudotyped adeno-associated virus type 5 correlates with myoblast differentiation,J.Virol.,75:7662-7671(2001). 57.Halbert et al.,Repeat transduction in the mouse lung by using adeno-associated virus vectors with different serotypes,J.Virol.,74:1524-1532(2000). 58.Zolotukhin et al.,Production and purification of serotype 1,2,and 5 recombinant adeno-associated viral vectors,Methods,28:158-167(2002). 59.Auricchio et al.,Exchange of surface proteins impacts on viral vector cellular specificity and transduction characteristics:the retina as a model,Hum.Mol.Genet.,10:3075-3081(2001). 60.Kozomara et al.,miRBase:annotating high confidence microRNAs using deep sequencing data Nuc Acids Res,42:68-73(2013). 61.Griffiths-Jones,S.,The microRNA Registry,Nuc Acids Res,1:32(2004). 62.Remington’s Pharmaceutical Sciences(Mack Publishing Co.N.J.USA(1991). 63.Remington:The Science and Practice of Pharmacy,22nd edition.Pharmaceutical Press,(2012).

Claims

**Claim 1** A recombinant adeno-associated virus (AAV) capsid protein comprising an insertion by the sequence set forth in SEQ ID NO: 1 or a functional equivalent thereof. **Claim 2** The recombinant AAV capsid protein according to claim 1, wherein the insertion is in VR-VIII of the AAV8 capsid protein or at the corresponding position of the capsid protein of an AAV serotype other than AAV8, and the insertion is relative to the parental AAV capsid protein. **Claim 3** The recombinant AAV capsid protein according to claim 1 or 2, wherein the insertion is preferably located at the position corresponding to amino acid 590 of the capsid protein of AAV8 or at the corresponding position of the capsid protein of an AAV serotype other than AAV8. **Claim 4** The recombinant AAV capsid protein according to any one of claims 1 to 3, wherein the insertion is relative to the parental AAV capsid protein by the sequence set forth in SEQ ID NO: 121 or 125. **Claim 5** The recombinant AAV capsid protein according to any one of claims 1 to 4, wherein the insertion comprises a sequence by any one of SEQ IDs NO: 2 to 108. **Claim 6** The recombinant AAV capsid protein according to any one of claims 1 to 4, wherein the insertion comprises a sequence that differs from the sequence set forth in SEQ ID NO: 1 by only one or two or fewer amino acids. **Claim 7** The recombinant AAV capsid protein according to any one of claims 1 to 4, wherein the insertion comprises the sequence set forth in SEQ ID NO: 109 or SEQ ID NO:

110. **Claim 8** The recombinant AAV capsid protein according to any one of claims 1 to 7, wherein the insertion optionally comprises a linker adjacent to the 5' and / or 3' end of the insertion, the linker comprising the sequence set forth in SEQ ID NO: 111 and / or SEQ ID NO:

112. **Claim 9** The recombinant AAV capsid protein according to claim 8, wherein the insertion comprises the sequence set forth in SEQ ID NO: 129 or 138. **Claim 10** The recombinant AAV capsid protein according to any one of claims 1 to 9, wherein the insertion optionally comprises the sequence set forth in SEQ ID NO: 130 to 133 or 139 to 140 in one or more or all of the VP1, VP2, and VP3 capsid proteins, preferably in the VP3 capsid protein. **Claim 11** The recombinant capsid protein contains a mutation selected from one or more or all of Y447F, T494V, and Y733F, and preferably, each of Y447F, T494V, and Y733F is included in the AAV8 capsid protein. The recombinant AAV capsid protein according to any one of claims 1 to 10.

12. The recombinant AAV capsid protein according to claim 11, comprising the sequence set forth in any one of SEQ ID NO: 135 or 142.

13. The recombinant AAV capsid protein according to any one of claims 1 to 12, wherein the AAV capsid protein is an AAV2, AAV4, AAV7, or AAV10 capsid protein.

14. Recombinant adeno-associated virus (AAV) particles comprising the AAV capsid protein according to any one of claims 1 to 13.

15. An isolated nucleic acid encoding the recombinant adeno-associated virus (AAV) capsid protein according to any one of claims 1 to 13.

16. The isolated nucleic acid sequence according to claim 15, comprising the sequence set forth in SEQ ID NO: 134 or 141.

17. An isolated nucleic acid encoding a recombinant adeno-associated virus (AAV) capsid protein having at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO:

124.

18. An isolated nucleic acid encoding a recombinant adeno-associated virus (AAV) capsid VP3 protein, wherein the VP3 protein has at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 130 to 133 or 139 to 140.

19. The isolated nucleic acid according to claim 16 or 17, wherein the nucleic acid encoding the recombinant AAV capsid protein comprises a p5 enhancer element, preferably an AAV2 p5 enhancer element.

20. The isolated nucleic acid according to any one of claims 17 to 16 or 19, wherein the nucleic acid encoding the recombinant AAV capsid protein comprises the AAV8 3'UTR.

21. An isolated nucleic acid encoding a recombinant adeno-associated virus (AAV) particle having at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 136 or 143.

22. The isolated nucleic acid according to claim 21, wherein the nucleic acid optionally comprises the AAV2 rep nucleic acid sequence defined according to SEQ ID NO:

122.

23. The isolated nucleic acid according to claim 21 or 22, comprising the AAV2 inverted terminal repeat (ITR).

24. The isolated nucleic acid according to claim 22, optionally comprising a mutation from ATG to ACG at the start codon of the AAV2 rep gene according to the sequence defined according to SEQ ID NO:

114.

25. An isolated nucleic acid encoding a recombinant AAV particle according to any one of claims 21 to 24, comprising an expression cassette for expressing a therapeutic molecule, and optionally, the therapeutic molecule is DNA, mRNA, cRNA, and cDNA, tRNA, siRNA, shRNA, and hpRNA.

26. The isolated nucleic acid encoding a recombinant AAV particle according to claim 25, wherein the therapeutic molecule is optionally suitable for the treatment of eye diseases selected from the group consisting of retinitis pigmentosa, diabetic retinopathy, cystoid macular edema, clinically significant macular edema, uveitis, iritis, giant cell arteritis, vasculitis, peripheral uveitis, corneal transplant rejection, intraocular inflammation or lamellar corneal transplant rejection, macular degeneration, central retinal vein occlusion, retinal vein branch occlusion, and ocular angiogenesis.

27. The isolated nucleic acid encoding a recombinant AAV particle according to claim 25 or 26, wherein the therapeutic molecule inhibits angiogenesis and / or inflammation.

28. The therapeutic molecule is -comprising endostatin, angiostatin, or a fusion of endostatin and angiostatin, -a binding protein, -comprising an antigen-binding site of an antibody, -selected from the group consisting of ranibizumab, bevacizumab, and aflibercept, -inhibiting inflammation, or, An isolated nucleic acid encoding a recombinant AAV particle according to any one of claims 25 to 27, which is interleukin-10 (IL-10), interleukin-1 receptor antagonist (IL-1RA), or a fusion of IL-10 and IL-1RA.

29. The isolated nucleic acid encoding a recombinant AAV particle according to any one of claims 25 to 28, wherein the therapeutic molecule is an inhibitor of vascular endothelial growth factor (VEGF), placental growth factor (PlGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), TIE ligand (angiopoietin), Ephrin, angiopoietin-like 3 (ANGPTL3), angiopoietin-like 4 (ANGPTL4), insulin-like growth factor-I (IGF-I), epidermal growth factor (EGF), connective tissue growth factor (CTGF), transforming growth factor alpha (TGF-α), transforming growth factor beta (TGF-β), or TNF-alpha (e.g., anti-inflammatory soluble TNF-R).

30. The isolated nucleic acid encoding a recombinant AAV particle according to claim 29, wherein the therapeutic molecule is an inhibitor of vascular endothelial growth factor (VEGF), optionally selected from a VEGF antibody, a VEGF receptor antibody, or VEGF siRNA.

31. The isolated nucleic acid encoding a recombinant AAV particle according to any one of claims 21 to 30, wherein the expression cassette optionally comprises a retina-specific promoter for driving the expression of a therapeutic molecule selected from the group consisting of rhodopsin, rhodopsin kinase, RPE65, and retinaldehyde-binding protein 1 (RLBP1).

32. The expression cassette comprises a) a kill switch comprising a first site-specific recombination sequence and a second site-specific recombination sequence; b) a regulatable element operably linked to the nucleic acid sequence encoding the therapeutic molecule, wherein the activity of the regulatable element is regulated by a regulator compound. c) A constitutive promoter operably linked to a nucleic acid sequence encoding a regulatory factor compound-binding polypeptide capable of binding to the regulatory factor compound, wherein when the regulatory factor compound binds, the regulatory factor compound-binding polypeptide regulates the expression of the therapeutic molecule, and activation of the kill switch by recombination between the first site-specific recombination sequence and the second site-specific recombination sequence silences the expression of the nucleic acid encoding the therapeutic molecule from the cassette; and the constitutive promoter, an isolated nucleic acid encoding a recombinant AAV particle according to any one of claims 21 to 31.

33. A pharmaceutical composition comprising the AAV particle according to claim 14 and one or more carriers or excipients.

34. An ex vivo, in vitro, or in vivo method for increasing the transduction efficiency of adeno-associated virus (AAV) particles in a target cell, tissue, or organ, the method comprising contacting the target cell, tissue, or organ with the AAV particle according to claim 14 or the composition according to claim 33 under conditions sufficient for transduction of the AAV particles in the target cell, tissue, or organ, wherein the transduction efficiency is increased compared to AAV particles without a capsid insertion.

35. The method according to claim 34, wherein the method is an in vivo method, the AAV particle comprises an expression cassette for expressing a therapeutic molecule, and the expression of the therapeutic molecule is increased compared to an AAV particle that comprises the expression cassette and does not have a capsid insertion.

36. The transduction efficiency is increased by at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400% or more compared to AAV particles without a capsid insertion. The method according to claim 34 or 35.

37. The method according to claim 34 or 35, wherein the transduction efficiency is increased by at least 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 times or more as compared with AAV particles having no capsid insertion.

38. A method for reducing an immune response to adeno-associated virus (AAV) particles in a target cell, tissue, or organ, the method comprising contacting the target cell, tissue, or organ with the AAV particles according to claim 14 or the composition according to claim 33 under conditions sufficient for transduction of the AAV particles in the target cell, tissue, or organ, wherein the immune response is reduced as compared with AAV particles having no capsid insertion.

39. The method according to any one of claims 34 to 38, wherein the target cell is a retinal cell, the target tissue is a retinal tissue, and the target organ is an eye.

40. A method for performing it in a subject in need of treating a condition, disorder, or disease, the method comprising administering to the subject the AAV particles according to claim 14 or the composition according to claim 33, thereby treating the condition, disorder, or disease in the subject.

41. Use of the AAV particles according to claim 14 or the composition according to claim 33 in the preparation of a medicament for performing it in a subject in need of treating a condition, disorder, or disease.

42. The AAV particles according to claim 14 or the composition according to claim 33 for use in performing it in a subject in need of treating a condition, disorder, or disease.

43. The AAV particles or composition for use according to the method of claim 40, the use of claim 41, or the use of claim 42, wherein the condition, disorder, or disease is optionally selected from the group consisting of retinitis pigmentosa, diabetic retinopathy, cystoid macular edema, clinically significant macular edema, uveitis, iritis, giant cell arteritis, vasculitis, peripheral uveitis, corneal transplant rejection, intraocular inflammation or lamellar corneal transplant rejection, macular degeneration, central retinal vein occlusion, branch retinal vein occlusion, and ocular angiogenesis.

44. The method according to claim 40 or 43, the use according to claim 41 or 43, or the AAV particles or composition for the use according to claim 42 or 43, wherein the subject has at least one symptom of an eye disorder selected from the group including a decrease in peripheral vision, a decrease in central vision, a decrease in night vision, and a loss of color vision.

45. The AAV particles or composition thereof to be administered comprises a modified capsid protein according to any one of claims 1 to 13, and the expression cassette comprises a) a kill switch comprising a first site-specific recombination sequence and a second site-specific recombination sequence; b) a regulatable element operably linked to a nucleic acid sequence encoding a therapeutic molecule, wherein the activity of the regulatable element is regulated by a regulator compound; c) a constitutive promoter operably linked to a nucleic acid sequence encoding a regulator compound-binding polypeptide capable of binding to the regulator compound, wherein when the regulator compound binds, the regulator compound-binding polypeptide regulates the expression of the therapeutic molecule, and activation of the kill switch by recombination between the first site-specific recombination sequence and the second site-specific recombination sequence silences the expression of the nucleic acid encoding the therapeutic molecule from the cassette. The method according to any one of claims 40 or 43 to 44, the use according to any one of claims 41 or 43 to 44, or the AAV particles or composition for the use according to any one of claims 42 to 44.

46. The AAV particles are administered intravitreally or subretinally, the kill switch is activated by administering a site-specific recombinase or a nucleic acid encoding a site-specific recombinase, and the site-specific recombinase catalyzes recombination between the first site-specific recombination sequence and the second site-specific recombination sequence, thereby silencing the expression of the therapeutic molecule. The method, use, or AAV particles or composition for the use according to claim 45.

47. The method, use, or AAV particles or composition for the use according to claim 45 or 46, wherein the treatment comprises administering the regulator compound locally to the eye or as an eye drop.

48. Preferably, before administration of the recombinant AAV or its composition, the method according to any one of claims 40 or 43 to 47, the use according to any one of claims 41 or 42 to 47, or the use according to any one of claims 42 to 47, which comprises administration of an immunosuppressant, or an AAV particle or composition for use according to any one of claims 42 to 47.

49. Optionally, the method according to any one of claims 40 or 43 to 48, the use according to any one of claims 41 or 42 to 48, or the AAV particle or composition for use according to any one of claims 42 or 43 to 48, further comprising performing an additional treatment selected from the group consisting of surgery, lens replacement with an intraocular lens, laser surgery, or drug therapy.

50. The method according to any one of claims 40 or 43 to 49, the use according to any one of claims 41 or 42 to 49, or the AAV particle or composition for use according to any one of claims 42 or 43 to 49, wherein the recombinant AAV particle or composition is administered intravitreally.

51. The method, use, or AAV particle or composition for use according to claim 48, wherein the immunosuppressant and / or additional therapy is administered intravenously, orally, subcutaneously, or intramuscularly.

52. An isolated mammalian cell comprising the recombinant adeno-associated virus (AAV) particle according to claim 14.

53. The isolated mammalian cell according to claim 52, wherein the mammalian cell is optionally a human cell selected from the group consisting of photoreceptor cells, retinal ganglion cells, bipolar cells, fiber columns, retinal pigment epithelial cells, amacrine cells, astrocytes, horizontal cells, microglia, or Müller glial cells, preferably human retinal cells.

54. A kit comprising the recombinant adeno-associated virus (AAV) particle according to claim 14 or the composition according to claim 33 for preventing or treating a disease, condition, or disorder in a subject.

55. Optionally, the kit according to claim 54 for preventing or treating an eye disease in a subject selected from the group consisting of retinitis pigmentosa, diabetic retinopathy, cystoid macular edema, clinically significant macular edema, uveitis, iritis, giant cell arteritis, vasculitis, peripheral uveitis, corneal transplant rejection, intraocular inflammation or lamellar corneal transplant rejection, macular degeneration, central retinal vein occlusion, branch retinal vein occlusion, and ocular angiogenesis.

56. A method for increasing the titer of an adeno-associated virus (AAV) vector genome in a target cell, tissue, or organ, the method comprising contacting the target cell, tissue, or organ with the AAV particles according to claim 14 under conditions sufficient for transduction of the AAV particles within the target cell, tissue, or organ, wherein the vector genome is increased as compared to AAV particles without a capsid insertion.

Images