Antisense oligonucleotides for targeting prograin
Antisense oligonucleotides with methanesulfonyl phosphoramidate linkages enhance progranulin expression by promoting exon 1-exon 2 splice variants, addressing progranulin deficiency in neurodegenerative diseases.
Patent Information
- Application Number
- JP2024573811
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-17
- Filing Date
- 2023-06-15
- Publication Date
- 2025-07-03
AI Technical Summary
There is an urgent need for therapeutic agents that can increase the expression and/or activity of progranulin to address neurodegenerative diseases caused by progranulin deficiency, such as frontotemporal dementia, as existing antisense oligonucleotides have not effectively improved splicing switching activity.
Development of antisense oligonucleotides comprising a contiguous nucleotide sequence 8 to 40 nucleotides in length, complementary to splice regulatory sites of progranulin pre-mRNA, with one or more methanesulfonyl phosphoramidate nucleotide linkages, to upregulate the expression of exon 1-exon 2 progranulin splice variants and reduce the production of intron 1-exon 2 splice variants.
The antisense oligonucleotides significantly enhance the expression of functional progranulin protein by increasing the ratio of exon 1-exon 2 splice variants and reducing intron 1-exon 2 splice variants, potentially treating neurodegenerative diseases like frontotemporal dementia.
Smart Images

Figure 2025520514000026 
Figure 2025520514000027 
Figure 2025520514000001
Abstract
Description
Technical Field
[0001] The present invention relates to antisense oligonucleotides that alter the splicing pattern of progranulin, and their use in the treatment of neuropathy. Such antisense oligonucleotides can upregulate or restore the expression of exon 1-exon 2 progranulin splice variants in cells.
Background Art
[0002] Progranulin (PGRN) is a highly conserved secreted protein expressed in multiple cell types in both the central nervous system (CNS) and peripheral tissues.
[0003] Deficiency of the secreted protein progranulin in the central nervous system causes the neurodegenerative disease frontotemporal dementia (FTD). Pathogenic progranulin mutations result in a loss of approximately 50% of progranulin levels and intracellular aggregation of the TDP-43 protein via haploinsufficiency. Progranulin plays supportive and protective roles in numerous processes in the brain, including neurite outgrowth, synapse biology, response to extrinsic stress, lysosomal function, neuroinflammation, and angiogenesis, in both autonomous and non-autonomous modes of cells.
[0004] Directly and through its conversion to granulin, progranulin regulates lysosomal function, cell proliferation, survival, repair, and inflammation. Progranulin has a major role in the regulation of microglial responses related to lysosomal function in the CNS. Autosomal dominant mutations in the progranulin gene that result in protein haploinsufficiency are associated with familial frontotemporal dementia (FTLD-TDP) with neuropathological frontotemporal lobar degeneration (FTLD) associated with the accumulation of 43 kDa TAR-DNA binding protein (TDP-43) inclusions. Homozygous GRN mutations are associated with neuronal ceroid lipofuscinosis (NCL) (Townley, et al., Neurology, 2018 June 12;90(24):1127).
[0005] Mutations in the progranulin gene have recently been identified as the cause of approximately 5% of all FTD, including some sporadic cases. In recent studies using mouse models, the expression of progranulin in the brain has been defined (Petkau et al., 2010). Progranulin is expressed in the late stage of neurogenesis and co-localizes with markers of mature neurons. Progranulin is expressed in neurons in most brain regions and shows the highest expression in the thalamus, hippocampus, and cortex. Microglial cells also express progranulin, and the expression level is upregulated by microglial activation. Approximately 70 different progranulin gene mutations have been identified in FTD, all of which reduce progranulin levels or result in loss of progranulin function.
[0006] Therefore, there is an urgent need for therapeutic agents that can increase the expression and / or activity of progranulin.
[0007] In gapmer antisense oligonucleotides, mesylphosphoramidate modification has been shown to improve the therapeutic index and duration of effect (Anderson et al., Nucleic acids research, 2021), but mesylphosphoramidate modification of gapmer antisense oligonucleotides has also been shown to significantly reduce both immunostimulation and cytotoxicity (Anderson et al., Nucleic acids research, 2021). The mesylphosphoramidate linkage modification can include a methanesulfonylphosphoramidate nucleotide internucleotide linkage in which the negative charge is retained in the phosphate backbone, unlike other phosphoramidate linkages and alkylphosphonate linkages.
[0008] Mesyl phosphoramidate oligonucleotides can also act as splicing switching agents. However, in the evaluation of the splicing switching activity of mesyl phosphoramidate oligonucleotides in fibroblasts derived from spinal muscular atrophy patients, no significant difference in splicing switching efficacy was found between 2'-MOE mesyl oligonucleotides and the corresponding phosphorothioate (nusinersen) oligonucleotides, so previous studies have not shown an improvement in splicing switching (Hammond et al., Nucleic Acid Therapeutics, 2021).
Summary of the Invention
[0009] A splice variant of progranulin that retains the 5' portion of intron 1 is expressed in the brain, such as in neurons or microglial cells (Capell et al. The Journal of Biological Chemistry, 2014, 289(37), 25879-25889). This splice variant contains the most 5'-terminal 271 nucleotides of intron 1, which is 3823 nucleotides in total. The 271-nucleotide fragment of intron 1 contains two AUG sites upstream of the canonical downstream AUG (open reading frame) in exon 2. Translation from these two upstream AUG sites does not encode the progranulin protein, and due to premature stop codons, the transcript can undergo nonsense-mediated mRNA decay (NMD).
[0010] International Publication No. 2020 / 191212 describes specific oligonucleotides that can target progranulin mRNA.
[0011] Previously, the inventors determined that reduction of a splice variant retaining the 5’ portion of intron 1 increased exon 1 and exon 2 splice variants and further increased progranulin protein expression. Thereby, antisense oligonucleotides of progranulin were invented. These antisense oligonucleotides have the ability to alter the splicing pattern of progranulin. In particular, the antisense oligonucleotides can upregulate the expression of exon 1-exon 2 progranulin splice variants, reduce the production of progranulin intron 1-exon 2 splice variants retaining the 5’ portion of intron 1, and increase the expression of progranulin protein. These antisense oligonucleotides can be described as modulators of progranulin splicing or as agonists of progranulin exon 1-exon 2 and can be used to restore or enhance the expression of progranulin exon 1-exon 2 splice variants in cells.
[0012] The inventors have surprisingly determined that this effect can be increased by including one or more methanesulfonyl phosphoramidate nucleotide internucleotide linkages within the antisense oligonucleotide or its contiguous nucleotide sequence.
[0013] The present invention provides an antisense oligonucleotide comprising a contiguous nucleotide sequence 8 to 40 nucleotides in length that is complementary, e.g., fully complementary, to a splice regulatory site of a human progranulin pre-mRNA transcript, wherein the contiguous nucleotide sequence comprises one or more methanesulfonyl phosphoramidate nucleotide internucleotide linkages.
[0014] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides, comprising a continuous nucleotide sequence of 8 to 40 nucleotides that is complementary, for example, completely complementary, to a splice regulatory site of exon 1, intron 1, and exon 2 sequences of a human progranulin pre-mRNA transcript, and the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0015] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides, comprising a continuous nucleotide sequence of 8 to 40 nucleotides that is complementary, for example, completely complementary, to a human progranulin pre-mRNA transcript containing exon 1, intron 1, and exon 2 sequences (SEQ ID NO: 1) of human progranulin pre-mRNA, and the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0016] The progranulin exon 1, intron 1, and exon 2 sequences are shown below as SEQ ID NO: 1. The progranulin exon 1 sequence (in capital letters) corresponds to positions 44,345,123 to 44,345,334 on chromosome 17 of genome Ensemble (www.ensemble.org). Intron 1 corresponds to positions 44,345,335 to 44,349,157 on chromosome 17 of genome Ensemble, and the exon 2 sequence (in capital letters) corresponds to positions 44,349,158 to 44,349,302 on chromosome 17 of genome Ensemble.
[0017] Exon 1, intron 1, and exon 2 sequences of human progranulin pre-mRNA (SEQ ID NO: 1):
[0018] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides and containing a continuous nucleotide sequence of at least 12 nucleotides in length that is complementary, for example, completely complementary, to a splice regulatory site of human progranulin pre-mRNA, wherein the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0019] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides and containing a continuous nucleotide sequence of at least 12 to 16 nucleotides in length that is complementary, for example, completely complementary, to a splice regulatory site of human progranulin pre-mRNA, wherein the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0020] The present invention provides an antisense oligonucleotide having a length of 12 to 16 nucleotides and containing a continuous nucleotide sequence of at least 12 to 16 nucleotides in length that is complementary, for example, completely complementary, to a splice regulatory site of human progranulin pre-mRNA, wherein the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0021] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides and containing a continuous nucleotide sequence of at least 12 to 18 nucleotides in length that is complementary, for example, completely complementary, to a splice regulatory site of human progranulin pre-mRNA, wherein the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0022] The present invention provides an antisense oligonucleotide having a length of 12 to 18 nucleotides, comprising a continuous nucleotide sequence of 12 to 18 nucleotides in length that is complementary, for example, completely complementary, to the splice regulatory site of human progranulin pre-mRNA, and the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0023] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides, comprising a continuous nucleotide sequence of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length that is complementary, for example, completely complementary, to the splice regulatory site of human progranulin pre-mRNA, and the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0024] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides, comprising a continuous nucleotide sequence of 8 to 40 nucleotides in length that is complementary, for example, completely complementary, to the nucleotide sequence contained within SEQ ID NO: 1, and the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0025] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides, comprising a continuous nucleotide sequence of 8 to 40 nucleotides in length that is complementary, for example, completely complementary, to the nucleotide sequence contained within nucleotides 449 to 466 of SEQ ID NO: 1, and the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0026] The present invention provides an antisense oligonucleotide having a length of 8 to 40 nucleotides, comprising a continuous nucleotide sequence of 8 to 40 nucleotides in length that is complementary, for example, completely complementary, to SEQ ID NO: 39, and the continuous nucleotide sequence contains one or more methanesulfonyl phosphoramidate nucleotide internucleotide linkages.
[0027] SEQ ID NO: 39 is a target site having the sequence: ACCACACCATTCTTGACC.
[0028] The antisense oligonucleotide can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.
[0029] In some embodiments, the antisense oligonucleotide is 8 to 40, 12 to 40, 12 to 20, 10 to 20, 14 to 18, 12 to 18 or 16 to 18 nucleotides in length.
[0030] The continuous nucleotide sequence can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.
[0031] In some embodiments, the continuous nucleotide sequence is at least 12 nucleotides in length, for example, 12 to 16 or 12 to 18 nucleotides in length.
[0032] In some embodiments, the continuous nucleotide sequence is the same length as the antisense oligonucleotide.
[0033] In some embodiments, the antisense oligonucleotide consists of the continuous nucleotide sequence.
[0034] In some embodiments, the antisense oligonucleotide is a continuous nucleotide sequence.
[0035] In some embodiments, the continuous nucleotide sequence is completely complementary to the nucleotide sequence contained within SEQ ID NO: 1.
[0036] In some embodiments, the continuous nucleotide sequence is completely complementary to the nucleotide sequence contained within nucleotides 449 - 466 of SEQ ID NO: 1.
[0037] In some embodiments, the continuous nucleotide sequence is completely complementary to SEQ ID NO: 39.
[0038] In some embodiments, the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NOs: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, and 38, or at least 8 consecutive nucleotides thereof.
[0039] In some embodiments, the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, and SEQ ID NO: 38, or at least 9 consecutive nucleotides thereof.
[0040] In some embodiments, the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, and SEQ ID NO: 38, or at least 10 consecutive nucleotides thereof.
[0041] In some embodiments, the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, and SEQ ID NO: 38, or at least 11 consecutive nucleotides thereof.
[0042] In some embodiments, the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, and SEQ ID NO: 38, or at least 12 consecutive nucleotides thereof.
[0043] In some embodiments, the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, and SEQ ID NO: 38, or at least 13 consecutive nucleotides thereof.
[0044] In some embodiments, the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, and SEQ ID NO: 38, or at least 14 consecutive nucleotides thereof.
[0045] In some embodiments, the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, and SEQ ID NO: 38, or at least 15 consecutive nucleotides thereof.
[0046] In some embodiments, the continuous nucleotide sequence is selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, and SEQ ID NO: 38.
[0047] In some embodiments, the continuous nucleotide sequence is selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, and SEQ ID NO: 37.
[0048] In some embodiments, the continuous nucleotide sequence is selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 28, SEQ ID NO: 31, and SEQ ID NO: 35.
[0049] In some embodiments, the continuous nucleotide sequence is SEQ ID NO: 11.
[0050] In some embodiments, the continuous nucleotide sequence is SEQ ID NO: 15.
[0051] In some embodiments, the continuous nucleotide sequence is SEQ ID NO: 16.
[0052] In some embodiments, the continuous nucleotide sequence is SEQ ID NO: 28.
[0053] In some embodiments, the continuous nucleotide sequence is SEQ ID NO: 31.
[0054] In some embodiments, the continuous nucleotide sequence is SEQ ID NO: 35.
[0055] In some embodiments, the continuous nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or more methanesulfonyl phosphoramidate nucleotide linkages.
[0056] In some embodiments, the continuous nucleotide sequence comprises one or more methanesulfonyl phosphoramidate nucleotide linkages.
[0057] In some embodiments, the continuous nucleotide sequence comprises two or more methanesulfonyl phosphoramidate nucleotide linkages.
[0058] In some embodiments, the continuous nucleotide sequence comprises three or more methanesulfonyl phosphoramidate nucleotide linkages.
[0059] In some embodiments, the continuous nucleotide sequence comprises four or more methanesulfonyl phosphoramidate nucleotide linkages.
[0060] In some embodiments, the continuous nucleotide sequence comprises five or more methanesulfonyl phosphoramidate nucleotide linkages.
[0061] In some embodiments, the continuous nucleotide sequence comprises six or more methanesulfonyl phosphoramidate nucleotide linkages.
[0062] In some embodiments, the continuous nucleotide sequence comprises seven or more methanesulfonyl phosphoramidate nucleotide linkages.
[0063] In some embodiments, the continuous nucleotide sequence comprises eight or more methanesulfonyl phosphoramidate nucleotide linkages.
[0064] In some embodiments, the continuous nucleotide sequence comprises nine or more methanesulfonyl phosphoramidate nucleotide linkages.
[0065] In some embodiments, the continuous nucleotide sequence comprises ten or more methanesulfonyl phosphoramidate nucleotide linkages.
[0066] In some embodiments, the continuous nucleotide sequence comprises eleven or more methanesulfonyl phosphoramidate nucleotide linkages.
[0067] In some embodiments, the continuous nucleotide sequence comprises twelve or more methanesulfonyl phosphoramidate nucleotide linkages.
[0068] In some embodiments, the continuous nucleotide sequence comprises thirteen or more methanesulfonyl phosphoramidate nucleotide linkages.
[0069] In some embodiments, the continuous nucleotide sequence comprises fourteen or more methanesulfonyl phosphoramidate nucleotide linkages.
[0070] In some embodiments, the continuous nucleotide sequence comprises 15 or more methanesulfonyl phosphoramidate nucleotide linkages.
[0071] In some embodiments, the continuous nucleotide sequence comprises 16 or more methanesulfonyl phosphoramidate nucleotide linkages.
[0072] In some embodiments, the continuous nucleotide sequence comprises 17 or more methanesulfonyl phosphoramidate nucleotide linkages.
[0073] In some embodiments, the continuous nucleotide sequence comprises 1 or more phosphorothioate nucleotide linkages.
[0074] In some embodiments, the continuous nucleotide sequence comprises a plurality of phosphorothioate nucleotide linkages, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate nucleotide linkages.
[0075] In some embodiments, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100% of the nucleotide linkages of the continuous nucleotide sequence are modified.
[0076] In some embodiments, all of the nucleotide linkages located between nucleotides of the continuous nucleotide sequence are modified.
[0077] In some embodiments, all of the nucleotide linkages present within the antisense oligonucleotide are selected from phosphorothioate nucleotide linkages and methanesulfonyl phosphoramidate nucleotide linkages.
[0078] In some embodiments, the antisense oligonucleotide or its continuous nucleotide sequence comprises one or more modified nucleosides.
[0079] In some embodiments, the continuous nucleotide sequence comprises one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.
[0080] In some embodiments, the continuous nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.
[0081] In some embodiments, the continuous nucleotide sequence comprises at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.
[0082] In some embodiments, the nucleosides of the continuous nucleotide sequence are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides.
[0083] The present invention provides an isolated, purified or manufactured antisense oligonucleotide.
[0084] In some embodiments, the antisense oligonucleotide is or comprises a mixmer or totalmer of the antisense oligonucleotide. In some embodiments, the continuous nucleotide sequence is a mixmer or totalmer.
[0085] The present invention provides a conjugate comprising an antisense oligonucleotide according to the present invention and at least one conjugate moiety covalently attached to the antisense oligonucleotide.
[0086] The present invention provides an antisense oligonucleotide attached by a covalent bond to at least one conjugate moiety.
[0087] The present invention provides a pharmaceutically acceptable salt of the antisense oligonucleotide according to the present invention or the conjugate according to the present invention.
[0088] The present invention provides an antisense oligonucleotide according to the present invention in the form of a pharmaceutically acceptable salt.
[0089] In some embodiments, the pharmaceutically acceptable salt can be a sodium salt, a potassium salt or an ammonium salt.
[0090] The present invention provides a pharmaceutically acceptable sodium salt of the antisense oligonucleotide according to the present invention or the conjugate according to the present invention.
[0091] The present invention provides a pharmaceutically acceptable potassium salt of the antisense oligonucleotide according to the present invention or the conjugate according to the present invention.
[0092] The present invention provides a pharmaceutically acceptable ammonium salt of the antisense oligonucleotide according to the present invention or the conjugate according to the present invention.
[0093] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide or conjugate of the present invention and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.
[0094] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide or conjugate of the present invention and a pharmaceutically acceptable salt. For example, the salt can contain a metal cation such as a sodium salt, a potassium salt or an ammonium salt.
[0095] The present invention provides a pharmaceutical composition comprising an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a pharmaceutically acceptable salt of the present invention, and an aqueous diluent or solvent.
[0096] The present invention provides a solution such as phosphate buffered saline of an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a pharmaceutically acceptable salt of the present invention. Suitably, the solution such as phosphate buffered saline of the present invention is a sterile solution.
[0097] The present invention provides a method for enhancing the expression of exon 1-exon 2 progranulin splice variants in cells expressing progranulin, the method comprising administering to the cells an effective amount of an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a salt of the present invention, or a pharmaceutical composition of the present invention. In some embodiments, the method is an in vitro method. In some embodiments, the method is an in vivo method.
[0098] In some embodiments, the cell is either a human cell or a mammalian cell.
[0099] The present invention provides a method for treating or preventing progranulin haploinsufficiency or related disorders, the method comprising administering to a subject suffering from or susceptible to progranulin haploinsufficiency or related disorders a therapeutically or prophylactically effective amount of an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a salt of the present invention, or a pharmaceutical composition of the present invention.
[0100] The present invention provides a method for treating or preventing a neurological disease, the method comprising administering to a subject suffering from or susceptible to a neurological disease a therapeutically or prophylactically effective amount of an antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a salt of the present invention, or a pharmaceutical composition of the present invention. In one embodiment, the neurological disease can be a TDP-43 pathology.
[0101] The present invention provides the antisense oligonucleotides of the present invention for use as a medicament.
[0102] The present invention provides the antisense oligonucleotides of the present invention for use in therapy.
[0103] The present invention provides the antisense oligonucleotides of the present invention, or conjugates of the present invention, or salts of the present invention, or pharmaceutical compositions of the present invention for use as a medicament.
[0104] The present invention provides the antisense oligonucleotides of the present invention, or conjugates of the present invention, or salts of the present invention, or pharmaceutical compositions of the present invention for use in therapy.
[0105] The present invention provides the antisense oligonucleotides of the present invention, or conjugates of the present invention, or salts of the present invention, or pharmaceutical compositions of the present invention for use in the treatment of neurological diseases. In one embodiment, the neurological disease can be a TDP-43 pathology.
[0106] The present invention provides the antisense oligonucleotides of the present invention, or conjugates of the present invention, or salts of the present invention, or pharmaceutical compositions of the present invention for use in the treatment or prevention of progranulin haploinsufficiency or related disorders.
[0107] The present invention provides the use of the antisense oligonucleotides of the present invention, or conjugates of the present invention, or salts of the present invention, or pharmaceutical compositions of the present invention for the preparation of a medicament for the treatment or prevention of neurological diseases. In one embodiment, the neurological disease can be a TDP-43 pathology.
[0108] The present invention provides the use of the antisense oligonucleotide of the present invention, or the conjugate of the present invention, or the salt of the present invention, or the pharmaceutical composition of the present invention, for the preparation of a medicament for treating or preventing progranulin haploinsufficiency or related disorders.
[0109] In some embodiments, the method, use, or antisense oligonucleotide for use of the present invention is for the treatment of frontotemporal dementia (FTD), neuropathological frontotemporal lobar degeneration, or neuroinflammation. In other embodiments, the method, use, or antisense oligonucleotide for use of the present invention is for the treatment of amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine disease, spinocerebellar ataxia type 3, myopathy, or chronic traumatic encephalopathy.
[0110] In one aspect, the present invention includes an oligonucleotide progranulin agonist having the following structure:
Chemical formula
[0111] In one aspect, the present invention includes an oligonucleotide progranulin agonist having the following structure:
Chemical formula
[0112] In one aspect, the present invention includes an oligonucleotide progranulin agonist having the following structure:
Chemical formula
[0113] In one aspect, the present invention includes an oligonucleotide progranulin agonist having the following structure:
Chemical formula
[0114] In one aspect, the present invention includes an oligonucleotide progranulin agonist having the following structure: [Chemical formula]
[0115] In one aspect, the present invention includes an oligonucleotide progranulin agonist having the following structure: [Chemical formula]
[0116] In another aspect, the present invention includes an antisense oligonucleotide, wherein the oligonucleotide is the oligonucleotide compound GGTCAAGAATGGTGTGGT (SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 28, SEQ ID NO: 31 or SEQ ID NO: 35), all of the nucleosides are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, C is 5-methylcytosine, and all of the internucleoside linkages are selected from phosphorothioate internucleoside linkages and methanesulfonyl phosphoramidate internucleoside linkages.
[0117] In another aspect, the present invention includes an antisense oligonucleotide, wherein the oligonucleotide is the oligonucleotide compound GGTCAAGAATGGTGTGGT (SEQ ID NO: 2), all of the nucleosides are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, C is 5-methylcytosine, and all of the internucleoside linkages are methanesulfonyl phosphoramidate internucleoside linkages. BRIEF DESCRIPTION OF THE DRAWINGS
[0118]
Figure 1a
Figure 1b
[0119] Definition Oligonucleotide As used herein, the term “oligonucleotide” is defined as generally understood by those skilled in the art as a molecule comprising nucleosides linked by two or more covalent bonds. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers.
[0120] Oligonucleotides are typically made in the laboratory by solid-phase chemical synthesis followed by purification and isolation. When referring to the sequence of an oligonucleotide, reference is made to the sequence or order of the nucleobase portions of the nucleotides or nucleosides linked by covalent bonds, or to modifications thereof.
[0121] The oligonucleotides of the present invention are artificial, chemically synthesized, and typically purified or isolated.
[0122] The oligonucleotides of the present invention may contain one or more modified nucleosides, such as 2'-MOE nucleosides, and may further contain one or more additional or extra modified nucleosides, such as 2'-sugar modified nucleosides.
[0123] The oligonucleotides of the present invention may contain one or more modified nucleoside linkages, such as one or more methanesulfonyl phosphoramidate nucleoside linkages and one or more phosphorothioate nucleoside linkages.
[0124] Antisense oligonucleotide As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of modulating the expression of a target gene by hybridizing to a target nucleic acid, particularly a contiguous sequence on the target nucleic acid.
[0125] Antisense oligonucleotides are not essentially double-stranded and thus are not siRNA or shRNA.
[0126] The antisense oligonucleotides of the present invention may be single-stranded. The single-stranded oligonucleotides of the present invention are understood to be capable of forming hairpin or intermolecular duplex structures (duplexes between two molecules of the same oligonucleotide) as long as the degree of complementarity within or between themselves is less than approximately 50% over the entire length of the oligonucleotide.
[0127] In certain contexts, the antisense oligonucleotides of the present invention may be referred to as oligonucleotides.
[0128] In some embodiments, the single-stranded antisense oligonucleotides of the present invention may not contain RNA nucleosides.
[0129] Advantageously, the antisense oligonucleotides of the present invention comprise one or more modified nucleosides or nucleotides, such as 2'-sugar modified nucleosides. Further, in some of the antisense oligonucleotides of the present invention, it may be advantageous for the unmodified nucleosides to be DNA nucleosides.
[0130] Continuous nucleotide sequence The term "continuous nucleotide sequence" refers to a region of an oligonucleotide that is complementary to a target nucleic acid and that can be an oligonucleotide motif sequence or can include an oligonucleotide motif sequence. This term is used interchangeably herein with the term "continuous nucleic acid base sequence".
[0131] In some embodiments, all of the nucleosides of the oligonucleotide constitute a continuous nucleotide sequence. The continuous nucleotide sequence is the sequence of nucleotides in an oligonucleotide of the present invention that is complementary, and in some cases completely complementary, to a target nucleic acid or target sequence, or target site sequence. The terms "target nucleic acid", "target sequence" and "target site sequence" can be used interchangeably to refer to the sequence to which the continuous nucleotide sequence binds.
[0132] In some embodiments, the target sequence is SEQ ID NO: 1.
[0133] SEQ ID NO: 1 is the sequence of exon 1, intron 1 and exon 2 of the human progranulin pre-mRNA transcript.
[0134] In some embodiments, the target sequence is nucleotides 449-466 of SEQ ID NO: 1 or includes the same.
[0135] In some embodiments, the target sequence is SEQ ID NO: 39 or includes the same.
[0136] In some embodiments, the target sequence is SEQ ID NO: 39.
[0137] In some embodiments, the target sequence includes SEQ ID NO: 39.
[0138] In some embodiments, the oligonucleotide includes a contiguous nucleotide sequence and may optionally include a nucleotide linker region that can be used to attach additional nucleotides, such as functional groups (e.g., conjugate groups), to the contiguous nucleotide sequence.
[0139] The nucleotide linker region may or may not be complementary to the target nucleic acid. It is understood that the contiguous nucleotide sequence of the oligonucleotide cannot be longer than the oligonucleotide itself and the oligonucleotide cannot be shorter than the contiguous nucleotide sequence.
[0140] Splice regulatory site As used herein, the term "splice regulatory site" is defined as a site within a pre-mRNA transcript that affects the splicing of the pre-mRNA.
[0141] In some embodiments, the splice regulatory site can regulate the splicing of one or more of exon 1, intron 1, and exon 2 of the human progranulin pre-mRNA transcript.
[0142] Nucleotides and nucleosides Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides and, for the purposes of the present invention, include both naturally occurring nucleotides and nucleosides as well as non-naturally occurring nucleotides and nucleosides. By nature, nucleotides such as DNA nucleotides and RNA nucleotides include a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers".
[0143] Modified nucleotides As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside modified by the introduction of one or more modifications to the sugar moiety or the (nucleic acid) base moiety, as compared to the equivalent DNA or RNA nucleoside.
[0144] The antisense oligonucleotides of the present invention may comprise a contiguous nucleotide sequence comprising one or more 2'-MOE nucleosides.
[0145] The antisense oligonucleotides of the present invention may comprise a contiguous nucleotide sequence comprising one or more further or additionally modified nucleosides comprising a modified sugar moiety.
[0146] The term modified nucleoside may also be used interchangeably herein with the terms "nucleoside analog", or modified "unit", or modified "monomer". Nucleosides having an unmodified DNA or RNA sugar moiety are referred to herein as DNA or RNA nucleosides.
[0147] Nucleosides having a modification in the base region of a DNA or RNA nucleoside are still generally referred to as DNA or RNA if they are capable of Watson-Crick base pairing.
[0148] Exemplary modified nucleosides that may be used in the compounds of the present invention include LNA, 2'-O-MOE and morpholino nucleoside analogs.
[0149] Methanesulfonyl phosphoramidate internucleotide linkages The contiguous nucleotide sequence of the antisense oligonucleotides of the present invention comprises one or more modified nucleoside internucleotide linkages that are methanesulfonyl phosphoramidate internucleotide linkages.
[0150] The methanesulfonyl phosphoramidate internucleoside linkage is such that one of the non-bridging oxygen atoms in the phosphodiester linkage is replaced by a methanesulfonamide group, and this linkage differs from other phosphoramidate and alkylphosphonate linkages in that it retains a negative charge on the phosphate backbone but lacks the negatively charged sulfur atom that is a major pharmacophore for ASO-protein interactions.
[0151] The methanesulfonyl phosphoramidate internucleoside linkage may be referred to in the literature as mesyl phosphoramidate, methanesulfonyl phosphoramidate, or N-methanesulfonyl phosphoramidate, where mesyl is short for methanesulfonyl and "N" designates the position of the methanesulfonyl on nitrogen. In this specification, these terms may be used interchangeably.
[0152] In some embodiments, at least 50% of the internucleoside linkages in the antisense oligonucleotide or its contiguous nucleotide sequence are methanesulfonyl, for example, at least 60%, for example at least 70%, for example at least 75%, for example at least 80%, for example at least 90%, for example at least 95%, or more thereof are methanesulfonyl.
[0153] In some embodiments, the contiguous nucleotide sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or more methanesulfonyl phosphoramidate internucleoside linkages.
[0154] In some embodiments, the contiguous nucleotide sequence comprises one or more methanesulfonyl phosphoramidate internucleoside linkages.
[0155] In some embodiments, the contiguous nucleotide sequence comprises two or more methanesulfonyl phosphoramidate internucleoside linkages.
[0156] In some embodiments, the continuous nucleotide sequence comprises linkages between three or more methanesulfonyl phosphoramidate nucleotides.
[0157] In some embodiments, the continuous nucleotide sequence comprises linkages between four or more methanesulfonyl phosphoramidate nucleotides.
[0158] In some embodiments, the continuous nucleotide sequence comprises linkages between five or more methanesulfonyl phosphoramidate nucleotides.
[0159] In some embodiments, the continuous nucleotide sequence comprises linkages between six or more methanesulfonyl phosphoramidate nucleotides.
[0160] In some embodiments, the continuous nucleotide sequence comprises linkages between seven or more methanesulfonyl phosphoramidate nucleotides.
[0161] In some embodiments, the continuous nucleotide sequence comprises linkages between eight or more methanesulfonyl phosphoramidate nucleotides.
[0162] In some embodiments, the continuous nucleotide sequence comprises linkages between nine or more methanesulfonyl phosphoramidate nucleotides.
[0163] In some embodiments, the continuous nucleotide sequence comprises linkages between ten or more methanesulfonyl phosphoramidate nucleotides.
[0164] In some embodiments, the continuous nucleotide sequence comprises linkages between eleven or more methanesulfonyl phosphoramidate nucleotides.
[0165] In some embodiments, the continuous nucleotide sequence comprises linkages between twelve or more methanesulfonyl phosphoramidate nucleotides.
[0166] In some embodiments, the continuous nucleotide sequence comprises 13 or more methanesulfonyl phosphoramidate nucleotide internucleotide linkages.
[0167] In some embodiments, the continuous nucleotide sequence comprises 14 or more methanesulfonyl phosphoramidate nucleotide internucleotide linkages.
[0168] In some embodiments, the continuous nucleotide sequence comprises 15 or more methanesulfonyl phosphoramidate nucleotide internucleotide linkages.
[0169] In some embodiments, the continuous nucleotide sequence comprises 16 or more methanesulfonyl phosphoramidate nucleotide internucleotide linkages.
[0170] In some embodiments, the continuous nucleotide sequence comprises 17 or more methanesulfonyl phosphoramidate nucleotide internucleotide linkages.
[0171] Advantageously, all internucleotide linkages of the continuous nucleotide sequence of the antisense oligonucleotide may be methanesulfonyl, or all internucleotide linkages of the antisense oligonucleotide may be methanesulfonyl linkages.
[0172] Modified internucleotide linkages The continuous nucleotide sequence of the antisense oligonucleotide of the present invention may comprise one or more modified internucleotide linkages. Since the continuous nucleotide sequence of the antisense oligonucleotide of the present invention must comprise one or more methanesulfonyl phosphoramidate nucleotide internucleotide linkages, it will be apparent to those skilled in the art that alternatively modified internucleotide linkages are further modified internucleotide linkages.
[0173] The term "modified internucleotide linkage" is defined as a linkage other than a phosphodiester (PO) linkage that covalently connects two nucleotides to each other, as is generally understood by those skilled in the art.
[0174] In some embodiments, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100% of the internucleotide linkages of a continuous nucleotide sequence are modified.
[0175] In some embodiments, all of the internucleotide linkages located between nucleotides of a continuous nucleotide sequence are modified.
[0176] In some embodiments, a continuous nucleotide sequence comprises phosphorothioate internucleotide linkages of one or more embodiments.
[0177] In some embodiments, a continuous nucleotide sequence comprises multiple phosphorothioate internucleotide linkages, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages.
[0178] In some embodiments, all of the internucleotide linkages present within an antisense oligonucleotide are selected from phosphorothioate internucleotide linkages and methanesulfonyl phosphoramidate internucleotide linkages.
[0179] Nucleobase The term "nucleobase" includes the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term "nucleobase" includes modified nucleobases that may differ from naturally occurring nucleobases but are functional in nucleic acid hybridization. In this context, "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research vol. 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.
[0180] In some embodiments, the nucleobase moiety is modified by changing it to a nucleobase selected from a modified purine or pyrimidine, e.g., a substituted purine or substituted pyrimidine, e.g., isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.
[0181] The nucleobase moiety may be indicated by a letter code for each corresponding nucleobase, e.g., A, T, G, C, or U, and each letter may optionally include a modified nucleobase of equivalent function. For example, in the exemplified oligonucleotide, the nucleobase moiety is selected from A, T, G, C, and 5-methylcytosine. Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides may be used.
[0182] Modified oligonucleotide The antisense oligonucleotides of the present invention can be modified oligonucleotides.
[0183] The term "modified oligonucleotide" describes an oligonucleotide that contains one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term "chimeric oligonucleotide" is a term used in the literature to describe an oligonucleotide that contains sugar-modified nucleosides and DNA nucleosides. In some embodiments, it may be advantageous for the antisense oligonucleotides of the present invention to be chimeric oligonucleotides.
[0184] Complementarity The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U).
[0185] Oligonucleotides may contain nucleosides with modified nucleobases. For example, 5-methylcytosine is often used in place of cytosine. Thus, it will be understood that the term complementarity encompasses Watson-Crick base pairing between unmodified and modified nucleobases (see, for example, Hirao et al. (2012) Accounts of Chemical Research vol. 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).
[0186] As used herein, the term "percent complementary" refers to the percentage of nucleotides in a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that is complementary to a reference sequence (e.g., a target sequence or sequence motif) over a contiguous nucleotide sequence. Thus, the percentage of complementarity is calculated by counting the number of aligned nucleic acid bases that are complementary (from Watson-Crick base pairs) between the two sequences (when the oligonucleotide sequence from the target sequence 5'-3' and 3'-5' are aligned), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, nucleic acid bases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not tolerated in the calculation of percent complementarity of a contiguous nucleotide sequence. It will be understood that chemical modifications of nucleic acid bases are ignored when determining complementarity so long as the functional ability of the nucleic acid base to form Watson-Crick base pairs is retained (e.g., 5-methylcytosine is considered identical to cytosine for the purposes of calculating percent identity).
[0187] Within the present invention, the term "complementary" requires that the antisense oligonucleotide be at least about 80% complementary, or at least about 90% complementary, to the human progranulin pre-mRNA transcript. In some embodiments, the antisense oligonucleotide can be at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% complementary to the human progranulin pre-mRNA transcript. In other words, in some embodiments, the antisense oligonucleotides of the present invention may contain one, two, three or more mismatches, which are nucleotides within the antisense oligonucleotides of the present invention that do not base pair with their target.
[0188] The term "fully complementary" refers to 100% complementarity.
[0189] The antisense oligonucleotides of the present invention are complementary to human progranulin pre-mRNA. The antisense oligonucleotides of the present invention are preferably complementary to the intron 1 sequence of the human progranulin pre-mRNA transcript. The sequences of exon 1, intron 1 and exon 2 of the human progranulin pre-mRNA transcript are exemplified herein as SEQ ID NO: 1. SEQ ID NO: 1 is provided herein as a reference sequence, and it will be understood that the target progranulin nucleic acid can be an allelic variant of SEQ ID NO: 1, for example an allelic variant that contains one or more polymorphisms in the human progranulin nucleic acid sequence.
[0190] Identity As used herein, the term "identity" refers to the percentage (expressed as a percent) of nucleotides in a contiguous nucleotide sequence within a nucleic acid molecule (e.g., an oligonucleotide) that are identical to a reference sequence (e.g., an array motif) over the contiguous nucleotide sequence.
[0191] Thus, the percentage of identity is calculated by counting the number of identical (matching) aligned nucleic acid bases between the two sequences (in the contiguous nucleotide sequence of the compound of the invention and in the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Thus, percent identity = (number of matches × 100) / length of the alignment region (e.g., contiguous nucleotide sequence). Insertions and deletions are not tolerated in the calculation of the percentage of identity of contiguous nucleotide sequences. It will be understood that chemical modifications of nucleic acid bases are ignored when determining identity as long as the functional ability of the nucleic acid base to form Watson-Crick base pairs is retained (e.g., 5-methylcytosine is considered identical to cytosine for purposes of calculating % identity).
[0192] Hybridization The term "hybridize" or "hybridizing", as used herein, should be understood to mean that two nucleic acid strands (e.g., an antisense oligonucleotide and a target nucleic acid) form a duplex by forming hydrogen bonds between base pairs on opposing strands. The affinity of the bond between two nucleic acid strands is the strength of hybridization. This is often explained in terms of the melting temperature (Tm), which is defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. Under physiological conditions, Tm is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔG° more accurately represents the binding affinity and is related to the dissociation constant (Kd) of the reaction by ΔG° = -RTln(Kd), where R is the gas constant and T is the absolute temperature. Thus, a very low ΔG° for the reaction between an oligonucleotide and a target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction at an aqueous solution concentration of 1 M, a pH of 7, and a temperature of 37°C. Hybridization of an oligonucleotide to a target nucleic acid is a spontaneous reaction, and for a spontaneous reaction, ΔG° is less than zero. ΔG° can be measured experimentally, for example, by using the isothermal titration calorimetry (ITC) method described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov. Today. Those skilled in the art will know that commercially available devices are available for ΔG° measurement. ΔG° can also be estimated numerically by using the nearest neighbor model described in SantaLucia, 1998, Proc. Natl. Acad. Sci. USA. 95:1460-1465, using appropriately obtained thermodynamic parameters as described in Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405.
[0193] In some embodiments, the antisense oligonucleotides of the invention hybridize to a target nucleic acid with an estimated ΔG° value of less than -10 kcal relative to an oligonucleotide 10-30 nucleotides in length.
[0194] In some embodiments, the degree or strength of hybridization is measured by the Gibbs free energy ΔG° in the standard state. The oligonucleotide can hybridize to a target nucleic acid with an estimated ΔG° value of less than the range of -10 kcal, for example less than -15 kcal, for example less than -20 kcal, and for example less than -25 kcal, relative to an oligonucleotide 8-30 nucleotides in length. In some embodiments, the oligonucleotide hybridizes to a target nucleic acid with an estimated ΔG° value of -10 to -60 kcal, for example -12 to -40, for example -15 to -30 kcal, or -16 to -27 kcal, for example -18 to -25 kcal.
[0195] High-affinity modified nucleoside A high-affinity modified nucleoside is a modified nucleotide that, when incorporated into an oligonucleotide, enhances the affinity of the oligonucleotide for its complementary target, as measured, for example, by the melting temperature (Tm). The high-affinity modified nucleosides of the invention preferably result in an increase in melting temperature of +0.5 to +12 °C, more preferably +1.5 to +10 °C, and most preferably +3 to +8 °C per modified nucleoside. Many high-affinity modified nucleosides are known in the art and include, for example, many 2'-substituted nucleosides and locked nucleic acids (LNA) (see, for example, Freier & Altmann, 1997, Nucl. Acid Res., 25, 4429-4443 and Uhlmann, 2000, Curr. Opinion in Drug Development, 3(2), 293-213).
[0196] Sugar modification A number of nucleosides with modifications of the ribose moiety have been prepared mainly for the purpose of improving certain properties of oligonucleotides such as affinity and / or nuclease resistance.
[0197] Such modifications include, for example, hexose rings (HNA), or typically bicyclic rings (LNA) having a biradicle bridge between the C2 and C4 carbons on the ribose ring, or typically unlinked ribose rings lacking a bond between the C2 and C3 carbons (e.g., UNA) that replace the ribose ring structure. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (International Publication No. WO 2011 / 017521) or tricyclic nucleic acids (International Publication No. WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is replaced by a non-sugar moiety, as in the case of, for example, peptide nucleic acids (PNA) or morpholino nucleic acids.
[0198] Sugar modifications also include modifications made by changing a substituent on the ribose ring to a group other than hydrogen or the 2'-OH group naturally found in DNA and RNA nucleosides. The substituent can be introduced, for example, at the 2', 3', 4', or 5' position.
[0199] 2'-Sugar-modified nucleosides 2'-Sugar-modified nucleosides are nucleosides having a substituent other than H or -OH at the 2' position (2'-substituted nucleosides), or nucleosides containing a 2'-linked biradical capable of forming a bridge between the 2' carbon of the ribose ring and a second carbon, such as LNA (2'-4' biradical bridge) nucleosides.
[0200] In fact, the development of 2'-sugar-substituted nucleosides has received much attention, and a number of 2'-substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars can confer enhanced binding affinity and / or increased nuclease resistance to oligonucleotides.
[0201] Examples of 2'-substituted modified nucleosides are 2'-O-alkyl-RNA nucleosides, 2'-O-methyl-RNA nucleosides, 2'-alkoxy-RNA nucleosides, 2'-O-methoxyethyl-RNA (MOE) nucleosides, 2'-amino-DNA nucleosides, 2'-fluoro-RNA nucleosides and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann, 1997, Nucl. Acid Res., 25, 4429-4443 and Uhlmann, 2000, Curr. Opinion in Drug Development, 3(2), 293-213, and Deleavey and Damha, 2012, Chemistry and Biology, 19, 937. The following are illustrations of some 2'-substituted modified nucleosides.
Chemical formula
[0202] With respect to the present invention, 2'-substituted sugar-modified nucleosides do not include 2'-bridged nucleosides such as LNA.
[0203] Locked nucleic acid nucleoside (LNA nucleoside) An "LNA nucleoside" is a 2'-modified nucleoside that contains a radical (also called a "2'-4' bridge") that links C2' and C4' of the ribose sugar ring of the nucleoside, which restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). The locking of the ribose conformation is associated with an enhancement of the hybridization affinity (stabilization of the double strand) when LNA is incorporated into oligonucleotides of complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary double strand.
[0204] Non-limiting, exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al., 2010, J. Org. Chem., Vol 75(5) pp. 1569-81, and Mitsuoka et al., 2009, Nucleic Acids Research, 37(4), 1225-1238, and Wan and Seth, 2016, J. Medical Chemistry, 59, 9645-9667.
[0205] Additional non-limiting, exemplary LNA nucleosides are disclosed in Scheme 1. Scheme 1:
Chemical formula
[0206] Certain LNA nucleosides are beta-D-oxy-LNA, 6'-methyl-beta-D-oxy LNA, such as (S)-6'-methyl-beta-D-oxy-LNA (ScET) and ENA.
[0207] Particularly advantageous LNA is beta-D-oxy-LNA.
[0208] Morpholino oligonucleotides In some embodiments, the antisense oligonucleotides of the invention comprise or consist of morpholino nucleosides (i.e., are morpholino oligomers, such as phosphorodiamidate morpholino oligomers (PMOs)). Splice-modulating morpholino oligonucleotides are approved for clinical use, see, e.g., eteplirsen, a 30 nt morpholino oligonucleotide that targets a frameshift mutation in DMD and is used in the treatment of Duchenne muscular dystrophy. Morpholino oligonucleotides have nucleobases attached to a six-membered morpholine ring rather than ribose, such as a methylene morpholine ring linked via a phosphorodiamidate group, as shown, for example, in the description of the following four consecutive morpholino nucleotides.
Chemical formula
[0209] In some embodiments, the morpholino oligonucleotides of the invention can be, for example, 20 to 40 morpholino nucleotides in length, such as 25 to 35 morpholino nucleotides in length.
[0210] Activity and recruitment of RNase H The RNase H activity of an antisense oligonucleotide refers to the ability to recruit RNase H when it is within a duplex with a complementary RNA molecule. WO 01 / 23613 provides in vitro methods for determining RNase H activity that can be used to determine the ability to recruit RNase H. Typically, an oligonucleotide having the same base sequence as the modified oligonucleotide being tested when a complementary target nucleic acid sequence is provided, but containing only DNA monomers having phosphorothioate linkages between all monomers in the oligonucleotide, is used, and when the methodology provided by Examples 91 - 95 of WO 01 / 23613 (incorporated herein by reference) is used, if it has an initial rate measured at at least 5%, for example at least 10%, at least 20% or more than 20% of the initial rate determined, this oligonucleotide is considered to be able to recruit RNase H. Recombinant RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland for use in determining RHase H activity.
[0211] DNA oligonucleotides, like gapmer oligonucleotides containing a region of DNA nucleosides (typically at least 5 or 6 contiguous DNA nucleosides) flanked 5' and 3' by regions containing 2'-sugar modified nucleosides, typically high affinity 2'-sugar modified nucleosides such as 2-O-MOE and / or LNA, are known to effectively recruit RNaseH. For effective regulation of splicing, degradation of pre-mRNA is undesirable and thus it is preferred to avoid degradation by the target RNaseH. Thus, the antisense oligonucleotides of the present invention are not RNaseH recruiting gapmer oligonucleotides.
[0212] Recruitment of RNaseH can be avoided by limiting the number of contiguous DNA nucleotides within the oligonucleotide, so a totalmer design can be used.
[0213] Mixmers and Totalmers For splice modulation, it is often advantageous to use antisense oligonucleotides that do not recruit RNAaseH. Since RNaseH activity requires a continuous sequence of DNA nucleotides, the RNaseH activity of an antisense oligonucleotide can be achieved by designing antisense oligonucleotides that do not contain regions of more than 3 or more than 4 contiguous DNA nucleosides. This can be achieved by using antisense oligonucleotides or contiguous nucleoside regions thereof having a mixmer design that includes sugar-modified nucleosides such as 2'-sugar-modified nucleosides and short regions of DNA nucleosides such as 1, 2, or 3 DNA nucleosides. Mixmers are exemplified herein by every-other design, such as LDLDLDLDLDLDLDLL, in which the nucleosides alternate one LNA nucleoside and one DNA nucleoside and have LNA nucleosides at the 5' and 3' termini, and every-third design, such as LDDLDDLDDLDDLDDL, in which the nucleosides are LNA nucleosides every third.
[0214] A totalmer is an antisense oligonucleotide or contiguous nucleotide sequence that does not contain DNA or RNA nucleosides and may contain, for example, a fully modified MOE phosphorothioate, such as MMMMMMMMMMMMMMMMMMMMM (M = 2'-O-MOE), which has been reported to be an effective splice modulating factor for therapeutic use, containing only 2'-O-MOE nucleosides.
[0215] Alternatively, the mixmer may comprise a mixture of modified nucleosides such as MLMLMLMLMLMLMLMLMLML, where L = LNA and M = 2'-O-MOE nucleoside. Advantageously, the internucleosides in the mixmer and totalmer may comprise one or more phosphorothioate internucleotide linkages and one or more methanesulfonyl phosphoramidate internucleotide linkages, or most of the nucleoside linkages in the mixmer may be phosphorothioate internucleotide linkages and methanesulfonyl phosphorothioate internucleotide linkages. The mixmer and totalmer may, by way of example, comprise other internucleotide linkages such as phosphodiester or phosphorodithioate.
[0216] Region D' or D'' within the oligonucleotide In some embodiments, the antisense oligonucleotides of the invention can comprise, or consist of, a contiguous nucleotide sequence of an oligonucleotide that is complementary to a target nucleic acid, such as a totalmer region, as well as additional 5' and / or 3' nucleosides. The additional 5' and / or 3' nucleosides may or may not be complementary, such as fully complementary, to the target nucleic acid. Such additional 5' and / or 3' nucleosides may be referred to herein as regions D' and D''.
[0217] The addition of region D' or D'' can be used for the purpose of connecting a contiguous nucleotide sequence, such as a totalmer, to a conjugate moiety or another functional group. When used to conjugate a contiguous nucleotide sequence to a conjugate moiety, it can act as a biodegradable linker. Alternatively, it may be used to provide exonuclease protection or to facilitate synthesis or manufacture.
[0218] Region D’ or D’’ may independently comprise or consist of 1, 2, 3, 4 or 5 additional nucleotides and may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F’ region are not sugar-modified nucleotides such as DNA or RNA, nor are they the base-modified versions thereof. The D’ or D’’ region can serve as a nuclease-sensitive, biocleavable linker (see definition of linker). In some embodiments, the additional 5’ and / or 3’ terminal nucleotides are linked by phosphodiester linkages and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D’ or D’’ are disclosed in WO 2014 / 076195, which includes as an example phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in polynucleotide constructs is disclosed in WO 2015 / 113922, where they are used to link multiple antisense constructs within a single oligonucleotide.
[0219] In one embodiment, the antisense oligonucleotide of the invention comprises regions D’ and / or D’’ in addition to the contiguous nucleotide sequence that makes up the totalmer.
[0220] In some embodiments, the internucleoside linkage located between the D’ or D’’ region and the totalmer region is a phosphodiester linkage.
[0221] Conjugate The invention encompasses an antisense oligonucleotide covalently attached to at least one conjugate moiety. In some embodiments, this may be referred to as the conjugate of the invention.
[0222] As used herein, the term "conjugate" refers to an antisense oligonucleotide covalently linked to a non-nucleotide moiety (conjugate moiety or Region C or third region). The conjugate moiety may be covalently linked to the antisense oligonucleotide optionally via a linker group such as Region D' or D''.
[0223] Oligonucleotide conjugates and their synthesis are also reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S. T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, 2002, Antisense and Nucleic Acid Drug Development, 12, 103.
[0224] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a carbohydrate (e.g., GalNAc), a cell surface receptor ligand, a prodrug, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.
[0225] Linker A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. The conjugate moiety may be attached to the antisense oligonucleotide either directly or via a linking moiety (e.g., a linker or tether). The linker serves to covalently join a third region, e.g., the conjugate moiety (Region C), to a first region, e.g., an oligonucleotide or contiguous nucleotide sequence (Region A) complementary to the target nucleic acid.
[0226] In some embodiments of the present invention, the conjugate or antisense oligonucleotide conjugate of the present invention optionally includes a linker region (second region or region B and / or region Y) located between an oligonucleotide or contiguous nucleotide sequence (region A or first region) complementary to the target nucleic acid and a conjugate moiety (region C or third region).
[0227] Region B refers to a biodegradable linker that includes or consists of a physiologically labile bond that is cleavable under conditions normally encountered or similar to those encountered in the mammalian body. Conditions under which a physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidation or reduction conditions or agents, and salt concentration, similar to those found or encountered in mammalian cells. Intracellular conditions in mammalian cells also include the presence of enzymatic activities normally present in mammalian cells, such as proteolytic enzymes, hydrolytic enzymes or nucleases. In one embodiment, the biodegradable linker is susceptible to S1 nuclease cleavage. In some embodiments, the nuclease-sensitive linker includes 1 to 5 nucleosides, such as DNA nucleosides, including at least two contiguous phosphodiester linkages. Biodegradable linkers containing phosphodiesters are described in more detail in WO 2014 / 076195.
[0228] Region Y does not necessarily have to be biocleavable, but mainly refers to a linker that serves to covalently connect a conjugate part (region C or the third region) to an oligonucleotide (region A or the first region). The linker in region Y may include a chain structure or oligomer of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups. The oligonucleotide conjugate of the present invention can be constructed from the following region elements A-C, A-B-C, A-B-Y-C, A-Y-B-C, or A-Y-C. In some embodiments, the linker (region Y) is an aminoalkyl, such as a C2-C36 aminoalkyl group including, for example, a C6-C12 aminoalkyl group. In some embodiments, the linker (region Y) is a C6 aminoalkyl group.
[0229] Treatment As used herein, the term "treatment" refers to both the treatment of an existing disease (e.g., a disease or disorder mentioned herein) and the prevention of a disease, i.e., prophylaxis. Thus, it will be appreciated that the treatment referred to herein can, in some embodiments, be prophylactic.
[0230] TDP-43 pathology TDP-43 pathology is a disease associated with a decrease or abnormality in the expression of TDP-43, and is often associated with an increase in cytoplasmic TDP-43, particularly hyperphosphorylated and ubiquitinated TDP-43.
[0231] Diseases associated with TDP-43 pathology include amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), Alzheimer's disease, Parkinson's disease, autism, hippocampal sclerosis dementia, Down syndrome, Huntington's disease, polyglutamine disease, such as spinocerebellar ataxia type 3, myopathy, and chronic traumatic encephalopathy.
Modes for Carrying Out the Invention
[0232] By targeting progranulin pre-mRNA transcripts with antisense oligonucleotides, the inventors have identified that it is possible to increase the expression of progranulin exon 1-exon 2 splice mRNA, decrease the expression of progranulin intron 1-exon 2 splice mRNA (retaining the 271 nucleotide 5’ fragment of intron 1), and / or alter the ratio of exon 1-exon 2 mRNA to intron 1-exon 2 mRNA. This is particularly true when antisense oligonucleotides containing one or more methanesulfonyl phosphoramidate nucleotide linkages are used.
[0233] Described herein are target sites that exist on human progranulin pre-mRNA that can be targeted by antisense oligonucleotides. Also described are antisense oligonucleotides that are complementary, e.g., fully complementary, to these target sites.
[0234] Without wishing to be bound by theory, it is believed that the antisense oligonucleotides of the present invention can bind to these regions and affect, e.g., increase, the production of exon 1-exon 2 splice variants, thereby increasing the expression of progranulin exon 1-exon 2 splice mRNA, decreasing the expression of progranulin intron 1-exon 1 splice mRNA, and / or altering the ratio of exon 1-exon 2 mRNA to intron 1-exon 2 mRNA.
[0235] Oligonucleotides, e.g., single-stranded antisense oligonucleotides or siRNAs that recruit RNaseH, are widely used in the art to inhibit target RNAs, i.e., used as antagonists of their complementary nucleic acid targets.
[0236] The antisense oligonucleotides of the present invention can be described as regulators, i.e., they alter the expression of their complementary targets, specific splice variants of progranulin pre-mRNA, thereby increasing the production of active progranulin protein.
[0237] A decrease in the expression of the progranulin intron 1-exon 2 splice variant is desirable because the inclusion of an intron within the mature mRNA sequence, such as intron 1, results in nonsense-mediated mRNA decay (NMD).
[0238] Enhancement of the expression of progranulin exon 1-exon 2 relative to splice variants retaining the 5' portion of intron 1 is desirable because the exon 1-exon 2 splice variant does not contain a 271 nucleotide fragment of intron 1 that has two AUG sites upstream of the canonical downstream AUG (open reading frame) in exon 2. Translation from these two upstream AUG sites does not encode the progranulin protein, and transcripts may undergo nonsense-mediated mRNA decay (NMD) due to premature stop codons. A change in splicing to the exon 1-exon 2 splice variant instead results in translation of the active version of the progranulin protein. Progranulin is a neuroprotective protein, and an increase in its production can be used to treat a wide range of neuropathies, such as the TDP-43 pathology.
[0239] In certain embodiments, the antisense oligonucleotides of the present invention can enhance the production of the exon 1-exon 2 progranulin splice variant.
[0240] In certain embodiments, the antisense oligonucleotides of the invention can enhance the production of exon 1-exon 2 progranulin splice variant mRNA by at least about 10% compared to the production of exon 1-exon 2 progranulin splice variant mRNA in the absence of the antisense oligonucleotides of the invention. In other embodiments, the antisense oligonucleotides of the invention can enhance the production of exon 1-exon 2 progranulin splice variant mRNA by at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500% or more compared to the production of exon 1-exon 2 progranulin splice variant mRNA in the absence of the antisense oligonucleotides of the invention.
[0241] In certain embodiments, the antisense oligonucleotides of the invention can reduce the production of intron 1-exon 2 progranulin splice variant mRNA.
[0242] In certain embodiments, the antisense oligonucleotides of the invention can reduce the production of intron 1-exon 2 progranulin splice variant mRNA by at least about 10% compared to the production of intron 1-exon 2 progranulin splice variant mRNA in the absence of the antisense oligonucleotides of the invention. In other embodiments, the antisense oligonucleotides of the invention can reduce the production of intron 1-exon 2 progranulin splice variant mRNA by at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500% or more compared to the production of intron 1-exon 2 progranulin splice variant mRNA in the absence of the antisense oligonucleotides of the invention.
[0243] Enhanced expression of the progranulin exon 1-exon 2 splice variant should result in translation of the active version of the progranulin protein. In certain embodiments, the antisense oligonucleotides of the invention can increase the production of progranulin protein by at least about 10% compared to the production of progranulin protein in the absence of the antisense oligonucleotides of the invention. In other embodiments, the antisense oligonucleotides of the invention can increase the production of progranulin protein by at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500% or more compared to the production of progranulin protein in the absence of the antisense oligonucleotides of the invention.
[0244] In certain embodiments, the antisense oligonucleotides of the invention can alter the ratio of exon 1-exon 2 progulin mRNA to intron-exon 2 progulin mRNA.
[0245] In certain embodiments, the antisense oligonucleotides of the invention can alter the ratio of exon 1-exon 2 progulin mRNA to intron 1-exon 2 progulin mRNA by at least about 10% compared to the ratio of exon 1-exon 2 progulin mRNA to intron 1-exon 2 progulin mRNA in the absence of the antisense oligonucleotides of the invention. In other embodiments, the antisense oligonucleotides of the invention can alter the ratio of exon 1-exon 2 progulin mRNA to intron 1-exon 2 progulin mRNA by at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100% or more compared to the ratio of exon 1-exon 2 progulin mRNA to intron 1-exon 2 progulin mRNA in the absence of the antisense oligonucleotides of the invention.
[0246] In certain embodiments, the antisense oligonucleotides of the invention can change the ratio of exon 1-exon 2 progranulin mRNA to intron 1-exon 2 progranulin mRNA to at least about 1.2. In certain embodiments, the antisense oligonucleotides of the invention can change the ratio of exon 1-exon 2 progranulin mRNA to intron 1-exon 2 progranulin mRNA to at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.7, at least about 1.8, at least about 1.9, at least about 2.0 or greater.
[0247] In some embodiments, the antisense oligonucleotide of the invention or a contiguous nucleotide sequence thereof comprises, or consists of, a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 contiguous nucleotides.
[0248] In some embodiments, the entire nucleotide sequence of the antisense oligonucleotide is a contiguous nucleotide sequence.
[0249] In one embodiment, the contiguous nucleotide sequence can be a sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37. The invention also contemplates fragments of these contiguous nucleotide sequences that comprise at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14 or at least 15 contiguous nucleotides thereof.
[0250] In some embodiments, the antisense oligonucleotide or continuous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37.
[0251] It will be understood that the sequences shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37 may contain modified nucleobases that function as the nucleobases shown in base pairing, for example, 5-methylcytosine may be used instead of methylcytosine. Inosine can be used as a universal base.
[0252] In some embodiments, the antisense oligonucleotide or continuous nucleotide sequence comprises or consists of an 8-30 or 8-40 nucleotide length having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37.
[0253] In some embodiments, the antisense oligonucleotide can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length.
[0254] It is understood that the continuous nucleic acid base sequence (motif sequence) can be modified, for example, to increase nuclease resistance and / or binding affinity for the target nucleic acid.
[0255] The pattern in which modified nucleosides (such as high-affinity modified nucleosides) are incorporated into the oligonucleotide sequence is generally referred to as oligonucleotide design.
[0256] The antisense oligonucleotides of the present invention are designed using modified nucleosides and DNA nucleosides. Advantageously, high-affinity modified nucleosides are used.
[0257] In one embodiment, the antisense oligonucleotide comprises at least one modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleosides.
[0258] In one embodiment, the antisense oligonucleotide comprises 1 to 10 modified nucleosides, such as 2 to 9 modified nucleosides, such as 3 to 8 modified nucleosides, such as 4 to 7 modified nucleosides, such as 6 or 7 modified nucleosides. Suitable modifications are described in the "Definitions" section of "Modified Nucleosides", "High-Affinity Modified Nucleosides", "Sugar Modifications", "2'-Sugar Modifications", and "Locked Nucleic Acids (LNAs)".
[0259] In certain embodiments, the antisense oligonucleotide comprises one or more sugar-modified nucleosides, such as 2'-sugar-modified nucleosides. Preferably, the antisense oligonucleotides of the invention comprise one or more 2'-sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides. It is advantageous if one or more of the modified nucleoside(s) is a locked nucleic acid (LNA).
Example
[0260] Example 1 hiPSC-derived microglia (iCell Microglia Kit, 01279, catalog number R1131) were seeded at 20,000 cells / well in 200 μL in 96-well plates (Greiner catalog # 655946) coated with poly-D-lysine (n = 1) and treated with the indicated concentrations of SEQ ID NOs: 2-38 at 3 μM and 10 μM for 5 days.
[0261] 125 μL of RLT buffer (Qiagen) was added and RNA was extracted using Qiagen's RNeasy 97 kit and protocol. cDNA synthesis was performed using 4 μL of input RNA with the iScript Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad), and 2 μL of RNA was used as input for digital droplet PCR using the ddPCR Supermix for probes (without dUTP) (Bio-Rad) according to the manufacturer's protocol. The following primers and probes (IDT) were used: GRN exon 1-exon 2 (FAM): Primer 1: GCTGCTGCCCAAGGACCGCGGA (SEQ ID NO: 40) Primer 2: GCCCTGCTGTTAAGGCCACCCA (SEQ ID NO: 41) Probe / 56-FAM / GGACGCAGG / ZEN / CAGACCATGTGGACCCTG / 3IABkFQ / (SEQ ID NO: 42) GRN intron 1-exon 2 (HEX): Primer 1: CCAAAGCAGGGACCACACCATTCTT (SEQ ID NO: 43) Primer 2: GCCCTGCTGTTAAGGCCACCCA (SEQ ID NO: 44) Probe / 5HEX / CCCAGCTCC / ZEN / ACCCCTGTCGGCAGACCATG / 3IABkFQ / (SEQ ID NO: 45) GAPDH: GAPDH (FAM, Hs.PT.39a.22214836, IDT) GAPDH (HEX, Hs.PT.39a.22214836, IDT)
[0262] The exon 1-exon 2 GRN mRNA and intron 1-exon 2 GRN mRNA concentrations were quantified using QuantaSoft Software (Bio-Rad) relative to the housekeeping gene GAPDH.
[0263] The results are shown in FIGS. 1a and 1b. Compared to SEQ ID NO: 2, SEQ ID NOS: 5, 6, 7, 9, 10, 11, 12, 14, 15, 16, 19, 20, 21, 22, 23, 24, 25, 27, 28, 30, 31, 34, 35, 36, and 37 show efficient and improved skipping of intron 1 retention (Int1-Ex2) and a potential slight increase in exon 1-exon 2 (Ex1-Ex2) splice variants at both 3 μM and 10 μM doses. SEQ ID NO: 33 was tested twice and has overlapping results in both FIGS. 1a and 1b.
[0264] Compound table HELM notation The antisense oligonucleotides (compounds) of the present invention and the antisense oligonucleotide conjugates (conjugates) of the present invention are shown herein using the Hierarchical Editing Language (HELM) notation for macromolecules.
[0265] HELM is a notation designed to depict the structure of macromolecules. The full details of the HELM notation can be found at www.pistoiaalliance.org / helm-tools / in Zhang et al., 2012, J. Chem. Inf. Model., 52, 2796 - 2806 (which first described the HELM notation) and Milton et al., 2017, J. Chem Inf. Model., 57, 1233 - 1239 (which describes HELM version 2.0).
[0266] Briefly, a macromolecule is represented as a "HELM string" and is divided into sections. The first section lists the molecules contained in the macromolecule. The second section lists the connections between the molecules within the macromolecule. One or more dollar signs $ mark the end of a section of the HELM string.
[0267] The compounds of the present invention are represented by a HELM string consisting of a single first section that defines an oligonucleotide.
[0268] Each molecule listed in the first section of the HELM string is given an identifier (e.g., "RNA1" in the case of a nucleic acid), and the structure of the molecule is defined by the notation within the curly braces {} immediately following the identifier. The HELM notation used to define the structure of each molecule in the curly braces {} of the first section of the HELM string for the compounds and conjugates of the present invention is as follows.
[0269] [MOE](G) is 2'-O-(2-methoxy)ethyl RNA guanosine [MOE](U) is 2'-O-(2-methoxy)ethyl RNA uracil nucleoside [MOE](A) is 2'-O-(2-methoxy)ethyl RNA adenine nucleoside [MOE]([5meC]) is 2'-O-(2-methoxy)ethyl RNA 5-methylcytosine nucleoside MOE](T) is 2'-O-(2-methoxy)ethyl thymine nucleoside [sP] is a phosphorothioate backbone [MsNP] is a methanesulfonyl phosphoramidate backbone
[0270] As described above, in the context of the present invention, the second section is used only in the HELM string representing the conjugate of the present invention. This second section lists the connections between the molecules listed in the first section. Each pair of molecules to be connected is defined by listing their identifiers, and then the attachment points between them (i.e., the points where covalent bonds exist between the molecules) are defined.
[0271] Example of HELM notation For example, SEQ ID NO: 2 is represented by the following HELM string (shown in the compound table of Example 1).
[0272] RNA1{[MOE](G)[sP].[MOE](G)[sP].[MOE](T)[sP].[MOE]([5meC])[sP].[MOE](A)[sP].[MOE](A)[sP].[MOE](G)[sP].[MOE](A)[sP].[MOE](A)[sP].[MOE](T)[sP].[MOE](G)[sP].[MOE](G)[sP].[MOE](T)[sP].[MOE](G)[sP].[MOE](T)[sP].[MOE](G)[sP].[MOE](G)[sP].[MOE](T)}$$$$V2.0
[0273] This HELM string consists of a single section that enumerates the oligonucleotide at array number 2. The first "RNA1" indicates that the molecule is a nucleic acid (oligonucleotide). The structure of the oligonucleotide is shown using HELM notation within the curly braces {} following RNA1. "$$$$" marks the end of the section and the entire HELM string. "V2.0" indicates that HELM version 2.0 is being used.
[0274] HELM annotation key: [MOE](G) is 2'-O-(2-methoxy)ethyl RNA guanosine nucleoside [MOE](U) is 2'-O-(2-methoxy)ethyl RNA uracil nucleoside [MOE](A) is 2'-O-(2-methoxy)ethyl RNA adenine nucleoside [MOE]([5meC]) is 2'-O-(2-methoxy)ethyl RNA 5-methylcytosine nucleoside MOE](T) is 2'-O-(2-methoxy)ethyl thymine nucleoside [sP] is a phosphorothioate backbone [MsNP] is a methanesulfonyl phosphoramidate backbone
Table 1-1
Table 1-2
Table 1-3
Table 1-4
Table 1-5
Table 1-6
Table 1-7
Table 1-8
Table 1-9
Table 1-10
Claims
**Claim 1** An antisense oligonucleotide comprising a continuous nucleotide sequence 8 to 40 nucleotides in length, which is complementary to a splice regulatory site of a human progranulin pre-mRNA transcript, wherein the continuous nucleotide sequence comprises one or more methanesulfonyl phosphoramidate internucleotide linkages. **Claim 2** The antisense oligonucleotide according to claim 1, wherein the human progranulin pre-mRNA transcript comprises the exon 1, intron 1 and exon 2 sequences of the human progranulin pre-mRNA transcript (SEQ ID NO: 1). **Claim 3** The antisense oligonucleotide according to claim 1 or claim 2, wherein the continuous nucleotide sequence is complementary to SEQ ID NO:
39. **Claim 4** The antisense oligonucleotide according to claim 3, wherein the continuous nucleotide sequence is selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37 and SEQ ID NO: 38, or at least 8 consecutive nucleotides thereof. **Claim 5** The antisense oligonucleotide according to claim 4, wherein the continuous nucleotide sequence is selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37, or at least 8 consecutive nucleotides thereof. **Claim 6** The antisense oligonucleotide according to claim 5, wherein the continuous nucleotide sequence is selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 28, SEQ ID NO: 31, and SEQ ID NO: 35, or is at least 8 consecutive nucleotides thereof.
7. The antisense oligonucleotide according to claim 6, wherein the continuous nucleotide sequence is SEQ ID NO:
11.
8. The antisense oligonucleotide according to claim 6, wherein the continuous nucleotide sequence is SEQ ID NO:
15.
9. The antisense oligonucleotide according to claim 6, wherein the continuous nucleotide sequence is SEQ ID NO:
16.
10. The antisense oligonucleotide according to claim 6, wherein the continuous nucleotide sequence is SEQ ID NO:
28.
11. The antisense oligonucleotide according to claim 6, wherein the continuous nucleotide sequence is SEQ ID NO:
31.
12. The antisense oligonucleotide according to claim 6, wherein the continuous nucleotide sequence is SEQ ID NO:
35.
13. The antisense oligonucleotide according to any one of claims 1 to 12, wherein the continuous nucleotide sequence contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or more methanesulfonyl phosphoramidate nucleotide linkages.
14. The antisense oligonucleotide according to any one of claims 1 to 13, wherein the continuous nucleotide sequence contains one or more phosphorothioate nucleotide linkages.
15. The antisense oligonucleotide according to any one of claims 1 to 14, wherein the continuous nucleotide sequence contains a plurality of phosphorothioate nucleotide linkages.
16. The antisense oligonucleotide according to any one of claims 1 to 15, wherein at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the nucleotide linkages between the nucleotides of the continuous nucleotide sequence are modified.
17. The antisense oligonucleotide according to any one of claims 1 to 16, wherein all of the nucleotide linkages located between the nucleotides on the continuous nucleotide sequence are modified.
18. The antisense oligonucleotide according to claim 17, wherein all of the internucleotide linkages present within the antisense oligonucleotide are selected from phosphorothioate internucleotide linkages and methanesulfonyl phosphoramidate internucleotide linkages. **Claim 19** The antisense oligonucleotide according to any one of claims 1 to 18, wherein the antisense oligonucleotide or its contiguous nucleotide sequence contains one or more modified nucleosides. **Claim 20** The antisense oligonucleotide according to claim 19, wherein the contiguous nucleotide sequence contains one or more 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides. **Claim 21** The antisense oligonucleotide according to claim 20, wherein the contiguous nucleotide sequence contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides. **Claim 22** The antisense oligonucleotide according to any one of claims 19 to 21, wherein the contiguous nucleotide sequence contains at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides. **Claim 23** The antisense oligonucleotide according to any one of claims 19 to 22, wherein all of the nucleosides of the contiguous nucleotide sequence are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides. **Claim 24** Structure: 【Chemical 1】 An antisense oligonucleotide having the same. **Claim 25** Structure: [Chemical 2] An antisense oligonucleotide having the same. **Claim 26** Structure: [Chemical 3] An antisense oligonucleotide having the same. **Claim 27** Structure: [Chemical Formula 4] An antisense oligonucleotide having the same. **Claim 28** Structure: 【Chemical Formula 5】 An antisense oligonucleotide having the same. **Claim 29** Structure: [Chemical Formula 6] An antisense oligonucleotide having the same. **Claim 30** An antisense oligonucleotide, wherein the oligonucleotide is the oligonucleotide compound GGTCAAGAATGGGTGTGGG (SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 28, SEQ ID NO: 31 or SEQ ID NO: 35), all of the nucleosides are 2'-O-methoxyethyl-RNA (2'-MOE) nucleosides, C is 5-methylcytosine, and all of the internucleoside linkages are selected from phosphorothioate internucleoside linkages and methanesulfonyl phosphoramidate internucleoside linkages.
31. A pharmaceutical composition comprising the antisense oligonucleotide according to any one of claims 1 to 30 and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.
32. The antisense oligonucleotide according to any one of claims 1 to 30 or the pharmaceutical composition according to claim 31 for use in the treatment of a neurological disorder.
33. The antisense oligonucleotide according to any one of claims 1 to 30 or the pharmaceutical composition according to claim 31 for use in the treatment of progranulin haploinsufficiency or related disorders.
34. An in vivo or in vitro method for enhancing the expression of exon 1-exon 2 progranulin splice variants in cells expressing progranulin, the method comprising administering to the cells in an effective amount the antisense oligonucleotide according to any one of claims 1 to 30 or the pharmaceutical composition according to claim 31.