Antibody against hepatitis B virus, its production and application
An IgG1-type antibody variant with specific mutations and reduced fucose content, produced via Fut8-knockout cells, addresses the limitations of existing HBV treatments by enhancing effector functions and half-life, offering improved therapeutic outcomes for hepatitis B and D.
Patent Information
- Application Number
- JP2024575112
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-20
- Filing Date
- 2023-06-19
- Publication Date
- 2025-07-03
AI Technical Summary
Current hepatitis B virus (HBV) treatments, including universal vaccination and antiviral drugs, fail to achieve complete removal of the virus, leading to long-term drug use and increased risk of liver cancer, and existing antibodies like A14 lack optimal modifications for enhanced Fc-mediated effector functions and extended half-life.
Development of an IgG1-type antibody variant with specific mutations in the Fc region and reduced fucose content, produced using Fut8-knockout mammalian cells, to enhance ADCC and ADCP activities and extend half-life, combined with CRISPR/Cas9 gene editing for Fut8 knockout.
The antibody variant demonstrates significantly improved ADCC and ADCP activities, enhanced affinity for activating Fcγ receptors, and extended half-life, providing effective treatment and prevention of hepatitis B and D infections, with synergistic effects when combined with antiviral drugs.
Smart Images

Figure 2025520633000011 
Figure 2025520633000012 
Figure 2025520633000013
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of antibody drugs. The present invention provides an antibody variant that specifically targets hepatitis B virus (HBV), and the antibody variant has a function of enhancing the effects of Fc, such as ADCC and / or ADCP activities, on the parental antibody, and optionally further has an extended in vivo half-life. The present invention further provides a method and cells for producing the antibody variant. Furthermore, a drug composition containing the antibody variant, the use of the antibody variant, and the combined use of the antibody variant with other anti-HBV drugs are provided.
Background Art
[0002] Hepatitis B virus (HBV) infection is a major cause of liver diseases. There are 296 million chronic hepatitis B virus-infected people worldwide, and approximately 820,000 people die from liver cirrhosis or liver cancer caused by hepatitis B virus infection every year (Hepatitis B (who.int) https: / / www.who.int / news-room / fact-sheets / detail / hepatitis-b). Universal vaccination with hepatitis B vaccine can effectively reduce new infections, and interferon and nucleos(t)ide-based anti-hepatitis B drugs can effectively suppress virus replication, but the goal of completely removing hepatitis B virus and curing chronic hepatitis B cannot be achieved. Therefore, most chronic hepatitis B patients need to take drugs for a long time, and patients with persistent virological inhibition are still at risk of progressing to liver cancer (Grossi, G., et al. (2017). Hepatitis B virus long-term impact of antiviral therapy nucleot(s)ide analogues (NUCs). Liver Int 37 Suppl 1: 45-51).
[0003] The A14 antibody is a fully human IgG1 monoclonal antibody targeting hepatitis B virus pre-S1. It can not only inhibit the entry of hepatitis B virus into hepatocytes, but also has the ability to remove hepatitis B virus or infected cells through Fc-mediated immune responses (WO2016188386A1), and is a potential inhibitor for treating chronic hepatitis B (WO2021013135A1).
[0004] In the pharmaceutical industry, antibody drugs are usually produced using animal cells as production host cells. It is known that the Fc effector functions of IgG-type antibodies, such as antibody-dependent cell-mediated cytotoxicity (ADCC) activity and complement-dependent cytotoxicity (CDC) activity, are affected by glycosylation. Also, it is considered that the structure of the sugar chain in glycosylation is determined by glycosyltransferase genes involved in sugar chain synthesis and glycosidases involved in the hydrolysis of sugar chains in the production host cells. Researchers have proposed that the effector functions of IgG-type antibodies, especially IgG1 subtype antibodies, can be altered by changing glycosylation modifications.
[0005] The inventors of US8067232B2 discovered that antibodies without fucose addition exhibit higher ADCC activity, and the lower the content of core fucose sugar chains, the stronger the ADCC activity. This patent provides mammalian cells, such as CHO cells, in which α-1,6-fucosyltransferase has been inactivated by homologous recombination, and demonstrates that antibodies produced using such cells have enhanced ADCC activity.
[0006] US7662925 discloses a plurality of Fc mutations that can change the binding affinity between IgG1 antibodies and human Fcγ receptors.
[0007] However, in view of the complexity of the molecular structure and function of antibody proteins, as well as the diversity and complexity of sugar chain structures, it is still difficult to predict in advance which amino acid sites or which glycosylation modifications can be changed to adjust the effector function and other properties of a certain antibody to an ideal degree. Therefore, there is still an unsatisfied need for hepatitis B virus antibodies with improved properties and methods for producing the same.
Summary of the Invention
[0008] As a result of intensive studies, the inventors developed an anti-hepatitis B virus antibody variant with enhanced Fc effector function and extended half-life based on the A14 antibody, and completed the present invention.
[0009] Accordingly, in a first aspect, the present invention relates to an IgG1-type antibody variant that can specifically bind to the Pre-S1 domain of hepatitis B virus (HBV), and enhances the affinity for activating Fcγ receptors (FcγRs) and reduces the affinity for inhibitory Fcγ receptors (FcγR) compared to the parental antibody. Thereby, the antibody variant of the present invention has enhanced Fc-mediated effector functions, such as enhanced ADCC and / or ADCP activities.
[0010] In a specific embodiment, with respect to the parental antibody, the antibody variant contains one or more amino acid mutations in the heavy chain constant region with respect to human IgG1 represented by the amino acids of SEQ ID NO: 31, and optionally, the variant antibody has a reduced or deleted sugar chain containing 1,6-fucose. In a specific embodiment, the amino acid mutation is located in the Fc region of the antibody variant having a sequence corresponding to the 114th to 330th amino acids of SEQ ID NO: 31. In a preferred embodiment, the amino acid mutation is one or more selected from the group consisting of G236A, S239D, I332E, F243L, R292P, Y300L, V305I, P396L, L235V, where the amino acid positions are specified by the EU numbering system.
[0011] Furthermore, the antibody variant containing an amino acid mutation in the Fc region has an extended half-life compared to the unmodified antibody. In a specific embodiment, the antibody variant further comprises one or more amino acid mutations selected from the group consisting of M252Y, S254T, T256E, M428L, and N434S.
[0012] In a second aspect, the present invention provides a production cell for producing a non-fucosylated modified antibody, wherein the cell is a mammalian cell in which FUT8 is inactivated, such as a 293F cell, a CHOK1 cell, a CHOZN GS- / - cell or a CHO K1Q cell, and an antibody-encoding sequence is introduced into the cell. Preferably, the cell is a 293F cell, a CHOK1 cell, a CHOZN GS- / - cell or a CHO K1Q cell in which the Fut8 gene has been knocked out. Preferably, the introduced sequence encodes the antibody variant of the first aspect.
[0013] In a third aspect, the present invention provides a method for producing a production cell in which the Fut8 gene has been knocked out, the method comprising introducing (a) a coding sequence of a gRNA targeting Fut8 and a Cas9 nuclease, or (b) a complex of a gRNA targeting Fut8 and a Cas9 nuclease into a mammalian cell.
[0014] In a fourth aspect, the present invention provides an sgRNA for producing a cell in which the Fut8 gene has been knocked out.
[0015] In a fifth aspect, the present invention provides a method for producing an antibody, comprising culturing the cell of the second aspect in a medium to generate a culture containing the antibody.
[0016] In a sixth aspect, the present invention provides an antibody produced by the method of the fifth aspect.
[0017] In a seventh aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding the antibody of the first aspect.
[0018] In an eighth aspect, the present invention provides an expression vector comprising the isolated nucleic acid molecule of the seventh aspect.
[0019] In a ninth aspect, the present invention provides a host cell comprising the isolated nucleic acid molecule of the seventh aspect or the expression vector of the eighth aspect.
[0020] In a tenth aspect, the present invention provides a pharmaceutical composition comprising the antibody variant of the first aspect or the antibody of the sixth aspect.
[0021] In an eleventh aspect, the present invention provides the use of the antibody variant of the first aspect or the antibody of the sixth aspect in the manufacture of a medicament for treating hepatitis B or D virus infection or a disease caused by said infection, such as chronic hepatitis B, or inducing Fc effector function, in a subject in need thereof.
[0022] In a twelfth aspect, the present invention provides a method for treating hepatitis B or D virus infection or a disease caused by said infection, such as chronic hepatitis B, or inducing ADCC effect in a subject, comprising administering to the subject the antibody variant of the first aspect or the antibody of the sixth aspect.
[0023] In a thirteenth aspect, the present invention provides a combination use of the antibody variant of the first aspect or the antibody of the sixth aspect with another antiviral drug. BRIEF DESCRIPTION OF THE DRAWINGS
[0024]
FIG. 1A - B
FIG. 2
FIG. 3
FIG. 4
FIG. 5
FIG. 6
FIG. 7
FIG. 8
FIG. 9
FIG. 10
FIG. 11
FIG. 12
FIG. 13A - C
FIG. 14
FIG. 15
FIG. 16
FIG. 17
FIG. 18
FIG. 19
FIG. 20
FIG. 21
FIG. 22
FIG. 23
FIG. 24
Mode for Carrying Out the Invention
[0025] Definition "Antibody" has the meaning known in the art in the context of the present invention, i.e., an immunoglobulin having a Y-shaped structure produced by the immune system in response to foreign substances, such as pathogens. An antibody of classical structure is a homodimer, and each monomer contains one heavy chain and one light chain linked by disulfide bonds. The light chain has one variable region (V L) and one constant region (C L ) and the heavy chain consists of one variable region (V H ) and three constant regions (C H 1, C H 2 and C H 3). Each variable region contains three complementarity-determining regions (CDRs) that constitute an antigen-binding site complementary to the antigen. V L , C L , V H and C H 1, the antigen-binding fragment consisting of is called "Fab". The remaining part, i.e., the "stem" part below the Y-shaped structure, is called the "Fc" region and consists of the constant regions C H 2 and C H 3 domains.
[0026] The "Fc region" has various functions including activating immune effector pathways by binding to Fc receptors (FcRs) on effector cells such as macrophages or natural killer cells. The Fc region further contains glycosylation sites, and the sugar chains linked to these glycosylation sites can also affect the Fc effector function of the antibody.
[0027] A "neutralizing antibody" or "NAb" means an antibody that can "neutralize" the biological action of a foreign substance such as a pathogen and protect cells or organisms.
[0028] "HBV" means hepatitis B virus. "HDV" means hepatitis D virus.
[0029] "Pre-S1" is a domain located at the N-terminus in the S gene-encoded product on the surface of hepatitis B virus. The S gene contains three coding reading frames which are three parts: pre-S1, pre-S2 and S. Accordingly, the S gene can encode three protein products with different lengths. Among them, the largest product is called the L (large) protein, which simultaneously contains the three domains of Pre-S1, Pre-S2 and S. The part that is more than the other two products (the M protein containing the Pre-S2 and S domains, and the S protein containing only the S domain) is namely the N-terminal pre-S1 domain.
[0030] "A14" is a fully human monoclonal antibody targeting the hepatitis B virus Pre-S1 domain previously developed by the inventor of the present application. It can inhibit the entry of hepatitis B virus into hepatocytes and has the ability to remove hepatitis B virus and / or cells infected with hepatitis B virus through the immune reaction mediated by Fc. A14 is an IgG1-type antibody. Also, the antibody is a potential inhibitor for treating chronic hepatitis B. For more information about the A14 antibody, reference can be made to the PCT invention publication documents WO2016188386A1 and WO2021013135A1.
[0031] "IgG1" is a subtype (sometimes also called a subclass) of an immunoglobulin IgG isotype. Different IgG subtypes have different disulfide bond positions and numbers.
[0032] "Antibody variant" refers to an antibody modified with respect to the "parent antibody", and the modification includes, but is not limited to, modification to the antibody sequence and modification to the glycosylation modification of the antibody. The "parent antibody" means the antibody before modification, and in a specific embodiment, it means the A14 antibody.
[0033] "Fc variant" or "Fc antibody variant" means an antibody modified with respect to the Fc region of the parent antibody.
[0034] The "EU numbering" is a method of numbering antibody amino acids. The basis of this numbering method is that in 1968, Gerald M. Edelman et al. isolated and purified IgG1 immunoglobulin, named it Eu, measured its amino acid sequence, numbered each amino acid position, and thus formed the Eu numbering system. Currently, when encoding the amino acid sequence of an antibody, more commonly used systems are the optimized Kabat, Chothia, IMGT, etc. However, since the Eu numbering is based on IgG1 antibodies, it is also suitable for numbering the amino acid sequence of IgG1 antibody A14 in the present invention. Therefore, in the present invention, the position of amino acid mutations is described using the EU numbering.
[0035] "Fc receptor" is a receptor present on the surface of various cells (such as effector cells) that can specifically bind to the Fc region of an antibody.
[0036] "Fcγ receptor" or "FcγR" is a type of Fc receptor, and all its members belong to the immunoglobulin superfamily and are further divided into FcγRI, FcγRIIA, FcγRIIB, FcγRIIIA, and FcγRIIIB. The affinity for different subtypes of IgG varies among members, and they have different functions. Among various human Fcγ receptors, FcγRI, FcγRIIa, FcγRIIIa, and FcγRIIIb are "activating Fcγ-receptors", and FcγRIIb is the only "inhibitory Fcγ-receptor" in the human body.
[0037] The "effector function" of an antibody mainly means the effector function mediated by Fc in the context of the present invention, including ADCC and ADCP, etc.
[0038] "ADCC" is an abbreviation for antibody-dependent cell-mediated cytotoxicity, which is an immune mechanism mediated by cells. Specifically, effector cells bind to the Fc segment of an antibody specifically bound to a target cell via a receptor, release cytotoxic substances, and kill the target cell. ADCC is an important indicator for evaluating the effect of an antibody.
[0039] "ADCP" is an abbreviation for antibody-dependent cellular phagocytosis.
[0040] "Non-fucosylated", "non-fucosylation modification" or "non-fucose" means that fucose contained in the sugar chain of an antibody glycoprotein is reduced or completely disappears due to modification. For example, when describing an antibody variant, "non-fucosylated" means that the antibody variant has fewer sugar chains containing fucose or no sugar chains containing fucose compared to its parental antibody, and such an antibody variant can be represented by the abbreviation "afuco-" as a prefix. When describing a cell, "non-fucosylated" means that when the cell is used for antibody production, it can lack fucose in the sugar chain of the antibody, or such a production cell line is described as a "non-fucose protein cell line".
[0041] "FUT8" means α-(1,6)-fucosyltransferase, and its coding gene is the "Fut8 gene". FUT8 is involved in the glycosylation process after antibody expression and adds fucose to the oligosaccharide chain.
[0042] "FITC-LCA" means Lens culinaris agglutinin (LCA) labeled with fluorescein isothiocyanate (FITC). "PE-LCA" means Lens culinaris agglutinin labeled with phycoerythrin. LCA has a strong affinity for fucose and can be used to detect the level of fucose after fluorescent labeling with FITC or phycoerythrin.
[0043] "Treatment" means that a disease or its symptoms are improved, alleviated or eliminated (i.e., cured). In some cases, treatment includes preventive treatment.
[0044] "Synergistic effect" means that when two or more drugs are administered jointly, an additive or effect-enhancing action occurs, preferably an effect-enhancing action, that is, the effect during joint administration is superior to the sum of the effects of the individual administrations of the various drugs.
[0045] Parent antibody The parental antibody of the present invention is an antibody that specifically binds to the Pre-S1 domain of HBV. The main differences between the parental antibody and the antibody variant are the amino acid sequence of the Fc region and the degree of fucosylation.
[0046] In a preferred embodiment, the parental antibody of the present invention has the constant region of unmodified human IgG. For example, the parental antibody has the heavy chain constant region of unmodified human IgG, preferably the Fc region of unmodified human IgG. For example, the human IgG is human IgG1.
[0047] In a specific embodiment, the parental antibody of the present invention is the A14 antibody.
[0048] The parental antibody of the present invention may have the same six CDR sequences (amino acid sequences shown in SEQ ID NOs: 32-37) as the A14 antibody, and thus may have the same heavy chain variable region (SEQ ID NO: 1) and light chain variable region (SEQ ID NO: 5). However, it should be understood that the heavy chain constant region, particularly the Fc region, is derived from human IgG1 and has not been modified in any way.
[0049] Nomenclature rule for mutations When describing the mutations included in the Fc variant in the context of the present invention, unless otherwise specified, all are based on the heavy chain constant sequence of human IgG1 shown in SEQ ID NO: 31, and the type and position of amino acid mutations are described using the EU numbering system. Specifically, according to the EU numbering system, the heavy chain constant region of human IgG1 is a sequence of a total of 330 amino acids consisting of alanine at position 118 to lysine at position 447. From position 118 to position 214 is CH1 (corresponding to amino acid positions 1-97 of SEQ ID NO: 31), from position 215 to position 230 is the hinge region (corresponding to amino acid positions 98-113 of SEQ ID NO: 31), from position 231 to position 340 is CH2 (corresponding to amino acid positions 114-223 of SEQ ID NO: 31), and from position 341 to position 447 is CH3 (corresponding to amino acid positions 224-330 of SEQ ID NO: 31).
[0050] When describing the position of amino acid mutations in the present invention, it is recorded by the position in the EU numbering system of the mutated amino acid, rather than the position number in SEQ ID NO: 31. As described above, for the same amino acid, the number in the EU number is 117 greater than the position number of the amino acid in SEQ ID NO: 31. When describing the type of amino acid mutation, the amino acid type at the corresponding amino acid position in SEQ ID NO: 31 is used as the amino acid before mutation and is placed in front of (left side of) the position number, and the amino acid present in the variant antibody after mutation is placed after (right side of) the position number. When the same position can be mutated to different amino acids, multiple selectable amino acids are separated by " / ".
[0051] Based on the above rules, taking the G236A mutation of the present invention as an example, it means that the 236th glycine is mutated to alanine based on the EU number. For the amino acid sequence of SEQ ID NO:31, this mutation corresponds to mutating the 119th glycine to alanine. Also, for example, S239D / Q / E means that the 239th serine is mutated to aspartic acid, glutamine or glutamic acid based on the EU number. For the amino acid sequence of SEQ ID NO:31, this mutation corresponds to mutating the 122nd serine to aspartic acid, glutamine or glutamic acid.
[0052] For the sake of simplicity of expression, in the context of the present invention, the mutations or combinations of mutations of some antibody variants of the present invention against the parental antibody (A14) may be represented by abbreviations, and thus these antibody variants themselves may also be represented by these abbreviations. The types of mutations or combinations of mutations specifically meant by the abbreviations are shown in Table 6.
[0053] Alter the ADCC and ADCP activities of the antibody For therapeutic antibodies, the effector functions via FcγR, including ADCC and ADCP activities, are related to the ability of the antibody to mediate the removal of target cells. The antibody variants of the present invention further improve the effect of the antibody by improving the ADCC and / or ADCP activities of the original antibody by different means.
[0054] Natural killer (NK) cells are the main immune effector cells involved in ADCC. In addition, monocytes and eosinophils can also mediate ADCC. In the human body, the strength of antibody-mediated ADCC is related to many factors, such as the affinity between the antibody and the antigen, the affinity between the antibody Fc and the receptor FcγRIIIa, and the characteristics of immune effector cells. Modifying the glycosylation and amino acid sequence of the antibody Fc fragment is an effective means to improve the affinity between Fc and FcγRIIIa and enhance ADCC activity. Studies have shown that in the CH2 domain of the Fc fragment of IgG antibodies, after non-fucosylation modification of the sugar chain structure at the Asn297 site, the affinity between the Fc fragment of IgG antibodies and FcγRIIIa on the surface of NK cells is improved, thereby significantly enhancing the ADCC effect of the antibody and improving the clinical therapeutic effect of the antibody.
[0055] In mammalian cells, the addition of core fucose to the oligosaccharide chain of the antibody Fc fragment is directly catalyzed and completed by α-1,6-fucosyltransferase (FUT8) encoded by the Fut8 gene. FUT8 forms the core fucose of the Fc fragment oligosaccharide by transferring the fucose residue from guanosine diphosphate-fucose (GDP-Fuc) to the end of the innermost N-acetylglucosamine (GlcNAc) of the Fc fragment oligosaccharide chain. α-1,6-Fucosyltransferase is an important glycosyltransferase in the fucosylation synthesis pathway. To produce antibodies with enhanced ADCC effects, the fucosylation modification level of IgG antibodies has been reduced by various methods, such as producing cell lines using Fut8 gene knockout or low-expression antibodies, or highly expressing GnTIII by gene transfection in antibody-producing cell lines.
[0056] Knockout of the Fut8 gene in antibody-producing cells can be performed by known methods in the art, such as different methods, for example, small interfering RNA (siRNA), short hairpin RNA, homologous recombination, etc. In a preferred embodiment of the present invention, knockout of the Fut8 gene in antibody-producing cells is performed by homologous recombination via nuclease. Homologous recombination via nuclease includes, but is not limited to, CRISPR / Cas9, TALEN, ZFN. In a more preferred embodiment, knockout of the Fut8 gene in antibody-producing cells is performed by the CRISPR / Cas9 system. The specific CRISPR / Cas9 editing method will be described in detail later.
[0057] In some embodiments, the antibody variant of the present invention contains amino acid mutations in the Fc region relative to the parental antibody to improve ADCC activity. Amino acid mutations for improving ADCC activity can enhance ADCC by increasing the affinity of the antibody for activating receptors (e.g., human FcγRIIIa) and / or decreasing the affinity of the antibody for inhibitory receptors (e.g., human FcγRIIb).
[0058] In a specific embodiment, the antibody variant of the present invention may contain one or more amino acid mutations for improving ADCC activity selected from the group consisting of L235V, S239E / D / Q, F243L, R292P, Y300L, V305I, A330L, I332E, P396L.
[0059] Antibody variants having amino acid mutations can be introduced by molecular biological techniques. Specifically, a nucleotide sequence encoding the amino acid mutation is synthesized, inserted into an appropriate construct, and the construct is introduced into a host cell for expression to obtain an antibody variant containing the amino acid mutation. Hereinafter, amino acid mutations for improving other different effects, such as amino acid mutations for improving ADCP and half-life, can also be introduced in the same manner.
[0060] The antibody variant may simultaneously have a knockout of the Fut8 gene and an amino acid mutation that improves ADCC activity, or may have only one of them, thereby improving in terms of the activity that mediates ADCC.
[0061] The activity of ADCP mediated by the antibody in the human body can also be adjusted by modifying Fc. By increasing the affinity with the activating receptor human FcγRIIIa or decreasing the affinity with the inhibitory receptor human FcγRIIb, the ADCP activity can be enhanced.
[0062] One of the amino acid mutations that can enhance ADCP activity is G236A, which can decrease the affinity with the inhibitory receptor FcγRIIb.
[0063] In a preferred embodiment, the antibody variant of the present invention simultaneously includes modifications that improve ADCC and ADCP functions, including non-fucosylation modification and amino acid mutations in the Fc region. For example, the antibody variant of the present invention, relative to its parental antibody, (1) has a sugar chain containing reduced 1,6-fucose, or the sugar chain containing 1,6-fucose is deleted, and / or one or more amino acid modifications selected from the group consisting of L235V, S239E / D / Q, F243L, R292P, Y300L, V305I, A330L, I332E, P396L, and (2) optionally, has the G236A amino acid mutation.
[0064] In a specific embodiment, the antibody variant of the present invention has the modifications shown in items 3-33 of Table 6.
[0065] In a preferred embodiment, the antibody variant of the present invention has a mutation selected from the following group relative to its parental antibody. (a) having a sugar chain containing reduced 1,6-fucose or lacking a sugar chain containing 1,6-fucose, (b) having a sugar chain containing reduced 1,6-fucose or lacking a sugar chain containing 1,6-fucose and having a G236A amino acid mutation (GA mutation), (c) having a G236A and S239D amino acid mutation (GASD mutation), (d) having F243L, R292P, L235V, Y300L and P396L mutations (FLRPLVYLPL mutation), (e) having F243L, R292P, Y300L, V305I and P396L mutations (FLRPYLVIPL mutation), (f) having a G236A, I332E mutation (GAIE mutation).
[0066] In a particularly preferred embodiment, the antibody variant of the present invention has a sugar chain containing reduced 1,6-fucose or lacking a sugar chain containing 1,6-fucose and has a G236A amino acid mutation with respect to its parent antibody.
[0067] Alter the half-life of the antibody As one of protein molecules, it is known that the half-life of an antibody can be changed in various ways.
[0068] In a specific embodiment of the present invention, the half-life is changed by changing the affinity between the antibody and the FcRn receptor. In a specific embodiment, an amino acid mutation is introduced into the Fc region of the antibody to enhance the affinity between the obtained antibody variant and the FcRn receptor and extend the half-life.
[0069] In a specific embodiment, the antibody variant of the present invention contains one or more amino acid mutations selected from the group consisting of M252Y, S254T, T256E, M428L, N434S with respect to its parent antibody.
[0070] In a more specific embodiment, the antibody variant of the present invention contains an amino acid mutation selected from the following group (g) or (h) with respect to its parent antibody. (g) M428L and N434S amino acid mutations (LS mutation), (h) M252Y, S254T, T256E amino acid mutations (YTE mutations).
[0071] Combinatorial modification In a preferred embodiment, the antibody of the present invention simultaneously has improved Fc-mediated effector function and an extended half-life.
[0072] In a specific embodiment, the antibody variant of the present invention includes the following with respect to its parental antibody. (1) A sugar chain containing reduced 1,6-fucose, or a sugar chain containing 1,6-fucose is deleted, and / or one or more amino acid mutations selected from the group consisting of L235V, S239E / D / Q, F243L, R292P, Y300L, V305I, A330L, I332E, P396L (2) Optionally, a G236A amino acid mutation, and (3) Optionally, one or more amino acid mutations selected from the group consisting of M252Y, S254T, T256E, M428L, N434S.
[0073] In a specific embodiment, the antibody variant of the present invention has one set of mutations selected from (a)-(f) and one mutation selected from (g) or (h) with respect to its parental antibody, or is different from the parental antibody only by one set of mutations selected from (a)-(f) and a mutation selected from (g) or (h). (a) Having a sugar chain containing reduced 1,6-fucose, or a sugar chain containing 1,6-fucose is deleted, (b) Having a sugar chain containing reduced 1,6-fucose, or a sugar chain containing 1,6-fucose is deleted, and having a G236A amino acid mutation (GA mutation), (c) Having G236A and S239D amino acid mutations (GASD mutations), (d) Having F243L, R292P, L235V, Y300L and P396L amino acid mutations (FLRPLVYLPL mutations), (e) having the F243L, R292P, Y300L, V305I and P396L amino acid mutations (FLRPYLVIPL mutation), (f) having the G236A, I332E amino acid mutations (GAIE mutation), (g) the M428L and N434S amino acid mutations (LS mutation), (h) the M252Y, S254T, T256E amino acid mutations (YTE mutation).
[0074] In the most specific embodiment, the antibody variant of the present invention has a sugar chain containing reduced 1,6-fucose or lacks a sugar chain containing 1,6-fucose with respect to the parental antibody, and has the G236A, M428L and N434S amino acid mutations.
[0075] In a preferred embodiment, the antibody variant of the present invention has been subjected to one or more modifications with respect to the parental antibody, but has an affinity and / or viral activity for the hepatitis B virus Pre-S1 region corresponding to the parental antibody. For example, the antibody variant of the present invention changes only the Fc region with respect to the parental antibody and does not change the variable region and the complementarity determining region (CDR), and thus has a binding affinity for the hepatitis B virus corresponding to the parental antibody, specifically the Pre-S1 protein. For example, in the in vitro anti-viral activity evaluation, the antibody variant of the present invention has an IC 50 value corresponding to the parental antibody. "Corresponding" activity or value means substantially the same or close. For example, in the in vitro anti-viral activity measurement, "the activity corresponding to the parental antibody" means that the difference in the relative activity (IC 50 value) between the variant antibody of the present invention and its parental antibody does not exceed 20%.
[0076] Production cell line The present invention can produce the antibodies of the present invention using mammalian cell lines commonly used for antibody production in this field. Particularly suitable cells for the present invention are host cells that can be used for the development and production of recombinant protein drugs in the biopharmaceutical industry. In a preferred embodiment, it is necessary to knock out the Fut8 gene in the production cell line of the present invention.
[0077] In a specific embodiment, the production cell lines suitable for the present invention include, but are not limited to, 293F, CHO-K1, CHOZN GS - / - and CHOK1Q. All of these engineered cells are used for development and production in the pharmaceutical industry, with the cell growth time maintained at 12 - 40 h and the cell viability being 90% or more.
[0078] 293F cells are derived from primary human embryonic kidney cells, have high transfection efficiency, and can suspend and culture cells expressing high levels of proteins in serum-free medium. 293F cells grow rapidly and can be cultured at high density.
[0079] CHO-K1, CHOZN GS - / - and CHOK1Q are all adult Chinese hamster ovary cells (CHO). CHO-K1 is an unmodified wild-type CHO cell. The CHOZN GS - / - cell line knocks out the glutamine synthetase gene by ZFN (zinc finger nuclease) technology, so that the survival of the cell line depends on the supplementation of exogenous glutamine, and high-expression target clones can be obtained without applying excessive MTX or MSX pressure throughout the screening process. CHOK1Q is a wild-type CHO-K1 cell without genetic modification, but has undergone suspension, high osmotic pressure, high ammonium ion, and high lactate domestication modifications.
[0080] Manufacturing method As described above, knocking out the Fut8 gene in an antibody-producing cell line can be accomplished in a variety of different ways. The present invention's adoption of the CRISPR / Cas method has the advantages of being easy to operate, having high target accuracy, high editing efficiency, no insertion of foreign DNA into the host genome, and high safety compared to other methods.
[0081] The CRISPR / Cas9 gene editing technology uses guide RNA (sgRNA) to induce the Cas9 endonuclease to cleave the target double-stranded DNA in the genome, causing double-strand breaks in the target sequence. Then, under the action of the intracellular DNA repair mechanism, substitution, deletion, insertion, etc. occur in the genome, thereby enabling the knockout of the target gene. The CRISPR / Cas9 system is widely used for gene editing in various organisms. Using the CRISPR / Cas9 technology to target and knockout the Fut8 gene in 293F, CHOZN GS - / - or CHOK1, CHOK1Q cells can produce non-fucosylated antibodies and improve the ADCC activity of the antibodies.
[0082] When using 293F cells as the production cell line, the Fut8 gene can be knocked out using the nucleotide sequence of SEQ ID NO:10 as the sgRNA.
[0083] When using CHO-K1 and its derivative cell lines as the production cell line, the Fut8 gene can be knocked out using the nucleotide sequence selected from SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 as the sgRNA. Preferably, the sgRNA having the nucleotide sequence of SEQ ID NO:20 is used.
[0084] Use Unless otherwise specified, the antibodies or antibody variants of the present invention are human antibodies.
[0085] The antibody or antibody variant of the present invention can be used for the treatment or prevention of hepatitis B, particularly for the treatment or prevention of chronic hepatitis B.
[0086] The antibody or antibody variant of the present invention can be used for the treatment of hepatitis B as an adjuvant treatment, that is, as an auxiliary means of the first-choice drug to further improve the therapeutic effect.
[0087] The antibody of the present invention can be used in combination with other hepatitis B treatments. Anti-hepatitis B virus drugs that can be used in combination with the antibody of the present invention include immunomodulatory drugs such as interferon, thymosin-α1, cytokines; nucleoside (thio)ide analogs such as Entecavir, Telbivudine, Adefovir or Adefovir dipivoxil, Tenofovir, Lamivudine. For example, it can be used in combination with currently clinically approved anti-hepatitis B virus drugs. In a specific embodiment, the antibody or antibody variant of the present invention can be used in combination with Entecavir.
[0088] In some cases, the antibody or antibody variant of the present invention can also be used for the treatment or prevention of hepatitis D.
[0089] The antibody or antibody variant of the present invention can be administered to a subject by conventional delivery means. In a preferred embodiment, the antibody of the present invention is administered to a subject by parenteral administration, preferably by intravenous injection or subcutaneous injection.
[0090] The present invention also relates to the following items. 1. An antibody variant that specifically binds to the Pre-S1 domain of hepatitis B virus (HBV) and has enhanced Fc-mediated effector function compared to the parental antibody. 2. The antibody variant according to item 1, wherein the Fc-mediated effector function is ADCC and / or ADCP activity. 3. The antibody variant according to claim 1 or 2, having an enhanced affinity for the activated Fcγ receptor and / or a reduced affinity for the inhibitory Fcγ receptor. 4. The antibody variant according to any one of claims 1-3, wherein the antibody variant and the parental antibody are IgG1-type antibodies. 5. The antibody variant according to any one of claims 1-4, wherein the antibody has a characteristic selected from the following group with respect to its parental antibody. (1) A decrease or deletion of a sugar chain containing 1,6-fucose, and / or one or more amino acid modifications selected from the group consisting of L235V, S239E / D / Q, F243L, R292P, Y300L, V305I, A330L, I332E, P396L, and (2) Optionally, a G236A amino acid mutation 6. The antibody variant according to claim 5, having the modification shown in items 3-33 of Table 6 with respect to the parental antibody. 7. The antibody variant according to claim 5, having any one mutation selected from the following groups (a)-(f) with respect to the parental antibody. (a) Having a reduced sugar chain containing 1,6-fucose or lacking a sugar chain containing 1,6-fucose (b) Having a reduced sugar chain containing 1,6-fucose or lacking a sugar chain containing 1,6-fucose and having a G236A amino acid mutation (GA mutation) (c) Having G236A and S239D amino acid mutations (GASD mutation) (d) Having F243L, R292P, L235V, Y300L and P396L mutations (FLRPLVYLPL mutation) (e) Having F243L, R292P, Y300L, V305I and P396L mutations (FLRPYLVIPL mutation) (f) Having G236A, I332E mutations (GAIE mutation) 8. The antibody variant according to claim 7, having a reduced sugar chain containing 1,6-fucose or lacking a sugar chain containing 1,6-fucose and having a G236A amino acid mutation (GA mutation). 9. The antibody variant according to any one of items 5-8, wherein the reduction or deletion of the sugar chain containing 1,6-fucose is achieved by knockout of the Fut8 gene in the host cell for producing the antibody variant. 10. The antibody variant according to any one of items 1-9, which has an extended half-life compared to the parent antibody. 11. The antibody variant according to item 10, which contains one or more amino acid mutations selected from the group consisting of M252Y, S254T, T256E, M428L, and N434S with respect to the parent antibody. 12. The antibody variant according to item 11, which contains an amino acid mutation selected from the following group (g) or (h) with respect to the parent antibody. (g) M428L and N434S amino acid mutations (LS mutation) (h) M252Y, S254T, and T256E amino acid mutations (YTE mutation) 13. With respect to the parent antibody, (1) having a sugar chain containing reduced 1,6-fucose or lacking a sugar chain containing 1,6-fucose, and / or one or more amino acid mutations selected from the group consisting of L235V, S239E / D / Q, F243L, R292P, Y300L, V305I, A330L, I332E, and P396L, (2) optionally, the G236A amino acid mutation, and, (3) optionally, one or more amino acid mutations selected from the group consisting of M252Y, S254T, T256E, M428L, and N434S The antibody variant according to any one of items 1-12. 14. The antibody variant according to item 13, which has one mutation selected from (a)-(f) and one mutation selected from (g) or (h) with respect to its parent antibody. (a) having a sugar chain containing reduced 1,6-fucose or lacking a sugar chain containing 1,6-fucose (b) having a sugar chain containing reduced 1,6-fucose or lacking a sugar chain containing 1,6-fucose and having the G236A amino acid mutation (GA mutation) (c) Having the G236A and S239D amino acid mutations (GASD mutation) (d) Having the F243L, R292P, L235V, Y300L and P396L amino acid mutations (FLRPLVYLPL mutation) (e) Having the F243L, R292P, Y300L, V305I and P396L amino acid mutations (FLRPYLVIPL mutation) (f) Having the G236A and I332E amino acid mutations (GAIE mutation) (g) The M428L and N434S amino acid mutations (LS mutation) (h) The M252Y, S254T, T256E amino acid mutations (YTE mutation) 15. The antibody variant according to item 14, which has a sugar chain containing reduced 1,6-fucose or lacks a sugar chain containing 1,6-fucose with respect to the parental antibody, and has the G236A, M428L and N434S amino acid mutations. 16. The antibody variant according to any one of items 1-15, wherein the parental antibody and the antibody variant have the CDR sequences shown in SEQ ID NOs: 32-37. 17. The antibody variant according to item 16, wherein the parental antibody is the A14 antibody and has the heavy chain variable region sequence shown in SEQ ID NO: 1, the heavy chain constant region sequence shown in SEQ ID NO: 38, the light chain variable region sequence shown in SEQ ID NO: 5, and the light chain constant region sequence shown in SEQ ID NO: 6. 18. The antibody variant according to any one of items 1-17, which has a similar hepatitis B virus resistance ability compared to the parental antibody, for example, has a similar IC50. 19. (1) Three heavy chain CDR sequences shown in SEQ ID NOs: 32, 33 and 34, and three light chain CDR sequences shown in SEQ ID NOs: 35, 36 and 37, and / or, (2) An antibody that specifically binds to the Pre-S1 domain of hepatitis B virus (HBV) and contains the heavy chain constant region of the amino acid sequence shown in SEQ ID NO: 2. 20. (1) The heavy chain variable region sequence shown in SEQ ID NO:1 and the light chain variable region sequence shown in SEQ ID NO:5, and / or, (2) The antibody according to item 19, comprising a heavy chain constant region containing the amino acid sequence shown in SEQ ID NO:2. 21. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the antibody variant according to any one of items 1-18 or the antibody according to any one of items 19-20. 22. The isolated nucleic acid molecule according to item 21, comprising a nucleotide sequence encoding the heavy chain constant region shown in SEQ ID NO:4. 23. An expression vector comprising the isolated nucleic acid molecule according to item 21 or 22. 24. A host cell comprising the isolated nucleic acid molecule according to item 21 or 22 or the expression vector according to item 23. 25. A mammalian cell, wherein FUT8 in the cell is inactivated, and the isolated nucleic acid molecule according to item 21 or 22 or the expression vector according to item 23 is introduced into the cell. 26. The mammalian cell according to item 25, wherein FUT8 is inactivated by knocking out the Fut8 gene of the cell. 27. The mammalian cell according to item 25 or 26, selected from the group consisting of 293F cells, CHOK1 cells, CHOZN GS- / - cells and CHO K1Q cells. 28. The mammalian cell according to item 27, which is a 293F cell. 29. Step (1) of culturing the mammalian cell according to any one of items 25-28 in a medium to obtain a culture containing the antibody, and Step (2) of recovering the antibody from the culture, which is a method for producing an antibody. 30. To the mammalian cell, (a) The coding sequence of gRNA targeting Fut8 and Cas9 nuclease, or, (b) A complex of gRNA targeting Fut8 and Cas9 nuclease, is introduced, Here, a method for producing mammalian cells in which the Fut8 gene is knocked out, preferably introduced by (b). 31. The method according to item 30, wherein the mammalian cell is selected from the group consisting of 293F cells, CHOK1 cells, CHOZN GS- / - cells, and CHO K1Q cells. 32. The method according to item 31, wherein the nucleotide sequence of the gRNA comprises a nucleotide sequence selected from the following group targeting the Fut8 gene. Nucleotide positions 1 to 20 of the nucleotide sequence shown in SEQ ID NO:10 Nucleotide positions 1 to 20 of the nucleotide sequence shown in SEQ ID NO:19 Nucleotide positions 1 to 20 of the nucleotide sequence shown in SEQ ID NO:20 Nucleotide positions 1 to 20 of the nucleotide sequence shown in SEQ ID NO:21, or Nucleotide positions 21 to 40 of the nucleotide sequence shown in SEQ ID NO:39 33. The method according to item 32, wherein the nucleotide sequence of the sgRNA is selected from the nucleotide sequences shown in SEQ ID NO:10, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, or SEQ ID NO:39. 34. Mammalian cells produced by the method according to any one of items 30 - 33. 35. An sgRNA for knocking out the Fut8 gene, having the nucleotide sequence shown in SEQ ID NO:10, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, or SEQ ID NO:39. 36. The sgRNA according to item 35, having the nucleotide sequence shown in SEQ ID NO:10, for knocking out the Fut8 gene in 293F cells. The sgRNA according to item 35, having a nucleotide sequence shown in SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, or SEQ ID NO: 39 for knocking out the Fut8 gene in CHO-K1 cells and derivative cells thereof. 38. Step (1) of introducing the isolated nucleic acid molecule according to item 21 or 22 or the expression vector according to item 23 into the mammalian cell of item 34; Step (2) of culturing the mammalian cell obtained in step (1) to generate a culture containing the antibody; Step (3) of recovering the antibody from the culture of step (2), a method for producing an antibody. 39. An antibody produced by the method of item 29 or the method of item 38. 40. A drug composition comprising the antibody variant according to any one of items 1-18, the antibody according to any one of items 19-20 or 39, and a pharmaceutically acceptable carrier. 41. Use in the manufacture of a drug of the antibody variant according to any one of items 1-18, the antibody according to any one of items 19-20 or 39, wherein the drug is used to treat hepatitis B or D virus infection or a disease caused by said infection in a subject in need thereof, or to induce an ADCC effect. 42. The use according to item 41, wherein the subject is selected from the group of subjects confirmed to be infected with hepatitis B virus or hepatitis D virus, subjects exposed to hepatitis B virus or hepatitis D virus, subjects at high risk of being exposed to hepatitis B virus or hepatitis D virus, and subjects suffering from chronic hepatitis B. 43. The use according to item 41 or 42, wherein the drug is used to treat chronic hepatitis B. 44. A method for treating hepatitis B or D virus infection or a disease caused by said infection in a subject, or for inducing an ADCC effect, comprising administering to the subject a therapeutically effective amount of the antibody variant according to any one of items 1-18, the antibody according to any one of items 19-20 or 39, or the drug composition according to item 40. 46. The method according to item 44 or 45, wherein the subject is selected from the group consisting of a subject confirmed to be infected with hepatitis B virus or hepatitis D virus, a subject exposed to hepatitis B virus or hepatitis D virus, a subject at high risk of being exposed to hepatitis B virus or hepatitis D virus, and a subject suffering from chronic hepatitis B. 47. The method according to any one of items 44 - 46, wherein the antibody variant or antibody is administered by intravenous injection or subcutaneous injection. 48. The method according to any one of items 44 - 47, wherein the method comprises administering to the subject another drug for treating or preventing a disease caused by hepatitis B virus (HBV) infection, particularly a chronic disease caused by hepatitis B virus (HBV) infection. 49. The method according to item 48, wherein the another drug is an immunomodulator or a nucleoside analogue. 50. A drug combination for treating hepatitis B or D virus infection or a disease caused by said infection, comprising (a) an antibody variant according to any one of items 1 - 18, an antibody according to any one of items 19 - 20 or 39, and (b) another drug for treating or preventing a disease caused by hepatitis B virus (HBV) infection, particularly a chronic disease caused by hepatitis B virus (HBV) infection. 51. The drug combination according to item 50, wherein the another antiviral drug is an immunomodulator or a nucleoside analogue.
[0091] Examples Hereinafter, in order to more comprehensively understand and apply the present invention, the present invention will be described in detail with reference to examples and drawings. However, the said examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention. The scope of the present invention is indicated by the claims.
[0092] Example 1. Construction of a non-fucosylated protein production cell line This example describes the construction of a production cell line for non-fucosylated proteins. Specifically, by using the Crispr / Cas9 nuclease editing system to knockout the Fut8 gene in the 293F cell line, the antibodies produced by the edited cells were made deficient in fucosylation modification. First, sgRNAs for the target gene required for the Crispr / Cas9 system were designed. Using the online design website for sgRNAs http: / / crispr.dbcls.jp / , two sgRNA sequences targeting the Fut8 gene (NM_178155.2) in 293F cells (purchased from Beijing Protein Innovation Co., Ltd.) were designed, and the specific sequences are shown in SEQ ID NO:9 and SEQ ID NO:10 below. In the following sequences, the sgRNA target sequences are underlined and the PAM sequences (protospacer adjacent motifs) are shown in bold. sgFut8-1: ATTCCAAGATGAGTGTTCGC TGG (SEQ ID NO: 9) sgFut8-2: CTCGTACAAGTCGATCTGCG AGG (SEQ ID NO: 10) Subsequently, two pairs of primer pairs were synthesized (sgFut8-1-F1 and sgFut8-1-R1, sgFut8-2-F1 and sgFut8-2-R1, see Table 1). After synthesizing double strands by in vitro annealing, the double-stranded products were cloned into the pLenti-sgRNA-EGFP vector (purchased from Addgene) digested with BfuAI enzyme to obtain sgRNA expression plasmids pLenti-sgFut8-1-EGFP and pLenti-sgFut8-2-EGFP (Figure 1A), respectively. Furthermore, the plasmid pLenti-OCT1-cas9-IRES-BSD expressing Cas9 (purchased from Addgene) and PEI were used to co-transfect 293F cells (purchased from Beijing Protein Innovation Co., Ltd.) (Figure 1B). Flow cytometry was performed 48 h after cell transfection to select EGFP-expressing positive cells, and the culture was continued until 7 days after transfection. The cells were collected and verified by T7E1 (NEB). In the T7E1 experiment, for the two sgRNAs, two pairs of primers shown in Table 1 below (T7-sgFut8-1-F1 and T7-sgFut8-1-R1, T7-sgFut8-2-F1 and T7-sgFut8-2-R1) were used respectively. Since the T7E1 endonuclease can recognize mismatched bases on DNA and cleave the recognized site, semi-quantitative detection of gene editing efficiency can be performed using T7E1 after gene editing, the gene editing efficiency was determined, and the measurement results are shown in Figure 2. As shown in Figure 2, it was confirmed that both of the two designed sgRNAs can effectively edit the Fut8 gene in cells.
[0093] Table 1. Primer sequences for knocking out the Fut8 gene in 293F cells JPEG2025520633000001.jpg52147
[0094] Next, monoclonal cells were obtained from the cells verified by T7E1 using the limiting dilution method, and a cell binding experiment by flow cytometry (FACS) was performed on the cloned cells. Functional phenotype analysis was used to verify whether the monoclonal cells were monoclonal cells after gene editing. Lens Culinaris Agglutinin (LCA) is a lectin that can specifically recognize and bind to polysaccharides modified with fucose. LCA labeled with fluorescein isothiocyanate (FTIC) (FITC-LCA) can be used to detect the fucose modification and modification level of cell surface proteins. The FACS results are shown in Figure 3. As shown in Figure 3, the unedited 293F wild-type cells had a very strong binding to FITC-LCA, with the strongest FITC signal value. The cells that were successfully edited, such as the cell clone with the code number FCC#, had a significantly reduced binding to LCA. Also, for example, the cell clone with the code number F28# had no difference in the ability to bind to LCA compared to the wild-type cells, indicating that F28# was a cell that was not successfully edited. Furthermore, Sanger sequencing was performed on the FCC# cells to identify the specific gene editing pattern. The results showed that the cells were homozygous knockout of Fut8 (Figure 4).
[0095] From the above results, it was shown that the obtained FCC# clone was 293F cells in which the Fut8 gene was stably knocked out (referred to as "FCC#-293F cells") and could be used for the expression of non-fucose antibodies. These cells can be used as host cells for the production of non-fucosylated antibodies.
[0096] Example 2. Construction of non-fucosylated CHOK1, CHOZNGS- / - and CHO K1Q cell lines 2.1 Design and verification of sgRNA Using the sgRNA online design website http: / / crispr.dbcls.jp / , based on the Fut8 gene sequence (Gene ID: 100751648, NCBI reference number: NM_003613860) of CHO-K1 cells (purchased from the Cell Culture Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences) published in the NCBI database, four sgRNA sequences for this gene were designed (Table 2). Using the method described in Example 1, the sgRNA fragment was ligated into the pLenti-sgRNA-EGFP vector, and then, together with the plasmid pLenti-OCT1-Cas9-IRES-BSD expressing Cas9 respectively, CHO-K1 cells (purchased from the National Experimental Cell Resource Sharing Platform) were co-transfected with PEI. On the second day after transfection, EGFP-positive cells (i.e., cells co-expressing sgRNA and Cas9) were screened by flow cytometry, and after continuous culture for 5 days, a cell binding assay was performed with LCA labeled with Rhodamine (Rho). As shown in the results in Figure 5, all four designed sgRNAs could effectively edit the Fut8 gene in CHO-K1 cells, and the ability of cells co-expressing sgcgFut8 and Cas9 to bind to Rho-LCA was significantly reduced, indicating that the fucose level of cell surface proteins was clearly reduced. This result shows that the editing of the Fut8 gene was successful and the expression of the FUT8 protein was effectively silenced.
[0097] Table 2. sgRNA target sequences targeting the Fut8 gene of CHO-K1 cells JPEG2025520633000002.jpg43150
[0098] 2.2 Construction of a non-fucose CHOZNGS- / - stable transfection cell line To construct a non-fucosylated CHOZNGS- / - stable transfection cell line, one sgRNA (sgcgFut8-2) was selected from the four validated sgRNAs described in 2.1 for gene editing. To deliver sgRNA / Cas9 into cells, a DNA-free, virus-free vector, and transfection reagent-free method was adopted. Refer to Table 3 for the primer sequence information used in the study.
[0099] Table 3. Primer sequence list JPEG2025520633000003.jpg70151
[0100] By co-incubating in vitro transcribed sgRNA with Cas9 protein having a signal peptide, a gRNA / Cas9 ribonucleoprotein (RNP) complex is formed. Then, this RNP complex was introduced into CHOZNGS- / - cells (purchased from Merck, Batch No: 2113-53667) by electroporation to target-cut double-stranded DNA in the cell genome and edit the Fut8 gene. Different from the method of delivering the sgRNA and Cas9 coding sequences by plasmid in Example 1, as shown in Figure 8, the advantage of the delivery method of delivering the RNP complex by electroporation is that the operation is simple, the gene editing specificity is high, there is no risk of DNA insertion mutation, and there is no cytotoxicity caused by transfection reagents. LCA, as a lectin that can specifically bind to fucose, binds to the fucose-modified protein on the cell membrane surface and then is taken up by the cell and leads to cell death. Based on this principle, LCA pressure screening was combined to improve the acquisition success rate of Fut8 gene knockout cells.
[0101] 2.2.1 Preparation of sgDNA template The sgDNA sequence (SEQ ID NO: 39) of the following template was designed. TTAATACGACTCACTATAggCTCTCAGGAGTCGATCTGCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT The underlined part is the sequence of the T7 promoter, the italic part is the gRNA target sequence, and the normal font part is the gRNA conserved scaffold sequence. As shown in Table 4 below, an Overlap PCR reaction system was set up to prepare the sgDNA template as described above. The PCR reaction conditions were as follows: after pre-denaturation at 98°C for 2 minutes, denaturation at 98°C for 10 seconds, annealing at 60°C for 10 seconds, extension at 72°C for 10 seconds, for a total of 35 cycles, and finally extension at 72°C for 4 minutes again. The PCR product after the PCR reaction was subjected to 2% agarose gel electrophoresis, the gel was cut, and the product with a desired size of 123 bp was recovered. Then, it was identified by T7-sgcgFut8-2 sequencing to confirm the accurate synthesis of the sgDNA template.
[0102] Table 4. Preparation of the sgDNA template reaction system by Overlap PCR JPEG2025520633000004.jpg126160
[0103] 2.2.2 T7 by In vitro transcription of gRNA Using the sgDNA as a template, the following reaction system (Table 5) was set up according to the instructions of the T7 in vitro transcription kit (NEB) and incubated at 72°C for 16 hours. The gRNA product obtained after transcription was purified to obtain the gRNA.
[0104] Table 5. Preparation of gRNA by T7 in vitro transcription JPEG2025520633000005.jpg68156
[0105] 2.2.3 Preparation of gRNA / Cas9 complex The above-prepared sgcgFut8-2 gRNA and EnGen Cas9-NLS (20 μM, NEB) protein were incubated at room temperature for 10 - 15 minutes at a molar ratio of 2:1 to form a gRNA / Cas9 complex. The in vitro CRISPR / Cas9 cleavage assay showed that after the synthesized sgcgFut8-2 gRNA formed a complex with EnGen Cas9-NLS, it could effectively cleave the CHOK1 Fut8 DNA fragment containing the sgcgFut8 target sequence (Figure 6), indicating that the constructed gene editing system could operate effectively.
[0106] 2.2.4 Screening and construction of Fut8 knockout CHOZN GS- / - cell line by electroporation Next, the gRNA / Cas9 complex prepared in 2.2.3 was electroporated into CHOZN GS - / - cells using a Gene Pulser Xcell electroporator. A total of three independent experiments were conducted. One week after electroporation, some cells were collected and their genomic DNA was extracted. The genomic DNA fragment containing the sgcgFut8 target region was amplified by PCR using the T7E1-sgcgFut8-2F and T7E1-sgcgFut8-2R primers. Subsequently, T7E1 enzyme cleavage was performed to verify the gene editing efficiency via sgcgFut8-2 gRNA / Cas9. As a result, the sgcgFut8-2 gRNA successfully induced Cas9 to cleave the Fut8 gene in CHOZN GS- / - cells (Figure 7). To enrich cells in which the Fut8 gene had been edited, pressure screening was performed using LCA. Twelve days after screening, the binding ability of FITC-LCA to cells was analyzed by FACS. As a result, wild-type CHOZN GS− / − cells could bind to FITC-LCA with high affinity, whereas in cells electroporated with sgcgFut8-2 gRNA / Cas9, some cell populations lost the ability to bind to FITC-LCA. This result indicated that the editing of the Fut8 gene had been successful. Furthermore, after undergoing LCA pressure screening, the number of cells binding to FITC-LCA decreased significantly, indicating that cells in which the editing of the Fut8 gene had been successful were effectively enriched (Figure 8). Furthermore, cells electroporated with sgcgFut8-2 gRNA / Cas9 after LCA pressure screening were cloned, and a FITC-LCA cell binding assay (Figure 9) and Sanger sequencing of the Fut8 region targeted by sgcgFut8-2 (Figure 10) were performed to obtain a Fut8 homozygous knockout CHOZN GS− / − cell line (Fut8_KO-8#).
[0107] 2.3 Construction of a non-fucose CHO K1Q stable transfection cell line A non-fucose CHO K1Q cell line was constructed in the same manner as the construction of the non-fucose CHOZN GS− / − cell line. A total of three independent experiments were performed. Verification by T7E1 showed that the editing of the Fut8 gene in CHO K1Q cells (purchased from Yasushi Nakayama) was successful by electroporation of sgcgFut8-2 gRNA / Cas9 RNP. As shown in Figure 11, the target DNA fragment was cleaved into two small fragments by the T7E1 enzyme. Figure 11 further shows that the efficiency of gene editing after LCA pressure screening was further improved because the content of the target DNA fragment after cleavage by the T7E1 enzyme further decreased. For the sgcgFut8-2 gRNA / Cas9 electroporated cells after cloned LCA pressure screening, verification was performed by FITC-LCA cell binding assay. As shown in Figure 12, the ability of CHO K1Q-Fut8 KO-1#, 2# and 3# obtained from three independent experiments to bind to FITC-LCA was significantly reduced, indicating that the ability of the cells to produce fucose-modified polysaccharides or proteins was reduced. In addition, Sanger sequencing was performed on the Fut8 region targeted by sgcgFut8-2. As shown in Figure 13, the sequencing results further confirmed that CHO K1Q-Fut8 KO-1#, 2# and 3# were CHO K1Q cell lines with Fut8 homozygous knockout.
[0108] Example 3. Enhancement of ADCC and ADCP of neutralizing antibodies This example relates to improving the ADCC and ADCP activities of anti-hepatitis B virus neutralizing antibodies, particularly by modifying the Fc region of the antibodies.
[0109] 3.1 Production of A14 Fc variants The inventors introduced amino acid mutations into the heavy chain Fc region of the A14 antibody expressed using genetic engineering technology to obtain a series of A14 Fc variants. These A14 Fc variants were constructed into the eukaryotic expression plasmid pCAGGS vector (Addgene) and expressed in the FCC#-293F cells (Fut8 gene deletion) constructed in Example 1 to obtain various non-fucosylated antibodies. A total of 33 different A14 Fc variants were constructed. First, the absorbance value of the protein at 280 nm was measured by Nanodrop one, and the expression level of each A14 antibody variant was evaluated based on the amount of antibody in the obtained cell culture solution per 1 ml, and the results are shown in Table 6. Each "+" in Table 6 indicates 10 μg / ml. Based on the results in Table 6, A14 antibody variants with high expression levels were selected for subsequent experiments.
[0110] Table 6. Constructed A14 variants and their expression levels JPEG2025520633000006.jpg178153
[0111] 3.2 Evaluation of ADCC and ADCP Activities of A14 Fc Variant Using Jurkat / NFAT-luc2p / FcγRIIIa F158 and Jurkat / NFAT-luc2p / FcγRIIa R131 transgenic cell lines expressing Fcγ receptors constructed by the inventors based on Jurkat parental cells (purchased from the Cell Culture Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences) as effector cells, and CHO (CHO-59C) stably expressing the A14 binding epitope as target cells, the ADCC and ADCP activities of the A14 Fc variant were evaluated. In the experiment, an Fc variant (DANA) antibody that had lost its binding activity to the Fcγ receptor was set as a control at the same time. When evaluating the ADCC and ADCP activities, the concentrations of the A14 Fc mutant antibody were set to 30 ng / ml and 100 ng / ml respectively, the ratio of effector cells to target cells was 6:1, and after incubation at 37°C for 6 h, the relative luciferase activity (RLU) due to cell expression was detected (Figure 14). In the experiment, the luciferase activity value RLU induced by A14 DANA was set to 1, and the relative ADCC and ADCP activities induced by other A14 Fc mutations were compared. As shown in Fig. 14, afuco-A14 GA is excellent in mediating the activities of both ADCC and ADCP. In terms of mediating ADCC and ADCP, afuco-A14 GA is not only better than afuco-A14 with only non-fucosylation modification or the Fc amino acid variant with only GA mutation, but also better than antibody variants with other mutations in addition to non-fucosylation modification and GA mutation, such as afuco-A14 GAIE and afuco-A14 GAALIE. This result was unexpected. For example, as can be seen from Fig. 14, in terms of mediating ADCC, the effect of GAIE is significantly better than that of GA, but after further adding non-fucosylation modification, the effect of afuco-A14 GAIE is inferior to that of afuco-A14 GA.
[0112] 3.3 Evaluation of the dose-response relationship of the ADCC activity of the A14 Fc variant Based on the results of the preliminary evaluation in 3.2, the dose-response relationship of the ADCC activity was further evaluated for A14 Fc variants afuco-A14, afuco-A14 GA, A14-GASD, A14-FLRPYLVIPL, A14-FLRPLVYLPL, and A14-GAIE, which have strong relative activities of ADCC and ADCP. As a control, the unmodified A14 antibody (A14WT) was used. The initial protein amount of the antibody was 10 μg / ml, and gradient dilutions of 11 different concentrations were prepared at a dilution ratio of 3-fold. In the experiment, the Jurkat / NFAT-luc2p / FcγRIIIa F158 transgenic cell line (stably expressing NFAT-luc2p and FcγRIIIa F158 in Jurkat cells, where Jurkat cells were purchased from the Cell Bank of the Committee for Type Culture Collection, Chinese Academy of Sciences) was selected as the effector cell, and the target cell was CHO (CHO-59C) stably expressing the A14 binding epitope. The ratio of effector cells to target cells was 6:1. In the experiment, negative control wells (i.e., wells containing only PBS without antibody) and background well controls were set up. Using GraphPad Prism software, with the relative light signal value (RLU) on the vertical axis and the logarithmic value of the antibody concentration (Log10) on the horizontal axis, a curve was plotted using a four-parameter fitting regression model, and the EC50 value of the antibody ADCC effect was calculated. The candidate antibodies evaluated and the results are shown in Figure 15, among which the non-fucosylated modified A14 antibody variants afuco-A14 and afuco-A14 GA showed optimal ADCC activity.
[0113] 3.4 Evaluation of the ADCP activity of A14 Fc variants In the ADCP experiment, afuco-A14, afuco-A14 GA, and the A14-GASD mutant antibody were further analyzed, with A14WT as the control. The effector cells used were macrophages induced to differentiate in vitro from mouse bone marrow cells, and the target cells were 293F cells (293F-59C) expressing the A14 binding epitope. The effector cells were labeled with an anti-mouse F4 / 80 monoclonal antibody with red fluorescence Alexa Fluor 647, and the target cells were labeled with the green fluorescent dye CFSE. A negative control (PBS) was set up. After incubating the target cells with the A14 Fc mutant antibody (10 μg / mL), they were added to the effector cell culture plate. Both the effector cells and the target cells were 2×10 5Cells / wells, and the ratio of effector cells to target cells (E:T) was 1:1. After incubation at 37°C for 2 hours, the culture supernatant was discarded, and the target cells not phagocytosed by macrophages were washed. Fluorescent photographs were taken using a confocal microscope Nikon A1, and the phagocytosis index, i.e., the number of positive target cells (green fluorescence) in 100 macrophages (red fluorescence), was counted. As a result, afuco-A14 GA most strongly mediated the phagocytosis (ADCP) of target cells 293F-59C by macrophages (Figure 16). Based on the above ADCC and ADCP results and in accordance with the antibody expression level, afuco-A14-GA antibody was selected as a lead candidate molecule with enhanced immune effect.
[0114] Example 4. Measurement of the affinity between A14 Fc mutant antibody and human FcγRs receptor 4.1 In vitro recombinant expression of human-derived FcγRs protein To study the affinity between A14 Fc variant and FcγR receptor, human FcγR receptor with a 6xHis tag at the C-terminus was recombinantly expressed in 293F cells and purified by Ni column.
[0115] 4.2 Measurement of the affinity between A14 Fc mutant antibody and FcγRs receptor Using Biacore, the affinities of several A14 Fc variants obtained in the initial screening with various human FcγRs were analyzed, including activating receptors hFcγR1a, hFcγR2a H131, hFcγR2a R131, hFcγR3a V158, hFcγR3a F158, and inhibitory receptor hFcγR2b. V158 and H131 are high-affinity receptor SNPs, while F158 and R131 are low-affinity receptor SNPs. The ADCC activity of the antibody variant is related to the affinity with hFcγR3a V158 and hFcγR3a F158, and the ADCP activity of the antibody variant is related to the affinity with hFcγR2a H131 and hFcγR2a R131. The obtained results are summarized in Table 7.
[0116] Table 7. Affinity analysis of A14 Fc variants and human FcγRs by Biacore (KD,M) JPEG2025520633000007.jpg68150
[0117] As can be seen from the data in Table 7, afuco-A14 GA has enhanced affinity with the activating receptors hFcγR2a H131, hFcγR2a R131, hFcγR3a V158 and hFcγR3a F158 compared to wild-type A14 (A14 WT).
[0118] Summarizing the above results, afuco-A14 GA was selected as a lead candidate molecule with enhanced immune effects. In addition, modifications were made to optimize the half-life of the antibody.
[0119] Example 5. An A14 Fc variant with an extended half-life was obtained by genetic engineering modification. Based on the afuco-A14 GA antibody obtained from the above-mentioned research evaluation, afuco-A14 GA LS and afuco-A14 GA YTE variants were further obtained by genetic engineering modification, aiming to extend the in vivo half-life of the antibody. Using the ADCC and ADCP luciferase reporter systems based on Jurkat cells, after introducing the above new mutations, it was investigated whether the ADCC and ADCP activities of the antibody were affected. The results are shown in Figure 18. Compared with A14 WT and the precursor antibody afuco-A14 GA, after introducing the YTE mutation into the Fc fragment of the antibody, both the ADCC and ADCP activities of the antibody were significantly reduced, affecting the immune effect activity of the precursor antibody. In contrast, the introduction of the LS mutation did not significantly change the activities of ADCC and ADCP. This indicates that afuco-A14 GA LS is an optimal candidate molecule for enhancing immune effects and extending the half-life.
[0120] Example 6. Study on the physicochemical properties, biological activities and in vivo half-life of afuco-A14 GA LS molecule In this example, various properties and functions of the afuco-A14 GA LS antibody were further measured and compared with the unmodified A14 antibody.
[0121] 6.1 A14-WT and afuco-A14 GA LS expressed were analyzed by SDS-PAGE. A14 WT and afuco-A14 GA LS antibodies were respectively expressed in 293F and FCC# cells, purified with protein A, and then protein quantification was performed. Then, 2 μg was taken respectively for SDS-PAGE electrophoresis analysis. The results are shown in Fig. 19.
[0122] 6.2 Analysis of the affinity between afuco-A14 GA LS and human FcγRs According to the method described in Example 4, the affinity between afuco-A14 GA LS and hFcγRIa, hFcγRIIa H131, hFcγRIIa R131, hFcγRIIb, hFcγRIIIa V158 and hFcγRIIIa F158 was analyzed using Biacore. Specifically, after coupling Protein G to the CM5 chip via an amino group, the A14 WT antibody and afuco-A14 GA LS antibody were respectively captured, and recombinant hFcγR at different concentrations was used as the mobile phase to bind and dissociate with the antibody on the chip through the flow path under the condition of pH 7.0. Then, the data was fitted in a 1:1 Langmuir binding mode to calculate the affinity, and the results are shown in Table 8. As shown in Table 8, compared with A14 WT, the affinity of afuco-A14 GA LS with the activating receptors hFcγRIIa and hFcγRIIIa was significantly enhanced.
[0123] Table 8. Affinity analysis between afuco-A14 GA LS and human FcγRs (KD, M) JPEG2025520633000008.jpg39151
[0124] 6.3 Evaluation of the ADCC and ADCP activities of afuco-A14 GA LS As effector cells, the same Jurkat / NFAT-luc2p / FcγRIIIa F158 and Jurkat / NFAT-luc2p / FcγRIIa R131 transgenic cell lines as in 3.2 were used, and the target cells were CHO (CHO-59C) stably expressing the A14 binding epitope. The ratio of effector cells to target cells was 6:1. The initial concentration of the antibody was 10 mg / ml, and serial dilutions were performed in triplicate to obtain a total of 11 different concentration gradient dilution samples, and the ADCC and ADCP activities of afuco-A14 GA LS and A14 WT antibodies were compared. In the experiment, negative control wells (wells containing only PBS without antibody) and background well controls were set up. Using GraphPad Prism software, with the relative fluorescence signal value (RLU) on the vertical axis and the logarithmic value of the antibody concentration (Log10) on the horizontal axis, a curve was plotted using a four-parameter fitting regression model, and the results of calculating the EC50 value of the antibody ADCC effect are shown in Figure 20. As a result, the ADCC and ADCP activities of afuco-A14 GA LS were significantly enhanced compared to A14, and the enhancement multiples were at least 18.6-fold and 4.7-fold, respectively.
[0125] 6.4 Evaluation of the binding activity of afuco-A14 GA LS to human FcRn The in vivo half-life of an antibody is mainly determined by the affinity between the antibody Fc and FcRn on the surface of human endothelial cells. The binding of FcRn to antibody IgG is pH-dependent, binding only at a weakly acidic pH of about 6.0 and not binding at neutral pH. Therefore, the binding activity of afuco-A14 GA LS to human FcRn under acidic conditions was analyzed by Biacore. Specifically, after the recombinantly expressed hFcRn was coupled to the CM5 chip via an amino group, different concentrations of A14 WT antibody and afuco-A14 GA LS antibody were used as the mobile phase to bind and dissociate with hFcRn on the chip via the flow path under the condition of pH 6.0, and then the data were fitted in a 1:1 Langmuir binding mode to calculate the affinity, and the results are shown in Figure 21. As shown in Fig. 21, it was observed that afuco-A14 GA LS has a stronger affinity under acidic conditions than A14, and the KD value is improved by 3.4 times.
[0126] 6.5 Affinity analysis of afuco-A14 GA LS antibody and target antigen The sequence modification of afuco-A14 GA LS is limited to the Fc region. Since it has the same Fab as A14 WT for identifying the HBV Pre-S1 epitope, theoretically, the binding activities of both to the target antigen Pre-S1 should be the same. Nevertheless, the ability of afuco-A14 GA LS to bind to the target antigen was confirmed by experiments. The results of measuring the relative binding activity between afuco-A14 GA LS and the antigen polypeptide NC36b (pre-S1) using the ELISA binding activity detection method are shown in Fig. 22. The antigen polypeptide was synthesized by Beijing Zhongke Yaguang Biotechnology Co., Ltd., and its sequence is described in paragraph 019 of WO2016188386A1. The results in Fig. 22 show that the binding activity between afuco-A14 GA LS and Pre-S1 is equivalent to that of A14 WT, indicating no obvious change.
[0127] 6.6 In vitro antiviral activity evaluation An HBV infection system using human HepG2-hNTCP cells produced by the inventors as host cells was used. afuco-A14 GA LS and A14 WT were serially diluted, uniformly mixed with an equal volume of recombinant HBV D genotype virus (produced according to the description in Yan, H., et al., Sodium taurocholate cotransporting polypeptide is a functional receptor for human hepatitis B and D virus. Elife, 2012. 1: p. e00049), and then used for the infection of HepG2-hNTCP cells. The cell culture supernatant was collected on the 5th day after infection. The secretion amount of HBeAg in the cell culture supernatant was detected using an HBeAg antigen ELISA detection kit (Beijing Wantai Biological Pharmacy Co., Ltd.), and the inhibition percentage at different antibody concentrations was calculated with the secretion amount of HBeAg in the virus infection control group (containing only PBS without adding antibodies) as the base number. Using GraphPad Prism software, with the logarithm of the concentration on the x-axis and the inhibition rate on the y-axis, a curve was plotted using a four-parameter fitting regression model, and the IC50 value was calculated. As a result, afuco-A14 GA LS and A14 WT had an equivalent IC50 of approximately 11.0 ng / ml (Figure 23).
[0128] 6.7 Study on the in vivo half-life of afuco-A14 GA LS in hFcRn KI mice Furthermore, the half-life of afuco-A14 GA LS was studied in mice in vivo. In this experiment, human FcRn knock-in (hFcRn KI) mice expressing human FcRn were used. In the experiment, A14 WT and afuco-A14 GA LS groups were set up, with 6 mice in each group, half male and half female. The antibody dosage was 10 mg / kg, and the administration route was intraperitoneal injection. Blood was collected from the mice before administration, 10 minutes, 1 hour, 3 hours, 10 hours, 1 day, 3 days, 7 days, 10 days, 14 days, 17 days, 21 days, 28 days, and 35 days after administration. The blood drug concentration in the mouse serum was measured by ELISA. As shown in Figure 24, the T of A14 WT 1 / 2was 5.77 ± 1.16 days, AUC Inf was 515.13 ± 84.82 day*μg / mL, and the terminal clearance (CL) was 19.79 ± 2.78 mL / day / kg, while the T 1 / 2 of afuco-A14 GA LS was 15.41 ± 2.96 days, AUC Inf was 995.48 ± 197.64 day*μg / mL, and CL was 10.39 ± 2.08 mL / day / kg. As can be seen from the results, the half-life of afuco-A14 GA LS was extended by about 2.67 times compared with A14 WT.
[0129] 6.8 Evaluation of the antiviral activity of afuco-A14 GA LS in mice in vivo To study the established therapeutic effect of afuco-A14 GA LS on HBV infection, the effects of single administration of afuco-A14 GA LS and combined administration with entecavir were evaluated in a liver humanized chimeric hFRG (Fah - / - Rag2 - / - / IL2rg - / - ) mouse model. Entecavir is a hepatitis B virus reverse transcriptase inhibitor that treats hepatitis B by inhibiting viral replication. The drawback of entecavir is that once the drug is stopped, viral replication rebounds. In the experiment, a control group (saline), a single-agent treatment group of afuco-A14 GA LS (10 mg / kg), a single-agent treatment group of entecavir (ETV, 0.1 mg / kg), a combined treatment group of afuco-A14 GA LS (10 mg / kg) and entecavir (0.1 mg / kg) were set up respectively. Mice were administered from the 28th day (D28) after HBV infection (HBV D genotype, 2 × 10 9 GE / mouse) (afuco-A14 GA LS was administered subcutaneously, and ETV was administered orally). Thereafter, afuco-A14 GA LS was administered subcutaneously once a week (D35, D42, D49, D56, D63, D70), and ETV was administered once a day until D70. Observation was carried out until D91 after the administration was stopped.
[0130] Plasma of experimental mice was collected by venous blood sampling, and the HBV DNA level in mouse plasma was quantitatively detected by qPCR. From the experimental results, compared with the control group administered with physiological saline, the HBV DNA in the sera of the mice in the administration groups all decreased significantly. Specifically, at the final administration time (D70), the viral DNA levels in the afuco-A14 GA LS monotherapy group and the ETV monotherapy group decreased by about 7.3-fold and 436-fold, respectively. After afuco-A14 GA LS was combined with ETV, the level of the serum virus titer further decreased and reached 855-fold. The virus titers of each treatment group rebounded after drug withdrawal, but were still lower than the virus titer level at baseline D28. The average values of the virus titers of each group at the test endpoint (D91, 21 days after drug withdrawal) decreased by 2.43-fold for afuco-A14 GA LS alone, 7.15-fold for ETV alone, and 12.6-fold for the combination of afuco-A14 GA LS and ETV, respectively, compared with the treatment start point (D28). From these results, the combined effect of the antibody variant of the present invention and ETV is superior to the effect of using any of them alone, and it was shown that such advantages in antiviral effect can continue until 21 days after drug withdrawal.
[0131] Sequence information JPEG2025520633000009.jpg233168 JPEG2025520633000010.jpg239167
Claims
1. An antibody variant that specifically binds to the Pre-S1 domain of hepatitis B virus (HBV) and has enhanced Fc-mediated effector functions, such as ADCC and / or ADCP activities, compared to the parental antibody.
2. The antibody variant according to claim 1, wherein the antibody variant and the parental antibody are IgG1-type antibodies.
3. The antibody variant according to claim 1 or 2, wherein the antibody has a characteristic selected from the following group with respect to its parental antibody. (1) The sugar chain containing 1,6-fucose is reduced or the sugar chain containing 1,6-fucose is deleted, and / or one or more amino acid modifications selected from the group of L235V, S239E / D / Q, F243L, R292P, Y300L, V305I, A330L, I332E, P396L, and (2) Optionally, a G236A amino acid mutation
4. The antibody variant according to claim 3, which has any one mutation selected from the following groups (a)-(f) with respect to the parental antibody. (a) Having a reduced sugar chain containing 1,6-fucose or lacking a sugar chain containing 1,6-fucose (b) Having a reduced sugar chain containing 1,6-fucose or lacking a sugar chain containing 1,6-fucose and having a G236A amino acid mutation (GA mutation) (c) Having G236A and S239D amino acid mutations (GASD mutation) (d) Having F243L, R292P, L235V, Y300L, and P396L mutations (FLRPLVYLPL mutation) (e) Having F243L, R292P, Y300L, V305I, and P396L mutations (FLRPYLVIPL mutation) (f) Having G236A and I332E mutations (GAIE mutation)
5. The antibody variant according to claim 3 or 4, wherein the reduction or deletion of the sugar chain containing 1,6-fucose is achieved by knockout of the Fut8 gene in the host cell for producing the antibody variant.
6. The antibody variant according to any one of claims 1-5, which has an extended half-life with respect to the parental antibody.
7. The antibody variant according to claim 6, which contains one or more amino acid mutations selected from the group of M252Y, S254T, T256E, M428L, N434S with respect to the parental antibody.
8. The antibody variant according to claim 7, which comprises an amino acid mutation selected from the following group (g) or (h) with respect to the parental antibody. (g) M428L and N434S amino acid mutations (LS mutation) (h) M252Y, S254T, T256E amino acid mutations (YTE mutation)
9. With respect to the parental antibody, (1) having a sugar chain containing reduced 1,6-fucose or lacking a sugar chain containing 1,6-fucose, and / or one or more amino acid mutations selected from the group consisting of L235V, S239E / D / Q, F243L, R292P, Y300L, V305I, A330L, I332E, P396L, (2) optionally, the G236A amino acid mutation, and (3) optionally, one or more amino acid mutations selected from the group consisting of M252Y, S254T, T256E, M428L, N434S, the antibody variant according to any one of claims 1-8.
10. The antibody variant according to any one of claims 1-9, wherein the parental antibody and the antibody variant have CDR sequences shown in SEQ ID NOs: 32-37.
11. The parental antibody is the A14 antibody and has a heavy chain variable region sequence shown in SEQ ID NO: 1, a heavy chain constant region sequence shown in SEQ ID NO: 38, a light chain variable region sequence shown in SEQ ID NO: 5, and a light chain constant region sequence shown in SEQ ID NO: 6, the antibody variant according to claim 16.
12. (1) Three heavy chain CDR sequences shown in SEQ ID NOs: 32, 33 and 34, and three light chain CDR sequences shown in SEQ ID NOs: 35, 36 and 37, and (2) An antibody that specifically binds to the Pre-S1 domain of hepatitis B virus (HBV) and comprises a heavy chain constant region containing the amino acid sequence shown in SEQ ID NO:
2.
13. An isolated nucleic acid molecule comprising the nucleotide sequence encoding the antibody variant according to any one of claims 1-18 or the antibody according to claim 12, preferably comprising the nucleotide sequence encoding the heavy chain constant region shown in SEQ ID NO:
4.
14. An expression vector comprising the isolated nucleic acid molecule according to claim 13.
15. A host cell comprising the isolated nucleic acid molecule according to claim 13 or the expression vector according to claim 14.
16. A mammalian cell, wherein FUT8 in the cell is inactivated and the isolated nucleic acid molecule according to claim 13 or the expression vector according to claim 14 is introduced into the cell.
17. The mammalian cell according to claim 16, which is selected from the group consisting of 293F cells, CHO-K1 cells, CHOZN GS− / − cells, and CHO K1Q cells.
18. Step (1) of culturing the mammalian cell according to any one of claims 16 or 17 in a medium to obtain a culture containing the antibody; Step (2) of recovering the antibody from the culture, which is a method for producing an antibody.
19. Into the mammalian cell, (a) a coding sequence of a gRNA targeting Fut8 and a Cas9 nuclease, or (b) a complex of a gRNA targeting Fut8 and a Cas9 nuclease, is introduced, wherein preferably introduced by (b), a method for producing a mammalian cell in which the Fut8 gene is knocked out.
20. The method according to claim 19, wherein the nucleotide sequence of the sgRNA is selected from the nucleotide sequences shown in SEQ ID NO: 10, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, or SEQ ID NO: 39.
Citation Information
Patent Citations
Modified Chinese hamster ovary (CHO) cells and application thereof
CN107760650A
Optimized fc mutants and methods for their generation
JP2006512407A
A polypeptide containing an Fc region exhibiting improved effector functionality through modification of the degree of fucosylation, and its method of use.
JP2013507128A
Anti-CD19 antibodies with ADCC and CDC function and improved glycosylation profile
JP2013535192A
Nonfucosylated proteins and methods
JP2017526384A