Method for treating muscular dystrophy
By combining AAVrh74 viral vectors with an IgG-cleaving enzyme, the method addresses the immune response issue in AAV gene therapy, enhancing its efficacy and allowing repeated treatments for muscular dystrophy.
Patent Information
- Application Number
- JP2024575076
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-11-02
- Filing Date
- 2023-06-28
- Publication Date
- 2025-07-10
AI Technical Summary
Existing gene therapy methods using adeno-associated virus (AAV) for muscular dystrophy face challenges due to the body's immune response, leading to a decrease in AAV copy number over time and reduced efficacy, as human subjects develop neutralizing antibodies against the AAV vector.
Administering a recombinant AAVrh74 viral vector in conjunction with an enzyme that cleaves immunoglobulin G (IgG) to reduce the immune response, thereby maintaining vector efficacy by reducing IgG antibodies that neutralize the AAV vector.
The approach enhances the persistence and efficacy of AAV gene therapy by minimizing the immune response, allowing for repeated administrations and improved expression of therapeutic proteins like dystrophin and sarcoglycans in subjects with muscular dystrophy.
Smart Images

Figure 2025521533000045 
Figure 2025521533000046 
Figure 2025521533000047
Abstract
Description
Technical Field
[0001] Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 357,029, filed Jun. 30, 2022, and U.S. Provisional Application No. 63 / 382,047, filed Nov. 2, 2022. The entire teachings of the above applications are incorporated herein by reference in their entirety.
[0002] Incorporation by Reference of Sequence Listing The content of the electronically submitted sequence listing (name: 8183WO00_SequenceListing.XML, size: 91 kilobytes, creation date: Jun. 28, 2023) filed herewith together with this specification is incorporated herein by reference in its entirety.
[0003] The present disclosure provides a method for treating muscular dystrophy in a human subject in need thereof.
Background Art
[0004] Muscular dystrophy (MD) is one of a rare but highly debilitating class of genetic diseases. For example, Duchenne muscular dystrophy (DMD) is caused by a defect in the expression of the protein dystrophin. The gene encoding this protein contains 79 exons spanning over 2 million nucleotides of DNA. Any exon mutation characterized by changing the reading frame of the exons, introducing a stop codon, or removing all out-of-frame exon(s) or duplicating one or more exons can prevent the production of functional dystrophin and result in MD.
[0005] Gene therapy provides a sustainable means of treating various diseases, and adeno-associated virus (AAV) is one of the most commonly investigated gene therapy vectors. AAV is a protein shell that surrounds and protects a small single-stranded DNA genome of approximately 4.8 kilobases (kb). Naso et al., BioDrugs, 31(4):317-334(2017). AAV belongs to the parvovirus family and depends on co-infection with other viruses, mainly adenovirus, to replicate. Ibid. Its single-stranded genome contains three genes: Rep (replication), Cap (capsid), and aap (assembly). Ibid. These coding sequences are adjacent to the inverted terminal repeats (ITRs) necessary for genome replication and packaging. Ibid. The two cis-acting AAV ITRs are approximately 145 nucleotides long and have interrupted palindromic sequences that can fold into a T-shaped hairpin structure that functions as a primer during DNA replication initiation. Initial results in animal models indicate that AAV gene therapy may be a viable approach for treating DMD and BMD, but it has been found that the AAV copy number decreases over time and correlates with a decrease in efficacy. One suspected reason for this decrease in AAV copy number is the body's immune response to AAV virus particles. After the first AAV therapy, human subjects generally produce neutralizing antibodies that promote the destruction of the foreign AAV vector. As a result, the AAV copy number decreases over time, and subsequent therapies using the same vector may result in a complete lack of response. Therefore, there remains a need for an improved treatment method for treating MD.
Prior Art Documents
Non-Patent Documents
[0006]
Non-Patent Document 1
Summary of the Invention
[0007] Certain aspects of the present disclosure are directed to a method of treating a subject having muscular dystrophy, the method comprising administering to the subject a recombinant AAVrh74 viral vector and an enzyme that cleaves immunoglobulin G (IgG).
[0008] In some aspects, the recombinant AAVrh74 viral vector and the enzyme that cleaves IgG are administered to the subject simultaneously.
[0009] In some aspects, the recombinant AAVrh74 viral vector and the enzyme that cleaves IgG are administered to the subject sequentially.
[0010] In some aspects, the subject is determined to have anti-AAVrh74 antibodies.
[0011] In some aspects, the anti-AAVrh74 antibodies are neutralizing anti-AAVrh74 antibodies.
[0012] In some aspects, the anti-AAVrh74 antibodies are non-neutralizing anti-AAVrh74 antibodies.
[0013] In some aspects, the anti-AAVrh74 antibodies are total anti-AAVrh74 antibodies that include both neutralizing and non-neutralizing antibodies.
[0014] In some aspects, the subject has an anti-AAVrh74 antibody titer greater than 1:400 in a total anti-AAVrh74 antibody ELISA assay.
[0015] In some aspects, the subject has anti-AAVrh74 antibodies in a neutralizing cell assay.
[0016] In some aspects, the recombinant AAVrh74 viral vector is administered after the enzyme that cleaves IgG.
[0017] In some aspects, the subject is administered the recombinant AAVrh74 viral vector within 54 hours after administration of the enzyme that cleaves IgG.
[0018] In some embodiments, the method further comprises administering a second dose of an IgG-cleaving enzyme to the subject before administering a recombinant AAVrh74 viral vector to the subject if the subject is determined to have anti-AAVrh74 antibodies after administration of a first dose of the IgG-cleaving enzyme.
[0019] In some embodiments, the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody.
[0020] In some embodiments, the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody.
[0021] In some embodiments, the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both neutralizing and non-neutralizing antibodies.
[0022] In some embodiments, the subject has an anti-AAVrh74 antibody titer greater than 1:400 in a total anti-AAVrh74 antibody ELISA assay.
[0023] In some embodiments, the subject has anti-AAVrh74 antibodies in a neutralizing cell assay.
[0024] In some embodiments, the recombinant AAVrh74 viral vector is administered after the second dose of the IgG-cleaving enzyme.
[0025] In some embodiments, the subject is administered the recombinant AAVrh74 viral vector within 54 hours after administration of the second dose of the IgG-cleaving enzyme.
[0026] In some embodiments, the subject is administered the second dose of the enzyme within 60 hours after the first dose of the IgG-cleaving enzyme.
[0027] In some embodiments, the subject has an anti-AAVrh74 antibody titer of about 1:1600 to about 1:3200 in a total anti-AAVrh74 antibody ELISA assay.
[0028] In some embodiments, the method further comprises administering to the subject a third dose of an enzyme that cleaves IgG before administering the recombinant AAVrh74 viral vector.
[0029] In some embodiments, the recombinant AAVrh74 viral vector is administered after the third dose of the enzyme that cleaves IgG.
[0030] In some embodiments, the subject is administered the recombinant AAVrh74 viral vector within 54 hours after administration of the third dose of the enzyme that cleaves IgG.
[0031] In some embodiments, the subject is administered the third dose of the enzyme within 60 hours after the second dose of the enzyme that cleaves IgG.
[0032] There is further provided a method of treating a subject having muscular dystrophy, the method comprising administering to the subject a recombinant AAVrh74 viral vector, wherein the subject has been previously administered an enzyme that cleaves IgG.
[0033] In some embodiments, the subject is administered an enzyme that cleaves IgG within 54 hours before administration of the recombinant AAVrh74 viral vector.
[0034] There is provided a method of preparing a subject for gene therapy for muscular dystrophy, the method comprising administering to the subject an enzyme that cleaves IgG before administering the recombinant AAVrh74 viral vector.
[0035] There is provided a method of removing anti-AAVrh74 antibodies in a subject, the method comprising administering an enzyme that cleaves IgG and measuring the anti-rAAVrh74 antibody titer in the subject after administering the enzyme that cleaves IgG.
[0036] In some embodiments, the method further comprises measuring the anti-rAAVrh74 antibody titer in the subject before administering an enzyme that cleaves IgG.
[0037] In some embodiments, the method further comprises administering a recombinant AAVrh74 viral vector if the anti-rAAVrh74 antibody titer measured in the subject is 1:400 or less in the total anti-AAVrh74 antibody ELISA assay.
[0038] In some embodiments, if the anti-rAAVrh74 antibody in the subject exceeds 1:400 in the total anti-AAVrh74 antibody ELISA assay, the subject is not administered a recombinant AAVrh74 viral vector.
[0039] In some embodiments, the method further comprises administering a second dose of an enzyme that cleaves IgG to the subject.
[0040] In some embodiments, the method further comprises measuring the anti-rAAVrh74 antibody titer in the subject after the second dose of the enzyme that cleaves IgG.
[0041] In some embodiments, the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody.
[0042] In some embodiments, the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody.
[0043] In some embodiments, the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both neutralizing and non-neutralizing antibodies.
[0044] In some embodiments, the subject has an anti-AAVrh74 antibody titer greater than 1:400 in the total anti-AAVrh74 antibody ELISA assay.
[0045] In some embodiments, the subject has anti-AAVrh74 antibodies in a neutralizing cell assay.
[0046] In some embodiments, the method further comprises administering a recombinant AAVrh74 viral vector if the anti-rAAVrh74 antibody titer measured in the subject is less than 1:400 in the total anti-AAVrh74 antibody ELISA assay.
[0047] In some embodiments, the recombinant AAVrh74 viral vector is administered within 54 hours after a second dose of the IgG-cleaving enzyme.
[0048] In some embodiments, if the anti-rAAVrh74 antibody titer measured in the subject is greater than 1:400 in the total anti-AAVrh74 antibody ELISA assay, the subject is not administered a recombinant AAVrh74 viral vector.
[0049] In some embodiments, the muscular dystrophy is selected from Duchenne muscular dystrophy (DMD) and limb-girdle muscular dystrophy (LGMD).
[0050] In some embodiments, the muscular dystrophy is DMD.
[0051] In some embodiments, the IgG is human IgG.
[0052] In some embodiments, the IgG-cleaving enzyme specifically targets and cleaves human IgG selected from IgG1, IgG2, IgG3, IgG4, and any combination thereof.
[0053] In some embodiments, the IgG-cleaving enzyme specifically targets and cleaves human IgG1, human IgG2, human IgG3, and human IgG4.
[0054] In some embodiments, the IgG binds to the recombinant AAVrh74 viral vector.
[0055] In some embodiments, the enzyme that cleaves immunoglobulin IgG comprises a protease.
[0056] In some embodiments, the protease comprises a cysteine protease or a thiol protease.
[0057] In some embodiments, the enzyme that cleaves IgG inactivates IgG.
[0058] In some embodiments, the enzyme that cleaves IgG cleaves human IgG in the hinge region.
[0059] In some embodiments, the protease is isolated from or derived from a protease expressed by Streptococcus pyogenes, Streptococcus equi, or Mycoplasma canis.
[0060] In some embodiments, the enzyme that cleaves IgG comprises an amino acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 1 or 2.
[0061] In some embodiments, the enzyme that cleaves IgG comprises an amino acid sequence set forth in any of SEQ ID NOs: 3 - 18.
[0062] In some embodiments, the enzyme that cleaves IgG comprises an amino acid sequence set forth in SEQ ID NO: 1 or 2.
[0063] In some embodiments, the enzyme is imurifidase.
[0064] In some embodiments, the subject has one or more IgG antibodies that specifically bind to a protein present in a recombinant AAVrh74 viral vector.
[0065] In some embodiments, the subject has one or more IgG antibodies that specifically bind to the capsid protein of the recombinant AAVrh74 viral vector.
[0066] In some embodiments, the one or more IgG antibodies are AAVrh74 neutralizing antibodies.
[0067] In some embodiments, the one or more IgG antibodies are AAVrh74 non-neutralizing antibodies.
[0068] In some embodiments, the one or more IgG antibodies are total AAVrh74 antibodies that include both neutralizing and non-neutralizing antibodies.
[0069] In some embodiments, the subject has an anti-AAVrh74 antibody titer greater than 1:400 in a total anti-AAVrh74 antibody ELISA assay.
[0070] In some embodiments, the subject has anti-AAVrh74 antibodies in a neutralizing cell assay.
[0071] In some embodiments, the subject has previously been administered a recombinant AAVrh74 viral vector.
[0072] In some embodiments, the recombinant AAVrh74 viral vector includes a gene cassette encoding a therapeutic molecule.
[0073] In some embodiments, the therapeutic molecule includes a polypeptide, an RNA molecule, or a DNA molecule.
[0074] In some embodiments, the gene cassette encodes a therapeutic polypeptide selected from dystrophin, beta-sarcoglycan, alpha-sarcoglycan, and any combination thereof.
[0075] In some embodiments, the gene cassette comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 19.
[0076] In some embodiments, the gene cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 19.
[0077] In some embodiments, the gene cassette comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 21.
[0078] In some embodiments, the gene cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 21.
[0079] In some embodiments, the gene cassette comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 23.
[0080] In some embodiments, the gene cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 23.
[0081] In some embodiments, the recombinant AAVrh74 viral vector further comprises a promoter.
[0082] In some embodiments, the promoter is a tissue-specific promoter.
[0083] In some embodiments, the promoter is selected from the MHCK7 promoter and the tMCK promoter.
[0084] In some embodiments, the promoter comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 25 or 26.
[0085] In some embodiments, the promoter comprises the nucleic acid sequence set forth in SEQ ID NO: 25 or 26.
[0086] In some embodiments, the recombinant AAVrh74 viral vector further comprises an intron.
[0087] In some embodiments, the intron comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the nucleic acid sequences set forth in SEQ ID NOs: 27-29.
[0088] In some embodiments, the intron comprises the nucleic acid sequences set forth in SEQ ID NOs: 27-29.
[0089] In some embodiments, the recombinant AAVrh74 viral vector further comprises a 3'UTR poly(A) tail sequence.
[0090] In some embodiments, the 3’UTR poly(A) tail sequence comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 30.
[0091] In some embodiments, the AAVrh74 viral vector comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a nucleic acid sequence selected from the nucleic acid sequences set forth in SEQ ID NOs: 20, 22, and 24.
[0092] In some embodiments, imlifidase is administered at a dose of 0.25 mg / kg.
[0093] In some embodiments, the recombinant AAVrh74 viral vector is delandistrogene moxeparvovec (or delandistrogene moxeparvovec-rokl), virdistrogene xparvovec, or patisiran.
[0094] In some embodiments, delandistrogene moxeparvovec, virdistrogene xparvovec, or patisiran is administered at a dose of about 1.33×10 14 vg / kg.
[0095] In some embodiments, the administration of imlifidase is intravenous.
[0096] In some embodiments, the administration of delandistrogene moxeparvovec, viltolarsen, or patisiran is intravenous.
[0097] In some embodiments, the recombinant AAVrh74 is delandistrogene moxeparvovec.
[0098] A kit for treating a subject in need of treatment for muscular dystrophy, comprising (i) an enzyme that cleaves IgG, (ii) a recombinant AAVrh74 viral vector, and (iii) instructions for administering the enzyme and / or the recombinant AAVrh74 viral vector to the subject as described herein, is further provided.
[0099] Use of a recombinant AAVrh74 viral vector for the manufacture of a medicament for treating a subject in need of treatment for muscular dystrophy, wherein the subject has been previously administered an enzyme that cleaves IgG, is provided.
[0100] Use of a recombinant AAVrh74 viral vector for the manufacture of a medicament for treating a subject in need of treatment for muscular dystrophy, in combination with an enzyme that cleaves IgG, is provided.
[0101] In some embodiments, the recombinant AAVrh74 viral vector and the enzyme are scheduled to be administered simultaneously to treat a subject in need of treatment for muscular dystrophy.
[0102] In some embodiments, the recombinant AAVrh74 viral vector and the enzyme are scheduled to be administered sequentially.
[0103] In some embodiments, the recombinant AAVrh74 viral vector is administered within 54 hours after the administration of the enzyme.
[0104] In some embodiments, the muscular dystrophy is selected from DMD and LGMD.
[0105] In some embodiments, the muscular dystrophy is DMD.
[0106] Also provided is a composition comprising a recombinant AAVrh74 viral vector for use in treating a subject in need of treatment of muscular dystrophy, wherein the subject has been previously administered an enzyme that cleaves IgG.
[0107] Provided is a composition comprising a recombinant AAVrh74 viral vector in combination with an enzyme that cleaves IgG for use in treating a subject in need of treatment of muscular dystrophy.
[0108] In some embodiments, the recombinant AAVrh74 viral vector and the enzyme are scheduled to be administered simultaneously for use in treating a subject in need of treatment of muscular dystrophy.
[0109] In some embodiments, the recombinant AAVrh74 viral vector and the enzyme are scheduled to be administered sequentially.
[0110] In some embodiments, the recombinant AAVrh74 viral vector is administered within 54 hours after administration of the enzyme.
[0111] In some embodiments, the muscular dystrophy is selected from DMD and LGMD.
[0112] In some embodiments, the muscular dystrophy is DMD.
[0113] Further provided is a method for removing anti-AAVrh74 antibodies in treating a subject in need thereof, the method comprising administering imlifidase and measuring the anti-rAAVrh74 antibody titer in the subject after administering imlifidase.
[0114] In some embodiments, the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody.
[0115] In some embodiments, the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody.
[0116] In some embodiments, the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both neutralizing and non-neutralizing antibodies.
[0117] In some embodiments, the subject has an anti-AAVrh74 antibody titer greater than 1:400 in a total anti-AAVrh74 antibody ELISA assay.
[0118] In some embodiments, the subject has an anti-AAVrh74 antibody in a neutralizing cell assay.
[0119] In some embodiments, the method further comprises measuring the anti-rAAVrh74 antibody titer in the subject before administering imlifidase.
[0120] In some embodiments, the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody.
[0121] In some embodiments, the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody.
[0122] In some embodiments, the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both neutralizing and non-neutralizing antibodies.
[0123] In some embodiments, the subject has an anti-AAVrh74 antibody titer greater than 1:400 in a total anti-AAVrh74 antibody ELISA assay.
[0124] In some embodiments, the subject has an anti-AAVrh74 antibody in a neutralizing cell assay.
[0125] In some embodiments, the method further comprises administering a recombinant AAVrh74 viral vector if the anti-rAAVrh74 antibody titer measured in the subject is 1:400 or less in the total anti-AAVrh74 antibody ELISA assay.
[0126] In some embodiments, Imuridase is administered at a dose of 0.25 mg / kg.
[0127] In some embodiments, the recombinant AAVrh74 viral vector is Delandistrogene moxeparvovec, Bicistrovir gene xparvovec, or Patisistrogene bexparvovec.
[0128] In some embodiments, the recombinant AAVrh74 is Delandistrogene moxeparvovec.
[0129] In some embodiments, Delandistrogene moxeparvovec, Bicistrovir gene xparvovec, or Patisistrogene bexparvovec is administered at a dose of about 1.33×10 14 vg / kg.
[0130] In some embodiments, Delandistrogene moxeparvovec is administered at a dose of about 1.33×10 14 vg / kg.
[0131] In some embodiments, the administration of Imuridase is intravenous.
[0132] In some embodiments, the administration of Delandistrogene moxeparvovec, Bicistrovir gene xparvovec, or Patisistrogene bexparvovec is intravenous.
[0133] In some embodiments, if the anti-rAAVrh74 antibody titer measured in the subject exceeds 1:400 in the total anti-AAVrh74 antibody ELISA assay, the subject is not administered a recombinant AAVrh74 viral vector.
[0134] In some embodiments, the method further comprises administering a second dose of Immulifidase to the subject.
[0135] In some embodiments, the second dose of Immulifidase is 0.25 mg / kg.
[0136] In some embodiments, the second dose of Immulifidase is administered within 60 hours after the first dose.
[0137] In some embodiments, the method further comprises measuring the anti-rAAVrh74 antibody titer in the subject after the second dose of Immulifidase.
[0138] In some embodiments, the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody.
[0139] In some embodiments, the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody.
[0140] In some embodiments, the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both neutralizing and non-neutralizing antibodies.
[0141] In some embodiments, the method further comprises administering a recombinant AAVrh74 viral vector if the anti-rAAVrh74 antibody titer measured in the subject is 1:400 or less in the total anti-AAVrh74 antibody ELISA assay.
[0142] In some embodiments, the recombinant AAVrh74 viral vector is administered within 54 hours after the second dose of Immulifidase. BRIEF DESCRIPTION OF THE DRAWINGS
[0143]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6A
Figure 6B
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Mode for Carrying Out the Invention
[0144] The present disclosure is directed to a method of treating a subject having muscular dystrophy, the method comprising administering to the subject a recombinant AAVrh74 viral vector and an enzyme that cleaves immunoglobulin G (IgG). In some embodiments, the muscular dystrophy is DMD. In some embodiments, the muscular dystrophy is LGMD.
[0145] I. Terms To facilitate a better understanding of the present disclosure, certain terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout this application.
[0146] It should be noted that the term "a" or "an" entity refers to one or more of that entity; for example, it is understood that "a nucleotide sequence" represents one or more nucleotide sequences. Thus, the terms "a" (or "an"), "one or more", and "at least one" can be used interchangeably herein.
[0147] Furthermore, "and / or" as used herein, when used in a phrase such as "A and / or B", should be regarded as a specific disclosure of each of the two specified features or components, regardless of the presence or absence of the other. Thus, the term "and / or" as used in a phrase such as "A and / or B" herein is intended to include "A and B", "A or B", "A" (alone), and "B" (alone). Similarly, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to include each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0148] The term "about" is used herein to mean approximately, roughly, around, or in that vicinity. When the term "about" is used in conjunction with a numerical range, the range is thereby modified by extending the boundaries above and below the recited numerical values. Generally, the term "about" is used herein to modify a numerical value up or down (higher or lower) by a variation of 10 percent above and below the recited value, unless otherwise indicated.
[0149] The term "at least" before a number or series of numbers is understood to include the number adjacent to the term "at least" and all subsequent numbers or integers that can be logically included, as is apparent from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21-nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the indicated property. When "at least" is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers within that series or range. "At least" is not limited to integers (e.g., "at least 5%" includes 5.0%, 5.1%, 5.18% without considering the number of significant figures).
[0150] Whenever an aspect is described herein using the language “comprising,” other aspects similar in other respects that are described by “consisting of” and / or “consisting essentially of” are understood to be provided.
[0151] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press, The Dictionary of Cell and Molecular Biology, 5th ed., 2013, Academic Press, and the Oxford Dictionary of Biochemistry and Molecular Biology, 2nd ed., 2006, Oxford University Press provide one of ordinary skill in the art with general dictionaries of many of the terms used in this disclosure.
[0152] Units, prefixes, and symbols are denoted in their internationally approved SI forms. Numerical ranges include the numbers defining the range. Unless otherwise indicated, nucleotide sequences are written left to right in a 5' to 3' direction. Amino acid sequences are written left to right in an amino to carboxy orientation. Headings provided herein do not limit the various aspects of the disclosure and may be included by reference to the entire specification. Accordingly, the terms defined immediately below are more fully defined by reference to the entire specification.
[0153] As used herein, the term "enzyme that cleaves IgG" refers to a polypeptide (e.g., a protease) that promotes the cleavage of immunoglobulin G (IgG). In some embodiments, the cleavage of IgG inactivates the IgG. In some embodiments, the cleavage of IgG prevents the ability of the IgG to bind to an antigen. Any enzyme capable of cleaving IgG can be used in the methods disclosed herein. Examples of suitable enzymes can be found, for example, in International Publication No. WO2020 / 102740 and European Patent Application No. EP3768304 (B1), which are hereby incorporated by reference in their entirety. In some embodiments, the enzyme that cleaves IgG includes IdeS (immunoglobulin-degrading enzyme of S. Pyrogenes, also known as Imurifidase).
[0154] As used herein, the term "adeno-associated virus" (AAV) is a common abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells in which a specific function is provided by a coinfecting helper virus. AAV serotypes include AAV type 1, AAV type 2, AAV type 3 (including 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh74, AAV serotypes and clades disclosed by Gao et al. (J. Virol. 78:6381 (2004)) and Moris et al. (Virol. 33:375 (2004)), and any other AAVs currently known or later discovered. See, for example, FIELDS et al. VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
[0155] As used herein, the term "adeno-associated vector nucleic acid" or "AAV vector nucleic acid" refers to a vector comprising one or more polynucleotides of interest (or "transgenes", such as dystrophin, etc.) adjacent to AAV inverted terminal repeat sequences (ITRs). Such AAV vector nucleic acids can replicate and package into infectious virus particles when present in host cells transfected with a vector encoding and expressing the rep and cap gene products.
[0156] As used herein, the terms "AAV vector", "AAV virion", "AAV virus particle", "AAV vector particle", "AAVrh74 vector", "AAVrh74 virion", "AAVrh74 virus particle", or "AAVrh74 vector particle" refer to virus particles consisting of at least one AAV capsid protein or AAVrh74 capsid protein and a capsid-forming polynucleotide AAV vector. If the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene intended to be delivered to mammalian cells, etc.), the particle is typically referred to as an "AAV vector particle", "AAVrh74 vector particle", or in some cases simply an "AAV vector" or "AAVrh74 vector". Thus, the production of AAV vector particles necessarily involves the packaging of AAV vector nucleic acids into the AAV capsid.
[0157] "Serotype" with respect to a vector or virus capsid is defined by different immunological profiles based on the capsid protein sequence and capsid structure.
[0158] "AAV Cap" means the AAV Cap proteins VP1, VP2, and VP3, and their analogs.
[0159] "AAV Rep" means the AAV Rep proteins and their analogs.
[0160] As used herein, "adjacent," with respect to an array in which other elements are adjacent, refers to the presence of one or more adjacent elements upstream and / or downstream of, i.e., on the 5' side and / or 3' side of, that array. The term "adjacent" is not intended to indicate that the arrays are necessarily contiguous. For example, there may be sequences intervening between a nucleic acid encoding a transgene and an adjacent element. Two other elements (e.g., ITRs) that are "adjacent" to an array (e.g., a transgene) indicate that one element is located on the 5' side of that array and the other is located on the 3' side of that array, although there may be sequences intervening between them.
[0161] In some embodiments, "AAV" includes derivatives of known AAVs. In some embodiments, "AAV" includes modified AAVs or artificial AAV vectors. In certain embodiments, AAV is AAVrh74. As used herein, "AAVrh74" refers to adeno-associated virus rhesus macaque serotype 74, which is endogenous to rhesus macaques and was first isolated from mesenteric lymph nodes and subsequently from the spleen.
[0162] As used herein, the term "derived from" refers to a component isolated from a particular molecule or organism, or information from a particular molecule or organism (e.g., an amino acid sequence or nucleic acid sequence), or a component made using them. For example, a nucleic acid sequence derived from a second nucleic acid sequence can include a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence. In the case of a nucleotide or polypeptide, the resulting species can be obtained, for example, by naturally occurring mutagenesis, site-directed mutagenesis, or random mutagenesis. The mutagenesis used to derive a nucleotide or polypeptide can be intentionally directed, intentionally random, or a mixture of each. Mutagenesis of a nucleotide or polypeptide to create a different nucleotide or polypeptide derived from a first nucleotide or polypeptide can be a random event (e.g., caused by polymerase infidelity), and the identification of the resulting nucleotide or polypeptide can be performed, for example, by appropriate screening methods discussed herein. Mutagenesis of a polypeptide typically involves manipulation of the polynucleotide encoding the polypeptide.In some embodiments, the nucleotide sequence or amino acid sequence derived from the second nucleotide sequence or amino acid sequence has at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity with the second nucleotide sequence or amino acid sequence, and the first nucleotide sequence or amino acid sequence retains the biological activity of the second nucleotide sequence or amino acid sequence.
[0163] The terms "nucleic acid", "nucleic acid molecule", "nucleotide", "nucleotide sequence", and "polynucleotide" are used interchangeably and refer to ribonucleosides (adenosine, guanosine, uridine, or cytidine, "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine, "DNA molecules") in the form of a phosphoester polymer, either in single-stranded form or as a double-stranded helix, or any phosphoester analog thereof, such as phosphorothioates and thioesters. A single-stranded nucleic acid sequence refers to single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double-stranded DNA-DNA, DNA-RNA, and RNA-RNA helices are possible. The term nucleic acid molecule, particularly DNA molecule or RNA molecule, refers only to the primary and secondary structure of the molecule and is not limited to any particular tertiary form. Thus, the term includes, among other things, linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA, and double-stranded DNA found in chromosomes. When discussing the structure of a particular double-stranded DNA molecule, the sequence can be described herein according to the usual convention of simply providing the sequence in the 5' to 3' direction along the non-transcribed strand of the DNA (i.e., the strand having the sequence homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that has been subjected to molecular biology manipulations. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA. The "nucleic acid composition" of the present disclosure includes one or more nucleic acids described herein.
[0164] As used herein, the term "expression cassette" refers to any type of genetic construct that contains a nucleic acid capable of transcribing some or all of the sequence encoding a nucleic acid. Typically, an expression cassette contains a promoter operably linked to a nucleic acid (e.g., a transgene of interest). In some embodiments, the "expression cassette" contains a polynucleotide sequence encoding human dystrophin. In some embodiments, the "expression cassette" contains a polynucleotide sequence that is an intron. In some embodiments, the "expression cassette" contains a polynucleotide sequence that induces the addition of a polyadenosine (poly(A)) tail.
[0165] As used herein, the "coding region" or "coding sequence" is a portion of a polynucleotide consisting of codons that are translatable into amino acids. A "stop codon" (TAG, TGA, or TAA) is typically not translated into an amino acid and can be considered part of the coding region, but any adjacent sequences, such as a promoter, ribosome binding site, transcription terminator, intron, etc., are not part of the coding region. The boundaries of the coding region are typically determined by the start codon at the 5' end that encodes the amino terminus of the resulting polypeptide and the translation stop codon at the 3' end that encodes the carboxyl terminus of the resulting polypeptide. Two or more coding regions can be present in a single polynucleotide construct, e.g., on a single vector, or in separate polynucleotide constructs, e.g., on separate (different) vectors. Subsequently, a single vector can contain only a single coding region or can contain two or more coding regions. As used herein, "transcript" refers to, for example, an mRNA sequence formed during DNA transcription by, e.g., RNA polymerase.
[0166] The term "downstream" refers to a nucleotide sequence located on the 3' side of a reference nucleotide sequence. In certain embodiments, the downstream nucleotide sequence is related to the sequence following the transcription start point. For example, the translation start codon of a gene is located downstream of the transcription start site. The term "upstream" refers to a nucleotide sequence located on the 5' side of a reference nucleotide sequence. In certain embodiments, the upstream nucleotide sequence is related to the sequence located on the 5' side of the coding region or at the transcription start point. For example, most promoters are located upstream of the transcription start site.
[0167] A product, e.g., a polynucleotide encoding a microdystrophin, e.g., a gene cassette disclosed herein, can include a promoter and / or other expression (e.g., transcription or translation) control elements operably associated with one or more coding regions. In an operable association, the coding region of a gene product, e.g., a polypeptide, is associated with one or more regulatory regions such that expression of the gene product occurs under the influence or control of the regulatory region. For example, when induction of promoter function results in transcription of mRNA encoding the gene product encoded by the coding region and the nature of the linkage between the promoter and the coding region does not interfere with the ability of the promoter to induce expression of the gene product or the ability of the DNA template to be transcribed, the coding region and the promoter are "operably associated." Other expression control elements, such as enhancers, operators, repressors, and transcription termination signals, in addition to the promoter, can also be operably associated with the coding region to induce gene product expression.
[0168] The "transcription control array" refers to DNA regulatory sequences such as promoters, enhancers, and terminators that provide for the expression of a coding sequence in a host cell. Various transcription control regions are known to those skilled in the art. These include, but are not limited to, promoters and enhancer segments derived from cytomegalovirus (the immediate early promoter in combination with intron-A), simian virus 40 (early promoter), and retroviruses (such as Rous sarcoma virus), which include transcription control regions that function in vertebrate cells. Other transcription control regions include those derived from vertebrate genes such as actin, heat shock protein, bovine growth hormone, and rabbit β-globin, as well as other sequences capable of controlling gene expression in eukaryotic cells. Additional suitable transcription control regions include tissue-specific promoters and enhancers, as well as lymphokine-inducible promoters (e.g., promoters inducible by interferon or interleukin).
[0169] Similarly, various translation control elements are known to those skilled in the art. These include, but are not limited to, ribosome binding sites, translation initiation and termination codons, and elements derived from picornaviruses (especially the internal ribosome entry site, also known as the CITE sequence, i.e., IRES).
[0170] "Promoter" and "promoter sequence" are used interchangeably and refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. Generally, the coding sequence is located on the 3'-side of the promoter sequence. Promoters may be wholly derived from natural genes, or may consist of different elements derived from different promoters found in nature, or may even contain synthetic DNA segments. It is understood by those skilled in the art that different promoters can induce the expression of genes in different tissues or cell types, or at different developmental stages, or in response to different environmental or physiological conditions. A promoter that expresses a gene in most cell types is generally referred to as a "constitutive promoter". A promoter that expresses a gene in a specific cell type is generally referred to as a "cell-specific promoter" or "tissue-specific promoter". A promoter that expresses a gene at a specific developmental stage or cell differentiation stage is generally referred to as a "development-specific promoter" or "cell differentiation-specific promoter". A promoter that is induced after exposure or treatment of cells with an agent, biological molecule, chemical, ligand, light, etc. that induces the promoter and expresses a gene is generally referred to as an "inducible promoter" or "regulatory promoter". It is further recognized that in most cases, since the exact boundaries of regulatory sequences are not fully defined, DNA fragments of different lengths can have the same promoter activity.
[0171] A promoter sequence typically extends upstream (in the 5'-direction) to be bounded at its 3'-end by the transcription start site and to contain a minimum number of bases or elements necessary to initiate transcription at a detectable level above background. Within the promoter sequence are found the transcription start site (conveniently defined, for example, by mapping with nuclease S1), as well as protein-binding domains (consensus sequences) involved in the binding of RNA polymerase.
[0172] In some embodiments, the nucleic acid molecule comprises a tissue-specific promoter. In certain embodiments, the tissue-specific promoter drives the expression of a therapeutic protein, such as dystrophin or microdystrophin, in the brain, muscle, kidney, lung, testis, or any combination thereof. In particular embodiments, the promoter is selected from the group consisting of enhancer 358bp muscle creatine kinase proximal promoter (Enh358MCK), muscle creatine kinase (CK) promoter (e.g., hCK (SEQ ID NO: 31) or hCK plus (SEQ ID NO: 32), truncated muscle creatine kinase promoter (tMCK, SEQ ID NO: 26), myosin heavy chain (MHC), MHCK7 (hybrid version of MHC and MCK, SEQ ID NO: 25), C5-12 (synthetic promoter), muscle-specific and heart-specific enhancer (MHCK), CK8, SPc5-12, human desmin (Des) promoter, human alpha-myosin heavy chain (α-MHC) promoter, rat myosin light chain 2 (MLC-2) promoter, and human cardiac troponin C (cTnC) promoter. In certain embodiments, the promoter comprises the tMCK promoter. In certain embodiments, the promoter comprises the MHCK7 promoter.
Table 1-1
Table 1-2
[0173] In some embodiments, the expression of a protein product, such as dystrophin or microdystrophin, can be increased using one or more enhancers. The enhancer can be located, for example, in the AAV, 5', or 3' of the coding region, or within an intron. In some embodiments, one or more enhancers are tissue-specific enhancers. In certain embodiments, one or more enhancers are selected from a human skeletal actin gene element, a cardiac actin gene element, a muscle cell-specific enhancer binding factor MEF (e.g., MEF2), a MyoD enhancer element, a cardiac enhancer factor (CEF) site, a mouse creatine kinase enhancer element, a skeletal fast-twitch troponin C gene element, a slow-twitch troponin C gene element, a slow-twitch troponin I gene element, a hypoxia-inducible nuclear factor, a steroid-inducible element, a glucocorticoid response element (GRE), and any combination thereof.
[0174] As used herein, the term "expression" refers to the process by which a polynucleotide produces a gene product, such as RNA or polypeptide. This includes, but is not limited to, transcription of the polynucleotide into messenger RNA (mRNA), transfer RNA (tRNA), small hairpin RNA (shRNA), small interfering RNA (siRNA), or any other RNA product, and translation of the mRNA into a polypeptide. Expression results in the production of a "gene product." As used herein, a gene product can be either a nucleic acid, such as messenger RNA produced by transcription of a gene, or a polypeptide translated from a transcript. Gene products described herein further include nucleic acids having post-transcriptional modifications, such as polyadenylation or splicing, or polypeptides having post-translational modifications, such as methylation, glycosylation, lipid addition, association with other protein subunits, or proteolytic cleavage. As used herein, the term "yield" refers to the amount of polypeptide produced by the expression of a gene.
[0175] As used herein, the terms "dystrophin", "dys", or "dystrophin polypeptide" are intended to refer to the full-length dystrophin protein as well as fragments and / or variants thereof. Human dystrophin is encoded by the DMD gene, is 2.4 megabases (mb) in size, and contains 79 exons. Full-length human dystrophin contains an N-terminal (NT) domain, four hinge regions (H1-H4), 24 spectrin-like repeat regions (R1-R24), a cysteine-rich (CR) domain, and a C-terminal (CT) domain. Dystrophin may further include various binding domains, including one or more dystroglycan binding domains (Dg BD) (e.g., located within the H4 and CR domains), one or more neuronal nitric oxide synthase binding domains (e.g., located within one or more of the spectrin-like repeat regions, e.g., within R16 and R17), one or more syntrophin binding domains (Syn BD) (e.g., located within the CT domain), and one or more dystrobrevin binding domains (DB BD) (e.g., located within the CT domain). Structurally, the spectrin-like repeats form a central rod domain, giving dystrophin a modular structure. In some embodiments, the region of dystrophin containing R1-R24 is collectively referred to as the "rod domain".
[0176] As used herein, "dystrophin" includes fragments of the full-length dystrophin sequence that can be used interchangeably with "microdystrophin" or "minidystrophin". "Microdystrophin" is used to refer to any dystrophin polypeptide that contains deletions compared to the full-length dystrophin sequence. Dystrophin, e.g., microdystrophin, can include deletions at the N-terminus (e.g., deletion of all or part of the NT domain), deletions at the C-terminus (e.g., deletion of all or part of the CT domain), deletions between the N-terminus and the C-terminus (e.g., deletion of one or more hinge regions or parts thereof and / or one or more spectrin-like repeat regions or parts thereof), or any combination thereof. Dystrophin, e.g., microdystrophin, can include deletions within one or more of the NT domain, hinge region, spectrin-like repeat region, CR domain, and CT domain. In some embodiments, the deletions include partial deletions of one or more of the NT domain, hinge region, spectrin-like repeat region, CR domain, and CT domain. In some embodiments, the deletions include complete deletions of one or more of the NT domain, hinge region, spectrin-like repeat region, CR domain, and CT domain. Examples of dystrophin and / or microdystrophin useful in the present disclosure can be found, for example, in International Publication Nos. WO / 2002 / 029056, WO / 2008 / 088895, WO / 2010 / 093784, WO / 2011 / 088081, WO / 2014 / 193716, WO / 2016 / 004319, WO / 2016 / 115543, WO / 2017 / 077451, WO / 2017 / 221145, WO / 2019 / 012336, WO / 2019 / 245973, U.S. Publication No. US2017 / 0368198, and U.S. Patent No. 7,655,467. Each of these is hereby incorporated by reference in its entirety. In certain embodiments, microdystrophin retains the function of the full-length dystrophin. In certain embodiments, dystrophin includes an amino acid sequence selected from the amino acid sequences set forth in SEQ ID NOs: 40-44.In certain embodiments, dystrophin comprises an amino acid sequence encoded by a nucleic acid sequence selected from the nucleic acid sequences set forth in SEQ ID NOs: 19 and 33-39. In some embodiments, dystrophin comprises an amino acid sequence encoded by the nucleic acid sequence set forth in SEQ ID NO: 19. In certain embodiments, AAVrh74 comprises a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 19.
Table 2-1
Table 2-2
Table 2-3
Table 2-4
Table 2-5
Table 2-6
Table 2-7
[0177] As used herein, the terms “beta-sarcoglycan,” “b-sarcoglycan,” “β-sarcoglycan,” or “SGCB” refer to a sub-complex of the dystrophin-glycoprotein complex that forms a linkage between the F-actin cytoskeleton and the extracellular matrix. Beta-sarcoglycan is highly expressed in the heart and skeletal muscle and to a lesser extent in the brain, kidney, placenta, and lung. The standard amino acid sequence of beta-sarcoglycan is shown in Table 3 as SEQ ID NO: 45 (Uniprot Q16585). In some embodiments, the recombinant AAVrh74 viral vector of the present disclosure comprises a gene cassette comprising a nucleic acid molecule encoding beta-sarcoglycan. Non-limiting examples of beta-sarcoglycan sequences and constructs useful in the present disclosure are disclosed in International Publication WO2017 / 180976, which is hereby incorporated by reference in its entirety. In some embodiments, the nucleic acid molecule encoding beta-sarcoglycan comprises the nucleic acid sequence set forth in SEQ ID NO: 21 (Table 3). [Table 3]
[0178] As used herein, the terms "alpha-sarcoglycan", "a-sarcoglycan", "α-sarcoglycan", or "SGCA" refer to a sub-complex of the dystrophin-glycoprotein complex that forms a link between the F-actin cytoskeleton and the extracellular matrix. Alpha-sarcoglycan is highly expressed in skeletal muscle, less so in cardiac muscle, and much less so in the lung. The standard amino acid sequence of alpha-sarcoglycan is shown in Table 4 as SEQ ID NO: 46 (Uniprot Q16586). In some embodiments, the recombinant AAVrh74 viral vector of the disclosure comprises a gene cassette comprising a nucleic acid molecule encoding alpha-sarcoglycan. Non-limiting examples of alpha-sarcoglycan sequences and constructs useful in the disclosure are disclosed in International Publication WO2013 / 078316, which is hereby incorporated by reference in its entirety. In some embodiments, the nucleic acid molecule encoding alpha-sarcoglycan comprises the nucleic acid sequence set forth in SEQ ID NO: 23 (Table 4).
Table 4
[0179] As used herein, the term "polypeptide" is intended to include not only the singular form "polypeptide" but also the plural form "polypeptides", and refers to a molecule consisting of monomers (amino acids) linearly linked by amide bonds (alternatively referred to as peptide bonds). The term "polypeptide" refers to any chain (s) of two or more amino acids and does not refer to a specific length of the product. Thus, the term "polypeptide" includes peptides, dipeptides, tripeptides, oligopeptides, "proteins," "amino acid chains," or any other term used to refer to a chain (s) of two or more amino acids, and the term "polypeptide" can be used in place of or interchangeably with any of these terms. The term "polypeptide" is also intended to refer to the product of post-expression modification of a polypeptide, including, but not limited to, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting groups / blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. A polypeptide can be derived from a natural biological source or can be produced by recombinant techniques, but is not necessarily translated from a specified nucleic acid sequence. It can be produced in any manner, including by chemical synthesis.
[0180] The term "percent identity", known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptide sequences or polynucleotide sequences, and in some cases, can be determined by the match between such strings of sequences. "Identity" can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology (Lesk, A.M., ed.) Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects (Smith, D.W., ed.) Academic Press, New York (1993), Computer Analysis of Sequence Data, Part I (Griffin, A.M., and Griffin, H.G., eds.) Humana Press, New Jersey (1994), Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987), and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991). Preferred methods for determining identity are designed to give the best match between the sequences being tested. Methods for determining identity are codified in publicly available computer programs.Array alignment and percent identity calculations can be performed using sequence analysis software such as the Megalign program of the LASERGENE Bioinformatics Computing Suite (DNASTAR Inc., Madison, WI), the GCG program suite (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, WI), BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol. 215:403 (1990)), and DNASTAR (DNASTAR, Inc., 1228 S. Park St. Madison, WI 53715 USA). In the context of this application, when sequence analysis software is used for analysis, it will be understood that the results of that analysis are based on the "default values" of the program being referenced, unless otherwise specified. As used herein, "default values" will mean any set of values or parameters that are initially loaded into the software when first initialized. For the purpose of determining the percent identity between the sequence of a therapeutic protein of the present disclosure, such as dystrophin, and a reference sequence, only the nucleotides in the reference sequence that correspond to the nucleotides in the sequence of the therapeutic protein of the present disclosure, such as dystrophin, are used to calculate the percent identity.
[0181] As used herein, the nucleotides corresponding to the nucleotides in a particular sequence of the present disclosure are identified by alignment of the sequences of the present disclosure to maximize identity to the reference sequence. The number used to identify the equivalent amino acids in the reference sequence is based on the number used to identify the corresponding amino acids in the sequences of the present disclosure.
[0182] As used herein, the term "linked" refers to a first amino acid or nucleotide sequence covalently or non-covalently attached to a second amino acid or nucleotide sequence, respectively. The first amino acid or nucleotide sequence can be directly attached or juxtaposed to the second amino acid or nucleotide sequence, or alternatively, intervening sequences can covalently attach the first sequence to the second sequence. The term "linked" does not mean only fusion of the first amino acid sequence to the second amino acid sequence at the C-terminus or N-terminus, but also includes insertion of the first amino acid sequence (or the second amino acid sequence) into any two amino acids in the second amino acid sequence (or the first amino acid sequences, respectively). In one embodiment, the first amino acid sequence can be linked to the second amino acid sequence by a peptide bond or a linker. The first nucleotide sequence can be linked to the second nucleotide sequence by a phosphodiester bond or a linker. The linker can be a peptide or polypeptide (in the case of a polypeptide chain), or a nucleotide or nucleotide chain (in the case of a nucleotide chain), or any chemical moiety (in the case of both polypeptide and polynucleotide chains). The term "linked" is also denoted by a hyphen (-).
[0183] As used herein, the term "Duchenne muscular dystrophy" or "DMD" refers to a class of muscular dystrophies caused by mutations in the DMD gene, resulting in the absence of dystrophin, a 427-kD muscle-sheath protein that associates with the dystrophin-associated protein complex (DAPC) (Hoffman et al., Cell 51(6):919-28, 1987). The DAPC consists of multiple proteins in the muscle sheath that form a structural link between the extracellular matrix (ECM) and the cytoskeleton via dystrophin, an actin-binding protein, and alpha-dystroglycan, a laminin-binding protein. These structural links function to stabilize the sarcolemma during contraction and protect against damage induced by contraction. Loss of dystrophin results in membrane fragility, leading to sarcolemmal tears and calcium influx, which in turn causes calcium-activated proteases and segmental fiber necrosis (Straub et al., Curr Opin. Neurol. 10(2):168-75, 1997). This uncontrolled cycle of muscle degeneration and regeneration ultimately depletes the muscle stem cell population (Sacco et al., Cell, 2010. 143(7):p. 1059-71, Wallace et al., Annu Rev Physiol, 2009. 71:p. 37-57), resulting in progressive muscle weakness, myositis, and fibrous scarring. It is estimated that 1 in 5,000 newborn males is affected by DMD.
[0184] As used herein, the term "limb-girdle muscular dystrophy" or "LGMD" generally refers to a class of muscular dystrophies that develop in the proximal muscles around the hips and shoulders. LGMD is the fourth most common genetic cause of muscle weakness, with an estimated prevalence of approximately 2 per 100,000 people. The unifying feature of LGMD is muscle weakness and atrophy of the limb-girdle muscles. However, the age at which symptoms appear, as well as the rate and severity of disease progression, can vary. There are at least 19 subtypes of LGMD, which are classified by their associated genetic defects: LGMD1A (autosomal dominant, myotilin gene), LGMD1B (autosomal dominant, lamin A / C gene), LGMD1C (autosomal dominant, caveolin gene), LGMD1D (autosomal dominant, chromosome 7), LGMD1E (autosomal dominant, chromosome 6), LGMD1F (autosomal dominant, chromosome 7), LGMD1G (autosomal dominant, chromosome 4), LGMD2A (autosomal recessive, calpain-3 gene), LGMD2B (autosomal recessive, dysferlin gene), LGMD2C (autosomal recessive, gamma-sarcoglycan gene), LGMD2D (autosomal recessive, alpha-sarcoglycan gene), LGMD2E (autosomal recessive, beta-sarcoglycan gene), LGMD2F (autosomal recessive, delta-sarcoglycan gene), LGMD2G (autosomal recessive, telethonin gene), LGMD2H (autosomal recessive, TRIM32), LGMD2I (autosomal recessive, FKRP gene), LGMD2J (autosomal recessive, titin gene), LGMD2K (autosomal recessive, POMT1 gene), and LGMD2L (autosomal recessive, fukutin gene).
[0185] As used herein, the term "North Star Ambulatory Assessment (NSAA) score" refers to a scale administered by a clinician that assesses the performance of 17 different functional activities, including 10-meter walk / run (10MWR), rising from sitting to standing, standing on one leg, ascending a box step, descending a box step, rising from supine to sitting, rising from the floor, lifting the head from the floor, standing on tiptoe, and hopping (Mazzone E, et al., North Star Ambulatory Assessment, 6-minute walk test and timed items in ambulant boys with Duchenne muscular dystrophy, Neuromuscul Disord. 20(11):712-6, 2010). Subjects are graded as follows: 2 = normal, no obvious activity modification; 1 = modified method, but achieving the goal without physical assistance from others; 0 = unable to achieve the goal independently.
[0186] The terms "effective amount" and "therapeutically effective amount" are used interchangeably herein and refer to the amount of a therapeutic compound, such as an AAV vector or enzyme disclosed herein, that is effective to produce the desired therapeutic effect when administered to a mammalian subject, either as a single dose or as part of a series of doses. In the case of an enzyme, this effect is typically brought about by cleavage of an IgG target. In the case of an AAV vector, the desired therapeutic effect is typically brought about by expression of a heterologous transgene present in the AAV vector and / or the persistence of the AAV vector in the subject.
[0187] "Enhance" or "enhancing", or "increase" or "increasing", or "stimulate" or "stimulating" generally refers to the ability of any one or more of the aforementioned AAVs, enzymes, or pharmaceutical compositions to produce or cause a greater physiological response (i.e., downstream effect) in a cell or subject as compared to the response caused by any of administration of no AAV, no enzyme, or a control compound.
[0188] As used herein, terms such as "function" and "functionality" refer to biological function, enzymatic function, or therapeutic function.
[0189] The phrase "pharmaceutically acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with other ingredients, including the formulation, and / or the subject being treated therewith.
[0190] As used herein, the phrase "pharmaceutically acceptable carrier" means a non-toxic, inert solid, semi-solid, or liquid filler, diluent, encapsulating material, or any type of formulation adjuvant. Some examples of materials that can serve as pharmaceutically acceptable carriers are, at the discretion of the formulator, sugars such as lactose, glucose, sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate; coloring agents; release agents; coating agents; sweetening agents; flavoring agents; fragrances; preservatives; and antioxidants.
[0191] The term "repair" with respect to the synthesis or production of a particular protein generally refers to the production of a protein, including a truncated protein, in a patient with muscular dystrophy after treatment with an AAV vector disclosed herein, such as an AAVrh74 vector.
[0192] In some embodiments, treatment with the AAV vectors disclosed herein, such as the AAVrh74 vector, decelerates or reduces progressive respiratory muscle dysfunction and / or failure in patients with DMD or LGMD that would be expected without treatment. In some embodiments, treatment with the AAV vectors disclosed herein, such as the AAVrh74 vector, can reduce or eliminate the need for respiratory assistance that would be expected without treatment. In some embodiments, measurements of respiratory function to track the course of the disease, as well as assessment of possible therapeutic interventions, include maximal inspiratory pressure (MIP), maximal expiratory pressure (MEP), and forced vital capacity (FVC). MIP and MEP measure the pressure levels that a person can generate during inhalation and exhalation, respectively, and these are sensitive measures of respiratory muscle strength. MIP is a measure of the diaphragmatic muscle strength decline.
[0193] In some embodiments, MEP can decline prior to changes in other pulmonary function tests including MIP and FVC. In certain embodiments, MEP can be an early indicator of respiratory dysfunction. In certain embodiments, FVC can be used to measure the total volume of air exhaled during a forced exhalation after a maximal inhalation. In DMD patients, FVC increases with body growth until the mid-teens. However, as the disease progresses and growth is retarded or impeded and muscle strength declines, the vital capacity enters a decline phase and decreases at an average rate of about 8-8.5 percent per year after 10-12 years of age. In certain embodiments, predicted MIP percent (MIP is adjusted for body weight), predicted MEP percent (MEP is adjusted for age), and predicted FVC percent (FVC is adjusted for age and height) are supportive analyses.
[0194] As used herein, the terms "subject" and "patient" include any animal that has or is at risk of having DMD or LGMD, or any of the symptoms associated with these conditions (e.g., muscle fiber loss), or that presents or is at risk of presenting a condition treatable with an AAV of the present disclosure, e.g., an AAVrh74 vector disclosed herein. Suitable subjects (or patients) include laboratory animals (such as mice, rats, rabbits, or guinea pigs), livestock, and breeding or pet animals (such as cats or dogs). Non-human primates, and preferably human patients (or subjects), are included. In certain embodiments, the subject is male.
[0195] As used herein, the phrases "systemic administration", "systemically administered", "peripheral administration", and "peripherally administered" mean the administration of a compound, drug, or other substance other than direct administration to the central nervous system, e.g., subcutaneous administration, whereby the compound, drug, or other substance enters the patient's system and is thus subject to metabolism and other similar processes.
[0196] As used herein, the phrases "parenteral administration" and "parenterally administered" mean a mode of administration other than enteral and topical administration, usually by injection, and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subdural, intraspinal, and intrasternal injections and infusions.
[0197] "Treatment" of a subject (e.g., a mammal such as a human) or a cell is any type of intervention used in an attempt to alter the natural course of the subject or cell. Treatment includes, but is not limited to, administration of an AAV vector disclosed herein, e.g., an AAVrh74 vector and an enzyme that cleaves IgG, and the treatment can be carried out either prophylactically or after the onset of a pathological event or after contact with a pathogen. Treatment includes any desirable effect on the symptoms or pathology of a disease or condition associated with the dystrophin protein, as seen in certain forms of muscular dystrophy, e.g., it can include a minimal change or improvement in one or more measurable markers of the disease or condition being treated. Also included is "prophylactic" treatment that can be aimed at reducing the rate of progression of the disease or condition being treated, delaying the onset of that disease or condition, or reducing the severity of its onset. "Treatment" or "prevention" does not necessarily indicate complete eradication, cure, or prevention of the disease or condition, or its attendant symptoms.
[0198] In some embodiments, treatment with an AAV vector containing a transgene according to the present disclosure and an enzyme that cleaves IgG results in increased production of the transgene (e.g., dystrophin, beta-sarcoglycan, or alpha-sarcoglycan), delayed disease progression, decelerated or reduced loss of walking, reduced muscle inflammation, reduced muscle damage, improved muscle function, reduced loss of lung function, and / or enhanced muscle regeneration, compared to what would be expected without treatment. In some embodiments, treatment results in maintenance, delay, or deceleration of disease progression. In some embodiments, treatment results in maintenance of walking or reduction of loss of walking. In some embodiments, treatment results in maintenance of lung function or reduction of loss of lung function. In some embodiments, treatment results in maintenance or increase of a stable walking distance in a patient, as measured, for example, by the 6-minute walk test (6MWT) as described by McDonald, et al. (Muscle Nerve, 2010;42:966-74, incorporated herein by reference). Changes in the 6-minute walk distance (6MWD) can be expressed as absolute values, rates of change, or changes in % predicted values. The performance of DMD patients in the 6MWT compared to the typical performance of healthy controls can be determined by calculating the % predicted values. For example, % predicted 6MWD can be calculated for males using the following equation: 196.72 + (39.81 × age) - (1.36 × age 2 2) + (132.28 × height (meters)). For females, % predicted 6MWD can be calculated using the following equation: 188.61 + (51.50 × age) - (1.86 × age 2 2) + (86.10 × height (meters)) (Henricson et al. PLoS Curr., 2012, version 2, incorporated herein by reference in its entirety).
[0199] In some embodiments, treatment results in the maintenance or reduction of the time to walk / run 10 meters (i.e., the 10-meter walk / run test). In some embodiments, treatment results in the maintenance or reduction of the time from supine position to standing position (i.e., the time to stand test). In some embodiments, treatment results in the maintenance or reduction of the time to climb a standard four-step staircase (i.e., the four-step climb test). In some embodiments, treatment results in the maintenance or reduction of muscle inflammation in a patient, as measured, for example, by MRI (e.g., MRI of leg muscles). In some embodiments, the MRI measures T2 and / or fat fraction to identify muscle degeneration. The MRI can identify changes in the structure and composition of muscle caused by inflammation, edema, muscle injury, and fat infiltration.
[0200] In some embodiments, treatment with an enzyme that cleaves the IgG of the present disclosure increases the vector copy number (VCN) of AAV after subsequent administration of the AAV described herein. In some embodiments, the VCN of AAV increases as compared to the VCN of AAV in a subject not administered an IgG-cleaving enzyme, or as compared to the vector copy number in a subject in the absence of administration of an IgG-cleaving enzyme. In some embodiments, the increase in the VCN of AAV is observed in muscle.
[0201] As used herein, the term "neutralizing antibody" refers to any antibody that binds to an AAV capsid protein of an AAV viral vector particle and inhibits transduction of target cells by the AAV viral vector particle.
[0202] As used herein, the term "non-neutralizing antibody" refers to any antibody that binds to an AAV capsid protein of an AAV viral vector particle and / or an AAV capsid protein that is not part of the AAV viral vector particle, does not inhibit transduction of target cells by the AAV viral vector particle, but can cause a pro-inflammatory response in a subject.
[0203] As used herein, the term "total antibody" refers to AAV antibodies, including neutralizing AAV antibodies and non-neutralizing AAV antibodies.
[0204] As used herein, the term "neutralizing cell assay" refers to an assay for quantifying neutralizing AAV antibodies in a sample of interest in vitro using cells that bind to AAV virus particles in which neutralizing antibodies are quantified and are transduced by the AAV virus particles. In some embodiments, the neutralizing cell assay comprises incubating AAV virus particles in which neutralizing antibodies are quantified with the sample of interest to prepare an AAV virus particle-sample mixture, and incubating cells that bind to the AAV virus particles in which neutralizing antibodies are quantified and are thereby transduced with the AAV virus particle-sample mixture. In some embodiments, the assay further comprises washing the cells and detecting the presence of AAV virus particles in the cells, for example, using an enzyme-conjugated antibody or a labeled antibody against an AAV virus particle protein, or, if the AAV virus particles used are recombinant AAV virus vector particles carrying a transgene, detecting the expression of the transgene in the cells.
[0205] As used herein, the term "total AAVrh74 antibody ELISA assay" refers to an enzyme-linked immunosorbent assay for quantifying total AAVrh74 antibodies in a sample of interest in vitro using AAVrh74 virus particles immobilized on a solid support, as well as the detection of AAVrh74 antibodies bound to the AAVrh74 virus particles immobilized by an enzyme-conjugated anti-IgG antibody and a substrate that can be quantified. In some embodiments, the total AAVrh74 antibody ELISA assay is used as described in Goedeker et al., Ther. Adv. Neurol. Disord., 6:1-7, 2023, which is hereby incorporated by reference in its entirety. In some embodiments, the total AAVrh74 antibody ELISA assay can be an ELECSYS® assay. II. Methods of the Disclosure
[0206] Certain aspects of the present disclosure are directed to a method of treating a subject in need of treatment for a disease or disorder, the method comprising administering to the subject (i) a recombinant AAV viral vector and (ii) an enzyme that cleaves immunoglobulin G (IgG). Without being bound by any particular theory or mechanism, administration of an enzyme that cleaves IgG before, concurrently with, and / or after administration of a therapeutic AAV vector disclosed herein, such as a recombinant AAVrh74 viral vector comprising a transgene encoding a therapeutic protein, reduces or eliminates the immune response to the AAV vector. Gene therapy using viral vectors such as recombinant AAV viral vectors often induces an inhibitory immune response in human subjects. Since many human subjects are exposed to AAV throughout their lives, the subject may already possess inhibitory antibodies prior to the first administration of AAV gene therapy. One means of reducing the effect of pre-existing inhibitory antibodies is to use an AAV serotype or other viral vector to which most humans, such as AAVrh74, are unlikely to have been exposed. However, after the first administration of the rarest serotype, human subjects often express inhibitory antibodies against the administered AAV, thereby limiting the duration of the response and preventing subsequent administrations using the same serotype. The methods disclosed herein reduce the effect of existing inhibitory antibodies and / or the formation of new inhibitory antibodies by destroying IgG polypeptides in human subjects.
[0207] Some aspects of the present disclosure are directed to a method of improving the efficacy of an AAV vector in a human subject having muscular dystrophy, the method comprising administering to the subject (i) an enzyme that cleaves IgG and (ii) an AAV vector. Some aspects of the present disclosure are directed to a method of improving the efficacy of an AAV vector in a human subject having muscular dystrophy, the method comprising administering to the subject (i) an enzyme that cleaves IgG and (ii) an AAV vector.
[0208] In some embodiments, the AAV vector and the enzyme that cleaves IgG are administered simultaneously. In some embodiments, the enzyme that cleaves IgG is administered prior to the AAV vector. In some embodiments, the AAV vector is administered prior to the enzyme that cleaves IgG.
[0209] In some embodiments, the methods disclosed herein are directed to treating a subject having muscular dystrophy. In some embodiments, the subject has Duchenne muscular dystrophy (DMD). In some embodiments, a subject having DMD has received a definitive diagnosis of DMD based on clinical documentation and confirmatory genetic testing. In some embodiments, the subject having DMD is a pediatric subject from 4 to 8 years of age (including 4 and 8 years of age). In some embodiments, the subject does not have a mutation in exons 1-17 (including the boundaries) of the dystrophin gene. In some embodiments, the subject does not have an in-frame deletion, in-frame insertion, or variant of unknown significance in the dystrophin gene.
[0210] In some embodiments, the subject has limb-girdle muscular dystrophy (LGMD). In some embodiments, the subject has LGMD caused by a mutation, in-frame deletion, in-frame insertion, or variant of unknown significance in the alpha-sarcoglycan gene. In some embodiments, the subject has LGMD caused by a mutation, in-frame deletion, in-frame insertion, or variant of unknown significance in the beta-sarcoglycan gene. In some embodiments, the subject has LGMD caused by a mutation, in-frame deletion, in-frame insertion, or variant of unknown significance in a non-sarcoglycan gene.
[0211] Some aspects of the present disclosure are methods of increasing or restoring muscle cell state in a human subject having muscular dystrophy and eligible for AAV vector therapy, the method comprising administering to the subject an enzyme that cleaves IgG, wherein the subject is scheduled to be administered an AAV vector after administration of the enzyme that cleaves IgG. Some aspects of the present disclosure are methods of increasing or restoring muscle cell state in a human subject having muscular dystrophy and eligible for AAV vector therapy, the method comprising administering to the subject an AAV vector, wherein the subject has been previously administered an enzyme that cleaves IgG. Some aspects of the present disclosure are methods of increasing or restoring muscle cell state in a human subject having muscular dystrophy and eligible for AAV vector therapy, the method comprising administering to the subject an AAV vector, wherein the subject has been previously administered an enzyme that cleaves IgG. Some aspects of the present disclosure are methods of increasing or restoring muscle cell state in a human subject having muscular dystrophy and eligible for AAV vector therapy, the method comprising administering to the subject an enzyme that cleaves IgG, wherein the subject is scheduled to be administered an AAV vector after administration of the enzyme that cleaves IgG.
[0212] In some aspects, the enzyme that cleaves IgG reduces the titer of IgG antibodies, such as neutralizing antibodies, that specifically bind to an antigen expressed on the capsid of the AAV vector. By reducing the titer of one or more neutralizing antibodies, the methods disclosed herein enable repeated administration of therapeutic AAV vectors with limited or no loss of efficacy in subsequent administrations.
[0213] In some embodiments, the disease or disorder is characterized by a lack of expression of a particular protein, and the AAV viral vector comprises a transgene encoding the particular protein or an analog thereof. In some embodiments, the disease or condition is characterized by a lack of, mis-expression of, or a combination of dystrophin expression, and the AAV viral vector comprises a transgene encoding dystrophin or microdystrophin as disclosed herein. In some embodiments, the disease or condition is characterized by a lack of, mis-expression of, or a combination of alpha-sarcoglycan expression, and the AAV viral vector comprises a transgene encoding alpha-sarcoglycan or an analog thereof as disclosed herein. In some embodiments, the disease or condition is characterized by a lack of, mis-expression of, or a combination of beta-sarcoglycan expression, and the AAV viral vector comprises a transgene encoding beta-sarcoglycan or an analog thereof as disclosed herein.
[0214] In some embodiments, the disease or disorder includes muscular dystrophy. In some embodiments, the muscular dystrophy is DMD. In some embodiments, the muscular dystrophy is LGMD.
[0215] II.A. Detection of anti-AAVrh74 antibodies Provided is a method for detecting neutralizing antibodies, non-neutralizing antibodies, and / or total AAVrh74 antibodies in a subject. The presence of neutralizing and / or non-neutralizing AAVrh74 antibodies in a subject to be treated with the AAVrh74 viral vector particles described herein can reduce the effectiveness of introduction of an AAVrh74 vector particle-introduced gene into target cells in the subject and / or promote a pro-inflammatory response in the subject. In some embodiments, the AAVrh74 antibodies present in the subject bind to the AAVrh74 capsid protein present in the AAVrh74 viral vector particles. In some embodiments, the AAVrh74 antibodies in the subject bind to the AAVrh74 capsid protein of the AAVrh74 viral vector particles at a position where the AAVrh74 capsid protein interacts with a cell receptor on a cell to be targeted by the AAVrh74 viral vector particles. In some embodiments, the AAVrh74 antibodies in the subject that bind to the AAVrh74 capsid protein at a position where it interacts with the cell receptor prevent the interaction between the AAVrh74 capsid protein and the target cell, block transduction of the target cell by the AAVrh74 viral vector particles, and such transduction-blocking AAVrh74 antibodies are also referred to as neutralizing antibodies.
[0216] In some embodiments, the AAVrh74 antibodies in the subject bind to the AAVrh74 capsid protein at a position on the AAVrh74 capsid protein that does not interact with the cell receptor on the cell to be targeted, and the AAVrh74 antibodies do not block transduction of the target cell by the AAVrh74 viral vector particles, and such non-transduction-blocking antibodies are also referred to as non-neutralizing antibodies. In some embodiments, non-neutralizing AAVrh74 antibodies can promote a pro-inflammatory response in the subject.
[0217] In some embodiments, the subject has both neutralizing AAVrh74 antibodies and non-neutralizing AAVrh74 antibodies. In some embodiments, total AAVrh74 antibodies are quantified in a subject using the assays described herein, and total AAVrh74 antibodies include neutralizing AAVrh74 antibodies and non-neutralizing AAVrh74 antibodies.
[0218] In some embodiments, a subject to be treated with the AAVrh74 viral vector particles described herein is tested for the presence of total AAVrh74 antibodies using the assays described herein, and the subject is further tested for the presence of neutralizing AAVrh74 antibodies using the assays described herein. In some embodiments, the amount of non-neutralizing AAVrh74 antibodies present in the subject is determined by subtracting the amount of neutralizing AAVrh74 antibodies present in the subject from the amount of total AAVrh74 antibodies present in the subject.
[0219] In some embodiments, total AAVrh74 antibodies, neutralizing AAVrh74 antibodies, and / or non-neutralizing AAVrh74 antibodies are determined in a subject prior to treatment with the AAVrh74 viral vector particles described herein.
[0220] In some embodiments, total AAVrh74 antibodies, neutralizing AAVrh74 antibodies, and / or non-neutralizing AAVrh74 antibodies are determined in a subject after treatment with the AAVrh74 viral vector particles described herein.
[0221] In some embodiments, total AAVrh74 antibodies, neutralizing AAVrh74 antibodies, and / or non-neutralizing AAVrh74 antibodies are determined in a subject prior to treatment with an enzyme that cleaves IgG described herein.
[0222] In some embodiments, total AAVrh74 antibodies, neutralizing AAVrh74 antibodies, and / or non-neutralizing AAVrh74 antibodies are determined in a subject after treatment with an enzyme that cleaves IgG described herein.
[0223] In some embodiments, total AAVrh74 antibodies, neutralizing AAVrh74 antibodies, and / or non-neutralizing AAVrh74 antibodies are determined in a subject prior to treatment with the AAVrh74 viral vector particles described herein and after a first treatment with an enzyme that cleaves IgG described herein.
[0224] In some embodiments, total AAVrh74 antibodies, neutralizing AAVrh74 antibodies, and / or non-neutralizing AAVrh74 antibodies are determined in a subject before treatment with the AAVrh74 viral vector particles described herein and after a second treatment with an enzyme that cleaves IgG as described herein.
[0225] In some embodiments, total AAVrh74 antibodies, neutralizing AAVrh74 antibodies, and / or non-neutralizing AAVrh74 antibodies are determined in a subject before treatment with the AAVrh74 viral vector particles described herein and after a third treatment with an enzyme that cleaves IgG as described herein.
[0226] In some embodiments, total AAVrh74 antibodies, neutralizing AAVrh74 antibodies, and / or non-neutralizing AAVrh74 antibodies are determined in a subject after a first treatment with AAVrh74 viral vector particles and before a second treatment with AAVrh74 viral vector particles.
[0227] In some embodiments, total AAVrh74 antibodies, neutralizing AAVrh74 antibodies, and / or non-neutralizing AAVrh74 antibodies are after a first treatment with AAVrh74 viral vector particles described herein and before a second treatment with AAVrh74 viral vector particles described herein, and after a first treatment with an enzyme that cleaves IgG in a subject.
[0228] In some embodiments, total AAVrh74 antibodies, neutralizing AAVrh74 antibodies, and / or non-neutralizing AAVrh74 antibodies are after a first treatment with AAVrh74 viral vector particles described herein and before a second treatment with AAVrh74 viral vector particles described herein, and after a second treatment with an enzyme that cleaves IgG in a subject.
[0229] In some embodiments, the total AAVrh74 antibody, neutralizing AAVrh74 antibody, and / or non-neutralizing AAVrh74 antibody are determined in a subject after a first treatment with the AAVrh74 viral vector particles described herein, before a second treatment with the AAVrh74 viral vector particles, and after a third treatment with an enzyme that cleaves IgG. In some embodiments, the total AAVrh74 antibody, neutralizing AAVrh74 antibody, and / or non-neutralizing AAVrh74 antibody are determined in a subject after a second treatment with the AAVrh74 viral vector particles and before a third treatment with the AAVrh74 viral vector particles.
[0230] In some embodiments, the total AAVrh74 antibody, neutralizing AAVrh74 antibody, and / or non-neutralizing AAVrh74 antibody are determined in a subject after a second treatment with the AAVrh74 viral vector particles described herein, before a third treatment with the AAVrh74 viral vector particles, and after a first treatment with an enzyme that cleaves IgG.
[0231] In some embodiments, the total AAVrh74 antibody, neutralizing AAVrh74 antibody, and / or non-neutralizing AAVrh74 antibody are determined in a subject after a second treatment with the AAVrh74 viral vector particles described herein, before a third treatment with the AAVrh74 viral vector particles, and after a second treatment with an enzyme that cleaves IgG.
[0232] In some embodiments, the total AAVrh74 antibody, neutralizing AAVrh74 antibody, and / or non-neutralizing AAVrh74 antibody are determined in a subject after a second treatment with the AAVrh74 viral vector particles described herein, before a third treatment with the AAVrh74 viral vector particles, and after a third treatment with an enzyme that cleaves IgG.
[0233] II.B. Detection of Neutralizing Anti-AAVrh74 Antibodies In some embodiments, neutralizing AAVrh74 antibodies are measured using the neutralizing cell-based assays described herein. In some embodiments, the neutralizing cell assay is the assay described in Enders et al., Clinical and Vaccine Immunology, 20:420-426, 2013, which is incorporated herein by reference in its entirety.
[0234] In some embodiments, neutralizing AAVrh74 antibodies are quantified in a sample of interest in vitro using cells that bind to AAVrh74 virus particles and are transduced by AAVrh74 virus particles. In some embodiments, neutralizing AAVrh74 antibodies are quantified in a sample by incubating AAVrh74 virus particles with the sample of interest to prepare an AAVrh74 virus particle-sample mixture. In some embodiments, cells that bind to AAVrh74 virus particles and are transduced by AAVrh74 virus particles are incubated with the AAVrh74 virus particle-sample mixture. In some embodiments, the cells are washed after incubation with the AAVrh74 virus particle-sample mixture, and the AAVrh74 virus particles are quantified within the cells. In some embodiments, the AAVrh74 virus particles are quantified within the cells using an enzyme-conjugated antibody against an AAVrh74 virus particle protein. In some embodiments, AAVrh74 virus vector particles having a transgene are used in the neutralizing antibody assay, and the AAVrh74 virus vector particles are quantified by quantifying the expression of the transgene in the cells.
[0235] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and before administration of imlifidase. In some embodiments, the neutralizing anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and after administration of the first dose of imlifidase. In some embodiments, the neutralizing anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and after administration of the second dose of imlifidase. In some embodiments, the neutralizing anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and after administration of the third dose of imlifidase.
[0236] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of the AAVrh74 vector particles. In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of the first dose of the AAVrh74 vector particles and after administration of the first dose of imlifidase.
[0237] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of the first dose of the AAVrh74 vector particles and after administration of the second dose of imlifidase.
[0238] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of the first dose of the AAVrh74 vector particles and after administration of the third dose of imlifidase.
[0239] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of the second dose of the AAVrh74 vector particles. In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of the second dose of the AAVrh74 vector particles and after administration of the first dose of imlifidase.
[0240] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of the second dose of the AAVrh74 vector particles and after administration of the second dose of imlifidase.
[0241] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of a second dose of AAVrh74 vector particles and after administration of a third dose of imlifidase.
[0242] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles. In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles and after administration of a first dose of imlifidase.
[0243] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles and after administration of a second dose of imlifidase.
[0244] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles and after administration of a third dose of imlifidase.
[0245] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles. In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles and after administration of a first dose of imlifidase.
[0246] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles and after administration of a second dose of imlifidase.
[0247] In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles and after administration of a third dose of imlifidase.
[0248] One of ordinary skill in the art will understand that the measurement of neutralizing AAVrh74 antibodies is not limited by the number of administrations of AAVrh74 vector particles or the number of doses of Immulyze. In some embodiments, neutralizing anti-AAVrh74 antibodies are measured at any time when a subject is being considered for administration of AAVrh74 vector particles. In some embodiments, neutralizing anti-AAVrh74 antibodies are measured at any time when a subject is being considered for administration of Immulyze.
[0249] In some embodiments, the assay used to measure neutralizing AAVrh74 antibodies in a subject is a neutralizing cell assay. In some embodiments, if the anti-AAVrh74 antibody titer measured by the neutralizing cell assay is greater than 1:400, the subject is determined to have neutralizing anti-AAVrh74 antibodies. In some embodiments, if the anti-AAVrh74 antibody titer measured by the neutralizing cell assay is 1:400 or less, the subject is determined to not have neutralizing anti-AAVrh74 antibodies.
[0250] II.C. Detection of Total Anti-AAVrh74 Antibodies In some embodiments, total anti-AAVrh74 antibodies, including neutralizing and non-neutralizing anti-AAVrh74 antibodies, are measured. In some embodiments, total anti-AAVrh74 antibodies are measured using a total anti-AAVrh74 antibody ELISA assay. In some embodiments, a subject having a total anti-AAVrh74 antibody titer greater than 1:400 in the total anti-AAVrh74 antibody ELISA assay is serum positive. In some embodiments, a subject having a total anti-AAVrh74 antibody titer of 1:400 or less in the total anti-AAVrh74 antibody ELISA assay is serum negative.
[0251] In some embodiments, the total anti-AAVrh74 antibody ELISA assay is the assay described in Goedeker et al., Ther. Adv. Neurol. Dis., 16:1-7, 2023, which is hereby incorporated by reference in its entirety.
[0252] In some embodiments, the total anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and before administration of imlifidase. In some embodiments, the total anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and after administration of the first dose of imlifidase. In some embodiments, the total anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and after administration of the second dose of imlifidase. In some embodiments, the total anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and after administration of the third dose of imlifidase.
[0253] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of the AAVrh74 vector particles. In some embodiments, the total anti-AAVrh74 antibody is measured after administration of the first dose of the AAVrh74 vector particles and after administration of the first dose of imlifidase.
[0254] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of the first dose of the AAVrh74 vector particles and after administration of the second dose of imlifidase.
[0255] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of the first dose of the AAVrh74 vector particles and after administration of the third dose of imlifidase.
[0256] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of the second dose of the AAVrh74 vector particles. In some embodiments, the total anti-AAVrh74 antibody is measured after administration of the second dose of the AAVrh74 vector particles and after administration of the first dose of imlifidase.
[0257] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of the second dose of the AAVrh74 vector particles and after administration of the second dose of imlifidase.
[0258] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of a second dose of AAVrh74 vector particles and after administration of a third dose of imlifidase.
[0259] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles. In some embodiments, the total anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles and after administration of a first dose of imlifidase.
[0260] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles and after administration of a second dose of imlifidase.
[0261] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles and after administration of a third dose of imlifidase.
[0262] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles. In some embodiments, the total anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles and after administration of a first dose of imlifidase.
[0263] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles and after administration of a second dose of imlifidase.
[0264] In some embodiments, the total anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles and after administration of a third dose of imlifidase.
[0265] One of ordinary skill in the art will understand that the measurement of total AAVrh74 antibody is not limited by the number of administrations of AAVrh74 vector particles or the number of doses of Immulyze. In some embodiments, total anti-AAVrh74 antibody is measured at all time points when the subject is being considered for administration of AAVrh74 vector particles. In some embodiments, total anti-AAVrh74 antibody is measured at all time points when the subject is being considered for administration of Immulyze.
[0266] In some embodiments, the assay used to measure total AAVrh74 antibody in a subject is a total AAVrh74 antibody ELISA assay. In some embodiments, if the anti-AAVrh74 antibody titer measured by the total anti-AAVrh74 antibody ELISA assay exceeds 1:400, the subject is determined to have total anti-AAVrh74 antibody. In some embodiments, if the anti-AAVrh74 antibody titer measured by the total anti-AAVrh74 antibody ELISA assay is 1:400 or less, the subject is determined to not have total anti-AAVrh74 antibody.
[0267] II.D. Detection of non-neutralizing anti-AAVrh74 antibodies In some embodiments, a subject to be treated with the AAVrh74 viral vector particles described herein is tested for the presence of non-neutralizing AAVrh74 antibodies. In some embodiments, total AAVrh74 antibody is quantified in a sample from the subject as described herein, and neutralizing AAVrh74 antibody is quantified in the sample as described herein. In some embodiments, the amount of non-neutralizing AAVrh74 antibody present in a sample from the subject is determined by subtracting the amount of neutralizing AAVrh74 antibody present in the sample from the amount of total AAVrh74 antibody present in the sample.
[0268] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and before administration of imlifidase. In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and after administration of the first dose of imlifidase. In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and after administration of the second dose of imlifidase. In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured before administration of the AAVrh74 vector particles and after administration of the third dose of imlifidase.
[0269] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of the AAVrh74 vector particles. In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of the first dose of the AAVrh74 vector particles and after administration of the first dose of imlifidase.
[0270] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of the first dose of the AAVrh74 vector particles and after administration of the second dose of imlifidase.
[0271] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of the first dose of the AAVrh74 vector particles and after administration of the third dose of imlifidase.
[0272] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of the second dose of the AAVrh74 vector particles. In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of the second dose of the AAVrh74 vector particles and after administration of the first dose of imlifidase.
[0273] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of the second dose of the AAVrh74 vector particles and after administration of the second dose of imlifidase.
[0274] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of a second dose of AAVrh74 vector particles and after administration of a third dose of imlifidase.
[0275] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles. In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles and after administration of a first dose of imlifidase.
[0276] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles and after administration of a second dose of imlifidase.
[0277] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of a third dose of AAVrh74 vector particles and after administration of a third dose of imlifidase.
[0278] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles. In some embodiments, the neutralizing anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles and after administration of a first dose of imlifidase.
[0279] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles and after administration of a second dose of imlifidase.
[0280] In some embodiments, the non-neutralizing anti-AAVrh74 antibody is measured after administration of a further dose of AAVrh74 vector particles and after administration of a third dose of imlifidase.
[0281] One of ordinary skill in the art will understand that the measurement of non-neutralizing AAVrh74 antibodies is not limited by the number of administrations of AAVrh74 vector particles or the number of doses of Immulyze. In some embodiments, non-neutralizing anti-AAVrh74 antibodies are measured at any time when a subject is being considered for administration of AAVrh74 vector particles. In some embodiments, non-neutralizing anti-AAVrh74 antibodies are measured at any time when a subject is being considered for administration of Immulyze.
[0282] III. Enzymes that cleave IgG Certain embodiments of the present disclosure are directed to a method of treating a subject in need of treatment for a disease or condition, such as muscular dystrophy, the method comprising administering to the subject (i) an AAV vector and (ii) an enzyme that cleaves IgG. In certain embodiments, the enzyme targets and cleaves human IgG. In some embodiments, the enzyme targets and cleaves human IgG selected from IgG1, IgG2, IgG3, IgG4, and any combination thereof. In some embodiments, the enzyme targets and cleaves human IgG1. In some embodiments, the enzyme targets and cleaves human IgG2. In some embodiments, the enzyme targets and cleaves human IgG3. In some embodiments, the enzyme targets and cleaves human IgG4. In some embodiments, the enzyme specifically targets and cleaves human IgG1, human IgG2, human IgG3, and human IgG4. In some embodiments, IgG binds to the AAV vector. In certain embodiments, IgG binds to the AAVrh74 vector. In some embodiments, the subject has one or more IgG antibodies that specifically bind to a protein expressed by AAVrh74. In some embodiments, the subject has one or more IgG antibodies that specifically bind to the AAVrh74 capsid protein. In some embodiments, the one or more IgG antibodies are AAVrh74 neutralizing antibodies.
[0283] In some embodiments, the enzyme that cleaves IgG includes a protease. In some embodiments, the enzyme that cleaves IgG includes a cysteine protease. In some embodiments, the enzyme that cleaves IgG includes a thiol protease. In some embodiments, the enzyme that cleaves IgG inactivates IgG upon cleavage. In some embodiments, the enzyme cleaves IgG in the hinge region of IgG. In certain embodiments, after cleavage, IgG can no longer bind to an antigen. In certain embodiments, after cleavage, IgG can no longer be recognized by human immune cells.
[0284] Any enzyme known in the art that can promote the cleavage of IgG can be used in the methods disclosed herein. In some embodiments, the enzyme is a naturally occurring enzyme. In some embodiments, the enzyme is derived from a naturally occurring enzyme. In some embodiments, the enzyme is a synthetic enzyme. In some embodiments, the enzyme is recombinant. In some embodiments, the enzyme is isolated from or derived from bacteria. In some embodiments, the enzyme is isolated from or derived from bacteria of the genus Streptococcus. In some embodiments, the enzyme is isolated from or derived from Streptococcus pyogenes. In some embodiments, the enzyme is isolated from or derived from Streptococcus equi. In some embodiments, the enzyme is isolated from or derived from bacteria of the genus Mycoplasma. In some embodiments, the enzyme is isolated from or derived from Mycoplasma canis.
[0285] In certain embodiments, the enzyme that cleaves IgG comprises an amino acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to an amino acid sequence selected from the amino acid sequences set forth in SEQ ID NOs: 1-18 (Table 5). In certain embodiments, the enzyme that cleaves IgG comprises an amino acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 2. In some embodiments, the enzyme that cleaves IgG comprises the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the enzyme that cleaves IgG comprises the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the enzyme that cleaves IgG comprises an amino acid sequence selected from the amino acid sequences set forth in SEQ ID NOs: 3-18.
Table 5-1
Table 5-2
Table 5-3
[0286] In certain embodiments, the enzyme that cleaves IgG comprises imurifidase. In certain embodiments, the enzyme that cleaves IgG consists of imurifidase. Imurifidase (also known as "IdeS" and "Mac-1", UniProt F8V4V0) is an endopeptidase derived from Streptococcus pyogenes that targets and cleaves all human subclasses of IgG without cleaving IgA, IgD, IgE, or IgM. Imurifidase is a cysteine protease having an active site residue consisting of a single Cys residue. Imurifidase cleaves the heavy chain of IgG in the hinge region to generate two Fc fragments and one F(ab 1 )2 fragment. Cleavage of IgG by imurifidase suppresses complement activation and Fc receptor-mediated processes, including antibody-dependent cell phagocytosis (ADCP), antibody-dependent cell-mediated cytotoxicity (ADCC), and complement-dependent cytotoxicity (CDC). Within hours after administration of imurifidase, the pool of IgG is cleaved into F(ab')2 and Fc fragments, creating an opportunity to perform gene therapy.
[0287] It has previously been shown that administration of imurifidase to highly HLA-sensitized patients prior to kidney transplantation removes or reduces donor-specific antibodies. Imurifidase is also known to interact with vitronectin receptor and platelet receptor via its RGD motif.
[0288] IV. AAV viral vector particles Certain aspects of the present disclosure are directed to a method of treating a disease or condition, such as muscular dystrophy, in a subject in need thereof, the method comprising administering to the subject (i) an AAV vector and (ii) an enzyme that cleaves IgG. The AAV vector can comprise a known vector or can comprise a variant, fragment, or fusion thereof. In some aspects, the AAV vector is selected from the group consisting of AAV type 1 (AAV1), AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, and any combination thereof. In some aspects, the AAV vector is derived from an AAV vector selected from the group consisting of AAV type 1 (AAV1), AAVrh.74, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, equine AAV, and any combination thereof. In certain aspects, the AAV vector comprises regions of at least two different AAV vectors known in the art. In some aspects, the AAV vector comprises an inverted terminal repeat from a first AAV (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, or ovine AAV) and a second inverted terminal repeat from a second AAV (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, or ovine AAV).
[0289] In some embodiments, the AAV vector is an AAV1 vector. In some embodiments, the AAV vector is derived from an AAV1 vector. In some embodiments, the AAV vector comprises a portion of an AAV1 vector. In some embodiments, the AAV vector is an AAV2 vector. In some embodiments, the AAV vector is derived from an AAV2 vector. In some embodiments, the AAV vector comprises a portion of an AAV2 vector. In some embodiments, the AAV vector is an AAV3 vector. In some embodiments, the AAV vector is derived from an AAV3 vector. In some embodiments, the AAV vector comprises a portion of an AAV3 vector. In some embodiments, the AAV vector is an AAV8 vector. In some embodiments, the AAV vector is derived from an AAV8 vector. In some embodiments, the AAV vector comprises a portion of an AAV8 vector. In some embodiments, the AAV vector is an AAV9 vector. In some embodiments, the AAV vector is derived from an AAV9 vector. In some embodiments, the AAV vector comprises a portion of an AAV9 vector. In some embodiments, the AAV vector is an AAVrh.74 vector. In some embodiments, the AAV vector is derived from an AAVrh.74 vector. In some embodiments, the AAV vector comprises a portion of an AAVrh.74 vector. For example, the nucleotide sequence of the AAV serotype 2 (AAV2) genome is presented in Srivastava et al., J Virol. 45:555-564 (1983), as corrected by Ruffing et al., J Gen Virol. 75:3385-3392 (1994).As another example, the complete genome of AAV-1 is provided in GenBank accession number NC_002077, the complete genome of AAV-3 is provided in GenBank accession number NC_1829, the complete genome of AAV-4 is provided in GenBank accession number NC_001829, the AAV-5 genome is provided in GenBank accession number AF085716, the complete genome of AAV-6 is provided in GenBank accession number NC_001862, at least a portion of the AAV-7 genome and the AAV-8 genome are provided in GenBank accession numbers AX753246 and AX753249, respectively (see also U.S. Patent Nos. 7,282,199 and 7,790,449 with respect to AAV-8), the AAV-9 genome is provided in Gao et al., J. Virol. 78:6381-6388 (2004), the AAV-10 genome is provided in Mol. Ther., 13(1):67-76 (2006), and the AAV-11 genome is provided in Virology, 330(2):375-383 (2004). The cloning of the AAVrh.74 serotype is described in Rodino-Klapac et al., Journal of Translational Medicine 5:45 (2007).
[0290] In certain embodiments, the AAV vector nucleic acid comprises the nucleic acid sequence of the capsid gene of AAVrh.74. In some embodiments, the AAV vector nucleic acid comprises a capsid gene, the capsid gene comprising a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 47. In some embodiments, the AAV vector nucleic acid comprises a capsid gene, the capsid gene comprising the nucleic acid sequence set forth in SEQ ID NO: 47. In some embodiments, the AAV vector nucleic acid comprises a capsid gene, the capsid gene comprising a nucleic acid sequence encoding a polypeptide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 48. In some embodiments, the AAV vector nucleic acid comprises a capsid gene, the capsid gene comprising the nucleic acid sequence encoding the amino acid sequence set forth in SEQ ID NO: 48.
[0291] In certain embodiments, the AAV vector nucleic acid comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 49. In some embodiments, the AAV vector nucleic acid comprises the nucleic acid sequence set forth in SEQ ID NO: 49. In some embodiments, the AAV vector nucleic acid comprises a portion of the nucleic acid sequence set forth in SEQ ID NO: 49. SEQ ID NO: 49 represents the nucleic acid sequence of the AAVrh.74 genome. Nucleotides 210-2147 of SEQ ID NO: 49 are the Rep78 gene open reading frame. In some embodiments, the AAV vector nucleic acid comprises the Rep78 gene open reading frame of AAVrh.74. Nucleotides 882-2081 of SEQ ID NO: 49 are the Rep52 open reading frame. In some embodiments, the AAV vector nucleic acid comprises the Rep52 open reading frame of AAVrh.74. Nucleotides 2079-2081 of SEQ ID NO: 49 are the Rep52 termination. In some embodiments, the AAV vector nucleic acid comprises the Rep52 termination of AAVrh.74. Nucleotides 2145-2147 of SEQ ID NO: 49 are the Rep78 termination. In some embodiments, the AAV vector nucleic acid comprises the Rep78 termination of AAVrh.74. Nucleotides 1797-1800 of SEQ ID NO: 49 are a splice donor site. In some embodiments, the AAV vector nucleic acid comprises the splice donor site of AAVrh.74. Nucleotides 2094-2097 of SEQ ID NO: 49 are a splice acceptor site. In some embodiments, the AAV vector nucleic acid comprises a splice acceptor site corresponding to nucleotides 2094-2097 of AAVrh.74 (SEQ ID NO: 49). Nucleotides 2121-2124 of SEQ ID NO: 49 are a splice acceptor site. In some embodiments, the AAV vector nucleic acid comprises a splice acceptor site corresponding to nucleotides 2121-2124 of AAVrh.74 (SEQ ID NO: 49). Nucleotides 174-181 of SEQ ID NO: 49 are the predicted p5 promoter +1.In some embodiments, the AAV vector nucleic acid comprises the predicted p5 promoter +1 of AAVrh.74. Nucleotides 145-151 of SEQ ID NO: 49 are the p5 TATA box. In some embodiments, the AAV vector nucleic acid comprises the Rep52 open reading frame of AAVrh.74. Nucleotides 758-761 of SEQ ID NO: 49 are the predicted pl9 promoter +1. In some embodiments, the AAV vector nucleic acid comprises the Rep52 open reading frame of AAVrh.74. Nucleotides 732-738 of SEQ ID NO: 49 are the pl9 TATA box. In some embodiments, the AAV vector nucleic acid comprises the Rep52 open reading frame of AAVrh.74. Nucleotides 1711-1716 of SEQ ID NO: 49 are the p40 TATA box. In some embodiments, the AAV vector nucleic acid comprises the p40 TATA box of AAVrh.74. Nucleotides 2098-4314 of SEQ ID NO: 49 are the VP1 Cap gene open reading frame. In some embodiments, the AAV vector nucleic acid comprises the VP1 Cap gene open reading frame of AAVrh.74. Nucleotides 2509-2511 of SEQ ID NO: 49 are the VP2 start. In some embodiments, the AAV vector nucleic acid comprises the VP2 start of AAVrh.74. Nucleotides 2707-2709 of SEQ ID NO: 49 are the VP3 start. In some embodiments, the AAV vector nucleic acid comprises the VP3 start of AAVrh.74. Nucleotides 4328-4333 of SEQ ID NO: 49 are the polyA signal. In some embodiments, the AAV vector nucleic acid comprises the polyA signal of AAVrh.74.
Table 6-1
Table 6-2
Table 6-3
[0292] In some embodiments, the AAV vector nucleic acid comprises a promoter. Any promoter known in the art can be used in the AAV vector nucleic acids of the present disclosure. In some embodiments, the AAV vector nucleic acid comprises a constitutively active promoter. Any constitutively active promoter, including but not limited to, the cytomegalovirus immediate early gene (CMV) promoter, EF1a promoter, SV40 promoter, PGK1 promoter, Ubc promoter, human beta-actin promoter, CAG promoter, TRE promoter, UAS promoter, Ac5 promoter, polyhedrin promoter, CaMKIIa promoter, GAL1 promoter, GAL10 promoter, TEF promoter, GDS promoter, ADH1 promoter, CaMV35S promoter, Ubi promoter, H1 promoter, U6, or any combination thereof, can be used in the AAV vector nucleic acid. In certain embodiments, the AAV vector comprises the CMV promoter. In certain embodiments, the AAV vector nucleic acid comprises the SV40 promoter.
[0293] In certain embodiments, the AAV vector nucleic acid comprises a tissue-specific promoter. In certain embodiments, the tissue-specific promoter drives the expression of a therapeutic molecule encoded by AAV, such as dystrophin, alpha-sarcoglycan, and / or beta-sarcoglycan, in the brain, muscle, kidney, lung, testis, or any combination thereof. In some embodiments, the tissue-specific promoter drives expression in cells of the subject's quadriceps muscle, the subject's cardiac muscle, the subject's diaphragm muscle, or any combination thereof. In certain embodiments, the tissue-specific promoter drives the expression of a therapeutic molecule encoded by AAV, such as dystrophin, alpha-sarcoglycan, and / or beta-sarcoglycan, in cells of the subject's quadriceps muscle. In certain embodiments, the tissue-specific promoter drives the expression of a therapeutic molecule encoded by AAV, such as dystrophin, alpha-sarcoglycan, and / or beta-sarcoglycan, in cells of the subject's cardiac muscle. In certain embodiments, the tissue-specific promoter drives the expression of a therapeutic molecule encoded by AAV, such as dystrophin, alpha-sarcoglycan, and / or beta-sarcoglycan, in cells of the subject's diaphragm muscle.
[0294] In certain embodiments, the promoter is selected from the group consisting of the enhancer 358bp muscle creatine kinase proximal promoter (Enh358MCK), the muscle creatine kinase (CK) promoter (e.g., hCK (SEQ ID NO: 31) or hCK plus (SEQ ID NO: 32), the truncated muscle creatine kinase promoter (tMCK, SEQ ID NO: 26), the myosin heavy chain (MHC), MHCK7 (a hybrid version of MHC and MCK, SEQ ID NO: 25), C5-12 (a synthetic promoter), the muscle-specific and heart-specific enhancer (MHCK), CK8, SPc5-12, the human desmin (Des) promoter, the human alpha-myosin heavy chain (α-MHC) promoter, the rat myosin light chain 2 (MLC-2) promoter, and the human cardiac troponin C (cTnC) promoter. In certain embodiments, the promoter comprises the MCK promoter. In certain embodiments, the promoter comprises the MHCK promoter. In some embodiments, the tissue-specific promoter is Enh358MCK. In some embodiments, the tissue-specific promoter is the CK promoter. In some embodiments, the tissue-specific promoter is the muscle-specific and heart-specific enhancer 7 (MHCK7) promoter. In some embodiments, the tissue-specific promoter is the CK8 promoter. In some embodiments, the tissue-specific promoter is the SPc5-12 promoter.
[0295] In some embodiments, the promoter comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 25. In some embodiments, the promoter comprises the nucleic acid sequence set forth in SEQ ID NO: 25.
[0296] In some embodiments, the promoter comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 26. In some embodiments, the promoter comprises the nucleic acid sequence set forth in SEQ ID NO: 26.
[0297] In some embodiments, the AAV vector nucleic acid comprises one or more enhancers. In some embodiments, the one or more enhancers are present alone in AAV or are present together with the promoters disclosed herein. In some embodiments, at least one of the one or more enhancers is a tissue-specific enhancer. In certain embodiments, the one or more enhancers are selected from the human skeletal actin gene element, cardiac actin gene element, muscle cell-specific enhancer binding factor MEF (e.g., MEF2), MyoD enhancer element, cardiac enhancer factor (CEF) site, mouse creatine kinase enhancer element, skeletal fast-twitch troponin C gene element, slow-twitch troponin C gene element, slow-twitch troponin I gene element, hypoxia-inducible nuclear factor, steroid-inducible element, glucocorticoid response element (GRE), and any combination thereof. In some embodiments, the AAV vector nucleic acid comprises MEF2. In some embodiments, the AAV vector nucleic acid comprises a MyoD enhancer element. In some embodiments, the AAV vector comprises a CEF site.
[0298] In some embodiments, the AAV vector nucleic acid further comprises an intron sequence, i.e., an intron. In some embodiments, the intron sequence is located 5' to the nucleic acid sequence encoding dystrophin. In some embodiments, the intron sequence is located 3' to the promoter. In some embodiments, the intron sequence comprises a synthetic intron sequence. In some embodiments, the intron comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a nucleic acid sequence selected from SEQ ID NOs: 27-29. In some embodiments, the intron comprises the nucleic acid sequence set forth in SEQ ID NO: 27. In some embodiments, the intron comprises the nucleic acid sequence set forth in SEQ ID NO: 28. In some embodiments, the intron comprises the nucleic acid sequence set forth in SEQ ID NO: 29.
Table 7
[0299] In some embodiments, the AAV vector nucleic acid comprises a post-transcriptional regulatory element. In some embodiments, the post-transcriptional regulatory element is positioned 3’ to the nucleic acid sequence encoding dystrophin. In some embodiments, the post-transcriptional regulatory element comprises a mutant woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a microRNA binding site, a DNA nuclear targeting sequence (DTS), or any combination thereof. In some embodiments, the microRNA binding site comprises a binding site for miR142-3p. In other embodiments, the miRNA binding site is selected from the miRNA binding sites disclosed in Rennie et al., RNA Biol. 13(6):554-560 (2016) and the STarMirDB available at http: / / sfold.wadsworth.org / starmirDB.php, which are hereby incorporated by reference in their entirety. In certain embodiments, the DTS comprises an SV40 enhancer sequence. In certain embodiments, the DTS comprises a c-Myc enhancer sequence.
[0300] In some embodiments, the AAV vector nucleic acid comprises a 3’UTR poly(A) tail sequence. In some embodiments, the 3’UTR poly(A) tail sequence is selected from the group consisting of bGH poly(A), actin poly(A), hemoglobin poly(A), and any combination thereof. In some embodiments, the 3’UTR poly(A) tail sequence comprises bGH poly(A). In some embodiments, the 3’UTR poly(A) tail sequence comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 30 (GGCCGCAATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGTTTTTTGTG). In some embodiments, the 3’UTR poly(A) tail sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 30.
[0301] In certain embodiments, the AAV vector nucleic acid of the present disclosure further comprises a gene cassette encoding a therapeutic molecule. In some embodiments, the therapeutic molecule is selected from a polypeptide, an RNA molecule, or a DNA molecule. In certain embodiments, the therapeutic molecule encoded by the gene cassette is a therapeutic RNA molecule. In some embodiments, the therapeutic RNA molecule is selected from miRNA, siRNA, mRNA, or any combination thereof. In some embodiments, the therapeutic molecule is an antisense oligomer.
[0302] In some embodiments, the therapeutic molecule comprises a polypeptide. In some embodiments, the polypeptide is a polypeptide that is not expressed or is misexpressed in a human subject. In certain embodiments, the gene cassette encodes a therapeutic polypeptide selected from dystrophin, beta-sarcoglycan, alpha-sarcoglycan, and any combination thereof.
[0303] IV.A. Dystrophin Transgene In some embodiments, an AAV vector, such as an AAVrh74 vector, comprises a gene cassette encoding a dystrophin polypeptide. In some embodiments, the gene cassette comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 19. In some embodiments, the gene cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 19.
[0304] In some embodiments, the gene cassette comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a nucleic acid sequence selected from the nucleic acid sequences set forth in SEQ ID NOs: 33-39. In some embodiments, the gene cassette comprises a nucleic acid sequence selected from the nucleic acid sequences set forth in SEQ ID NOs: 33-39.
[0305] In some embodiments, the gene cassette comprises a nucleic acid sequence encoding a microdystrophin polypeptide, and the microdystrophin polypeptide comprises an amino acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to an amino acid sequence selected from the amino acid sequences set forth in SEQ ID NOs: 40 - 44. In some embodiments, the gene cassette comprises a nucleic acid sequence encoding a microdystrophin polypeptide, and the microdystrophin polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 40. In some embodiments, the gene cassette comprises a nucleic acid sequence encoding a microdystrophin polypeptide, and the microdystrophin polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 41. In some embodiments, the gene cassette comprises a nucleic acid sequence encoding a microdystrophin polypeptide, and the microdystrophin polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 42. In some embodiments, the gene cassette comprises a nucleic acid sequence encoding a microdystrophin polypeptide, and the microdystrophin polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 43. In some embodiments, the gene cassette comprises a nucleic acid sequence encoding a microdystrophin polypeptide, and the microdystrophin polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 44.
[0306] In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises a gene cassette encoding a dystrophin polypeptide and a promoter, such as any of the promoters disclosed herein. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising a nucleic acid sequence encoding a dystrophin disclosed herein and (ii) an MHCK7 promoter. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 19 and (ii) an MHCK7 promoter. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 19 and (ii) a promoter comprising the nucleic acid sequence set forth in SEQ ID NO: 25.
[0307] In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises a gene cassette encoding a dystrophin polypeptide and an intron sequence, such as any of the intron sequences disclosed herein. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising a nucleic acid sequence encoding a dystrophin disclosed herein and (ii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 27. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 19 and (ii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 27. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 19, (ii) a promoter comprising the nucleic acid sequence set forth in SEQ ID NO: 25, and (iii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 27.
[0308] In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises a gene cassette encoding a microdystrophin polypeptide and a 3'UTR poly(A) tail sequence, e.g., any 3'UTR poly(A) tail sequence disclosed herein. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising a nucleic acid sequence encoding a microdystrophin disclosed herein and (ii) a 3'UTR poly(A) tail sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 30. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 19 and (ii) a 3'UTR poly(A) tail sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 30. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 19, (ii) a promoter comprising the nucleic acid sequence set forth in SEQ ID NO: 25, (iii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 27, and (iv) a 3'UTR poly(A) tail sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 30.
[0309] In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises a gene cassette encoding a microdystrophin polypeptide, and the AAV vector, e.g., an AAVrh74 vector, comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 20. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises a gene cassette encoding a microdystrophin polypeptide, and the AAV vector, e.g., an AAVrh74 vector, comprises the nucleic acid sequence set forth in SEQ ID NO: 20.
Table 8-1
Table 8-2
[0310] IV.A.1. Beta-Sarcoglycan Transgene In some embodiments, an AAV vector, e.g., an AAVrh74 vector, contains a gene cassette encoding a beta-sarcoglycan polypeptide. In some embodiments, the gene cassette contains a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 21. In some embodiments, the gene cassette contains the nucleic acid sequence set forth in SEQ ID NO: 21.
[0311] In some embodiments, the gene cassette contains a nucleic acid sequence encoding a beta-sarcoglycan polypeptide, and the beta-sarcoglycan polypeptide contains an amino acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the amino acid sequence set forth in SEQ ID NO: 45. In some embodiments, the gene cassette contains a nucleic acid sequence encoding a beta-sarcoglycan polypeptide, and the beta-sarcoglycan polypeptide contains the amino acid sequence set forth in SEQ ID NO: 45.
[0312] In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises a gene cassette encoding a beta-sarcoglycan polypeptide and a promoter, such as any of the promoters disclosed herein. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising a nucleic acid sequence encoding beta-sarcoglycan disclosed herein and (ii) an MHCK7 promoter. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 21 and (ii) an MHCK7 promoter. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 21 and (ii) a promoter comprising the nucleic acid sequence set forth in SEQ ID NO: 25.
[0313] In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises a gene cassette encoding a beta-sarcoglycan polypeptide and an intron sequence, such as any of the intron sequences disclosed herein. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising a nucleic acid sequence encoding beta-sarcoglycan disclosed herein and (ii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 28. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 21 and (ii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 28. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 21, (ii) a promoter comprising the nucleic acid sequence set forth in SEQ ID NO: 25, and (iii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 28.
[0314] In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises a gene cassette encoding a beta-sarcoglycan polypeptide and a 3'UTR poly(A) tail sequence, such as any 3'UTR poly(A) tail sequence disclosed herein. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising a nucleic acid sequence encoding beta-sarcoglycan disclosed herein and (ii) a 3'UTR poly(A) tail sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 30. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 21 and (ii) a 3'UTR poly(A) tail sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 30. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 21, (ii) a promoter comprising the nucleic acid sequence set forth in SEQ ID NO: 25, (iii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 28, and (iv) a 3'UTR poly(A) tail sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 30.
[0315] In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises a gene cassette encoding a beta-sarcoglycan polypeptide, and the AAV vector, such as an AAVrh74 vector, comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 22. In certain embodiments, an AAV vector, such as an AAVrh74 vector, comprises a gene cassette encoding a beta-sarcoglycan polypeptide, and the AAV vector, such as an AAVrh74 vector, comprises the nucleic acid sequence set forth in SEQ ID NO: 22. [Table 9]
[0316] IV.A.2. Alpha-sarcoglycan transgene In some embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises a gene cassette encoding an alpha-sarcoglycan polypeptide. In some embodiments, the gene cassette comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 23. In some embodiments, the gene cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 23.
[0317] In some embodiments, the gene cassette comprises a nucleic acid sequence encoding an alpha-sarcoglycan polypeptide, and the alpha-sarcoglycan polypeptide comprises an amino acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 46. In some embodiments, the gene cassette comprises a nucleic acid sequence encoding an alpha-sarcoglycan polypeptide, and the alpha-sarcoglycan polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 46.
[0318] In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises a gene cassette encoding an alpha-sarcoglycan polypeptide and a promoter, e.g., any of the promoters disclosed herein. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising a nucleic acid sequence encoding alpha-sarcoglycan disclosed herein and (ii) a tMCK promoter. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 23 and (ii) a tMCK promoter. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 23 and (ii) a promoter comprising the nucleic acid sequence set forth in SEQ ID NO: 26.
[0319] In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises a gene cassette encoding an alpha-sarcoglycan polypeptide and an intron sequence, e.g., any of the intron sequences disclosed herein. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising a nucleic acid sequence encoding alpha-sarcoglycan disclosed herein and (ii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 29. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 23 and (ii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 29. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 23, (ii) a promoter comprising the nucleic acid sequence set forth in SEQ ID NO: 26, and (iii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 29.
[0320] In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises a gene cassette encoding an alpha-sarcoglycan polypeptide and a 3'UTR poly(A) tail sequence, e.g., any 3'UTR poly(A) tail sequence disclosed herein. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising a nucleic acid sequence encoding alpha-sarcoglycan disclosed herein and (ii) a 3'UTR poly(A) tail sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 30. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 23 and (ii) a 3'UTR poly(A) tail sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 30. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises (i) a gene cassette comprising the nucleic acid sequence set forth in SEQ ID NO: 23, (ii) a promoter comprising the nucleic acid sequence set forth in SEQ ID NO: 26, (iii) an intron sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 29, and (iv) a 3'UTR poly(A) tail sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 30.
[0321] In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises a gene cassette encoding an alpha-sarcoglycan polypeptide, and the AAV vector, e.g., the AAVrh74 vector, comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NO: 24. In certain embodiments, an AAV vector, e.g., an AAVrh74 vector, comprises a gene cassette encoding an alpha-sarcoglycan polypeptide, and the AAV vector, e.g., the AAVrh74 vector, comprises the nucleic acid sequence set forth in SEQ ID NO: 24. [Table 10]
[0322] Method for generating V.AAV viral vector particles The present disclosure provides a composition comprising recombinant adeno-associated virus (rAAV) viral vector particles, wherein the rAAV vector particles are produced in mammalian adherent cells, and the adherent cells are cultured in an N-1 container under suspension conditions. In some embodiments, the rAAV vector particles are of serotype AAVrh.74 (e.g., rAAVrh74.MHCK7.microdystrophin).
[0323] The present disclosure also provides a method for generating rAAV viral vector particles, such as rAAVrh74.MHCK7.microdystrophin, in mammalian adherent cells by a suspension seeding process. In some embodiments, the suspension seeding process comprises: (a) culturing the cells in a first growth medium containing serum in an N-2 container; (b) removing the cells from the first medium; (c) inoculating the cells from step (b) into a second medium in an N-1 container that is serum-free or contains serum at a concentration less than that of the first medium; (d) culturing the cells in the N-1 container under suspension conditions; and (e) incubating a third medium in a bioreactor with the cells from step (d).
[0324] In some embodiments, the suspension seeding process further comprises transfecting the adherent cells with a transgene plasmid containing a recombinant MHCK7.microdystrophin construct between AAV ITRs, a plasmid containing the AAV rep gene and the AAV cap gene, and an adenovirus helper plasmid.
[0325] In some embodiments, the plasmid containing the AAV rep gene and the AAV cap gene contains the AAV2 rep gene and the AAVrh74 cap gene. In some embodiments, the plasmid containing the AAV rep gene contains the AAV rep gene of the same AAV serotype as the AAV ITR in the plasmid containing the recombinant MHCK7. microdystrophin construct. For example, the recombinant MHCK7. microdystrophin construct contains AAV2 ITRs, and the plasmid containing the AAV rep gene contains the AAV2 rep gene. In some embodiments, the plasmid containing the AAV2 rep gene further contains the AAVrh74 cap gene. In some embodiments, the adenoviral helper plasmid contains the adenovirus 5 E2A, E4ORF6, and VA RNA genes.
[0326] In some embodiments, the suspension seeding process further comprises (g) lysing adherent cells. In some embodiments, the adherent cells are lysed by freeze-thaw, solid shearing, hypertonic and / or hypotonic lysis, liquid shearing, sonication, high pressure extrusion, detergent lysis, or combinations thereof.
[0327] In some embodiments, the suspension seeding process further comprises (h) purifying the rAAVrh74 viral vector particles by at least one column chromatography step. In some embodiments, the at least one column chromatography step comprises anion exchange chromatography, size exclusion chromatography, or combinations thereof.
[0328] In some embodiments, the suspension seeding process further comprises culturing the cells in a first growth medium in an N-3 container. In some embodiments, the suspension seeding process further comprises culturing the cells in a first growth medium in an N-4 container.
[0329] In some embodiments, the bioreactor is an adherent bioreactor. In some embodiments, the rAAVrh74 viral vector particles are purified from the culture produced in the adherent bioreactor.
[0330] In some embodiments, the third medium in the bioreactor comprises at least one factor that promotes cell adhesion. In some embodiments, the at least one factor that promotes cell adhesion is selected from the group consisting of serum, FBS, fibronectin, collagen, laminin, calcium ions, proteoglycans or non-proteoglycan polysaccharides of the extracellular matrix, and combinations thereof. In some embodiments, the third medium in the bioreactor comprises DMEM and 10% FBS.
[0331] In some embodiments, the adherent cells are cultured under suspension conditions for about 48 to 72 hours.
[0332] In some embodiments, the N-1 container is a suspension shaking flask.
[0333] In some embodiments, the adherent cells are selected from the group consisting of HeLa cells, CHO cells, HEK-293 cells, VERO cells, BHK cells, MDCK cells, MDBK cells, and COS cells. In some embodiments, the adherent cells are HeLa cells or HEK-293 cells. In some embodiments, the adherent cells are HEK-293 cells. In some embodiments, the adherent cells are not adapted to suspension. In some embodiments, culturing the cells under suspension conditions does not change the cell adhesion dependence. In some embodiments, culturing does not change the cells to create a new cell line.
[0334] In some embodiments, the suspension seeding process used to generate rAAVrh74.MHCK7.microdystrophin in adherent mammalian cells comprises: (a) culturing the cells in a first growth medium containing serum in an N-2 vessel; (b) removing the cells from the first medium; (c) inoculating the cells from step (b) into a second medium in an N-1 vessel that is serum-free or contains serum at a concentration less than that of the first medium; (d) culturing the cells in suspension in the N-1 vessel; (e) inoculating the cells from step (d) into a third medium in a bioreactor; (f) transfecting the cells with a transgene plasmid containing a recombinant MHCK7.microdystrophin construct between AAV ITRs, a plasmid containing the AAV rep gene and the AAV cap gene, and an adenovirus helper plasmid; (g) lysing the cells; and (h) purifying the rAAV by at least one column chromatography step. In some embodiments, the transgene plasmid contains a recombinant MHCK7.microdystrophin construct between AAV2 ITRs, and the plasmid containing the AAV rep gene and the AAV cap gene contains the AAV2 rep gene and the AAVrh74 cap gene.
[0335] In some embodiments, the DNA plasmids of the disclosure contain the recombinant AAV (rAAV) genomes of the disclosure. In some embodiments, the DNA plasmids are transferred to cells permissive to infection by an AAV helper virus (e.g., an adenovirus, an E1-deleted adenovirus, or a herpesvirus), where the rAAV genomes assemble into infectious virus particles. Techniques for generating rAAV particles in which the rAAV genome, the rep gene and the cap gene to be packaged, and the helper virus functions are provided to the cells are standard in the art. Generation of rAAV vector particles requires the presence in a single cell (shown herein as a packaging cell) of the following components: an rAAV genome, an AAV rep gene and an AAV cap gene separated from (i.e., not present in) the rAAV genome, and helper virus functions. The AAV rep gene and the AAV cap gene can be obtained from and be derived from any AAV serotype, including but not limited to AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAVrh.74, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, and AAV-13, different from the AAV serotype of the rAAV genome ITR (which results in pseudotyped rAAV virus vector particles). Generation of pseudotyped rAAV vector particles is disclosed, for example, in WO01 / 83692, which is hereby incorporated by reference in its entirety.
[0336] In some embodiments, a method of generating packaging cells is to create a cell line that stably expresses all the components necessary for the production of rAAV viral vector particles. For example, a plasmid (or plasmids) containing an rAAV genomic nucleic acid lacking the AAV rep gene and the AAV cap gene, the AAV rep gene and the AAV cap gene separated from the rAAV genome, and a selectable marker such as the neomycin resistance gene is integrated into the genome of the cell. In some embodiments, the AAV rep gene is the AAV2 rep gene and the AAV cap gene is the AAVrh74 cap gene. In some embodiments, the AAV rep gene is of the same AAV serotype as the AAV ITR in the rAAV plasmid containing the rAAV genome lacking the AAV rep gene and the AAV cap gene. In some embodiments, the AAV rep gene is of the same AAV serotype as the AAV ITR in the recombinant MHCK7. microdystrophin plasmid, and the AAV cap gene is the AAVrh74 cap gene.
[0337] The AAV genome has been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., Proc. Natl. Acad. Sci. USA 79:2077 - 2081 (1982)), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., Gene 23:65 - 73 (1983)), or direct blunt - end ligation (Senapathy & Carter, J. Biol. Chem. 259:4661 - 4666 (1984)). In some embodiments, the packaging cell line is infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and suitable for large - scale production of rAAV viral vector particles. Other examples of suitable methods are to introduce the rAAV genome and / or the rep gene and the cap gene into the packaging cells using an adenovirus or a baculovirus instead of a plasmid.
[0338] The general principles for the production of rAAV viral vector particles are outlined, for example, in Carter, Current Opinions in Biotechnology 1533-539 (1992), and Muzyczka, N., Curr. Topics Microbial. Immunol. 158:97-129 (1992). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984), Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984), Tratschin et al., Mo1. Cell. Biol. 5:3251 (1985), McLaughlin et al., J. Virol., 62:1963 (1988), and Lebkowski et al., Mol. Cell. Biol., 7:349 (1988), Samulski et al., J. Virol., 63:3822-3828 (1989), U.S. Patent No. 5,173,414, WO95 / 13365 and corresponding U.S. Patent No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO 97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al. Vaccine 13:1244-1250 (1995), Paul et al. Human Gene Therapy 4:609-615 (1993), Clark et al. Gene Therapy 3:1124-1132 (1996), U.S. Patent No. 5,786,211, U.S. Patent No. 5,871,982, and U.S. Patent No. 6,258,595. The foregoing documents are hereby incorporated by reference in their entirety, with particular emphasis on the sections of the documents relating to the production of rAAV vector particles.
[0339] In some embodiments, at least one of the plasmid containing the transgene between AAV ITRs, the plasmid containing the AAV rep gene and the AAV cap gene, and / or the adenovirus helper plasmid used to generate the AAVrh74 viral vector particles described herein is stably integrated into the genome of the cell, and this cell generates the AAVrh74 viral vector particles.
[0340] In some embodiments, the transgene plasmid contains an expression cassette containing the enhanced green fluorescent protein (eGFP) between AAV2 ITRs and is used to prepare the AAVrh74 viral vector particles.
[0341] VI. Combination Therapy In some embodiments, provided is a method of treatment comprising administering a first dose of imlifidase to a subject in need thereof, followed by administering rAAVrh74 vector particles. In some embodiments, the rAAVrh74 vector particles are administered within 54 hours after the first dose of imlifidase. In some embodiments, the method further comprises measuring the antibody titer against rAAVrh74 in the subject before administering imlifidase. In some embodiments, the method further comprises measuring the antibody titer against rAAVrh74 in the subject after administering imlifidase. A useful rAAVrh74 vector particle is delandistrogene moxeparvovec.
[0342] In some embodiments, a method of treatment is provided that includes intravenously administering an initial dose of about 0.25 mg / kg of Imlygic to a subject in need of treatment. In some embodiments, the method further includes measuring the antibody titer against rAAVrh74 in the subject prior to administering Imlygic. In some embodiments, the method further includes measuring the antibody titer against rAAVrh74 in the subject after administering Imlygic. In some embodiments, the method further includes administering rAAVrh74 vector particles if the anti-rAAVrh74 antibody titer is 1:400 or less after administration of Imlygic. In some embodiments, the rAAVrh74 vector particles are administered within 54 hours after administration of Imlygic. In some embodiments, the rAAVrh74 vector particles are Delandistrogene Moxeparvovec.
[0343] In some embodiments, the method further includes administering a second dose of Imlygic if the anti-rAAVrh74 antibody titer exceeds 1:400 after the first administration of Imlygic. In some embodiments, the method further includes measuring the anti-rAAVrh74 antibody titer after the second administration of Imlygic, and if the anti-rAAVrh74 antibody titer is 1:400 or less, the method further includes administering rAAVrh74. In some embodiments, the rAAVrh74 vector particles are administered within 54 hours after the second administration of Imlygic. In some embodiments, the rAAVrh74 vector particles are Delandistrogene Moxeparvovec.
[0344] In some embodiments, if the anti-rAAVrh74 antibody titer exceeds 1:400 after administration of the second dose of Imlygic, the subject is not administered any rAAVrh74 vector particles.
[0345] In some embodiments, provided is a method of treatment comprising intravenous administration of an initial dose of 0.25 mg / kg of imlifidase. In some embodiments, the method further comprises measuring the antibody titer against rAAVrh74 in the subject after administration of imflifidase. In some embodiments, if the antibody titer against rAAVrh74 in the subject measured after administration of imlifidase is 1:400 or less, the method further comprises intravenous administration of 1.33×10 14 vg / kg of rAAVr74. In some embodiments, rAAVrhH74 is administered within 48 hours from the administration of the first dose of imlifidase. In some embodiments, the rAAVrh74 vector particles are administered within 54 hours from the first dose of imlifidase. In some embodiments, RAAVRH74 is administered within 48 hours from the time when the anti-rAAVrh74 antibody titer is measured to be 1:400 or less. In some embodiments, rAAVrh74 is administered within 48 hours from the time when the anti-rAAVrh74 antibody titer is measured to be 1:400 or less after the first dose of imlifidase. In some embodiments, rAAVrh74 is administered within 48 hours from the time when the anti-rAAVrh74 antibody titer is measured to be 1:400 or less after the second dose of imlifidase. In some embodiments, the rAAVrh74 vector particles are administered within 54 hours after the first or second dose of imlifidase. In some embodiments, the rAAVrh74 vector particles are delandistrogene moxeparvovec.
[0346] In some embodiments, the method includes intravenously administering a first dose of 0.25 mg / kg of Immulyze. In some embodiments, the method further includes measuring the antibody titer against rAAVrh74 in the subject after administering the first dose of Immulyze. In some embodiments, the method further includes intravenously administering a second dose of 0.25 mg / kg of Immulyze within 60 hours of measuring an antibody titer against rAAVrh74 in the subject that exceeds 1:400. In some embodiments, the method further includes measuring the antibody titer against rAAVrh74 in the subject after administering the second dose of Immulyze. In some embodiments, the method further includes intravenously administering 1.33×10 14 vg / kg of rAAVrh74 if the antibody titer against rAAVrh74 in the subject measured within 48 hours after administration of the second dose of Immulyze is 1:400 or less. In some embodiments, the rAAVrh74 vector particles are administered within 54 hours after the second dose of Immulyze. In some embodiments, if the antibody titer against rAAVrh74 in the subject measured within 48 hours after administration of the second dose of Immulyze exceeds 1:400, the subject is not administered rAAVrh74.
[0347] In some embodiments, the method further includes administering a steroid. In some embodiments, the method includes administering an oral steroid. In some embodiments, the oral steroid is administered daily for at least 12 weeks prior to administration of AAVrh74. In some embodiments, an additional steroid is administered at least 1 day prior to administration of AAVrh74. In some embodiments, an additional steroid is administered at least 1 day prior to administration of AAVrh74 and continues to be administered for approximately 60 days after administration of AAVrh74. In some embodiments, the oral steroid is prednisone or prednisolone.
[0348] VII. Kit Certain aspects of the present disclosure are directed to kits for treating a human subject in need of treatment for muscular dystrophy. In some aspects, the kit comprises (i) an enzyme that cleaves IgG disclosed herein, (ii) an AAV vector disclosed herein, such as an AAVrh74 vector, and (iii) instructions for administering the enzyme and the AAV vector according to any of the methods disclosed herein. In some aspects, the kit comprises (i) an AAV vector disclosed herein, such as an AAVrh74 vector, and (ii) instructions for administering the AAV vector to a subject previously administered an enzyme that cleaves IgG according to any of the methods disclosed herein.
[0349] All of the various aspects, aspects, and options described herein can be combined in any permutation.
Examples
[0350] Example 1: Evaluation of the safety and efficacy of AAVrh74.CMV.eGFP (rAAVrh74.CMV.eGFP) after single or repeated intravenous injection into female cynomolgus monkeys that had previously received a single intravenous injection of imlifidase, followed by observation for at least 59 days The purpose of this study was to evaluate the safety and efficacy of AAVrh74.CMV.eGFP ("test substance 2", hereinafter AAVrh74-eGFP) when administered as a single (Groups 2 to 6) or repeated (Group 7) intravenous injection to female cynomolgus monkeys that had previously received a single intravenous injection of imlifidase ("test substance 1"). After previously administering imlifidase and then AAVrh74.CMV-eGFP, the animals were subjected to observation for at least 59 days.
[0351] Study design Nine groups of female cynomolgus monkeys were assigned and administered the doses indicated in Table 19. For the Phase I animals, a single intravenous injection of Imurifidase was administered at a volume of 1 mL / kg to investigate the initial tolerance of Imurifidase in monkeys. As a standard immunosuppressive treatment using AAV gene therapy, for the Phase II animals, a single dose of prednisolone was administered by forced oral administration on Day 1 (Groups 2 to 7) at a volume of 0.33 mL / kg / day, or administered once a day for 14 days (Groups 8 and 9 only). To achieve the primary objective of this study, for the Phase III animals, a daily dose of prednisolone was administered by forced oral administration at a volume of 0.33 mL / kg / day for 62 days (Groups 3 to 6) or 96 days (Groups 2 and 7), and a single or repeated dose of the control substance, Imurifidase, and / or AAVrh74.eGFP was administered by intravenous injection at a volume of 1 mg / mL (control substance or Imurifidase) or 5.47 mL / kg (control substance or AAVrh74.eGFP). The control substances for Imurifidase and AAVrh74.eGFP were sterile physiological saline. The control substance for prednisolone was reverse osmosis water. Due to the complex test design, the animals were referred to by group number, and AAVrh74.CMV.eGFP was referred to as AAVrh74.eGFP in the sections of Overview, Results, Discussion, and Conclusion. In addition, since Administration Phase II consisted of a single dose of prednisolone to all animals and the period was 1 day, Administration Phase II was hardly or not discussed at all in the sections of Overview, Results, Discussion, and Conclusion.
[0352] Administration of Imurifidase and AAVrh74-eGFP Vector In this example, an AAVrh74-eGFP vector and Imurifidase were administered to non-human primates (NHP) to determine whether the Imurifidase administered before treatment reduced the total anti-AAVrh74 antibody titer for safe administration of AAV gene therapy.
[0353] One of the precautions of this study was that the efficacy of Imurifidase in NHP was about 70% compared to humans, and the efficacy of Imurifidase was about 99%.
[0354] NHPs were grouped according to existing antibody titers and treatments. Animals in groups 2 and 3 were seronegative, with a total AAVrh74 antibody titer of less than 1:400.
[0355] Animals in groups 4 and 5 had a total AAVrh74 antibody titer of 1:800 - 1:1,600 and were considered AAVrh74 seropositive animals.
[0356] Animals in group 6 had a total AAVrh74 antibody titer of 1:3,200 - 1:25,600 and were considered highly AAVrh74 seropositive. Animals in group 7 (the re - administration group) had a total AAVrh74 antibody titer of less than 1:400 before any treatment and were considered AABrh74 seronegative. After the first dose of the AAVrh74 vector, one animal in group 7 had a total AAVrh74 antibody titer of less than 1:400, and the other two animals in group 7 had total AAVrh74 antibody titers of 1:204,800 and 1:25,600, respectively.
[0357] The treatments were as follows. Animals in group 2 were administered only saline, and animals in groups 3 and 4 were administered the AAVrh74 - eGFP vector but no Imurifidase (vector control).
[0358] Animals in groups 5 and 6 were administered Imurifidase (IDEFIRIX®, Hansa Biopharma AB, Sweden) and the AAVrh74 - eGFP vector.
[0359] Animals in group 7 were administered the AAVrh74 - eGFP vector, followed by Imurifidase, followed by a second dose of the AAVrh74 - eGFP vector.
[0360] In groups 5 and 6, Imurifidase was administered at a dose of 10 mg / kg / dose on day 1, and AAVrh74 - EGFP was administered at a dose of 1.33×10 14 vector genomes / kg / dose on day 3.
[0361] In Group 7, AAVrh74-eGFP was administered at a dose of 1.33×10 14 vector genomes / kg / dose on Day 3 and Day 38, and Imurifidase was administered at a dose of 10 mg / kg / dose on Day 36.
[0362] The dosing schedule is shown in Table 19.
Table 19
[0363] In conclusion, animals with three different serum positive levels were administered a control substance (saline) or Imurifidase at a dose of 10 mg / kg / dose by bolus intravenous injection once on Day 1 (Groups 3 - 6) or once on Day 1 and Day 36 (Groups 2 and 7), followed by a control substance or AAVrh74.eGFP at a dose of 1.33×10 14 vg / kg / dose by slow bolus intravenous injection once on Day 3 (Groups 3 - 6) or once on Day 3 and Day 38 (Groups 2 and 7). As standard immunosuppressive treatment, all animals were administered a single dose of prednisolone once daily by forced oral administration throughout the duration of the study. AAVrh74.eGFP-related clinical findings included tachypnea corresponding to macroscopic observation of intraperitoneal and intrathoracic fluid in one animal administered AAVrh74.eGFP (anti-AAVrh74 titer of 1:400 or less) (Group 3).
[0364] Safety and efficacy evaluations were based on mortality, clinical findings, body weight, weight change, qualitative food intake, nerve conduction velocity (NCV) measurements, and clinical pathology and anatomical pathology. Blood samples were collected for clinical pathology, anti-AAVrh74 antibodies, Imurifidase exposure (pharmacokinetics) and efficacy (pharmacodynamics), cytokines, peripheral blood mononuclear cells, and complement analysis. Muscle biopsies and selected tissues were collected for vector genome analysis and direct fluorescence evaluation.
[0365] All animals survived until scheduled euthanasia. No changes in body weight or food intake, changes in sensory NCV, or AAVrh74.eGFP-related changes in peripheral blood mononuclear cell analysis were observed in animals administered AAVrh74.eGFP, regardless of whether they had been previously administered Imurifidase. An AAVrh74.eGFP-related clinical finding of rapid breathing corresponding to the macroscopic observation of fluid in the thoracic and abdominal cavities was observed in one animal in the third group. Total anti-AAVrh74 antibody responses in AAVrh74-eGFP and Imurifidase-treated mice
[0366] The total antibody response to AAVrh74-eGFP is shown in Figure 4. As expected, anti-AAVrh74 antibodies were not produced in animals in the second group that had no existing antibodies and were administered only saline. Animals in the third group that had a total AAVrh74 antibody titer of less than 1:400 prior to any treatment showed an increase in total anti-AAVrh74 antibody titer after administration of the AAVrh74-eGFP vector (Figure 4, third group).
[0367] Animals in the fourth group that had a total AAVrh74 antibody titer of 1:800 - 1:1,600 prior to treatment also showed an increase in anti-AAVrh74 antibody titer after administration of the AAVrh74-eGFP vector (Figure 4, fourth group).
[0368] Animals in the fifth group that had a total AAVrh74 antibody titer of 1:800 - 1:1,600 prior to treatment showed a decrease in total AAVrh74 antibody titer to less than 1:400 at the time of administration of Imurifidase on day 1. After administration of AAVrh74-eGFP on day 3, the total AAVrh74 antibody titer increased (Figure 4, fifth group).
[0369] Animals in the sixth group that had a total AAVrh74 antibody titer of 1:3,200 - 1:25,600 prior to treatment showed a decrease in AArh74 antibody titer to approximately 1:400 at the time of administration of Imurifidase on day 1. After administration of AAVrh74-eGFP on day 3, the total AAVrh74 antibody titer increased (Figure 4, sixth group).
[0370] Animals in Group 7, which had a total AAVrh74 antibody titer of 1:400 or less before treatment, had an increase in anti-AAVrh74 antibody titer after administration of the first dose of the AAVrh74-eGFP vector on Day 3. On Day 36, these animals were treated with imlifidase, and this imlifidase treatment resulted in a decrease in the total anti-AAVrh74 antibody titer. On Day 38, a second dose of AAVrh74-eGFP was administered to these animals, which resulted in a moderate increase in the anti-AAVrh74 antibody titer until approximately Day 50, after which the total anti-AAVrh74 antibody titer further increased.
[0371] In summary, these results showed that when imlifidase was administered to NHPs on Day 1, the total AAVrh74 antibody titer was maintained at 1:400 or less until at least Day 3. Furthermore, this data showed that administration of a second dose of imlifidase before the second dose of AAVrh74-eGFP did not significantly increase the anti-AAVrh74 antibody titer.
[0372] Total anti-AAVrh74 antibody titer after imlifidase Animals in Groups 2, 4, 5, and 6 were treated with imlifidase, and the total anti-AAVrh74 antibody titer was measured starting at 5 minutes after imlifidase treatment until the 5760-minute (96-hour) time point (Figure 5). No AAVrh74 antibody was detected in the control animals of Group 2. In animals in Group 4, which had an AAVrh74 antibody titer of 1:800 to 1:1,600 before treatment, the titer decreased to less than 1:400 approximately 2880 minutes (48 hours) after imlifidase treatment (Figure 5). In animals in Group 5, which had an AAVrh74 antibody titer of 1:800 to 1:1,600 before treatment, and in animals in Group 6, which had an AAVrh74 antibody titer of 1:3,200 to 1:25,600 before treatment, the AAVrh74 antibody titer decreased to less than 1:400 5 minutes and 30 minutes after imlifidase treatment, respectively (Figure 5).
[0373] In the animals of the seventh group, which had anti-AAVrh74 antibody titers of 1:204,800, 1:25,600, and 1:400, respectively, treatment with Imlygic resulted in a decrease in anti-AAVrh74 antibody titers in all animals after 5 minutes, and the lowest titers were measured between 30 minutes and 360 minutes (6 hours) (Figure 6A). Importantly, the animals in the seventh group did not result in a significant increase in anti-AAVrh74 antibody titers for at least 72 hours after readministration of anti-AAVrh74-eGFP (Figure 6B).
[0374] In summary, animals administered a single dose of AAVrh74-eGFP had an increase in anti-AAVrh74 capsid antibody titers, which was observed in both anti-AAVrh74 negative and anti-AAVrh74 positive animals, and slightly higher titers were observed in serum positive animals (Group 4). In animals with low serum positivity (titer levels of 1:400 or less) and moderate serum positivity (titer levels of 1:800 - 1:1600), treatment with Imlygic decreased the titer to the cut-off (defining the titer cut-off as 1:400 or less). However, in animals with high serum positivity levels (titers of 1:51200 or above, Group 7) that were readministered AAVrh74-eGFP, Imlygic was unable to decrease the high serum positive titers to the cut-off in all but 1 out of 3 animals. Administration of low-high serum positive animals and moderate serum positive animals allowed the titer to be decreased to the cut-off after Imlygic treatment. The ability of Imlygic treatment to decrease the titer to 1:400 or less was dependent on the total burden of anti-AAVrh74 antibodies before AAV administration.
[0375] Cleavage efficiency of Imlygic The cleavage efficiency of Imlygic was measured in serum samples from all animals using Western blot. Serum samples from serum negative animals in Group 3 (P0201, P0202, P0203) and serum positive animals in Group 4 (ID numbers: P0301, P0302, P0303) that did not receive Imlygic treatment are shown in Figures 7 and 8.
[0376] Group 5 serum-positive animals (P0401, P0402, P0402) with baseline AAVrh74 antibody titers of 1:400, 1:800, and 1:1,600, when treated with Imuridase, showed scIgG fragments, F(ab)2 fragments, and Fc fragments starting from 5 minutes after Imuridase treatment, respectively, resulting in AAVrh74 antibody titers of 1:200, 1:50, and 1:50 after Imuridase treatment (Figure 9). Furthermore, scIgG fragments, F(ab)2 fragments, and Fc fragments were dominant over total IgG in all animals for at least 24 hours.
[0377] Similarly, Group 6 serum-positive animals (P0501, P0502, P0503) with baseline AAVrh74 antibody titers of 1:6,400, 1:3,200, and 1:3,200, when treated with Imuridase, showed scIgG fragments, F(ab)2 fragments, and Fc fragments starting from 5 minutes after Imuridase treatment, respectively, resulting in AAVrh74 antibody titers of 1:800, 1:200, and 1:400 after Imuridase treatment (Figure 10). scIgG fragments, F(ab)2 fragments, and Fc fragments were dominant over total IgG in all animals for at least 24 hours.
[0378] Group 7 serum-negative animals administered the first dose of AAVrh74-eGFP vector had AAVrh74 antibody titers of 1:204,800, 1:400, and 1:25,600, respectively, on day 36 (P0601, P0602, P0603) (Figure 11). After Imuridase treatment on day 36, the animals in Group 7 showed scIgG fragments, F(ab)2 fragments, and Fc fragments starting from 5 minutes after Imuridase treatment, respectively, resulting in AAVrh74 antibody titers of 1:6,400, 1:200, and 1:3,200 after Imuridase treatment (Figure 11). scIgG fragments, F(ab)2 fragments, and Fc fragments were dominant over total IgG in all animals for at least 24 hours. eGFP transgene expression
[0379] Immunolabeling of green fluorescent protein (GFP) was used to detect transgene expression of eGFP in cells, and was observed in the heart (cardiomyocytes), skeletal muscle (muscle cells and cells in inflammatory infiltrates), liver (hepatocytes, Kupffer cells, and / or cells in small clusters of infiltrates), spleen (mononuclear cells in germinal centers and / or randomly scattered mononuclear cells), and kidney (tubular epithelium, macula densa, and / or interstitial cells of renal papilla, occasionally collecting duct epithelium, and / or rarely glomerular tuft epithelium) of animals in all AAVrh74-eGFP treatment groups, and in the gallbladder (reactive mesothelium) of one animal in group 7.
[0380] eGFP transgene expression was evaluated by fluorescence microscopy. Serum-negative animals in group 3 administered the AAVrh74-eGFP vector showed high GFP expression in the heart (Figure 12), skeletal muscle (Figure 13), and diaphragm (Figure 14).
[0381] Serum-positive animals in group 4 administered the AAVrh74-eGFP vector showed moderate GFP expression in the heart (Figure 12) and diaphragm (Figure 14), and low GFP expression in skeletal muscle (Figure 13). A tendency for higher GFP expression was observed in animals with low anti-AAVrh74 antibody titers.
[0382] Serum-positive animals in group 5 treated with imlifidase and administered the AAVrh74-eGFP vector showed high GFP expression in the heart (Figure 12), skeletal muscle (Figure 13), and diaphragm (Figure 14), and GFP expression was highest in animals with an anti-AAVrh74 antibody titer of 1:50 after imlifidase treatment, and slightly lower in animals with a titer of 1:200 after imlifidase treatment.
[0383] In contrast, high serum-positive animals in group 6 administered the AAVrh74-eGFP vector after imlifidase treatment showed low GFP expression in the heart (Figure 12), skeletal muscle (Figure 13), and diaphragm (Figure 14). As described above, the animals in group 6 had anti-AAVrh74 antibody titers of 1:800, 1:200, and 1:400 after imlifidase, respectively.
[0384] One animal in Group 7, which had an anti-AAVrh74 antibody titer of 1:400 after the first dose of AAVrh74-eGFP and an anti-AAVrh74 antibody titer of 1:200 after imlifidase treatment, showed high GFP expression in the heart (Figure 12), skeletal muscle (Figure 13), and diaphragm (Figure 14). In contrast, two animals in Group 7, which had high anti-AAVrh74 antibody titers after the first dose of AAVrh74-eGFP and anti-AAVrh74 antibody titers of 1:6,400 and 1:3,200, respectively, after imlifidase treatment, showed low GFP expression in the heart (Figure 12) and moderate GFP expression in the skeletal muscle (Figure 13) and diaphragm (Figure 14).
[0385] To determine the transduction levels across all tissues, the average GFP expression in all tissues was normalized to that in Group 3 (anti-AAVrh74 antibody negative and administered AAVrh74eGFP). Groups 4, 5, 6, and 7 showed decreased GFP expression compared to Group 3, and Group 5 (anti-AAVrh74 antibody titers of 1:800 to 1:1,600 and imlifidase treatment + AAVrh74-eGFP treatment) showed the highest GFP in all tissues compared to Groups 4, 6, and 7 (Figure 15).
[0386] GFP expression was also measured in different muscle tissues. GFP expression was highest in all the tested muscle tissues of the seronegative animals in Group 3 treated with AAVrh74-eGFP (Figure 16). The seropositive animals in Group 4 treated with AAVrh74-eGFP showed moderate GFP expression in the heart, biceps femoris, diaphragm, and vastus medialis (Figure 16). Thus, animals having a moderate level of pre-existing anti-AAVrh74 antibody titers (anti-AAVrh74 antibody titers of 1:800 to 1:1,600) before treatment with AAVrh74-eGFP had low levels of eGFP expression, consistent with the understanding that pre-existing antibodies block the expression mechanism of AAVrh74-eGFP. The low-level seropositive animals in Group 5 treated with imlifidase before AAVrh74-eGFP treatment showed moderate GFP expression in the heart, diaphragm, lateral and medial gastrocnemius muscles, and lateral and medial vastus muscles (Figure 16). Thus, administration of imlifidase to animals (Group 5) having pre-existing antibodies at a moderate level (anti-AAVrh74 antibody titers of 1:800 to 1:1,600) resulted in an increase in eGFP expression compared to animals (Group 4) having pre-existing antibodies at a moderate level without imlifidase administration. In contrast, animals (Group 6) having pre-existing antibodies at a high level (anti-AAVrh74 antibody titers of 1:3,200 to 1:25,600) treated with imlifidase before AAVrh74-eGFP treatment showed low-level GFP expression only in the heart, diaphragm, triceps, and lateral and medial gastrocnemius muscles, and no GFP expression in other tissues (Figure 16).
[0387] In addition, animals with pre-existing low antibody titers treated twice with imlifidase and AAVrh74-eGFP resulted in moderate levels of GFP expression (Group 7). These data indicate the effectiveness of imlifidase in improving the transduction rate of AAVrh74-eGFP in seropositive animals according to antibody titers.
[0388] Vector genome analysis Data from the vector genome analysis of the tissues showed that animals without existing anti-AAVrh74 antibodies (titer of 1:400 or less, group 3) achieved the highest levels of vector genome across all animals. Administration of imlifidase prior to administration of AAVrh74-aeGFP to animals with existing moderate antibodies (anti-AAVrh74 antibody titer range of 1:800 - 1:1600, group 5) resulted in an increase in GFP expression, a decrease in existing antibodies in seropositive animals, enhanced AAV transduction, and demonstrated the effectiveness of imlifidase in subsequent enhanced GFP expression, compared to animals with the same existing antibody range that did not receive imlifidase (group 4).
[0389] However, animals with existing high anti-AAVrh74 antibody titer levels (titer of 1:3200 - 1:25600) resulted in the second lowest vector genome transduction across all groups despite administration of imlifidase. One animal (group 7) showed evidence of seroconversion prior to administration of imlifidase and had the lowest transduction level among animals in group 7. After administration of AAVrh74-eGFP twice, group 7 showed the lowest transduction level across all tissues analyzed and was most similar to group 6 in terms of transduction.
[0390] Chemokine analysis No changes were observed in any of the cytokines examined at the 24-hour or 48-hour time points after administration in animals that received imlifidase, compared to the pre-dose values on day 1, controls, or animals that did not receive imlifidase.
[0391] Interleukin-1 receptor antagonist (IL-1RA) and monocyte chemoattractant protein-1 (MCP-1) AAVrh74-eGFP - single dose Compared with the pre-dose values, on day 43 of dosing phase III (40 days after AAVrh74-eGFP administration), in AAVrh74-negative animals (Group 3) administered AAVrh74-eGFP, a strong increase in IL-1RA level (70.75-fold) and MCP-1 level (4.38-fold) was observed. The magnitude of the increase was found to be several-fold higher in 2 animals of Group 3. The IL-1RA level decreased at subsequent time points compared to day 43 of the dosing phase III value, but remained 18-fold higher compared to the pre-dose value. The MCP1 level remained similar to that on day 43 of the dosing phase III value during the remaining test period.
[0392] In AAVrh74-positive animals (Groups 4, 5, and 6) administered the control substance or imlifidase and AAVrh74-eGFP, a more moderate increase in IL-1RA level (more than 4.5-fold) and MCP-1 level (more than 0.96-fold) was observed at 72 hours after administration on day 1 of dosing phase III (24 hours after AAVrh74-eGFP administration). In anti-AAVrh74 antibody-positive animals administered the control substance and AAVrh74-eGFP (Group 4) or imlifidase and AAVrh74-eGFP (Group 6), the IL-1RA level and MCP-1 level tended to return to the pre-dose levels and remained at levels similar to or slightly higher than the pre-dose values on day 43 of dosing phase III and subsequent time points. However, in anti-AAVrh74 antibody-positive animals (Group 5) administered imlifidase and AAVrh74-eGFP, the IL-1RA level and MCP-1 level remained increased in 2 out of 3 animals and 1 out of 3 animals, respectively, at day 43 of dosing phase III and subsequent time points compared to the baseline values.
[0393] In summary, the AAVrh74-eGFP-related increases in IL-1RA and MCP-1 were observed in both AAVrh74-negative and AAVrh74-positive animals (Groups 3 to 6), and a delayed but robust long-term increase was observed in AAVrh74-negative animals (Group 3) administered with AAVrh74-eGFP. The magnitude of the changes in IL-1RA levels and MCP-1 levels in AAVrh74-positive animals (Groups 5 and 6) administered with imralizumab and AAVrh74-eGFP was smaller compared to that in anti-AAVrh74 antibody-positive animals (Group 4) administered with imralizumab and AAVrh74-eGFP, and there was no consistency among the animals in the same group. Therefore, these changes were considered to be unrelated to imralizumab.
[0394] AAVrh74-eGFP - repeated dose In one anti-AAVrh74 antibody-negative animal, an increase in the IL-1RA level was observed at 72 hours after administration on day 1 of dosing stage III (24 hours after the first AAVrh74-eGFP administration). Compared with the pre-dose value, a stronger increase in IL-1RA (17.87-fold) was observed on day 15 of dosing stage III (12 days after the first AAVrh74-eGFP administration) in all anti-AAVrh74 antibody-negative animals (group 7) administered AAVrh74-eGFP. The IL-1RA level tended to return to the pre-dose value but remained higher (2.58-fold) than the pre-dose IL-1RA value on day 29 of dosing stage III (26 days after AAVrh74-eGFP administration). A further increase in the IL-1RA level was observed only in one animal administered the second dose of AAVrh74-GFP on day 57 of dosing stage III (21 days and 19 days after imlifidase administration and the second AAVrh74-eGFP administration, respectively), while the IL-1RA values of the other animals (group 7) administered the second dose of AAVrh74-eGFP remained close to the values observed on day 29 of dosing stage III (before imlifidase administration) for the remainder of the study. Overall, an AAVrh74-eGFP-related increase in IL-1RA was observed in anti-AAVrh74 antibody-negative animals administered the first dose of AAVrh74.eGFP. Since the magnitude of the change in IL-1RA after imlifidase administration and the second AAVrh74-eGFP administration was small and there was no consistency among the animals in the same group, these changes were considered to be unrelated to AAVrh74-eGFP or imlifidase.
[0395] A decrease in MCP-1 level was observed in one animal administered with AAVrh74.eGFP on day 29 of the dosing phase (26 days after the first AAVrh74-eGFP administration), compared to the pre-dose value. The MCP-1 level continued to decrease in this animal at all subsequent time points. An increase in MCP-1 level was observed in one animal administered with the second dose of AAVrh74-eGFP on day 43 of dosing phase III (7 days and 5 days after imlifidase administration and the second AAVrh74-eGFP administration, respectively), and at all subsequent time points during dosing phase III, compared to the baseline value. Overall, the changes in MCP-1 level were inconsistent in animals (Group 7) after the first and second doses of AAVrh74-eGFP and were considered unrelated to AAVrh74-eGFP.
[0396] Other cytokines IL-8 levels were detectable or above the limit of quantification in all animals at all time points evaluated, even at the pre-dose time point. Since the changes in IL-8 were equivalent to the pre-dosing phase values and were observed in the controls, these changes were considered to be due to normal biological variations and unrelated to the test substance.
[0397] An increase in MIP-1β was observed in animals (Group 7) administered with AAVrh74.eGFP on day 15 of dosing phase III (12 days after the first AAVrh74-eGFP administration). Since the magnitude of these increases was small and not observed at subsequent time points, they were considered unrelated to the test substance.
[0398] The levels of GM-CSF, IFN-γ, IL-1β, IL-2, IL-5, IL-6, IL-10, IL12 / IL23p40, IL-13, IL-15, IL-17A, MIP-1α, and TGF-α were sporadically elevated above the lower limit of quantification in animals administered the control substance or AAVrh74-eGFP. Since the magnitude of the changes in these cytokines was small, observed in controls, and inconsistent among animals of the same group, these changes were considered normal biological variations and unrelated to imlifidase or AAVrh74-eGFP.
[0399] In conclusion, in animals administered the first dose of AAVrh74-eGFP, AAVrh74-eGFP-related increases in IL-1RA and MCP-1 were observed in both anti-AAVrh74 antibody-negative animals (Group 3) and anti-AAVrh74 antibody-positive animals (Groups 4, 5, and 6), with a more robust but delayed and long-term increase observed in negative animals. Compared to animals administered saline and AAVrh74-eGFP (Group 4), no consistent imlifidase-related changes in IL-1RA levels and MCP-1 levels were observed in anti-AAVrh74 antibody-positive animals (Groups 5 and 6) administered imlifidase and AAVrh74-eGFP. In animals administered repeated doses of AAVrh74-eGFP (Group 7), an AAVrh74-eGFP-related increase in IL-1RA was observed in anti-AAVrh74 antibody-negative animals after the first dose of AAVrh74.eGFP, but not in MCP-1. No consistent AAVrh74-eGFP-related changes were observed in either IL-1RA levels or MCP-1 levels in animals after administration of the second dose of imlifidase and AAVrh74-eGFP.
[0400] No imlifidase- or AAVrh74.eGFP-related changes in the levels of GM-CSF, IFN-γ, IL-1β, IL-2, IL-5, IL-6, IL-8, IL-10, IL12 / IL23p40, IL-13, IL-15, IL-17A, MIP-1α,β, or TGF-α were observed in animals administered single or repeated doses of AAVrh74-eGFP.
[0401] Thus, AAVrh74-eGFP-related changes were seen in both anti-AAVrh74 antibody-negative and anti-AAVrh74 antibody-positive animals only at the levels of IL-1RA and MCP-1. These increases were stronger and more long-lasting in anti-AAVrh74 antibody-negative animals compared to anti-AAVrh74 antibody-positive animals. No Imurifidase-related changes were observed at any of the cytokine levels investigated. No AAVrh74-eGFP- or Imurifidase-related effects on other cytokine levels and complement activation were observed.
[0402] Clinical Pathology AAVrh74-eGFP-related clinical pathology findings in the animals of Groups 2 to 7 were minimal to moderate in scale and consisted mainly of increases in alanine aminotransferase (ALT) activity and aspartate aminotransferase (AST) activity, which were often associated with increases in creatine kinase (CK) activity. Clinical pathology was consistent with skeletal muscle damage and correlated with microscopic findings of degeneration / necrosis in the heart and skeletal muscle. Degeneration / necrosis of cardiomyocytes in the heart was also likely to have contributed to the aforementioned increases in CK activity and / or AST activity. The scale of enzyme activities (ALT, AST, and CK) was generally highest on Day 22 and / or Day 36 in all AAVrh74-eGFP-treated groups, regardless of antibody titer or co-administration of Imurifidase, and showed a general tendency for a decrease over time (from Day 36 to Day 63) in Groups 4, 5, and 6 compared to Groups 3 and 7.
[0403] Additional AAVrh74-eGFP-related effects were observed in one animal each from Group 3 and Group 7, including a decrease in albumin concentration and total protein concentration, a decrease in albumin concentration, cardiomyocyte degeneration, necrosis, and inflammation, which are likely to result in pleural effusion and are considered to contribute to fluid retention in two or more body cavities of these animals. The AAVrh74-eGFP-related effects limited to the animals in Group 7 consisted of a decrease in erythrocyte volume, a decrease in mean cell volume (decrease in red blood cell [RBC] size), a decrease in mean erythrocyte hemoglobin concentration, and a decrease in mean erythrocyte hemoglobin content (decrease in RBC hemoglobin content); an increase in RBC distribution width and a moderate increase in absolute reticulocyte count (indicating erythropoiesis); and an increase in platelet count considered to be secondary to the erythrocyte volume and regenerative response. The decrease in food intake contributed to these findings and was highly likely to be correlated with the decrease in cholesterol concentration in this animal. Furthermore, in the animals of Group 7, evidence of hepatobiliary derangement (increase in gamma-glutamyltransferase activity, alkaline phosphatase activity, and total bilirubin concentration) was observed in the absence of microscopic evidence of hepatobiliary changes. The additional AAVrh74-eGFP-related effects limited to the animals in Group 3 consisted of an increase in urea nitrogen and an increase in inorganic phosphorus concentration, indicating renal derangement, which was not accompanied by microscopic correlation in the kidney.
[0404] In anatomical pathology, vector-related microscopic findings at terminal sacrifice were observed in the peripheral nervous system (sciatic nerve, left and right plantar nerves, and left and right radial nerves), heart, skeletal muscle (biceps femoris, left gastrocnemius [medial and lateral], right gastrocnemius [medial and lateral], tibialis anterior, and tongue and esophageal skeletal muscle), and liver in the AAVrh74-eGFP-treated groups. Vector-related microscopic findings in the central nervous system (brainstem and spinal cord) and lumbar dorsal root ganglia were observed in the animals of Group 3, Group 5, and Group 7. These microscopic findings in the spinal cord and dorsal root ganglia are well-characterized changes observed with AAV vector administration (Hinderer et al., 2018; Hutt et al., 2022). Additionally, these findings were not related to clinical findings or observations during nerve conduction velocity testing.
[0405] Regardless of whether imrilfidase preceded or not, the AAVrh74-eGFP-related microscopic findings observed in all AAVrh74-eGFP treatment groups included nerve fiber degeneration (minimal to moderate) in peripheral nerves (sciatic, left and right plantar, and left and right radial); oval cell hyperplasia (minimal to moderate) in the liver; degeneration / necrosis (minimal to moderate) and mononuclear cell inflammation (minimal to marked) in the heart; and degeneration and necrosis (minimal to marked), mononuclear cell inflammation (minimal to marked), atrophy (minimal to slight), and / or fibrosis (minimal to moderate) in skeletal muscles (biceps femoris, left gastrocnemius [medial and lateral], right gastrocnemius [medial and lateral], tibialis anterior, and / or tongue and esophageal skeletal muscles).
[0406] The microscopic findings in skeletal muscles were consistent with the recognized effects of GFP reporter gene expression in skeletal muscles and oval cell hyperplasia in the liver, and correlated with the clinicopathological findings of increased aspartate aminotransferase (AST), creatine kinase (CK), and alanine aminotransferase (ALT). Degeneration and necrosis in the heart were also likely to contribute to the increase in AST activity and / or CK activity. The AAVrh74 vector-related macroscopic findings were observed in the intravenous injection site (hypertrophic tissue surrounding the right jugular vein) and the right medial gastrocnemius (discolored yellowish-brown) of one animal in Group 5, and correlated with the microscopic findings of skeletal muscle degeneration, necrosis, and mononuclear cell inflammation in the deep skeletal muscles of the right jugular vein and the right medial gastrocnemius.
[0407] In summary, these results showed that in animals with higher AAVrh74 titers, less severe AAVrh74-eGFP-related effects were observed in the clinicopathological examination results, which was consistent with the well-recognized effect that existing anti-AAV antibodies reduce AAV transduction. The AAVrh74-eGFP-related effects were not observed in the coagulation test results during Administration Phase III, regardless of the presence or absence of imrilfidase. The AAVrh74-eGFP-related hematological effects during Administration Phase III were limited to the animals in Group 7 described above.
[0408] Summary In animals administered a single dose of AAVrh74eGFP, an increase in anti-capsid antibody titers was observed regardless of serum positive levels. Treatment with Imlygic resulted in a decrease in anti-AAVrh74 antibody titer levels to the defined cut-off (≤1:400) in animals with low and moderate existing titer levels. Imlygic was unable to reduce high anti-AAVrh74 titer levels to the cut-off in 2 out of 3 animals in group 7 after a series of second doses. The ability of Imlygic treatment to reduce titers to the cut-off was dependent on the total burden of anti-AAVrh74 antibodies prior to AAV administration. Similarly, tissue vector genome analysis and quantification of GFP percent also indicated that Imlygic was effective in reducing existing antibodies, enhancing AAV transduction and subsequent eGFP expression, and enhancing the rate of transduction of AAVrh74-eGFP in serum positive animals, depending on the existing antibody titer levels.
[0409] Overall, Imlygic was found to be a safe and effective means for reducing existing anti-AAVrh74 titer levels in serum positive animals administered AAVrh74-eGFP, but the reduction was dependent on the existing anti-AAVrh74 titer levels prior to Imlygic administration. Repeated administration of Imlygic on day 36, followed by a second dose of AAVrh74-eGFP on day 38, resulted in a decrease in anti-AAVrh74 antibody titer levels in 1 out of 3 animals, and thus the efficacy was lower in the repeated dose scenario.
[0410] In summary, this NHP study demonstrated proof-of-concept that pretreatment with Imlygic reduced the total AAVrh74 antibody titers to enable safe administration of AAVrh74 gene therapy. In this NHP study, no adverse clinical events, no Imlygic- or AAV-related deaths, no immunotoxicity, or histopathology were observed in the genitalia either.
[0411] Reduction of anti-AAVrh74 antibody titers by Imlygic pretreatment resulted in efficient transduction and expression of the GFP transgene in muscle, heart, and diaphragm.
[0412] Example 2: An open-label systemic gene delivery study to evaluate the safety, tolerability, and expression of delandistrogene moxeparvovec related to imlifidase in subjects with Duchenne muscular dystrophy having existing antibodies against rAAVrh74 Objectives and Evaluation Items Primary Objectives 1) To evaluate microdystrophin expression at 12 weeks after administration of delandistrogene moxeparvovec in subjects pre-treated with imlifidase. Evaluation Items: Change in the amount of microdystrophin protein expression in biopsied muscle tissue from baseline to week 12 (Part 1), measured by Western blot, immunofluorescence (IF) fiber intensity, and IF dystrophin-positive fiber percentage (PDPF).
[0413] 2) To evaluate microdystrophin transduction at 12 weeks after administration of delandistrogene moxeparvovec in subjects pre-treated with imlifidase. Evaluation Items: Vector genome copies using polymerase chain reaction in muscle tissue biopsy. Secondary Objectives
[0414] 1) To establish the pharmacokinetic (PK) profile of imlifidase. Evaluation Items: Imlifidase PK in serum up to 7 days after administration of iflifidase.
[0415] 2) To establish the pharmacodynamic (PD) profile of imlifidase (IgG cleavage and recovery). Evaluation Items: Imlifidase PD (total IgG) in serum up to 12 weeks after administration of imlifidase.
[0416] 3) To evaluate the rAAVrh74 antibody titer after administration of imlifidase. Evaluation Items: rAAVrh74 antibody titer up to 120 hours after administration of imlifidase.
[0417] 4) Evaluate the rAAVrh74 genome concentration in the systemic circulation. Evaluation items: Vector genome copies using polymerase chain reaction in serum up to 7 days after administration of delandistrogene moxeparvovec.
[0418] 5) Evaluate the safety of imlifidase. Evaluation items: Occurrence of adverse events expressed under treatment, deterioration of vital or physical examination findings, occurrence of adverse events of particular interest, occurrence of severe adverse events, and clinically significant abnormalities in safety clinical test evaluations.
[0419] 6) Evaluate the safety of the combination of imlifidase and subsequent delandistrogene moxeparvovec. Evaluation items: Occurrence of adverse events expressed under treatment, deterioration of vital or physical examination findings, occurrence of adverse events of particular interest, occurrence of severe adverse events, clinically significant abnormalities in safety clinical test evaluations, electrocardiogram (ECG), and echocardiogram (ECHO).
[0420] Exploratory objectives 1) Evaluate the effect of delandistrogene moxeparvovec on creatine kinase (CK) levels. Evaluation items: Change in CK from baseline over 104 weeks.
[0421] 2) Evaluate the effect of delandistrogene moxeparvovec on physical function evaluation, as assessed by the North Star Ambulatory Assessment (NSAA) score. Evaluation items: Change in the total NSAA score from baseline to week 104.
[0422] 3) Evaluating the effect of delandistrogene moxeparvovec on the timed function test, which is evaluated by measuring 100-meter walking / running (100MWR), time to climb four steps, time to rise from the floor, and 10-meter walking / running (10MWR). Evaluation items: change in 100MWR time from baseline to week 104, change in time to climb four steps from baseline to week 104, change in time to rise from the floor from baseline to week 104, change in 10MWR time from baseline to week 104.
[0423] 4) Evaluating the immunogenicity of delandistrogene moxeparvovec, which is evaluated by detecting cellular immune responses against rAAVrh74 and the micro-dystrophin transgene, and antibodies against rAAVrh74 and micro-dystrophin. Evaluation items: cellular immune responses against rAAVrh74 and the micro-dystrophin transgene, measured by enzyme-linked immunospot (ELISpot) over 104 weeks (see Slota et al., Expert Rev Vaccines 10(3):299 - 206, 2011), and antibody titers against rAAVrh74 and the micro-dystrophin transgene over 104 weeks.
[0424] 5) Establishing the immunogenicity profile of imlifidase (anti-drug antibody [ADA]). Evaluation item: imlifidase ADA serum levels over 104 weeks after imlifidase administration.
[0425] Methodology This is an open-label trial of ambulatory male subjects aged 4 to 8 years with DMD and existing antibodies against rAAVrh74. Approximately 6 subjects will be treated with imlifidase and subsequently with delandistrogene moxeparvovec. To ensure that 6 subjects receive both therapies, additional subjects (up to 6) may be enrolled to account for subjects who receive imlifidase but do not meet the criteria for delandistrogene moxeparvovec administration.
[0426] The subjects receive the first IV dose of imlifidase (0.25 mg / kg), and then, if the results of the rAAVrh74 antibody after imlifidase are non-reactive, they receive an IV infusion of delandistrogene moxeparvovec (1.33×10 14 vg / kg) approximately 48 hours later, or if the results of rAAVrh74 after imlifidase remain reactive, they receive a second IV dose of imlifidase (0.25 mg / kg) within 60 hours of the first dose of imlifidase. For subjects who receive the second IV dose of imlifidase, if the rAAVrh74 results after imlifidase are non-reactive, the subject receives an IV delandistrogene moxeparvovec (1.33×10 14 vg / kg) approximately 48 hours later. Subjects who have rAAVrh74 results that return to reactive after the second dose of imlifidase do not receive delandistrogene moxeparvovec.
[0427] The first three subjects who receive both imlifidase and delandistrogene moxeparvovec are sentinel subjects and enter an imlifidase infusion period with at least one week between infusions. The safety, PK / PD, and 12-week expression data of these three sentinel subjects are reviewed by the SRC before additional subjects enter the infusion period.
[0428] This study consists of the following four periods. · A screening period (before infusion) of up to approximately 3 weeks (during which disease characteristics, baseline therapy, imlifidase antibody concentration, and rAAVrh74 antibody titer are evaluated and the pre-infusion assessment is completed). · A baseline period (before infusion) of approximately 1 week (during which the baseline assessment is completed). This period starts on the registration date and ends on the day before the first imlifidase infusion. · An imlifidase infusion period of up to 5 days (during which a maximum of 2 IV doses of imlifidase are administered). o Starting on the first imlifidase infusion day, the subjects initiate prophylactic antibiotics for 4 weeks. o Subjects receive antihistamines prior to each Immulifidase injection. · Follow-up period: o Subjects with rAAVrh74 antibody results that remained reactive despite two Immulifidase injections do not receive delandistrogene moxeparvovec and these subjects are followed for 52 weeks, during which safety parameters are monitored. For these subjects, the final study procedure is performed at week 52. o Subjects with rAAVrh74 antibody results that reverted to non-reactive after Immulifidase injection receive a single intravenous dose of delandistrogene moxeparvovec (1.33×10 14 vg / kg) on day 1 of a 104-week follow-up period and safety and expression parameters are evaluated during that period. - Starting at least 1 day before delandistrogene moxeparvovec injection, subjects receive at least 1 mg / kg of glucocorticoid (prednisone equivalent) daily until at least day 60 after delandistrogene moxeparvovec injection, unless early taper is needed to manage adverse events. - Part 1 of the follow-up period starts with delandistrogene moxeparvovec injection (day 1) and ends at week 12. - Part 2 of the follow-up period starts at week 12 and ends at week 104. For subjects who complete the study, the final study visit is performed at week 104.
[0429] Efficacy, safety, and immunogenicity evaluations are performed throughout the study and presented in the event schedule tables in Tables 11 - 14.
[0430] Number of subjects: Up to 12 subjects may be enrolled, but enrollment ends when both Immulifidase and delandistrogene moxeparvovec are administered to approximately 6 ambulatory subjects aged 4 years or older and 8 years or younger. At least 3 subjects enrolled in the study have a delandistrogene moxeparvovec antibody titer of 1:1600 or greater.
[0431] Inclusion Criteria: Subjects must meet all of the following criteria to be eligible to participate in this trial. 1. Male at birth, ambulant, and between 4 and 8 years of age at the time of screening. 2. Had a confirmed diagnosis of DMD prior to screening based on clinical findings documentation and confirmatory genetic testing using clinical diagnostic genetic testing. The gene report must document a frameshift deletion, frameshift duplication, premature termination ("nonsense"), canonical splice site variant, or other pathogenic variant in the DMD gene that is fully contained within exons 18 - 79 (including boundaries) and is predicted to lead to the absence of dystrophin protein. a. Variants in exons 1 - 17 (including boundaries) are not eligible. b. In-frame deletions, in-frame duplications, and variants of unknown significance (VUS) are not eligible. 3. Able to cooperate in the motor evaluation test. 4. All recommended encapsulated live organism prophylactic vaccinations in the area are up-to-date. 5. A stable dose of oral corticosteroids for at least 12 weeks prior to screening (this dose is expected to remain constant until week 52 of the trial, barring potential adjustment for weight changes). 6. Had a total rAAVrh74 antibody result at screening that was reactive by the total anti-AAVrh74 antibody ELISA assay. 7. Sexually active subjects must consent to use contraception throughout the duration of the trial, and female sexual partners must also use a medically acceptable form of contraception (e.g., oral contraceptives). 8. If under the age of consent (under 18 years), (a) has a parent or legal guardian who understands and can comply with the trial visit schedule and all other protocol requirements. 9. Intention to provide informed consent (where applicable), and (a) there is a parent or legal guardian who intends to provide written informed consent / assent for the subject to participate in this trial.
[0432] Exclusion Criteria Exclude subjects who meet any of the following criteria from this trial. 1. Previous treatment with Imurifidase. 2. High-dose IVIG treatment (2 g / kg BW) within 28 days before Imurifidase treatment. 3. Have a left ventricular ejection fraction of less than 40% on ECHO at screening, or have clinical signs and / or symptoms of cardiomyopathy. 4. Major surgery within 3 months before Day 1, or surgery scheduled at any time during this trial. 5. Any other clinically significant disease, including heart, lung, liver, kidney, hematological, immunological, or behavioral diseases, or infectious diseases, or malignant or concurrent diseases, or the need for chronic drug treatment that, in the opinion of the principal investigator, would cause unnecessary risks by receiving the investigational drug, or a medical condition or circumstance that, in the opinion of the principal investigator, would interfere with the subject's ability to comply with the tests or procedures required by the protocol, or would interfere with the subject's health, safety, or clinical interpretability. 6. Have serological evidence of ongoing, chronic, or active human immunodeficiency virus, hepatitis C, or hepatitis B infection. 7. Subjects with a history of major thromboembolic events, active peripheral vascular disease, or proven hypercoagulable state. 8. Subjects with active tuberculosis. 9. Have a history of thrombotic thrombocytopenic purpura (TTP), or present or have a known family history of TTP. 10. Have a medical condition or circumstance that, in the opinion of the principal investigator, would interfere with the subject's ability to comply with the tests or procedures required by the protocol, or would interfere with the subject's health, safety, or clinical interpretability. Have a symptomatic infection (e.g., upper respiratory tract infection, pneumonia, nephritis, meningitis, tuberculosis) within 4 weeks before Day 11. Exhibit a cognitive function delay or disorder that may disrupt motor development according to the opinion of the principal investigator of the clinical trial. 13. Treatment with any of the following therapies according to the following time frames specified below: Any time point: gene therapy, cell-based therapy (e.g., stem cell transplantation), CRISPR / Cas9, or any other form of gene editing. Within 12 weeks from Day 1 and at any time during the trial: use of human growth factors. Within 6 months from Day 1: any investigational drug, any treatment designed to increase dystrophin expression (e.g., Translarna (trademark)). 14. Have received a live virus vaccine within 4 weeks from the hospital visit on Day 1 or an inactivated vaccine within 2 weeks, or are scheduled to receive a vaccination during the first 3 months from Day 1. 15. Have clinically significant abnormal clinical test values considered by the principal investigator of the clinical trial, including but not limited to the following. o Gamma-glutamyltransferase is more than 2 times the upper limit of normal (ULN). o Total bilirubin is above ULN. Note: An increase in total bilirubin confirmed to be due to Gilbert's syndrome is not excluded. o White blood cell count is more than 18,500 per μl. o Platelets are below the lower limit of normal. 16. Known hypersensitivity to delandistrogene moxeparvovec or its excipients or to imlifidase or its excipients. 17. The family does not wish to disclose the subject's participation in the trial to general practitioners and other healthcare providers.
[0433] Investigational drug, dosage, and administration method: Imlifidase (0.25 mg / kg) by IV infusion, and delandistrogene moxeparvovec (1.33×10 14 vg / kg) by single IV infusion.
[0434] Test period: The participation period for each subject in this study is approximately 108 weeks, the pre-injection period is approximately 4 weeks, and the treatment and follow-up period is expected to be 104 weeks. For subjects who do not receive delandistrogene moxeparvovec, the participation period is approximately 56 weeks, the pre-injection period is approximately 4 weeks, and the injection and follow-up period is expected to be 52 weeks.
[0435] Statistical methods: Determination of the number of cases: The analysis of the primary evaluation items in this study is descriptive. A total of up to 12 subjects may be enrolled to have approximately 6 ambulatory subjects aged 4 to 8 years who receive both imlifidase and delandistrogene moxeparvovec.
[0436] Statistical analysis of primary evaluation items: The statistical analysis of microdystrophin protein expression and transduction will be performed after the assays of microdystrophin protein expression at baseline and week 12 and the assay of microdystrophin transduction at week 12 are completed. The observed values of the primary evaluation items and the changes from the baseline values will be descriptively summarized.
[0437] Statistical analysis of secondary evaluation items: PK and / or PD data analysis The PK parameter Cmax is estimated based on the actual values. The remaining PK parameters are estimated by non-compartmental analysis or compartmental analysis based on the measured values of the serum concentration-time data of imlifidase, and whenever possible, the following parameters: AUC, Tmax, t1 / 2, CL, and Vz (but not limited to these) are estimated.
[0438] The PD analysis is descriptive based on the measured values of the serum concentration-time data of intact IgG, the absolute concentration of IgG (intact + single-cleaved IgG [scIgG]), and the proportion of the remaining IgG.
[0439] Safety analysis Describe descriptively the adverse events, clinical examination evaluations, vital signs, ECG, ECHO, physical examination findings, as well as weight and height.
[0440] rAAVrh74 antibody and vector genome analysis Describe descriptively the antibody titers against rAAVrh74 and vector genome copies in serum.
[0441] Study design The study design of the subjects who received only Imlygic is shown in Figure 1.
[0442] The overall study design is shown in Figure 2.
[0443] The design of the pre-injection period and the Imlygic injection period is shown in Figure 3. Certain events shown in Table 11 were scheduled before injection and during the Imlygic injection period. The events scheduled during the follow-up period of the subjects who did not receive delandistrogene moxeparvovec are shown in Table 12. The events scheduled during the follow-up period of the subjects who received delandistrogene moxeparvovec are shown in Table 13 (Part 1) and Table 14 (Part 2).
[0444] Screening / baseline evaluation Demographics and medical history Obtain demographic information (e.g., age, sex at birth, race, ethnicity, weight, height, body mass index) and medical history for all subjects.
[0445] Genetic diagnosis Subjects must have received a definitive diagnosis of DMD prior to screening based on confirmatory genetic testing using clinical documentation of findings and prior clinical diagnostic genetic testing. The gene report must describe a frameshift deletion, frameshift duplication, premature stop, or other pathogenic variant of the DMD gene that is completely contained within exons 18 - 79 (including boundaries) and is expected to lead to the absence of dystrophin protein.
[0446] Mutations in exons 1 - 17 (including boundary values) are not eligible.
[0447] In - frame deletions, in - frame duplications, and variants of unknown significance (「VUS」) are not eligible.
[0448] Mutations completely contained within exon 45 (including boundary values) are not eligible.
[0449] Efficacy assessment Microdystrophin expression Muscle biopsies for the evaluation of microdystrophin expression are taken from all subjects at baseline and at week 12 as specified in Tables 11 and 13. The muscle biopsy should be taken using an open biopsy or a VACORA core biopsy, with the approval of the study sponsor. The biopsy requires the collection of muscle tissue from the medial gastrocnemius muscle. If this muscle is not viable, prior approval from the study sponsor is required for the use of an alternative muscle.
[0450] Biopsy samples are used to quantify transgene expression by Sarepta Western blot adjusted for muscle content, IF fiber strength, and PDPF. For further details on the handling and processing of biopsy tissue, refer to the Surgical and Laboratory Biopsy Manual.
[0451] Functional assessment Throughout the trial, every effort must be made to have each subject evaluated by the same clinical evaluator for physical function assessments (NSAA and timed function tests). The functional assessment should be scheduled in the morning and should be the first assessment conducted during a particular hospital visit.
[0452] The functional assessment is performed at the time points indicated in Tables 11, 13, and 14.
[0453] North Star Ambulatory Assessment Scale The NSAA is a scale managed by clinicians who evaluate the performance of various functional activities (Mazzone E, et al., Neuromuscul Disord. 20(11):712-6(2010), which is incorporated herein by reference in its entirety). It was designed to be used in boys with DMD who can stand and is being used in boys with DMD in the age ranges of this study (over 3 years old and under 8 years old, and 8 years old and above) (Connolly et al. Neuromuscul Disord. 2013;23(7):529-39, Mrecuri E, et al., PLoS One. 016;11(8):e0160195, Muntoni F, et al.,. PLoS One. 2019 Sep 3;14(9):e0221097, which are incorporated herein by reference in their entireties).
[0454] During this assessment, the subject performs 17 different functional activities including 10MWR, rising from sitting to standing, standing on one leg, ascending a box step, descending a box step, rising from supine to sitting, rising from the floor, lifting the head from the floor, standing on tiptoe, and hopping.
[0455] The subject is graded as follows: 2 = normal, no obvious activity modification, 1 = modified method but achieving the goal without physical assistance from others, 0 = unable to achieve the goal independently.
[0456] Time to rise from the floor The test for the time to rise from the floor is part of the NSAA (item 11) and quantifies the time required for the subject to start in the supine position with both arms at the sides and stand in a straight position with both arms at the sides (Henricson 2013, which is incorporated herein by reference in its entirety). The time required for the subject to complete this task is recorded during the NSAA implementation.
[0457] 10-meter walk / run The 10MWT is part of the NSAA (Item 17) and quantifies the time required for the subject to run or walk 10 meters (on a straight path) from a standing position (McDonald CM, et al., Muscle Nerve. 2013 Sep;48(3):357 - 68, which is incorporated herein by reference in its entirety). The subject is recommended to run past the 10 - meter mark. Record the time required for the subject to cover this distance during the NSAA implementation.
[0458] Time to climb 4 steps The 4 - step test quantifies the time required for the subject to climb a standard 4 - step (each step 6 inches high) (Bushby K, et al., Clin Investig (Lond). 2011;1(9):1217 - 35, which is incorporated herein by reference in its entirety). Record the time required for the subject to climb the standard - sized 4 - steps.
[0459] 100 - meter walk / run The 100MWT quantifies the time required for the subject to run or walk 100 meters (on a straight path) from a standing position (Alfano LN, et al., Neuromuscul Disord. 2017;27(5):452 - 7, which is incorporated herein by reference in its entirety). The subject is recommended to run past the 100 - meter mark. Record the time required for the subject to cover this distance.
[0460] Vector genome and quantification Perform vector quantification in serum for all subjects at the time of the test visit using polymerase chain reaction as indicated in Tables 11, 13, and 14. On Day 2, samples should be collected approximately 22 - 26 hours after the end of the delanzumab injection.
[0461] Measure vector genome copies in muscle biopsy samples at baseline and at 12 weeks using polymerase chain reaction.
[0462] Creatine kinase Creatine kinase levels after delranestroge moxeparbovec injection serve as an exploratory efficacy measure.
[0463] Safety evaluation Physical examination At the time points specified in Tables 11 to 14, a general or brief (symptom-oriented) physical examination is performed by the principal investigator or a qualified study staff member.
[0464] The general physical examination includes an examination of the general appearance, head, ears, eyes, nose, throat (HEENT), heart, chest (respiratory), abdomen (gastrointestinal), skin, lymph nodes, extremities, and musculoskeletal and nervous systems.
[0465] The brief physical examination includes an examination of the general appearance, HEENT, heart, chest, abdomen, and skin assessment.
[0466] Electrocardiogram and echocardiogram A 12-lead ECG is obtained in triplicate at the time points specified in Tables 11, 13, and 14 using an ECG device that automatically calculates the heart rate and measures the PR, QRS, and QT intervals. All ECGs should be performed before any invasive procedure (e.g., blood sampling, study drug injection, or biopsy). All ECGs should be performed only after the subject is at rest and has been quiet for approximately 5 minutes. On Day 1, a triplicate ECG is obtained both before and after delranestroge moxeparbovec injection. The principal investigator (or designee) reviews the ECG results and determines whether these findings are clinically significant. The pre-injection review on Day 1 should be completed and documented before delranestroge moxeparbovec injection.
[0467] A standard two-dimensional ECHO is obtained at the time points specified in Tables 11 and 14. An echocardiogram is performed before any invasive procedure (e.g., blood sampling, study drug injection, or biopsy). A locally medically qualified staff member reviews and interprets the ECHO. The left ventricular ejection fraction is described.
Table 11-1
Table 11-2
Table 11-3
Table 11-4
Table 11-5
Table 12-1
Table 12-2
Table 12-3
Table 13-1
Table 13-2
Table 13-3
Table 13-4
Table 13-5
Table 14-1
Table 14-2
Table 14-3
Table 15-1
Table 15-2
[0468] Example 3: Test Design of Example 2 Overall Test Design This is an open-label trial of male subjects 4 to 8 years of age with DMD and existing antibodies to rAAVrh74. Approximately 6 subjects will be treated with Emflaza and subsequently with delandistrogene moxeparvovec.
[0469] To ensure that at least 6 subjects receive both therapies, additional subjects (up to 6) may be enrolled to account for subjects who receive Emflaza but do not meet the criteria for delandistrogene moxeparvovec administration.
[0470] The first 3 subjects to receive both Emflaza and delandistrogene moxeparvovec are sentinel subjects and enter an infusion period with at least 1 week between infusions. The safety, PK / PD, and expression data for these 3 sentinel subjects are reviewed by the SRC before additional subjects enter the infusion period.
[0471] The total participation period for subjects receiving both Emflaza and delandistrogene moxeparvovec is expected to be approximately 108 weeks, including an approximate 4-week pre-infusion period, a maximum approximate 5-day Emflaza infusion period, and a 104-week delandistrogene moxeparvovec treatment and follow-up period. The total participation period for subjects not receiving delandistrogene moxeparvovec is expected to be approximately 56 weeks, including an approximate 4-week pre-infusion period, an approximate 5-day Emflaza infusion period, and a 52-week follow-up period.
[0472] Schematic diagrams of the test design are provided in Figures 1 - 3. Event schedules are provided in Tables 11 - 14.
[0473] Pre-infusion Period Before undergoing the test procedures, the subject provides informed consent / assent, and the parent or legal guardian provides written informed consent for the subject to participate in the trial (in the case of subjects under 18 years of age).
[0474] Screening period During the screening period of approximately up to 3 weeks, various evaluations are conducted to confirm eligibility, including the subject's medical history, demographics, documentation of DMD genotype determination, vital signs, physical examination, and blood sampling for enzyme-linked immunosorbent assay (ELISA) and selected clinical laboratory evaluations.
[0475] During the screening period, additional evaluations include ECG, ECHO, ribonucleic acid (RNA) samples, ELISpot samples, and premedication and concomitant medication reviews. For a complete overview of the evaluations conducted during the screening period, refer to the event schedules in Tables 11 - 14.
[0476] All clinical laboratory samples obtained, regardless of the screening results, are stored for future research on DMD if permitted by the informed consent / assent form, and are retained for up to 15 years after the end of this trial or in accordance with local regulations.
[0477] Baseline period The baseline period begins when eligibility is confirmed and ends on the day before the first injection of Emflaza. During this period, vital signs, selected clinical laboratory evaluations, and a brief physical examination are performed.
[0478] The physical function evaluations conducted include the NSAA (including time to rise from the floor and timed function test at 10MWR, although these timed components are not part of the NSAA), time to climb 4 steps, and 100MWR. The functional evaluation data collected at the baseline visit are used for the efficacy evaluation item analysis described in Section 5.2 and detailed in the Statistical Analysis Plan (SAP).
[0479] After all other pre-injection evaluations are completed and eligibility is confirmed, all subjects will undergo a muscle biopsy. The baseline biopsy is preferably a biopsy of the medial gastrocnemius muscle of the right leg. If the medial gastrocnemius muscle is not viable, prior approval from the sponsor of the clinical trial is required for the use of an alternative muscle in the lower limb. If possible, the biopsy at week 12 is a biopsy of the same muscle group as that used at baseline on the contralateral side. For subjects who may have undergone a pre-injection biopsy prior to trial participation, this may be used as the "baseline" biopsy. An overview of the evaluations conducted during the baseline period is shown in Table 11.
[0480] Immurificase Injection Period The Immurificase injection period consists of a maximum of 2 doses of Immurificase administered at a maximum interval of 60 hours. All enrolled subjects will receive 1 dose of Immurificase. A blood sample will be taken approximately 6 hours later to test for antibodies against rAAVrh74. If the rAAVrh74 antibody titer is 1:400 or less and more than 48 hours have elapsed since the completion of the Immurificase injection, the subject will enter the 260-week delandistrogene moxeparvovec treatment and follow-up period at approximately 48 hours after the Immurificase injection. If the antibody titer result is received 48 hours later or the result is greater than 1:400, the subject will receive a second injection of Immurificase approximately 60 hours after the first injection. The antibody titer is obtained approximately 6 hours after the second administration of Immurificase, the antibody titer result is received within 48 hours, and if it is 1:400 or less, the subject will enter the delandistrogene moxeparvovec treatment and follow-up period at approximately 48 hours after the Immurificase injection. If the antibody titer result is received 48 hours later or the result is greater than 1:400, the subject will not receive delandistrogene moxeparvovec and will enter a 52-week follow-up period at 48 hours after the second Immurificase injection.
[0481] On the first day of Imlygic injection, the subject starts prophylactic antibiotics for 4 weeks to reduce the potential increased risk of infection due to transient IgG depletion. Since respiratory tract infections are the most common infections in patients with hypogammaglobulinemia, the selected antibiotic, for example, 10 mg / kg amoxicillin twice daily (maximum dose of 500 mg twice daily), should cover upper respiratory tract pathogens. Alternative drugs with appropriate coverage (e.g., cephalosporins, macrolides) may be used at the discretion of the principal investigator of the clinical trial, and the alternative drugs may be based on regional or institutional resistance patterns and guidelines.
[0482] To reduce the risk of infusion reactions, an antihistamine (e.g., oral administration of up to 50 mg of 1.25 mg / kg diphenhydramine) is administered approximately 1 hour before each Imlygic injection. The choice and dosage of the antihistamine are determined at the discretion of the principal investigator of the clinical trial, and the choice and dosage may be based on local or institutional guidelines.
[0483] Each Imlygic injection is administered as a 0.25 mg / kg intravenous infusion over 15 minutes using an infusion pump. See the investigational medicinal product management procedure manual for additional information. The body weight recorded on the day before (or on the day of) the injection should be used for dosage calculation.
[0484] During the Imlygic injection period, the subject undergoes selected clinical tests, safety is monitored, and the effects on the PK / PD of Imlygic and the rAAVrh74 titer of Imlygic are evaluated. An overview of the evaluations performed during the Imlygic injection period is shown in Table 11. Dranziger's dystrogene moxeparvovec treatment and 260-week follow-up period: Part 1 and Part 2
[0485] The follow-up period consists of two parts: Part 1 and Part 2. Part 1 of the follow-up period starts from the Dranziger's dystrogene moxeparvovec injection (day 1) and continues until week 12. Part 2 of the follow-up period starts after week 12 and continues until week 104.
[0486] Follow-up Period: Part 1 At least 1 day before the injection of delandistrogene moxeparvovec, the subject starts 1 mg / kg of add-on corticosteroid therapy (prednisone or prednisolone) in addition to the chronic DMD-related steroid dose (Tables 11 - 14). The maximum total daily dose (including both chronic and add-on) is 60 mg per day. The additional steroid is continued until day 60, although early tapering for AE management may be permitted with prior approval by the medical monitor. If the gamma-glutamyltransferase (GGT) level is confirmed to be 150 U / L or higher, or if there are other clinically significant liver function abnormalities after the injection, the glucocorticoid added after the injection for immunosuppression should be increased to 2 mg / kg per day. For subjects receiving an additional 2 mg / kg of corticosteroid per day, the maximum total daily dose is 120 mg per day. The tapering of the glucocorticoid dose is performed based on the individual subject's response to the injection, as evaluated by liver function monitoring using GGT.
[0487] The injection of delandistrogene moxeparvovec is performed on day 1 via a peripheral limb vein over 1 - 2 hours. The body weight obtained on the day before or on the day of administration should be used for dose calculation.
[0488] On day 1, vital signs and blood samples are collected for selected clinical tests. A brief physical examination and an ECG are performed. The summary of the evaluations performed on day 1 are shown in Tables 11 - 14.
[0489] During Part 1, safety is evaluated by monitoring vital signs, physical examination, ECG, TEAE, SAE, and selected clinical test evaluations. Other evaluations during this period include blood samples for deoxyribonucleic acid (DNA) analysis (obtained from those who consented to this evaluation), RNA analysis, PK / PD modeling, functional evaluation, and muscle biopsy. The summary of the evaluations performed during Part 1 of the follow-up period are shown in Tables 11 - 14.
[0490] Follow-up Period: Part 2 Part 2 of the follow-up period starts after the 12th week and continues until the 104th week with follow-up visits. From the 16th week to the 48th week, monthly telephone contacts are made between the clinic visits that occur every 12 weeks.
[0491] Safety is evaluated by monitoring vital signs, physical examinations, ECG, TEAE, SAE, and selected clinical laboratory evaluations.
[0492] Immunogenicity is evaluated by measuring antibody titers against rAAVrh74 using ELISA. In addition, an interferon gamma ELISpot assay is performed to detect cellular immune responses against the rAAVrh74 capsid and the microdystrophin transgene.
[0493] Physical function assessments are performed throughout the study and include the NSAA (also used to measure the time to rise from the floor and the 10MWR time, although these time components are not part of the NSAA), the time to climb 4 steps, and the 100MWR. Follow-up period for subjects not receiving delandistrogene moxeparvovec
[0494] Subjects who receive antibody titers more than 48 hours after completion of the second administration of imlifidase, or whose antibody titers are more than 1:400, do not receive delandistrogene moxeparvovec and enter a 52-week follow-up period at the 48-hour time point after imlifidase injection. Administering delandistrogene moxeparvovec approximately more than 48 hours after completion of imlifidase injection increases the likelihood of being outside the imlifidase-induced IgG nadir where delandistrogene moxeparvovec administration is expected.
[0495] Continue safety monitoring of vital signs, physical examinations, TEAE, SAE, and selected clinical laboratory evaluations for 52 weeks as outlined in Tables 11 - 14 to ensure appropriate reconstitution of IgG levels and anti-imalifidase antibodies during follow-up. Study termination / early termination
[0496] For subjects who receive both Emryfilase and delandistrogene moxeparvovec and complete this trial, the last study visit will be conducted at week 104. For subjects who discontinue this trial early, an early discontinuation visit is required as shown in the event schedule (Table 14).
[0497] After completing the 104-week follow-up period, subjects will be enrolled in an extension study to evaluate the long-term safety and efficacy of delandistrogene moxeparvovec. Subjects will be followed for at least 5 years after receiving delandistrogene moxeparvovec injection.
[0498] For subjects who do not receive delandistrogene moxeparvovec and complete this trial, the last study procedure will be conducted at week 52. Subjects who do not receive delandistrogene moxeparvovec will not be enrolled in the extension study.
[0499] Completion of the trial This trial is considered completed when all subjects have completed their visit at week 104 or 52 as required, or otherwise the trial has been terminated.
[0500] Scientific rationale for the trial design Delandistrogene moxeparvovec is designed to treat the underlying biological cause of DMD, but the presence of pre-existing antibodies against rAAVrh74 has limited the potential for benefit in this population as they interfere with AAV-mediated gene delivery and weaken or abolish its therapeutic effect. Emryfilase presents a well-tolerated therapy with an appropriate mechanism of action to deplete pre-existing antibodies against rAAVrh74 and provide a safe therapeutic window for treating seropositive patients using gene therapy.
[0501] The target dosing schedule enables the evaluation of acute safety for each target, and this small-scale open-label trial allows for the collection of acute and subacute clinical safety data using representative commercial process materials. For the target, during this trial, non-pharmacological interventions such as standard treatment steroid therapy and physical therapy are continued. The 12-week period of Part 1 provides sufficient time to obtain expression data for the primary evaluation item. The total trial period of 104 weeks enables long-term safety follow-up after injection of delandistrogene moxeparvovec.
[0502] Rationale for test dose selection Delandistrogene moxeparvovec Dystrophic animal model (DMD MDX mouse model), a wide range of dose evaluations (4.43×10 13 vg / kg~4.01×10 14 vg / kg) were based on, a dose-dependent increase in tissue vector exposure was observed. A strong non-linear relationship with the saturation response was demonstrated between tissue vector exposure and the therapeutic response (delandistrogene moxeparvovec protein expression and functional improvement) in DMD MDX mice. Between 1.33×10 14 vg / kg (clinically proposed dose) and the highest dose tested (4.01×10 14 vg / kg), a significant overlap was observed in the ER profiles for both protein expression and functional improvement, and the therapeutic response related to 1.33×10 14 vg / kg approached the plateau achieved at the highest dose tested. The increase in vector exposure related to 4.01×10 14 vg / kg resulted in only a slight increase (<17%) in delandistrogene moxeparvovec protein expression compared to the clinically proposed dose of 1.33×10 14 vg / kg and did not lead to functional improvement in the dystrophic animal model.
[0503] Over three clinical trials (delandistrogene moxeparvovec-101, delandistrogene moxeparvovec-102, delandistrogene moxeparvovec-103), and across the 6.29×10 13 vg / kg and 8.94×10 13 vg / kg tested in the delandistrogene moxeparvovec-102 trial, and across three clinical doses including the clinically proposed dose of 1.33×10 14 vg / kg evaluated in the delandistrogene moxeparvovec-101, delandistrogene moxeparvovec-102, and delandistrogene moxeparvovec-103 trials, the general PK, PD, and population-based exposure response (efficacy and safety) of delandistrogene moxeparvovec have been characterized in patients with DMD.
[0504] The clinically proposed dose of 1.33×10 14 vg / kg achieved robust dystrophin transduction and delandistrogene moxeparvovec-dystrophin protein expression leading to a clinically meaningful benefit in motor function outcome as measured by the NSAA total score at 1 year post-dose. Importantly, similar to the evidence demonstrated in basic non-clinical studies, the dose of 1.33×10 14 vg / kg was also shown to approach a plateau in biological efficacy (delandistrogene moxeparvovec-dystrophin protein expression measured as IF PDPF) in patients with DMD. These findings support that 1.33×10 14 vg / kg of delandistrogene moxeparvovec is approaching maximization of membrane localization and functional delandistrogene moxeparvovec-dystrophin protein expression, and there is no expectation that higher doses (above 1.33×10 14 vg / kg) will result in a significant increase in biological efficacy.
[0505] Wild-type mice and DMD MDXA non-clinical GLP toxicity test using a representative commercial material in mice can be found in the Dalanje-Strogen Moxeparvovec investigational medicinal product summary. Clinical data were used to evaluate the relationship between the Dalanje-Strogen Moxeparvovec administered dose (total capsid load and serum vector genome exposure) and clinical safety biomarkers. Generally, no clear relationship was identified between the Dalanje-Strogen Moxeparvovec administered dose and changes in liver injury biomarker levels (GGT, GLDH), heart injury biomarkers (troponin), and importantly changes in immune system responses including complement components and platelet counts. This further supports the overall safety evidence demonstrated with Dalanje-Strogen Moxeparvovec up to 1.33×10 14 vg / kg.
[0506] Imlygic This test uses the commercially indicated dose of 0.25 mg / kg up to 2 times.
[0507] During the clinical development of Imlygic, a dose range including 0.12 mg / kg, 0.25 mg / kg, and 0.50 mg / kg was tested in healthy adults and patients with end-stage renal disease. Clinical results showed that 0.12 mg / kg was not sufficiently effective in IgG cleavage and 0.50 mg / kg did not provide additional efficacy compared to 0.25 mg / kg. In addition, a single or double dose of 0.25 mg / kg was supported by toxicity tests in non-clinical species having a NOAEL (no observed adverse effect level) of 2 mg / kg in rabbits and dogs. Furthermore, 0.25 mg / kg (up to 2 times the maximum dose) showed a favorable safety profile in clinical trials.
[0508] Dose extrapolation to pediatric patients is supported by population PK / PD modeling and simulation, which has shown that pediatric patients in different age and weight groups from 0 to 18 years are expected to have a consistent PK / PD profile like adults after 0.25 mg / kg. Furthermore, IgG cleavage assays comparing the efficacy of imlifidase in pediatric serum pools (covering 3 - 11 years, 12 - 17 years, or a pool covering 3 - 17 years) and serum from adult healthy donors showed no difference in efficacy. The clinical evaluation of the proposed dose of 0.25 mg / kg is scheduled in the 20 - HMedIdeS - 21 trial in the target pediatric population of highly sensitized pediatric patients over 1 year to less than 18 years old who are positive for cross - match tests and are scheduled to receive kidney transplants.
[0509] Since mutations in the DMD gene and disease progression are not expected to result in renal or hepatic dysfunction that would change the metabolism, excretion, or clearance of the imlifidase protein and affect its overall PK profile, the same dose of 0.25 mg / kg can be extended to patients with DMD. Therefore, it is reasonable to extend the above - mentioned pediatric dose extrapolation to patients with DMD to support the initial evaluation of imlifidase. Furthermore, since the pharmacokinetics of imlifidase is similar to other protein therapeutics, it is expected that the systemic clearance and volume of distribution parameters of imlifidase scale with body weight, and the 0.25 mg / kg dose is also sufficient to reach effective concentrations in the target pediatric population. If a single administration of imlifidase cannot reduce the total anti - rAAVrh74 titer to less than 1:400, a second dose can be administered within 60 hours after the first injection. In this study, the PK and PD of imlifidase will be evaluated at 0.25 mg / kg in patients with DMD to confirm dose extrapolation.
[0510] The stopping rules or completion of the test described in Example 2 If any of the following sentinel events occur: the occurrence of a new serious safety (ADR) alert or signal, a serious patient outcome: death, life-threatening event a, hospitalization, or a significant medical event, interrupt the trial registration.
[0511] After the subject completes the last study visit during the follow-up period (either at week 104 or week 52 depending on whether they received delanzomib moxeparvovec), or after the trial is terminated, the subject is considered to have completed participation in this trial.
[0512] Example 4: Treatment of patients in the trial described in Example 2 Investigational drug administered Delanzomib moxeparvovec Delanzomib moxeparvovec is supplied as a sterile single-use frozen liquid for intravenous injection. This frozen preparation must be thawed before clinical administration.
[0513] The administration of delanzomib moxeparvovec is via a peripheral vein. The subject should be carefully monitored for at least 6 hours after the injection is completed (see Table 13). A topical anesthetic cream (e.g., lidocaine 2.5%, prilocaine 2.5%, LMX4 cream) may be applied to the skin before insertion of the intravenous catheter for injection, depending on the site and the subject's preference.
[0514] Imlygic Imlygic IMP is supplied as a freeze-dried (lyophilized) powder of an injection concentrate at 11 mg per vial. After reconstitution with sterile water for injection, each 1 mL of the concentrate contains 10 mg of Imlygic. Thereafter, the concentrate should be diluted with 9 mg / mL (0.9%) sodium chloride injection solution and administered as an injection solution. For further details, refer to the investigational drug management procedure manual specific to this trial. [Table 16]
[0515] Non-clinical treatment The accurate selection and formulation of non-clinical trial drugs are at the discretion of the responsible investigator of the trial and are supplied from the pharmacy of the trial facility.
[0516] Corticosteroid According to the inclusion criteria, all subjects receive a stable daily dose of oral corticosteroids for at least 12 weeks prior to screening admission. On the day before the injection of delanzomib moxeparvovec and continuing for approximately 60 days after the injection of delanzomib moxeparvovec, each subject starts additional oral steroids (prednisone or prednisolone) for immunosuppression.
[0517] Antibiotic On the day of the first injection of Imlygic, the subject starts prophylactic antibiotics for 4 weeks to reduce the potential increased risk of infection due to IgG depletion. The selected antibiotic, for example, 10 mg / kg amoxicillin twice daily (maximum dose of 500 mg twice daily), should cover upper respiratory tract pathogens. Alternative drugs (e.g., cephalosporins, macrolides) may be used at the discretion of the responsible investigator of the trial, and the alternative drugs may be based on local or institutional resistance patterns or guidelines.
[0518] Antihistamine To reduce the risk of infusion reactions, an antihistamine (e.g., oral administration of up to 50 mg of 1.25 mg / kg diphenhydramine) is administered approximately 1 hour before each injection of Imlygic. The selection and dose of the antihistamine are determined at the discretion of the responsible investigator of the trial, and the selection and dose may be based on local or institutional guidelines.
[0519] Handling / storage of investigational drugs Storage Delanzomib moxeparvovec must be transported and stored at -60°C or below.
[0520] Before reconstitution, Imlygic should be stored cooled at +2°C to +8°C in the dark.
[0521] Safety monitoring Safety monitoring of liver chemistry tests Liver chemistry tests need to be monitored as specified in Tables 11 to 14. It is necessary to confirm abnormal liver chemistry test results in the following cases. · When GGT exceeds 3 × ULN at any point during the test · When the baseline value exceeds ULN, the AST or ALT measurement value exceeds 2 × the baseline value, and when the baseline value is within the normal range, it exceeds 3 × ULN
[0522] (As described above), subjects with confirmed liver chemistry test results must undergo re - testing of liver chemistry tests (GGT, ALT, AST, alkaline phosphatase, and total and direct bilirubin) at least twice a week, and subsequent additional tests are at the discretion of the principal investigator of the clinical trial. When the abnormal values have stabilized and the subject is asymptomatic, the frequency of re - testing can be reduced to once a week or less.
[0523] Additional tests (As described above), it is recommended that subjects with confirmed abnormal liver chemistry test results undergo the following evaluations. · Obtain a more detailed medical history of symptoms and previous diseases or comorbidities. · Obtain a history of concomitant medications (including over - the - counter drugs and herbal and nutritional supplement preparations), a history of alcohol use, a history of recreational drug use, and a special diet history. · Exclude acute viral hepatitis A, B, C, D, and E, autoimmune hepatitis, non - alcoholic fatty liver disease, hypoxic / ischemic liver injury, and biliary tract diseases. · Consider other viral diseases associated with hepatitis (e.g., Epstein - Barr virus [EBV], cytomegalovirus [CMV], parvovirus B19, human herpesvirus 6 [HH6], varicella - zoster virus). · Obtain a history of exposure to environmental chemicals.
[0524] Consultation on gastroenterology / hepatology and additional liver evaluation, including liver computed tomography or magnetic resonance imaging scan, may be carried out at the discretion of the principal investigator upon consultation with the sponsor medical monitor. Safety monitoring of immune-mediated myositis
[0525] Monitor for the occurrence of immune-mediated myositis by monitoring the AEs specified in Tables 11 - 14 in the subjects. In the limited number of cases reported to date, the time to onset is 24 - 42 days (Bonnemann et al. 2022 Muscular Dystrophy Association Clinical & Scientific Conference; March 13 - 16, 2022; Nashville, TN. Poster 44.). Instruct the subjects to promptly report any new muscle weakness, and the principal investigator needs to carefully evaluate all potential causes, including co-morbidities.
[0526] Additional tests Subjects who experience rapidly progressive muscle weakness need to consult with the sponsor medical monitor to determine whether additional monitoring or clinical tests are necessary. Additional evaluations, including consultation on immunology, ELISpot and ELISA tests for transgene microdystrophin protein, muscle biopsy, muscle MRI, and / or electromyogram nerve conduction tests, may be carried out at the discretion of the principal investigator upon consultation with the sponsor medical monitor.
[0527] Adverse events of particular interest related to immune-mediated myositis include any myositis, including immune-mediated myositis or autoimmune myositis, any severe (CTCAE grade 3 or higher) weakness or muscle weakness, dysphagia or dysphonia secondary to muscle weakness, rhabdomyolysis, myoglobinuria, pigmenturia, acute onset or exacerbation of myalgia. Safety monitoring of hypersensitivity
[0528] Monitor the occurrence of allergic reactions by monitoring the AEs specified in Tables 11 - 14 for the subjects. Instruct the subjects to promptly report any fever symptoms or signs or systemic symptoms that may occur during this trial, and the principal investigator of the clinical trial needs to carefully evaluate all potential causes including concurrent diseases.
[0529] Additional tests Subjects who experience significant or persistent systemic symptoms including any CTCAE grade 3 or higher hypersensitivity reactions should discuss with the sponsor medical monitor to determine whether additional monitoring or clinical tests are necessary. Additional evaluations including consultations on immunology and allergy reaction tests (e.g., absolute eosinophils, eosinophilic cationic protein, serum / plasma tryptase) may be conducted at the discretion of the principal investigator of the clinical trial after discussion with the sponsor medical monitor.
[0530] Safety monitoring of thrombotic microangiopathy (TMA) The subjects should be monitored for the occurrence of complement-mediated reactions mainly by monitoring AEs and complement levels. Instruct the subjects to promptly report any fever symptoms or signs or systemic symptoms that may occur during this trial, and the principal investigator of the clinical trial needs to carefully evaluate all potential causes including concurrent diseases. In addition to the monitoring of AEs, regular clinical test monitoring of complement-mediated reactions should be carried out according to the protocol including complement levels (see Tables 11 - 14).
[0531] Additional tests Subjects diagnosed with TMA need to discuss with the sponsor medical monitor to determine additional monitoring and clinical tests. Additional evaluation including consultation on nephrology and tests for complement activation and alternative etiologies (C3a, C5a, sC5b-9, Bb, prothrombin time, activated partial thromboplastin time, FDP, dimer, ADAMTS13, CFH Ab, STEC, stool culture swab, anti-phospholipid antibody, ECG, echocardiogram, ANA, anti-centromere antibody, anti-scl-70, anti-ds-DNA, plasma homocysteine, plasma and urinary methylmalonic acid, G6PD activity, T antigen, influenza test, CMV, and / or EBV) may be conducted at the discretion of the principal investigator after consultation with the sponsor medical monitor.
[0532] Safety monitoring of platelet count results Monitor platelet count as specified in Tables 11 to 14.
[0533] Platelet count < 75,000 / mm 3 Subjects in whom an occurrence of less than this has been confirmed should undergo the following evaluations. · Complete blood count including reticulocytes · Peripheral blood smear · Coagulation panel (prothrombin time / INR, activated partial thromboplastin time) · hsCRP
[0534] Additional tests Additional platelet evaluations for unexplained significant decreases in platelet count, including consultation on hematology, fibrinogen, fibrinogen degradation products / D-dimer, von Willebrand factor, total immunoglobulin, complement levels, viral serology, autoantibody screening, antiplatelet antibodies, antiplatelet factor 4 assay, and platelet function tests, may be conducted at the discretion of the principal investigator after consultation with the sponsor medical monitor.
[0535] Safety monitoring of rhabdomyolysis Rhabdomyolysis must be monitored by the urine test strips and AE specified in Tables 11 to 14.
[0536] Subjects in whom a positive urine test for heme has been confirmed need to be evaluated for urine microscopy and the following AE. · Rhabdomyolysis · Myoglobinuria · Colored urine · Acute onset or exacerbation of myalgia
[0537] Additional tests In cases of rhabdomyolysis, myoglobinuria, or colored urine, the subject needs to be evaluated for myoglobinuria, CK, renal function (e.g., serum cystatin C), and serum chemistry twice or three times a week until the values reach the normal / pre-event level or stabilize. In cases of acute onset or exacerbation of myalgia in the absence of rhabdomyolysis, myoglobinuria, or colored urine, these evaluations should be at the discretion of the investigator's physician.
[0538] In addition, the investigator's physician should obtain further details of the medical history, preceding activities and hydration status, use of concomitant medications, and recent infections or co-infections. Additional evaluations, including rheumatology / immunology consultations, anti-muscle antibodies, or ELISpot, may be conducted at the discretion of the investigator's physician in consultation with the sponsor's medical monitor.
[0539] If an acute onset or exacerbation of muscle weakness is characteristic of a rhabdomyolysis event, the subject should be evaluated for rapidly progressive muscle weakness as described in Section 4.4.2.
[0540] Risk of rhabdomyolysis due to anesthesia Participation in this trial requires a biopsy that may require anesthesia (Section 9.2.1). The principal investigator should be aware that subjects with DMD have specific risks and requirements when undergoing anesthesia (American Academy of Pediatrics 2005, Birnkrant 2009, Bushby 2010). For example, due to the risk of rhabdomyolysis, the use of depolarizing muscle relaxants (e.g., succinylcholine, also known as suxamethonium) is an absolute contraindication, and due to the risk of malignant hyperthermia-like reactions and rhabdomyolysis, it is strongly recommended to avoid inhaled anesthetics (e.g., sevoflurane, desflurane, enflurane, halothane, isoflurane). There is no evidence that exposure to delandistrogene moxeparvovec affects this risk.
[0541] Safety monitoring of troponin increase It is necessary to monitor the cardiac troponin levels as specified in the event schedule. It is necessary to confirm the initial cardiac troponin value results in the following cases. · When the cardiac troponin value is above 3×ULN (or 3× baseline for subjects with an increase in baseline value). · Subjects with an abnormal cardiac troponin level should have the cardiac troponin level retested until the level returns to baseline or stabilizes for at least 6 weeks. The frequency of retesting is at the discretion of the principal investigator.
[0542] Additional tests Additional evaluations, including ECG, consultation with a cardiologist, ECHO, cardiac MRI, CKMB, and myoglobin panel, may be performed at the discretion of the principal investigator in consultation with the sponsor medical monitor (see also Section 5.3.4).
[0543] Safety monitoring of infections Monitor for signs and symptoms of potential infections throughout the trial using vital signs, physical examinations, selected clinical tests, and patient reports. The following signs and symptoms require prompt consideration for infectious disease workup.
[0544] Fever; chills and sweats; headache; cough with and without mucus; nasal congestion or rhinorrhea; pharyngitis or new stomatitis; hoarseness; swelling of cervical lymph nodes; shortness of breath, chest tightness, or wheezing; burning or pain on urination; increased urination; abnormal vaginal discharge or irritation; erythema, pain, or swelling in any area including surgical wounds and surgical ports; vomiting; diarrhea; abdominal or rectal pain; fatigue, myalgia, general malaise.
[0545] Additional Tests Clinical tests such as CBC, viral panel, blood, urine, or stool cultures, and imaging tests such as chest x-rays may be performed at the discretion of the Investigator and subjects should be managed according to standard of care and applicable guidelines (see also Section 5.3.4).
[0546] Example 5 - Blend the test evaluations as described above Schedules outlining the test evaluations and evaluation times are shown in Tables 11 - 14.
[0547] Adverse Events of Special Interest In this trial, AESI is defined as follows.
[0548] Hepatotoxicity GGT > 8 × ULN
[0549] GGT > 5 × ULN and persistent for more than 2 weeks
[0550] Either GGT > 3 × ULN and total bilirubin > 2 × ULN or INR > 1.5
[0551] GGT is above 3×ULN and has new manifestations (i.e., onset coincides with changes in liver enzymes) such as fatigue, nausea, vomiting, right upper abdominal pain or tenderness, fever, rash, or eosinophilia (more than 5%) that are felt by the principal investigator of the clinical trial to be possibly related to hepatitis
[0552] Myositis All myositis including immune-mediated myositis or autoimmune myositis; any severe (CTCAE grade 3 or higher) weakness or muscle strength decrease; dysphagia or dysphonia secondary to muscle strength decrease
[0553] Thrombotic microangiopathy (TMA) TMA, acute kidney injury, and / or atypical hemolytic uremic syndrome
[0554] Hypersensitivity Anaphylaxis, anaphylactoid reaction, or angioedema; any severe (CTCAE grade 3 or higher) allergic reaction; any severe (CTCAE grade 3 or higher) inflammatory event (e.g., myocarditis, pneumonia, vasculitis, etc.); any severe (grade 3 or higher) infusion-related reaction occurring within 24 hours after injection of delanzumab; any infusion-related reaction occurring within 48 hours after injection of imlifidase
[0555] Thrombocytopenia Platelet count less than 75,000 / mm 3 Less than
[0556] Rhabdomyolysis Rhabdomyolysis; myoglobinuria; colored urine; acute onset or exacerbation of myalgia
[0557] Troponin elevation Troponin I above 3×ULN (or 3× baseline for subjects with an increase from baseline value).
[0558] Infection Any severe (grade 3 or higher) infection occurring within 30 days after injection of imlifidase; any infection requiring hospitalization occurring within 30 days after injection of imlifidase
[0559] Interruption of administration Any event that results in interruption (pause and / or discontinuation) of Imurifidase administration.
[0560] Pharmacokinetic evaluation, pharmacodynamic evaluation, and clinical laboratory evaluation Pharmacokinetic evaluation and pharmacodynamic evaluation Collect blood samples for pharmacokinetic analysis and pharmacodynamic analysis. Note that the IgG analysis methods (turbidimetry / nephelometry) commonly available in clinical chemistry laboratories do not distinguish between different IgG fragments generated after Imurifidase treatment. Record the actual collection date and time of each sample in the eCRF. Analyze PK samples using a valid electrochemiluminescence-based immunoassay with Mesoscale Discovery (MSD) technology. Analyze PD samples using Mesoscale Discovery (MSD) technology and SDS-PAGE with a valid electrochemiluminescence-based immunoassay.
[0561] Clinical laboratory evaluation Perform routine clinical laboratory tests at the time points specified in Tables 11 - 14. List the safety evaluations required by the protocol in Table 18.
[0562] Note: At week 12, collect samples before biopsy.
Table 17
[0563] Clinically significant laboratory abnormalities considered clinically significant by the principal investigator or designee should be recorded as AEs. Clinically significant abnormalities are generally abnormalities confirmed by repeated testing that have changed sufficiently from screening / baseline such that a change in management is justified at the discretion of the principal investigator.
[0564] Safety clinical laboratory evaluations required by the protocol The tests detailed in Table 18 are performed by the central laboratory.
Table 18
[0565] If the principal investigator of the clinical trial deems it necessary, or if the local regulations require it, additional tests may be performed at any time during the present trial.
[0566] It should be understood that, for the purpose of interpreting the claims, it is intended that the section of the mode for carrying out the invention, rather than the section of the summary of the invention and the abstract, be used. Since the section of the summary of the invention and the abstract may describe one or more but not all of the exemplary embodiments of the present invention contemplated by the present inventor, they are not intended to limit the present invention and the appended claims in any way.
[0567] The present invention has been described above using functional elements that describe the implementation of specified functions and their relationships. The boundaries of these functional elements are arbitrarily defined herein for convenience of description. Alternative boundaries can be defined as long as the specified functions and their relationships are properly performed.
[0568] The foregoing description of specific embodiments fully discloses the general nature of the present invention, so that others can, by applying the knowledge of the relevant technical field, easily modify such specific embodiments without departing from the general concept of the present invention and without undue experimentation, and / or adapt them to various uses. Accordingly, such adaptations and modifications are intended to be within the meaning and scope of the equivalents of the disclosed embodiments based on the teachings and guidance presented herein. It should be understood that the phrases or terms herein are for purposes of explanation and not limitation, as such phrases or terms will be interpreted by those skilled in the art in light of the teachings and guidance.
[0569] The breadth and scope of the present invention should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.
[0570] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application were specifically and individually incorporated by reference.
Claims
**Claim 1** A method for treating a subject having muscular dystrophy, the method comprising administering to the subject a recombinant AAVrh74 viral vector and an enzyme that cleaves immunoglobulin G (IgG). **Claim 2** The method according to claim 1, wherein the recombinant AAVrh74 viral vector and the enzyme that cleaves IgG are administered to the subject simultaneously. **Claim 3** The method according to claim 1, wherein the recombinant AAVrh74 viral vector and the enzyme that cleaves IgG are administered to the subject sequentially. **Claim 4** The method according to claim 1, wherein the subject is determined to have anti-AAVrh74 antibodies. **Claim 5** The method according to claim 4, wherein the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody. **Claim 6** The method according to claim 4, wherein the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody. **Claim 7** The method according to claim 4, wherein the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both neutralizing and non-neutralizing antibodies. **Claim 8** The method according to claim 7, wherein the subject has an anti-AAVrh74 antibody titer of greater than 1:400 in a total anti-AAVrh74 antibody ELISA assay. **Claim 9** The method according to claim 5, wherein the subject has anti-AAVrh74 antibodies in a neutralizing cell assay. **Claim 10** The method according to any one of claims 1 and 3 to 9, wherein the recombinant AAVrh74 viral vector is administered after the enzyme that cleaves IgG. **Claim 11** The method according to claim 10, wherein the recombinant AAVrh74 viral vector is administered to the subject within 54 hours after the administration of the enzyme that cleaves IgG. **Claim 12** The method according to claim 10, further comprising administering a second dose of the enzyme that cleaves IgG to the subject before administering the recombinant AAVrh74 viral vector if the subject is determined to have anti-AAVrh74 antibodies after the first dose of the enzyme that cleaves IgG has been administered. **Claim 13** The method according to claim 12, wherein the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody. **Claim 14** The method according to claim 12, wherein the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody. **Claim 15** The method according to claim 12, wherein the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both neutralizing and non-neutralizing antibodies.
16. The method according to claim 15, wherein the subject has an anti-AAVrh74 antibody titer of greater than 1:400 in a total anti-AAVrh74 antibody ELISA assay.
17. The method according to claim 13, wherein the subject has anti-AAVrh74 antibodies in a neutralizing cell assay.
18. The method according to any one of claims 12 to 17, wherein the recombinant AAVrh74 viral vector is administered after the second dose of the enzyme that cleaves the IgG.
19. The method according to claim 18, wherein the recombinant AAVrh74 viral vector is administered to the subject within 54 hours after the administration of the second dose of the enzyme that cleaves the IgG.
20. The method according to any one of claims 12 to 19, wherein the second dose of the enzyme that cleaves the IgG is administered to the subject within 60 hours after the first dose of the enzyme.
21. The method according to claim 15, wherein the subject has an anti-AAVrh74 antibody titer of about 1:1600 to about 1:3200 in a total anti-AAVrh74 antibody ELISA assay.
22. The method according to claim 21, further comprising administering a third dose of the enzyme that cleaves the IgG to the subject before administering the recombinant AAVrh74 viral vector.
23. The method according to claim 22, wherein the recombinant AAVrh74 viral vector is administered after the third dose of the enzyme that cleaves the IgG.
24. The method according to claim 23, wherein the recombinant AAVrh74 viral vector is administered to the subject within 54 hours after the administration of the third dose of the enzyme that cleaves the IgG.
25. The method according to any one of claims 22 to 24, wherein the third dose of the enzyme that cleaves the IgG is administered to the subject within 60 hours after the second dose of the enzyme.
26. A method of treating a subject having muscular dystrophy, the method comprising administering a recombinant AAVrh74 viral vector to the subject, wherein the subject has previously been administered an enzyme that cleaves IgG.
27. The method according to claim 26, wherein the enzyme that cleaves IgG is administered to the subject within 54 hours before the administration of the recombinant AAVrh74 viral vector.
28. A method of preparing a subject for gene therapy for muscular dystrophy, the method comprising administering an enzyme that cleaves IgG to the subject prior to administering a recombinant AAVrh74 viral vector.
29. A method of removing anti-AAVrh74 antibodies in a subject, the method comprising administering an enzyme that cleaves IgG and measuring the anti-rAAVrh74 antibody titer in the subject after administering the enzyme that cleaves IgG.
30. The method according to claim 29, further comprising measuring the anti-rAAVrh74 antibody titer in the subject before administering the enzyme that cleaves IgG.
31. The method according to claim 29 or 30, further comprising administering a recombinant AAVrh74 viral vector when the anti-rAAVrh74 antibody titer measured in the subject is 1:400 or less in a total anti-AAVrh74 antibody ELISA assay.
32. The method according to claim 29 or 30, wherein when the anti-rAAVrh74 antibody in the subject exceeds 1:400 in a total anti-AAVrh74 antibody ELISA assay, the subject is not administered a recombinant AAVrh74 viral vector.
33. The method according to claim 32, further comprising administering a second dose of the enzyme that cleaves IgG to the subject.
34. The method according to claim 33, further comprising measuring the anti-rAAVrh74 antibody titer in the subject after the second dose of the enzyme that cleaves IgG.
35. The method according to claim 34, wherein the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody.
36. The method according to claim 34, wherein the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody.
37. The method according to claim 34, wherein the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both neutralizing and non-neutralizing antibodies.
38. The method according to claim 37, wherein the subject has an anti-AAVrh74 antibody titer of 1:400 or more in a total anti-AAVrh74 antibody ELISA assay.
39. The method according to claim 35, wherein the subject has an anti-AAVrh74 antibody in a neutralizing cell assay.
40. The method according to claim 34 or 37, further comprising administering a recombinant AAVrh74 viral vector when the anti-rAAVrh74 antibody titer measured in the subject is 1:400 or less in a total anti-AAVrh74 antibody ELISA assay.
41. The method according to claim 40, wherein the recombinant AAVrh74 viral vector is administered within 54 hours after the second dose of the enzyme that cleaves the IgG.
42. The method according to claim 34 or 37, wherein when the anti-rAAVrh74 antibody titer measured in the subject exceeds 1:400 in a total anti-AAVrh74 antibody ELISA assay, the subject is not administered a recombinant AAVrh74 viral vector.
43. The method according to any one of claims 1 to 42, wherein the muscular dystrophy is selected from Duchenne muscular dystrophy (DMD) and limb-girdle muscular dystrophy (LGMD).
44. The method according to claim 43, wherein the muscular dystrophy is DMD.
45. The method according to any one of claims 1 to 44, wherein the IgG is human IgG.
46. The method according to any one of claims 1 to 45, wherein the enzyme that cleaves the IgG specifically targets and cleaves human IgG selected from IgG1, IgG2, IgG3, IgG4, and any combination thereof.
47. The method according to any one of claims 1 to 46, wherein the enzyme that cleaves the IgG specifically targets and cleaves human IgG1, human IgG2, human IgG3, and human IgG4.
48. The method according to any one of claims 1 to 47, wherein the IgG binds to the recombinant AAVrh74 viral vector.
49. The method according to any one of claims 1 to 48, wherein the enzyme that cleaves immunoglobulin IgG comprises a protease.
50. The method according to claim 49, wherein the protease comprises a cysteine protease or a thiol protease.
51. The method according to any one of claims 1 to 50, wherein the enzyme that cleaves the IgG inactivates the IgG.
52. The method according to any one of claims 1 to 51, wherein the enzyme that cleaves the IgG cleaves human IgG in the hinge region.
53. The method according to any one of claims 49 to 52, wherein the protease is isolated from or derived from a protease expressed by Streptococcus pyogenes, Streptococcus equi, or Mycoplasma canis.
54. The method according to any one of claims 1 to 53, wherein the enzyme that cleaves the IgG comprises an amino acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 1 or 2.
55. The method according to any one of claims 1 to 54, wherein the enzyme that cleaves the IgG comprises an amino acid sequence set forth in any of SEQ ID NOs: 3 to 18.
56. The method according to any one of claims 1 to 55, wherein the enzyme that cleaves the IgG comprises the amino acid sequence set forth in SEQ ID NO: 1 or 2.
57. The method according to any one of claims 1 to 56, wherein the enzyme is imurifidase.
58. The method according to any one of claims 1 to 57, wherein the subject has one or more IgG antibodies that specifically bind to a protein present in a recombinant AAVrh74 viral vector.
59. The method according to any one of claims 1 to 58, wherein the subject has one or more IgG antibodies that specifically bind to the capsid protein of a recombinant AAVrh74 viral vector.
60. The method according to claim 58 or 59, wherein the one or more IgG antibodies are AAVrh74 neutralizing antibodies.
61. The method according to claim 58 or 59, wherein the one or more IgG antibodies are AAVrh74 non-neutralizing antibodies.
62. The method according to claim 58 or 59, wherein the one or more IgG antibodies are total AAVrh74 antibodies comprising both neutralizing and non-neutralizing antibodies.
63. The method according to claim 62, wherein the subject has an anti-AAVrh74 antibody titer of greater than 1:400 in a total anti-AAVrh74 antibody ELISA assay.
64. The method according to claim 60, wherein the subject has anti-AAVrh74 antibodies in a neutralizing cell assay.
65. The method according to any one of claims 1 to 64, wherein the subject has been previously administered a recombinant AAVrh74 viral vector.
66. The method according to any one of claims 1 to 65, wherein the recombinant AAVrh74 viral vector comprises a gene cassette encoding a therapeutic molecule.
67. The method according to claim 66, wherein the therapeutic molecule comprises a polypeptide, an RNA molecule, or a DNA molecule.
68. The method according to claim 66 or 67, wherein the gene cassette encodes a therapeutic polypeptide selected from dystrophin, beta-sarcoglycan, alpha-sarcoglycan, and any combination thereof.
69. The method according to any one of claims 66 to 68, wherein the gene cassette comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO:
19.
70. The method according to claim 69, wherein the gene cassette comprises the nucleic acid sequence set forth in SEQ ID NO:
19.
71. The method according to any one of claims 66 to 68, wherein the gene cassette comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO:
21.
72. The method according to claim 71, wherein the gene cassette comprises the nucleic acid sequence set forth in SEQ ID NO:
21.
73. The method according to any one of claims 66 to 68, wherein the gene cassette comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO:
23.
74. The method according to claim 73, wherein the gene cassette comprises the nucleic acid sequence set forth in SEQ ID NO:
23.
75. The method according to any one of claims 68 to 74, wherein the recombinant AAVrh74 viral vector further comprises a promoter.
76. The method according to claim 75, wherein the promoter is a tissue-specific promoter.
77. The method according to claim 75 or 76, wherein the promoter is selected from the MHC K7 promoter and the tMCK promoter.
78. The method according to any one of claims 75 to 77, wherein the promoter comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 25 or 26.
79. The method according to any one of claims 75 to 77, wherein the promoter comprises the nucleic acid sequence set forth in SEQ ID NO: 25 or 26.
80. The method according to any one of claims 66 to 79, wherein the recombinant AAVrh74 viral vector further comprises an intron.
81. The method according to claim 80, wherein the intron comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the nucleic acid sequences set forth in SEQ ID NOs: 27 to 29.
82. The method according to claim 80 or 81, wherein the intron comprises the nucleic acid sequences set forth in SEQ ID NOs: 27-29.
83. The method according to any one of claims 68-82, wherein the recombinant AAVrh74 viral vector further comprises a 3'UTR poly(A) tail sequence.
84. The method according to claim 83, wherein the 3'UTR poly(A) tail sequence comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity with the nucleic acid sequence set forth in SEQ ID NO:
30.
85. The method according to any one of claims 1-84, wherein the AAVrh74 viral vector comprises a nucleic acid sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity with a nucleic acid sequence selected from the nucleic acid sequences set forth in SEQ ID NOs: 20, 22, and 24.
86. The method according to any one of claims 57-85, wherein imlifidase is administered at a dose of 0.25 mg / kg.
87. The method according to claim 85 or 86, wherein the recombinant AAVrh74 viral vector is delandistrogene moxeparvovec, virdistrogene xparvovec, or patisiran distrogene veksubparvovec.
88. The method according to claim 87, wherein delranjestrogen moxeparvovec, bidristrogen xeparvovec, or patristrogen bexarvovec is administered at a dose of about 1.33×10 14 vg / kg.
89. The method according to any one of claims 57-88, wherein the administration of imlifidase is intravenous.
90. The method according to any one of claims 87-89, wherein the administration of delandistrogene moxeparvovec, virdistrogene xparvovec, or patisiran distrogene veksubparvovec is intravenous.
91. The method according to any one of claims 87-90, wherein the recombinant AAVrh74 is delandistrogene moxeparvovec.
92. A kit for treating a subject in need of treatment for muscular dystrophy, comprising: (i) an enzyme that cleaves IgG; (ii) a recombinant AAVrh74 viral vector; and (iii) instructions for administering the enzyme and / or the recombinant AAVrh74 viral vector to the subject according to the method of any one of claims 1 to 91.
93. Use of a recombinant AAVrh74 viral vector for the manufacture of a medicament for treating a subject in need of treatment for muscular dystrophy, wherein the subject has been previously administered an enzyme that cleaves IgG.
94. Use of a recombinant AAVrh74 viral vector for the manufacture of a medicament for treating a subject in need of treatment for muscular dystrophy, in combination with an enzyme that cleaves IgG.
95. The use according to claim 94, wherein the recombinant AAVrh74 viral vector and the enzyme are to be administered simultaneously.
96. The use according to claim 94, wherein the recombinant AAVrh74 viral vector and the enzyme are to be administered sequentially.
97. The use according to claim 94 or 96, wherein the recombinant AAVrh74 viral vector is to be administered within 54 hours after the administration of the enzyme.
98. The use according to any one of claims 94 to 97, wherein the muscular dystrophy is selected from DMD and LGMD.
99. The use according to any one of claims 94 to 98, wherein the muscular dystrophy is DMD.
100. A composition comprising a recombinant AAVrh74 viral vector for use in treating a subject in need of treatment for muscular dystrophy, wherein the subject has been previously administered an enzyme that cleaves IgG.
101. A composition comprising a recombinant AAVrh74 viral vector for use in treating a subject in need of treatment for muscular dystrophy, in combination with an enzyme that cleaves IgG.
102. The composition for use according to claim 101, wherein the recombinant AAVrh74 viral vector and the enzyme are to be administered simultaneously.
103. The composition for use according to claim 101, wherein the recombinant AAVrh74 viral vector and the enzyme are to be administered sequentially.
104. The composition for use according to claim 103, wherein the recombinant AAVrh74 viral vector is administered within 54 hours after the administration of the enzyme.
105. The composition for use according to any one of claims 101 to 104, wherein the muscular dystrophy is selected from DMD and LGMD.
106. The composition for use according to any one of claims 101 to 105, wherein the muscular dystrophy is DMD.
107. A method for removing an anti-AAVrh74 antibody when treating a subject in need of removal of the anti-AAVrh74 antibody, the method comprising administering imlifidase and measuring the anti-rAAVrh74 antibody titer in the subject after administering imlifidase.
108. The method according to claim 107, wherein the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody.
109. The method according to claim 107, wherein the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody.
110. The method according to claim 107, wherein the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both a neutralizing antibody and a non-neutralizing antibody.
111. The method according to claim 110, wherein the subject has an anti-AAVrh74 antibody titer of more than 1:400 in a total anti-AAVrh74 antibody ELISA assay.
112. The method according to claim 108, wherein the subject has an anti-AAVrh74 antibody in a neutralizing cell assay.
113. The method according to any one of claims 107 to 112, further comprising measuring the anti-rAAVrh74 antibody titer in the subject before administering imlifidase.
114. The method according to claim 113, wherein the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody.
115. The method according to claim 113, wherein the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody.
116. The method according to claim 113, wherein the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both a neutralizing antibody and a non-neutralizing antibody.
117. The method according to claim 116, wherein the subject has an anti-AAVrh74 antibody titer of more than 1:400 in a total anti-AAVrh74 antibody ELISA assay.
118. The method according to claim 114, wherein the subject has an anti-AAVrh74 antibody in a neutralizing cell assay.
119. The method according to claim 116, further comprising administering a recombinant AAVrh74 viral vector when the anti-rAAVrh74 antibody titer measured in the subject is 1:400 or less in the total anti-AAVrh74 antibody ELISA assay.
120. The method according to any one of claims 107 to 119, wherein Imlygic is administered at a dose of 0.25 mg / kg.
121. The method according to any one of claims 107 to 120, wherein the recombinant AAVrh74 viral vector is delandistrogene moxeparvovec, virdistrogene xparvovec, or patisiran.
122. The method according to any one of claims 107 to 121, wherein the recombinant AAVrh74 is delandistrogene moxeparvovec.
123. The method according to claim 121 or 122, wherein delranjestrogen moxeparvovec, vidorjestrogen xepovovec, or patijestrogen bekovovec is administered at a dose of about 1.33×10 14 vg / kg.
124. The method according to any one of claims 121 to 123, wherein delranjestromoxepal bovectored is administered at a dose of about 1.33×10 14 vg / kg.
125. The method according to any one of claims 107 to 124, wherein the administration of Imlygic is intravenous.
126. The method according to any one of claims 107 to 125, wherein the administration of delandistrogene moxeparvovec, virdistrogene xparvovec, or patisiran is intravenous.
127. The method according to claim 116, wherein when the anti-rAAVrh74 antibody titer measured in the subject exceeds 1:400 in the total anti-AAVrh74 antibody ELISA assay, the subject is not administered a recombinant AAVrh74 viral vector.
128. The method according to claim 127, further comprising administering a second dose of Imlygic to the subject.
129. The method according to claim 128, wherein the second dose of Imlygic is 0.25 mg / kg.
130. The method according to claim 128 or 129, wherein the second dose of Imlygic is administered within 60 hours after the first dose.
131. The method according to any one of claims 128 to 130, further comprising measuring the anti-rAAVrh74 antibody titer in the subject after the second dose of Imlygic.
132. The method according to claim 131, wherein the anti-AAVrh74 antibody is a neutralizing anti-AAVrh74 antibody.
133. The method according to claim 131, wherein the anti-AAVrh74 antibody is a non-neutralizing anti-AAVrh74 antibody.
134. The method according to claim 131, wherein the anti-AAVrh74 antibody is a total anti-AAVrh74 antibody comprising both a neutralizing antibody and a non-neutralizing antibody.
135. The method according to claim 134, further comprising administering a recombinant AAVrh74 viral vector when the anti-rAAVrh74 antibody titer measured in the subject is 1:400 or less in a total anti-AAVrh74 antibody ELISA assay.
136. The method according to claim 135, wherein the recombinant AAVrh74 viral vector is administered within 54 hours after the second dose of imlifidase.