Methods and Compositions for Nucleic Acid Sequencing

The method of separate adapter ligation and fragmentation in nucleic acid sequencing addresses the challenge of detecting rare mutations and off-target editing events by ensuring error-corrected sequencing through reading both strands of the nucleic acid duplex, enhancing the accuracy of genome editing detection.

JP2025522572APending Publication Date: 2025-07-15BROKEN STRING BIOSCIENCES LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2024575728
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-22
Filing Date
2023-06-21
Publication Date
2025-07-15

AI Technical Summary

Technical Problem

Current nucleic acid sequencing methods, particularly next-generation sequencing, are error-prone and insufficient for detecting rare mutations and off-target editing events in large samples, especially in the context of CRISPR-Cas9 genome editing, where off-target sites are difficult to predict and can lead to harmful genetic changes.

Method used

A method for library preparation involving separate ligation of non-hairpin and hairpin adapters to nucleic acids, followed by fragmentation, which allows for error-corrected sequencing by reading both strands of the nucleic acid duplex, reducing the presence of nucleic acids that generate sequence information from only one strand.

Benefits of technology

This approach enables unbiased detection of low-frequency off-target sites and gene-editing-induced mutations across the genome, providing accurate sequence information without the need for amplification steps that can introduce errors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025522572000001_ABST
    Figure 2025522572000001_ABST
Patent Text Reader

Abstract

In one aspect, the present invention relates to a method for library preparation and a composition suitable for use in the method for library preparation. The present invention also relates to a method for sequencing and the use of a library in sequencing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] In one aspect, the present invention relates to methods for library preparation and compositions suitable for use in methods for library preparation. The present invention also relates to methods for sequencing and the use of libraries in sequencing.

Background Art

[0002] Current nucleic acid sequencing methods, such as next-generation sequencing (NGS), can obtain sequence information from very large samples. For example, this allows the collection of sequence information for the entire genome. However, both the sample preparation method and the sequencing method are error-prone. Errors can affect the results even at very low error rates, making them particularly problematic for applications that require the detection of small changes detected in large samples, such as the detection of single base pair changes in the genome.

[0003] Considering the increasing use of gene editing technologies such as CRISPR-Cas9, the need for detecting rare mutations is on the rise. CRISPR genome editing uses synthetic guide RNAs to target the Cas9 enzyme, which acts as a pair of genetic scissors, to specific sites in the genome where genetic changes are needed. Genome editing relies on the precise targeting of these sites to generate small insertions or deletions to manifest genetic changes. However, genome editing involves the introduction of DNA double-strand breaks (DSBs) in DNA molecules. Such breaks can have harmful effects on human health and may cause cancer depending on their location and the cell's repair capacity. Although this system is highly accurate in its targeting, secondary so-called off-target sites in the genome can also be inadvertently targeted during the editing process. These sites often resemble the target sequence but are not fully understood currently. In fact, in silico off-target predictions based solely on the guide RNA sequence are often not accurate enough to reveal all experimentally detected off-target sites. In silico off-target predictions are needed to improve guide design and prevent off-target editing. It is important to note that the specificity of guide RNAs is highly variable and has important implications for their safe use in gene therapy. In fact, off-target sites can undergo cleavage and / or mutations across the genome and generally pose an important and inherent risk of genome editing. This then poses a serious challenge to current conventional cell-based genotoxicity risk assessment methods that evaluate the effects of chemicals on genome stability. However, genome editing uses a new class of targeted biologics that poses a needle-in-a-haystack type of problem of how to recognize rare off-target editing events in complex genomes when they cannot be predicted by sequence alone. The off-target problem is exacerbated by CRISPR-Cas9 genome editing because the introduced off-targets are so rare that they cannot be detected by current cell-based methods.

[0004] To evaluate the long-term effects of these off-target cleavages, it is important to measure the outcome of mutations determined by accurate repair. Existing methods such as amplicon sequencing have been reported to have a mutation detection limit of about 10 3 percent. Thus, the sensitivity of amplicon sequencing is insufficient for detecting rare mutations at novel low-frequency off-target sites.

[0005] Schmitt et al. disclose a method aimed at detecting ultra-rare mutations by next-generation sequencing (PNAS, September 4, 2012, Vol. 109, No. 36, pp. 14508-14513). It is described in more detail by Kennedy, S.R. et al. (Detecting ultralow-frequency mutations by Duplex Sequencing. Nat Protoc, 2014.9(11):2586-606). Schmitt et al. disclose tagging and sequencing each of the two strands of a DNA duplex independently. The disclosed method requires adding a randomized double-stranded tag sequence of the duplex to a sequencing adapter by copying a degenerate sequence in one strand of the adapter using a DNA polymerase. As a similar method, there is NanoSeq disclosed by Abascal et al. (Somatic mutation landscapes at single-molecule resolution. Nature, 593, 405-410 2021), which describes an optimized version of the BotSeqS method that applies enzymatic fragmentation and modified end repair procedures to improve error-corrected sequencing using UMI tags as described above. However, detecting mutations genome-wide using these methods is challenging because this method requires high coverage (>10 4Since it requires a large number of reads (Kennedy, S.R. et al., 2014), it is currently prohibitively expensive for larger genomes, and its use is limited to targeted sequencing of off-targets that have already been identified by methods such as DSB detection methods. Furthermore, the choice of restriction enzymes for DNA fragmentation used in NanoSeq only provides partial coverage of the genome. Although sonication and exonuclease polishing have been proposed as alternative methods, this approach will suffer from the same requirements of excessive coverage as previously described.

[0006] WO2013 / 142389 A1 discloses a method aimed at reducing the error rate of massively parallel DNA sequencing using dual consensus sequencing. WO2013 / 142389 A1 discloses the formation of a library by ligation of adapters to DNA to yield three products (referred to as "Product I", "Product II", and "Product III").

Prior Art Documents

Patent Documents

[0007]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Patent Document 5

Non-Patent Documents

[0008]

Non-Patent Document 1

Non-Patent Document 2

[0009] There is a need for further methods that can generate error - corrected sequence information. In particular, there is a need for methods that can provide an unbiased determination of low - frequency off - target sites and gene - editing - induced mutations close to background levels across the genome. [Means for Solving the Problems]

[0010] In one aspect, a method for library preparation for nucleic acid sequencing is provided, the method comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to non - hairpin adapters under conditions that promote ligation; c) fragmenting the plurality of nucleic acids; d) exposing the plurality of nucleic acids to the hairpin adapter under conditions that promote ligation, or exposing the plurality of nucleic acids to conditions that allow the formation of a hairpin at the ends of the nucleic acid molecules, and comprising Steps b) and d) are performed separately.

[0011] The plurality of nucleic acids are fragmented after the first adapter ligation step and before or as part of the second adapter ligation step. The first ligation step is the first step of step b) or step d) being performed. The second ligation step is the second step of step d) or step b) being performed. Thus, the first ligation step is either i) step b) where step d) is the second ligation step, or ii) step d) where step b) is the second ligation step.

[0012] These steps can be sequentially performed in the order of a), b), c), d). These steps can be sequentially performed in the order of a), d), c), b). The steps can be performed in the order of step a), step b), and the combined steps c) and d). The steps can be performed in the order of step a), step d), and the combined steps c) and b).

[0013] The non-hairpin adapter can include a sequence that is at least partially complementary to the first primer immobilized on the substrate. It can include a sequence that is at least partially complementary to the first primer immobilized on the substrate, all at least 5, 10, 15, 16, 17, 18, 19, 20, or 21 bases of SEQ ID NO: 1, or all at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 bases of SEQ ID NO: 3.

[0014] The non-hairpin adapter may be a Y-shaped adapter. The Y-shaped adapter may include a first strand containing a sequence that is at least partially complementary to a first primer immobilized on a substrate, and a second strand containing a sequence identical to at least one region of a second primer. The sequence identical to at least one region of the second primer may include at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 2, or at least 5, 10, 15, 16, 17, 18, 19, or all 20 bases of SEQ ID NO: 4. The non-hairpin adapter is a Y-shaped adapter that, in the 5' to 3' direction, includes a first hybridization site to which a first sequencing primer can bind, a first strand containing a sequence that is at least partially complementary to a first immobilized primer, and, in the 5' to 3' direction, a sequence identical to a region of a second immobilized primer and a second hybridization site to which a second sequencing primer can bind.

[0015] The non-hairpin adapter may include 5' and / or 3' protective features. The non-hairpin adapter may include a first strand containing a 3' protective feature and a second strand containing a 5' protective feature.

[0016] The non-hairpin adapter may be a Y-shaped adapter that, in the 5' to 3' direction, includes a first hybridization site to which a first sequencing primer can bind, a sequence that is at least partially complementary to a first immobilized primer, and a 3' protective feature, and, in the 5' to 3' direction, a 5' protective feature, a sequence identical to at least one region of a second primer, and a second hybridization site to which a second sequencing primer can bind.

[0017] The plurality of nucleic acids may be DNA or genomic DNA (gDNA).

[0018] The method can further include the step of contacting a plurality of nucleic acids with a substrate comprising a first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid, wherein the non-hairpin adapter comprises a sequence that is at least partially complementary to the first immobilized primer. Optionally, no nucleic acid amplification step is performed prior to step e). The substrate may be a flow cell or beads.

[0019] The non-hairpin adapter can comprise a sequence that is identical to at least one region of a second primer, and the second primer is immobilized on the substrate. The first and second immobilized primers can act as a forward primer and a reverse primer for bridge amplification, and the method can include bridge amplification.

[0020] The method can further include the step of obtaining sequence information for any nucleic acid hybridized to the substrate in step e).

[0021] After steps a), b), c), and d) are performed, the method can further include the step of obtaining sequence information from the prepared library.

[0022] In another aspect, there is provided a nucleic acid library obtainable or obtained by the method of the present disclosure.

[0023] In another aspect, there is provided a nucleic acid library comprising a non-hairpin adapter ligated to one end and a target nucleic acid having a hairpin at the other end, wherein the nucleic acid library comprises 99.9% by mass, 99% by mass, 95% by mass, 90% by mass, 80% by mass, 70% by mass, 60% by mass, 50% by mass, 40% by mass, 30% by mass, 20% by mass, 10% by mass, 5% by mass, 3% by mass, 1% by mass, 0.1% by mass, or less than 0.01% by mass of target nucleic acids having non-hairpin adapters ligated to both ends, or does not contain any target nucleic acids having non-hairpin adapters ligated to both ends.

[0024] In another aspect, a method for array determination is provided, the method including obtaining sequence information for nucleic acids in the library of the present disclosure.

[0025] In another aspect, a method for obtaining sequencing information is provided, the method 1) contacting the library of the present disclosure with a substrate comprising a first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid; 2) obtaining sequence information for any nucleic acid hybridized to the substrate in step 1) and including.

[0026] In another aspect, provided is the use of the nucleic acid library of the present disclosure, or a nucleic acid library obtainable or obtained by the method of the present disclosure, in a nucleic acid sequencing method.

[0027] In another aspect, a method for library preparation for nucleic acid sequencing is provided, the method i) providing a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation; iii) exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation, or exposing the plurality of nucleic acids to conditions that allow formation of a hairpin at the ends of the nucleic acid molecules and including, the nucleic acids are not amplified during library preparation. Optionally, the method iv) further includes contacting the plurality of nucleic acids with a substrate comprising a first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid, the non-hairpin adapter includes a sequence that is at least partially complementary to the first primer immobilized on the substrate, the nucleic acids are not amplified prior to step iv).

[0028] The non-hairpin adapter can include a sequence that is identical to at least one region of the second primer, and the second primer is immobilized on a substrate. The first and second immobilized primers can act as a forward primer and a reverse primer for bridge amplification, and the method can include bridge amplification.

[0029] The method can include obtaining sequence information for any nucleic acid hybridized to the substrate in step iv). Steps ii) and iii) may be performed separately, and the fragmentation step may be performed after step ii) and before step iii), or after step iii) and before step ii).

[0030] In another aspect, a nucleic acid library obtainable or obtained by the above method is provided. In another aspect, a method of sequencing is provided, the method including obtaining sequence information for the nucleic acids within the library. In another aspect, a method of obtaining sequencing information is provided, the method including: 1) contacting the library with a substrate comprising a first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid; and 2) obtaining sequence information for any nucleic acid hybridized to the substrate in step 1). Also provided is the use of the nucleic acid library, or a nucleic acid library obtainable or obtained by the method, in a nucleic acid sequencing method.

Brief Description of the Drawings

[0031]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

DETAILED DESCRIPTION OF THE INVENTION

[0032] The inventors provide herein a technique for preparing a nucleic acid library suitable for generating error-corrected sequencing data. When the nucleic acid library of the present disclosure is sequenced, sequencing information is provided for both strands of the nucleic acid duplex. This enables correction of errors, including those introduced through library preparation or resulting from sequencing.

[0033] In a first aspect, a method for library preparation for nucleic acid sequencing is provided, the method comprising a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation; c) fragmenting the plurality of nucleic acids; d) exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation, or exposing the plurality of nucleic acids to conditions under which a hairpin can be formed at the ends of the nucleic acid molecules; and steps b) and d) are performed separately.

[0034] Steps b) and d) of the method of the first aspect are performed separately, and thus, the non-hairpin adapter and the hairpin adapter are not ligated to the nucleic acid as part of the same reaction. In other words, steps b) and d) are not performed simultaneously.

[0035] However, as further discussed herein, the adapter ligation and fragmentation steps can be performed simultaneously, in combination, or in parallel. For example, a tagmentation step can be used to ligate an adapter and fragment multiple nucleic acids. Thus, steps b) and c), or steps d) and c), can be performed simultaneously, in combination, or in parallel.

[0036] For all embodiments, the multiple nucleic acids are fragmented after the first adapter ligation step and before or as part of the second adapter ligation step.

[0037] Steps b), c), and d) of the method of the first aspect can be performed sequentially. The steps of the method can be performed in the order of a), b), c), then d), but this is not necessary. In particular, steps b) and d) can be exchanged such that the order is a), d), c), then b). The fragmentation step (step c)) can be performed between the ligation of one type of adapter and the ligation of the other type of adapter. The fragmentation step is performed at or before the second ligation of the adapter.

[0038] As used herein, the term "sequentially" means that the steps are not simultaneous. However, sequential steps need not be consecutive, and additional steps can be performed between the explicitly recited steps.

[0039] In other embodiments, the steps can be performed in the order of step b), then steps c) and d), simultaneously, in combination, or in parallel. The steps can be performed in the order of step d), then steps c) and b), simultaneously, in combination, or in parallel.

[0040] Due to the fact that steps b) and d) are performed separately, the non-hairpin adapter and the hairpin adapter are not ligated to the nucleic acid simultaneously or as part of the same step. For embodiments where a hairpin is formed, this process is not performed simultaneously with or as part of the ligation of the non-hairpin adapter.

[0041] Accordingly, in one embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation to generate a first library; c) fragmenting the first library; d) exposing the fragmented first library to a hairpin adapter under conditions that promote ligation to generate a second library, or exposing the plurality of nucleic acids to conditions that allow a hairpin to form at the ends of the nucleic acid molecules to generate a second library. The fragmentation of the first library and the generation of the second library may be sequential or simultaneous steps.

[0042] In an alternative embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation to generate a first library, or exposing the plurality of nucleic acids to conditions that allow a hairpin to form at the ends of the nucleic acid molecules to generate a first library; c) fragmenting the first library; d) exposing the fragmented first library to a non-hairpin adapter under conditions that promote ligation to generate a second library. The fragmentation of the first library and the generation of the second library may be sequential or simultaneous steps.

[0043] A nucleic acid library is a collection of nucleic acids or a plurality of nucleic acids to which at least one type of adapter has been ligated.

[0044] The library provided by the method of the first aspect has a reduced amount of sequence-determinable nucleic acids that generate error-correctable sequence information related to only one strand of the double strand. Such undesirable nucleic acids include, for example, those containing non-hairpin adapters ligated to both ends of the nucleic acid. This is advantageous because it eliminates the need for concentration and / or amplification before sequencing or a substrate-based step. Furthermore, the quality of the library is improved. The ability to obtain sequence information from the library without the need for an amplification step before sequencing, for example, before contacting the library with a substrate such as a flow cell, is advantageous because such a step itself can introduce mutations and biases. In some embodiments, the library provided by the method of the first aspect has a significantly reduced presence of sequence-determinable nucleic acids that generate error-correctable sequence information related to only one strand of the double strand. For example, the reduction is sufficient to sequence the library on a substrate without the need for concentration or amplification before application to the substrate. In some embodiments, it is desirable to generate a library of the first aspect that does not contain sequence-determinable nucleic acids that generate error-correctable sequence information related to only one strand of the double strand. However, any reduction in their presence, such that amplification is no longer required, for example, is advantageous. Prior art methods that result in libraries containing undesirable products are disclosed, for example, in WO2013 / 142389 A1.

[0045] The provision of a plurality of nucleic acids can be carried out as a first step of the method. This step may include the purification of nucleic acids such as DNA from a sample. The nucleic acid purified or isolated from the sample may be genomic DNA (gDNA). Thus, the provision of a plurality of nucleic acids may be the provision of DNA or gDNA molecules to be sequenced, which may be referred to as target nucleic acids. The sample may be a biological sample such as a sample obtained from a patient or a sample obtained from living cells. The sample may be a tissue sample, a sample of a biological fluid, a cell line, or any other suitable sample. The sample may contain normal cells, neoplastic cells, malignant cells, or cancerous cells. The sample may contain nucleic acids from normal cells, neoplastic cells, malignant cells, or cancer cells. The sample may be a tumor sample or a tissue sample containing neoplastic or cancerous cells. The sample may be blood or a blood fraction such as a plasma fraction. The sample may be a blood fraction such as blood or plasma that contains or is suspected of containing circulating tumor DNA. The sample may contain circulating tumor DNA or may be suspected of containing circulating tumor DNA. The sample may be a blood fraction such as blood or plasma that contains or is suspected of containing circulating fetal DNA. The sample may contain circulating fetal DNA or may be suspected of containing circulating fetal DNA. The sample may have been subjected to genetic modification or gene editing. For example, the sample may have been subjected to an editing technique capable of inducing DSB, such as CRISPR-Cas9, TALEN, or other nucleases. Thus, the library can be generated to enable the detection of off-target mutations induced by the editing technique.

[0046] If necessary for the properties of the isolated nucleic acid, the nucleic acid can be sheared or fragmented as part of step a). Methods for fragmenting nucleic acids are known in the art and can be, for example, mechanical shearing or enzymatic shearing. Fragmentation can include, for example, sonication using a Bioruptor sonicator or a Covaris sonicator. Fragmentation can be enzyme-based and can utilize enzyme-based reagents that shear DNA to generate fragments of a desired size over time. Suitable commercially available reagents include NEBNext dsDNA Fragmentase (NEB). Fragmentation can be performed simultaneously with the first adapter ligation step, for example, via tagmentation. Fragmentation can include the use of nucleases, such as one endonuclease, multiple endonucleases, one restriction enzyme, or multiple restriction enzymes. Fragmentation can include the use of nucleic acid-induced endonucleases such as RNA-induced DNA endonucleases. Fragmentation can include the use of Cas proteins or derivatives or variants. Fragmentation can include the use of Cas9, Cpf1, C2c2, C2c1, CasM, CasMini, retrons, prokaryotic argonautes, TALENs, or meganucleases.

[0047] Fragmentation as part of step a) may not be required in all embodiments. For example, some nucleic acid sources do not require fragmentation. For example, samples obtained from plasma may not require fragmentation. Alternatively, the nucleic acid may contain naturally occurring or inducible double-strand breaks (DSBs), and such samples may not need to be fragmented in step a). In some examples, adapters can be ligated directly to the DSBs.

[0048] Fragmentation may generate nucleic acid fragments of a particular size or having a particular size distribution, and a size selection step may follow. Methods where step a) does not include fragmentation may also include a size selection step. Many systems or reagents for size selection and / or cleanup steps are known in the art. For example, size selection using beads to remove or select fragments of a particular size. The beads may be solid-phase reversible immobilization (SPRI) beads. Commercially available beads include "SPRIselect" (Beckman Coulter) or SPRI beads (GC Biotech, CNGS-0005). Capillary DNA electrophoresis can be used for size selection. Capillary DNA electrophoresis can also be used to evaluate the success of ligation and removal of excess adapters. Other alternative methods include gel-based electrophoresis size selection steps or systems, including for example the use of agarose gels or polyacrylamide gels. Suitable systems such as the BluePippin system (Sage Science) are commercially available. Further examples of systems for size selection and / or cleanup include DNA extraction column-based systems.

[0049] The method may include removing fragments of a size less than about 100 bp or less than about 150 bp, and / or retaining fragments of a size greater than about 150 bp.

[0050] In some embodiments, the resulting fragments are 100 - 1500 bp, 200 - 1300 bp, 300 - 1100 bp, 400 - 1000 bp, 500 - 900 bp, or 600 - 800 bp. In certain embodiments, the nucleic acid is a fragment of a size of about 600 - 800 bp.

[0051] Thus, in one embodiment, step a) is the following a) A step of providing a plurality of nucleic acids, wherein the providing step i) A step of isolating a plurality of nucleic acids from a sample, and ii) A step of fragmenting the plurality of nucleic acids, and (iii) selecting fragments of a plurality of nucleic acids based on size; This may be a step including this.

[0052] The fragmented nucleic acids can be processed to be suitable for adapter ligation. For example, one binding feature or a plurality of binding features can be added to the nucleic acid. The binding feature may include a 5' feature and / or a 3' feature. The binding feature may be any one suitable for facilitating the ligation of an adapter.

[0053] For example, the 5' or 3' binding feature may include one of the following: a phosphate group, a triphosphate "T tail" such as deoxythymidine triphosphate "T tail", a triphosphate "A tail" such as deoxyadenosine triphosphate "A tail", at least one random N nucleotide such as a plurality of N nucleotides, or any other known binding group that enables the ligation of an adapter to the nucleic acid.

[0054] In certain embodiments, the fragmented nucleic acids are end-polished and A-tailed. Accordingly, a 5' phosphate and / or a 3' A tail can be added to the fragmented nucleic acids.

[0055] Accordingly, in one embodiment, step a) is the following a) providing a plurality of nucleic acids, the providing step being i) isolating a plurality of nucleic acids from a sample; and optionally, ii) fragmenting the plurality of nucleic acids; and optionally, iii) selecting fragments of the plurality of nucleic acids based on size; and iv) adding 5' and / or 3' binding features to the plurality of nucleic acids This may be a step including this.

[0056] Steps i), ii), iii), and iv) can be performed in the order of i), ii), iii), and then iv). However, any order that enables the preparation of multiple nucleic acids suitable for the downstream steps disclosed herein may also be followed. For example, the order of i), ii), iv), and then iii) may be used.

[0057] In certain non-limiting embodiments, step a) is the following a) A step of providing a plurality of nucleic acids, wherein the providing step is i) A step of isolating a plurality of nucleic acids from a sample, wherein the plurality of nucleic acids are gDNA; ii) A step of fragmenting the isolated plurality of nucleic acids; iii) A step of selecting fragments of the plurality of nucleic acids based on size; iii) A step of blunting the ends of the selected nucleic acids; iv) A step of adding an A-tail to the blunt-ended nucleic acids and may be a step including.

[0058] In another non-limiting embodiment, step a) is the following a) A step of providing a plurality of nucleic acids, wherein the providing step is i) A step of isolating a plurality of nucleic acids from a sample, wherein the plurality of nucleic acids are gDNA; ii) A step of fragmenting the isolated plurality of nucleic acids; iii) A step of selecting fragments of the plurality of nucleic acids based on size; iii) A step of blunting and 5'-phosphorylating the selected nucleic acids; iv) A step of adding an A-tail to the blunt-ended nucleic acids and may be a step including.

[0059] In other embodiments, step a) includes both nucleic acid fragmentation and adapter ligation. For example, it is a tagmentation step. The ligated adapter may be a non-hairpin adapter or a hairpin adapter depending on the order in which the step is performed.

[0060] Steps a) and b) are as follows i) isolating a plurality of nucleic acids from a sample; ii) fragmenting a non-hairpin adapter and ligating it to the plurality of nucleic acids; Optionally, iii) selecting fragments of the plurality of nucleic acids based on size can be combined.

[0061] Alternatively, steps a) and d) are as follows i) isolating a plurality of nucleic acids from a sample; ii) fragmenting a hairpin adapter and ligating it to the plurality of nucleic acids; Optionally, iii) selecting fragments of the plurality of nucleic acids based on size can be combined.

[0062] In one embodiment, steps a) and b) are as follows 1) providing a plurality of nucleic acids; 2) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation and fragmentation are combined.

[0063] In another embodiment, steps a) and d) are as follows 1) providing a plurality of nucleic acids; 2) exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation and fragmentation are combined.

[0064] In some embodiments, at least one type of adapter is ligated in situ. In this context, step a) may include permeabilizing a cell or tissue sample. For example, step a) may include exposing the sample to a permeabilizing agent. Nucleic acids such as DNA or gDNA can be isolated from the sample after adapter ligation. In these embodiments, the adapter can be ligated to a DSB. The DSB may be naturally occurring or induced.

[0065] Step b) comprises exposing a plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation. Thus, in some embodiments, the non-hairpin adapter is ligated to the available or unprotected ends of the nucleic acids. In embodiments where step b) is performed before step d), ligation of the non-hairpin adapter to both ends of at least a portion of the plurality of nucleic acids is effected. In embodiments where step b) is performed after step d), ligation of the non-hairpin adapter to the ends of the nucleic acids that do not have hairpins is effected.

[0066] As discussed, step b) can be performed separately from or simultaneously with fragmentation. In embodiments where step b) is simultaneous with fragmentation, this can be the fragmentation of step a) and can be part of the initial library preparation, or if step b) is performed after step d), step b) can be combined with step c) (i.e., fragmentation occurs after the first adapter ligation step). A "non-hairpin adapter" is an adapter that does not contain a hairpin loop. For example, a non-hairpin adapter does not contain a single nucleic acid strand that forms a duplex by hybridization of a portion of the single nucleic acid strand to another portion of the same single nucleic acid strand. A double-stranded non-hairpin adapter can contain two separate nucleic acid strands that can form a duplex by hybridization between at least a portion of one strand and at least a portion of the other strand.

[0067] In some embodiments, the non-hairpin adapter is a nucleic acid or contains a nucleic acid. In some embodiments, the non-hairpin adapter is DNA, RNA, and / or xeno nucleic acid (XNA) or contains them. The non-hairpin adapter can contain modified and / or unmodified nucleotides. In some embodiments, the non-hairpin adapter is double-stranded. In certain embodiments, the non-hairpin adapter contains double-stranded DNA.

[0068] The non-hairpin adapter may include a sequence that can bind by hybridization to a primer immobilized on a substrate. For example, the non-hairpin adapter may include a sequence that is at least partially complementary to a primer immobilized on a substrate. In some examples, the sequence may be referred to as a site for hybridization of a flow cell primer or a bead-binding primer. In such embodiments, the method may be a method for library preparation for nucleic acid sequencing, and the preparation includes modifying the nucleic acid to be suitable for binding to a substrate containing an immobilized primer. The length of the complementary region may be 5, 10, 15, 20, 21, 22, 23, 24 bases, or more bases. Alternatively, the complementary region may include 5, 10, 15, 20, 21, 22, 23, 24 bases, or more complementary bases.

[0069] The non-hairpin adapter may include a sequence that is identical to at least a part or all of a second primer. The second primer may be immobilized on a substrate or may be present in solution. The length of the identical region may be 5, 10, 15, 20, 21, 22, 23, 24 bases, or more bases. The first and second primers may be configured to enable amplification of nucleic acids on the substrate.

[0070] In certain embodiments, the non-hairpin adapter is ligated as a complete adapter. Thus, in these embodiments, no further steps need to be performed to add features of the adapter. Thus, the non-hairpin adapter can be ligated as a complete adapter to multiple nucleic acids without the need for one or more polymerase steps to add or fill in any nucleic acid sequences. In particular, the non-hairpin adapter can be ligated to multiple nucleic acids as a molecule that includes both a sequence that can hybridize to a substrate and a sequence that enables amplification on the substrate.

[0071] In a preferred embodiment, the non-hairpin adapter is a Y-shaped adapter. A "Y-shaped adapter" contains two strands that are only partially complementary, such that the Y-shaped adapter includes a portion containing two non-complementary single strands and a double-stranded complementary portion (e.g., forming a "Y" shape). The ends of the double-stranded portion may be ligated to another nucleic acid, and thanks to the single-stranded portions, it can result in one sequence ligated to the 5' end of the nucleic acid and a different sequence ligated to the 3' end of the nucleic acid.

[0072] For example, a Y-shaped adapter may include a first nucleic acid (e.g., DNA) strand and a second nucleic acid (e.g., DNA) strand. In one embodiment, the first strand includes a portion complementary to the second strand and a portion non-complementary to the second strand in the 5' to 3' direction, and the second strand includes a portion non-complementary to the first strand and a portion complementary to the first strand in the 5' to 3' direction.

[0073] In certain embodiments, the Y-shaped adapter is ligated as a complete adapter. Thus, in these embodiments, no further steps need to be performed to add features to the Y-shaped adapter. Thus, the Y-shaped adapter can be ligated as a complete adapter to multiple nucleic acids without requiring one or more polymerase steps to add or fill in any nucleic acid sequences. In particular, the Y-shaped adapter can be ligated to multiple nucleic acids as a molecule containing both a sequence capable of hybridizing to a substrate and a sequence enabling amplification on the substrate.

[0074] Y-shaped adapters are known in the art. For example, the Y-shaped adapter may be an Illumina Y-shaped adapter comprising a P5 binding sequence and a P7 binding sequence. In one embodiment, the Y-shaped adapter comprises the sequence GTGTAGATCTCGGTGGTCGCCGTATCATT (SEQ ID NO: 1) and / or the sequence CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 2). In another embodiment, the Y-shaped adapter comprises the sequence ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 3) and / or AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 4). In one embodiment, the Y-shaped adapter comprises at least 5, 10, 15, 16, 17, 18, 19, 20, or 21 consecutive bases of SEQ ID NO: 1. In one embodiment, the Y-shaped adapter comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 consecutive bases of SEQ ID NO: 2. In one embodiment, the Y-shaped adapter comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 consecutive bases of SEQ ID NO: 3. In one embodiment, the Y-shaped adapter comprises at least 5, 10, 15, 16, 17, 18, 19, 20, or 20 consecutive bases of SEQ ID NO: 4. In one embodiment, the Y-shaped adapter comprises at least 5, 10, 15, 16, 17, 18, 19, 20, or 21 consecutive bases of SEQ ID NO: 1 and at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 consecutive bases of SEQ ID NO: 2. In one embodiment, the Y-shaped adapter comprises at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 consecutive bases of SEQ ID NO: 3 and at least 5, 10, 15, 16, 17, 18, 19, or 20 consecutive bases of SEQ ID NO: 4. The Y-shaped adapter may comprise any of the bases of SEQ ID NOs: 1-4 sufficient to enable hybridization to a complementary primer.

[0075] The Y-shaped adapter may include an array that can be ligated by hybridization to a first primer and optionally an array that can be ligated by hybridization to a second primer. The first and second primers may be for, e.g., clonal amplification of nucleic acids via bridge amplification. The Y-shaped adapter may include an array that can be ligated by hybridization to a first primer immobilized on a substrate and an array that is identical to at least a part or all of a second primer immobilized on the substrate. For example, the Y-shaped adapter may include an array that is at least partially complementary to a first primer immobilized on a substrate. The array that is at least partially complementary to the first immobilized primer and the array that is identical to at least a part of the second immobilized primer may be present on different strands of the Y-shaped adapter, resulting in the formation of at least a part of the non-complementary portion of the Y-shaped adapter. In these embodiments, the method may be a method for library preparation for nucleic acid sequencing, and the preparation includes modifying the nucleic acid to be suitable for ligation to a substrate including a first type of immobilized primer and a second type of immobilized primer. In such embodiments, the complementary portion of the first immobilized primer and the Y-shaped adapter and the identical portion of the second immobilized primer and the Y-shaped adapter may be suitable for performing bridge amplification of the target nucleic acid.

[0076] Thus, in one embodiment, the Y-shaped adapter comprises a first strand comprising a sequence that is at least partially complementary to a first primer immobilized on a substrate and a second strand comprising a sequence identical to at least one region of a second primer immobilized on the substrate. In one embodiment, the Y-shaped adapter comprises a first strand comprising at least 5, 10, 15, 16, 17, 18, 19, 20, or all 21 bases of SEQ ID NO: 1, and a second strand comprising at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 2. In one embodiment, the Y-shaped adapter comprises a first strand comprising at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 3, and a second strand comprising at least 5, 10, 15, 16, 17, 18, 19, or all 20 bases of SEQ ID NO: 4. In one embodiment, the Y-shaped adapter comprises a first strand comprising the sequence according to SEQ ID NO: 1 and a second strand comprising the sequence according to SEQ ID NO: 2. In one embodiment, the Y-shaped adapter comprises a first strand comprising the sequence according to SEQ ID NO: 3 and a second strand comprising the sequence according to SEQ ID NO: 4.

[0077] In other embodiments, the Y-shaped adapter may comprise a sequence that can hybridize to a first primer immobilized on a substrate and a sequence that is identical to at least a portion of a second primer that is not immobilized on the substrate. In one embodiment, the substrate may be beads.

[0078] The non-hairpin adapter may comprise a hybridization site to which a sequencing primer can bind. The non-hairpin adapter may comprise a first hybridization site to which a first sequencing primer can bind and a second hybridization site to which a second sequencing primer can bind. The first hybridization site and the second hybridization site may be on different strands of the non-hairpin adapter. The first and second hybridization sites may be at least partially complementary.

[0079] Thus, in one embodiment, a non-hairpin adapter, such as a Y-shaped adapter, can include a first strand that includes a first hybridization site to which a first sequencing primer can bind, and a second strand that includes a second hybridization site to which a second sequencing primer can bind.

[0080] Examples of suitable hybridization sites are provided herein as SEQ ID NOs: 5-8. These sequences are purely illustrative. Each of SEQ ID NOs: 5-8 can include 1-7, 1-6, 1-5, 1-4, 1-3, 2, or 1 modification such as a substitution, deletion, or insertion. In one embodiment, the modification is a substitution. However, one of ordinary skill in the art will understand that any modification is acceptable as long as a complementary modification can be made to the cognate primer for sequencing, or as long as the modification does not affect the hybridization and function of the cognate primer.

[0081] In embodiments where the non-hairpin adapter includes both a sequence capable of binding by hybridization to a primer immobilized on a substrate and a hybridization site to which a sequencing primer can bind, after ligation, the adapter can be oriented such that the sequence capable of binding by hybridization to a primer immobilized on the substrate is located closer to the end, and the hybridization site to which a sequencing primer can bind is located closer to the ligation site.

[0082] In certain embodiments, the non-hairpin adapter is a first strand that, in the 5' to 3' direction, includes a first hybridization site to which a first sequencing primer can bind and a sequence that is at least partially complementary to a first immobilization primer, and a second strand that, in the 5' to 3' direction, includes a sequence identical to a second immobilization primer and a second hybridization site to which a second sequencing primer can bind A Y-shaped adapter that includes. The first and second hybridization sites may be at least partially complementary.

[0083] The non-hairpin adapter may include one or more 5' and / or 3' ligation features. The ligation feature may be any suitable one for facilitating the ligation of the adapter. For example, the 5' or 3' ligation feature may include one of the following: a phosphate group, a triphosphate "T tail" such as deoxythymidine triphosphate "T tail", a triphosphate "A tail" such as deoxyadenosine triphosphate "A tail", at least one random N nucleotide such as a plurality of N nucleotides, or any other known ligation group that enables the ligation of the adapter to a nucleic acid. In certain embodiments, the 5' ligation feature is a phosphate group and the 3' ligation feature is a T tail.

[0084] In certain embodiments, the non-hairpin adapter, such as a Y-shaped adapter, includes a first strand that includes a 5' ligation feature, such as a phosphate group, and a second strand that includes a 3' ligation feature, such as a T tail.

[0085] The non-hairpin adapter may include one or more 5' and / or 3' protective features, particularly in embodiments where step b) is performed before step d). The protective feature may be any one that prevents the ligation of the protected adapter to another adapter. For example, one or more protective features may prevent the ligation of the hairpin adapter to the non-hairpin adapter. The non-hairpin adapter may include two different terminal protective features. The protective feature may not be required in all embodiments. For example, embodiments characterized by tagmentation may not require the presence of a protective feature.

[0086] In certain embodiments, a non-hairpin adapter (e.g., a Y-shaped adapter) includes a first strand that includes a sequence at least partially complementary to a first primer immobilized on a substrate and a 3' protective feature, and a second strand that includes a sequence identical to at least one region of a second primer immobilized on the substrate and a 5' protective feature.

[0087] The 5' and / or 3' protective features can include features that provide resistance to any one or more of the following: phosphorylation activity, phosphatase activity, terminal transferase activity, nucleic acid hybridization, endonuclease activity, exonuclease activity, ligase activity, polymerase activity, and protein binding. This can be achieved by any means known to those skilled in the art, such as phosphorothioate bonds, phosphoramidite spacers, phosphate groups, 2'-O-methyl groups, reverse deoxy and dideoxy-T modifications, locked nucleic acid bases, dideoxynucleotides, etc., but is not limited thereto. The protective feature can be a C3 spacer phosphoramidite (3SpC3). Examples of the activities provided by these features are shown in Table 1.

[0088] In certain embodiments, the non-hairpin adapter includes a 5' reverse dideoxy T (ddT) and a 3' C3 spacer phosphoramidite. In one embodiment, the non-hairpin adapter is a Y-shaped adapter that includes a 5' reverse dideoxy T (ddT) and a 3' C3 spacer phosphoramidite.

[0089] In certain embodiments, a non-hairpin adapter, such as a Y-shaped adapter, includes a first strand that includes a 3' protective feature, such as a C3 spacer phosphoramidite, and a second strand that includes a 5' protective feature, such as reverse dideoxy T (ddT).

[0090] In certain embodiments, the non-hairpin adapter is a Y-shaped adapter comprising, in the 5' to 3' direction, a first hybridization site to which a first sequencing primer can bind, a sequence that is at least partially complementary to a first immobilization primer, and a first strand comprising a 3' protecting feature (e.g., a C3 spacer phosphoramidite), and, in the 5' to 3' direction, a 5' protecting feature (e.g., a reverse ddT), a sequence identical to at least one region of a second immobilization primer, and a second strand comprising a second hybridization site to which a second sequencing primer can bind. Optionally, the first and second hybridization sites are at least partially complementary.

[0091] In certain embodiments, the non-hairpin adapter is a Y-shaped adapter comprising, in the 5' to 3' direction, a 5' binding feature (e.g., a phosphate group), a first hybridization site to which a first sequencing primer can bind, a sequence that is at least partially complementary to a first immobilization primer, and a first strand comprising a 3' protecting feature (e.g., a C3 spacer phosphoramidite), and, in the 5' to 3' direction, a 5' protecting feature (e.g., a reverse ddT), a sequence identical to at least one region of a second immobilization primer, a second hybridization site to which a second sequencing primer can bind, and a 3' binding feature (e.g., a T tail). Optionally, the first and second hybridization sites are at least partially complementary.

[0092] Non-hairpin adapters may optionally contain an index array, which may be referred to as a barcode. The index array may enable the identification of sequences from a particular sample. For example, different samples may be pooled prior to sequencing, and the index may enable the subsequent identification of the sample from which the sequence originated. This is sometimes referred to as post-sequencing demultiplexing. The index array may be arranged to be read during sequencing, for example, it may be arranged on the 3' side of the hybridization site of the sequencing primer. The index array may be an array of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 nucleotides in length or more. The index array may be a known array of at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 20 nucleotides in length or more. The index array may be a random array of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 nucleotides in length or more. The index array may be a degenerate or semi-degenerate array. The index array may be 5-10 base pairs in length. The index may be 5 or 7 nucleotides in length. The index array may be present on both strands of the double-stranded portion of the adapter and may be complementary. Non-hairpin adapters may contain two indexes for dual-index sequencing.

[0093] The non-hairpin adapter may optionally include a single molecule identifier (SMI). Examples of SMIs are disclosed in WO2013 / 142389, which is incorporated herein by reference. The SMI may enable the identification of amplified nucleic acid molecules derived from a single parental molecule. The SMI sequence may be a double-stranded complementary SMI sequence or a single-stranded SMI sequence. The SMI sequence may be degenerate or semi-degenerate, or may be a random degenerate sequence. The double-stranded SMI sequence may include a first degenerate or semi-degenerate nucleotide n-mer sequence and a second n-mer sequence complementary to the first degenerate or semi-degenerate nucleotide n-mer sequence, and the single-stranded SMI sequence may include a first degenerate or semi-degenerate nucleotide n-mer sequence. The first and / or second degenerate or semi-degenerate nucleotide n-mer sequences may be of any suitable length to generate a sufficient number of unique tags to label a set of sheared DNA fragments from a segment of DNA. Each n-mer sequence may be about 3 to 20 nucleotides in length. Thus, each n-mer sequence may be about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In one embodiment, the SMI sequence is a random degenerate nucleotide n-mer sequence that is 12 nucleotides in length. With respect to the present invention, inclusion of the SMI sequence is not essential as a nucleic acid amplification step is not required prior to binding to the substrate. Thus, in some embodiments, the non-hairpin adapter does not include an SMI sequence.

[0094] The Y-shaped adapter may include the sequence GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (SEQ ID NO: 5), an index, and SEQ ID NO: 1, and these features may be in the order listed 5' to 3'. The index may be 7 bases in length. The Y-shaped adapter may include the sequence of SEQ ID NO: 2, an index, and the sequence GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 6), and these features may be in the order listed 5' to 3'. The index may be 5 bases in length.

[0095] The Y-shaped adapter may include the sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (SEQ ID NO: 7), an index, and SEQ ID NO: 3, and these characteristic parts may be in the order listed from 5' to 3'. The index may be 7 bases in length. The Y-shaped adapter may include SEQ ID NO: 4, an index, and ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 8), and these characteristic parts may be in the order listed from 5' to 3'. The index may be 5 bases in length.

[0096] In certain embodiments, the non-hairpin adapter a first strand that, in the 5' to 3' direction, includes SEQ ID NO: 5, optionally an index, and SEQ ID NO: 1, and a second strand that, in the 5' to 3' direction, includes SEQ ID NO: 2, optionally an index, and SEQ ID NO: 6 is a Y-shaped adapter. SEQ ID NOs: 1, 2, 5, and 6 may each include 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modification such as a substitution, deletion, or insertion. In one embodiment, the modification is a substitution.

[0097] In certain embodiments, the non-hairpin adapter a first strand that, in the 5' to 3' direction, includes SEQ ID NO: 7, optionally an index, and SEQ ID NO: 3, and a second strand that, in the 5' to 3' direction, includes SEQ ID NO: 4, optionally an index, and SEQ ID NO: 8 is a Y-shaped adapter. SEQ ID NOs: 3, 4, 7, and 8 may each include 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modification such as a substitution, deletion, or insertion. In one embodiment, the modification is a substitution.

[0098] Non-hairpin adapters are provided to a plurality of nucleic acids under conditions that promote ligation of the adapter to the nucleic acids within the plurality of nucleic acids. The conditions can vary depending on the nature of the ligation reaction and the binding characteristics of the non-hairpin adapter and the plurality of nucleic acids. For example, the conditions can facilitate ligation between two double-stranded nucleic acids, each containing a 5' phosphate, one containing a 3'A tail, and the other containing a 3'T tail. Other suitable methods of ligating the adapter to the nucleic acid and the required conditions are known in the art. A purification step may be included after adapter ligation. This step can remove excess adapter molecules. Adapter ligation may also be via techniques that include fragmentation, e.g., tagmentation.

[0099] In embodiments where step b) is performed before step d), the ligation reaction results in ligation of the non-hairpin adapter to both ends of at least a portion of the plurality of nucleic acids. This can be referred to as the first library. In embodiments where the non-hairpin adapter is a Y-shaped adapter, the first library contains fragments of the nucleic acid to be sequenced, and the Y-shaped adapter is ligated to each end of at least a portion of the fragment. Thus, the first nucleic acid sequence may be ligated to the 5' end of the strand within the fragment, and the second nucleic acid sequence may be ligated to the 3' end of the strand within the fragment.

[0100] In embodiments where step b) is performed after step d), the ligation reaction results in ligation of the non-hairpin adapter to the ends of the nucleic acid that does not have a hairpin. Thus, at least a portion of the nucleic acid to be sequenced contains a hairpin at one end and a non-hairpin adapter at the other end. This can be referred to as the second library. In embodiments where the non-hairpin adapter is a Y-shaped adapter, the second library contains fragments of the nucleic acid to be sequenced, and at least a portion of the fragment contains a Y-shaped adapter ligated to one end and a hairpin at the other end.

[0101] Step c) involves fragmenting a plurality of nucleic acids and can be performed after either step b) or step d). Step c) is applied to the first library and is performed before or during the formation of the second library.

[0102] Methods for fragmenting nucleic acids are known in the art and may be, for example, mechanical shearing or enzymatic shearing. Fragmentation can include, for example, sonication using a Bioruptor sonicator or a Covaris sonicator. Fragmentation may be enzyme-based and may utilize enzyme-based reagents that shear DNA to generate fragments of a desired size over time. Suitable commercially available reagents include NEBNext dsDNA Fragmentase (NEB). Fragmentation can be performed simultaneously with the second adapter ligation step, for example, via tagmentation. Fragmentation can result in double-strand breaks in a plurality of nucleic acids. Fragmentation need not be site-specific and can thus induce random breaks such as random double-strand breaks. Fragmentation results in double-strand breaks that allow adapters to ligate, optionally after end repair or a similar step. Fragmentation can result in double-strand breaks that allow adapters to ligate without the need for a prior polymerase-based step that utilizes one strand as a template. In some embodiments, fragmentation does not include the use of site-specific nickases. In some embodiments, fragmentation does not include the use of site-specific nickases to yield single-stranded portions, which are then repaired using a template-based polymerase.

[0103] Fragmentation can include the use of nucleases, for example, one endonuclease, a plurality of endonucleases, one restriction enzyme, or a plurality of restriction enzymes. Fragmentation can include the use of nucleic acid-induced endonucleases such as RNA-induced DNA endonucleases. Fragmentation can include the use of Cas proteins or derivatives or variants. Fragmentation can include the use of Cas9, Cpf1, C2c2, C2c1, CasM, CasMini, retrons, prokaryotic argonautes, TALENs, or meganucleases.

[0104] Fragmentation may generate nucleic acid fragments of a specific size or having a specific size distribution, and a size selection step may follow. Many systems or reagents for size selection and / or cleanup steps are known in the art. For example, size selection using beads to remove or select fragments of a specific size. The beads may be solid phase reversible immobilization (SPRI) beads. Commercially available beads include "SPRIselect" (Beckman Coulter) or SPRI beads (GC Biotech, CNGS-0005). Capillary DNA electrophoresis can be used for size selection. Capillary DNA electrophoresis can also be used to evaluate the success of ligation and the removal of excess adapters. Other alternatives include gel-based electrophoresis size selection steps or systems, including for example the use of agarose or polyacrylamide gels. Appropriate systems such as the BluePippin system (Sage Science) are commercially available. Further examples of systems for size selection and / or cleanup include DNA extraction column-based systems.

[0105] If the sample is fragmented before or during ligation of the first adapter, step c) may include selecting fragments that are approximately half the size of the preceding fragmentation step.

[0106] Step c) may include removing fragments of a size less than about 100 bp or less than about 150 bp, and / or retaining fragments of a size greater than about 150 bp.

[0107] In some embodiments, the resulting fragments are 100 - 700 bp, 150 - 650 bp, 200 - 600 bp, 250 - 550 bp, 300 - 500 bp, or 350 - 450 bp. In some embodiments, the resulting fragments are 150 - 600 bp, 200 - 550 bp, 250 - 500 bp, 275 - 450 bp, or 300 - 400 bp.

[0108] Fragmented nucleic acids can be processed to be suitable for adapter ligation. For example, one or more binding features can be added to the nucleic acid. The binding feature can include a 5' feature and / or a 3' feature. The binding feature can be any suitable one for facilitating the ligation of an adapter, including any of the binding features disclosed herein. When step b) is performed to generate the first library, since there is a protecting feature on the non-hairpin adapter, the binding feature cannot be added to the non-hairpin adapter.

[0109] In certain embodiments, the fragmented nucleic acids are end-polished and A-tailed. Accordingly, a 5' phosphate and / or a 3' A-tail can be added to the fragmented nucleic acids.

[0110] Accordingly, in one embodiment, step c) comprises the following c) a step of fragmenting a plurality of nucleic acids, and further optionally, i) a step of selecting fragments of the plurality of nucleic acids based on size; and ii) a step of adding a 5' and / or 3' binding feature to the plurality of nucleic acids and includes.

[0111] Steps i) and ii) can be performed in the order of i), then ii). However, it may also be in any order that enables the preparation of a plurality of nucleic acids suitable for the downstream steps disclosed herein.

[0112] In certain non-limiting embodiments, step c) comprises the following c) a step of fragmenting a plurality of nucleic acids, and further i) a step of selecting fragments of the plurality of nucleic acids based on size; ii) a step of end-polishing the selected nucleic acids; iii) a step of adding an A-tail to the end-polished nucleic acids and includes.

[0113] In other embodiments, step c) includes fragmenting the nucleic acid and ligating an adapter. For example, it is a tagmentation step. The ligated adapter may be a non-hairpin adapter or a hairpin adapter depending on the order in which the steps are performed.

[0114] Accordingly, steps c) and b) are as follows i) fragmenting a non-hairpin adapter and ligating it to the plurality of nucleic acids; Optionally, ii) selecting fragments of the plurality of nucleic acids based on size; can be combined.

[0115] Alternatively, steps c) and d) are as follows i) fragmenting a hairpin adapter and ligating it to the plurality of nucleic acids; Optionally, ii) selecting fragments of the plurality of nucleic acids based on size; can be combined.

[0116] In other embodiments, step c) may include a tagmentation step of inserting a recognition site into the fragmented nucleic acid. For example, it is a recognition site of an enzyme capable of forming a hairpin such as telomerase. Telomerase may be TelN.

[0117] In some examples, step d) includes exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation. Accordingly, the hairpin adapter is ligated to the available or unprotected ends of the nucleic acid. In embodiments where step d) is performed before step b), ligation of the hairpin adapter to both ends of at least a portion of the plurality of nucleic acids is effected. In embodiments where step d) is performed after step b), ligation of a non-hairpin adapter to the ends of the nucleic acids where the hairpin is not ligated is effected.

[0118] In other examples, step d) comprises exposing a plurality of nucleic acids to conditions under which a hairpin can be formed at the ends of the nucleic acid molecules. For example, step d) may include the use of conditions or enzymes that can generate covalently closed ends in double-stranded nucleic acid molecules. Examples of suitable enzymes are telomerases such as TelN. The TelN recognition sequence may be present in the plurality of nucleic acids or may be introduced into the plurality of nucleic acids. For example, the TelN recognition sequence can be introduced as part of fragmentation via tagmentation.

[0119] As discussed, step d) can be performed separately from or simultaneously with fragmentation. In embodiments where step d) is simultaneous with fragmentation, this is the fragmentation of step a) and may be part of the initial library preparation, or if step d) is performed after step b), step d) can be combined with step c) (i.e., fragmentation occurs after the first adapter ligation step).

[0120] A "hairpin" adapter includes a hairpin loop. A hairpin adapter can include a single nucleic acid strand in which a portion of the single nucleic acid strand hybridizes to another portion of the same single nucleic acid strand to form a double strand. Hairpin adapters are known in the art. A hairpin adapter can be referred to as a "U-adapter".

[0121] A double-stranded nucleic acid having a hairpin present only at one end can be denatured to form a single-stranded molecule containing both strands of the original double-stranded nucleic acid.

[0122] In some embodiments, the hairpin adapter is or comprises a nucleic acid. In some embodiments, the hairpin adapter is or comprises DNA, RNA, and / or XNA. The hairpin adapter can include modified and / or unmodified nucleotides. In certain embodiments, the hairpin adapter comprises DNA.

[0123] A non-limiting example of a hairpin adapter is GGGCCTADDDDDDDDTAGGCCCT (SEQ ID NO: 9), where D is G, A, or T (but not C).

[0124] The hairpin adapter can be provided to a plurality of nucleic acids under conditions that promote ligation of the adapter to the nucleic acids within the plurality of nucleic acids. The conditions can vary depending on the nature of the ligation reaction and the binding characteristics of the hairpin adapter and the plurality of nucleic acids. For example, the conditions can facilitate ligation between two double-stranded nucleic acids, each containing a 5' phosphate, one containing a 3' A tail, and the other containing a 3' T tail. Other suitable methods and the necessary conditions for ligating the adapter to the nucleic acids are known in the art. A purification step can be included after adapter ligation. This step can remove excess adapter molecules.

[0125] In embodiments where step d) is performed before step b), step d) results in ligation of the hairpin adapter to both ends of at least a portion of the plurality of nucleic acids, or formation of a hairpin at both ends of at least a portion of the plurality of nucleic acids. This can be referred to as the first library. In such embodiments, the method can include a step of removing any linear nucleic acids. This step can result in essentially only the nucleic acids that are nucleic acid loops and have hairpins at both ends being retained.

[0126] In embodiments where step d) is performed after step b), step d) results in ligation of the hairpin adapter to the ends of nucleic acids to which a non-hairpin adapter has not been ligated, or formation of a hairpin at the ends of nucleic acids to which a non-hairpin adapter has not been ligated. Thus, at least a portion of the nucleic acids to be sequenced contains a hairpin at one end and a non-hairpin adapter at the other end. This can be referred to as the second library.

[0127] As discussed, step d) can be carried out separately from fragmentation or simultaneously with fragmentation. In embodiments where step d) is simultaneous with fragmentation, this is the fragmentation of step a) and may be part of the initial library preparation, or if step d) is carried out after step b), step d) can be combined with step c) (i.e., fragmentation occurs after the first adapter ligation step).

[0128] In one embodiment, a method for library preparation for nucleic acid sequencing is provided, the method comprising, in the recited order, the following sequential steps: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation; fragmenting the plurality of nucleic acids; exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation; and

[0129] In one embodiment, a method for library preparation for nucleic acid sequencing is provided, the method comprising, in the recited order, the following sequential steps: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation; fragmenting the plurality of nucleic acids; exposing the plurality of nucleic acids to conditions under which hairpins can be formed at the ends of the nucleic acid molecules; and

[0130] In another embodiment, a method for library preparation for nucleic acid sequencing is provided, the method comprising, in the recited order, the following sequential steps: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation; exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation and fragmentation; and

[0131] In one embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising, in the order recited, the following consecutive steps: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation; fragmenting the plurality of nucleic acids; exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation; and

[0132] In one embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising, in the order recited, the following consecutive steps: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to conditions under which a hairpin can form at the ends of the nucleic acid molecules; fragmenting the plurality of nucleic acids; exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation; and

[0133] In another embodiment, a method for preparing a library for nucleic acid sequencing is provided, the method comprising, in the order recited, the following consecutive steps: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation; exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation and fragmentation; and

[0134] In some embodiments, the method may further comprise contacting, at this stage, a plurality of nucleic acids, which may be referred to as a second library at this stage, with a substrate comprising an immobilized primer under conditions suitable for hybridization of a portion of the non-hairpin adapter and at least a portion of the immobilized primer.

[0135] Any nucleic acid lacking a ligated non-hairpin adapter does not hybridize to the flow cell. For example, any nucleic acid containing hairpin adapters at both ends.

[0136] The substrate may be a solid surface such as the surface of a flow cell, beads, slides, or membranes. In particular, the substrate may be a flow cell. The substrate may be a patterned flow cell or an unpatterned flow cell. The substrate may include glass, quartz, silica, metal, ceramic, or plastic. The substrate surface may include a polyacrylamide matrix or coating.

[0137] As used herein, the term "flow cell" is intended to have its ordinary meaning in the art, particularly in the field of synthetic sequencing. Exemplary flow cells include, but are not limited to, flow cells for the Genome Analyzer®, MiSeq®, NextSeq®, HiSeq®, or NovaSeq® platforms commercially available from Illumina, Inc. (San Diego, CA), or flow cells for the SOLiD™ or Ion Torrent™ sequencing platforms commercially available from Life Technologies (Carlsbad, CA) and used in nucleic acid sequencing apparatuses. Exemplary flow cells and methods for their manufacture and use are also described, for example, in WO2014 / 142841A1, US Patent Application Publication No. 2010 / 0111768 A1, and US Patent No. 8,951,781.

[0138] The substrate can include immobilized primers, for example, two types of primers that can act together as a forward primer and a reverse primer for bridge amplification. Immobilization to the substrate means that the primer binds to the substrate even under conditions that denature double-stranded nucleic acids. For example, the primer can be covalently attached to the substrate. The primer is oriented such that the 5' end is proximal to the point of attachment and the 3' end is distal. Such an arrangement is standard in the art.

[0139] In certain embodiments, the substrate can include a first and a second immobilized primer. The immobilized primer may, in some embodiments, be suitable for acting as a primer during bridge amplification. Bridge amplification can result in clonal amplification of nucleic acids immobilized to the substrate. The non-hairpin adapter can be a Y-shaped adapter that includes a sequence complementary to the first immobilized primer and a sequence identical to the second immobilized primer. Thus, in such embodiments, the second library includes a nucleic acid that includes a hairpin adapter at one end and, at the other end, a sequence complementary to the first immobilized primer ligated to one strand and a sequence identical to the second immobilized primer ligated to the other strand. The sequence complementary to the first immobilized primer can be ligated to the 3' end of the nucleic acid, and the sequence identical to the second immobilized primer can be ligated to the 5' end of the nucleic acid.

[0140] In some embodiments, the second library can be denatured prior to contacting the substrate such that the nucleic acids of the second library are single-stranded. In some embodiments, the second library can be contacted with the substrate under denaturing conditions such that the nucleic acids within the library are single-stranded upon contact.

[0141] In certain embodiments, a method for library preparation for nucleic acid sequencing is disclosed, the preparation including modifying the nucleic acid to be suitable for binding to a substrate that includes a first immobilized primer, the method including a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation, wherein the non-hairpin adapter comprises a sequence complementary to the first immobilization primer; c) fragmenting the plurality of nucleic acids; d) exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation, or exposing the plurality of nucleic acids to conditions that allow a hairpin to form at the ends of the nucleic acid molecules; In one embodiment, the steps may be performed in the order of a), b), c), and then d). These steps may be continuous, or steps c) and d) may be combined, for example, as a tagmentation step. Step b) may be combined with an earlier fragmentation step. In another embodiment, the steps may be performed in the order of a), d), c), and then b). These steps may be continuous, or steps c) and b) may be combined, for example, as a tagmentation step. Step d) may be combined with an earlier fragmentation step.

[0142] Following the above steps, the method may further comprise: e) contacting the plurality of nucleic acids with a substrate under conditions suitable for hybridization of the first immobilization primer to its complementary nucleic acid. As an example, the substrate may be a flow cell suitable for nucleic acid sequencing.

[0143] In certain embodiments, a nucleic acid amplification step such as PCR is not performed prior to step e). For example, the method may start with a tissue sample and end with fragments of gDNA from the sample bound to a sequencing flow cell via ligated adapters hybridized to immobilized primers, and no nucleic acid amplification step such as a PCR step is performed during this process. A PCR step can be included to amplify the target, but the inventors have surprisingly found that this is not a requirement of the method of the present invention. Excluding the amplification step can advantageously avoid introducing bias or sequence errors as a result of amplification. Thus, the method of the present invention excluding the amplification step can be used for whole-genome error-corrected sequencing.

[0144] Thus, in one embodiment, a method for preparing a library for nucleic acid sequencing is disclosed, the preparation including modifying the nucleic acid to be suitable for binding to a substrate comprising a first immobilized primer, the method comprising the following steps, in the recited order, wherein steps c) and d) can be combined: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adapter under ligation-promoting conditions, the non-hairpin adapter comprising a sequence complementary to the first immobilized primer; c) fragmenting the plurality of nucleic acids; d) exposing the plurality of nucleic acids to a hairpin adapter under ligation-promoting conditions, or exposing the plurality of nucleic acids to conditions under which a hairpin can be formed at the ends of the nucleic acid molecules; e) contacting the plurality of nucleic acids with a substrate under conditions suitable for hybridization of the nucleic acids complementary to the first immobilized primer; and No nucleic acid amplification step, such as PCR, is performed prior to step e). The non-hairpin adapter can be any of those disclosed herein, such as a Y-shaped adapter. The substrate can be any of those disclosed herein, such as a flow cell.

[0145] In an alternative embodiment, a method for preparing a library for nucleic acid sequencing is disclosed, the preparation including modifying the nucleic acid to be suitable for binding to a substrate comprising a first immobilized primer, the method comprising the following steps, in the recited order, wherein steps c) and d) can be combined: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a hairpin adapter under ligation-promoting conditions, or exposing the plurality of nucleic acids to conditions under which a hairpin can be formed at the ends of the nucleic acid molecules; c) fragmenting the plurality of nucleic acids; d) exposing a plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation, wherein the non-hairpin adapter comprises a sequence complementary to a first immobilized primer; e) contacting the plurality of nucleic acids with a substrate under conditions suitable for hybridization of the first immobilized primer to its complementary nucleic acid; comprising; Prior to step e), no nucleic acid amplification step, such as PCR, is performed. The non-hairpin adapter may be any of those disclosed herein, such as a Y-shaped adapter. The substrate may be any of those disclosed herein, such as a flow cell.

[0146] After step e), the method may further comprise contacting the hybridized nucleic acids with a polymerase under conditions suitable for extension of the immobilized primer to synthesize a nucleic acid that is a nucleotide strand complementary to the hybridized nucleic acid. The newly formed nucleic acid can then be amplified. In some embodiments, the primers for amplification are also immobilized on the substrate and may be suitable for, for example, bridge amplification. This process is known in the art and forms clusters of cloned nucleic acids. In other examples, the primers for amplification may be present in solution, for example, for embodiments where the substrate is beads. The amplified nucleic acids can then be sequenced by conventional methods, such as by synthesis-based sequencing. The non-hairpin adapter may include a site for the binding of sequencing primers to assist in this process. The non-hairpin adapter may also include an index.

[0147] Thus, in one embodiment, the method comprises f) further comprising obtaining sequence information for any nucleic acid hybridized to the substrate in step e).

[0148] In embodiments where step e) is not performed, sequence information can be obtained by sequencing a second library.

[0149] A method including a step of obtaining array information can be called a method for nucleic acid sequencing or a method for error-corrected nucleic acid sequencing. In such a method, the array information is derived from both strands of a part of a double-stranded nucleic acid. Thus, any errors introduced after the provision of the nucleic acid for sequencing can be corrected by comparing the sequence obtained for one strand with the sequence obtained for the other strand. Essentially, each part of the original nucleic acid sample is read twice, and each read is of an independent sequence. Thus, error correction of any mismatches that exist only in a single read becomes possible.

[0150] In one embodiment, the method is for identifying mutations. The method includes identifying as a mutation any change in a predicted sequence that matches on both strands of a DNA molecule, and not identifying as a mutation any change in a predicted sequence if the change does not match on both strands of the DNA molecule. Such a method may include a bioinformatics alignment of the sequence reads to a reference sequence to identify deviations from the expected sequence. The reference sequence may be a known sequence, such as the human genome reference sequence Human Build 38 patch release 14 (GRCh38.p14; Genome Reference Consortium) in the NCBI database, etc.

[0151] In certain embodiments, the method may be applied to gDNA obtained from a sample and may be for genome-wide unbiased error-corrected sequencing. In some embodiments, the method may be used to detect off-target effects of gene editing techniques. For example, the method may be used to detect off-target effects of CRISPR-Cas9 editing, TALEN editing, or any other method that changes the sequence of a nucleic acid.

[0152] Methods for sequencing nucleic acids such as immobilized nucleic acid clusters are known in the art. In some embodiments, the sequencing may involve the use of one sequencing primer or a plurality of sequencing primers. For example, embodiments of the non-hairpin adapters described herein may include a first hybridization site to which a first sequencing primer can bind, and step f) may involve the use of the first sequencing primer. In some embodiments, the non-hairpin adapters described herein may also include a second hybridization site to which a second sequencing primer can bind, and step f) may also involve the use of the second sequencing primer.

[0153] The sequencing may be next-generation sequencing or ultra-parallel sequencing.

[0154] In certain embodiments, a method for library preparation for nucleic acid sequencing is provided, the preparation including modifying the nucleic acid to be suitable for binding to a substrate comprising an immobilized primer, the method comprising a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a Y-shaped adapter under conditions that promote ligation to generate a first library, the Y-shaped adapter comprising a first strand comprising a sequence at least partially complementary to a first primer immobilized on a substrate and optionally a 3'-protecting feature; and a second strand comprising a sequence identical to at least one region of a second primer immobilized on a substrate and optionally a 5'-protecting feature; and; c) fragmenting the first library; and i) further comprising the step of selecting fragments of the plurality of nucleic acids based on size; d) exposing the selected fragments to a hairpin adapter under conditions that promote ligation to generate a second library, or exposing the plurality of nucleic acids to conditions under which a hairpin can be formed at the ends of the nucleic acid molecules; and.

[0155] In another embodiment, a method for preparing a library for nucleic acid sequencing is provided, the preparation including modifying the nucleic acid to be suitable for binding to a substrate containing an immobilized primer, the method comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a Y-shaped adapter under conditions that promote ligation to generate a first library, wherein the Y-shaped adapter comprises: a first strand comprising a sequence that is at least partially complementary to a first primer immobilized on a substrate and optionally a 3' protective feature; and a second strand comprising a sequence that is identical to at least one region of a second primer immobilized on a substrate and optionally a 5' protective feature; and; (combined steps) c) and d) exposing the first library to a hairpin adapter under conditions that promote ligation and fragmentation to generate a second library, optionally with tagging; and.

[0156] The above two embodiments may also be methods for obtaining sequence information from nucleic acids, the method comprising: e) denaturing the second library to generate single-stranded nucleic acids, contacting the single-stranded nucleic acids with a substrate under conditions suitable for hybridization to the complementary nucleic acids of the first immobilized primer, and optionally generating clusters of immobilized nucleic acids via bridge amplification, wherein the first and second immobilized primers act as primers for bridge amplification; f) obtaining sequence information for any nucleic acid hybridized to the substrate in step e); and further comprising.

[0157] In a second aspect, a nucleic acid library obtainable or obtained by any method of the first aspect of the present disclosure is provided. The library of the second aspect is referred to as the second library with respect to the first aspect of the present disclosure.

[0158] The nucleic acid library of the second aspect includes a nucleic acid for which sequence information is desired, which may be referred to as a target nucleic acid and may be DNA derived from a sample (or derived from said DNA). The DNA may be derived from a mammalian or human sample. The target nucleic acid may be a fragment of gDNA or may be derived from said gDNA.

[0159] The library includes a portion of a target nucleic acid having a ligated non-hairpin adapter as disclosed herein at one end and a ligated hairpin adapter at the other end. The non-hairpin adapter ligated to the nucleic acid of the library of the present invention may be any of those disclosed herein. In one embodiment, a portion of the target nucleic acid has a ligated Y-shaped adapter as disclosed herein at one end and a ligated hairpin adapter as disclosed herein at the other end. The Y-shaped adapter may be an Illumina Y-shaped adapter including a P5 binding sequence and a P7 binding sequence.

[0160] The present disclosure encompasses a library of the second aspect that is denatured to form a single strand such that the portion forming the hairpin forms a linker between the two strands of the target nucleic acid and the non-hairpin adapter is present as a 5'-terminal sequence and a 3'-terminal sequence.

[0161] In addition to the above species, the nucleic acid library of the second aspect may include a target nucleic acid having hairpins at both ends. Such species do not bind to the substrate and thus cannot be sequenced.

[0162] Compared to the prior art, the nucleic acid library of the second aspect has a reduced amount of target nucleic acid with non-hairpin adapters ligated to both ends. In some embodiments, the nucleic acid library does not contain or contains a substantially reduced amount of target nucleic acid with non-hairpin adapters ligated to both ends. Such species are sequenceable but not error-correctable, and thus, this reduction or avoidance of such species enables an improvement in sequencing accuracy. Further, this reduction may enable sequencing of the library without a prior amplification step, for example, it can enable sequencing of the library on a substrate without amplification prior to application to the substrate.

[0163] In an example, the library may contain less than 99.9 wt%, 99 wt%, 95 wt%, 90 wt%, 80 wt%, 70 wt%, 60 wt%, 50 wt%, 40 wt%, 30 wt%, 20 wt%, 10 wt%, 5 wt%, 3 wt%, 1 wt%, 0.1 wt%, or 0.01 wt% of target nucleic acid with non-hairpin adapters ligated to both ends.

[0164] Accordingly, in certain embodiments, a nucleic acid library is disclosed that includes a target nucleic acid having a non-hairpin adapter ligated to one end and a hairpin at the other end. The nucleic acid library does not contain, has a reduced amount of, or contains a substantially reduced amount of target nucleic acid having non-hairpin adapters ligated to both ends. This reduction may be in comparison to a library prepared in the same manner but where the first and second adapter ligation steps are performed simultaneously.

[0165] In particular, the nucleic acid library of the second aspect may be suitable for a sequencing method that includes contacting the library with a substrate to bind a portion of the library to the substrate. The non-hairpin adapter may include a sequence that is at least partially complementary to a first primer immobilized on the substrate. Thus, in one embodiment, i) a target nucleic acid having a non-hairpin adapter ligated to one end and a hairpin at the other end, wherein the non-hairpin adapter includes a sequence that is at least partially complementary to a first primer immobilized on the substrate, and optionally ii) a target nucleic acid having a hairpin at one end and a hairpin at the other end, and a nucleic acid library suitable for a sequencing method that includes contacting the library with a substrate to bind a portion of the library to the substrate is disclosed.

[0166] In a third aspect, a method of sequencing is disclosed, the method including obtaining sequence information about a nucleic acid in the library of the second aspect of the present disclosure.

[0167] In one embodiment, a method of obtaining sequencing information is disclosed, the method including 1) contacting the library of the second aspect of the present disclosure with a substrate comprising a first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid; and 2) obtaining sequence information about any nucleic acid hybridized to the substrate in step 1). and including.

[0168] Step 1) of the third aspect has the same features as step e) of the first aspect of the present disclosure. Step 2) of the third aspect has the same features as step f) of the first aspect of the present disclosure.

[0169] In one embodiment, a method of obtaining sequencing information is disclosed, the method including 1) contacting a nucleic acid library with a substrate comprising a first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid; and 2) obtaining sequence information for any nucleic acid hybridized to the substrate in step 1) and comprising the nucleic acid library a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation; c) fragmenting the plurality of nucleic acids; d) exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation, or exposing the plurality of nucleic acids to conditions under which a hairpin can be formed at the ends of the nucleic acid molecules and comprising wherein steps b) and d) are prepared or obtainable by a method in which they are performed separately.

[0170] As disclosed herein, the inventors have surprisingly found that amplification of nucleic acids from a sample prior to binding to the substrate is not a requirement for the methods of the invention.

[0171] Accordingly, in a fourth aspect, there is provided a method for preparing a library for nucleic acid sequencing, the method comprising i) providing a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation; iii) exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation, or exposing the plurality of nucleic acids to conditions under which a hairpin can be formed at the ends of the nucleic acid molecules and comprising wherein the nucleic acids are not amplified during library preparation.

[0172] The features disclosed in relation to step a) of the first aspect of the disclosure are also applicable to step i) of the fourth aspect.

[0173] The non-hairpin adapter of the fourth aspect may be any of those disclosed for the first aspect of the present disclosure. The non-hairpin adapter may include protective features and / or binding features disclosed in connection with the first aspect. The hairpin adapter of the fourth aspect may be any of those disclosed for the first aspect of the present disclosure. The conditions that allow the formation of a hairpin at the ends of the nucleic acid molecule may be any of those disclosed for the first aspect of the present disclosure.

[0174] The nucleic acid is not amplified during the preparation of the library according to the fourth aspect. For example, the PCR step is not performed.

[0175] In certain embodiments, the steps of the fourth aspect are performed in the order of i), ii), and then iii). In another embodiment, the steps of the fourth aspect are performed in the order of i), iii), and then ii). In certain embodiments, steps ii) and iii) are performed separately, and the fragmentation step is included between these steps. In another embodiment, the second ligation step may include fragmentation, for example, a tagmentation step. The features disclosed in connection with step c) of the first aspect of the present disclosure are also applicable to the fragmentation step of the fourth aspect.

[0176] The nucleic acid library produced by steps i), ii), and iii) may be referred to as the second library. Sequence information may be obtained from the second library. In one embodiment, the non-hairpin adapter includes a sequence that is at least partially complementary to a first primer immobilized on a substrate, and the method includes a step iv) of contacting the second library with a substrate comprising the first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid. The features disclosed in connection with step e) of the first aspect of the present disclosure are also applicable to step iv) of the fourth aspect. The features disclosed in connection with obtaining sequence information for the first aspect are also applicable to the fourth aspect. In these embodiments, the nucleic acid amplification step is not performed before step iv).

[0177] In a fifth aspect, a nucleic acid library obtainable or obtained by any method of the fourth aspect of the present disclosure is provided. The library of the fifth aspect is referred to as the second library with respect to the first aspect of the present disclosure.

[0178] The library of the fifth aspect does not contain amplified target nucleic acid. For example, the target nucleic acid has not been subjected to a PCR reaction. The remaining features of the library of the fifth aspect may be as disclosed for the second aspect of the present disclosure.

[0179] In a sixth aspect, a sequencing method is disclosed, which includes obtaining sequence information about the nucleic acids in the library of the fifth aspect of the present disclosure.

[0180] In one embodiment, a method for obtaining sequencing information is disclosed, the method comprising: 1) contacting the library of the fifth aspect of the present invention with a substrate comprising a first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid; 2) obtaining sequence information about any nucleic acid hybridized to the substrate in step 1). and includes.

[0181] Step 1) of the sixth aspect has the same features as step e) of the first aspect of the present disclosure. Step 2) of the sixth aspect has the same features as step f) of the first aspect of the present disclosure.

[0182] In a seventh aspect, a non-hairpin adapter is provided that includes, in the 5' to 3' direction, a first strand including a sequence at least partially complementary to the first immobilized primer and a 3' protecting moiety, and, in the 5' to 3' direction, a 5' protecting moiety and a sequence identical to at least one region of the second primer.

[0183] The non-hairpin adapter of the seventh aspect may include any sequence that is at least partially complementary to the first immobilization primer disclosed for the first aspect of the present disclosure. The non-hairpin adapter of the seventh aspect may include any sequence that is identical to at least one region of the second primer disclosed for the first aspect of the present disclosure. The sequence that is at least partially complementary to the first immobilization primer may be SEQ ID NO: 1 or SEQ ID NO: 3. The sequence that is identical to at least one region of the second immobilization primer may be SEQ ID NO: 2 or SEQ ID NO: 4. In one embodiment, the non-hairpin adapter includes at least 5, 10, 15, 16, 17, 18, 19, 20, or all 21 bases of SEQ ID NO: 1, and / or at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 2. In one embodiment, the non-hairpin adapter includes at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 3, and / or at least 5, 10, 15, 16, 17, 18, 19, or all 20 bases of SEQ ID NO: 4. The non-hairpin adapter may include any bases of SEQ ID NOs: 1 to 4 sufficient to enable hybridization to the complementary primer.

[0184] In certain embodiments, the non-hairpin adapter in the 5' to 3' direction, a first strand comprising SEQ ID NO: 5, optionally an index, SEQ ID NO: 1, and 3SPc3, and in the 5' to 3' direction, a second strand comprising a 5' block, SEQ ID NO: 2, optionally an index, and SEQ ID NO: 6 is a Y-shaped adapter. SEQ ID NOs: 1, 2, 5, and 6 may each include 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modification such as a substitution, deletion, or insertion. In one embodiment, the modification is a substitution.

[0185] In certain embodiments, the non-hairpin adapter in the 5' to 3' direction, a first strand comprising SEQ ID NO: 7, optionally an index, SEQ ID NO: 3, and 3SPc3, and In the 5' to 3' direction, a second strand comprising a 5' block, SEQ ID NO: 4, optionally an index, and SEQ ID NO: 8, and a Y-shaped adapter. SEQ ID NOs: 3, 4, 7, and 8 may each include 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modification such as a substitution, deletion, or insertion. In one embodiment, the modification is a substitution.

[0186] The 5' and 3' protective features may be any of those disclosed for the first aspect of the present disclosure.

[0187] In some embodiments, the non-hairpin adapter is a nucleic acid or includes a nucleic acid. In some embodiments, the non-hairpin adapter is DNA, RNA, and / or XNA or includes them. The non-hairpin adapter may include modified and / or unmodified nucleotides. In some embodiments, the non-hairpin adapter is double-stranded. In certain embodiments, the non-hairpin adapter includes double-stranded DNA. The non-hairpin adapter may be a Y-shaped adapter.

[0188] The non-hairpin adapter may include any 5' and / or any 3' binding features disclosed in connection with the first aspect of the present disclosure. The non-hairpin adapter may or may not include any index as disclosed for the first aspect of the present disclosure.

[0189] In certain embodiments, the non-hairpin adapter is a Y-shaped adapter that, in the 5' to 3' direction, includes a first hybridization site to which a first sequencing primer can bind, a sequence that is at least partially complementary to a first immobilization primer, and a first strand including a 3' protective feature, and, in the 5' to 3' direction, a 5' protective feature, a sequence identical to at least one region of a second primer, and a second strand including a second hybridization site to which a second sequencing primer can bind. Optionally, the first and second hybridization sites are at least partially complementary.

[0190] In an eighth aspect of the present invention, there is provided a kit comprising the non-hairpin adapter and the hairpin adapter of the seventh aspect of the present disclosure. The hairpin adapter may be any of those disclosed for the first aspect of the present disclosure.

[0191] [Table 1]

[0192] [Table 2A]

[0193] [Table 2B]

[0194] [Table 2C]

[0195] [Table 2D] [Examples]

[0196] (Example 1) DEDUCE-Seq Unbiased flow Cell Enrichment and Duplex Determination by Sequencing (DEDUCE-seq) uses full-length Y-shaped adapters to incorporate all the necessary DNA elements required for Illumina sequencing. However, the second hairpin adapter locks the oligos, ligates both strands, and thus retains duplex information as a linear molecule (Figure 1). Similar to the Duplex-seq method [Kennedy, S.R. et al., Detecting ultralow-frequency mutations by Duplex Sequencing. Nat Protoc, 2014.9(11):2586-606] that uses a tag-based system to retain duplex information, DEDUCE-seq utilizes DNA complementarity to distinguish true mutations from sequencing errors. However, DEDUCE-seq achieves this by physically linking both strands of the DNA duplex into a single sequenceable DNA molecule. Furthermore, the typical base calling accuracy of current sequencers has improved by at least an order of magnitude (up to 1 in 10 3 ) over the past decade, improving the theoretical limits at which variants can be called. By using redundant information from both DNA strands, only true mutations or variants are called on both strands of the duplex, while technical errors, which are present in only one of the two reads, can be excluded (Figure 1). This strategy is effective for very rare mutations (1×10 -6has been shown to significantly improve the accurate detection of (up to) [Salk, J. J., and S. R. Kennedy, Next-Generation Genotoxicology: Using Modern Sequencing Technologies to Assess Somatic Mutagenesis and Cancer Risk. Environ Mol Mutagen, 2020. 61(1): 135-151]. However, Duplex-seq relies on unique molecular identifiers (UMIs) and PCR amplification to achieve this [Kennedy, S. R. et al., Detecting ultralow-frequency mutations by Duplex Sequencing. Nat Protoc, 2014. 9(11): 2586-606]. Therefore, since this method is not PCR-free, the cost of sequencing is significantly increased, and its application is limited to targeted sequencing. However, DEDUCE-seq is designed to be PCR-free by design and instead uses an Illumina flow cell to concentrate DNA and is designed to be able to cost-effectively detect rare mutations genome-wide.

[0197] In the first example, the inventors use DEDUCE-seq to detect mutations from a previously conducted isogenic yeast experiment. In this project, a mutation survey of multiple yeast strains treated with UV irradiation was carried out, and then the cells were grown for approximately 1,200 generations to accumulate mutations. The mutations acquired during these experiments were measured using conventional WGS and variant calling. Therefore, due to the legacy data of this small-sized yeast genome, DEDUCE-seq can be utilized as a benchmark for in vivo mutation detection. Next, DEDUCE-seq is applied for the detection of mutations at novel off-target sites discovered by INDUCE-seq (WO2022 / 038291 A1). The CRISPR genome editing project is available for the detection of mutations in human cells. Using INDUCE-seq, the inventors discovered novel off-targets for very stringent guide RNAs and guide RNAs with very poor targeting, and DEDUCE-seq enabled the assay of both ends of this spectrum to evaluate mutagenesis at high-frequency and low-frequency off-target cleavage sites in human cells.

[0198] Method - Initial Design The inventors utilize genomic DNA from mutagenesis surveys conducted in yeast (see above). To establish a library preparation, the genomic DNA is fragmented to a size of approximately 600 - 800 bp. For the first ligation, a full-length Y-shaped adapter is used to incorporate all the adapter components necessary for sequencing (Figure 1). Next, the DNA is purified to remove excess adapter DNA and subjected to a second fragmentation to approximately 200 - 300 bp. DNA size selection, ligation success, and adapter DNA removal are all evaluated using capillary DNA electrophoresis. For the second ligation, the inventors use hairpin adapters to physically link the complementary strands of the DNA and fix the duplex information into a single sequenceable molecule (see Figure 1). Size selection and purification of this library DNA also remove excess hairpin adapter DNA. To verify ligation success, qPCR is used to quantify the sequenceable DNA fraction of the sample. This reveals that the adapter design shown in Figure 1 yields functional and sequenceable molecules. These pilot experiments are first performed on a small scale with paired-end sequencing. This confirms the success of the ligation strategy and reveals the general quality of the library. For this purpose, the inventors first sequence DNA from untreated cells (low mutation rate) and highly mutagenic cells (high mutation rate). Using preliminary data from these experiments, the development of a data analysis pipeline that utilizes duplex information is initiated. Next, the pilot DEDUCE-seq experiments are scaled up to more samples and higher coverage (approximately 100-fold) using a high-throughput sequencing platform (MiSeq v3 or NextSeq 550) to detect mutations in early and late generation yeast from (i) untreated wild-type cells, (ii) UV-irradiated wild-type cells, and (iii) cells with known mutator phenotypes. Finally, after these pilot experiments, the inventors apply DEDUCE-seq to the detection of mutations from a large cohort of yeast samples from the above-mentioned mutagenesis project previously conducted.The data generated hereafter can be used to evaluate the performance of DEDUCE-seq when compared to the original WGS performed at a coverage of approximately 10 - 25 fold. Once established, this method will be used to detect genome-wide mutations from CRISPR-Cas9 edited genomic DNA with low and high frequency off-targets measured by INDUCE-seq.

[0199] Methods - For Pilot 1 and Pilot 2 Genomic DNA Input To generate the DEDUCE-seq library, fragmented genomic yeast DNA was used as input. The genomic DNA sample was thawed and run on an automated electrophoresis system (Agilent TapeStation 2100, High Sensitivity D1000 ScreenTape) to assess size distribution and quality. Next, the DNA was quantified using Qubit-2 (ThermoFisher) using the High Sensitivity kit (Qubit™ dsDNA HS Assay Kit) and normalized to 200 - 250 ng per 50 μL in nuclease-free water (NFW).

[0200] Preparation of DEDUCE-seq Library Genomic DNA was prepared using single-sided size selection. First, fragments larger than 300 bp were removed with 0.6× (v / v) SPRI beads (CleanNGS, GCBiotech), and target DNA of 100 - 500 bp was maintained in the solution. In the second purification step, SPRI beads were added to a final concentration of 1.8× (v / v), and the DNA was eluted to a final volume of 25 μL of NFW. Next, the NEBNext® Ultra™ II End Repair / dA-Tailing Module (E7546L, New England Biolabs) was used to blunt-end and add an A-tail to the DNA at a final volume of 30 μL, and preparations were made for ligation using the NEBNext® Ultra™ II Ligation Module (E7595L, New England Biolabs). For the first ligation, Pilot 1 used 1.25 μL of 7.5 μM full-length Y-shaped adapter (P5 - P7), and Pilot 2 used 1.25 μL of 7.5 μM hairpin adapter. The total DNA was purified, and the remaining adapters were removed using 1.8× (v / v) SPRI beads, after which the DNA was eluted into 100 μL of NFW and prepared for sonication. The ligated DNA was subjected to re-sonication for 60 cycles (30 seconds on / off, high power) using a Bioruptor (Diagenode). For the second end prep and ligation preparation, the DNA was purified using 1.8× (v / v) SPRI beads, eluted into 25 μL of NFW, and reduced to a volume suitable for the NEBNext Ultra II module. The re-sonicated DNA was blunt-ended and A-tailed using the NEBNext® Ultra™ II End Repair / dA-Tailing Module (E7546L, New England Biolabs) and ligated as described above using the NEBNext® Ultra™ II Ligation Module (E7595L, New England Biolabs).In Pilot 1, 1.25 μL of 7.5 μM hairpin adapter was used, and in Pilot 2, 1.25 μL of 7.5 μM full-length Y-shaped adapter (P5 - P7) was used for the second ligation. After the second and final ligations, DNA was purified using 1.8× (v / v) SPRI beads and eluted in 28 μL of NFW. The final library was quantified using qPCR and tested on an automated electrophoresis system (Agilent TapeStation 2100, High Sensitivity D1000 ScreenTape) to evaluate size distribution and quality. Throughout the protocol, the size and quality of the library DNA were measured using electrophoresis, and adapter removal, re-sonication, and the final library were evaluated.

[0201] DEDUCE-seq Library Quantification The final DEDUCE-seq library DNA was diluted 50-fold with dilution buffer (10 mM Tris-HCl, pH 8.0, 0.05% Tween-20), and 4 μL of the diluted library DNA was subjected to qPCR in triplicate using a 20 μL final PCR reaction volume (KAPA Library Quantification Kit Illumina® Platforms). The library DNA was amplified using the cycling protocol recommended by the supplier's guidelines and quantified using the supplied tool to obtain the undiluted library concentration (μM).

[0202] Sequencing of the DEDUCE-seq Library The final DNA library was pooled to the relevant location and the final volume was reduced to 40 μL using a SpeedVac. Before loading onto the sequencing flow cell, the DEDUCE-seq library was prepared according to a modified denaturation protocol where 40 μL of freshly diluted 0.2 N NaOH was combined with the final library (40 μL) for 5 minutes at room temperature to denature the DNA. Next, the solution was neutralized using 40 μL of 200 mM Tris-HCl (pH 7). The resulting denatured library (120 μL) was supplemented with 1179 μL of pre-cooled HT1 and 1 μL of denatured and diluted PhiX control (20 pM). This 1.3 mL mixture was loaded onto a NextSeq cartridge for sequencing the entire volume.

[0203] Sequencing data processing The execution of sequencing was evaluated using Illumina's online BaseSpace utility or an offline sequence analysis viewer (SAV, Illumina). Read pass filters, base call quality (Q30), and cluster density were used as the first pass quality controls. Thereafter, the demultiplexed data was retrieved and prepared for downstream analysis as described below.

[0204] Secondary data analysis The demultiplexed sequencing data was downloaded from BaseSpace as FASTQ files. trim_galore (v0.6.7) was used to perform quality analysis on the reads and trim adapters with standard parameters. FASTQC was used to check the quality of the trimmed and untrimmed data. Standard command line tools GNU grep (3.7) and AWK (1.3.4) were used to query the data to search for HP-containing reads. Seqkit fq2fa was first used to convert the FASTQ files to FASTA format, and then the following commands were applied to calculate the exact positions of the hairpin sequences in reads 1 and 2.

[0205]

Number

[0206] The alignment of DEDUCE-seq data was performed using bowtie2 (2.5.1) in the following manner, using the default parameters for the exploratory analysis of aligning the matched read pairs and the default parameters for the unmatched DEDUCE-seq reads.

[0207]

Number

[0208] Here, the relevant unmapped reads and secondary alignments were removed using samtools (1.6).

[0209]

Number

[0210] The aligned data was converted to a BAM file using samtools (1.6) and visualized using the Integrated Genomics Viewer (2.14.1) (Robinson et al., 2011).

[0211] (Example 2) DEDUCE-Seq Pilot 1 and Pilot 2 The pilot study described in this specification was designed to establish the core elements of the DEDUCE-seq library and determine the most efficient ligation strategy. Accordingly, the inventors generated DEDUCE-seq libraries in which the hairpin was ligated first and the Y-shaped adapter was ligated second (Pilot 1), and vice versa (Pilot 2). In these studies, genomic yeast DNA was used to generate the DEDUCE-seq library. This DNA was previously used to measure mutations in studies designed to detect UV-induced mutations in isogenic yeast strains (Nandi et al., 2018), providing a suitable source of genomic DNA of known origin with a known mutation load. These samples were stored as fragmented DNA of approximately 200-300 bp and normalized to 4-5 ng / μL. First, for Pilot 1, two samples were processed in parallel and subjected to right-sided size selection to remove larger DNA fragments greater than 300 bp (data for one representative sample is shown). The starting DNA ranges from 100-500 bp (Figure 5, left panel).

[0212] Pilot 1 - Construction of DEDUCE-seq library with hairpin ligated first and Y-shaped adapter ligated second Next, the DNA was blunt-ended, A-tailed, and ligated with hairpin adapters using the NEBNext Ultra II kit. The ligated DNA was purified and checked on a TapeStation to confirm removal of the hairpin adapter DNA (Figure 5, middle panel, black trace). When the DNA was re-sonicated, the size distribution centered around ~200 bp shifted in the range of 75–500 bp (Figure 5, middle panel, gray trace). The end prep and ligation processes were repeated for the second Y-shaped adapter to obtain the final purified library shown in Figure 5 (right panel, gray trace). The final ligation did not result in a large shift in the size distribution. Residual Y-shaped adapters could be detected at 50 bp, and high molecular weight fragments were detected at ~900 bp after Y-shaped adapter ligation (Figure 5, right panel). Importantly, this is a known artifact of Y-shaped adapter ligation as shown as part of a previous paper on the Duplex-seq methodology using short Y-shaped adapters (Kennedy et al., 2014). This large fraction can be ignored without issue.

[0213] The final library contains a mixture of molecules, one fraction of which consists of functional DEDUCE-seq HP-Y adapter ligation fragments. The presence of the full-length P5-P7 hybrid Y adapter enables DEDUCE-seq library molecules to contain the constitutive primer binding sites required for quantification. Thus, the inventors applied qPCR to quantify sequenceable molecules in the final library preparation and measured library concentrations of 1.1 and 2.0 nM for Samples 1 and 2, respectively. Importantly, the high molecular weight artifacts shown in Figure 5 (right panel) do not contribute to the qPCR readout. Molecules with extremely high melting temperatures cannot be detected in these samples (data not shown). The final library is predicted to contain 190 to 355 million sequenceable molecules per μL of undiluted library at these concentrations for Samples 1 and 2, respectively. Thus, sequencing 1 μL of the library from Sample 2 on a NextSeq 500 High output 2×150bp flow cell resulted in 240 million reads, 96% of which passed the filter with a Q30 score of 93%. The success of the sequencing demonstrated that the HP-Y adapter ligation strategy of Pilot 1 yielded functional sequenceable molecules that could be quantified by qPCR and loaded onto a sequencer to generate clusters and reads proportional to the qPCR readout.

[0214] Pilot 1 - DEDUCE-seq data analysis where the hairpin was ligated first and the Y adapter was ligated second The design of the DEDUCE-seq library is non-standard and is predicted to result in discordant read pairs in the forward-forward (F1F2) or reverse-reverse (R2R1) orientation that not all aligners will accept as valid output. Similarly, depending on the insert length and trimming, concordant reads may arise from this library and not all aligners will accept them. Furthermore, the inventors found from preliminary alignment experiments that most reads aligned as concordant pairs (F1R2 or R1F2), and they hypothesized that these originated from the double Y-shaped adapter ligation products predicted as a minority of DEDUCE-seq outputs (data not shown). Thus, the inventors first evaluated the composition of the DEDUCE-seq sequencing reads by searching for hairpin-containing reads in an unbiased manner. Searching for hairpin-containing reads from Read1 and Read2 programmatically returned 33 and 44M reads (14 - 18.4%) respectively from a total of 237M reads (Table 2). When the genomic DNA insert size is larger than 150bp, not all double-stranded molecules are expected to contain the HP sequence in the reads. Interestingly, based on the basic positional information from this search, it became clear that most reads contain the HP sequence at the start of the read, while approximately 7.5M reads contain the HP sequence somewhere in the middle of the read. However, it is rare for the inventors to find the HP sequence at the very end of the read (Table 3).

[0215]

Table 3

[0216] Using this information, the inventors extracted all read pairs that contain the HP sequence in both R1 and R2 and elucidated the conformation of these molecules. Using this list of 9.5M read pairs, the inventors calculated the exact position of the hairpin sequence in each read and plotted the distribution of hairpin positions as a function of read length (<151bp).

[0217] For this class of reads, as shown in Table 2 (Table 3), the inventors found that approximately half contain hairpin DNA towards the start of the read. In the remaining reads, the HP sequences are evenly distributed over the read length. Next, the inventors collected 9.5M read pairs (4%) containing HP sequences and aligned them against the reference genome using bowtie2. Bowtie2 can handle discordant read pairs, aligning approximately 200 - 800 reads and enabling their inspection in a genome browser (Figure 7). This revealed that all of these reads had the correct double - parallel orientation (F1F2 and R1R2), as expected from the DEDUCE - seq library design. This allowed HP - containing reads to be aligned using bowtie2, confirmed to be in the correct orientation, and further clarified the relevant SAM flags (F1F2, SAM flags 67 - 133 and R2R1, SAM flags 115 - 179) that define these read pairs.

[0218] Using this information, the inventors aligned the entire 230M read dataset using the specific configuration of bowtie2 described above and filtered the correctly aligned DEDUCE - seq reads using the corresponding SAM flags. This resulted in approximately 120K reads with the expected DEDUCE - seq - specific orientation (Figure 7 and Table 3 (Table 4)), demonstrating that the combination of hairpin and Y - shaped adapter ligation results in a functional library. The results of this alignment are summarized in Table 4 (Table 5).

[0219]

Table 4

[0220]

Table 5

[0221] By forcing the alignment of DEDUCE-seq data through bowtie2 in this way, more than 190M read pairs were brought in as unmapped, which usually (based on SAM flags) results in concordant pairs (data not shown). Conversely, properly paired and mapped reads were classified into the correct classes of discordant parallel reads (F1F2 and R2R1), totaling 180K (Table 2).

[0222] DEDUCE-seq: Library construction, where the pilot 2 Y-shaped adapter is ligated first and the hairpin second Similar to pilot 1, the DEDUCE-seq library for pilot 2 was derived from the same genomic DNA. In this case, a total of 250 ng of DNA from four independent samples was size-selected to remove large DNA fragments (>500 bp) and prepared for ligation. In the first step, the full-length Y-shaped adapter was ligated to the DNA. After purification and removal of unligated Y-shaped adapters, the DNA was sonicated again for 60 cycles and purified. The DNA was processed through another round of end prep and ligation to attach the hairpin adapter, and then the DNA was purified and quantified using qPCR. The final library concentrations of these samples ranged from 2.8 to 8.3 pM.

[0223] Therefore, by preparing the DEDUCE-seq library by first ligating the Y-shaped adapter and then the hairpin adapter, a yield of sequence-determinable molecules that is approximately three orders of magnitude lower than the reverse order implemented in Pilot 1 is obtained. This demonstrates that the ligation efficiency between the Y-shaped adapter and the hairpin adapter is different, and the ligation order affects the yield of the DEDUCE-seq library. The estimated sequencing reads from the samples prepared in Pilot 2 range from 11 to 35 M. Therefore, the inventors pooled four samples together for a total of 73 M predicted reads and sequenced the pool on a NextSeq 500 High output 2×150bp flow cell. This sequencing run resulted in 38 million reads with 91% passing the filter with a Q30 score of 91%. Importantly, the DEDUCE-seq library generated here resulted in a lower sequencing output than expected from qPCR quantification. The original design of the DEDUCE-seq library constructed in this way facilitates flow cell enrichment of correctly ligated Y-shaped-DNA-hairpin products while simultaneously immobilizing unligated fragments in double hairpin ligation loops, rendering these molecules inactive. This theoretically improves the selective enrichment of sequence-determinable molecules on the flow cell.

[0224] DEDUCE-seq with Y-shaped adapter ligated first and hairpin ligated second in Pilot 2: Data analysis Based on the findings obtained from Pilot 1, the inventors used the same approach as above to collate hairpin-containing reads and calculate the position of the hairpin sequence in each read.

[0225]

Table 6

[0226] In summary, this returned reads from 420 - 470K from both the R1 and R2 containing hairpin sequences from a total of 38M reads (1.1 - 1.2%). Combining pairs where both reads contain the HP sequence left 200K read pairs (about 0.5%), of which 23K aligned to the reference genome (about 0.05%). The distribution of hairpin positions is shown in Figure 9. By ligating the hairpin adapter second, most of the HP sequences are located near the 3' or end of read 1 or read 2 as expected.

[0227] Importantly, this alignment was performed in the presence of non - coding hairpin sequences in reads 1 and 2 that are not present in the yeast reference genome and interfere with alignment. Trimming the hairpin DNA from these reads improves the alignment (data not shown).

[0228] Conclusion Combining the orientations of both the Y - shaped adapter and the HP adapter ligation of DEDUCE - seq gives parallel double - stranded molecules as designed for DEDUCE - seq.

[0229] Ligating the Y - shaped adapter first and the hairpin second, as done in Pilot 2, may be a preferred option to fully utilize the flow - cell enrichment of Y - shaped HP molecules properly formed from inactive double - hairpin molecules. However, this library strategy is less efficient compared to that applied in Pilot 1. In Pilot 1, the total library yield was high (nM) compared to Pilot 2 (pM).

Claims

1. A method for preparing a library for nucleic acid sequencing, comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation; c) fragmenting the plurality of nucleic acids; d) exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation, or exposing the plurality of nucleic acids to conditions that allow a hairpin to form at the ends of the nucleic acid molecules; wherein steps b) and d) are performed separately.

2. The method according to claim 1, wherein the plurality of nucleic acids are fragmented after the first adapter ligation step and before or as part of the second adapter ligation step.

3. The method according to claim 1, wherein the steps are sequentially performed in the order of a), b), c), d), or the steps are sequentially performed in the order of a), d), c), b), or the steps are performed in the order of step a), step b), and the combined steps c) and d), or the steps are performed in the order of step a), step d), and the combined steps c) and b).

4. The method according to any one of claims 1 to 3, wherein the non-hairpin adapter comprises a sequence that is at least partially complementary to a first primer immobilized on a substrate.

5. The method according to claim 4, wherein the sequence that is at least partially complementary to the first primer immobilized on the substrate comprises at least 5, 10, 15, 16, 17, 18, 19, 20, or all 21 bases of SEQ ID NO: 1, or at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO:

3.

6. The method according to any one of claims 1 to 5, wherein the non-hairpin adapter is a Y-shaped adapter.

7. The Y-shaped adapter comprises a first strand comprising a sequence that is at least partially complementary to a first primer immobilized on a substrate, and a second strand comprising a sequence that is identical to at least one region of a second primer The method according to claim 6.

8. The method according to claim 7, wherein said sequence that is identical to at least one region of the second primer comprises all of at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 bases of SEQ ID NO: 2, or all of at least 5, 10, 15, 16, 17, 18, 19, or 20 bases of SEQ ID NO:

4.

9. The non-hairpin adapter is in the 5' to 3' direction, a first strand comprising a first hybridization site to which a first sequencing primer can bind and a sequence that is at least partially complementary to the first immobilization primer, and in the 5' to 3' direction, a second strand comprising a sequence that is identical to a region of the second immobilization primer and a second hybridization site to which a second sequencing primer can bind The method according to any one of claims 1 to 8, which is a Y-shaped adapter.

10. The method according to any one of claims 1 to 9, wherein the non-hairpin adapter comprises 5' and / or 3' protecting features.

11. The method according to claim 10, wherein the non-hairpin adapter comprises a first strand comprising a 3' protecting feature and a second strand comprising a 5' protecting feature.

12. The non-hairpin adapter is in the 5' to 3' direction, a first strand comprising a first hybridization site to which a first sequencing primer can bind, a sequence that is at least partially complementary to the first immobilization primer, and a 3' protecting feature, and in the 5' to 3' direction, a second strand comprising a 5' protecting feature, a sequence that is identical to at least one region of the second primer, and a second hybridization site to which a second sequencing primer can bind The method according to any one of claims 1 to 11, which is a Y-shaped adapter.

13. The method according to any one of claims 1 to 12, wherein the plurality of nucleic acids are DNA.

14. The method according to claim 13, wherein the plurality of nucleic acids are genomic DNA (gDNA).

15. The method comprises e) contacting the plurality of nucleic acids with a substrate comprising a first immobilization primer under conditions suitable for hybridizing the first immobilization primer to a complementary nucleic acid. The method according to any one of claims 1 to 14, wherein the non-hairpin adapter comprises a sequence that is at least partially complementary to the first immobilized primer. **Claim 16** The method according to claim 15, wherein no nucleic acid amplification step is performed before step e). **Claim 17** The method according to claim 15 or claim 16, wherein the non-hairpin adapter comprises a sequence identical to at least one region of a second primer, and the second primer is immobilized on the substrate. **Claim 18** The method according to claim 17, wherein the first and second immobilized primers can act as a forward primer and a reverse primer for bridge amplification, and the method comprises bridge amplification. **Claim 19** The method according to any one of claims 15 to 18, wherein the substrate is a flow cell or beads. **Claim 20** The method according to any one of claims 15 to 19, comprising step f) of obtaining sequence information about any nucleic acid hybridized to the substrate in step e). **Claim 21** The method according to any one of claims 1 to 14, wherein after steps a), b), c), and d) are performed, the method further comprises obtaining sequence information from the prepared library. **Claim 22** A nucleic acid library obtainable or obtained by the method according to any one of claims 1 to 14. **Claim 23** A method of sequencing, comprising obtaining sequence information about a nucleic acid in the library according to claim 22. **Claim 24** A method of obtaining sequencing information, 1) contacting the library according to claim 22 with a substrate comprising a first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid; and 2) obtaining sequence information about any nucleic acid hybridized to the substrate in step 1). The method comprising. **Claim 25** Use of the nucleic acid library according to claim 22, or a nucleic acid library obtainable or obtained by the method according to any one of claims 1 to 14, in a nucleic acid sequencing method. **Claim 26** A method for preparing a library for nucleic acid sequencing, i) providing a plurality of nucleic acids; and ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions that promote ligation. (iii) exposing the plurality of nucleic acids to a hairpin adapter under conditions that promote ligation, or exposing the plurality of nucleic acids to conditions under which a hairpin can be formed at the ends of the nucleic acid molecules; and comprising a method wherein the nucleic acid is not amplified during the preparation of the library. **Claim 27** (iv) contacting the plurality of nucleic acids with a substrate comprising a first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid, wherein the non-hairpin adapter comprises a sequence that is at least partially complementary to the first primer immobilized on the substrate, the method according to claim 26, wherein the nucleic acid is not amplified prior to step (iv). **Claim 28** The method according to claim 27, wherein the non-hairpin adapter comprises a sequence that is identical to at least one region of a second primer, and the second primer is immobilized on the substrate. **Claim 29** The method according to claim 28, wherein the first and second immobilized primers can act as a forward primer and a reverse primer for bridge amplification, and the method comprises bridge amplification. **Claim 30** The method according to any one of claims 27 to 29, comprising obtaining sequence information for any nucleic acid hybridized to the substrate in step (iv). **Claim 31** The method according to any one of claims 26 to 30, wherein steps (ii) and (iii) are carried out separately, and the fragmentation step is carried out after step (ii) and before step (iii), or after step (iii) and before step (ii). **Claim 32** A nucleic acid library obtainable or obtained by the method according to claim 26. **Claim 33** A method of sequencing, comprising obtaining sequence information for a nucleic acid in the library according to claim 32. **Claim 34** A method of obtaining sequencing information, comprising 1) contacting the library according to claim 32 with a substrate comprising a first immobilized primer under conditions suitable for hybridizing the first immobilized primer to a complementary nucleic acid; and 2) obtaining sequence information for any nucleic acid hybridized to the substrate in step 1). comprising a method. **Claim 35** Use of the nucleic acid library according to claim 32, or a nucleic acid library obtainable or obtainable by the method according to claim 26, in a nucleic acid sequencing method.

Citation Information

Patent Citations

  • Systems and devices for sequence by synthesis analysis

    US20100111768A1

  • Systems, methods, and apparatuses to image a sample for biological or chemical analysis

    US8951781B2

  • Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing

    WO2013142389A1

  • Multilayer fluidic devices and methods for their fabrication

    WO2014142841A1

  • A method for the isolation of double-strand breaks

    WO2022038291A1