Nanoparticle and template-directed RIG-I agonist precursor composition and its use for cancer treatment

Abstract

Compositions and methods for treating cancer using a RIG-I agonist precursor comprising a single-stranded 5'-non-capped triphosphate or diphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA, optionally comprising a RIG-I agonist precursor and nanoparticles for targeted delivery of a radiolabel to the tumor microenvironment, are described herein. The present invention provides, for example, nanoparticles comprising a core-shell structure, wherein the shell comprises a RIG-I agonist precursor comprising a single-stranded 5'-non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA; and optionally, a radiolabel.

Description

Technical Field

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 356,449, filed June 28, 2022, which is incorporated herein by reference in its entirety.

[0002] Field of Disclosure The present disclosure relates to compositions, including nanoparticles, comprising RIG-I agonist precursors comprising single-stranded 5'-uncapped triphosphate antisense oligonucleotides having sequences complementary to endogenous miRNAs, formulations for decelerating tumor growth, and methods of treating cancers having solid tumors.

Background Art

[0003] Background of the Disclosure Cancer represents a continuing and significant threat to overall human health. The use of novel mechanisms for treating cancer represents a promising means of delivering therapeutic agents that meet an ongoing and urgent need for effective cancer treatment. Recent studies have shown that systemic delivery of synthetic RIG-I (retinoic acid-inducible gene I) agonists inhibits tumor growth. RIG-I senses short double-stranded RNAs having an uncapped 5'-triphosphate moiety, a common motif typically found in viral RNAs. RIG-I is expressed in a number of cell types, including tumor cells, and serves as a promising target for cancer treatment. Accordingly, it is an object of the present disclosure to provide compositions and methods for selectively activating RIG-I using a template-directed RIG-I agonist precursor in the tumor microenvironment, where radiolabeled nanoparticles can further treat and / or diagnose cancer. Therapeutic methods that utilize endogenous miRNAs as a means of activating RIG-I provide a very promising approach for targeting the tumor microenvironment and treating various related cancers.

[0004] The compositions and methods of the present disclosure use a formulation or composition comprising an effective amount of a RIG-I agonist precursor, which comprises a single-stranded 5'-non-capped triphosphate or diphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA, together with core-shell nanoparticles for the delivery of both the RIG-I agonist precursor and a radiolabel that targets the tumor microenvironment, to selectively activate RIG-I in a solid tumor microenvironment; a targeted two-sided approach for treating cancer is provided. The radiolabeled nanoparticles that deliver the RIG-I agonist precursor of the present disclosure, which target the tumor microenvironment, reduce off-target toxicity and enhance the effectiveness of activating RIG-I. Together with imaging methods, the use of radiolabeled nanoparticles comprising the RIG agonist precursor of the present invention provides important information regarding the optimization of dosage and administration schedules, real-time tumor quantification, tumor heterogeneity, and the pharmacokinetics and pharmacodynamics of therapeutic agents directly related to dynamic tumor changes. All of these parameters are important in predicting treatment response and identifying patients who are very likely to benefit from treatment. The compositions and methods of the present invention address these problems in the current treatment of cancer with solid tumors. SUMMARY OF THE INVENTION MEANS FOR SOLVING THE PROBLEM

[0005] SUMMARY OF THE INVENTION In certain embodiments, the present application relates to compositions and uses of a RIG-I agonist precursor comprising a single-stranded 5'-non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA. When an endogenous miRNA complementary sequence that forms a duplex and activates RIG-I is present, the RIG-I agonist precursor of the present disclosure forms a RIG-I agonist in situ / in vivo. The RIG-I agonist precursor binds to and hybridizes with miRNAs that are highly expressed in solid tumors or solid tumor microenvironments as compared to non-solid tumors or non-solid tumor microenvironments.

[0006] In certain embodiments, the RIG-I agonist precursor is bound (covalently or non-covalently) to nanoparticles having a core-shell structure. In certain advantageous embodiments, the nanoparticles further comprise a radiolabel. In certain embodiments, the activation of RIG-I can be further enhanced by co-administration (before, after, or simultaneously) with a single-stranded oligonucleotide sequence (e.g., an endogenous miRNA mimic sequence) complementary to a single-stranded 5'-non-capped triphosphate antisense oligonucleotide. In embodiments, the single-stranded oligonucleotide sequence complementary to the single-stranded 5'-non-capped triphosphate antisense oligonucleotide is also bound to the nanoparticles. In embodiments, the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In embodiments, the antisense oligonucleotide is selected from SEQ ID NOs: 1-13.

[0007] In certain embodiments, the nanoparticles comprise a core-shell structure where the shell comprises a polysaccharide such as one selected from the group consisting of dextran, alginate, chitosan, chitin, cellulose, hyaluronic acid (HA), amylose, amylopectin, carrageenan, and a polysaccharide polymer (pullulan) consisting of maltotriose units. In embodiments, the shell comprises an aminated polysaccharide coating agent. In an exemplary embodiment, the polysaccharide comprises dextran. In certain embodiments, the dextran comprises thiolated dextran, phosphorylated dextran or dextran sulfate. In certain embodiments, the core comprises a polymer, metal or metal ion, where the metal or metal oxide is selected from gold, iron, iron oxide, gold alloy, silver, zinc oxide, silicon dioxide (silica), platinum, copper, cobalt, indium, nickel, manganese oxide, calcium carbonate, calcium phosphate or combinations thereof, and the polymer is selected from sodium alginate, poly(lactic-co-glycolic acid) (PLGA) polymer, PLGA copolymer, polysaccharide, chitosan, polystyrene, polycaprolactone, or polyethylene glycol. In an exemplary embodiment, the core comprises iron oxide.

[0008] In advantageous embodiments, the nanoparticles comprise a radioactive label. In certain embodiments, the radioactive label is selected from an alpha emitter, a beta emitter or a gamma emitter. In embodiments, the radioactive label is selected from copper 64 (Cu-64), copper 67 (Cu-67), F-18, yttrium 90 (Y-90), scandium 44 (SC-44), cobalt 55 (co-55), niobium 90 (Nb-90), rhenium 186 (Re-186), rhenium 188 (Re-188), terbium 161 (Tb-161), lutetium 177 (Lu-177), bismuth 231 (Bi-213), lead 212 (Pb-212), actinium 225 (Ac-225), zirconium 89 (Zr), or any combination thereof. In certain embodiments, the radioactive label comprises copper 64 (Cu-64).

[0009] In certain embodiments, the nanoparticle comprises a chelating agent that is covalently linked to the nanoparticle core and to the radiolabel, and that is covalently linked to the nanoparticle core via a chemical moiety. In embodiments, the chelating agent comprises DOTA, DOTA-GA, p-SCN-Bn-DOTA, CB-TE2A, CB-TE1A1P, AAZTA, MeCOSar, p-SCN-Bn-NOTA, NOTA, HBED-CC, THP, MAS3, DFO, or any combination thereof. In certain embodiments, the chelating agent comprises 1,4,7-triazacyclononane,1-glutaric acid-4,7-acetic acid (NODAGA).

[0010] In embodiments, provided herein is a pharmaceutical formulation for slowing tumor growth in a subject, the pharmaceutical formulation comprising an effective amount the nanoparticles of the present disclosure comprising a RIG-I agonist precursor comprising a single-stranded 5'-non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA. In embodiments, the pharmaceutical formulation is formulated into a dosage form that is an injection, tablet, lyophilized powder, suspension, or any combination thereof.

[0011] In embodiments, provided herein is a pharmaceutical formulation for slowing tumor growth in a subject, the pharmaceutical formulation comprising an effective amount of a RIG-I agonist precursor comprising a single-stranded 5'-non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA. In embodiments, the formulation further comprises a single-stranded oligonucleotide sequence complementary to the single-stranded 5'-non-capped triphosphate antisense oligonucleotide.

[0012] Provided herein is a method for decelerating tumor growth in a subject in need thereof, comprising administering the pharmaceutical formulation of the present disclosure or the nanoparticle composition of the present disclosure. In other embodiments of the present disclosure, a method for treating a tumor in a subject in need thereof is provided, comprising administering the pharmaceutical formulation of the present disclosure or the nanoparticle composition of the present disclosure. In embodiments, the tumor is a primary tumor. In other embodiments, the tumor is a secondary tumor. In certain embodiments, administration of the pharmaceutical formulation or nanoparticle composition induces a rapid and long-term immune response against the tumor. The long-term immune response is generally characterized as lasting longer than about 1 week (e.g., 7 days) after treatment and is associated with acquired or memory immunity against the tumor. The rapid immune response is generally characterized as being induced within 24 hours, or within 1 to 2 days, after treatment and is associated with the innate immune system.

[0013] In embodiments, the tumor is selected from the group consisting of sarcoma and carcinoma. In certain embodiments, the tumor is bladder cancer, blood cancer, bone cancer, brain cancer, breast cancer, cervical cancer, colon cancer, kidney cancer, esophageal cancer, endometrial cancer, gastric cancer, glioblastoma, head and neck cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cancer, skin cancer, stomach cancer, thyroid cancer, and uterine cancer. The RIG-I agonist precursor of the present disclosure is not antigen-specific; rather, it activates RIG-I in the tumor microenvironment when a complementary miRNA sequence is present. In other words, the methods of the present disclosure can be used in a variety of tumor types that non-specifically activate the innate immune system and induce immune memory against a specific tumor (e.g., acquired immunity against tumor antigens). In embodiments, RIG-I activation elicits a tumor-specific immune response. In certain embodiments, the tumor-specific immune response includes type I IFN, DAMP (danger-associated molecular pattern), and / or the release of tumor antigens. In embodiments, the nanoparticles enhance the radiosensitivity of solid tumors. In embodiments, an effective amount of the RIG-I agonist precursor is an amount sufficient to reduce cancer cell invasion or metastasis in a subject. In certain embodiments, cancer cell metastasis is from a primary solid tumor to lymph nodes in the subject or from lymph nodes to secondary tissues in the subject.

[0014] In certain embodiments, treatment with an RIG-I agonist precursor is a monotherapy. In embodiments, the method further comprises administering additional supportive or adjuvant therapy. In embodiments, adjuvant therapy includes radiation therapy, cryotherapy, or ultrasound therapy; additional supportive or adjuvant therapy includes miRNAs complementary to the RIG-I agonist precursor; and / or additional therapeutic agents are selected from the group consisting of targeted therapy, chemotherapeutic agents, immunotherapeutic agents, immunogenic cell death inducers (ICDi), and siRNA therapy. In embodiments, chemotherapeutic agents are selected from the group consisting of cyclophosphamide, mechlorethamine, chlorambucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, valrubicin, paclitaxel, docetaxel, etoposide, teniposide, tafuriposide, azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, thioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, all-trans retinoic acid, vinblastine, vincristine, vindesine, vinorelbine, and bevacizumab. In certain embodiments, targeted therapies are selected from the group consisting of trastuzumab, gilotrif, proleukin, alectinib, campath, atezolizumab, avelumab, axitinib, belimumab, belinostat, bevacizumab, belotecan, canakinumab, ceritinib, cetuximab, crizotinib, dabrafenib, daratumumab, dasatinib, denosumab, elotuzumab, enasidenib, erlotinib, gefitinib, ibrutinib, zydelig, imatinib, lenvatinib, midostaurin, necitumumab, niraparib, obinutuzumab, osimertinib, panitumumab, regorafenib, rituximab, luxolitinib, sorafenib, tocilizumab, and trastuzumab.In certain embodiments, the immunotherapeutic agent is an immune checkpoint inhibitor optionally selected from the group consisting of pembrolizumab (Keytruda®), nivolumab (Opdivo®), atezolizumab (Tecentriq®), ipilimumab (Yervoy®), avelumab (Bavencio®), and durvalumab (Imfinzi®). In embodiments, supportive or adjuvant therapy is administered before, in conjunction with, or after administration of the modified RNA oligonucleotide.

[0015] In certain embodiments, provided herein are nanoparticles comprising a nanoparticle core, which may be radiolabeled, and a single-stranded 5′-non-capped triphosphate or diphosphate RNA oligonucleotide that is complementary to a miRNA and highly expressed in a solid tumor or solid tumor microenvironment compared to a non-solid tumor or non-solid tumor microenvironment. The radiolabel may be an alpha emitter, a beta emitter, or a gamma emitter. In certain embodiments, the radiolabel may have dual energy properties. In further embodiments, the radiolabel may be copper 64 (Cu-64), copper 67 (Cu-67), F-18, yttrium 90 (Y-90), scandium 44 (SC-44), cobalt 55 (co-55), niobium 90 (Nb-90), rhenium 186 (Re-186), rhenium 188 (Re-188), terbium 161 (Tb-161), lutetium 177 (Lu-177), bismuth 213 (Bi-213), lead 212 (Pb-212), actinium 225 (Ac-225), zirconium 89 (Zr), or any combination thereof. The radiolabel may be linked to the nanoparticle via a chelating agent covalently linked to the nanoparticle core and to the radiolabel. The chelating agent may be covalently linked to the nanoparticle core via a chemical moiety that is a secondary amine. In certain aspects, the chelating agent comprises 1,4,7-triazacyclononane, l-glutaric acid-4,7-acetic acid (NODAGA), DOTA, DOTA-GA, p-SCN-Bn-DOTA, CB-TE2A, CB-TE1A1P, AAZTA, MeCOSar, p-SCN-Bn-NOTA, NOTA, HBED-CC, THP, MAS3, DFO, or any combination thereof. In certain embodiments, the nanoparticle core comprises an iron oxide core and may further comprise a polymeric coating agent such as dextran. The nanoparticle core has a diameter of from about 10 nanometers (nm) to about 30 nm and is typically magnetic.

[0016] In other embodiments, the nanoparticles include RNA oligonucleotides covalently linked to the nanoparticle core via a chemical moiety containing a disulfide bond. The modified RNA oligonucleotides can form duplexes with miRNAs. The miRNAs are selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In certain embodiments, the miRNA is an oncogenic miRNA.

[0017] In embodiments, a method for generating a localized immune response, comprising administering to a subject a therapeutically effective amount of a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5′ non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment, thereby generating a localized immune response, is provided herein. In other embodiments, a method for treating a solid tumor in a subject, comprising administering to the subject a therapeutically effective amount of a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5′ non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment, thereby generating a localized immune response, is provided herein. In certain embodiments, a method for detecting, diagnosing, and / or monitoring the treatment of a solid tumor in a subject, comprising administering a radiolabeled nanoparticle of the present disclosure comprising a RIG-I agonist precursor comprising a single-stranded 5′ non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA, is also provided.

[0018] In an embodiment, a method for preparing a radiolabeled nanoparticle of the present disclosure comprising a RIG-I agonist precursor of the present invention, the method comprising: preparing a nanoparticle core; covalently linking a modified RIG-I agonist precursor to the nanoparticle core; covalently linking a chelating agent to the nanoparticle core by reacting the nanoparticle core with the chelating agent at a ratio of about 40 chelating agent equivalents per nanoparticle core; 64 adding a solution of CuCh to the nanoparticle core; and 64 purifying the mixture of the CuCh solution and the nanoparticle core to obtain a nanoparticle, is provided herein. In an embodiment, the nanoparticle comprises a polysaccharide shell. In certain embodiments, the polysaccharide is aminated and used to bind (covalently or non-covalently) the RIG-I agonist precursor oligonucleotide of the present disclosure. In an exemplary embodiment, the nanoparticle is prepared using an iron oxide core and a dextran shell. BRIEF DESCRIPTION OF THE DRAWINGS

[0019]

Figure 1

[0020]

Figure 2-1

Figure 2-2

[0021]

Figure 3-1

Figure 3-2

[0022]

Figure 4

[0023]

Figure 5-1

Figure 5-2

[0024]

Figure 6-1

Figure 6-2

[0025]

Figure 7

[0026]

Figure 8

[0027]

Figure 9

[0028]

Figure 10

[0029]

Figure 11

Figure 12

[0030] **Detailed Description of the Disclosure** **Introduction**

[0031] The present disclosure relates to the use of a RIG-I agonist precursor (the "RIG-I agonist precursor") comprising a single-stranded 5'-non-capped triphosphate or diphosphate antisense oligonucleotide that acts in a template-directed manner and has a sequence complementary to an endogenous (tumor) miRNA for forming a RIG-I agonist in vivo / in situ. Applicants have shown that the RIG-I agonist precursor of the present invention activates RIG-I in cancer cells and, when administered to solid tumors, induces a long-term immune response against the tumor in a murine model while slowing the growth of both primary and secondary tumors. See Examples 7 and 8. Accordingly, compositions comprising the RIG-I agonist precursor of the present invention and methods of using the same for treating a tumor (e.g., a solid tumor) and / or slowing its growth are provided herein.

[0032] In certain embodiments, provided herein is a pharmaceutical formulation for slowing the growth of a tumor in a subject, the pharmaceutical formulation comprising an effective amount of a RIG-I agonist precursor comprising a single-stranded 5'-non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA. In certain other embodiments, provided herein is a nanoparticle comprising a core-shell structure, the shell comprising a RIG-I agonist precursor comprising a single-stranded 5'-non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA. In certain other embodiments, provided herein are nanoparticles, formulations thereof, and methods of formulating the same, the nanoparticles comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, the oligonucleotide being complementary to a miRNA that is highly expressed in a solid tumor or a solid tumor microenvironment as compared to a non-solid tumor or a non-solid tumor microenvironment.

[0033] Overview

[0034] miRNA in Cancer

[0035] Small RNAs such as miRNAs exert their regulatory functions from within ribonucleoprotein complexes called RISC (RNA-induced silencing complexes). The core subunit of RISC is a small RNA bound to a member of the Argonaute family of proteins. Argonaute uses the small RNA as a guide to identify complementary target transcripts for silencing through various mechanisms. miRNAs are generally captured by the human Argonaute 2 protein (AGO2) and can regulate gene expression by base-pairing with complementary mRNA targets while associating with AGO2. The miRNA captured by AGO2 serves as a guide RNA to receive and hybridize with the complementary RNA target to form a double-stranded RNA duplex. Highly complementary RNA targets have been shown to facilitate the release of the guide RNA:target RNA duplex from AGO2.

[0036] Retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) are important RNA sensors that mediate the transcriptional induction of type I interferons and other genes that collectively establish the antiviral host response (Yong HY, Luo D. 2018;9:1379). RIG-I is expressed in substantially all cell types, including tumor cells, and is a promising alternative for enhancing the efficacy of immune checkpoint inhibitors (ICIs) (Heidegger S. et al., 2019. EBioMedicine. 41:146, Poeck H., et al. 2008. Nat. Med. 14:1256). Preclinical studies have shown that systemic delivery of synthetic RIG-I agonists inhibits tumor growth by a mechanism similar to that which induces the elimination of virus-infected cells (Poeck H., et al. 2008. 5'-triphosphate-siRNA: turning gene silencing and Rig-I activation against melanoma. Nat. Med. 14:1256). The involvement of RIG-I results in preferential tumor cell death (by intrinsic or extrinsic apoptosis and inflammasome-induced pyroptosis), as well as IFN-I-mediated activation of the innate and adaptive immune systems (see Figure 1 in Elion DL., et al. 2018. Oncotarget. 9:29007). The specific RIG-I agonist, RGT100, recently reported results from two Phase I trials, as a monotherapy (NCT03065023) and in combination with pembrolizumab (NCT03739138), and concluded that patients experienced acceptable safety but only minimal antitumor activity at the doses tested for RGT100 [Moreno., et al. 2022. Cancer Immunol Immunother; 71(12):2985-2998].

[0037] Although not bound by theory, the RIG-I pathway can be selectively activated in these cells by the in situ generation of 5’ppp-dsRNA following the introduction of miRNA (5’ppp anti-miRNA) or 5’ppp RNA complementary to mRNA that is specifically expressed in cancer cells, according to the methods and compositions of the present disclosure (Figure 1). Applicants have shown activation of RIG-I in HEK-Lucia RIG-I reporter cells and in melanoma cells using ss-ppp-miRNA-21 as a RIG-I agonist precursor. See Figure 2e and Examples 3 and 6-8 and Example 7. The same or similar selective activation of the RIG-I pathway is expected from 5’pp-dsRNA. As a result, the anti-tumor immune capacity of the tumor microenvironment (TME) can be revealed by activation of the RIG-I signaling pathway in combination with simultaneous activation of certain tumor suppressor gene(s) by simply using single-stranded RNA. See Figure 6.

[0038] The utility of the RIG-I agonist triphosphate RNA for melanoma treatment has recently been demonstrated (Helms MW. et al. 2019. Utility of the RIG-I Agonist Triphosphate RNA for Melanoma Therapy. Mol Cancer Ther. 2019;18(12):2343-2356). It is also noted that the similarity between the natural ligand of RIG-I, triphosphate RNA (5’ppp-dsRNA) (and 5’pp), and small interfering RNA (siRNA) has led to the development of bifunctional siRNAs for the simultaneous silencing of oncogenic or immunosuppressive targets and activation of the RIG-I signaling pathway (Poeck H., et al. 2008. Nat. Med. 14:1256, Ellermeier J. et al. 2013. 2013;73(6):1709-1720). The combined approach initiates an attack on two targets in tumor cells and shows promising results.

[0039] MicroRNA (miRNA) is a small non-coding RNA that can regulate various target genes. miRNA regulates gene expression at the post-transcriptional level by base pairing with the complementary sequence of messenger RNA (mRNA). This interaction leads to gene silencing by cleavage of the mRNA strand, destabilization of the mRNA by shortening of its poly-A tail, or inhibition of translation of the mRNA into protein. miRNA controls the expression of approximately 60% of protein-coding genes and regulates cell metabolism, proliferation, differentiation, and apoptosis (Huang Z, Shi J, Gao Y, et al. HMDD v3.0: a database for experimentally supported human microRNA-disease associations. Nucleic Acids Res. 2019;47(D1):D1013-D1017).

[0040] Under normal physiological conditions, miRNA functions in a feedback mechanism by protecting important biological processes including cell proliferation, differentiation, and apoptosis (Reddy, K.B., Cancer Cell International, 2015, 15:38). miRNA is expressed in various organs and cells and regulates both pro-inflammatory and anti-inflammatory effects. miRNA has been revealed as an important regulator of the inflammatory response in a wide range of human diseases (Tahamtan, A., et al., Front Immunol. 2018; 9: 1377).

[0041] Dysregulation of miRNA expression is associated with the manifestation of various diseases such as cancer. More than 50% of miRNA genes have been shown to be located in cancer-related genomic regions (Di Leva, G., et al., Annu Rev Pathol. 2014; 9():287-314). Dysregulation of miRNA has been shown to play a fundamental role in the initiation, progression, and seeding of several types of cancer. For example, miRNA dysregulation is known to be associated with chronic lymphocytic leukemia, and miR-15a and miR-16-1 have been shown to be downregulated or deleted in the majority of patients with chronic lymphocytic leukemia (Calin G.A., et al., Proc Natl Acad Sci USA; 2002; pp. 15524-15529). Other miRNAs such as miR-21, miR-26, and miR-29a have been shown to be preferentially expressed in cancer cells and / or the tumor cell microenvironment (Chakraborty, C., et al., Mol Ther Nucleic Acids. 2020 Jun 5; 20: 606-620). Therefore, therapeutic approaches targeting endogenous miRNAs provide a very promising strategy for treating various cancers associated with miRNA dysregulation by targeting the tumor microenvironment.

[0042] RIG-I-mediated RNA-induced immunogenic cell death

[0043] Retinoic acid-inducible gene I (RIG-I), a pattern recognition receptor, recognizes specific molecular patterns of viral RNAs to induce type I interferons. RIG-I consists of two N-terminal caspase activation and recruitment domains (CARDs), a central RNA helicase domain, and a C-terminal RNA-binding domain. The C-terminal domain (CTD) of RIG-I recognizes the 5'-ppp group of non-self RNAs, undergoes a conformational change, and induces IFN-β production (Lee, M., et al., Nucleic Acids Research, 2016, Vol. 44, No. 17). Structural and biochemical studies have shown that the RIG-I CTD can bind to blunt-ended dsRNAs containing 5'-ppp. Tests have shown that 5'-ppp dsRNA binds strongly to the RIG-I CTD and stimulates interferon production more efficiently compared to 5'-OH dsRNA (Pichlmair, A., et al., 2006, Science, 314, 997-1001; Vela, A., et al., 2012, J. Biol. Chem., 287, 42564-42573).

[0044] RIG-I-like receptor ligands have been used as promising strategies for the treatment of solid malignancies, including melanoma, pancreatic cancer, and breast cancer, in preclinical models. A major feature of RIG-I is its ubiquitous expression and the outcome of signal transduction, particularly the production of type I IFN and preferential tumor cell death, which are two important factors in a strong T cell response. Despite the potential success of the RIG-I approach, the immune system is powerful and incompletely understood, warranting careful optimism and thorough examination of the considerations associated with innate immune activation, including off-target induction of autoimmunity or induction of cytokine "storms" that can pose a threat to patient safety. Since RIG-I is expressed in many cells in the human body, it is important to note that the consequences of RIG-I activation are widespread and can drive symptoms such as fatigue, depression, and cognitive dysfunction.

[0045] In certain embodiments, the present disclosure presents a strategy for reducing potential side effects associated with RIG-I therapy by restricting RIG-I activation to the tumor microenvironment. Specifically, tumor-specific miRNAs are used as templates for the assembly of 5’ppp-dsRNA RIG-I agonists. To achieve this, the methods of the invention introduce exogenously supplied 5’ppp single-stranded oligonucleotides (“RIG-I agonist precursors”) (e.g., RNAs) that are complementary to endogenous miRNAs. The complementary miRNA (endogenous) and single-stranded 5’ppp oligonucleotide (RIG-I agonist precursor) hybridize to form a 5’ppp-dsRNA (“RIG-I agonist”) that promotes release from AGO2. The released 5’ppp-dsRNA RIG-I agonist facilitates potent activation of RIG-I signaling. This process using template-directed RIG-I agonist precursors confines RIG-I activation to cancer cells and essentially eliminates non-specific activation of the immune system elsewhere in the body. Further levels of specificity can be achieved by coupling the exogenously supplied single-stranded 5’ppp oligonucleotides to nanoparticle carriers that preferentially localize to the tumor microenvironment. As shown in Figure 1, substitution of the 5(p)pp-anti-mRNA or -miRNA approaches described herein for standard RNAi techniques for silencing target miRNAs or mRNAs promotes RIG-I activation that induces RIG-I signaling and cell death, thereby improving the outcome of treatment. In vivo, 5’(p)pp-anti-mRNA / miRNA hybridizes to the target mRNA or miRNA, silences it, binds to the RIG-I protein, resulting in the formation of 5’(p)pp-ds-mRNA / -miRNA that activates it, and can lead to RIG-I signaling and cancer cell death.

[0046] The Applicant has shown herein that the RIG-I agonist precursor of the present disclosure activates RIG-I in melanoma cells by forming a RIG-I agonist in situ, and that treatment with the RIG-I agonist precursor of the present invention decelerates the growth of primary and secondary tumors when delivered using nanoparticles. The compositions and methods of the present invention provide treatment for cancers having solid tumors and can be used to prevent secondary tumor formation by immune cell-mediated memory against tumors. See Examples 8 and 9.

[0047] Treatment and Diagnosis of Cancer Using Radiation-Inducible miRNA Expression

[0048] Radiation is used in approximately 50% of all cancer treatments with the aim of maximizing damage to tumors while minimizing damage to surrounding healthy tissues. Ionizing radiation damages cells mainly by inducing ionization and DNA damage. Gholami YH, et al. Sci Rep. 2019;9(1):14346. This DNA damage can directly or indirectly induce changes in the expression levels of miRNAs. Sriharshan A. J Proteomics Bioinform. 2014;07(10). Czochor JR, et al. 2014;21(2):293-312. Radiation-inducible miRNA expression can result in survival responses in cancer cells and can impede cancer-targeted therapies.

[0049] In certain embodiments, the present disclosure presents a strategy for treating cancer using radiation-induced miRNA expression by targeting tumor-specific miRNAs and increasing miRNA expression in cells that have taken up radiolabeled nanoparticles using targeted radiation. To achieve this, the methods of the invention introduce nanoparticles comprising a nanoparticle core, a radiolabel, and a single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide (also referred to herein as a "modified RNA oligonucleotide"). The modified RNA oligonucleotide is linked to the nanoparticle core and is complementary to miRNAs that are highly expressed in solid tumors or the solid tumor microenvironment as compared to non-solid tumors or the non-solid tumor microenvironment. As previously described, the modified RNA oligonucleotide hybridizes with the endogenous miRNA to form a 5'ppp double-stranded RNA that activates RIG-I signaling. This process confines RIG-I activation to cancer cells and essentially eliminates non-specific activation of the immune system elsewhere in the body.

[0050] For example, since miR10b is upregulated in many tumors with invasive and metastatic properties, miR10b may be a good target for the treatment of metastatic tumors. Kim J, et al. Cancer Research. 2016;76(21):6424-6435. However, not all metastases necessarily express miR10b, or they may express miR10b at lower levels. In such cases, administration of radiolabeled nanoparticles can be used to locally induce miRNA expression (e.g., miR10b expression). Specifically, radiolabeled nanoparticles containing modified RNA oligonucleotides can be taken up by cancer cells in a subject. Then, after imaging the subject to determine the location and number of cancer cells, radiation can be locally administered to the subject. Some cancer cells that have taken up the nanoparticles may already express the miR10b target before radiation, but radiation can increase miR10b expression among targeted cancer cells that either already express or do not express miR10b. Therefore, methods of treating cancer are provided herein by combining RIG-I-mediated immune activation against tumor cells while inhibiting miRNA or mRNA as needed (e.g., using modified RNA oligonucleotides that are complementary to endogenous miR21).

[0051] In addition to targeting cancer cells by RIG-I activation, the radiolabeled nanoparticles of the present application can also locally enhance the radiation-induced death of cancer cells. Specifically, in conventional external beam radiation therapy, the dose of radiation administered to cancer cells is often limited by the presence of vital organs near the treatment area. Gholami YH, et al. Sci Rep. 2019;9(1):14346. However, radiation from nanoparticles using external beam radiation therapy or internal radionuclide therapy has been shown to enhance the radiation dose to localized tumors. Ibid. Therefore, radiation from localized nanoparticles can increase the radiosensitivity of cancer by amplifying the effect of radiation within tumor cells.

[0052] Furthermore, the nanoparticles described herein can be used to detect, diagnose, and / or monitor cancer in a subject. Accordingly, the present application provides a new class of theranostic nanoparticles that simultaneously amplify radiation dose under clinical irradiation conditions, activate RIG-I, result in cell death, and thereby enable imaging contrast while improving treatment outcome.

[0053] 2. Definitions

[0054] The terms used herein generally have their ordinary meaning in the art, within the context of the present disclosure, and in the particular context in which each term is used. Certain terms are discussed below or elsewhere in the specification to provide further guidance to the practitioner in describing the compositions and methods of the present disclosure and the manner of making and using them. The scope or meaning of any use of a term is apparent from the particular context in which the term is used.

[0055] "About" and "approximately" generally mean an acceptable degree of error with respect to the measured quantity, taking into account the nature or accuracy of the measurement. Typically, the exemplary degree of error is within twenty percent (20%) of a given value or range of values, preferably within ten percent (10%), more preferably within five percent (5%).

[0056] Alternatively, and particularly in biological systems, the terms "about" and "approximately" may mean a value within one order of magnitude of a given value, preferably within five-fold, more preferably within two-fold. Quantities given herein are approximate unless otherwise stated, and mean that the term "about" or "approximately" can be inferred if not explicitly stated.

[0057] The terms "a" and "an" include plural referents unless the context in which the term is used clearly dictates otherwise. The terms "a" (or "an"), as well as the terms "one or more" and "at least one" can be used interchangeably herein. Further, as used herein, "and / or" shall be taken to mean each specific disclosure of two or more specified features or components, including or excluding the other. Thus, the term "and / or" as used in phrases such as "A and / or B" herein is intended to include "A and B", "A or B", "A only", and "B only". Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to include each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A only; B only; and C only.

[0058] The numerical ranges disclosed herein include the numbers defining the ranges.

[0059] The term "nucleic acid" means any single-stranded or double-stranded polynucleotide (e.g., DNA or RNA, cDNA of semi-synthetic or synthetic origin). The term "nucleic acid" includes oligonucleotides containing at least one modified nucleotide (e.g., containing a modification in the base and / or in the sugar) and / or a modification in the phosphodiester bond linking two nucleotides. In some embodiments, the nucleic acid may contain at least one modified ribose such as 2'-fluoro (2'-F). In some embodiments, the nucleic acid may contain a 5'-un-capped triphosphate or diphosphate. Non-limiting examples of nucleic acids are described herein. Further examples of nucleic acids are known in the art.

[0060] The nucleic acids disclosed herein may contain oligonucleotide sequences that do not occur naturally. Such variants will necessarily have less than 100% sequence identity or similarity to the starting molecule. In certain embodiments, the variant has, for example, over the length of the variant molecule, less than about 75% to less than 100%, more preferably less than about 80% to less than 100%, more preferably less than about 85% to less than 100%, more preferably less than about 90% to less than 100% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), most preferably less than about 95% to less than 100% amino acid sequence identity or similarity to the nucleic acid sequence of the starting (e.g., naturally occurring, or wild-type) oligonucleotide. In certain aspects, the oligonucleotide sequence is completely complementary to the target sequence. In other words, the double-stranded region formed by the oligonucleotide and its target exhibits a completely complementary sequence (i.e., without any base pair mismatches or gaps) when overhangs are not taken into account. In certain aspects, the oligonucleotide and the target sequence contain no more than 0 to 5 base pair mismatches in the double-stranded region.

[0061] The tumor-specific RNAs of the present disclosure may include microRNA (miRNA) or messenger RNA (mRNA). The miRNA or mRNA of the present disclosure may include oncogenic miRNA or mRNA. Oncogenic miRNA or mRNA is miRNA or mRNA that is thought to be involved in or associated with tumors / plural tumors and / or cancer.

[0062] The term "diamagnetic" is used to describe a composition having a relative magnetic permeability less than or equal to 1 and being repelled by a magnetic field.

[0063] The term "highly expressed" refers to a state where there is a measurable increase in expression beyond normal or baseline levels. For example, a molecule (e.g., miRNA) that is overexpressed in cancer appears at a measurably higher level in the presence of cancer than in its absence. Such an increase may be at least 2-fold, at least 3-fold, or even greater. In certain embodiments, a molecule (e.g., miRNA) that is overexpressed in cancer appears at a measurably higher level, such as an increase of at least 10%, 15%, 20%, 25%, 30%, 40% or 50% or greater, in the presence of cancer than in its absence.

[0064] The term "paramagnetic" is used to describe a composition that generates a magnetic moment only in the presence of an externally applied magnetic field.

[0065] The term "ferromagnetic" is used to describe a composition that is strongly affected by a magnetic field and can retain its magnetic properties (magnetic moment) even after the externally applied magnetic field is removed.

[0066] The term "nanoparticle" means an object having a diameter of about 2 nm to about 200 nm (e.g., 10 nm to 200 nm, 2 nm to 100 nm, 2 nm to 40 nm, 2 nm to 30 nm, 2 nm to 20 nm, 2 nm to 15 nm, 100 nm to 200 nm, and 150 nm to 200 nm). Non-limiting examples of nanoparticles include the nanoparticles described herein.

[0067] The term "magnetic nanoparticle" means a nanoparticle (e.g., any of the nanoparticles described herein) that is magnetic (as defined herein). Non-limiting examples of magnetic nanoparticles are described herein. Further magnetic nanoparticles are known in the art.

[0068] As used herein, the term "subject" or "patient" refers to any mammal (e.g., a human or veterinary subject such as a dog, cat, horse, cow, goat, sheep, mouse, rat, or rabbit) to which the compositions or methods of the present disclosure can be administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. A subject may be one seeking treatment, in need of treatment, requiring treatment, undergoing treatment, about to undergo treatment, or under the care of a trained professional for a particular disease or condition.

[0069] As used herein, the term "tumor" refers to an abnormal mass of tissue and / or cells in which the growth of the mass exceeds and is uncoordinated with the growth of normal tissue, and which includes both solid masses (such as in solid tumors) or fluid masses (such as in blood cancers) or any cancer cells found within the tumor. Tumors may be solid (e.g., lymphoma, sarcoma, or carcinoma) or non-solid (e.g., tumors of the blood, bone marrow, or lymph nodes, such as leukemia). Tumors can be defined as "benign" or "malignant" depending on the following characteristics: the degree of cell differentiation, including morphology and function, the rate of growth, local invasion, and metastasis. "Benign" tumors are well-differentiated, have a characteristically slower growth than malignant tumors, and may remain localized to the site of origin. Additionally, in some cases, benign tumors do not have the ability to infiltrate, invade, or metastasize to distant sites. "Malignant" tumors are poorly differentiated (anaplastic), have a characteristically rapid growth associated with progressive infiltration, invasion, and destruction of surrounding tissue. Additionally, malignant tumors may have the ability to metastasize to distant sites. Thus, cancer cells are cells found within an abnormal mass of tissue in which the growth is uncoordinated with the growth of normal tissue.

[0070] As used herein, the term "microenvironment" means any part or region of a tissue or body that has a definite or transient physical or chemical difference from other regions of the tissue or body.

[0071] As used herein, the term "tumor microenvironment" refers to the environment in which a tumor exists, which is the non-cellular region within the tumor and the region immediately outside the tumor tissue, but does not belong to the intracellular compartment of the cancer cells themselves. It also refers to the cells found within the tumor microenvironment, such as fibroblasts, endothelial cells, adipocytes, pericytes, neuroendocrine cells, or immune cells (such as macrophages, B cells, T cells, etc.) in the tumor microenvironment. The tumor and the tumor microenvironment are closely related and constantly interact. The tumor changes its microenvironment, and the microenvironment can affect how the tumor grows and spreads. Typically, the tumor microenvironment has a low pH in the range of 5.0 - 7.0, or 5.0 - 6.8, or 5.8 - 6.8, or 6.2 - 6.8. On the other hand, the normal physiological pH is in the range of 7.2 - 7.8. The tumor microenvironment is also known to have lower concentrations of glucose and other nutrients compared to plasma, but higher concentrations of lactate. Additionally, the tumor microenvironment can have a temperature that is 0.3 - 1 °C higher than the normal physiological temperature.

[0072] The term "non-tumor microenvironment" refers to the microenvironment at sites other than tumors.

[0073] The term "metastasis" refers to the secondary, non-adjacent tissue migration of cancer cells present in the primary tumor in a subject. Non-limiting examples of metastasis include metastasis from the primary tumor to lymph nodes (such as the regional lymph nodes), bone tissue, lung tissue, liver tissue, and / or brain tissue. The term "metastasis" also includes the migration of metastatic cancer cells found in lymph nodes to secondary tissues (such as bone tissue, liver tissue, or brain tissue). In some non-limiting embodiments, the cancer cells present in the primary tumor are breast cancer cells, colon cancer cells, kidney cancer cells, lung cancer cells, skin cancer cells, ovarian cancer cells, pancreatic cancer cells, prostate cancer cells, rectal cancer cells, stomach cancer cells, thyroid cancer cells, or uterine cancer cells. Further aspects and examples of metastasis are known in the art or described herein.

[0074] The term "primary tumor" refers to a tumor that is present at the anatomical site where tumor progression began, progressed, and resulted in a mass of cancer. In some embodiments, a physician may not be able to clearly identify the site of the primary tumor in a subject.

[0075] The term "metastatic tumor" refers to a tumor in a subject that originates from tumor cells that have metastasized from a primary tumor in the subject. In some embodiments, a physician may not be able to clearly identify the site of the primary tumor in a subject.

[0076] Preferred methods and materials are described herein, but methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the methods and compositions of the present disclosure. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0077] 3. Endogenous Tumor-Specific RNAs

[0078] Compositions and methods for eliciting an immune response with a composition comprising an oligonucleotide complementary to an endogenous tumor-specific RNA are described herein. In some embodiments, the present disclosure provides a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment as compared to a non-tumor or non-tumor microenvironment.

[0079] In some embodiments, the present disclosure provides a method for generating a localized immune response, the method comprising administering to a subject a therapeutically effective amount of a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment as compared to a non-tumor or non-tumor microenvironment, thereby generating a localized immune response.

[0080] In some embodiments, the present disclosure provides a method for treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment as compared to a non-tumor or non-tumor microenvironment, thereby generating a localized immune response.

[0081] In some embodiments, the present disclosure provides a method for detecting, diagnosing, and / or monitoring the treatment of cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment as compared to a non-tumor or non-tumor microenvironment, thereby generating a localized immune response.

[0082] In some embodiments, a single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to an endogenous tumor-specific RNA, the tumor-specific RNA is specific to tumor cells, and RIG-I is selectively activated in tumor cells that highly express the tumor-specific RNA. The endogenous tumor-specific RNA of the present disclosure can be selected from miRNA or mRNA. The endogenous tumor-specific RNA of the present disclosure can be further selected from oncogenic miRNA or oncogenic mRNA. Oncogenic miRNA or mRNA are miRNA or mRNA that are considered to be involved in cancer.

[0083] miRNAs have been shown to be components in many cancers and can provide new means for cancer treatment. The miRNAs of the methods and compositions of the present disclosure include, but are not limited to, miR-9; miR-10b; miR-17; miR-18; miR-19b; miR-21; miR-26a; miR-29a; miR-92a; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210; miR-210-3p; miR-221; miR-222; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; and miR-181 / 340. A complete list of sequences is available in OncomiRDB (Wang et al. Bioinformatics. 2014;30(15):2237-2238; mircancer.ecu.edu / browse.jsp; US20150004221A1); see also Tables 1 and 2).

[0084] An example of such a miRNA is miR-10b. Upregulation of miR-10b has been shown to be responsible for the migration and invasion of metastatic tumor cells and the viability of these cells (Tian Y., et al., J. Biol. Chem. 2010; 285:7986-7994). Analysis of miR-10b levels in 40 human esophageal cancer samples and their paired normal adjacent tissues showed an increase in miR-10b expression in 95% (38 out of 40) of the cancer tissues sampled (Tian Y., et al., J. Biol. Chem. 2010; 285:7986-7994). There are many other miRNAs that also play roles in carcinogenesis, the related targets; these, and other miRNAs, are potential new classes of targets for therapeutic inhibition (Nguyen DD, Chang S. Int J Mol Sci. 2017;19(1):65). For example, miR-21 has been shown to be involved in various cancer cells and tissues, not limited to glioblastoma, breast cancer, colorectal cancer, lung cancer, pancreatic cancer, skin cancer, liver cancer, stomach cancer, cervical cancer, and thyroid cancer, as well as various lymphomas, and hematopoietic cancers and neuroblastomas. miR-21 is a representative example of a single miRNA that targets multiple carcinogenic signaling cascades and causes global dysregulation of gene expression networks in cancer cells (Pan, X., et al., Cancer Biol. Ther. 2010; 10:1224-1232).Increased miR-21 expression has been shown to target various essential tumor suppressors such as phosphatase and tensin homolog (PTEN), PDCD4, RECK, and TPM1, facilitating cell proliferation, survival, metastasis, and acquisition of the chemoresistant phenotype (Meng, F., et al., Gastroenterology. 2007; 133:647-658; Peralta-Zaragoza O., et al., BMC Cancer. 2016; 16:215; Zhang, X., et al., BMC Cancer. 2016;16:86; Reis ST., et al., BMC Urol. 2012;12:14; Zhu S., et al., J. Biol. Chem. 2007;282:14328-14336).

[0085] miR-155 is epigenetically regulated by BRCA1 and is overexpressed in breast, ovarian, and lung cancers. miR-155 has been investigated as a potential biomarker for B-cell cancers. Overexpression of miR-155 blocks B-cell differentiation by downregulating the SHIP1 and C / EBPβ genes, leading to improved cell survival due to activation of the PI3K-Akt and MAPK pathways. In other cancers such as gliomas, overexpression of miR-155 promotes tumor progression through a negative correlation with caudal-type homeobox 1 protein (CDX1) expression in glioma tissues.

[0086] miR-210 is a well-established miRNA involved in various aspects of cancer development, progression, and metastasis. Increased miR-210 expression has been observed in both bone metastatic and non-bone metastatic prostate cancer tissues. Expression was found to be elevated in bone metastatic prostate cancer tissues compared to non-bone metastatic prostate cancer tissues, and it has been shown to promote epithelial-mesenchymal transition and bone metastasis of prostate cancer cells via the NF-κB signaling pathway (Ren D., et al., Mol Cancer. 2017; 16: 117). Other miRNAs such as miRNA-221 have been found to be upregulated in breast cancer, glioma, hepatocellular carcinoma, pancreatic adenocarcinoma, melanoma, chronic lymphocytic leukemia, and papillary thyroid carcinoma (Brognara E., et al., Int J Oncol. 2012 Dec;41(6):2119-27).

[0087] In some embodiments, the present disclosure provides a method for treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment compared to a non-tumor or non-tumor microenvironment, thereby generating a localized immune response. In some embodiments, the endogenous tumor-specific RNA is an oncogenic miRNA. In some embodiments, the endogenous tumor-specific RNA is not an oncogenic miRNA.

[0088] In some embodiments, the endogenous tumor-specific RNA is an miRNA selected from the group consisting of miR-9; miR-10b; miR-17; miR-18; miR-19b; miR-21; miR-26a; miR-29a; miR-92a; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210; miR-210-3p; miR-221; miR-222; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; and miR-181 / 340. In some embodiments, the endogenous tumor-specific RNA is miR-9. In some embodiments, the endogenous tumor-specific RNA is miR-10b. In some embodiments, the endogenous tumor-specific RNA is miR-17. In some embodiments, the endogenous tumor-specific RNA is miR-18. In some embodiments, the endogenous tumor-specific RNA is miR-19b. In some embodiments, the endogenous tumor-specific RNA is miR-21. In some embodiments, the endogenous tumor-specific RNA is miR-26a. In some embodiments, the endogenous tumor-specific RNA is miR-29a. In some embodiments, the endogenous tumor-specific RNA is miR-92a. In some embodiments, the endogenous tumor-specific RNA is miR-106b / 93. In some embodiments, the endogenous tumor-specific RNA is miR-125b. In some embodiments, the endogenous tumor-specific RNA is miR-130a. In some embodiments, the endogenous tumor-specific RNA is miR-155. In some embodiments, the endogenous tumor-specific RNA is miR-181a. In some embodiments, the endogenous tumor-specific RNA is miR-200s. In some embodiments, the endogenous tumor-specific RNA is miR-210. In some embodiments, the endogenous tumor-specific RNA is miR-210-3p. In some embodiments, the endogenous tumor-specific RNA is miR-221. In some embodiments, the endogenous tumor-specific RNA is miR-222. In some embodiments, the endogenous tumor-specific RNA is miR-221 / 222.In some embodiments, the endogenous tumor-specific RNA is miR-335. In some embodiments, the endogenous tumor-specific RNA is miR-498. In some embodiments, the endogenous tumor-specific RNA is miR-504. In some embodiments, the endogenous tumor-specific RNA is miR-1810. In some embodiments, the endogenous tumor-specific RNA is miR-1908. In some embodiments, the endogenous tumor-specific RNA is miR-224 / 452. In some embodiments, the endogenous tumor-specific RNA is miR-181 / 340.

[0089] In preferred embodiments of the present disclosure, the endogenous tumor-specific RNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the endogenous tumor-specific RNA is miR10b. In some embodiments, the endogenous tumor-specific RNA is miR17. In some embodiments, the endogenous tumor-specific RNA is miR18a. In some embodiments, the endogenous tumor-specific RNA is miR18b. In some embodiments, the endogenous tumor-specific RNA is miR19b. In some embodiments, the endogenous tumor-specific RNA is miR21. In some embodiments, the endogenous tumor-specific RNA is miR26a. In some embodiments, the endogenous tumor-specific RNA is miR29a. In some embodiments, the endogenous tumor-specific RNA is miR92a-1. In some embodiments, the endogenous tumor-specific RNA is miR92a-2. In some embodiments, the endogenous tumor-specific RNA is miR155. In some embodiments, the endogenous tumor-specific RNA is miR210. In some embodiments, the endogenous tumor-specific RNA is miR22.

[0090] In some embodiments, the endogenous tumor-specific RNAs highly expressed in tumor cells are selected from the group consisting of miR-9; miR-10b; miR-17; miR-18; miR-19b; miR-21; miR-26a; miR-29a; miR-92a; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210; miR-210-3p; miR-221; miR-222; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; and miR-181 / 340. In some embodiments, the tumor cells are associated with bone and non-bone metastatic cancers, breast cancer, glioma, hepatocellular carcinoma, pancreatic adenocarcinoma, melanoma, papillary thyroid cancer, glioblastoma, colorectal cancer, lung cancer, kidney cancer, pancreatic cancer, skin cancer, liver cancer, stomach cancer, cervical cancer, thyroid cancer, lymphoma, hematopoietic cancer, neuroblastoma, esophageal cancer, osteosarcoma, ovarian cancer, oral cancer, bladder cancer, adenoid cystic carcinoma, undifferentiated thyroid cancer, astrocytoma, meningioma, retinoblastoma.

[0091] In some embodiments, the tumor cells are associated with bone metastatic cancer. In some embodiments, the tumor cells are associated with non-bone metastatic cancer. In some embodiments, the tumor cells are associated with breast cancer. In some embodiments, the tumor cells are associated with glioma. In some embodiments, the tumor cells are associated with hepatocellular carcinoma. In some embodiments, the tumor cells are associated with pancreatic adenocarcinoma. In some embodiments, the tumor cells are associated with melanoma. In some embodiments, the tumor cells are associated with papillary thyroid cancer. In some embodiments, the tumor cells are associated with glioblastoma. In some embodiments, the tumor cells are associated with colorectal cancer. In some embodiments, the tumor cells are associated with lung cancer. In some embodiments, the tumor cells are associated with kidney cancer. In some embodiments, the tumor cells are associated with pancreatic cancer. In some embodiments, the tumor cells are associated with skin cancer. In some embodiments, the tumor cells are associated with liver cancer. In some embodiments, the tumor cells are associated with gastric cancer. In some embodiments, the tumor cells are associated with cervical cancer. In some embodiments, the tumor cells are associated with thyroid cancer. In some embodiments, the tumor cells are associated with lymphoma. In some embodiments, the tumor cells are associated with hematopoietic cancer. In some embodiments, the tumor cells are associated with neuroblastoma. In some embodiments, the tumor cells are associated with esophageal cancer. In some embodiments, the tumor cells are associated with osteosarcoma. In some embodiments, the tumor cells are associated with ovarian cancer. In some embodiments, the tumor cells are associated with oral cancer. In some embodiments, the tumor cells are associated with bladder cancer. In some embodiments, the tumor cells are associated with adenoid cystic carcinoma. In some embodiments, the tumor cells are associated with undifferentiated thyroid cancer. In some embodiments, the tumor cells are associated with astrocytoma. In some embodiments, the tumor cells are associated with meningioma. In some embodiments, the tumor cells are associated with retinoblastoma.

[0092] Numerous web-based tools are available for identifying microRNAs involved in human cancer. For a review, see Mar-Aguilar F, Rodriguez-Padilla C, Resendez-Perez D. Web-based tools for microRNAs involved in human cancer, Oncol Lett. 2016;11(6):3563-3570. Databases can be mined for miRNAs associated with a specific type of cancer, or for the behavior of a specific miRNA in different malignancies simultaneously, and the sequences of specific miRNAs can be readily retrieved from various databases. For example, miRCancer (mircancer.ecu.edu) is a database that stores records of miRNA-cancer associations collected by data mining. It devised a rule-based approach to analyze the titles and abstracts of 26,414 publications (2016) to find complete sentences or phrases containing miRNA and cancer type names, and any terms of interest. The results of this data mining process were then manually verified. miRCancer has over 3,764 miRNA-cancer association records from 2,611 publications, which translate to 236 miRNA expression profiles from 176 human cancers. miRCancer is freely accessible online and can be searched by miRNA name, cancer type, or a combination of both (Xie B, Ding Q, Han H, Wu D. miRCancer: a microRNA- cancer association database constructed by text mining on literature. Bioinformatics. 2013;29(5):638-644).

[0093] For example, by mining a database (December 16, 2020), miR-10b was found to be upregulated in 20 cancers including acute myeloid leukemia, bladder cancer, colorectal cancer, endometrial cancer, esophageal cancer, esophageal squamous cell carcinoma, gastric cancer, glioblastoma, glioma, hepatocellular carcinoma, lung cancer, malignant melanoma, medulloblastoma, nasopharyngeal carcinoma, non-small cell lung cancer, oral cancer, osteosarcoma, pancreatic cancer, and pancreatic ductal adenocarcinoma. Similarly, hsa-miR-101, hsa-miR-106a, hsa-miR-106b, hsa-miR-10b, hsa-miR-1207-5p, hsa-miR-1228, hsa-miR-1229, hsa-miR-1246, hsa-miR-125a, hsa-miR-125b, hsa-miR-1307-3p, hsa-miR-135a, hsa-miR-140, hsa-miR-141, hsa-miR-150, hsa-miR-150-5p, hsa-miR-153, hsa-miR-155, hsa-miR-17, hsa-miR-17-5p, hsa-miR-181a, hsa-miR-181b, hsa-miR-181b-3p, hsa-miR-182, hsa-miR-182-5p, hsa-miR-183, hsa-miR-183-5p, hsa-miR-18a, hsa-miR-18b, hsa-miR-191, hsa-miR-1915-3p, hsa-miR-196a, hsa-miR-197, hsa-miR-19a, hsa-miR-19b, hsa-miR-200a, hsa-miR-200a-3p, hsa-miR-200b, hsa-miR-200c, hsa-miR-203, hsa-miR-205, hsa-miR-205-5p, hsa-miR-206, hsa-miR-20a, hsa-miR-20b, hsa-miR-21, hsa-miR-214-3p, hsa-miR-217, hsa-miR-221, hsa-miR-222, hsa-miR-223, hsa-miR-224, hsa-miR-224-5p, hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-24-2-5p, hsa-miR-24-3p, hsa-miR-27a, hsa-miR-27b, hsa-miR-29a, hsa-miR-301a-3p,More than 100 miRNAs, including miR-10b, hsa-miR-3136-3p, hsa-miR-3188, hsa-miR-32, hsa-miR-330-3p, hsa-miR-346, hsa-miR-3646, hsa-miR-370, hsa-miR-372, hsa-miR-372-3p, hsa-miR-373, hsa-miR-374a, hsa-miR-376b, hsa-miR-378, hsa-miR-423, hsa-miR-429, hsa-miR-4469, hsa-miR-449a, hsa-miR-4513, hsa-miR-4530, hsa-miR-4732-5p, hsa-miR-494, hsa-miR-495, hsa-miR-498, hsa-miR-5003-3p, hsa-miR-503, hsa-miR-503-3p, hsa-miR-510, hsa-miR-520c, hsa-miR-520e, hsa-miR-520g, hsa-miR-526b, hsa-miR-544a, hsa-miR-645, hsa-miR-655, hsa-miR-660-5p, hsa-miR-665, hsa-miR-675, hsa-miR-761, hsa-miR-762, hsa-miR-9, hsa-miR-92a, hsa-miR-92a-3p, hsa-miR-93, hsa-miR-93-5p, hsa-miR-937, hsa-miR-944, hsa-miR-96, and hsa-miR-96-5p, have been found to be associated with breast cancer.,

[0094] The sequence of miR-10b or any sequence of interest can be retrieved from miRbase, the microRNA database (mirbase.org / ): >hsa-miR-10b-5p MIMAT0000254 UACCCUGUAGAACCGAAUUUGUG >hsa-miR-10b-3p MIMAT0004556 ACAGAUUCGAUUCUAGGGGAAU。

[0095]

Table 1-1

Table 1-2

Table 1-3

[0096]

Table 2-1

Table 2-2

[0097] The methods and compositions of the present disclosure can be extended to other RNA targets such as mRNA encoding proteins that promote cancer development. In some embodiments, the present disclosure provides a method for treating cancer, comprising administering a single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide, wherein the oligonucleotide is complementary to an endogenous tumor-specific RNA that is highly expressed in tumor cells as compared to non-tumor cells. In some embodiments, the present disclosure provides a method for treating cancer in a subject, comprising administering to the subject a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment as compared to a non-tumor or non-tumor microenvironment, thereby generating a localized immune response. In some embodiments, the present disclosure provides a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment as compared to a non-tumor or non-tumor microenvironment. In some embodiments, the endogenous tumor-specific RNA is mRNA. In some embodiments, the endogenous tumor-specific RNA is mRNA. In some embodiments, the endogenous tumor-specific RNA is not mRNA.

[0098] Some mRNAs are thought to be involved in cancer. The antisense strand of the mRNA containing the polyA tail can be generated from a DNA template by in vitro transcription and modified with 5’(p)pp. The 5’(p)pp-anti-mRNA sequence can be optimized to contain sequence elements that increase RNA stability. The anti-mRNA can be formulated with lipids to obtain an RNA-lipid nanoparticle formulation. In vivo, the 5’(p)pp-anti-mRNA can hybridize with the target mRNA, silence it, bind to the RIG-I protein, leading to the formation of 5’(p)pp-ds-mRNA that activates it, and result in RIG-I signaling and cancer cell death. See Table 3 for a list of exemplary mRNA transcripts.

[0099] [Table 3]

[0100] For example, survivin (also known as BIRC5), a well-known cancer therapeutic target, can be targeted using this approach. Survivin, a multi-regulator of the cell cycle and apoptosis, is overexpressed in all human cancers but shows low expression in normal tissues. The increased expression has been detected in 90% of primary breast cancers and correlates with poor clinical outcomes. Furthermore, an increase in survivin levels has been shown to be significantly associated with a negative hormone receptor status. Importantly, high levels of survivin have been detected in other cancers such as pancreatic cancer, which correlates with both cell proliferation and apoptosis, indicating a potential ubiquitous role for this anti-apoptotic marker. Considering the potential value of reducing or invalidating survivin expression as a means to overcome chemoresistance, the process of RNA interference (RNAi) can be shown to be valuable. Indeed, downregulation of BIRC5 by RNAi has shown promise in in vitro acute lymphoblastic leukemia, lung cancer, and cervical cancer as well as in vivo breast cancer (Ghosh SK, Yigit MV, Uchida M, et al. Sequence-dependent combination therapy with doxorubicin and a survivin-specific small interfering RNA nanodrug demonstrates efficacy in models of adenocarcinoma. Int J Cancer. 2014;134(7):1758-1766). Sequence-dependent combination therapy with doxorubicin and a survivin-specific small interfering RNA nanodrug demonstrates efficacy in models of adenocarcinoma.

[0101] The use of the current 5(p)pp-anti-mRNA approach instead of standard siRNA technology for silencing survivin promotes RIG-I signaling and RIG-I activation that induces cell death, thereby improving the outcome of treatment.

[0102] 4. Radioactively Labeled Nanoparticles Containing Modified RNA Oligonucleotides

[0103] In certain embodiments, the present disclosure relates to nanoparticles and their use. In certain embodiments, the nanoparticle comprises a nanoparticle core, a radioactive label, and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment as compared to a non-tumor or non-tumor microenvironment.

[0104] Oligonucleotides and Oligonucleotide Modifications

[0105] In certain embodiments, the nanoparticles provided herein comprise a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to a nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a tumor or tumor microenvironment as compared to a non-tumor or non-tumor microenvironment.

[0106] Exogenous RNA containing 5'-triphosphate (ppp) has been shown to induce immunogenic forms of cell death in different tumor entities (Elion, DL., et al Cancer Res. 2018 Nov 1; 78(21):6183-6195; Besch, R., et al, J Clin Investig. 2009;119:2399-411; Duewell, P., et al., Cell Death Differ. 2014;21:1825-37; Kuber, K., et al., Cancer Res. 2010;70:5293-304). 5'-diphosphate (5'pp) or 5'-triphosphate (5'ppp) modifications can be referred to herein as 5'pp and 5'ppp anti-miRNA / mRNA, respectively. 5'-ppp-RNA has been shown to induce cytokine release and promote an adaptive cellular immune response against tumor cells, along with the direct sensing of viral RNA by immune cells (Poeck, H., et al., Nat Med. 2008 Nov; 14(11):1256-63). The pattern recognition receptor RIG-I can bind to blunt-ended dsRNA containing non-capped 5'ppp or 5'pp. As disclosed herein, non-capped addition refers to RNA lacking a 5' cap structure consisting of 7-methylguanosine triphosphate linked to the 5' end of mRNA by a 5'→5' triphosphate bond. The present disclosure provides a method for selectively activating RIG-I in tumor cells, comprising administering a single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide, wherein the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to an endogenous tumor-specific RNA. The present disclosure also provides single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotides that are complementary to miRNAs highly expressed in tumor tissue compared to non-tumor tissue. The 5'-triphosphate structure is shown below: [Chemical formula]

[0107] In embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises an uncapped 5'-triphosphate. In embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises an uncapped 5'-diphosphate.

[0108] In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to an miRNA. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to an endogenous miRNA. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to an oncogenic miRNA selected from the group consisting of miR-9; miR-10b; miR-17; miR-18; miR-19b; miR-21; miR-26a; miR-29a; miR-92a; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210; miR-210-3p; miR-221; miR-222; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; and miR-181 / 340. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-9. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-10b. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-17. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-18. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-19b. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-21. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-26a.In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-29a. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-92a. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-106b / 93. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-125b. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-130a. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-155. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-181a. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-200s. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-210. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-210-3p. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-221. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-222. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-221 / 222. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-335.In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-498. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-504. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-1810. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-1908. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-224 / 452. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence complementary to miR-181 / 340.

[0109] In certain embodiments of the present disclosure, single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotides comprise sequences complementary to miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR10b. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR17. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR18a. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR18b. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR19b. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR21. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR26a. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR29a. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR92a-1. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR92a-2. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR155. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR210.In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence complementary to miR22.

[0110] In some embodiments, a single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a duplex with a miRNA. In preferred embodiments, the duplex comprises a 5'-blunt end. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a duplex with a miRNA selected from the group consisting of miR-9; miR-10b; miR-17; miR-18; miR-19b; miR-21; miR-26a; miR-29a; miR-92a; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210; miR-210-3p; miR-221; miR-222; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; and miR-181 / 340. In preferred embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a duplex with a miRNA selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide is capable of forming a duplex with the miRNA, and the duplex portion of the oligonucleotide is complementary to at least 10 consecutive nucleotides within the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 11 consecutive nucleotides within the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 12 consecutive nucleotides within the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 13 consecutive nucleotides within the miRNA. In some embodiments, the duplex portion of the oligonucleotide is complementary to at least 14 consecutive nucleotides within the miRNA.In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 15 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 16 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 17 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 18 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 19 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 20 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 21 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 22 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 23 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 24 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 25 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 26 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 27 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 28 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 29 consecutive nucleotides within the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is complementary to at least 30 consecutive nucleotides within the miRNA.In some embodiments, the double-stranded portion of the oligonucleotide is at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or at least 100% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 50% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 60% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 70% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 75% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 80% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 85% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 90% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide is at least 95% complementary to the miRNA. In a preferred embodiment, the double-stranded portion of the oligonucleotide is at least 100% complementary to the miRNA. In some embodiments, the double-stranded portion of the oligonucleotide contains 0 to 5 mismatched base pairs. In some embodiments, the double-stranded portion of the oligonucleotide contains less than 5 mismatched base pairs. In some embodiments, the double-stranded portion of the oligonucleotide contains less than 4 mismatched base pairs. In some embodiments, the double-stranded portion of the oligonucleotide contains less than 3 mismatched base pairs. In some embodiments, the double-stranded portion of the oligonucleotide contains less than 2 mismatched base pairs. In some embodiments, the double-stranded portion of the oligonucleotide contains less than 1 mismatched base pair. In a preferred embodiment, the double-stranded portion of the oligonucleotide does not contain mismatched base pairs.

[0111] In some embodiments, a single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide can form a duplex with a miRNA, compete with endogenous mRNA, and bind to the miRNA. In some embodiments, the duplex is not cleaved by AGO2. In some embodiments, the duplex activates RIG-I. In some embodiments, the RIG-I activation is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, or 200% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 20% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 25% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 30% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 35% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 40% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 45% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 45% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 50% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 55% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 60% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide.In some embodiments, the RIG-I activation is at least 65% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 70% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 75% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 80% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 85% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 90% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 95% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 100% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 110% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 120% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 130% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 140% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 150% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation is at least 200% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In preferred embodiments, the RIG-I activation elicits a tumor-specific immune response.

[0112] Oligonucleotides linked to the nanoparticle core may include modifications. As disclosed herein, modifications may include chemical modifications, additions, deletions, substitutions, or manipulations of the nucleic acid phosphate backbone, nucleic acid sugar, nucleic acid base, and / or the 5' or 3' terminus of the oligonucleotide. Oligonucleotides, particularly those implemented in therapeutic agents or as therapeutic agents, are generally modified in the phosphate backbone and / or ribose sugar to increase nuclease resistance and enhance affinity for the target RNA. Phosphorothioate (PS) backbone modifications replace non-bridging oxygen atoms with sulfur atoms, extending the half-life of oligonucleotides in plasma from minutes to days. Enhanced protein binding has also been reported for oligonucleotides with PS modifications compared to those with phosphodiester (PO) bonds. Further improvements in nuclease stability and binding affinity of oligonucleotides for target RNA can be obtained by 2'-ribose modifications such as 2'-O-methyl, 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), 2',4'-constrained 2'-O-ethyl (cEt), and locked nucleic acid (LNA). The position of 2'-modifications within the oligonucleotide sequence can further affect protein-oligonucleotide interactions.

[0113] In certain embodiments, a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide is complementary to an endogenous tumor-specific RNA that is highly expressed in tumor cells compared to non-tumor cells. In certain embodiments, a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a sequence that is complementary to an endogenous tumor-specific RNA. In some embodiments, a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises other modifications.

[0114] In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide further comprises a 2'-fluoro (2'-F) ribose modification. In some embodiments, the 2'-F ribose modification is present when the corresponding base is cytosine or uracil. In some embodiments, the 2'-F ribose modification is present at the 10th or 11th nucleotide from the 5' end of the modified RNA oligonucleotide. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide further comprises a phosphorothioate (PS) backbone modification. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide further comprises a 2'-fluoro (2'-F) ribose modification and a phosphorothioate (PS) backbone modification.

[0115] In preferred embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide does not contain any other modifications. In preferred embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide does not contain any modification selected from the group consisting of 2'-O-methyl (2'-OMe) ribose modification, N6-methyladenosine (m6A), pseudouridine (Ψ), N1-methylpseudouridine (mΨ), N1-methylpseudouridine (mΨ), 5-methyl-cytidine (5mC), 5-hydroxymethyl-cytidine (5hmC), or 5-methoxycytidine (5moC). In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide does not contain a 2'-O-methyl (2'-OMe) ribose modification. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide does not contain N6-methyladenosine (m6A). In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide does not contain pseudouridine (Ψ). In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide does not contain N1-methylpseudouridine (mΨ). In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide does not contain 5-methyl-cytidine (5mC). In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide does not contain 5-hydroxymethyl-cytidine (5hmC). In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide does not contain 5-methoxycytidine (5moC).

[0116] In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises one or more modifications. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises one or more modifications selected from the group consisting of phosphorothioate (PS) backbone modification, 2'-O-methyl (2'-OMe) ribose modification, N-6-methyladenosine (m6A), pseudouridine (Ψ), N-1-methylpseudouridine (mΨ), 5-methyl-cytidine (5mC), 5-hydroxymethyl-cytidine (5hmC), or 5-methoxycytidine (5moC). In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a 2'-O-methyl (2'-OMe) ribose modification. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises N-6-methyladenosine (m6A). In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises pseudouridine (Ψ). In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises N-1-methylpseudouridine (mΨ). In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises 5-methyl-cytidine (5mC). In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises 5-hydroxymethyl-cytidine (5hmC). In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises 5-methoxycytidine (5moC).

[0117] In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide comprises a sequence that is at least 10 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 15 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 16 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 17 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 18 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 21 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 22 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 23 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 24 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 25 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 26 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 27 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 28 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 29 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 30 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is at least 50 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15 to 50 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15 to 30 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15 to 29 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15 to 28 nucleotides in length.In some embodiments, the oligonucleotide comprises a sequence that is 15 to 27 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15 to 26 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 15 to 25 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16 to 50 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16 to 30 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16 to 29 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16 to 28 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16 to 27 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16 to 26 nucleotides in length. In some embodiments, the oligonucleotide comprises a sequence that is 16 to 25 nucleotides in length.

[0118] 5’pp and 5’ppp anti-miRNA / mRNA comprise a sequence that is complementary to at least 10 (e.g., at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23) consecutive nucleotides within the miRNA or mRNA. Exemplary miRNAs include, for example, miR-9; miR-10b; miR-21; miR-106b / 93; miR-125b; miR-130a; miR-155; miR-181a; miR-200s; miR-210-3p; miR-221 / 222; miR-335; miR-498; miR-504; miR-1810; miR-1908; miR-224 / 452; or miR-181 / 340 (see, e.g., Table 1 of Nguyen and Chang, Int J Mol Sci. 2017;19(1):65) and those listed in Tables 1 and 2 herein. Exemplary mRNAs include those listed in Table 2 herein.

[0119] In certain embodiments, the nanoparticles comprise single-stranded 5'-non-capped triphosphate-modified RNA oligonucleotides. In certain embodiments, the nanoparticles comprise single-stranded 5'-non-capped diphosphate-modified RNA oligonucleotides. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotides comprise a nucleic acid sequence that is at least 75% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotides comprise a nucleic acid sequence that is at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotides comprise a nucleic acid sequence that is at least 80% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotides comprise a nucleic acid sequence that is at least 85% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotides comprise a nucleic acid sequence that is at least 90% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotides comprise a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotides comprise a nucleic acid sequence that is at least 97% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13.In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 98% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 99% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is 100% identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide consists of a nucleic acid sequence that is identical to a nucleic acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13.

[0120] In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 8.In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotide comprises a nucleic acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 13.

[0121] In some embodiments, a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide (the "modified RNA oligonucleotide") is attached to the nanoparticle core. In certain embodiments, the nanoparticle comprises up to 40 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 35 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 30 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 25 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 20 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 15 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 10 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 9 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 8 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 7 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 6 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 5 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 4 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 3 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises up to 2 different modified RNA oligonucleotides. In certain embodiments, the nanoparticle comprises 1 modified RNA oligonucleotide.

[0122] In some embodiments, a single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide is attached to a nanoparticle core (e.g., the polymer coating agent of the nanoparticle core) via a chemical moiety containing a thioether bond or a disulfide bond. In some embodiments, a single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide is attached to a nanoparticle core via a chemical moiety containing an amide bond. Additional chemical moieties that can be used to covalently link a nucleic acid (e.g., a single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide) to a nanoparticle core are known in the art.

[0123] Nucleic acids (e.g., single-stranded 5'-uncapped triphosphate or diphosphate modified RNA oligonucleotides) can be covalently linked to the nanoparticle core using a variety of different methods. Non-limiting examples of methods that can be used to link nucleic acids to the nanoparticle core are described in EP0937097; US RE41005; Lund et al., Nucleic Acid Res. 16: 10861, 1998; Todt et al., Methods Mol. Biol. 529:81-100, 2009; Brody et al., J. Biotechnol. 74:5-13, 2000; Ghosh et al., Nucleic Acids Res. 15:5353-5372, 1987; U.S. Patent No. 5,900,481; U.S. Patent No. 7,569,341; U.S. Patent No. 6,995,248; U.S. Patent No. 6,818,394; U.S. Patent No. 6,811,980; U.S. Patent No. 5,900,481; and U.S. Patent No. 4,818,681 (each incorporated by reference in its entirety). In some embodiments, carbodiimide is used for the terminal attachment of nucleic acids to the nanoparticle core. In some embodiments, the nucleic acid is attached to the nanoparticle core by reaction of one of its bases with an activated moiety present on the surface of the nanoparticle core (e.g., reaction of an electrophilic base with a nucleophilic moiety on the surface of the nanoparticle core, or reaction of a nucleophilic base with an electrophilic residue on the surface of the nanoparticle core). In some embodiments, 5'-NEE modified nucleic acids are attached to nanoparticle cores containing CNBr-activated hydroxyl groups (see, e.g., Lund et al., supra). Further methods for attaching amino-modified nucleic acids to the nanoparticle core are described below. In some embodiments, 5'-phosphate nucleic acids are attached to nanoparticle cores containing hydroxyl groups in the presence of carbodiimide (see, e.g., Lund et al., supra). Other methods for attaching nucleic acids to the nanoparticle core include carbodiimide-mediated attachment of 5'-phosphate nucleic acids to NEE groups on the nanoparticle core, and carbodiimide-mediated attachment of 5'-NEE nucleic acids to nanoparticle cores having carboxyl groups (see, e.g., Lund et al., supra).

[0124] In an exemplary method, nucleic acids containing reactive amine or reactive thiol groups can be produced. The amine or thiol in the nucleic acid can be linked to another reactive group. Two general strategies for performing this reaction are to link the nucleic acid to similar reactive moieties (amine to amine, or thiol to thiol), called homobifunctional ligation, or to link the nucleic acid to opposing groups (amine to thiol, or thiol to amine), known as heterobifunctional ligation. Both techniques can be used to bind the nucleic acid to the nanoparticle core (see, for example, Misra et al., Bioorg. Med. Chem. Lett. 18:5217-5221, 2008; Mirsa et al., Anal. Biochem. 369:248-255, 2007; Mirsa et al., Bioorg. Med. Chem. Lett. 17:3749-3753, 2007; and Choithani et al., Methods Mol Biol. 381:133-163, 2007).

[0125] In particular, conventional conjugation techniques for amine groups have relied on homo-bifunctional linkages. One of the most common techniques was the use of bisaldehydes such as glutaraldehyde. Covalent bonds between nucleic acids and nanoparticle cores can also be generated using disuccinimidyl suberate (DSS), which was marketed by Syngene (Frederick, MD) as Synthetic Nucleic Acid Probe (SNAP) technology, or p-phenylenediisothiocyanate reagents. N,N'-o-phenylenedimaleimide can be used to crosslink thiol groups. Any homo-bifunctional crosslinker can be used to first activate the nucleic acid and then add it to the nanoparticle core (see, for example, Swami et al., Int. J. Pharm. 374: 125-138, 2009, Todt et al., Methods Mol. Biol. 529:81-100, 2009, and Limanskii, Biofizika 51:225-235, 2006).

[0126] Heterobifunctional linkers can also be used to attach nucleic acids to nanoparticle cores. For example, N-succinidimidyl-3-(2-pyridyldithio)propionate (SPDP) is first linked to a primary amine to obtain a dithiol-modified compound. This can then be reacted with a thiol to exchange the pyridylthiol for the subsequent thiol (see, for example, Nostrum et al., J. Control Release 15; 153(1): 93-102, 2011, and Berthold et al., Bioconjug. Chem. 21: 1933-1938, 2010).

[0127] An alternative approach regarding the use of thiols was the thiol exchange reaction. When thiolated nucleic acids are introduced onto disulfide nanoparticle cores, a disulfide exchange reaction can occur that results in nucleic acids covalently bound to the nanoparticle core by disulfide bonds. A number of potential crosslinking chemicals are available for hetero-bifunctional crosslinking of amines and thiols.

[0128] Generally, these procedures are used with thiolated nucleotides. Reagents typically used were NHS (N-hydroxysuccinimide ester), MBS (m-maleimidobenzoyl-N-succinimide ester), and SPDP (pyridyldisulfide-based systems). Commonly used heterobifunctional linkers rely on the aminated nucleic acid.

[0129] Additional methods for covalently linking nucleic acids to the nanoparticle core are known in the art.

[0130] Nanoparticle core

[0131] In some embodiments, the nanoparticles provided herein include a nanoparticle core. In some embodiments, the nanoparticle or nanoparticle core has a diameter of about 2 nm to about 200 nm (e.g., about 10 nm to about 30 nm, about 5 nm to about 25 nm, about 10 nm to about 25 nm, about 15 nm to about 25 nm, about 20 nm to about 25 nm, about 25 nm to about 50 nm, about 50 nm to about 200 nm, about 70 nm to about 200 nm, about 80 nm to about 200 nm, about 100 nm to about 200 nm, about 140 nm to about 200 nm, and about 150 nm to about 200 nm) and contains a polymeric coating agent.

[0132] In some embodiments, the nanoparticles have a diameter that is about 18% to about 28% (e.g., about 18% to about 23%, about 20% to about 23%, about 23% to about 25%, about 23% to about 28%) larger than the diameter of nanoparticles that do not contain a radioactive label. In some embodiments, the nanoparticles may have a diameter that is about 23% larger than the diameter of nanoparticles that do not contain a radioactive label. In some embodiments, the nanoparticles can accumulate in the target metastatic tissue of a subject at a rate similar to that of nanoparticles that target metastases that do not contain a radioactive label. In some embodiments, the nanoparticles exhibit substantially the same accumulation in the target metastatic tissue of a subject as compared to nanoparticles that target metastases that do not contain a radioactive label.

[0133] In some embodiments, the nanoparticles or nanoparticle cores are spherical or ellipsoidal, or have an amorphous shape. In some embodiments, the nanoparticles or nanoparticle cores have a diameter (between any two points on the outer surface of the nanoparticle) of from about 2 nm to about 200 nm (e.g., from about 10 nm to about 200 nm, from about 2 nm to about 30 nm, from about 5 nm to about 25 nm, from about 10 nm to about 25 nm, from about 15 nm to about 25 nm, from about 20 nm to about 25 nm, from about 50 nm to about 200 nm, from about 70 nm to about 200 nm, from about 80 nm to about 200 nm, from about 100 nm to about 200 nm, from about 140 nm to about 200 nm, and from about 150 nm to about 200 nm). In some embodiments, nanoparticles or nanoparticle cores having a diameter of from about 2 nm to about 30 nm may localize in the lymph nodes of interest. In some embodiments, nanoparticles or nanoparticle cores having a diameter of from about 40 nm to about 200 nm may localize in the liver.

[0134] In some embodiments, the nanoparticles or nanoparticle cores contain a core that partially contains a polymer (e.g., poly(lactic-co-glycolic acid)). One of ordinary skill in the art will understand that any number of materials known in the art can be used to prepare the nanoparticle core, including but not limited to gums (e.g., acacia, guar), chitosan, gelatin, sodium alginate, and albumin. Additional polymers that can be used to generate the nanoparticle cores described herein are known in the art. For example, polymers that can be used to generate the nanoparticle cores include, but are not limited to, cellulose-based, poly(2-hydroxyethyl methacrylate), poly(N-vinylpyrrolidone), poly(methyl methacrylate), poly(vinyl alcohol), poly(acrylic acid), polyacrylamide, poly(ethylene-co-vinyl acetate), poly(ethylene glycol), poly(methacrylic acid), polylactide (PLA), polyglycolide (PGA), poly(lactide-co-glycolide) (PLGA), polyanhydrides, polyorthoesters, polycyanoacrylates, and polycaprolactone.

[0135] One skilled in the art will understand that the materials used in the composition of the nanoparticle core, the methods for preparing and coating the nanoparticle core, and the methods for controlling the size of the nanoparticle core may vary substantially. However, these methods are well known to those skilled in the art. Important issues include the biodegradability, toxicity profile, and pharmacokinetics / pharmacodynamics of the nanoparticles. The composition and / or size of the nanoparticle core are important determinants of its biological fate. For example, larger nanoparticle cores are typically taken up and degraded by the liver, while smaller nanoparticle cores (less than 30 nm in diameter) typically circulate for extended periods (sometimes with a blood half-life exceeding 24 hours in humans) and accumulate in the interstitium of organs with enhanced permeability vasculature such as lymph nodes and tumors.

[0136] In some embodiments, the nanoparticle core is magnetic (e.g., contains a core of a magnetic material). In some embodiments, the nanoparticles described herein have a core of a magnetic material (e.g., magnetic nanoparticles). In some embodiments, examples of magnetic nanoparticle cores include ferric chloride, ferrous chloride, or a combination thereof, and a dextran coating agent. In some embodiments, the magnetic nanoparticle core contains a mixture of two or more different nanoparticle cores described herein. In some embodiments, the mixture of two or more different nanoparticle cores contains at least one magnetic nanoparticle core with tunable surface functionalization and at least one magnetic nanoparticle core with tunable magnetic properties.

[0137] In some embodiments, any of the nanoparticles described herein may contain a core of a magnetic material (e.g., therapeutic magnetic nanoparticles). In some embodiments, the magnetic material or particle may contain a diamagnetic, paramagnetic, superparamagnetic, or ferromagnetic material that is responsive to a magnetic field. In some embodiments, the magnetic nanoparticle core comprises a metal oxide. In some embodiments, the metal oxide is selected from the group consisting of magnetite; ferrite (e.g., manganese, cobalt, and nickel ferrites); Fe(II) oxide, and hematite, as well as metal alloys thereof. The core of the magnetic material can be formed by converting a metal salt to a metal oxide using methods known in the art (e.g., Kieslich et al., Inorg. Chem. 2011). In some embodiments, the nanoparticles contain cyclodextrin gold or quantum dots. Non-limiting examples of methods that can be used to generate magnetic nanoparticles are described in Medarova et al., Methods Mol. Biol. 555:1-13, 2009; and Medarova et al., Nature Protocols 1:429-431, 2006.

[0138] Additional magnetic materials and methods of making magnetic materials are known in the art. In some embodiments, the location or localization of the magnetic nanoparticles can be imaged in a subject (e.g., imaged in a subject after administration of one or more doses of magnetic nanoparticles).

[0139] In some embodiments, the magnetic nanoparticle core is functionalized with one or more amine groups. In some embodiments, the functionalization is performed on the surface of the magnetic nanoparticle core. In some embodiments, the one or more amine groups are covalently linked to a dextran coating agent. In some embodiments, the one or more amine groups replace one or more hydroxyl groups of the dextran coating agent. In some embodiments, the number of the one or more amine groups is adjustable based on the concentration of ferric chloride, ferrous chloride, or a combination thereof. In some embodiments, the nanoparticle composition contains about 5 to about 1000 amine groups. In some embodiments, the nanoparticle core contains about 5 to 25, 25 to 100, 100 to 150, 150 to 200, 200 to 250, 250 to 300, 300 to 350, 350 to 400, 450 to 500, 500 to 550, 550 to 600, 600 to 650, 650 to 700, 700 to 750, 750 to 800, 800 to 850, 850 to 900, 900 to 950, or 950 to 1000 amine groups.

[0140] In some embodiments, the magnetic nanoparticle core comprises a core of a magnetic material (e.g., ferric chloride and / or ferrous chloride). In some embodiments, the magnetic nanoparticle core comprises from about 0.60 g to about 0.70 g of ferric chloride and from about 0.3 g to about 0.5 g of ferrous chloride. In some embodiments, a magnetic nanoparticle core comprising from about 0.60 g to about 0.70 g of ferric chloride and from about 0.3 g to about 0.5 g of ferrous chloride is functionalized with from about 5 to 150 amine groups. In some embodiments, the magnetic nanoparticle core comprises about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride. In some embodiments, a magnetic nanoparticle core comprising about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride is functionalized with from about 60 to 90 amine groups. In some embodiments, a magnetic nanoparticle core comprising about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride is functionalized with from about 5 to 150 amine groups. In some embodiments, a magnetic nanoparticle core comprising about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride is functionalized with from about 1 to 150 amine groups. In some embodiments, a magnetic nanoparticle core comprising about 0.65 g of ferric chloride and about 0.4 g of ferrous chloride is functionalized with from about 1 to 10 amine groups, from about 10 to 20 amine groups, from about 20 to 30 amine groups, from about 30 to 40 amine groups, from about 40 to 50 amine groups, from about 50 to 60 amine groups, from about 60 to 70 amine groups, from about 70 to 80 amine groups, from about 80 to 90 amine groups, from about 90 to 100 amine groups, from about 100 to 110 amine groups, from about 110 to 120 amine groups, from about 120 to 130 amine groups, from about 130 to 140 amine groups, or from about 140 to 150 amine groups.

[0141] In some embodiments, the magnetic nanoparticle core contains about 1 g to about 1.4 g of ferrous chloride. In some embodiments, the magnetic nanoparticle core containing about 1 g to about 1.4 g of ferrous chloride is functionalized with about 246 to 500 amine groups. In some embodiments, the magnetic nanoparticle core contains about 1.2 g of ferrous chloride. In some embodiments, the magnetic nanoparticle core containing about 1.2 g of ferrous chloride is functionalized with about 246 to 500 amine groups. In some embodiments, the magnetic nanoparticle core functionalized with about 246 to 500 amine groups does not contain ferrous chloride. In some embodiments, the magnetic nanoparticle core containing about 1.2 g of ferrous chloride is functionalized with about 200 to 600 amine groups. In some embodiments, the magnetic nanoparticle core containing about 1.2 g of ferrous chloride is functionalized with about 200 to 250 amine groups, about 250 to 300 amine groups, about 300 to 350 amine groups, about 350 to 400 amine groups, about 400 to 450 amine groups, about 450 to 500 amine groups, about 500 to 550 amine groups, about 550 to 600 amine groups, or more amine groups.

[0142] Thus, in some embodiments, by controlling the concentrations of ferrous chloride and ferrous chloride used to prepare the magnetic nanoparticle core, the number of amine groups conjugated to the dextran coating agent can be finely adjusted.

[0143] In some embodiments, the magnetic nanoparticle core has a magnetic strength that is adjustable based on the concentration of ferrous chloride, ferrous chloride, or a combination thereof.

[0144] In some embodiments, the magnetic nanoparticle core contains, per MNP, from about 0.1% to about 99.9% of ferrous ions and from about 99.9% to about 0.1% of ferric ions in total iron. In some embodiments, a magnetic nanoparticle core containing from about 60% to about 80% ferrous chloride and from about 20% to about 40% ferric chloride has stronger magnetic properties than a nanoparticle core having a ferric chloride amount higher than about 80%. In some embodiments, a magnetic nanoparticle core containing about 70% ferrous ions and about 30% ferric ions has stronger magnetic properties than a magnetic nanoparticle core having a ferric ion amount higher than about 30%.

[0145] In some embodiments, the magnetic nanoparticle core has a non-linearity index (NLI) in the range of about 6 to about 40. In some embodiments, the magnetic nanoparticle core has an NLI in the range of about 6 to about 70. In some embodiments, the magnetic nanoparticle core has an NLI in the range of about 8.5 to about 14.8. In some embodiments, the magnetic nanoparticle core has an NLI in the range of about 8 to about 14. In some embodiments, the magnetic nanoparticle core has an NLI of about 6. In some embodiments, the magnetic nanoparticle core has an NLI of about 8. In some embodiments, the magnetic nanoparticle core has an NLI of about 14. In some embodiments, the magnetic nanoparticle core has an NLI of about 67. In some embodiments, the magnetic nanoparticle core has an NLI in the range of 6 - 7, 7 - 8, 8 - 9, 9 - 10, 10 - 11, 11 - 12, 12 - 13, 13 - 14, 14 - 15, 15 - 16, 16 - 17, 17 - 18, 18 - 19, 19 - 20, 20 - 30, 30 - 40, 40 - 50, 50 - 60, or 60 - 70. In some embodiments, the magnetic nanoparticle core contains about 0.54 g of ferrous chloride and about 0.2 g of ferric chloride. In some embodiments, a magnetic nanoparticle core containing about 0.54 g of ferrous chloride and about 0.2 g of ferric chloride has an NLI in the range of about 8.5 to about 14.8. In some embodiments, a magnetic nanoparticle core containing about 0.54 g of ferrous chloride and about 0.2 g of ferric chloride has an NLI of about 12. In some embodiments, the magnetic strength of the magnetic nanoparticle core can be quantified by measuring the non-linearity index (NLI) by the magnetic particle spectroscopy described in WO2021 / 113829.

[0146] In some embodiments, the magnetic nanoparticle core comprises from about 80% to about 100% ferric chloride and from about 20% to about 0% ferrous chloride. In some embodiments, the magnetic nanoparticle core comprises from about 0% to about 50% ferric chloride and from about 100% to about 50% ferrous chloride. In some embodiments, a magnetic nanoparticle core comprising from about 0% to about 50% ferric chloride and from about 100% to about 50% ferrous chloride has weaker magnetic properties than a magnetic nanoparticle core having a ferrous chloride amount of less than about 0.4 g. In some embodiments, a magnetic nanoparticle core comprising about 0.54 g ferric chloride and about 0.4 g ferrous chloride has weaker magnetic properties than a magnetic nanoparticle core having a ferrous chloride amount of less than about 0.2 g. In some embodiments, a magnetic nanoparticle core comprising about 0.54 g ferric chloride and about 0.4 g ferrous chloride has an NLI in the range of about 50 to about 120. In some embodiments, a magnetic nanoparticle core comprising about 0.54 g ferric chloride and about 0.4 g ferrous chloride has an NLI of about 67.

[0147] Thus, in some embodiments, the magnetic properties (e.g., magnetic strength) of the magnetic nanoparticle core can be finely tuned by controlling the concentrations of ferric chloride and ferrous chloride used to prepare the magnetic nanoparticle core.

[0148] In some embodiments, the magnetic nanoparticle core has an iron concentration in the range of about 8 mM to about 217 mM. In some embodiments, the magnetic nanoparticle core has an iron concentration in the ranges of about 8 mM to about 15 mM, about 15 mM to about 25 mM, about 25 mM to about 50 mM, 50 mM to about 60 mM, about 60 mM to about 70 mM, about 70 mM to about 80 mM, about 80 mM to about 90 mM, about 90 mM to about 100 mM, about 100 mM to about 110 mM, about 110 mM to about 120 mM, about 120 mM to about 130 mM, about 130 mM to about 140 mM, about 140 mM to about 150 mM, about 150 mM to about 160 mM, about 160 mM to about 170 mM, about 170 mM to about 180 mM, about 180 mM to about 190 mM, about 190 mM to about 200 mM, about 200 mM to about 210 mM, and about 210 mM to about 220 mM.

[0149] In some embodiments, the magnetic nanoparticle core has an iron concentration in the range of about 1 mg / mL to about 25 mg / mL. In some embodiments, the magnetic nanoparticle core has an iron concentration in the range of about 1 mg / mL to about 5 mg / mL, about 5 mg / mL to about 10 mg / mL, about 10 mg / mL to about 15 mg / mL, about 15 mg / mL to about 20 mg / mL, or about 20 mg / mL to about 25 mg / mL. In some embodiments, the nanoparticles described herein do not contain a magnetic material.

[0150] In some embodiments, the magnetic nanoparticle core is used to deliver a composition containing any one of at least one (e.g., 1, 2, 3, or 4) of the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotides described herein (e.g., the modified RNA oligonucleotides used herein). "At least one" means that one or more modified RNA oligonucleotides of the same or different oligonucleotide(s) can be used together. In some embodiments, the magnetic nanoparticles deliver one modified RNA oligonucleotide. In some embodiments, the magnetic nanoparticles deliver two modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles deliver three modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles deliver four modified RNA oligonucleotides. In some embodiments, the magnetic nanoparticles deliver five modified RNA oligonucleotides.

[0151] Polymer coating agent of nanoparticles

[0152] In some embodiments, the nanoparticles described herein include a polymeric coating agent over the nanoparticle core (e.g., over the surface of the nanoparticle core). The polymeric material may be suitable for binding or coupling one or more biological agents (e.g., such as any of the modified oligonucleotides or radiolabels described herein). One or more biological agents (e.g., modified oligonucleotides or radiolabels) can be immobilized to the polymeric coating agent by chemical coupling (covalent bond).

[0153] In some embodiments, the nanoparticle core is formed by a method that includes coating the core of the nanoparticle (e.g., a magnetic material) with a polymer that is relatively stable in water. In some embodiments, the nanoparticle core is formed by a method that includes coating a material (e.g., a magnetic material) with a polymer or absorbing the material into a thermoplastic polymer resin having a reducing group thereon. The coating can also be applied to the material using the methods described in U.S. Pat. Nos. 5,834,121, 5,395,688, 5,356,713, 5,318,797, 5,283,079, 5,232,789, 5,091,206, 4,965,007, 4,774,265, 4,770,183, 4,654,267, 4,554,088, 4,490,436, 4,336,173, and 4,421,660; and WO10 / 111066, the disclosures of each of which are incorporated herein by reference.

[0154] Examples of methods for synthesizing iron oxide nanoparticle cores include, for example, physical and chemical methods. For example, iron oxide can be prepared by coprecipitation of Fe2+ and Fe3+ salts in an aqueous solution. The resulting core consists of magnetite (Fe3O4), maghemite (γ-Fe2O3), or a mixture of the two. The anionic salt content (chloride, nitrate, sulfate, etc.), Fe2+ and Fe3+ ratio, pH, and ionic strength in the aqueous solution all play a role in controlling the size. It is important to prevent oxidation of the synthesized nanoparticle core and protect its magnetic properties by performing the reaction in an oxygen-free environment under an inert gas such as nitrogen or argon. To prevent aggregation of the iron oxide nanoparticles into microparticles, a coating material can be added during the coprecipitation process. Those skilled in the art will understand that any number of surface coating materials known in the art, such as synthetic and natural polymers such as polyethylene glycol (PEG), dextran, polyvinylpyrrolidone (PVP), fatty acids, polypeptides, chitosan, and / or gelatin, can be used to stabilize the iron oxide nanoparticles.

[0155] For example, U.S. Patent No. 4,421,660 (the " '660 patent") describes that polymer-coated particles of inorganic materials can be conventionally prepared by: (1) treating an inorganic solid with an acid, a combination of an acid and a base, an alcohol, or a polymer solution; (2) dispersing an addition-polymerizable monomer in an aqueous dispersion of the treated inorganic solid; and (3) subjecting the resulting dispersion to emulsion polymerization conditions. See, for example, cols. 1, lines 21-27 of the '660 patent. The '660 patent also discloses a method for coating inorganic nanoparticles with a polymer, which includes: (1) emulsifying a hydrophobic emulsion-polymerizable monomer in an aqueous colloidal dispersion of individual particles of an inorganic solid; and (2) subjecting the resulting emulsion to emulsion polymerization conditions to form a stable, fluid aqueous colloidal dispersion of inorganic solid particles dispersed in a matrix of a water-insoluble polymer of the hydrophobic monomer. See, for example, cols. 1, lines 42-50 of the '660 patent.

[0156] Alternatively, polymer-coated magnetic materials meeting the starting size requirements can be commercially obtained. For example, commercially available ultrasmall superparamagnetic iron oxide nanoparticles include NC100150 Injection (Nycomed Amersham, Amersham Health) and Ferumoxytol (AMAG Pharmaceuticals, Inc.).

[0157] Suitable polymers that can be used to coat the core of a material (e.g., a magnetic material) include, but are not limited to, fluorinated or chlorinated polymers such as polystyrene, polyacrylamide, polyetherurethane, polysulfone, polyvinyl chloride, polyethylene, and polypropylene, polycarbonate, and polyester. Further examples of polymers that can be used to coat the core of a material (e.g., a magnetic material) include polyolefins such as polybutadiene, polydichlorobutadiene, polyisoprene, polychloroprene, halogenated polyvinylidene, polyvinylidene carbonate, and polyfluorinated ethylene. Some copolymers containing styrene / butadiene, alpha-methylstyrene / dimethylsiloxane, or other polysiloxanes can also be used to coat the core of a material (e.g., polydimethylsiloxane, polyphenylmethylsiloxane, and polytrifluoropropylmethylsiloxane). Further polymers that can be used to coat the core of a material include polyalpha-acrylonitrile copolymers, alkyd or terpenoid resins, and polyacrylonitrile or acrylonitrile-containing polymers such as polyalkylene polysulfonate. In some embodiments, the polymer coating agent is dextran.

[0158] Chelating agent

[0159] In some embodiments, the nanoparticles described herein include at least one chelating agent covalently linked to the nanoparticle core. In some embodiments, the chelating agent forms a stable complex with a radioactive label. In some embodiments, the chelating agent binds to a radioactive label.

[0160] In some embodiments, the nanoparticles comprise a mixture of two or more different chelating agents described herein. In some embodiments, the nanoparticles comprise from about 1 to about 15 chelating agents (e.g., from about 1 to about 11 chelating agents, from about 1 to about 12 chelating agents, from about 1 to about 13 chelating agents, from about 1 to about 14 chelating agents, from about 1 to about 15 chelating agents, from about 11 to about 12 chelating agents, from about 11 to about 13 chelating agents, from about 11 to about 14 chelating agents, or from about 11 to about 15 chelating agents) covalently linked to each nanoparticle core. In some embodiments, the nanoparticles may comprise about 13 chelating agents covalently linked to each nanoparticle core.

[0161] A variety of different chelating agents that can be covalently linked to the nanoparticle core are known in the art. Non-limiting examples of such chelating agents include 1,4,7-triazacyclononane, l-glutamic acid-4,7-acetic acid (NODAGA), 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetrayl) tetraacetic acid (DOTA), 10-(2,6-dioxotetrahydro-2H-pyran-3-yl)-1,4,7,10-tetraazacyclododecane-1,4,7-triyl) triacetic acid (DOTA-GA), 2-[4,7,10-tris(carboxymethyl)-6-[(4-isothiocyanatophenyl)methyl]-1,4,7,10-tetraazacyclododec(tetrazacyclododec)-1-yl] acetic acid (p-SCN-Bn)-DOTA, 2,2'-(1,4,8,11-tetraazabicyclo[6.6.2]hexadecane-4,11-diyl) diacetic acid (CB-TE2A), CB-TE1A1P, 1,4-bis(carboxymethyl)-6-[bis(carboxymethyl)]amino-6-methylperhydro-1,4-diazepine (AAZTA), 5-(8-methyl-3,6,10,13,16,19-hexaaza-bicyclo[6.6.6]icosan-1-ylamino)-5-oxopentanoic acid (MeCOSar), 2-S-(4-isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid (p-SCN-Bn)-NOTA, 1,4,7-triazacyclononane-1,4,7-triacetic acid (NOTA), N,N'-bis-[2-hydroxy-5-(carboxyethyl)benzyl]ethylenediamine-N,N'-diacetic acid)(HBED-CC), tris(hydroxypyridinone) (THP), MAS3, and desferoxamine (DFO).

[0162] Additional chelating agents are also described in Price and Ovig (Chem. Soc. Rev., 2014, 43, 260-290), Boros and Packard (Chem. Rev. 2019, 119, 2, 870-901), Barndt et al. (J. Nucl. Med., 2018, 59, 1500-1506), and Sneddon and Cornelissen (Curr. Opin. Chem. Biol., 2021, 63, 152-162), each of which is incorporated by reference in its entirety.

[0163] In some embodiments, the chelating agent is attached to the nanoparticle core via a chemical moiety containing a primary amine, secondary amine, amide, thioester, or disulfide bond. Additional chemical moieties that can be used to covalently link the chelating agent to the nanoparticle core are known in the art.

[0164] Various different methods can be used to covalently link the chelating agent to the nanoparticle core. In some embodiments, by reaction of an amine group (present in the chelating agent or on the nanoparticle core) with an active ester, carboxylate, isothiocyanate, or hydrazine (e.g., present in the chelating agent or on the nanoparticle core); by reaction of a carboxyl group (e.g., present in the chelating agent or on the nanoparticle core) in the presence of a carbodiimide; by reaction of a thiol (e.g., present in the chelating agent or on the nanoparticle core) in the presence of maleimide; by reaction of a thiol (e.g., present in the chelating agent or on the nanoparticle core) in the presence of maleimide or acetyl bromide; or by reaction of an azide (e.g., present in the chelating agent or on the nanoparticle core) in the presence of glutaraldehyde, the fluorophore is attached to the nanoparticle core. Additional methods for attaching the chelating agent to the nanoparticle core are known in the art.

[0165] In some embodiments, the nanoparticle core does not contain a chelating agent. In some embodiments, the nanoparticle may include a radiolabel directly associated with (e.g., covalently linked to) the nanoparticle core.

[0166] Radiolabel

[0167] In some embodiments, the nanoparticles described herein include a radiolabel. In some embodiments, the radiolabel can be associated with the nanoparticle core. For example, in some embodiments, the radiolabel can be covalently or non-covalently attached to the nanoparticle core via a linker. In some embodiments, the radiolabel can be directly covalently or non-covalently attached to the nanoparticle core. In some embodiments, the radiolabel can be associated with (e.g., by van der Waals forces) the nanoparticle core or a composition or moiety surrounding the nanoparticle core. In some embodiments, the radiolabel can be associated with the nanoparticle core without using a chelating agent (e.g., when the nanoparticle core does not contain a chelating agent). In some embodiments, the radiolabel can be associated with a nanoparticle core having a chelating agent. In some embodiments, the radiolabel forms a stable complex with a chelating agent.

[0168] In some embodiments, the nanoparticle core contains from about 1 radiolabel atom to about 15 radiolabel atoms (e.g., from about 1 radiolabel atom to about 11 radiolabel atoms, from about 1 radiolabel atom to about 12 radiolabel atoms, from about 1 radiolabel atom to about 13 radiolabel atoms, from about 1 radiolabel atom to about 14 radiolabel atoms, from about 1 radiolabel atom to about 15 radiolabel atoms, from about 13 radiolabel atoms to about 14 radiolabel atoms, from about 13 radiolabel atoms to about 15 radiolabel atoms) per nanoparticle core. In some embodiments, the nanoparticle core contains about 14 radiolabel atoms associated with (e.g., via a chelating agent) each nanoparticle core.

[0169] In some embodiments, the radioactive label has an emission energy in the range of about 550 kiloelectronvolts (keV) to about 3500 keV (e.g., about 550 keV to about 580 keV, about 550 keV to about 640 keV, about 550 keV to about 660 keV, about 550 keV to about 770 keV, about 550 keV to about 910 keV, about 579 keV to about 1200 keV, about 579 keV to about 1900 keV, about 579 keV to about 3500 keV) (e.g., 0 + energy). In some embodiments, the radioactive label has an emission energy of about 656 keV. In some embodiments, the radioactive label has an emission energy equivalent (e.g., ±25 keV) to the emission energy of fluorine-18 (F-18). In some embodiments, the radioactive label has an emission energy of about 656 keV.

[0170] In some embodiments, the radioactive label has a half-life that allows for adequate evaluation of the slow pharmacokinetics of the polymer and / or blood-pool agent. In some embodiments, the radioactive label has a half-life in the range of about 10 minutes to about 80 hours (e.g., about 10 minutes to about 13 hours, about 70 minutes to about 13 hours, about 110 minutes to about 13 hours, about 13 hours to about 26 hours, about 13 hours to about 80 hours). In some embodiments, the radioactive label has a half-life of about 12.7 hours.

[0171] A variety of different radiolabels that can be associated (e.g., covalently linked or non-covalently linked) to the nanoparticle core are known in the art. The radiolabel may be an alpha emitter, a beta emitter or a gamma emitter. In certain embodiments, the radiolabel may have dual energy characteristics. In further embodiments, the radiolabel may be copper 64 (Cu-64), copper 67 (Cu-67), F-18, yttrium 90 (Y-90), scandium 44 (SC-44), cobalt 55 (co-55), niobium 90 (Nb-90), rhenium 186 (Re-186), rhenium 188 (Re-188), terbium 161 (Tb-161), lutetium 177 (Lu-177), bismuth 231 (Bi-213), lead 212 (Pb-212), actinium 225 (Ac-225), zirconium 89 (Zr), or any combination thereof.

[0172] 5. Treatment method

[0173] In certain embodiments, the present disclosure is a method for slowing the growth of a tumor (primary and / or secondary tumor) in a subject in need thereof, the method comprising administering a composition or pharmaceutical formulation comprising an effective amount of a RIG-I agonist precursor comprising a single-stranded 5'-uncapped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA. In certain embodiments, the method further comprises administering a single-stranded oligonucleotide sequence complementary to the single-stranded 5'-uncapped triphosphate antisense oligonucleotide. In embodiments, the method comprises the use of core / shell nanoparticles for delivering the RIG-I agonist precursor and a radiolabel.

[0174] In certain other embodiments, the present disclosure relates to a method for generating a localized immune response, the method comprising administering to a subject a therapeutically effective amount of a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment, thereby generating a localized immune response. In some embodiments, the present disclosure contemplates a method for treating a solid tumor in a subject, the method comprising administering to the subject a therapeutically effective amount of a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment, thereby generating a localized immune response. In some embodiments, the present disclosure contemplates a method for detecting, diagnosing, and / or monitoring the treatment of a solid tumor in a subject, the method comprising administering to the subject a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment, thereby generating a localized immune response. In some embodiments, the RNA is mRNA. In some embodiments, the RNA is miRNA. In some embodiments, the miRNA is selected from the group consisting of SEQ ID NOs: 1-13.

[0175] As used herein, the terms "treatment", "treating", "alleviating", etc. generally mean obtaining a desired pharmacokinetic and / or physiological effect, and can also be used to refer to improving, alleviating, and / or reducing the severity of one or more clinical complications of the condition being treated (e.g., solid tumor). The effect may be prophylactic in terms of completely or partially delaying the onset or recurrence of the disease, condition, or its complications, and / or may be therapeutic in terms of partial or complete cure of the disease or condition and / or the adverse effects resulting from the disease or condition. As used herein, "treatment" encompasses any treatment of a disease or condition in a mammal, particularly a human. As used herein, a therapeutic agent that "prevents" a disorder or condition refers to a compound that reduces the occurrence of the disorder or condition in a treated sample compared to an untreated control sample, or delays the onset of the disease or condition compared to an untreated control sample, in a statistical sample.

[0176] Generally, treatment or prevention of a disease or condition (e.g., solid tumor) described in the present disclosure is achieved by administering one or more nanoparticles of the present disclosure in an "effective amount". An effective amount of a drug refers to the dosage necessary to achieve the desired therapeutic or prophylactic result and an amount that is effective over a period of time. The "therapeutically effective amount" of a drug of the present disclosure may vary depending on factors such as the medical condition, age, gender, and weight of the individual, as well as the ability of the drug to elicit the desired response in the individual. A "prophylactically effective amount" refers to the dosage necessary to achieve the desired prophylactic result and an amount that is effective over a period of time.

[0177] In certain embodiments, the present disclosure contemplates the use of one or more nanoparticles in combination with one or more additional active agents or other supportive therapies for treating or preventing a disease or condition (e.g., solid tumor). As used herein, “in combination with,” “combination of,” “administered in combination with,” or “co-administered” refers to any form of administration such that the additional active agent or supportive therapy (e.g., second, third, fourth, etc.) remains effective in the body (e.g., multiple compounds are simultaneously effective in a patient over some period of time, which may include a synergistic effect of these compounds). Effectiveness may not correlate with a measurable concentration of the agent in blood, serum, or plasma. For example, different therapeutic compounds can be administered simultaneously or sequentially, and at different schedules, in the same formulation or in separate formulations. Thus, a subject undergoing such treatment can benefit from the combined effects of the different active agents or therapies. One or more nanoparticles of the present disclosure can be administered in conjunction with, before, or after one or more other additional agents or supportive therapies such as those disclosed herein. Generally, each active agent or therapy is administered at a dosage and / or time schedule determined for that particular agent. The specific combinations for use in a regimen take into account the compatibility of the nanoparticles of the present disclosure with the additional active agent or therapy and / or the desired effect.

[0178] The methods described herein are methods for treating solid tumors in a subject, comprising administering to the subject a therapeutically effective amount of a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5′ non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to an miRNA that is highly expressed in the solid tumor or solid tumor microenvironment as compared to the non-solid tumor or non-solid tumor microenvironment, thereby generating a localized immune response. Without wishing to be bound by theory, the nanoparticle delivers the single-stranded 5′ non-capped triphosphate or diphosphate modified RNA oligonucleotide to the solid tumor, and the single-stranded 5′ non-capped triphosphate or diphosphate modified RNA oligonucleotide forms a duplex with the tumor-specific RNA, thereby eliciting a tumor-specific immune response via the RIG-I signaling pathway. Thus, methods for treating solid tumors are provided herein by combining RIG-I-mediated immune activation against tumor cells while inhibiting miRNA or mRNA, if desired (e.g., using a modified RNA oligonucleotide that is complementary to endogenous miR21). In some embodiments, the endogenously expressed mRNA or miRNA is oncogenic. In some embodiments, the endogenously expressed mRNA or miRNA is tumor-specific. As used herein, "tumor-specific RNA" refers to an RNA (e.g., miRNA or mRNA) that is highly expressed in tumor cells as compared to non-tumor cells.

[0179] In vivo, miRNAs often exert regulatory functions within the RNA-induced silencing complex (RISC). The core subunit of RISC is an miRNA bound to AGO2 (a member of the Argonaute family of proteins). The miRNA within the RISC complex comprises a double-stranded miRNA where one RNA strand is the miRNA-guide that directs the complex to the target mRNA and the other RNA strand is the passenger strand that is removed from the complex and degraded. AGO2 uses the miRNA-guide to identify complementary target transcripts for repression.

[0180] In some embodiments, a single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a duplex with endogenous tumor-specific RNA. In some embodiments, the endogenous tumor-specific RNA is selected from miRNA or mRNA. In some embodiments, the miRNA or mRNA is oncogenic. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide forms a duplex with miRNA. In some embodiments, the duplex is not cleaved by AGO2. In some embodiments, the duplex is released by AGO2. In some embodiments, the duplex contains 0 to 5 mismatched base pairs.

[0181] In some embodiments, the duplex activates RIG-I. In some embodiments, the RIG-I activation is at least 5%, 10%, 15% or 20% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. In some embodiments, the RIG-I activation elicits a tumor-specific immune response. In some embodiments, the single-stranded 5'-uncapped triphosphate or diphosphate-modified RNA oligonucleotide competes with endogenous mRNA and binds to miRNA.

[0182] The methods disclosed herein include the treatment of disorders associated with abnormal apoptosis or differentiation processes, such as cell proliferation disorders or cell differentiation disorders, such as solid tumors. In certain embodiments, the methods relate to a dual treatment method that includes a combination of tumor-specific immune activation and inhibition of miRNA or mRNA. Using the methods, it is also possible to reduce the risk of developing disorders associated with abnormal apoptosis or differentiation processes by inducing an immune response that targets developing cancer cells. In some embodiments, the disorder is a solid tumor, such as breast cancer, prostate cancer, pancreatic cancer, brain cancer, liver cancer, lung cancer, kidney cancer, skin cancer, or colon cancer. Generally, the methods include administering a therapeutically effective amount of the treatment described herein to a subject in need of such treatment or a subject determined to be in need of such treatment. In some embodiments, the methods include administering a therapeutically effective amount of a treatment that includes, for example, a modified RNA oligonucleotide linked to a nanoparticle. In some embodiments, the nanoparticle is a magnetic nanoparticle.

[0183] As used in this context, "treating" means ameliorating at least one symptom of a disorder associated with abnormal apoptosis or differentiation processes. For example, treatment can result in a reduction in tumor size or growth rate. Administration of a therapeutically effective amount of a compound described herein for the treatment of a condition associated with abnormal apoptosis or differentiation processes (e.g., cancer) can result, inter alia, in a reduction in tumor size or growth rate, a reduction in the risk or frequency of recurrence, a delay in recurrence, a reduction in metastasis, an increase in survival rate, and / or a decrease in morbidity and mortality.

[0184] Examples of cell proliferation and / or differentiation disorders include cancer, such as carcinoma, sarcoma, metastatic disorders. Metastatic tumors can arise from a number of primary tumor types, including, but not limited to, those of prostate, colon, lung, breast, and liver origin.

[0185] As used herein, the terms “cancer,” “hyperproliferative,” and “neoplastic” refer to a cell having the ability of autonomous growth, i.e., an abnormal condition or state characterized by rapidly proliferating cell growth. Hyperproliferative and neoplastic pathologies can be classified as pathogenic, i.e., capable of characterizing or constituting a pathology, or non-pathogenic, i.e., not associated with a pathology and classifiable as a deviation from normal. This term means including any type of cancerous growth or carcinogenic process, metastatic tissue, or malignantly transformed cells, tissues, or organs, regardless of histopathologic type or stage of invasion. “Pathogenic hyperproliferation” cells occur in a condition characterized by malignant tumor growth. Examples of non-pathogenic hyperproliferative cells include the proliferation of cells associated with wound repair.

[0186] The term “cancer” or “neoplasm” includes malignant tumors of various organ systems such as the bladder, bone, lung, kidney, breast, thyroid, lymphatic system, gastrointestinal tract, and urogenital tract that are affected, as well as adenocarcinomas including many colon cancers, renal cell carcinomas, prostate cancers and / or testicular tumors, non-small cell lung cancers, cancers of the small intestine, and cancers of the esophagus. Other types of cancer include, but are not limited to, bile duct cancer, brain cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, endometrial cancer, esophageal cancer, gastric cancer, glioblastoma, intraepithelial neoplasia, liver cancer, lung cancer, melanoma, neuroblastoma, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, sarcoma, skin cancer, stomach cancer, testicular cancer, thyroid cancer, uterine cancer, and kidney cancer. In certain embodiments, the cancer is selected from melanoma, squamous cell carcinoma, renal cell carcinoma, prostate cancer, bladder cell carcinoma, breast cancer, ovarian cancer, non-small cell lung cancer, small cell lung cancer, hepatocellular carcinoma, basal cell tumor, colon cancer, cervical dysplasia, and Kaposi sarcoma (AIDS-related and non-AIDS-related).

[0187] The term "cancer" is recognized in the art and refers to malignant tumors of epithelial or endocrine tissues, including cancers of the respiratory system, gastrointestinal system, urogenital system, testicular cancer, breast cancer, prostate cancer, endocrine system cancers, and melanoma. In some embodiments, the disease is renal cancer or melanoma. Exemplary cancers include those formed from tissues of the cervix, lung, prostate, breast, head and neck, colon, and ovary. The term also includes carcinosarcomas, for example, malignant tumors composed of carcinomatous and sarcomatous tissues. "Adenocarcinoma" refers to a cancer derived from glandular tissue or a cancer in which the tumor cells form recognizable glandular structures.

[0188] The term "sarcoma" is recognized in the art and refers to a malignant tumor of mesenchymal origin.

[0189] Cancer Treatment and Detection

[0190] In some embodiments of any of the methods described herein, the nanoparticles are administered to a subject diagnosed with having cancer (e.g., having primary solid tumor cancer or metastatic solid tumor cancer). In some embodiments, the subject has breast cancer (e.g., metastatic breast cancer). In some non-limiting embodiments, the subject is male or female, adult, adolescent, or pediatric. In some embodiments, the subject has one or more symptoms of cancer or metastatic cancer (e.g., metastatic cancer in lymph nodes). In some embodiments, the subject has severe or advanced stage cancer (e.g., primary cancer or metastatic cancer). In some embodiments, the subject has metastatic tumors present in at least one lymph node. In some embodiments, the subject has undergone lymphedema and / or mastectomy.

[0191] Metastatic cancer is cancer that originates from cancer cells that have migrated from a primary tumor to different tissues of a subject. In some embodiments, the cancer cells derived from the primary tumor can migrate to different tissues of the subject by moving through the subject's bloodstream or lymphatic system. In some embodiments, the metastatic cancer is metastatic cancer present in the lymph nodes of the subject.

[0192] The symptoms of metastatic cancer experienced by a subject depend on the site of metastatic tumor formation. Non-limiting symptoms of metastatic cancer in the subject's brain include headache, dizziness, and blurred vision. Non-limiting symptoms of metastatic cancer in the subject's liver include weight loss, fever, chills, loss of appetite, abdominal pain, abdominal fluid (ascites), jaundice, and swelling of the legs. Non-limiting symptoms of metastatic cancer in the subject's bone include pain after minor trauma or without injury and bone destruction. Non-limiting symptoms of metastatic cancer in the subject's lung include dry cough, cough that brings up blood-tinged sputum, chest pain, and shortness of breath.

[0193] A healthcare provider (e.g., a physician, physician assistant, nurse, or laboratory technician) can diagnose metastatic cancer in a subject using methods known in the art. For example, in part, metastatic cancer can be diagnosed in a subject by observation or detection of at least one symptom of metastatic cancer in the subject (e.g., any of those symptoms listed above). Metastatic cancer can also be diagnosed in a subject using various imaging techniques (e.g., alone or in combination with observation of one or more symptoms of metastatic cancer in the subject). For example, computed tomography, magnetic resonance imaging, positron emission tomography, and x-rays can be used to detect the presence of metastatic cancer (e.g., metastatic cancer in lymph nodes) in a subject. Additionally, metastatic cancer (e.g., metastatic cancer in lymph nodes) can be diagnosed by performing a biopsy of tissue from the subject (e.g., a biopsy of a lymph node from the subject).

[0194] Metastatic tumors can form in various different tissues of a subject, including but not limited to the brain, lung, liver, bone, abdomen, adrenal gland, skin, and muscle. The primary tumor can be of any cancer type including but not limited to breast cancer, colon cancer, kidney cancer, lung cancer, skin cancer, ovarian cancer, pancreatic cancer, rectal cancer, stomach cancer, thyroid cancer, or uterine cancer.

[0195] Any one or more of the nanoparticles described herein can be administered to a subject having cancer (e.g., metastatic cancer). The one or more nanoparticles can be administered to the subject in a medical facility (e.g., a hospital or clinic) or a care facility. In some embodiments, the subject may have been previously diagnosed as having cancer (e.g., primary cancer). In some embodiments, the subject may have been previously diagnosed as having metastatic cancer (e.g., metastatic cancer of the lymph nodes). In some embodiments, the subject has already received a therapeutic treatment for primary cancer. In some embodiments, the subject's primary tumor has been surgically removed prior to treatment with one of the nanoparticles described herein. In some embodiments, at least one lymph node has been removed from the subject prior to treatment with one of the nanoparticles described herein. In some embodiments, the subject may be in a period of cancer remission. In some embodiments, the subject is administered additional supportive or adjuvant therapy. In some embodiments, the additional supportive or adjuvant therapy is radiation therapy, cryotherapy, or ultrasound therapy. In some embodiments, the additional supportive or adjuvant therapy is surgery.

[0196] In some embodiments, administration of at least one nanoparticle results in a decrease (e.g., a significant or observable decrease) in the size of metastatic tumors present in the lymph nodes of a subject, stabilization of the size of metastatic tumors present in the lymph nodes (e.g., no significant or observable change in size), or a decrease in the growth rate of metastatic tumors present in the lymph nodes (e.g., a detectable or observable decrease). A healthcare provider can use a variety of different imaging techniques, including but not limited to computed tomography, magnetic resonance imaging, positron emission tomography, and x-rays, to monitor the size and / or change in size of metastatic tumors present in the lymph nodes of a subject. For example, the size of metastatic tumors present in the lymph nodes of a subject can be determined before and after treatment to determine whether there has been a decrease or stabilization in the size of the metastatic tumors of the subject in response to treatment. The growth rate of metastatic tumors in the lymph nodes of a subject can be compared to the growth rate of metastatic tumors in another subject or population of subjects that is untreated or receiving a different treatment. A decrease in the growth rate of metastatic tumors in the lymph nodes of a subject can also be determined by comparing the growth rate of metastatic tumors in the lymph nodes before and after a therapeutic treatment (e.g., treatment with any of the nanoparticles described herein). In some embodiments, visualization of metastatic tumors (e.g., metastatic tumors in lymph nodes) can be performed using imaging techniques that utilize labeled probes or molecules that specifically bind to cancer cells in the metastatic tumors (e.g., labeled antibodies that selectively bind to epitopes present on the surface of primary cancer cells). In some embodiments, visualization of metastatic tumors (e.g., metastatic tumors in lymph nodes) can be performed using imaging techniques that utilize radiolabels (e.g., copper 64) conjugated to the nanoparticles.

[0197] In some embodiments, administration of at least one nanoparticle to a subject results in a reduced risk of developing additional metastatic tumors in a subject that already has at least one metastatic tumor (e.g., a subject that already has a metastatic tumor in a lymph node), e.g., as compared to the rate of developing additional metastatic tumors in a subject that has a similar metastatic tumor but is untreated or receiving an alternative treatment. The reduced risk of developing additional metastatic tumors in a subject that already has at least one metastatic tumor can also be compared to the risk of developing additional metastatic tumors in a population of subjects that are untreated or receiving alternative forms of cancer treatment.

[0198] In some embodiments, administration of the nanoparticle to a subject reduces the risk of developing metastatic cancer (e.g., metastatic cancer in a lymph node) in a subject that has (e.g., is diagnosed with) a primary cancer (e.g., primary breast cancer), e.g., as compared to the rate of developing metastatic cancer in a subject that has a similar primary cancer but is untreated or receiving an alternative treatment. The reduced risk of developing metastatic tumors in a subject that has a primary cancer can also be compared to the rate of formation of metastatic cancer in a population of subjects that are untreated or receiving alternative forms of cancer treatment.

[0199] A healthcare provider can also evaluate the efficacy of a therapeutic treatment for metastatic cancer (e.g., metastatic cancer in a subject's lymph node) by observing a decrease in the number of symptoms of metastatic cancer in the subject or by observing a decrease in the severity, frequency, and / or duration of one or more symptoms of metastatic cancer in the subject. Various symptoms of metastatic cancer are known in the art and are described herein. Non-limiting examples of symptoms of metastatic cancer in a lymph node include pain in the lymph node, swelling of the lymph node, loss of appetite, and weight loss.

[0200] In some embodiments, treatment with the nanoparticles disclosed herein increases (e.g., significantly increases) the chance of survival from primary or metastatic cancer in a subject (e.g., as compared to a population of subjects having similar primary or metastatic cancer but receiving different therapeutic treatments or no therapeutic treatment). In some embodiments, treatment with the nanoparticles disclosed herein improves the prognosis of a subject having primary or metastatic cancer (e.g., as compared to a population of subjects having similar primary or metastatic cancer but receiving different therapeutic treatments or no therapeutic treatment).

[0201] Method for reducing invasion or metastasis of cancer cells

[0202] Also provided is a method for reducing invasion or metastasis of cancer cells in a subject, comprising administering to the subject an amount of at least one nanoparticle described herein sufficient to reduce invasion or metastasis of cancer cells in the subject (e.g., a significant or observable reduction).

[0203] In some embodiments of these methods, metastasis of cancer cells is from a primary tumor (e.g., any of the primary tumors described herein) in the subject to secondary tissue (e.g., lymph nodes). In some embodiments of these methods, metastasis of cancer cells is from lymph nodes in the subject to secondary tissue (e.g., any of the secondary tissues described herein).

[0204] In some embodiments, invasion of cancer cells is migration of cancer cells into tissue adjacent to the primary tumor. In some embodiments, invasion of cancer cells is migration of cancer cells from the primary tumor into the lymphatic system. In some embodiments, invasion of cancer cells is migration of metastatic cancer cells present in the subject's lymph nodes into the lymphatic system or migration of metastatic cancer cells present in secondary tissue into adjacent tissue.

[0205] The invasion of cancer cells in a subject can be evaluated or monitored by visualization using any of the imaging techniques described herein. For example, one or more tissues of a subject having cancer or metastatic cancer can be visualized at two or more time points (e.g., immediately after diagnosis of cancer and at a later time point). In some embodiments, a decrease in the invasion of cancer cells in a subject can be detected by observing a decrease in the spread of the primary tumor through a particular tissue of the subject (where the spread of the primary tumor is known in the art or is evaluated by the imaging techniques described herein). In some embodiments, a decrease in the invasion of cancer cells can be detected by a decrease in the number of circulating primary cancer cells or circulating metastatic cancer cells in the blood or lymph of the subject.

[0206] The metastasis of cancer cells can be detected using any of the methods described herein or known in the art. For example, the success of a decrease in the metastasis of cancer cells can be observed as a decrease in the rate of development of additional metastatic tumors in a subject already having at least one metastatic tumor (e.g., a subject having a metastatic tumor in a lymph node) (e.g., compared to the rate of development of additional metastatic tumors in a subject or population of subjects having similar metastatic tumors but not receiving treatment or receiving an alternative treatment). The success of a decrease in the metastasis of cancer cells can also be observed as a decrease in the risk of developing at least one metastatic cancer (e.g., metastatic cancer in a lymph node) in a subject having (e.g., diagnosed with) a primary cancer (e.g., primary breast cancer) (e.g., compared to the risk of developing metastatic cancer in a subject or population of subjects having similar primary cancers but not receiving treatment or receiving an alternative treatment).

[0207] Also provided herein is a method of detecting, diagnosing, and / or monitoring cancer (e.g., metastatic cancer) in a subject, comprising administering any of the nanoparticles disclosed herein to a subject having cancer (e.g., metastatic cancer) and imaging the nanoparticles.

[0208] In some embodiments of these methods, the nanoparticles are administered in an amount sufficient to image the nanoparticles in a subject. In some embodiments, the amount of nanoparticles sufficient to detect, diagnose, and / or monitor cancer (e.g., metastatic cancer) in a subject is less than about 0.020 mg / kg (e.g., about 0.001 mg / kg to about 0.005 mg / kg, about 0.005 to about 0.010 mg / kg, about 0.010 mg / kg to about 0.015 mg / kg, about 0.011 mg / kg to about 0.015 mg / kg, about 0.012 mg / kg to about 0.015 mg / kg, about 0.013 mg / kg to about 0.015 mg / kg, about 0.012 mg / kg to about 0.016 mg / kg, about 0.013 mg / kg to about 0.017 mg / kg, about 0.013 mg / kg to about 0.018 mg / kg, or about 0.015 mg / kg to about 0.020 mg / kg). In some embodiments, the amount of nanoparticles sufficient to detect, diagnose, and / or monitor cancer (e.g., metastatic cancer) in a subject is less than about 0.001 mg / kg. In some embodiments, the amount of nanoparticles sufficient to detect, diagnose, and / or monitor cancer (e.g., metastatic cancer) in a subject is less than about 0.014 mg / kg. In some embodiments, the amount of nanoparticles sufficient to detect, diagnose, and / or monitor cancer (e.g., metastatic cancer) in a subject does not induce drug side effects in the subject.

[0209] In some embodiments, imaging is performed using non-invasive imaging techniques. In some embodiments, imaging is performed using minimally invasive imaging techniques. As used herein, the term "minimally invasive imaging technique" includes imaging techniques that use an internal probe or injection of the compositions provided herein via a syringe. Exemplary imaging techniques include, but are not limited to, magnetic resonance imaging (MRI), tomographic imaging, positron emission tomography (PET) imaging, single photon emission computed tomography (SPECT) imaging, computed tomography (CT) imaging, PET using CT imaging, PET-MRI imaging, or any combination thereof. In some embodiments, imaging is performed by PET-MRI. In some embodiments, the nanoparticles of the present disclosure can accumulate in cancer (e.g., metastatic cancer) tissue and thus can be effective in highlighting the cancer when imaged (e.g., by PET or PET-MRI). In some embodiments, the subject is imaged to determine the location or number of tumor cells in the subject. In some embodiments, the subject is imaged to determine the location of the nanoparticles in the subject.

[0210] In some embodiments, the methods provided herein further include waiting for a sufficient time to allow the nanoparticles to accumulate in a cancer-associated cell or tissue site (e.g., a cell or tissue site of the subject) prior to imaging. In some embodiments, the methods provided herein further include waiting for a sufficient time to allow the nanoparticles to accumulate in a cancer-associated cell or tissue site (e.g., a cell or tissue site of the subject) prior to administering a dose of radiation to the subject. In some embodiments, the methods provided herein further include waiting for a sufficient time to allow the nanoparticles to accumulate in a cancer-associated cell or tissue site (e.g., a cell or tissue site of the subject) prior to and / or prior to imaging the subject, before administering a dose of radiation to the subject.

[0211] In some embodiments, the time sufficient to accumulate the nanoparticles in the cells or tissue site is from about 30 seconds to about 24 hours, such as from about 30 seconds to about 24 hours, from about 30 seconds to about 12 hours, from about 30 seconds to about 6 hours, from about 30 seconds to about 2 hours, from about 30 seconds to about 1 hour, from about 30 seconds to about 30 minutes, from about 30 seconds to about 10 minutes, from about 10 minutes to about 24 hours, from about 10 minutes to about 12 hours, from about 10 minutes to about 6 hours, from about 10 minutes to about 2 hours, from about 10 minutes to about 1 hour, from about 10 minutes to about 30 minutes, from about 30 minutes to about 24 hours, from about 30 minutes to about 12 hours, from about 30 minutes to about 6 hours, from about 30 minutes to about 2 hours, from about 30 minutes to about 1 hour, from about 1 hour to about 24 hours, from about 1 hour to about 12 hours, from about 1 hour to about 6 hours, from about 1 hour to about 2 hours, from about 2 hours to about 24 hours, from about 2 hours to about 12 hours, from about 2 hours to about 6 hours, from about 6 hours to about 24 hours, from about 6 hours to about 12 hours, or from about 12 hours to about 24 hours.

[0212] In some embodiments, the subject is administered one or more doses of radiation (e.g., ionizing radiation). In some embodiments, the radiation damages cells by inducing ionization and DNA damage. In some embodiments, the radiation can directly or indirectly induce a change in the expression level of miRNA (e.g., miR10b). In some embodiments, the radiation of the nanoparticles can enhance the radiation damaging effect on a local area. In some embodiments, the radiation of the nanoparticles can enhance the radiosensitivity of cancer. In some embodiments, the radiation is external beam radiation therapy (EBRT).

[0213] RIG-I receptor-activated immune response

[0214] As previously described, RIG-I is a cytosolic nucleic acid that senses pattern recognition receptors (PRRs) of the innate immune system. It is essential for recognizing RNA structures (such as viruses) using the 5'-triphosphate signature. RIG-I activation can be programmed as an immune response against cancer. Importantly, tumor cell death by RIG-I has been shown to build immune memory, which means that once the body's immune system is activated, the body becomes immune and the tumor is rejected as "foreign".

[0215] In some embodiments, the present disclosure contemplates a method for generating a localized immune response, the method comprising administering to a subject a therapeutically effective amount of a nanoparticle comprising a nanoparticle core; a radiolabel; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment, thereby generating a localized immune response. Without wishing to be bound by theory, the nanoparticle delivers the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide to cancer cells. When the single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide forms a duplex with a tumor-specific RNA, thereby eliciting a tumor-specific immune response via the RIG-I signaling pathway, the immune system is selectively activated in cancer cells. In some embodiments, administration of the modified RNA oligonucleotide induces an antiviral response, particularly a type I IFN response. In some embodiments, the type I IFN response is an IFN-α response. In some embodiments, RIG-I activation elicits a tumor-specific immune response (e.g., a response against tumor cells that highly express tumor-specific RNA). In some embodiments, the tumor-specific immune response comprises the release of type I IFN, DAMPs (danger-associated molecular patterns), and / or tumor antigens. In some embodiments, the method induces immune memory against the tumor cells. In some embodiments, the method increases the localized immune response against cancer. In some embodiments, the method increases the localized immune response by at least 1-fold. In some embodiments, the method increases the localized immune response by at least 2-fold (e.g., at least 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, or 100-fold). In some embodiments, the method increases the localized immune response by at least 3-fold. In some embodiments, the method increases the localized immune response by at least 4-fold. In some embodiments, the method increases the localized immune response by at least 5-fold. In some embodiments, the method increases the localized immune response by at least 6-fold. In some embodiments, the method increases the localized immune response by at least 7-fold.In some embodiments, the method increases the local immune response by at least 8-fold. In some embodiments, the method increases the local immune response by at least 9-fold. In some embodiments, the method increases the local immune response by at least 10-fold. In some embodiments, the method increases the local immune response by at least 15-fold. In some embodiments, the method increases the local immune response by at least 20-fold. In some embodiments, the method increases the local immune response by at least 30-fold. In some embodiments, the method increases the local immune response by at least 40-fold. In some embodiments, the method increases the local immune response by at least 50-fold. In some embodiments, the method increases the local immune response by at least 60-fold. In some embodiments, the method increases the local immune response by at least 70-fold. In some embodiments, the method increases the local immune response by at least 80-fold. In some embodiments, the method increases the local immune response by at least 90-fold. In some embodiments, the method increases the local immune response by at least 100-fold.

[0216] In some embodiments, the administration of the nanoparticles comprising the modified RNA oligonucleotide induces apoptosis of tumor cells. In some embodiments, the administration of the nanoparticles induces (a) an antiviral response, particularly a type I IFN response, and (b) downregulates tumor-specific RNAs (e.g., miRNA21) in vertebrates, particularly mammals. The present application further provides the use of at least one nanoparticle for the preparation of a pharmaceutical composition for inducing apoptosis of tumor cells in vertebrates, particularly mammals.

[0217] Methods and / or compositions are described herein for inducing a tumor-specific immune response by administration of nanoparticles, thereby activating the body's immune system to effect a desired treatment response (e.g., addressing and / or creating anti-tumor immune memory in an animal). Without wishing to be bound by theory, as shown in FIG. 1, the RIG-I pathway is selectively activated in cancer cells by in situ generation of 5'ppp double-stranded RNA following introduction of a 5'ppp single-stranded RNA oligonucleotide complementary to a miRNA or mRNA specifically expressed in cancer cells; the same or similar is expected from 5'pp single-stranded RNA. As a result, the anti-tumor immune capacity of the tumor microenvironment (TME) can be revealed by activation of the RIG-I signaling pathway in conjunction with co-activation of certain tumor suppressor gene(s) by simply using single-stranded RNA. In some embodiments, the modified RNA oligonucleotide in FIG. 1 is delivered to cancer using radiolabeled nanoparticles.

[0218] 6. Pharmaceutical Compositions and Modes of Administration

[0219] In embodiments provided herein, a pharmaceutical composition comprises an effective amount of a RIG-I agonist precursor comprising a single-stranded 5'-non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA. In certain embodiments, the pharmaceutical composition comprises a nanoparticle having a core-shell structure, wherein the shell comprises a RIG-I agonist precursor comprising a single-stranded 5'-non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA. In specific embodiments, the nanoparticle comprises a radiolabel.

[0220] In certain embodiments, in any of the methods described herein, nanoparticles comprising a nanoparticle core, a radiolabel, and a modified RNA oligonucleotide can be administered by a healthcare provider (e.g., a physician, physician assistant, nurse, or laboratory or clinic worker), the subject (i.e., self-administration), or a friend or family member of the subject. Administration can be performed at the clinical site (e.g., a clinic or hospital), in a skilled nursing facility, or at a pharmacy.

[0221] In some embodiments, at least two (e.g., at least 2, 3, or 4) of any of the types of nanoparticles described herein may be present in a pharmaceutical composition in any combination. The pharmaceutical composition can be formulated in any manner known in the art.

[0222] The pharmaceutical composition is formulated to be compatible with its intended route of administration (e.g., intravenous, intraarterial, intramuscular, intradermal, subcutaneous, or intraperitoneal). In some embodiments, the compositions provided herein may include a pharmaceutically acceptable diluent (e.g., a sterile diluent). In some embodiments, pharmaceutically acceptable diluents include sterile water, sterile saline, fixed oils, polyethylene glycol, glycerin, propylene glycol or other synthetic solvents, antibacterial or antifungal agents, such as benzyl alcohol or methylparaben, chlorobutanol, phenol, ascorbic acid, thimerosal, etc., antioxidants, such as ascorbic acid or sodium bisulfite, chelating agents, such as ethylenediaminetetraacetic acid, buffers, such as acetate, citrate, or phosphate, and isotonic agents, such as sugars (e.g., dextrose), polyalcohols (e.g., mannitol or sorbitol), or salts (e.g., sodium chloride), or any combination thereof.

[0223] In some embodiments, the pharmaceutical compositions provided herein may include a pharmaceutically acceptable carrier. Liposome suspensions can also be used as a pharmaceutically acceptable carrier (see, e.g., U.S. Patent No. 4,522,811).

[0224] The preparation of the composition can be formulated and encapsulated in an ampoule, a disposable syringe, or a multi-dose vial. If necessary (for example, as in the case of an injectable preparation), appropriate fluidity can be maintained by using a coating agent such as lecithin or a surfactant. The absorption of the nanoparticles can be extended by including an agent that delays absorption (for example, aluminum monostearate and gelatin). Alternatively, controlled release can be achieved by an implant and a microencapsulated delivery system that may include a biodegradable, biocompatible polymer (for example, ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoester, and polylactic acid; Alza Corporation and Nova Pharmaceutical, Inc.).

[0225] A composition containing any one or more of the nanoparticles described herein can be formulated for parenteral (for example, intravenous, intraarterial, intramuscular, intradermal, subcutaneous, or intraperitoneal) administration in a unit dosage form (that is, a physically discrete unit containing a predetermined amount of the active compound for ease of administration and uniformity of dosage). In some embodiments, a composition containing any one or more of the nanoparticles described herein can be administered (injected) directly into the lymph nodes of a subject. In some embodiments, a composition containing any one or more of the nanoparticles described herein can be formulated into a dosage form that is an injection, a tablet, a lyophilized powder / dispersion, a suspension, or any combination thereof. In some embodiments, a composition containing any one or more of the nanoparticles described herein can be formulated for immediate release, controlled release, timed release, sustained release, extended release, or continuous release.

[0226] The pharmaceutical composition can be administered by any route known in the art, including but not limited to topical, enteral, and parenteral routes, provided that it is compatible with the intended application. Examples of topical administration include, but are not limited to, on the skin, inhalation, intranasal, vaginal administration, enema, eye drops, and ear drops. Examples of enteral administration include, but are not limited to, oral, rectal administration, and administration via a feeding tube. Examples of parenteral administration include, but are not limited to, intravenous, intraarterial, intramuscular, intracardiac, subcutaneous, intraosseous, intradermal, intrathecal, intraperitoneal, transdermal, transmucosal, and inhalation administration. The pharmaceutical composition can be used for prophylactic and / or therapeutic purposes.

[0227] In some embodiments, the subject is administered a composition comprising at least 1 (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30) dose of at least 1 (e.g., 1, 2, 3, or 4) of any of the nanoparticles described herein. In some embodiments of any of the methods described herein, the subject is administered a nanoparticle comprising at least 1 (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30) dose of at least 1 (e.g., 1, 2, 3, or 4) of any of the modified RNA oligonucleotides described herein.

[0228] The toxicity and therapeutic efficacy of the composition can be determined by standard pharmaceutical procedures in cell cultures or experimental animals (e.g., monkeys). Those skilled in the art can determine, for example, the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population): the therapeutic index is the ratio of LD50:ED50. Agents with a high therapeutic index are preferred. If the agent exhibits undesirable side effects, care should be taken to minimize potential damage (i.e., to reduce undesirable side effects). Toxicity and therapeutic efficacy can be determined by other standard pharmaceutical procedures.

[0229] Data obtained from cell culture assays and animal studies can be used to formulate an appropriate dosage of any given agent for use in a subject (e.g., a human). A therapeutically effective amount of one or more (e.g., 1, 2, 3, or 4) nanoparticles (e.g., any of the nanoparticles described herein) is an amount that results in one of the following: (1) a decrease in invasion or metastasis of cancer cells in a subject having cancer (e.g., breast cancer); (2) treatment of metastatic cancer in a subject's lymph nodes; (3) a decrease or stabilization in the size of a metastatic tumor in a subject's lymph nodes; (4) a decrease in the rate of metastatic tumor growth in a subject's lymph nodes; (5) a decrease in the severity, frequency, and / or duration of one or more symptoms of metastatic cancer in a subject's (e.g., a human's) lymph nodes; or (6) a decrease in the number of symptoms of metastatic cancer in a subject's lymph nodes (e.g., compared to a control subject having the same disease but not receiving treatment, or receiving a different treatment, or the same subject prior to treatment).

[0230] The effectiveness and administration of any of the nanoparticles described herein can be determined by medical practitioners using methods known in the art, as well as by observation of one or more symptoms of metastatic cancer in a subject's (e.g., a human's) lymph nodes. Certain factors can affect the dosage and timing required to effectively treat a subject (e.g., the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and the presence of other diseases).

[0231] Exemplary dosages include milligram or microgram amounts of any of the nanoparticles described herein per kilogram of the subject's body weight. For example, in some embodiments, the nanoparticles can be administered to the subject at a dosage of less than about 0.020 mg / kg (e.g., about 0.001 mg / kg to about 0.005 mg / kg, about 0.005 to about 0.010 mg / kg, about 0.010 mg / kg to about 0.015 mg / kg, about 0.011 mg / kg to about 0.015 mg / kg, about 0.012 mg / kg to about 0.015 mg / kg, about 0.013 mg / kg to about 0.015 mg / kg, about 0.012 mg / kg to about 0.016 mg / kg, about 0.013 mg / kg to about 0.017 mg / kg, about 0.013 mg / kg to about 0.018 mg / kg, or about 0.015 mg / kg to about 0.020 mg / kg). In some embodiments, the nanoparticles can be administered to the subject at a dosage of less than about 0.014 mg / kg. In some embodiments, the nanoparticles can be administered to the subject at a dosage of less than about 0.014 mg / kg for imaging, detecting, diagnosing, and / or monitoring metastatic cancer tissue in the subject.

[0232] In some embodiments, the nanoparticles can be administered to a subject at a dosage in the range of about 1 mg / kg to about 10 mg / kg (e.g., about 1 mg / kg to about 5 mg / kg, about 1 to about 7 mg / kg, about 2 mg / kg to about 7 mg / kg, about 2 mg / kg to about 8 mg / kg, about 2 mg / kg to about 9 mg / kg, about 2 mg / kg to about 10 mg / kg, about 3 mg / kg to about 5 mg / kg, about 3 mg / kg to about 6 mg / kg, about 3 mg / kg to about 7 mg / kg, about 3 mg / kg to about 8 mg / kg, about 3 mg / kg to about 9 mg / kg, about 3 mg / kg to about 10 mg / kg, about 4 mg / kg to about 5 mg / kg, about 4 mg / kg to about 6 mg / kg, about 4 mg / kg to about 7 mg / kg, about 4 mg / kg to about 8 mg / kg, about 4 mg / kg to about 9 mg / kg, about 4 mg / kg to about 10 mg / kg, about 5 mg / kg to about 6 mg / kg, about 5 mg / kg to about 7 mg / kg, about 5 mg / kg to about 8 mg / kg, about 5 mg / kg to about 9 mg / kg, about 5 mg / kg to about 10 mg / kg, about 6 mg / kg to about 7 mg / kg, about 6 mg / kg to about 8 mg / kg, about 6 mg / kg to about 9 mg / kg, about 6 mg / kg to about 10 mg / kg, about 7 mg / kg to about 8 mg / kg, about 7 mg / kg to about 9 mg / kg, or about 7 mg / kg to about 10 mg / kg). In some embodiments, the nanoparticles can be administered to a subject at a dosage of about 5 mg / kg to about 7 mg / kg. In some embodiments, the nanoparticles can be administered to a subject at a dosage less than about 5 mg / kg to about 7 mg / kg to treat metastatic cancer in the subject and / or to reduce cell invasion or metastasis.

[0233] These dosages encompass a certain range, and those skilled in the art will understand that the therapeutic agent containing the nanoparticles described herein varies in its efficacy and that the effective amount can be determined by methods known in the art. Typically, a relatively low dosage is initially administered, and the attending medical personnel (in the case of therapeutic applications) or researchers (if still working during the development stage) may then gradually increase the dosage until an appropriate response is obtained. Further, it is understood that the specific dosage level for any particular subject depends on various factors including the activity of the specific compound being used, the age, weight, general health, sex, and diet of the subject, the time of administration, the route of administration, the rate of excretion, and the half-life of the nanoparticles in vivo.

[0234] In some embodiments, the nanoparticles are administered to the subject once a day. In some embodiments, the nanoparticles are administered to the subject twice a day. In some embodiments, the nanoparticles are administered to the subject once a week. In some embodiments, the nanoparticles are administered to the subject twice a week. In some embodiments, the nanoparticles are administered to the subject three times a week. In some embodiments, the nanoparticles are administered to the subject every two weeks. In some embodiments, the nanoparticles are administered to the subject every three weeks. In some embodiments, the nanoparticles are administered to the subject every four weeks. In some embodiments, the nanoparticles are administered to the subject monthly.

[0235] The pharmaceutical composition can be contained in a kit, container, pack, or dispenser together with instructions for administration.

[0236] In some embodiments, the pharmaceutical composition further comprises an agent that facilitates the delivery of the nanoparticles to the cell, particularly the cytosol of the cell. In some embodiments, the delivery agent is a micelle, a lipid nanoparticle (LNP), a spherical nucleic acid (SNA), an extracellular vesicle, a synthetic vesicle, an exosome, a lipidoid, a liposome, or a lipoplex.

[0237] In some embodiments, the pharmaceutical composition may further comprise another agent, such as an agent that stabilizes the modified RNA oligonucleotide of the nanoparticle. Examples of stabilizers include proteins that complex with the modified RNA oligonucleotide to form iRNPs, chelating agents such as EDTA, salts, and RNase inhibitors.

[0238] In some embodiments, the pharmaceutical composition, particularly the pharmaceutical composition comprising the nanoparticles described herein, further comprises one or more pharmaceutically active therapeutic agents. Examples of pharmaceutically active agents include immunostimulants, antiviral agents, antibiotics, antifungal agents, antiparasitic agents, antitumor agents, cytokines, chemokines, growth factors, anti-angiogenic factors, chemotherapeutic agents, antibodies, and gene silencing agents. Preferably, the pharmaceutically active agent is selected from the group consisting of immunostimulants, antiviral agents, and antitumor agents. More than one pharmaceutically active agent may be of the same or different categories.

[0239] In some embodiments, the pharmaceutical composition, particularly the pharmaceutical composition comprising the nanoparticles described herein, further comprises an antigen, an antiviral vaccine, an antibacterial vaccine, and / or an antitumor vaccine, wherein the vaccine may be prophylactic and / or therapeutic.

[0240] In some embodiments, the pharmaceutical composition, particularly the pharmaceutical composition comprising the nanoparticles described herein, further comprises retinoic acid, IFN-α, and / or IFN-β. Without being bound by any theory, retinoic acid, IFN-α, and / or IFN-β may perhaps be able to prime cells for IFN-α production, possibly by upregulating RIG-I expression.

[0241] In some embodiments, a pharmaceutical composition, particularly a pharmaceutical composition comprising the nanoparticles described herein, further comprises at least one additional therapeutic agent. In some embodiments, the at least one additional therapeutic agent is a chemotherapeutic agent (e.g., cyclophosphamide, mechlorethamine, chlorambucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, valrubicin, paclitaxel, docetaxel, etoposide, teniposide, tafuriposide, azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, thioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, bortezomib, carfilzomib, salinosporamide A, all-trans retinoic acid, vinblastine, vincristine, vindesine, and vinorelbine) and / or an analgesic (e.g., acetaminophen, diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, mefenamic acid, meloxicam, nabumetone, naproxen, oxaprozin, phenylbutazone, piroxicam, sulindac, tolmetin, celecoxib, buprenorphine, butorphanol, codeine, hydrocodone, hydromorphone, levorphanol, meperidine, methadone, morphine, nalbuphine, oxycodone, oxymorphone, pentazocine, propoxyphene, and tramadol).

[0242] In some embodiments, the at least one additional therapeutic agent is an immunogenic cell death inducer (ICDi) (e.g., daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel). In some embodiments, the at least one additional therapeutic agent is siRNA therapy. In some embodiments, the siRNA therapy targets genes associated with cancer (e.g., PD-L1, CTLA-4, TGF-β, and / or VEGF).

[0243] In some embodiments, at least one additional therapeutic agent is a targeted therapy. Targeted therapy is the basis of what is also referred to as precision medicine, a form of medicine that uses information about human genes and proteins to prevent, diagnose, and treat diseases. Such therapeutic agents may also be referred to as "molecularly targeted drugs" or similar names. The process of searching for them is often referred to as "rational drug design". This concept is also sometimes referred to as "personalized medicine".

[0244] Molecularly targeted drugs interact with specific target molecules, or a set of structurally related target molecules, in a pathway and thus modulate the endpoint effects of that pathway, such as disease-related processes, and thus obtain a therapeutic benefit.

[0245] Molecularly targeted drugs can be small molecules or biopharmaceuticals, usually antibodies. They can be useful alone or in combination with other therapeutic agents and methods.

[0246] Because they target specific molecules, or a set of related molecules, and are usually designed to minimize their interactions with other molecules, targeted therapeutic agents can have fewer adverse side effects. Broadly speaking, targeted cancer drugs block cancer growth and spread by interacting with specific molecules or a set of structurally related molecules (collectively, "molecular targets") involved in cancer growth, progression, lack of suppression or removal, or spread. Such molecular targets may include proteins or genes involved in one or more cellular functions, including, but not limited to, signal transduction, gene expression modulation, induction or suppression of apoptosis, angiogenesis inhibition, or immune system modulation.

[0247] Targeted therapeutic monoclonal antibodies (mAbs) and targeted small molecules are used as cancer treatments. They are used as monotherapies or, in particular, in combination with other conventional therapeutic modalities, especially when the disease under treatment is refractory to treatments using only the prior art. In some embodiments, at least one additional therapeutic agent is a molecularly targeted therapy. In some embodiments, the molecularly targeted therapy is selected from the group consisting of trastuzumab, ziotrif, proleukin, alectinib, campath, atezolizumab, avelumab, axitinib, belimumab, belinostat, bevacizumab, belkyd, canakinumab, ceritinib, cetuximab, crizotinib, dabrafenib, daratumumab, dasatinib, denosumab, elotuzumab, enasidenib, erlotinib, gefitinib, ibrutinib, zydelig, imatinib, lenvatinib, midostaurin, necitumumab, niraparib, obinutuzumab, osimertinib, panitumumab, regorafenib, rituximab, luxolitinib, sorafenib, tocilizumab, and trastuzumab.

[0248] In some embodiments, at least one additional therapeutic agent is an immunotherapy. As used herein, the term "immunotherapy" refers to a compound, composition or treatment that indirectly or directly enhances, stimulates or increases the body's immune response against cancer cells and / or reduces the side effects of other anti-cancer treatments. Immunotherapy is thus a treatment that directly or indirectly stimulates or enhances the immune system's response against cancer cells and / or reduces the side effects that can be caused by other anti-cancer agents. Immunotherapy is also referred to in the art as immunogenic therapy, biological therapy, biologic response modifier therapy and biotherapy. Examples of common immunotherapeutic agents known in the art include, but are not limited to, cytokines, cancer vaccines, monoclonal antibodies and non-cytokine adjuvants. Alternatively, an immunotherapy treatment may consist of administering a certain amount of immune cells (such as T cells, NK cells, dendritic cells, B cells, etc.) to a subject.

[0249] Immunotherapeutic agents may be non-specific, i.e., they may boost the immune system generally so that the human body becomes more effective in fighting the growth and / or spread of cancer cells, or they may be specific, i.e., they can target the cancer cells themselves, and an immunotherapy regimen may combine the use of non-specific and specific immunotherapeutic agents.

[0250] Non-specific immunotherapeutic agents are substances that stimulate or indirectly improve the immune system. Non-specific immunotherapeutic agents have been used alone as a primary treatment for cancer and, in addition to the primary treatment, when the non-specific immunotherapeutic agent functions as an adjuvant to enhance the effectiveness of other treatments (e.g., cancer vaccines). Non-specific immunotherapeutic agents can also function in this latter context to reduce the side effects of other treatments, such as myelosuppression induced by certain chemotherapeutic agents. Non-specific immunotherapeutic agents act on important immune system cells and can cause secondary responses such as an increase in the production of cytokines and immunoglobulins. Alternatively, the agent may itself contain cytokines. Non-specific immunotherapeutic agents are generally classified as cytokines or non-cytokine adjuvants.

[0251] In some embodiments, the immunotherapy is selected from the group consisting of pembrolizumab (Keytruda®), nivolumab (Opdivo®), atezolizumab (Tecentriq®), ipilimumab (Yervoy®), avelumab (Bavencio®), and durvalumab (Imfinzi®). In some embodiments, the subject has received or is receiving anti-PD-1, anti-PD-L1, or anti-CTLA4 therapy. Alternatively, any method may further comprise administering to the subject an effective amount of anti-PD-1, anti-PD-L1, or anti-CTLA4 therapy. In some examples, the anti-PD-1, anti-PD-L1, or anti-CTLA4 therapy may each comprise an anti-PD-1, anti-PD-L1, or anti-CTLA4 antibody. Exemplary anti-PD-1 antibodies include pembrolizumab, nivolumab, and AMP-224, or antigen-binding fragments thereof. Exemplary anti-CTLA-4 antibodies include ipilimumab, and tremelimumab, or antigen-binding fragments thereof. Exemplary anti-PD-L1 antibodies include durvalumab, atezolizumab, and avelumab, or antigen-binding fragments thereof.

[0252] In some embodiments, at least one additional therapeutic agent and at least one nanoparticle are administered in the same composition (e.g., the same pharmaceutical composition). In some embodiments, at least one additional therapeutic agent and at least one nanoparticle are administered to the subject using different routes of administration (e.g., at least one additional therapeutic agent delivered by oral administration and at least one nanoparticle delivered by intravenous administration). "At least one" means that one or more nanoparticles of the same or different nanoparticles (plural) can be used together.

[0253] In some embodiments, at least one additional therapeutic agent can be administered to a subject prior to administering at least one nanoparticle (e.g., any of the nanoparticles described herein). In some embodiments, one or more additional therapeutic agents can be administered to a subject after administering at least one nanoparticle. In some embodiments, one or more additional therapeutic agents and at least one nanoparticle are administered to a subject such that the biological activity periods of the one or more additional therapeutic agents and the at least one nanoparticle in the subject overlap.

[0254] In some embodiments, a subject can be administered at least one nanoparticle or pharmaceutical composition (e.g., any of the nanoparticles or pharmaceutical compositions described herein) over a long period of time (e.g., over at least 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1 year, 2 years, 3 years, 4 years, 5 years, or 10 years). A skilled medical practitioner can determine the length of the treatment period using any of the methods described herein (e.g., using the methods described above and methods known in the art) to diagnose or monitor the effectiveness of the treatment. As described herein, a skilled medical practitioner can also vary (e.g., increase or decrease) the identity and number of nanoparticles (and / or one or more additional therapeutic agents) administered to a subject and, based on an assessment of the effectiveness of the treatment (e.g., using any of the methods described herein and methods known in the art), adjust (e.g., increase or decrease) the dosage or frequency of administration of at least one nanoparticle (and / or one or more additional therapeutic agents) to the subject. A skilled medical practitioner can further determine when treatment should be discontinued (e.g., when, for example, the subject's symptoms have significantly decreased).

[0255] 7. Method for Preparing Nanoparticles

[0256] Also, a method for preparing any of the nanoparticles of the present disclosure, comprising preparing a nanoparticle core (e.g., by any one of the methods described elsewhere in this specification), covalently linking a nucleic acid molecule to the nanoparticle core (NC), covalently linking a chelating agent to the nanoparticle core (e.g., a magnetic nanoparticle core) by reacting the nanoparticle core with the chelating agent at a ratio of about 40:1 equivalents (eq.) (i.e., 40 equivalents of the chelating agent per 1 equivalent of the nanoparticle core), 64 adding a solution of CuCh to the nanoparticle core, and 64 purifying the mixture of the CuCh solution and the nanoparticle core to obtain the nanoparticles, is also provided herein.

[0257] In some embodiments, the method has a ratio in the range of about 5:1 chelating agent eq.:NC to about 60:1 chelating agent eq.:NC (e.g., about 5:1 chelating agent eq.:NC to about 10:1 chelating agent eq.:NC, about 5:1 chelating agent eq.:NC to about 12:1 chelating agent eq.:NC, about 5:1 chelating agent eq.:NC to about 15:1 chelating agent eq.:NC, about 5:1 chelating agent eq.:NC to about 20:1 chelating agent eq.:NC, about 5:1 chelating agent eq.:NC to about 25:1 chelating agent eq.:NC, about 5:1 chelating agent eq.:NC to about 30:1 chelating agent eq.:NC, about 5:1 chelating agent eq.:NC to about 35:1 chelating agent eq.:NC, about 5:1 chelating agent eq.:NC to about 40:1 chelating agent eq.:NC, about 5:1 chelating agent eq.:NC to about 45:1 chelating agent eq.:NC, about 5:1 chelating agent eq.:NC to about 50:1 chelating agent eq.:NC, about 5:1 chelating agent eq.:NC to about 55:1 chelating agent eq.:NC, or about 5:1 chelating agent eq.:NC to about 60:1 chelating agent eq.:NC, about 10:1 chelating agent eq.:NC to about 12:1 chelating agent eq.:NC, about 10:1 chelating agent eq.:NC to about 15:1 chelating agent eq.:NC, about 10:1 chelating agent eq.:NC to about 20:1 chelating agent eq.:NC, about 10:1 chelating agent eq.:NC to about 25:1 chelating agent eq.:NC, about 10:1 chelating agent eq.:NC to about 30:1 chelating agent eq.:NC, about 10:1 chelating agent eq.:NC to about 35:1 chelating agent eq.:NC, about 10:1 chelating agent eq.:NC to about 40:1 chelating agent eq.:NC, about 10:1 chelating agent eq.:NC to about 45:1 chelating agent eq.:NC, about 10:1 chelating agent eq.:NC to about 50:1 chelating agent eq.:NC, about 10:1 chelating agent eq.:NC to about 55:1 chelating agent eq.:NC, or about 10:1 chelating agent eq.:NC to about 60:1 chelating agent eq.:NC, about 15:1 chelating agent eq.:NC to about 20:1 chelating agent eq.:NC, about 15:1 chelating agent eq.:NC to about 25:1 chelating agent eq.:NC, about 15:1 chelating agent eq.:NC to about 30:1 chelating agent eq.:NC, about 15:1 chelating agent eq.:NC to about 35:1 chelating agent eq.:NC, about 15:1 chelating agent eq.:NC to about 40:1 chelating agent eq.:NC, chelating agent eq.:NC from about 15:1 to about 45:1, chelating agent eq.:NC from about 15:1 to about 50:1, chelating agent eq.:NC from about 15:1 to about 55:1, or chelating agent eq.:NC from about 15:1 to about 60:1, chelating agent eq.:NC from about 20:1 to about 45:1, chelating agent eq.:NC from about 25:1 to about 45:1, chelating agent eq.:NC from about 30:1 to about 45:1, chelating agent eq.:NC from about 35:1 to about 45:1, chelating agent eq.:NC from about 40:1 to about 45:1, chelating agent eq.:NC from about 35:1 to about 50:1, chelating agent eq.:NC from about 38:1 to about 40:1, chelating agent eq.:NC from about 38:1 to about 42:1, chelating agent eq.:NC from about 38:1 to about 45:1, chelating agent eq.:NC from about 40:1 to about 50:1, chelating agent eq.:NC from about 40:1 to about 55:1, or chelating agent eq.:NC from about 40:1 to about 60:1), and reacting a chelating agent with a nanoparticle core.

[0258] In some embodiments, covalently linking a chelating agent to a nanoparticle core is performed at a temperature of about 0°C to about 8°C (e.g., about 0°C to about 4°C, about 1°C to about 4°C, about 2°C to about 4°C, about 3°C to about 4°C, about 2°C to about 6°C, about 3°C to about 7°C, about 4°C to about 5°C, about 4°C to about 6°C, about 4°C to about 7°C, or about 4°C to about 8°C). In some embodiments, covalently linking a chelating agent to a nanoparticle core is performed at a temperature of about 4°C.

[0259] In some embodiments, these methods 64The method further includes heating a mixture of a solution of CuCh and the nanoparticle core at a temperature of from about 40 °C to about 65 °C (such as from about 40 °C to about 65 °C, from about 45 °C to about 65 °C, from about 50 °C to about 65 °C, from about 55 °C to about 65 °C, from about 56 °C to about 65 °C, from about 57 °C to about 65 °C, from about 58 °C to about 65 °C, from about 59 °C to about 65 °C, from about 58 °C to about 62 °C, from about 59 °C to about 61 °C, from about 58 °C to about 63 °C, from about 59 °C to about 63 °C, from about 59 °C to about 60 °C, from about 60 °C to about 61 °C, or from about 60 °C to about 62 °C). In some embodiments, these methods 64 further include heating the mixture of the solution of CuCh and the nanoparticle core at a temperature of about 60 °C.

[0260] In some embodiments, these methods 64 further include heating the mixture of the solution of CuCh and the nanoparticle core for from about 10 minutes to about 30 minutes (such as from about 10 minutes to about 20 minutes, from about 11 minutes to about 21 minutes, from about 12 minutes to about 22 minutes, from about 13 minutes to about 23 minutes, from about 14 minutes to about 24 minutes, from about 15 minutes to about 25 minutes, from about 16 minutes to about 26 minutes, from about 13 minutes to about 20 minutes, from about 15 minutes to about 20 minutes, from about 15 minutes to about 22 minutes, from about 18 minutes to about 20 minutes, from about 18 minutes to about 22 minutes, from about 19 minutes to about 21 minutes, from about 19 minutes to about 23 minutes, from about 20 minutes to about 25 minutes, or from about 20 minutes to about 30 minutes). In some embodiments, these methods 64 further include heating the mixture of the solution of CuCh and the nanoparticle core for about 20 minutes.

[0261] In some embodiments, these methods do not expose the nanoparticles to a temperature above about 65 °C. In some embodiments, these methods do not expose the nanoparticles to a temperature above about 60 °C. In some embodiments, the methods disclosed herein advantageously avoid any harsh conditions (such as a temperature above about 60 °C for longer than about 20 minutes) that can potentially damage nucleic acid molecules by including the use of a chelating agent that associates a radiolabel with the nanoparticle core.

[0262] The abbreviations used herein, including those in the Examples, are shown below: RIGA: RIG-I agonist.

[0263] miR / miRNA: A small, evolutionarily conserved, single-stranded non-coding RNA molecule that binds to target mRNAs to prevent protein production by one of two different mechanisms.

[0264] Anti-miR / anti-miRNA: Anti-miRNA oligonucleotides (AMOs) that bind to miRNAs via complementary sequences and inhibit miRNA function in living cells.

[0265] miR-21 mimic: A synthetic miRNA-21, also used interchangeably with miR-21 / miRNA-21.

[0266] RIGA-miR-21: 5’-ppp-anti-miRNA-21.

[0267] Anti-miR-21: Anti-miRNA-21.

[0268] TTX-RIGA-miR-21: TTX-5’-ppp-anti-miR-21.

[0269] TTX-miR-21: TTX-anti-miR-21.

[0270] ppp-dsRNA / 5’-ppp-dsRNA: 5’-ppp-double-stranded RNA, a commercially available RIG-I agonist.

Examples

[0271] The present invention is generally described herein and will be more readily understood by reference to the following examples, which are included for the purpose of illustration of certain embodiments of the invention only and are not intended to limit the invention.

[0272] (Example 1) Materials and Methods

[0273] Oligonucleotides

[0274] The miRNA-21 mimics, 5’-UAGCUUAUCAGACUGAUGUUGA-3’ (SEQ ID NO: 19) and its 100% complementary sequence, [+ / -(ppp)]-5’-UCAACAUCAGUCUGAUAAGCUA-3’-(s-s) (SEQ ID NO: 6) were synthesized by Eurogentec North America (Fremont, CA). A 5’-triphosphate modification (ppp) is required for RIG-I agonism and the 3’ disulfide bond (s-s) modification conjugates the oligo to the nanoparticle via a covalent bond. A 19-mer 5’ppp-dsRNA positive control for RIG-I activation was obtained from InvivoGen (Catalog No. tlrl-3prna, San Diego, CA).

[0275] Analysis methods

[0276] Dynamic light scattering (DLS) and electrophoretic light scattering (ELS). DLS and ELS measurements were performed on a Zetasizer Lab (Malvern Panalytical, UK) with the accessory containing the sample diluted to 0.1 mg Fe / mL in dH2O.

[0277] Colorimetric quantification of iron using o-phenanthroline (OPT iron assay). The iron assay was used to determine the nanoparticle concentration expressed as iron concentration. 10 microliters of the test sample was incubated with 90 μL of 6N HCl for 10 minutes at RT. 20 μL of the digestion mixture was mixed with 20 μL of 0.4% ascorbic acid (w / v), incubated for 10 minutes at RT, and then 130 μL of 1M NaOAc in 50% ethanol (v / v) and 200 μL of 0.8% o-phenanthroline (w / v) were added. After 5 - 10 minutes at RT, the sample was diluted with 630 μL of dH2O, transferred to a microplate (3 x 250 μL), and read at 510 nm using a microplate reader.

[0278] Quantification of amine groups on nanoparticles. Surface amine groups on the nanoparticles were indirectly determined by the functionalization of TTX-NH2 (2 mg Fe) with an excess of heterobifunctional linker (2 mg SPDP / mg Fe), N-succinimidyl 3-(2-pyridyldithio)propionate (SPDP) in 33% DMSO for 1 h at RT. After purification by ultracentrifugation, the obtained particles (TTX-PDP) were diluted to 1.0 mg Fe / mL in PBS and equal volumes were dispensed into two microtubes and treated with 1.5% TCEP (pH 7) (1:5) (T-test) or PBS (C-control). After 30 min at RT, the mixture was transferred to another Amicon Ultra-0.5 mL filter and centrifuged at 14,000×g for 10 min at 4 °C. Equal volumes of the filtrate were treated with PBS (T) or 3% TCEP (C) in a ratio of 1:5 for 10 min. The reaction mixture was then measured at 343 nm in a NanoDrop spectrophotometer to quantify the released 2-MP. The difference in the readings of T and C reflects the contribution of the PDP linker and was used to calculate the number of PDP linkers on the NPs.

[0279] Determination of oligos in nanodrugs. The nanodrug sample was diluted to 1.0 mg Fe / mL and dispensed into two 1.5 mL microtubes. Exactly 0.1 volume of PBS was added to tube A and 0.1 volume of 3% TCEP·HCl was added to tube B. After 30 min at RT, 1 volume of 1 M NH4HCO3 was added to tube B. The final sample was treated by ultrafiltration and the obtained filtrate was analyzed using a NanoDrop spectrophotometer at the wavelengths specified at 260 nm and 343 nm.

[0280] Synthesis of TTX-RIGA-miR-21 (“RIG-I agonist precursor”) and TTX-miR-21

[0281] Dextran-coated iron oxide nanoparticles (TTX) were synthesized basically according to the published protocol. Briefly, a dextran T10 solution (9.0 g in 30 mL of dH2O) was pre-mixed with an FeCl3·6H2O solution (0.65 g in 1.0 mL of dH2O), filtered (0.22 μm), cooled in an ice bath, flushed with N2 for 30 minutes with stirring, and then an FeCl2·4H2O solution (0.40 g in 1.0 mL of dH2O) was added. Particle formation was initiated by the addition of ice-cold 28% (vol / vol) ammonia (14 mL). The particles were then heated and maintained at 70 - 85 °C for 90 minutes, cooled to RT, and purified to approximately 10 mg Fe / mL by TFF ultrafiltration against dH2O. The particles were treated with epichlorohydrin (16 mL, RT, 8 hours) to stabilize the dextran layer by cross-linking and introduce epoxy anchors, and then aminated with NH4OH (35 mL, 48 - 60 hours). After thorough ultrafiltration and buffer exchange to PBS using TFF, the aminated NPs (TTX-NH2) were sterile filtered and stored at 4 °C. TTX-NH2 was incubated with heterobifunctional SPDP (0.3 mg SPDP / mg Fe) in the presence of 33% DMSO (v / v) at 4 °C for 16 hours on a rocker platform, and then the particle functionalization was completed by changing the TFF to PBS (TTX-PDP). Activation of the protected thiol-modified oligo was carried out by reduction using TCEP and purification by ethanol / ammonium acetate precipitation. After mixing equal volumes of the TTX-PDP solution and the deprotected thiol-oligo solution in the desired molar ratio, the oligo conjugation was routinely carried out at 5 mg Fe / mL or less by incubating on a rotator at 2 - 8 °C for 16 - 24 hours and purifying by spin filtration. The final products were named TTX-RIGA-miR-21 for 5’-ppp-anti-miRNA-21 and TTX-miR21 for anti-miRNA-21.

[0282] Cell culture

[0283] The RIG-I receptor cell line HEK-Lucia™ RIG-I cells (catalog code, hkl-hrigi, InvivoGen) and the control cell line HEK-Lucia™ Null cells (catalog code, hkl-null, InvivoGen), and mouse skin melanoma cells (B16-F10) were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco). All culture media contained 10% fetal bovine serum (serum, Gibco), 100 U / mL of penicillin, and 100 μg / mL of streptomycin. The cells were incubated at 37 °C in 5% CO2, 5% humidity, and when a nearly confluent monolayer was achieved, subcultured at 2 × 10 4 cells / mL. The cells were not contaminated with mycoplasma. To generate B16-F10 miRNA-21 transfectants, mature miRNA-21 mimics (0, 0.3, 3, 30, 300, and 1000 ng / mL) were transfected into the cells using a LyoVec cationic lipid-based transfection agent (catalog code, lyec-12, InvivoGen). Briefly, the miRNA-21 mimics were mixed with 100 μL of LyoVec™. The mixture was incubated at 15 - 25 °C for 15 minutes to 1 hour to form complexes, which were then used for cell transfection. 10 μL of the LyoVec / miRNA-21 mimic complex was added to 200 μL of culture medium.

[0284] Isolation and quantitative real-time PCR of miRNA

[0285] After treatment, miRNAs were purified from the cells using the miRNeasy Mini Kit (catalog number 217004, Qiagen) according to the protocol recommended by the manufacturer. Complementary DNA (cDNA) was then synthesized using the miRCURY LNA RT Kit (catalog number 339340, Qiagen). For each miRNA target, the cDNA was diluted 1:10 with nuclease-free water before use.

[0286] The expression analysis of miR-21 was performed by using primers from the miRCURY LNA SYBR Green PCR Kit (Catalog number 339345, Qiagen) and miRCURY LNA miRNA PCR Assays (Catalog number 339306, Qiagen) for hsa-miR-21-5p (GeneGlobe ID YP00204230). The following cycling program: 2 minutes at 95°C and two-step cycling (40 cycles) of denaturation (10 seconds at 95°C) and a combination of annealing / extension (60 seconds at 56°C) was used to perform the reaction in a StepOnePlus Real-Time PCR System (Applied Biosystems).

[0287] The calculation of relative expression was performed using the 2 -ΔΔCt method. U6 SNRNA (GeneGlobe ID YP02119464) was used as a reference.

[0288] Western blotting

[0289] Cells (3×10 5Individuals were transfected with 1 μg / mL of 5’-ppp-dsRNA positive control (InvivoGen), RIGA-miR-21 (4 μg / mL), or anti-miR-21 (4 μg / mL) with or without miR-21 mimic (1 μg / mL). After incubation for 48 hours, the medium was aspirated, and the cells were washed twice with ice-cold 1×PBS and lysed directly in the plate on ice for 15 minutes in IP lysis buffer (catalog number 87787, Pierce / Thermo Scientific) containing Halt Protease and Phosphatase Inhibitor Cocktail (100×) (catalog number 78440, Thermo Scientific). The lysate was then centrifuged at 14,000×g for 10 minutes at 4°C. The supernatant was collected, and the protein concentration was determined using the Quick Start Bradford Protein Assay Kit (catalog number 5000202, Bio-Rad). Equal amounts of protein (50 μg) were electrophoresed on a 4–20% Mini protean TGX stain-free protein gel (Bio-Rad) (125 volts, 1 hour) and transferred to a nitrocellulose membrane (125 volts, 1 hour). The membrane was blocked with Blocker Blotto (catalog number 37530, Thermo Scientific) in TBS for 1 hour at room temperature and incubated overnight at 4°C with primary antibodies (1:1000 dilution) in blocking buffer, rabbit monoclonal antibodies against RIG-I (catalog number 3743), phospho-p65 (catalog number 3033), p65 (catalog number 8242), and β-actin (catalog number 5125) from Cell Signaling Technology. In this case, β-actin functioned as a reference protein. The membrane was further incubated with anti-rabbit IgG (secondary antiserum), horseradish peroxidase-conjugated secondary antibody (1:2000 dilution; catalog number 7074, Cell Signaling Technology) for 2 h at 37°C.In accordance with the manufacturer's instructions, detection of immunoreactive bands was performed using Pierce ECL Plus Western Blotting Substrate (Catalog No. 32132, Thermo Scientific) and an iBright CL750 Imaging System (Thermo Scientific).

[0290] RIG-I Activation Assay

[0291] HEK-Lucia™ RIG-I or HEK-Lucia™ Null cells (1, 2, 2.5 or 5×10 4 cells / well) were seeded into 96-well plates at a confluency of 70 - 85%. Next, 5’-ppp-dsRNA positive control (1 μg / mL, InvivoGen) or RIGA-miRNA-21 (1, 2 or 4 μg / mL) was transfected into the cells using LyoVec™ (Catalog Code lyec-12, InvivoGen) according to the manufacturer's instructions. Transfection was performed immediately after seeding the cells. The cells were incubated at 37 °C and 5% CO2 for 48 h. Next, 20 μL of the culture medium was transferred to a 96-well clear-bottom black plate, and 50 μL of QUANTI-Luc™ assay solution (Catalog Code rep-qlc, Invivogen) was added directly to each well. Luminescence was measured immediately using a Spectramax M3 microplate reader (Molecular Devices) with the exposure set to 0.1 s.

[0292] Cell Viability

[0293] Cell viability was determined using the CellTiter-Glo Luminescent Cell Viability Assay Kit (Catalog No. G7570, Promega) according to the manufacturer's instructions. Briefly, B16-F10 cells were seeded at 2×10 4Cells / well density was seeded in 96-well clear-bottom black plates (Corning, Tewksbury, MA). 5’-ppp-dsRNA positive control (1 μg / mL, InvivoGen), RIGA-miRNA-21 (1, 2 or 4 μg / mL) or anti-miR-21 (1, 2 or 4 μg / mL) were transfected into cells using LyoVec™ (catalog code lyec-12, InvivoGen) according to the manufacturer's instructions. After incubating for 48 hours, 100 μL of CellTiter-Glo (catalog number G9242, Promega) was added to each well (containing 100 μL of culture medium) and incubated at room temperature for 10 minutes to stabilize the luminescence signal. The luminescence signal was measured using a SpectraMax M3 microplate reader (Molecular Devices).

[0294] Caspase 3 / 7 activation

[0295] Caspase 3 / 7 activity was determined using the Caspase-Glo 3 / 7 Assay Kit (catalog number G8091, Promega) according to the manufacturer's instructions. Briefly, B16-F10 cells (1 or 2×10 4 cells / well) were seeded in 96-well plates (Corning, Tewksbury, MA) and treated with 5’-ppp-dsRNA positive control (1 μg / mL, InvivoGen), RIGA-miRNA-21 (1, 2 or 4 μg / mL) or anti-miR-21 (1, 2 or 4 μg / ml) for 48 hours. The plates were equilibrated to room temperature. 100 microliters of Caspase-Glo® 3 / 7 reagent was added to each well. The plates were incubated at room temperature for 1 hour. Luminescence was measured using a SpectraMax M3 microplate reader.

[0296] Immunoassay of IFN-γ-induced protein 10 (IP-10 / CXCL-10)

[0297] B16-F10 cells were treated with RIGA-miRNA-21 and their respective controls for 48 hours. The release of IP-10 / CXCL10 from mouse cells was assayed using the Quantikine Mouse IP-10 ELISA assay (Catalog number DY466-05, R&D Systems) using the cell-free supernatant of the stimulated cells according to the manufacturer's instructions. Absorbance was measured at 405 nm, and the concentration of IP-10 in the samples was determined by comparison with a standard.

[0298] Statistical analysis

[0299] Data were represented as mean ± sem. When indicated, statistical comparisons were depicted using two-tailed t-tests or ANOVA. Dose responses were analyzed using non-linear regression. All statistical tests were performed using GraphPad Prism software. P-values less than 0.05 were considered statistically significant.

[0300] (Example 2) Design of a template-specific RIG-I agonist precursor, 5'-ppp-antimiR-21 (RIGA-miR-21)

[0301] In this study, the inventors selected miRNA-21 as a target for template-directed assembly of RIG-I agonists based on its proven abundance in tumor cells (Bautista-Sanchez et al., 2020). However, the underlying concept is modular and can be applied to other miRNA targets that are enriched or highly expressed in tumor cells. The designed RIGA-miR-21 construct is 100% complementary to endogenous miRNA-21, is modified with 5’-ppp, and lacks any internal modifications (Figure 1a). Figures 1b and 1c illustrate a working model for the proposed action of the RIG-I agonist precursor RIGA-miR-21. Upon cell entry, RIGA-miR-21 hybridizes with endogenous miRNA-21 to form a 5’-ppp-dsRNA complex (“RIG-I agonist”), i.e., a standard RIG-I agonist (Yoo et al., 2014; Lima et al., 2018). This hybridization event likely results in the release of miRNA from the RNA-induced silencing complex (RISC), as previously observed (De et al., 2013). The 5’-ppp-dsRNA complex is then recognized by RIG-I in the cytosol, leading to its activation (Figure 1c). Consistent with the known mechanisms of immunomodulation by RIG-I agonism (Thoresen et al., 2021), RIG-I signaling stimulates the rapid production of type I interferon (IFN), induces direct cancer cell death, triggers the release of IFN, inflammatory cytokines, and tumor antigens (TA), and as a result, can promote cell-mediated immunity (Figure 1d). This remodeling of the tumor microenvironment (TME) activates both innate immune cells and the adaptive immune system. Leukocytes such as natural killer (NK) cells and macrophages enhance their cytolytic activity in response to an IFN-rich environment. Importantly, the increase in IFN and TA can also activate the adaptive immune response, leading to the maturation and activation of macrophages and dendritic cells (DC), and improved antigen presentation to T lymphocytes in tumor-draining regional lymph nodes.Subsequently, naive T cells are activated, proliferate, differentiate, and are recruited to the TME, where they exert an effective anti-tumor response through direct cytolytic activity mediated by perforin and granzyme, as well as indirect cytolytic activity through the secretion of cytokines such as IFN-γ and TNFα. After cancer cell death, many tumor-specific effector CD8+ T cells undergo apoptosis, but some can survive and develop into long-lived defensive memory CD8+ T cells (Figure 1d).

[0302] (Example 3) The template-specific RIG-I agonist precursor, RIGA-miR-21, effectively agonizes RIG-I in a template-dependent manner in reporter cell lines

[0303] This study aimed to investigate the ability of RIGA-miR-21 to induce RIG-I activation in a human RIG-I luciferase reporter cell line, HEK-Lucia™ RIG-I. This commercially available cell line shows stable expression of high levels of human RIG-I and the secreted Lucia luciferase reporter. This reporter gene is regulated by the IFN-inducible ISG54 promoter enhanced by the multimeric IFN-stimulated response element (ISRE). By monitoring the activity of Lucia luciferase, the activation of RIG-I signaling can be investigated using HEK-Lucia™ RIG-I and HEK-Lucia™ Null control cells.

[0304] The inventors first confirmed the presence of miRNA-21 in both cell lines by RT-PCR (Figure 2a), and the high expression of RIG-I in HEK-Lucia RIG-I reporter cells using Western blotting (Figure 2b). The inventors also verified the discriminatory sensitivity of HEK-Lucia™ RIG-I and HEK-Lucia™ Null control cells to a commercially available conventional RIG-I agonist consisting of 5'-triphosphate double-stranded RNA 19-mer (5'-ppp-dsRNA or ppp-dsRNA). There was a very significant enhancement of luciferase activity in RIG-I overexpressing cells compared to null cells (Figure 2c).

[0305] The inventors next evaluated the ability of their template-specific RIG-I agonist precursor, RIGA-miR-21, to activate RIG-I. HEK-Lucia™ RIG-I and HEK-Lucia™ Null control cells were treated with RIGA-miR-21. The inventors observed significant RIG-I activation in HEK-Lucia™ RIG-I but not in HEK-Lucia™ Null cells at all three dose levels of the RIGA-miR-21 tested (Figure 2a), even though miR-21 expression was equivalent in both cell lines (Figure 2c).Considering the stringent requirements for the formation of RNA duplexes for RIG-I activation [Schmidt, A., Schwerd, T., Hamm, W., Hellmuth, J.C., Cui, S., Wenzel, M., Hoffmann, F.S., Michallet, M.C., Besch, R., Hopfner, K.P., Endres, S., and Rothenfusser, S. (2009). 5'-triphosphate RNA requires base-paired structures to activate antiviral signaling via RIG-I. Proc Natl Acad Sci U S A 106, 12067-12072; Takahasi, K., Yoneyama, M., Nishihori, T., Hirai, R., Kumeta, H., Narita, R., Gale, M., Jr., Inagaki, F., and Fujita, T. (2008). Non-self RNA-sensing mechanism of RIG-I helicase and activation of antiviral immune responses. Mol Cell 29, 428-440; Marq, J.B., Kolakofsky, D., and Garcin, D. (2010). Unpaired 5' ppp-nucleotides, as found in arenavirus double-stranded RNA panhandles, are not recognized by RIG-I. J Biol Chem 285, 18208-18216], these results provided support for a templated-directed mechanism of RIG-I agonism.

[0306] To further investigate the template-dependence of the observed RIG-I activation when using the inventors' RIGA-miR-21, the inventors repeated a reporter assay using HEK-Lucia™ RIG-I cells transiently transfected with increasing concentrations of mature miRNA-21 mimics (miR-21 mimics or miR-21). Transfection with the mimics was performed prior to the addition of RIGA-miR-21 to avoid annealing between them prior to entry into the cells. The inventors observed a highly significant induction of RIG-I signaling by their RIGA-miR-21 in cells transfected with 30 and 300 ng / mL of the mimics even in cultures of as few as 10,000 cells (Figure 2e). The level of activation by RIGA-miR-21 was similar to that observed for a commercially available ppp-dsRNA positive control (Figure 2e). The 5'-ppp-deficient anti-miR-21 (anti-miR-21) was unable to cause detectable RIG-I activation (Figure 2e).

[0307] (Example 4) RIGA-miR-21 agonizes RIG-I in a template-dependent manner in melanoma cells and induces apoptosis

[0308] After successfully establishing the template-dependence of RIG-I activation by RIGA-miR-21 in HEK-Lucia reporter cells overexpressing RIG-I, the inventors proceeded to investigate whether their template-specific RIG-I agonist precursor could induce the activation of apoptosis-promoting signaling in the B16-F10 melanoma cell line. B16-F10 melanoma cells are characterized by moderate expression levels of miR-21 (Figure 3a) and have been previously used to test intrinsic RIG-I signaling with cell death as an endpoint [Bek, S., Stritzke, F., Wintges, A., Nedelko, T., Bohmer, D.F.R., Fischer, J.C., Haas, T., Poeck, H., and Heidegger, S. (2019). Targeting intrinsic RIG-I signaling turns melanoma cells into type I interferon-releasing cellular antitumor vaccines. Oncoimmunology 8, e1570779].

[0309] IP-10 / CXCL-10 is a member of the CXC chemokine family and is induced by IFN, particularly IFN-γ. It plays an important role in the recruitment of activated T cells. To verify its expression associated with RIG-I activation, the inventors evaluated IP-10 protein in the culture supernatant of B16-F10 cells after treatment with increasing concentrations of RIGA-miR-21 and corresponding controls for 48 hours. Figure 3b shows a substantial induction of IP-10 in cells treated with RIGA-miR-21 after transfection with mature miR-21 mimics (300 or 600 ng / mL). In contrast, this effect was not observed in control treatments or in the absence of miR-21 mimics.

[0310] To reconcile with the known mechanism of apoptosis induction by the intrinsic RIG-I signaling in tumor cells, the inventors first evaluated caspase 3 / 7 activation in B16-F10 melanoma cells treated with RIGA-miR-21 or its 5'-ppp-deficient equivalent (i.e., anti-miR-21). As a result, dose-dependent caspase 3 / 7 activation was shown, and a more prominent effect was observed in the presence of 5'-ppp (Figure 3c, 30,000 cells). Subsequently, the inventors transiently transfected cells with a miR-21 mimic (an endogenous miR-21 sequence complementary to the agonist precursor sequence), then treated with the construct and evaluated caspase 3 / 7 activation. The data showed a miR-21 dose-dependent increase in caspase 3 / 7 activation, which was significantly higher in cells treated with RIGA-miR-21 compared to its 5'-ppp-deficient counterpart (Figure 3d, 10,000 cells). These findings indicated that activation of RIG-I using a template-directed approach could initiate caspase 3 / 7 signaling and prime cells for apoptosis.

[0311] In subsequent analysis by the inventors, in addition to RIG-I activation, the inventors investigated the expression level of RIG-I to determine whether there was also evidence of RIG-I upregulation in B16-F10 cells treated with RIGA-miR-21. Low basal levels of RIG-I were detected in B16-F10 cells, which were upregulated in cells treated with both RIGA-miR-21 and miR-21 or ppp-dsRNA control, but not in cells treated with miR-21 or RIGA-miR-21 alone (Figure 3e).

[0312] The inventors then evaluated the phosphorylation status of NF-κB, a key regulator of the inflammatory process in the nuclear factor kappa B (NF-κB) pathway. One mechanism of immune activation by RIG-I agonism involves the activation of NF-κB to regulate the expression of pro-inflammatory and pro-apoptotic genes [Ramos, H.J., and Gale, M., Jr. (2011). RIG-I like receptors and their signaling crosstalk in the regulation of antiviral immunity. Curr Opin Virol 1, 167-176]. In the study by the inventors, the inventors analyzed the phosphorylation of the NF-κB subunit p65 at S536 to measure NF-κB transactivation. The inventors observed strong phospho-P65 reactivity in lysates derived from B16-F10 cells treated with RIGA-miR-21, which was further amplified when the cells were also transfected with a miR-21 mimic (Figure 3f). This effect was not associated with an increase in the expression of p65, indicating that it specifically reflected target phosphorylation. This observation provided further support for the effective template-dependent immune stimulation by RIGA-miR-21. The effects of the 5'-ppp-dsRNA control or the miR-21 mimic were complicated by the observation that only LyoVec was able to cause significant p65 phosphorylation.

[0313] In summary, RIG-I activation was observed in BF16 cells as indicated by low but detectable levels of caspase 3 / 7 activation, NF-κB phosphorylation, and decreased cell viability, but was not reflected by IP-10 and RIG-I and also relied on the supplementation of the miR-21 mimic.

[0314] (Example 5) Nanoparticle formulation of RIGA-miR-21 targeted for systemic delivery

[0315] In particular, along with demonstrating the efficacy of RIGA-miR-21 in activating RIG-I signaling in melanoma cells in combination with miR-21 mimics, the next objective of the inventors was to develop a nanoparticle formulation suitable for systemic delivery. Amino-functionalized dextran-coated iron oxide nanoparticles were synthesized prior to this study by co-precipitation of iron oxide from Fe(II) and Fe(III) chloride solutions under alkaline conditions in the presence of dextran. The dextran shell was stabilized by cross-linking and amino-functionalization using ammonia. To enable oligonucleotide conjugation, a disulfide linker was incorporated into the amino-functionalized iron oxide nanoparticles (TTX-NH2), resulting in the formation of TTX-PDP. The thiol-modified oligonucleotide used in the conjugation process is typically delivered in its oxidized form and can be readily activated by reduction using TCEP. Subsequently, the deprotected oligonucleotide was conjugated to the nanoparticles by a thiol-disulfide exchange reaction to generate the final product (TTX-oligo). This design enables delivery of the payload into cells by the nanoparticles and release into the cytosol upon exposure to cytosolic glutathione (GSH) (Figure 4).

[0316] (Example 6) The nanoparticle formulation of RIGA-miR-21 can be successfully delivered, which efficiently agonizes RIG-I in reporter cell lines

[0317] Consistent with previous studies using RIGA-miR-21, the inventors proceeded to evaluate the efficacy of TTX-RIGA-miR-21 in a reporter cell line. HEK-Lucia™ RIG-I and HEK-Lucia™ Null control cells were treated with TTX-RIGA-miR-21 or control, TTX-miR-21 or 5’-ppp-dsRNA (transfected with LyoVec). RIG-I activation was observed in HEK-Lucia™ RIG-I cells treated with TTX-RIGA-miR-21 (4 μg / mL) or ppp-dsRNA control. However, ppp-deficient TTX-miR-21 was unable to induce detectable RIG-I activation (Figure 5a). Subsequently, a dose-response test of TTX-RIGA-miR-21 in the range of 1 - 4 μg / mL was conducted (Figure 5b). Basal luciferase expression was observed in HEK-Lucia™ RIG-I compared to HEK-Lucia™ Null, which did not show responsiveness to lower concentrations of TTX-RIGA-miR-21 treatment (1 or 2 μg / mL). Consistent with the findings in Figure 5a, luciferase activity levels were significantly increased for 4 μg / mL of TTX-RIGA-miR-21 and further increased when cells were pre-treated with miR-21 mimics.

[0318] To investigate the expression of RIG-I, the inventors performed reverse transcription polymerase chain reaction (RT-PCR) analysis. The mRNA levels of RIG-I were evaluated in both HEK-Lucia™ RIG-I and HEK-Lucia™ Null control cells. Consistent with the results of western blot (Figure 2b), the inventors confirmed the presence of basal level RIG-I expression in HEK-Lucia™ RIG-I cells. This expression level was slightly higher compared to HEK-Lucia™ Null control cells (Figure 5c). Treatment with TTX-RIGA-miR-21 resulted in a significant upregulation of the mRNA levels of RIG-I in HEK-Lucia™ RIG-I and was further enhanced when cells were pre-treated with miR-21 mimics.

[0319] The inventors also evaluated the expression level of miR-21 in HEK-Lucia™ RIG-I cells in response to TTX-RIGA-miR-21 treatment using RT-PCR analysis. The inventors confirmed the basal level of miR-21 expression previously observed in HEK-Lucia™ RIG-I cells (Figure 2a), which was significantly upregulated upon treatment with TTX-RIGA-miR-21 (4 μg / mL) in HEK-Lucia™ RIG-I cells. When exogenous miR-21 mimics were supplied in addition to TTX-RIGA-miR-21, there was a further increase in miR-21 expression levels (Figure 5d), which could have been the sum of the contributions of upregulated miR-21 and exogenous miR-21 mimics.

[0320] In summary, similar to RIGA-miR-21 transfected with LyoVec, TTX-RIGA-miR-21 can also induce template-dependent RIG-I activation in HEK293 reporter cells, which was indirectly supported by positive feedback upregulation of both RIG-I and miR-21 templates. This result indicated that RIGA-miR-21 could be successfully delivered to cells by the TTX platform.

[0321] (Example 7) TTX-RIGA-miR-21 efficiently agonizes RIG-I in melanoma cells and induces apoptosis in melanoma cells

[0322] Based on the successful delivery of TTX-RIGA-miR-21 and its activation of RIG-I signaling in HEK-Lucia reporter cells, the inventors extended their investigation to the B16-F10 melanoma cell line, which has been shown to express a moderate level of miR-21 (Figure 3a). This cell line provides a relevant model for evaluating the efficacy of TTX-RIGA-miR-21 in the context of melanoma and assessing its potential as a therapeutic approach for targeting miR-21 in cancer cells.

[0323] IFN-β, IP-10, and RIG-I

[0324] Induction of type I interferon (IFN) is an important response of the innate immune system upon nucleic acid sensing. In our initial tests using RT-PCR, we did not observe a detectable change in IFN-β mRNA expression in cells treated with TTX-RIGA-miR-21 (1 - 4 μg / mL), but we did observe a significant increase in IFN-β expression in cells treated with a double treatment of TTX-RIGA-miR-21 and miR-21 mimics, or cells that received 5’-ppp-dsRNA which functions as a positive control (Figure 6a). Further analysis of IFNβ protein using ELISA confirmed a strict dependence of IFNβ upregulation on the exogenous miR-21 template (Figure 6b). Neither TTX-RIGA-miR-21 nor miR-21 mimics alone enabled a detectable change in IFN-β.

[0325] Similar observations were made for IP-10, which was significantly increased only in cells treated with a double treatment of TTX-RIGA-miR-21 and miR-21 mimics, or cells that received 5’-ppp-dsRNA (Figures 6c, 6d). Neither TTX-RIGA-miR-21 nor miR-21 mimics alone resulted in a detectable IP-10 response.

[0326] To investigate whether RIG-I activation in B16-F10 cells treated with TTX-RIGA-miR-21 is accompanied by upregulation of RIG-I, the inventors evaluated RIG-I expression at the mRNA level using RT-PCR and at the protein level using SDS-PAGE. Both assays showed that the expression of RIG-I remained unchanged when cells were loaded with TTX-RIGA-miR-21 alone (1-4 μg / mL), but was significantly increased when cells were supplied with miR-21 mimics prior to TTX-RIGA or treated with ppp-dsRNA (Figures 7a, 7b). This result was consistent with the strict miR-21-dependence observed for RIGA-miR-21 transfected with LyoVec.

[0327] Caspase 3 / 7, TRAIL and cell viability

[0328] To evaluate the induction of apoptosis by tumor cell-intrinsic RIG-I signaling, the inventors examined caspase 3 / 7 activation in B16-F10 cells by TTX-RIGA-miR-21 (Figure 8a). Caspase 3 / 7 remained unchanged when cells were loaded with TTX-RIGA-miR-21 or miR-21 mimics alone, but was significantly boosted in the case of double treatment. The lack of effect of TTX-RIGA-miR-21 on caspase 3 / 7 activation compared to the low level of caspase 3 / 7 activation observed for RIGA-miR-21 / LyoVec may be due to the reduction of the cells used in this assay.

[0329] Next, the inventors investigated the activation of the extrinsic apoptosis pathway by examining the level of TNF-related apoptosis-inducing ligand (TRAIL), a biomarker related to the activation of the RIG-I signaling pathway and associated with the initiation of the extrinsic apoptosis pathway. TRAIL has been shown to selectively induce apoptotic cell death in various tumor cells by binding to its cell death-inducing receptors. Similar to the inventors' observations regarding caspase 3 / 7 activation, the inventors found increased secretion of TRAIL only in cells treated with both TTX-RIGA-miR-21 and miR-21 mimics, but not with TTX-RIGA-miR-21 alone. Although the efficacy was not as pronounced as that of ppp-dsRNA, the combination of TTX-RIGA-miR-21 and miR-21 mimics significantly upregulated the expression of TRAIL (Figure 8b).

[0330] Next, the inventors performed a cell viability assay to evaluate the overall effect of TTX-RIGA-miR-21 on RIG-I activation in melanoma cells. In contrast to the lack of a detectable effect on many biomarkers evaluated above in the absence of miR-21 mimics, treatment with TTX-RIGA-miR-21 alone resulted in dose-dependent cell death even at a low dose of 1 μg / mL. This effect was further enhanced when miR-21 mimics were provided in combination with TTX-RIGA-miR-21 (Figure 8c), and the template dependence of cell death was confirmed. In particular, only 4 μg / mL of TTX-RIGA-miR-21 showed efficacy comparable to that of LyoVec-delivered RIGA-miR-21 + miR-21 mimics or the 5'-ppp-dsRNA control in inducing cell death.

[0331] The cell viability assay provides a comprehensive assessment of the effect of RIG-I activation on melanoma cells, reflecting the cumulative effect of the activation of downstream pathways and processes that contribute to cell survival or cell death, which might otherwise not be detectable individually.

[0332] The observation of a dose-dependent decrease in cell viability upon TTX-RIGA-miR-21 treatment indicates that the template-directed approach to RIG-I activation using a single agonist precursor has the potential to induce cell death, particularly in melanoma and other cancer cells.

[0333] (Example 8) TTX-RIGA-miR-21 efficiently reduces the tumor burden of primary tumors, induces long-term immunity, and dramatically reduces the secondary tumor burden.

[0334] In an in vivo mouse model, the inventors investigated the ability of TTX-RIGA-miR-21 to inhibit tumor development. Tumor cells were transplanted into the left flank of mice, and different treatments were administered at the indicated time points. TTX-RIGA-miR-21 and PBS were delivered intravenously, while free 5'-ppp-dsRNA was delivered intratumorally. Tumor growth was monitored by caliper measurements, and the weight of the primary tumors was measured at the time of mouse sacrifice. Both intravenously delivered TTX-RIGA-miR-21 and intratumorally delivered ppp-dsRNA significantly inhibited tumor growth compared to the PBS control (Figure 9a). The observations regarding TTX-RIGA-miR-21 were notable considering the dilution effect and the multiple barriers that the nanodrug had to overcome to reach the target site. The effect of TTX-RIGA-miR-21 on tumor weight was less impressive compared to the positive control, but it still showed a tendency towards lower tumor weight compared to the PBS control (Figure 9b).

[0335] Importantly, the inventors investigated whether TTX-RIGA-miR-21 could induce memory immunity that inhibits the development of secondary tumors. Tumor cells were implanted on the opposite side of the primary tumor in mice on day 14, and the growth of secondary tumors was monitored (Figure 9c). No differences were observed between the test groups until day 19. However, as the tumors continued to grow, TTX-RIGA-miR-21 showed a significant ability to inhibit tumor growth on days 21 and 22, while the response to 5’ppp-dsRNA remained no different from the PBS control. These findings clearly show that systemically delivered TTX-RIGA-miR-21, as a RIG-I agonist precursor, was able to induce memory immunity and inhibit the development of secondary tumors.

[0336] RIG-I agonist precursors, their agonists and methods for treating and / or inhibiting primary tumor growth and secondary tumor growth are provided herein. In certain embodiments, the methods and compositions are for treating and preventing the growth and / or formation of secondary tumors.

[0337] (Example 9) (Non)radioactive labeled TTX-Oligo (e.g., TTX-oligo- nat / 64 Cu 2+ ) synthesis

[0338] The synthesis of (non)radioactive labeled TTX-Oligo from the TTX-NH2 platform is illustrated in Figure 10 and involves the following steps: a) coupling reaction of TTX-NH2 with NODAGA-NHS to form TTX-NODAGA, b) functionalization with the heterobifunctional linker SPDP to form TTX-NODAGA-PDP, c) deprotection of the oligo to yield thiol oligo (Oligo-SH), d) conjugation of the thiol oligo by thiol-disulfide exchange reaction to form TTX-Oligo-NODAGA, e) resulting in TTX-Oligo- nat / 64 Cu 2+ yielding nat CuCl2 or64 It involves complexation with CuCl2. The overall procedure is described in detail below.

[0339] Synthesis of A. TTX-NODAGA-PDP

[0340] To synthesize NPs dual-functionalized for radiolabeling and oligo-conjugation, TTX-NH2 is sequentially treated with NODAGA-NHS to introduce a chelating agent for Cu 2+ loading and then treated with SPDP, a hetero-bifunctional linker, to introduce a redox-sensitive disulfide linker for oligo-conjugation by thiol-disulfide exchange reaction. Dilute the TTX-NH2 solution to 10 mg Fe / mL or less with PBS and cool on ice. Dissolve NODAGA-NHS in anhydrous DMSO (1 / 4 volume of the TTX-NH2 solution, approximately 0.0625 mg / mg iron). Add the NODAGA-NHS solution to the TTX-NH2 solution and mix rapidly. Incubate this reaction mixture overnight at 2 - 8 °C on a shaker in the refrigerator. Prepare the SPDP solution by dissolving the powder in DMSO (1 / 4 volume of the TTX-NH2 solution, approximately 0.325 mg / mg iron). Then add the freshly prepared SPDP / DMSO solution to the TTX-NODAGA solution, mix well by pipetting or stirring, and incubate the mixture overnight at 2 - 8 °C on a shaker in the refrigerator. Then dilute the TTX-NODAGA-PDP reaction mixture with 4 volumes of PBS and purify using an Amicon Ultra-15 mL filter (30 or 100 kDa) and buffer exchange into PBS. Sterile filter the final product and store it at 2 - 8 °C in the refrigerator. Characterization includes, according to appropriate protocols, iron content, size and size distribution, and the number of PDP ligands. To quantify the number of NODAGA per NP, subtract the number of amines per NP after conjugation with NODAGA from the number of amines per NP before conjugation.

[0341] B. Synthesis of TTX-Oligo-NODAGA

[0342] Exemplary Procedure for Deprotecting Disulfide-Protected Oligonucleotides

[0343] Prepare the disulfide-protected oligo as a 1 mM solution in nuclease-free water (NFW). Also, separately prepare 3% TCEP (w / v) in NFW. Add 50 μL of the TCEP solution to 0.5 mL of the oligo solution and incubate at room temperature for 30 minutes. Purify the resulting thiol-oligo using the ethanol / ammonium acetate precipitation method (briefly, add 250 μL of 9.5 M ammonium acetate to the oligo mixture, then add 1150 μL of cold ethanol). A turbid oligo precipitate can be visually observed. Hold this turbid solution at -80 °C for 1 hour, then centrifuge the mixture at 4 °C, 20,000 × g for 15 minutes. A white oligo pellet forms at the bottom of the tube. Discard the supernatant and wash the pellet sequentially with 1 mL of 100% ethanol and 0.5 mL of 70% ethanol (prepared from 100% ethanol using NFW). Further, dry the oligo pellet using a speed vacuum concentrator, resuspend the pellet in 0.25 mL of NFW, label it as the thiol-oligo, and store it in a refrigerator set at 2 - 8 °C.

[0344] B2. Exemplary Procedure for Conjugating Oligonucleotides to Nanoparticles (TTX-NODAGA-PDP)

[0345] Mix TTX-NODAGA-PDP with the thiol-oligo at a molar ratio of 1:13. Incubate the resulting reaction mixture on a rotator in a cold place for 24 hours. Thereafter, use the same filtration procedure as above to purify and concentrate the nanodrug solution using an Amicon Ultra 15 mL centrifugal filter (MWCO 30 kDa). Store the final product TTX-oligo-NODAGA in a refrigerator at 2 - 8 °C while gently rotating.

[0346] C. Synthesis and Characterization of TTX-Oligo- 64 Cu

[0347] Modify and follow the procedure by Le Fur et al. [Le Fur M, Ross A, Pantazopoulos P, Rotile N, Zhou I, Caravan P, Medarova Z, Yoo B. Radiolabeling and PET-MRI microdosing of the experimental cancer therapeutic, MN-anti-miR10b, demonstrates delivery to metastatic lesions in a murine model of metastatic breast cancer. Cancer Nanotechnol. 2021;12(1):16]. Briefly, copper chloride ( 64 CuCl2) and the TTX-Oligo-NODAGA solution are pre-diluted in 0.2 M sodium citrate (pH 8.0) and then mixed at the desired ratio. Then, the reactants are heated to 65 - 70 °C in a heating block for 30 minutes, during which the TTX-oligo-NODAGA precursor is 64 chelated with Cu 2+ ions to obtain TTX-Oligo-Cu64 (TTX-Oligo- 64 Cu). The radiochemical purity is determined by radio-iTLC (instant thin layer chromatography). If the radiochemical purity is less than 90%, the remaining unreacted 64 Cu is removed by centrifugal filtration.

[0348] The radiochemical purity of the product is analyzed by iTLC (Agilent, iTLC-SG, Santa Clara, CA) using an EDTA solution (50 mM, pH 5) as the eluent with a radio-TLC imaging scanner (AR-2000, Eckert & Ziegler, Berlin, Germany). If necessary, TTX-Oligo- 64The radiochemical identity of the final Cu solution can be confirmed by analytical HPLC (Agilent 1100 HPLC system, Santa Clara, CA) using a size exclusion column (TSK gel QC-PAK-300, isocratic, 100% 0.1 M sodium phosphate pH 7.4, 20 min) and a Carroll / Ramsey radioactivity detector equipped with a silicon PIN photodiode and UV detection at 254 nm.

[0349] Inductively coupled plasma mass spectrometry (ICP-MS) analysis (Agilent 8800-QQQ system, Santa Clara, CA) is performed to determine the concentrations of copper and iron. All samples are prepared by weight. Calibration standards are prepared by diluting certified copper and iron standards (1000 mg / L). A calibration curve is obtained from five standard solutions in the range of 0.1 - 400 ppb. Ruthenium (1 ppm) is used as an external standard to ensure proper introduction of the samples. The hydrodynamic diameter and zeta potential are measured by a dynamic light scattering spectrometer (Zetasizer Nano, Malvern, UK), and the size of the iron oxide core is determined by transmission electron microscopy (JEM 2100 TEM, Jeol, Tokyo, Japan).

[0350] D. Non-radioactive TTX-Oligo- nat Cu 2+ Synthesis

[0351] Non-radioactive TTX-Oligo- nat Cu 2+ is used as a control in various tests. Both the TTX-Oligo-NODAGA solution and CuCl2, pre-diluted in 0.2 M sodium citrate (pH 8.0), are mixed in the desired ratio (NODAGA:Cu ratio, e.g., 1:50). The reaction mixture is then heated in a heating block at 65 - 70 °C for 30 min, during which the TTX-oligo-NODAGA precursor chelates with Cu 2+ to obtain TTX-Oligo- nat Cu 2+ The mixture is diluted with 0.1 volume of 0.1 M EDTA (pH 7.4) to remove free Cu2+ After chelating the ions, purification and concentration are performed using ultrafiltration with nuclease-free PBS buffer as the eluent. The final TTX-Oligo- nat Cu 2+ amount of the Cu 2+ product is determined by ICP-MS.

[0352] (Example 10) Synthesis of radioiodine-labeled TTX-Oligo (e.g., TTX-oligo- 125 I)

[0353] Radiolabeled pharmaceuticals, including iodine-based radiopharmaceuticals, have received great attention in the fields of chemistry and biomedicine. These compounds are used mainly in the imaging of various diseases such as oncological conditions, neurological conditions, cardiovascular conditions, gastrointestinal conditions, and endocrine conditions in clinical practice for both diagnostic and therapeutic purposes. The use of radiolabeled compounds for diagnosis is advantageous because of their easy detectability and ability to determine very small amounts. They enable non-invasive visualization of the anatomical and physiological signs of diseases. As therapeutic agents, radiopharmaceuticals can be used to selectively target cancer cells, destroy them, and cause their cell death.

[0354] Radioactive halogen-containing compounds, particularly iodine isotopes, play a major role in nuclear medicine due to their favorable chemical and radioactive decay properties. Iodine radioisotopes such as iodine-125 and iodine-131 are widely used to label both low molecular weight compounds and larger biomolecules such as peptides and nucleic acids. The longer half-lives of iodine isotopes compared to other commonly used radioisotopes (e.g., carbon-11 and fluorine-18) are advantageous from the perspective of diverse synthetic methods for radioiodination (Figure 11a). Furthermore, iodine-containing compounds tend to increase lipophilicity and can enhance their pharmacological and pharmacokinetic properties. Radioactive iodine itself has a tendency to accumulate in the thyroid, stomach, and salivary glands. To deliver it to other target organs, radioactive iodine is often combined with molecules that specifically bind to these tissues. Iodine-based radiopharmaceuticals have proven to be useful tools in nuclear medicine. Iodine radionuclide therapy is used for the treatment of various cancers, including thyroid cancer, pheochromocytoma and paraganglioma, and non-Hodgkin lymphoma. In summary, its optimal half-life, diverse synthetic methods, and ability to accumulate in specific tissues make iodine radionuclides useful for both diagnostic imaging and targeted therapy in various diseases, particularly in the field of oncology.

[0355] Iodination at tyrosine residues has been widely used to label proteins or peptides in various applications. The iodinated N-hydroxysuccinimide ester of 3-(4-hydroxyphenyl)propionate, also known as the Bolton-Hunter reagent or SHPP, has been successfully used to iodinate proteins lacking tyrosine residues. In this method, the protein is covalently bound to an acylating agent, where the acylating agent reacts with the protein side chain at lysine residues. This method is more suitable for proteins with few or no tyrosine residues and is also suitable for proteins that are susceptible to oxidation. This method has many applications, including the targeted labeling of cytosolic proteins, membrane proteins, viruses, cell lysates, and compounds such as gentamicin.

[0356] Reagents typically used for the radiolabeling of proteins / peptides with iodine after the Bolton-Hunter procedure, including the Bolton-Hunter reagent (SHPP) or its water-soluble Bolton-Hunter reagent version (sulfo-SHPP), and Iodo-Gen, are listed in Figure 11b. The iodination reaction in the Bolton-Hunter procedure using Iodo-Gen involves the following steps: Dissolve Iodo-Gen in an organic solvent such as chloroform or methanol to create a stock solution. Incubate the reaction mixture, coat the surface of the reaction vessel with Iodo-Gen, and then evaporate the solvent. Mix the protein or peptide of interest with the Iodo-Gen stock solution. Radioactive iodine (usually Na 125 I] or Na 131A solution containing the form of [[I]] is added to the reaction mixture. Iodine is reacted with tyrosine or phenol groups on the protein, resulting in the incorporation of radioactive iodine into the molecule. Typically, the reaction is quenched by the addition of a reducing agent such as sodium metabisulfite or sodium thiosulfate. This method enables the specific iodination of tyrosine residues in proteins, including those present in cell membranes. It can also be used to label phenol groups on crosslinking agents or other protein modification reagents.

[0357] Experiment

[0358] In the present application, the Bolton-Hunter procedure is adapted for the iodine radiolabeling of the TTX platform. The overall procedure is outlined in Figure 12. Here, a step-by-step overview of the process is shown.

[0359] Functionalization of the TTX-NH2 platform for radiolabeling: TTX-NH2NP is treated with a controlled amount of SHPP or sulfo-SHPP (sulfosuccinimidyl 3-(4-hydroxyphenyl)propionate) to introduce phenol groups. It is important to ensure that only a small portion of the amine groups on TTX-NH2NP are used in this reaction. After treatment, the product is purified using ultrafiltration. This process helps to remove excess reagents and by-products from the reaction mixture, leaving behind the desired product (TTX-HPP).

[0360] Iodine radiolabeling: The TTX-HPP product is subjected to iodine radiolabeling. This is achieved using Iodo-Gen and a source of radioactive iodine isotope, Na[125I] or Na[131I]. After the radiolabeling step, the radiolabeled TTX- * I product is purified by performing ultrafiltration again to remove unreacted radioactive iodine or other impurities.

[0361] Functionalization of TTX- * I using SPDP: The purified radiolabeled TTX- *Functionalize I with SPDP (N - succinimidyl 3-(2 - pyridyldithio)propionate). This step involves attaching a PDP group to the unreacted amine groups, enabling subsequent conjugation with the oligo. The product obtained after functionalization with SPDP (TTX - * I - PDP) is purified once more to remove excess reagents and impurities.

[0362] Oligo deprotection: Activate the protected thiol - modified oligo by reduction with TCEP and purification by ethanol / ammonium acetate precipitation.

[0363] Oligo conjugation: Conjugate the purified radiolabeled TTX - * I - PDP to the oligo. This step involves the binding of the thiol - oligo to TTX - * I - PDP to form the final product (TTX - Oligo - * I), followed by purification using ultrafiltration.

[0364] Cold control - TTX - Oligo - I: As a control, a "cold" control sample can be synthesized in parallel with the TTX - Oligo - * I conjugate. This control sample is prepared using non - radioactive NaI instead of radioactive Na[125I] or Na[131I] used for radiolabeling. The cold control enables specific comparison and evaluation of the effect of radioactivity.

[0365] Quality control (QC): The final product, TTX - Oligo - * I, undergoes standard quality control procedures to ensure its integrity, purity, and functionality.

[0366] In vitro testing: In in vitro testing, such cell viability assays can be performed to evaluate the performance of the TTX - Oligo - * I product.

[0367] While particular embodiments of the subject matter have been discussed, the above specification is illustrative and not restrictive. Many variations will be apparent to those skilled in the art upon review of the present specification and the following claims. The full scope of the invention should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

Claims

1. A nanoparticle comprising a core-shell structure, wherein the shell comprises a RIG-I agonist precursor containing a single-stranded 5'-non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA; and optionally a radioactive label.

2. The nanoparticle according to claim 1, wherein the shell further comprises a single-stranded oligonucleotide sequence complementary to the single-stranded 5'-non-capped triphosphate antisense oligonucleotide.

3. The nanoparticle according to claim 1, wherein the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221.

4. The nanoparticle according to claim 1, wherein the antisense oligonucleotide is selected from SEQ ID NOs: 1 to 13.

5. The nanoparticle according to claim 2, wherein the complementary oligonucleotide sequence is selected from SEQ ID NOs: 14 to 26.

6. The nanoparticle according to claim 1, wherein the antisense oligonucleotide comprises a sequence that is 15 to 30 nucleotides in length.

7. The nanoparticle according to claim 1, wherein the antisense oligonucleotide comprises a sequence that is 16 to 27 nucleotides in length.

8. The nanoparticle according to claim 1, wherein the shell comprises an aminated polysaccharide coating agent.

9. The nanoparticle according to claim 1, having a particle size of 25 nm to 70 nm.

10. The nanoparticle according to claim 8, wherein the polysaccharide is selected from the group consisting of dextran, alginate, chitosan, chitin, cellulose, hyaluronic acid (HA), amylose, amylopectin, carrageenan, and a polysaccharide polymer (pullulan) consisting of maltotriose units.

11. The nanoparticle according to claim 8, wherein the polysaccharide comprises dextran.

12. The nanoparticle according to claim 11, wherein the dextran comprises thiolated dextran, phosphorylated dextran, or dextran sulfate.

13. The nanoparticle according to claim 1, wherein the core comprises a polymer, metal, or metal ion.

14. The nanoparticles according to claim 13, wherein the metal or metal oxide is selected from gold, iron, iron oxide, gold alloy, silver, zinc oxide, silicon dioxide (silica), platinum, copper, cobalt, indium, nickel, manganese oxide, calcium carbonate, calcium phosphate, or a combination thereof.

15. The nanoparticles according to claim 13, wherein the polymer is selected from sodium alginate, poly(lactic-co-glycolic acid) (PLGA) polymer, PLGA copolymer, polysaccharide, chitosan, polystyrene, polycaprolactone, or polyethylene glycol.

16. The nanoparticles according to claim 1, wherein the core contains iron oxide.

17. The nanoparticles according to claim 1, further comprising a radioactive label or a dye.

18. The nanoparticles according to claim 17, wherein the radioactive label contains copper 64 (Cu-64).

19. The nanoparticles according to claim 17, wherein the radioactive label is selected from an alpha emitter, a beta emitter, or a gamma emitter.

20. The nanoparticles according to claim 17, wherein the radioactive label is selected from copper 64 (Cu-64), copper 67 (Cu-67), F-18, yttrium 90 (Y-90), scandium 44 (SC-44), cobalt 55 (co-55), niobium 90 (Nb-90), rhenium 186 (Re-186), rhenium 188 (Re-188), terbium 161 (Tb-161), lutetium 177 (Lu-177), bismuth 213 (Bi-213), lead 212 (Pb-212), actinium 225 (Ac-225), zirconium 89 (Zr), or any combination thereof.

21. The nanoparticles according to claim 17, comprising a chelating agent covalently linked to the nanoparticle core and the radioactive label.

22. The nanoparticles according to claim 21, wherein the chelating agent is covalently linked to the nanoparticle core via a chemical moiety.

23. The nanoparticles according to claim 21, wherein the chemical moiety contains a secondary amine.

24. The nanoparticles according to claim 21, wherein the chelating agent contains 1,4,7-triazacyclononane, l-glutaric acid-4,7-acetic acid (NODAGA).

25. The chelating agent is DOTA, DOTA-GA, p-SCN-Bn-DOTA, CB-TE2A, CB-TE1A1P, AAZTA, MeCOSar, p-SCN-Bn-NOTA, NOTA, HBED-CC, THP, MAS ３ , DFO, or any combination thereof, the nanoparticles according to claim 21.

26. A pharmaceutical formulation for slowing the growth of tumors in a subject, the pharmaceutical formulation comprising an effective amount of the nanoparticles according to any one of claims 1 to 25.

27. The pharmaceutical preparation according to claim 26, further comprising at least one pharmaceutically acceptable carrier or diluent.

28. The pharmaceutical preparation according to claim 26, formulated into a dosage form which is an injection, a tablet, a lyophilized powder / dispersion, a suspension, or any combination thereof.

29. A pharmaceutical preparation for retarding the growth of a tumor in a subject, comprising an effective amount of a RIG-I agonist precursor comprising a single-stranded 5'-non-capped triphosphate antisense oligonucleotide having a sequence complementary to an endogenous miRNA.

30. The pharmaceutical preparation according to claim 29, further comprising a single-stranded oligonucleotide sequence complementary to the single-stranded 5'-non-capped triphosphate antisense oligonucleotide.

31. The pharmaceutical preparation according to claim 29, wherein the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221.

32. The pharmaceutical preparation according to claim 29, wherein the antisense oligonucleotide is selected from SEQ ID NOs: 1 to 13.

33. The pharmaceutical preparation according to claim 30, wherein the complementary oligonucleotide sequence is selected from SEQ ID NOs: 14 to 26.

34. The pharmaceutical preparation according to claim 29, wherein the antisense oligonucleotide comprises a sequence that is 15 to 30 nucleotides in length.

35. The pharmaceutical preparation according to claim 29, wherein the antisense oligonucleotide comprises a sequence that is 16 to 27 nucleotides in length.

36. The pharmaceutical preparation according to claim 29, wherein the antisense oligonucleotide is linked to a nanoparticle having a core-shell structure, and the shell comprises the RIG-I agonist precursor.

37. The pharmaceutical preparation according to claim 29, further comprising at least one pharmaceutically acceptable carrier or diluent.

38. The pharmaceutical preparation according to claim 29, formulated into a dosage form which is an injection, a tablet, a lyophilized powder / dispersion, a suspension, or any combination thereof.

39. A method for retarding the growth of a tumor in a subject in need thereof, comprising administering the pharmaceutical preparation according to any one of claims 26 to 38.

40. A method for treating a tumor in a subject in need of treating a tumor, comprising administering the pharmaceutical preparation according to any one of claims 26 to 38.

41. The method according to claim 39 or 40, wherein the tumor is a primary tumor.

42. The method according to claim 39 or 40, wherein the tumor is a secondary tumor.

43. The method according to claim 39 or 40, wherein the administration of the pharmaceutical preparation induces a rapid and long-term immune response against the tumor.

44. The method according to claim 39 or 40, wherein the tumor is selected from the group consisting of sarcoma and cancer.

45. The method according to claim 39 or 40, wherein the tumor is selected from the group consisting of bladder cancer, blood cancer, bone cancer, brain cancer, breast cancer, cervical cancer, colon cancer, kidney cancer, esophageal cancer, endometrial cancer, gastric cancer, glioblastoma, head and neck cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, kidney cancer, skin cancer, stomach cancer, thyroid cancer, and uterine cancer.

46. The method according to claim 42, which induces immune memory against the tumor.

47. The method according to any one of claims 39 to 46, further comprising administering additional supportive or adjuvant therapy.

48. The method according to claim 47, wherein the adjuvant therapy comprises radiotherapy, cryotherapy, or ultrasound therapy.

49. The method according to claim 47, wherein the additional supportive or adjuvant therapy comprises administering an miRNA sequence complementary to the antisense oligonucleotide.

50. The method according to any one of claims 47 to 49, wherein the supportive or adjuvant therapy is administered before, together with, or after the administration of the RIG-I agonist precursor antisense oligonucleotide.

51. The method according to any one of claims 39 to 50, comprising administering an additional therapeutic agent.

52. The method according to claim 51, wherein the additional therapeutic agent is selected from the group consisting of targeted therapy, chemotherapeutic agent, immunotherapeutic agent, immunogenic cell death inducer (ICDi), and siRNA therapy.

53. The method according to claim 52, wherein the chemotherapeutic agent is selected from the group consisting of cyclophosphamide, mechlorethamine, chlorambucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, valrubicin, paclitaxel, docetaxel, etoposide, teniposide, tafuriposide, azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, thioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, all-trans retinoic acid, vinblastine, vincristine, vindesine, vinorelbine and bevacizumab.

54. The method according to claim 52, wherein the targeted therapy is selected from the group consisting of trastuzumab, geotrif, proleukin, alectinib, campus, atezolizumab, avelumab, axitinib, belimumab, belinostat, bevacizumab, berkeley, canakinumab, ceritinib, cetuximab, crizotinib, dabrafenib, daratumumab, dasatinib, denosumab, elotuzumab, enasidenib, erlotinib, gefitinib, ibrutinib, zydelig, imatinib, lenvatinib, midostaurin, necitumumab, niraparib, obinutuzumab, osimertinib, panitumumab, regorafenib, rituximab, luxolitinib, sorafenib, tocilizumab, and trastuzumab.

55. The method according to claim 52, wherein the immunotherapeutic agent is an immune checkpoint inhibitor.

56. The method according to claim 52, wherein the immune checkpoint inhibitor is selected from the group consisting of pembrolizumab (Keytruda (registered trademark)), nivolumab (Opdivo (registered trademark)), atezolizumab (Tecentriq (registered trademark)), ipilimumab (Yervoy (registered trademark)), avelumab (Bavencio (registered trademark)) and durvalumab (Imfinzi (registered trademark)).

57. The method according to claim 52, wherein the ICDi is selected from the group consisting of daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel.

58. The method of claim 52, wherein the siRNA therapy targets PD-L1, CTLA-4, TGF-β, and / or VEGF.

59. A nanoparticle core; A radiolabel; and A single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide linked to the nanoparticle core A nanoparticle comprising, wherein the oligonucleotide is a RIG-I agonist precursor that is complementary to an endogenous miRNA.

60. The nanoparticle of claim 59, wherein the miRNA is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment.

61. A nanoparticle core; A radiolabel; and A single-stranded 5'-non-capped triphosphate or diphosphate-modified RNA oligonucleotide linked to the nanoparticle core A nanoparticle comprising, wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment.

62. The nanoparticle of claim 61, wherein the radiolabel comprises copper 64 (Cu-64).

63. The nanoparticle of claim 61, wherein the radiolabel is selected from an alpha emitter, a beta emitter, or a gamma emitter.

64. The nanoparticle of claim 61, wherein the radiolabel is selected from copper 64 (Cu-64), copper 67 (Cu-67), F-18, yttrium 90 (Y-90), scandium 44 (SC-44), cobalt 55 (co-55), niobium 90 (Nb-90), rhenium 186 (Re-186), rhenium 188 (Re-188), terbium 161 (Tb-161), lutetium 177 (Lu-177), bismuth 231 (Bi-213), lead 212 (Pb-212), actinium 225 (Ac-225), zirconium 89 (Zr), or any combination thereof.

65. The nanoparticle according to any one of claims 59 to 64, comprising a chelating agent covalently linked to the nanoparticle core and the radiolabel.

66. The nanoparticle of claim 65, wherein the chelating agent is covalently linked to the nanoparticle core via a chemical moiety.

67. The nanoparticle of claim 66, wherein the chemical moiety comprises a secondary amine.

68. The nanoparticles according to any one of claims 65 to 67, wherein the chelating agent contains 1,4,7-triazacyclononane, l-glutaric acid-4,7-acetic acid (NODAGA).

69. The chelating agent is DOTA, DOTA-GA, p-SCN-Bn-DOTA, CB-TE2A, CB-TE1A1P, AAZTA, MeCOSar, p-SCN-Bn-NOTA, NOTA, HBED-CC, THP, MAS ３ The nanoparticle according to any one of claims 65 to 67, comprising DFO, or any combination thereof.

70. The nanoparticles according to any one of claims 59 to 69, wherein the nanoparticle core contains an iron oxide core.

71. The nanoparticles according to any one of claims 59 to 70, wherein the nanoparticle core further contains a polymer coating agent.

72. The nanoparticles according to claim 71, wherein the polymer coating agent contains dextran.

73. The nanoparticles according to any one of claims 59 to 72, wherein the nanoparticle core has a diameter of about 10 nanometers (nm) to about 30 nm.

74. The nanoparticles according to any one of claims 59 to 73, wherein the nanoparticle core is magnetic.

75. The nanoparticles according to any one of claims 59 to 74, wherein the modified RNA oligonucleotide is covalently linked to the nanoparticle core via a chemical moiety containing a disulfide bond.

76. The nanoparticles according to any one of claims 59 to 75, wherein the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221.

77. The nanoparticles according to any one of claims 59 to 76, wherein the modified RNA oligonucleotide can form a double strand with the miRNA.

78. The nanoparticles according to any one of claims 59 to 76, wherein the modified RNA oligonucleotide forms a double strand with the miRNA.

79. The nanoparticles according to any one of claims 59 to 78, wherein the miRNA is an oncogenic miRNA.

80. The nanoparticles according to any one of claims 59 to 79, wherein the miRNA is a tumor-related miRNA.

81. The nanoparticles according to claim 77 or 78, wherein the double strand is not cleaved by AGO2.

82. The nanoparticles according to claim 77, 78, or 81, wherein the double strand activates RIG-I.

83. The nanoparticle according to claim 82, wherein the RIG-I activation is at least 5%, 10%, 15% or 20% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide.

84. The nanoparticle according to claim 82 or 83, wherein the RIG-I activation elicits a tumor-specific immune response.

85. The nanoparticle according to claim 84, wherein the tumor-specific immune response includes the release of type I IFN, DAMP (danger-associated molecular pattern), and / or tumor antigens.

86. The nanoparticle according to any one of claims 59 to 85, wherein the modified RNA oligonucleotide does not contain any other modification.

87. The nanoparticle according to any one of claims 59 to 85, wherein the modified RNA oligonucleotide contains at least two different modified RNA oligonucleotides.

88. The nanoparticle according to any one of claims 59 to 85, wherein the modified RNA oligonucleotide contains at least three different modified RNA oligonucleotides.

89. The nanoparticle according to any one of claims 59 to 85, wherein the modified RNA oligonucleotide contains at least four different modified RNA oligonucleotides.

90. The nanoparticle according to any one of claims 59 to 85, wherein the modified RNA oligonucleotide contains at least five different modified RNA oligonucleotides.

91. The nanoparticle according to any one of claims 59 to 85, wherein the modified RNA oligonucleotide contains up to forty different modified RNA oligonucleotides.

92. The nanoparticle according to any one of claims 59 to 91, wherein the modified RNA oligonucleotide further contains a 2'-fluoro (2'-F) ribose modification.

93. The nanoparticle according to claim 92, wherein the 2'-F ribose modification is present at the 10th or 11th nucleotide from the 5' end of the modified RNA oligonucleotide.

94. The nanoparticle according to any one of claims 59 to 93, wherein the modified RNA oligonucleotide does not contain a 2'-O-methyl (2'-OMe) ribose modification.

95. The nanoparticle according to any one of claims 59 to 94, wherein the modified RNA oligonucleotide does not contain an N6-methyladenosine (m6A) modification.

96. The nanoparticle according to any one of claims 59 to 95, wherein the modified RNA oligonucleotide does not contain pseudouridine (Ψ).

97. The nanoparticle according to any one of claims 59 to 96, wherein the modified RNA oligonucleotide does not contain N-1-methylpseudouridine (mΨ) modification.

98. The nanoparticle according to any one of claims 59 to 97, wherein the modified RNA oligonucleotide does not contain 5-methyl-cytidine (5mC) modification.

99. The nanoparticle according to any one of claims 59 to 98, wherein the modified RNA oligonucleotide does not contain 5-hydroxymethyl-cytidine (5hmC) modification.

100. The nanoparticle according to any one of claims 59 to 99, wherein the modified RNA oligonucleotide does not contain 5-methoxycytidine (5moC) modification.

101. The nanoparticle according to any one of claims 59 to 100, wherein the modified RNA oligonucleotide contains a sequence that is at least 19 nucleotides in length.

102. The nanoparticle according to any one of claims 59 to 100, wherein the modified RNA oligonucleotide contains a sequence that is 15 to 30 nucleotides in length.

103. The nanoparticle according to any one of claims 59 to 100, wherein the modified RNA oligonucleotide contains a sequence that is 16 to 27 nucleotides in length.

104. The nanoparticle according to any one of claims 59 to 103, wherein the modified RNA oligonucleotide is completely complementary to the miRNA.

105. The nanoparticle according to any one of claims 59 to 104, wherein the modified RNA oligonucleotide competes with the endogenous mRNA and binds to the miRNA.

106. The nanoparticle according to any one of claims 77, 78, 81, or 82, wherein the double-strand contains 0 to 5 mismatched base pairs.

107. The nanoparticle according to any one of claims 59 to 106, wherein the modified RNA oligonucleotide contains one of the nucleic acid sequences of SEQ ID NOs: 1 to 13.

108. The nanoparticle according to any one of claims 59 to 107, wherein the modified RNA oligonucleotide contains the nucleic acid sequence of SEQ ID NO:

6.

109. The nanoparticle according to claim 108, wherein the nucleic acid of SEQ ID NO: 6 is complementary to miR-21.

110. The nanoparticle according to any one of claims 59 to 107, wherein the modified RNA oligonucleotide comprises the nucleic acid sequence of SEQ ID NO:

1.

111. The nanoparticle according to claim 110, wherein the nucleic acid of SEQ ID NO: 1 is complementary to miR-10b.

112. A pharmaceutical composition comprising the nanoparticle according to any one of claims 59 to 111.

113. The pharmaceutical composition according to claim 112, further comprising at least one pharmaceutically acceptable carrier or diluent.

114. The pharmaceutical composition according to claim 112 or 113, formulated into a dosage form that is an injection, a tablet, a lyophilized powder / dispersion, a suspension, or any combination thereof.

115. A method for generating a localized immune response, comprising: administering to a subject a nanoparticle core; a radioactive label; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment, and administering a therapeutically effective amount of the nanoparticle to thereby generate a localized immune response.

116. A method for treating a solid tumor in a subject, comprising: administering to the subject a nanoparticle core; a radioactive label; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment, and administering a therapeutically effective amount of the nanoparticle to thereby generate a localized immune response.

117. A method for detecting, diagnosing, and / or monitoring the treatment of a solid tumor in a subject, comprising: administering to the subject a nanoparticle core; a radioactive label; and a single-stranded 5'-non-capped triphosphate or diphosphate modified RNA oligonucleotide linked to the nanoparticle core wherein the oligonucleotide is complementary to a miRNA that is highly expressed in a solid tumor or solid tumor microenvironment as compared to a non-solid tumor or non-solid tumor microenvironment, and administering the nanoparticle to thereby generate a localized immune response.

118. The method according to any one of claims 115 to 117, further comprising imaging the subject to determine the location or number of tumor cells in the subject.

119. The method according to any one of claims 115 to 117, further comprising imaging the subject to determine the location of the nanoparticles in the subject.

120. The method according to any one of claims 118 or 119, further comprising administering one or more doses of radiation to the subject.

121. The method according to claim 120, increasing the local immune response by at least 1-fold.

122. The method according to claim 120 or 121, increasing the local immune response by at least 2-fold (e.g., at least 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, or 100-fold).

123. The method according to claim 120, further comprising imaging the subject using a suitable imaging technique after administering one or more doses of radiation to the subject.

124. The method according to any one of claims 117 to 123, wherein the imaging is performed using magnetic resonance imaging, computed tomography imaging, positron emission tomography imaging, single photon emission computed tomography imaging, or any combination thereof.

125. The method according to any one of claims 115 to 124, wherein the radiolabel comprises copper 64 (Cu-64).

126. The method according to any one of claims 115 to 124, wherein the radiolabel comprises copper 67 (Cu-67), yttrium 90 (Y-90), terbium 161 (Tb-161), lutetium 177 (Lu-177), bismuth 213 (Bi-213), lead 212 (Pb-212), actinium 225 (Ac-225), zirconium 89 (Zr), or any combination thereof.

127. The method according to any one of claims 115 to 126, wherein the nanoparticles comprise a chelating agent covalently linked to the nanoparticle core and to the radiolabel.

128. The method according to claim 127, wherein the chelating agent is covalently linked to the nanoparticle core via a chemical moiety.

129. The method according to claim 128, wherein the chemical moiety comprises a secondary amine.

130. The method according to claim 127 or 128, wherein the chelating agent comprises 1,4,7-triazacyclononane, l-glutamic acid-4,7-acetic acid (NODAGA).

131. The chelating agent is DOTA, DOTA-GA, p-SCN-Bn-DOTA, CB-TE2A, CB-TE1A1P, AAZTA, MeCOSar, p-SCN-Bn-NOTA, NOTA, HBED-CC, THP, MAS ３ The method according to claim 127 or 128, comprising DFO, or any combination thereof.

132. The method according to any one of claims 115 to 131, wherein the modified RNA oligonucleotide is covalently linked to the nanoparticle core via a chemical moiety containing a disulfide bond.

133. The method according to any one of claims 115 to 132, wherein the nanoparticle core comprises an iron oxide core.

134. The method according to any one of claims 115 to 133, wherein the nanoparticle core further comprises a polymer coating agent.

135. The method according to claim 134, wherein the polymer coating agent comprises dextran.

136. The method according to any one of claims 115 to 135, wherein the nanoparticle core has a diameter of about 10 nanometers (nm) to about 30 nm.

137. The method according to any one of claims 115 to 136, wherein the nanoparticle core is magnetic.

138. The method according to any one of claims 115 to 137, wherein the miRNA is selected from the group consisting of miR10b, miR17, miR18a, miR18b, miR19b, miR21, miR26a, miR29a, miR92a-1, miR92a-2, miR155, miR210, and miR221.

139. The method according to any one of claims 115 to 138, wherein the modified RNA oligonucleotide can form a duplex with the miRNA.

140. The method according to any one of claims 115 to 139, wherein the modified RNA oligonucleotide forms a duplex with the miRNA.

141. The method according to claim 139 or 140, wherein the duplex is not cleaved by AGO2.

142. The method according to claim 139 or 140, wherein the duplex activates RIG-I.

143. The method according to any one of claims 115 to 142, wherein the miRNA is an oncogenic miRNA.

144. The method according to any one of claims 115 to 142, wherein the miRNA is a tumor-related miRNA.

145. The method according to claim 142, wherein the RIG-I activation is at least 5%, 10%, 15% or 20% greater than the activation by the corresponding unmodified monophosphate RNA oligonucleotide. **Claim 146** The method according to claim 142 or 145, wherein the RIG-I activation elicits a tumor-specific immune response. **Claim 147** The method according to claim 146, wherein the tumor-specific immune response includes the release of type I IFN, DAMP (danger-associated molecular pattern), and / or tumor antigen. **Claim 148** The method according to any one of claims 115 to 147, wherein the modified RNA oligonucleotide does not contain any other modification. **Claim 149** The method according to any one of claims 115 to 147, wherein the modified RNA oligonucleotide contains at least two different modified RNA oligonucleotides. **Claim 150** The method according to any one of claims 115 to 147, wherein the modified RNA oligonucleotide contains at least three different modified RNA oligonucleotides. **Claim 151** The method according to any one of claims 115 to 147, wherein the modified RNA oligonucleotide contains at least four different modified RNA oligonucleotides. **Claim 152** The method according to any one of claims 115 to 147, wherein the modified RNA oligonucleotide contains at least five different modified RNA oligonucleotides. **Claim 153** The method according to any one of claims 115 to 147, wherein the modified RNA oligonucleotide contains at most 40 different modified RNA oligonucleotides. **Claim 154** The method according to any one of claims 115 to 147 or 149 to 153, wherein the modified RNA oligonucleotide further contains a 2'-fluoro (2'-F) ribose modification. **Claim 155** The method according to claim 154, wherein the 2'-F ribose modification is present at the 10th or 11th nucleotide from the 5' end of the modified RNA oligonucleotide. **Claim 156** The method according to any one of claims 115 to 155, wherein the modified RNA oligonucleotide does not contain a 2'-O-methyl (2'-OMe) ribose modification. **Claim 157** The method according to any one of claims 115 to 156, wherein the modified RNA oligonucleotide does not contain an N6-methyladenosine (m6A) modification.

158. The method according to any one of claims 115 to 157, wherein the modified RNA oligonucleotide does not contain pseudouridine (Ψ).

159. The method according to any one of claims 115 to 158, wherein the modified RNA oligonucleotide does not contain N-1-methylpseudouridine (mΨ) modification.

160. The method according to any one of claims 115 to 159, wherein the modified RNA oligonucleotide does not contain 5-methyl-cytidine (5mC) modification.

161. The method according to any one of claims 115 to 160, wherein the modified RNA oligonucleotide does not contain 5-hydroxymethyl-cytidine (5hmC) modification.

162. The method according to any one of claims 115 to 161, wherein the modified RNA oligonucleotide does not contain 5-methoxycytidine (5moC) modification.

163. The method according to any one of claims 115 to 162, wherein the modified RNA oligonucleotide contains a sequence that is at least 19 nucleotides in length.

164. The method according to any one of claims 115 to 162, wherein the modified RNA oligonucleotide contains a sequence that is 15 to 30 nucleotides in length.

165. The method according to any one of claims 115 to 162, wherein the modified RNA oligonucleotide contains a sequence that is 16 to 27 nucleotides in length.

166. The method according to any one of claims 115 to 164, wherein the modified RNA oligonucleotide is completely complementary to the miRNA.

167. The method according to any one of claims 115 to 166, wherein the modified RNA oligonucleotide competes with the endogenous mRNA and binds to the miRNA.

168. The method according to any one of claims 139 to 142, wherein the double-strand contains 0 to 5 mismatched base pairs.

169. The method according to any one of claims 115 to 168, wherein the modified RNA oligonucleotide contains one of the nucleic acid sequences of SEQ ID NOs: 1 to 13.

170. The method according to any one of claims 115 to 169, wherein the modified RNA oligonucleotide contains the nucleic acid sequence of SEQ ID NO:

6.

171. The method according to claim 170, wherein the nucleic acid of SEQ ID NO: 6 is complementary to miR-21.

172. The method according to any one of claims 115 to 169, wherein the modified RNA oligonucleotide comprises the nucleic acid sequence of SEQ ID NO:

1.

173. The method according to claim 172, wherein the nucleic acid of SEQ ID NO: 1 is complementary to miR-10b.

174. The method according to any one of claims 115 to 173, wherein the nanoparticles enhance the radiosensitivity of the solid tumor.

175. The method according to any one of claims 115 to 174, wherein the solid tumor is selected from the group consisting of sarcoma and cancer.

176. The method according to any one of claims 115 to 175, wherein the solid tumor is selected from the group consisting of bladder cancer, blood cancer, bone cancer, brain cancer, breast cancer, cervical cancer, colon cancer, kidney cancer, esophageal cancer, endometrial cancer, gastric cancer, glioblastoma, head and neck cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, kidney cancer, skin cancer, stomach cancer, thyroid cancer, and uterine cancer.

177. The method according to any one of claims 115 to 176, which induces immune memory against the solid tumor.

178. The method according to any one of claims 115 to 177, wherein the treatment using the nanoparticles is a monotherapy.

179. The method according to any one of claims 115 to 178, further comprising administering additional supportive or adjuvant therapy.

180. The method according to claim 179, wherein the adjuvant therapy comprises radiotherapy, cryotherapy, or ultrasound therapy.

181. The method according to any one of claims 115 to 180, comprising administering an additional therapeutic agent.

182. The method according to claim 179, wherein the additional supportive or adjuvant therapy comprises miRNA.

183. The method according to any one of claims 179 to 181, wherein the miRNA according to claim 121 is complementary to the modified RNA oligonucleotide.

184. The method according to claim 181, wherein the additional therapeutic agent is selected from the group consisting of targeted therapy, chemotherapeutic agent, immunotherapeutic agent, immunogenic cell death inducer (ICDi), and siRNA therapy.

185. The method according to any one of claims 115 to 184, further comprising surgery.

186. The method according to claim 184, wherein the chemotherapeutic agent is selected from the group consisting of cyclophosphamide, mechlorethamine, chlorambucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, valrubicin, paclitaxel, docetaxel, etoposide, teniposide, tafuriposide, azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, thioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, all-trans retinoic acid, vinblastine, vincristine, vindesine, vinorelbine, and bevacizumab.

187. The method according to claim 184, wherein the targeted therapy is selected from the group consisting of trastuzumab, ziotrif, proleukin, alectinib, campath, atezolizumab, avelumab, axitinib, belimumab, belinostat, bevacizumab, belkyid, canakinumab, ceritinib, cetuximab, crizotinib, dabrafenib, daratumumab, dasatinib, denosumab, elotuzumab, enasidenib, erlotinib, gefitinib, ibrutinib, zydelig, imatinib, lenvatinib, midostaurin, necitumumab, niraparib, obinutuzumab, osimertinib, panitumumab, regorafenib, rituximab, luxolitinib, sorafenib, tocilizumab, and trastuzumab.

188. The method according to claim 184, wherein the immunotherapeutic agent is an immune checkpoint inhibitor.

189. The method according to claim 184, wherein the immune checkpoint inhibitor is selected from the group consisting of pembrolizumab (Keytruda (registered trademark)), nivolumab (Opdivo (registered trademark)), atezolizumab (Tecentriq (registered trademark)), ipilimumab (Yervoy (registered trademark)), avelumab (Bavencio (registered trademark)), and durvalumab (Imfinzi (registered trademark)).

190. The method according to any one of claims 179 to 189, wherein the adjuvant therapy induces the expression of the miRNA.

191. The method according to any one of claims 179 to 190, wherein the additional therapeutic agent induces the expression of the miRNA.

192. The method according to claim 184, wherein the ICDi is selected from the group consisting of daunorubicin, docetaxel, doxorubicin, mitoxantrone, oxaliplatin, and paclitaxel.

193. The method according to claim 184, wherein the siRNA therapy targets PD-L1, CTLA-4, TGF-β, and / or VEGF.

194. The method according to any one of claims 179 to 132, wherein the supportive or adjuvant therapy is administered before, together with, or after the administration of the modified RNA oligonucleotide.

195. The method according to any one of claims 115 to 194, wherein the nanoparticles are administered to the subject at a dose of less than about 0.014 mg / kg.

196. The method according to any one of claims 115 to 195, wherein the nanoparticles are administered in an amount sufficient to reduce invasion or metastasis of cancer cells in the subject.

197. The method according to claim 196, wherein the cancer cell metastasis is from a primary solid tumor to lymph nodes in the subject or from lymph nodes to secondary tissues in the subject.

198. The method according to claim 196 or 197, wherein the cancer cells are selected from the group consisting of breast cancer cells, colon cancer cells, kidney cancer cells, lung cancer cells, skin cancer cells, ovarian cancer cells, pancreatic cancer cells, prostate cancer cells, rectal cancer cells, gastric cancer cells, thyroid cancer cells, and uterine cancer cells.

199. The method according to any one of claims 115 to 198, wherein the nanoparticles are administered to the subject in two or more doses.

200. The method according to any one of claims 115 to 198, wherein the nanoparticles are administered to the subject at least once a week.

201. The method according to any one of claims 115 to 200, wherein the nanoparticles are administered to the subject by intravenous, subcutaneous, intraarterial, intramuscular, or intraperitoneal administration.

202. A method for preparing the nanoparticles according to any one of claims 59 to 111, comprising: preparing the nanoparticle core; covalently linking the modified RNA oligonucleotide to the nanoparticle core; Covalently linking the chelating agent to the nanoparticle core by reacting the nanoparticle core with the chelating agent at a ratio of about 40 chelating agent equivalents per nanoparticle core; ６４ Adding a solution of CuCh to the nanoparticle core; and ６４ Purifying a mixture of a solution of CuCh and the nanoparticle core to obtain the nanoparticles A method comprising.

203. The method according to claim 202, wherein covalently linking the chelating agent to the nanoparticle core is carried out at a temperature of about 0 °C to about 8 °C.

204. ６４ The method according to claim 202 or 203, further comprising heating a mixture of the CuCh solution and the nanoparticle core at a temperature of from about 40°C to about 65°C.

205. The method according to claim 204, wherein the mixture is heated for about 10 minutes to about 30 minutes.

Images