RNA interference oligonucleotides for inhibiting the formation of the perineuronal network
RNAi oligonucleotides delivered by MSC-exo EVs target and inhibit key proteins in the PNN, addressing the limitations of current spinal cord injury treatments by enhancing neuronal regeneration and plasticity.
Patent Information
- Application Number
- JP2024577145
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-07-10
- Filing Date
- 2023-07-09
- Publication Date
- 2025-07-17
AI Technical Summary
Current treatments for spinal cord injury lack effective methods to inhibit the perineuronal network (PNN), which limits neuronal plasticity and regeneration, and existing delivery methods for siRNA are not selective enough to target specific proteins within the Central Nervous System (CNS).
Development of RNA interference (RNAi) oligonucleotides, such as siRNA and shRNA, that specifically inhibit the expression of proteins like neurocan (NCAN) and tenascin-R (TNR) within the PNN, delivered via extracellular vesicles (EVs) derived from mesenchymal stem cells (MSC-exo) to disrupt PNN formation and enhance neuronal regeneration.
The RNAi oligonucleotides effectively inhibit PNN formation, promoting neuronal plasticity and regeneration by specifically targeting key proteins, offering a controlled and selective treatment for spinal cord injury.
Smart Images

Figure 2025522830000007 
Figure 2025522830000008 
Figure 2025522830000009
Abstract
Description
Technical Field
[0001] The present invention relates to RNA interference (RNAi) oligonucleotides that inhibit the expression of proteins involved in the formation of the perineuronal network, extracellular vesicles, and compositions containing the RNAi oligonucleotides or extracellular vesicles, and their use.
Background Art
[0002] Spinal cord injury is considered to be a chronic and irreversible condition. To date, there is no effective treatment that can bring about functional recovery after severe spinal cord injury. There are several neurological mechanisms underlying the limited ability of neurons to regenerate after transection. One of these mechanisms is the perineuronal network (PNN), an extracellular matrix that inhibits the plasticity of neurons in adulthood and thus also limits their regenerative ability.
[0003] PNN is composed of several proteins of the lectican family of chondroitin sulfate proteoglycans (CSPGs): neurocan (NCAN), tenascin-R (TNR), versican (VCAN), brevican (BCAN), and aggrecan (ACAN), which are highly organized into a ternary stable structure. These proteins are synthesized by neurons and maintain synaptic stabilization in the adult brain. PNN is a dynamic scaffold involved in plasticity regulation. Pathological studies have shown that there is a significant increase in the expression of CsPG in the lesion area that is most likely to prevent axonal regeneration and plasticity after spinal cord injury (SCI).
[0004] The use of siRNA for protein inhibition in the Central Nervous System (CNS) requires a smart delivery method that can transport the siRNA to the target cells and maintain its functionality. Exosomes are small lipid nanovesicles that are naturally used for cell-to-cell communication. Several studies have demonstrated that exosomes can be loaded and used as carriers for therapeutic agents.
[0005] Guo et al., (ACS Nano. 2019;13(9):10015 - 10028. doi:10.1021 / acsnano.9b01892); Perets et al., Nano Lett. 2019;19(6):3422 - 3431. doi:10.1021 / acs.nanolett.8b04148) have previously shown that exosomes derived from mesenchymal stem cells (MSC-exo) can specifically accumulate in the inflamed regions within the CNS after intranasal administration. Specifically, International Publication No. WO 2019186558 has demonstrated that siRNA against phosphatase and tensin homolog (PTEN) can be loaded into MSC-exo for delivery and promotion of spinal cord regeneration after complete transection. Since siRNA inhibits the expression of specific proteins within cells, the delivery method needs to preserve this ability and enable siRNA uptake by the target cells. Exosomes are excellent delivery systems in this regard as they are naturally taken up by their target cells.
[0006] To study its function, several methods of PNN degradation have been demonstrated. The most common strategy for PNN degradation involves the use of enzymatic digestion of PNN by chondroitinase ABC (O’Dell DE, Schreurs BG, Smith-Bell C, Wang D. Neurobiol Learn Mem. 2021;177(December 2020):107358. doi:10.1016 / j.nlm.2020.107358). Chondroitinase ABC (ChABC) is an enzyme obtained from a bacterium called Proteus vulgaris and acts by degrading the glycosaminoglycan side chains of CSPGs. The use of ChABC has been shown to be able to transiently degrade PNN and thus enable neuronal regeneration in the spinal cord after injury. However, ChABC does not selectively degrade specific PNN proteins and can have extensive effects on several other mechanisms such as immune regulatory responses by affecting IL-10. Currently, no efficient methods and further treatments for PNN destabilization are available. Such methods could be effective treatments in the case of spinal cord injury and are thus highly needed.
Summary of the Invention
[0007] The present invention is based on the development of novel RNA interference (RNAi) oligonucleotides such as siRNA molecules that can inhibit the expression of several proteins that play important roles in the formation of the perineuronal net (PNN). Specifically, inhibition of neurocan (NCAN), tenascin-R (TNR), or both is achieved.
[0008] As described above, PNNs are mainly observed in mature neurons and are involved in plasticity restriction. Thus, interfering with PNN formation enables greater neural plasticity and subsequent nerve regeneration. Unlike enzymatic degradation, RNA-based inhibition of protein expression is more specific and controllable. Since PNNs are protein-based structures, their structure can be disrupted by inhibiting the expression of one of the proteins that form them. Extracellular vesicles (EVs) derived from mesenchymal stem cells (MSC-exo) are used as a delivery system. These EVs have previously been demonstrated to have a natural ability to accumulate in inflamed areas and also convey natural therapeutic capabilities. Thus, additive and synergistic effects between short-term inhibition of PNN formation and MSC-exo were anticipated. The present invention relates to RNAi oligonucleotides capable of inhibiting the expression of proteins that are part of the PNN matrix, specifically, RNAi, RNAi molecules, or combinations thereof that inhibit the expression of proteins selected from neurocan (NCAN), tenascin-R (TNR), aggrecan (ACAN), versican (VCAN), and brevican (BCAN), isolated EVs containing the same, and pharmaceutical compositions containing the EVs and their use in the treatment of neurological conditions.
[0009] According to one aspect, the present invention provides an RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA comprising a guide strand that inhibits the expression of proteins in the perineuronal network. According to some examples, the proteins in the perineuronal network are selected from neurocan (NCAN) and tenascin-R (TNR). Thus, according to some embodiments, the present invention provides an RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5 and 30-43. In some examples, the RNAi oligonucleotide comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5 is for inhibiting the expression of neurocan (NCAN). In some examples, the RNAi oligonucleotide comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30-43 is for inhibiting the expression of tenascin-R (TNR). Thus, in some examples, the present invention provides an RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5 and 30-43 for inhibiting the expression of proteins in the perineuronal network selected from neurocan (NCAN) and tenascin-R (TNR).
[0010] According to some examples, the present invention provides an RNA interference (RNAi) oligonucleotide comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95, which inhibits the expression of neurocan. According to some examples, the RNAi oligonucleotide is selected from siRNA and shRNA. According to some examples, the RNAi oligonucleotide is siRNA, and the guide strand consists of a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95. According to some examples, the RNAi oligonucleotide comprises a strand complementary to the guide strand, and the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some examples, the complementary strand comprises 14 to 19 nucleotides. According to some examples, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20, and 96-105.
[0011] According to some examples, the present invention provides an RNA interference (RNAi) oligonucleotide comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71, which inhibits the expression of tenascin-R (TNR). According to some examples, the RNAi oligonucleotide is selected from siRNA and shRNA. According to some examples, the RNAi oligonucleotide is siRNA, and the guide strand consists of a nucleic acid sequence selected from SEQ ID NOs: 58-71. According to some examples, the RNAi oligonucleotide comprises a strand complementary to the guide strand, and the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some examples, the complementary strand comprises 14 to 19 nucleotides. According to some examples, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85.
[0012] According to some examples, the present invention provides conjugates with another part of RNAi as defined above. According to some examples, the RNAi is conjugated to a hydrophobic molecule selected from the group consisting of, for example, sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof. According to some examples, the RNAi is conjugated to a hydrophilic moiety. In some examples, the hydrophilic moiety is a carbohydrate. In some examples, the carbohydrate is selected from glucose and sucrose.
[0013] According to another aspect, the present invention provides isolated extracellular vesicles (EVs) comprising an RNA interference (RNAi) oligonucleotide that inhibits the expression of proteins of the perineuronal network. According to some examples, the RNAi oligonucleotide is selected from siRNA and shRNA. In some examples, the protein of the perineuronal network is selected from neurocan (NCAN), tenascin-R, aggrecan (ACAN), versican (VCAN), brevican (BCAN), and combinations thereof. According to some examples, the EV is selected from exosomes, microvesicles, and combinations thereof. According to some examples, the isolated EV comprises an RNAi oligonucleotide that inhibits the expression of NCAN as described in this application. According to some embodiments, the isolated EV comprises an RNAi oligonucleotide that inhibits the expression of tenascin-R as described in this application.
[0014] According to another aspect, the present invention provides a pharmaceutical composition comprising an RNAi oligonucleotide or isolated EV as defined in the examples and embodiments of the present application, and a pharmaceutically acceptable carrier. According to some embodiments, the pharmaceutical composition is formulated for administration via an administration route selected from intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, and intracerebral administration routes. According to some embodiments, the pharmaceutical composition is for use in treating neuronal injury or damage in a subject. According to some embodiments, the pharmaceutical composition is for use in optionally increasing neuroplasticity and / or nerve regeneration after neuronal injury or damage. According to one embodiment, the neuronal injury or damage is spinal cord injury (SCI). According to some specific embodiments, the use comprises intranasal administration of the composition.
[0015] According to another aspect, the present invention provides a method of treating neuronal injury or damage in a subject in need thereof, the method comprising administering to the subject an isolated extracellular vesicle comprising an inhibitor of the expression of a protein selected from neurocan (NCAN), tenascin-R (TNR), aggrecan (ACAN), versican (VCAN), brevican (BCAN), and combinations thereof, in a therapeutically effective amount. According to some embodiments, the method comprises administering an EV comprising an RNAi oligonucleotide of the present invention that inhibits the expression of NCAN and / or TNR. According to some embodiments, the method comprises intranasal administration of the EV. BRIEF DESCRIPTION OF THE DRAWINGS
[0016]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6A
Figure 6B
Best Mode for Carrying Out the Invention
[0017] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In case of conflict, the patent specification, including definitions, will control.
[0018] The present invention provides RNA interference oligonucleotides, such as siRNA or shRNA, that can inhibit the expression of at least one protein that forms the perineuronal network (PNN), and thereafter can inhibit the formation of the PNN. Such oligonucleotides can be useful for enabling neuronal regeneration after neuronal damage or injury that is generally inhibited or prevented by PNN formation.
[0019] NCAN In one aspect, the present invention provides an RNA silencing oligonucleotide for inhibiting the expression of neurocan. According to some embodiments, the RNA silencing oligonucleotide is an RNA interference (RNAi) oligonucleotide. According to some embodiments, the RNAi oligonucleotide, i.e., siRNA or shRNA, is designed to bind to the sequence of NCAN mRNA within the region of base numbers 1000 to 1300, preferably within the region of base numbers 1100 to 1200, in the sequence of SEQ ID NO: 21. According to some embodiments, the RNAi oligonucleotide, i.e., siRNA or shRNA, is designed to bind to the sequence of NCAN mRNA within the region of base numbers 3700 to 4000, preferably within the region of base numbers 3800 to 3900, in the sequence of SEQ ID NO: 21. According to some embodiments, the RNAi oligonucleotide, i.e., siRNA or shRNA, is designed to bind to the sequence of NCAN mRNA within the region of base numbers 500 to 800, preferably within the region of base numbers 600 to 700, in the sequence of SEQ ID NO: 21. According to some embodiments, the siRNA comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 to 5. According to some embodiments, the RNAi is selected from siRNA and shRNA. Thus, according to some embodiments, the present invention provides an RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 to 5. According to some embodiments, the RNAi oligonucleotide is for inhibiting the expression of neurocan. The sequences of the present invention are summarized in Table 1. According to some embodiments, RNAi such as siRNA and shRNA comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 11 to 15.
[0020] As used herein, the term "polynucleotide" refers to a long nucleic acid containing more than 150 nucleotides. As used herein, the term "oligonucleotide" refers to a short sequence of single-stranded or double-stranded nucleic acid such as ribonucleic acid (RNA), deoxyribonucleic acid (DNA), or mimetics thereof, which typically has 150 or fewer nucleotides. According to some embodiments, an oligonucleotide consists of 2 to 150, 10 to 100, or 14 to 50 nucleotides. According to other embodiments, an oligonucleotide consists of 15 to 40, 17 to 35, or 18 to 30 nucleic acids.
[0021] As used herein, the terms "RNA silencing agent", "RNA silencing molecule", and "RNA silencing oligonucleotide" are used interchangeably herein and refer to an RNA that can inhibit or "silence" the expression of a target gene. In certain embodiments, an RNA silencing agent can prevent the complete processing (e.g., complete translation and / or expression) of an mRNA molecule through a post-transcriptional silencing mechanism, e.g., by degradation of the mRNA via RNA interference. RNA silencing agents include non-coding RNA molecules, such as RNA duplexes containing complementary strands, as well as precursor RNAs that can generate such small non-coding RNAs. Exemplary RNA silencing agents, also referred to as RNA interference oligonucleotides, include dsRNAs such as siRNA, miRNA, and shRNA. In one embodiment, an RNA silencing agent can induce RNA interference. In another embodiment, an RNA silencing agent can mediate translational repression.
[0022] The term "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by RNA interference oligonucleotides such as short interfering RNAs (siRNAs) and shRNAs. The corresponding process in plants is generally called post-transcriptional gene silencing or RNA silencing, and is also called quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily conserved cellular defense mechanism used to prevent the expression of foreign genes, and is generally shared by diverse microbial floras and phyla. Such protection from foreign gene expression may have evolved through a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA in response to the production of double-stranded RNA (dsRNA) induced in the host genome from viral infection or random integration of transposon elements.
[0023] The presence of long dsRNA in the cell stimulates the activity of ribonuclease III enzymes called Dicer. Dicer is involved in processing dsRNA into short fragments of dsRNA known as small interfering RNAs (siRNAs). Small interfering RNAs resulting from Dicer activity are typically approximately 21 to 23 nucleotides in length and contain a duplex of approximately 19 base pairs. The RNAi response is also generally characterized by an endonuclease complex called the RNA-induced silencing complex (RISC), which mediates the cleavage of single-stranded RNA having a sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA occurs in the middle of the region complementary to the antisense strand of the siRNA duplex.
[0024] The terms "small interfering RNA" and "siRNA" refer to small interfering RNA duplexes (generally between 18 base pairs and 30 base pairs) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21mers with a 19bp duplex region in the center and symmetric 2-base 3' overhangs at the ends, although RNA duplexes chemically synthesized to be 25 bases to 30 bases in length have recently been reported to have 100-fold increased potency compared to 21mers in the same location. The increased potency observed using long RNAs to trigger RNAi is theorized to result from providing the substrate (27mer) to Dicer instead of the product (21mer), thereby improving the rate or efficiency of entry of the siRNA duplex into RISC. Shorter siRNAs such as those containing 19 nucleotides (nt) to 20 nucleotides (nt) in the mRNA-binding strand. Typically, artificial siRNAs appear as a 21mer guide (antisense) strand oligonucleotide that interacts with the mRNA and a shorter complementary strand (sense, usually 19mer) complementary to the guide strand. As used herein, the term "complementary" refers to the ability of a first polynucleotide to hybridize to a second polynucleotide under certain conditions.
[0025] The position of the 3'-overhang affects the potency of the siRNA, and asymmetric duplexes with a 3'-overhang on the antisense strand have generally been found to be more potent than those with a 3'-overhang on the sense strand. When targeting the antisense transcript, the opposite efficacy pattern is observed, which may be due to the asymmetric strand loaded into RISC.
[0026] According to some embodiments, the RNAi is siRNA. According to some embodiments, the siRNA that inhibits the expression of NCAN comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5. According to some embodiments, the siRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-5. According to some embodiments, the siRNA that inhibits the expression of NCAN comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 11-15 and 86-95. According to some embodiments, the siRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 11-15 and 86-95.
[0027] The terms "guide strand", "antisense strand", and "guide strand oligonucleotide" are used interchangeably herein and refer to the strand of siRNA or shRNA that binds directly to the mRNA molecule and is thus complementary to the mRNA molecule.
[0028] As used herein, the term "inhibiting the expression of X" means inhibiting the expression of gene X and inhibiting the production of X protein.
[0029] According to other embodiments, the RNAi is shRNA. According to some embodiments, the shRNA that inhibits the expression of NCAN comprises a nucleic acid sequence selected from SEQ ID NOs: 1-5. According to some embodiments, the shRNA that inhibits the expression of NCAN comprises a nucleic acid sequence selected from SEQ ID NOs: 11-15 and 86-95.
[0030] As used herein, the term "shRNA" refers to an RNA agent having a stem-loop structure that includes first and second regions of complementary sequences, where the degree of complementarity and the orientation of the regions are such that base pairing occurs between the regions, the first and second regions are joined by a loop region, and the loop is sufficient due to the lack of base pairing between nucleotides (or nucleotide analogs) within this loop region. The number of nucleotides within the loop is as known in the art and may vary, for example, including 3 nt to 23 nt, or 5 nt to 15 nt, or 7 nt to 13 nt, or 4 nt to 9 nt, or 9 nt to 11 nt. Some of the nucleotides within the loop can participate in base pair interactions with other nucleotides within the loop. Typically, an shRNA molecule has less than about 400 nucleotides (nt) to 500 nucleotides (nt), or less than 100 nt to 200 nt, and at least one stretch of at least 14 nucleotides to 100 nucleotides (e.g., 17 nt to 50 nt, 19 nt to 29 nt) base pairs with a complementary sequence located on the same RNA molecule (single-stranded RNA), and the sequence and the complementary sequence are separated by a non-paired region of at least about 4 nucleotides to 7 nucleotides (or about 9 nt to about 15 nt, about 15 nt to about 100 nt, about 100 nt to about 1000 nt), forming a single-stranded loop on the stem structure created by the two regions of base complementarity.
[0031] According to some embodiments, RNAi oligonucleotides such as siRNA or shRNA are not natural RNAi, i.e., they do not occur naturally and are artificially designed, chemically modified, and / or manufactured. According to some embodiments, siRNAi is artificial siRNA. According to some embodiments, shRNA is artificial shRNA.
[0032] The term "Neurocan" refers to the human chondroitin sulfate proteoglycan protein having the UniProtKB ID of O14594.
[0033] According to some embodiments, an RNAi oligonucleotide, e.g., siRNA or shRNA, comprises a complementary strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the sense strand comprises 14 to 19 nucleotides. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 6-10, wherein the complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 16-20 and 96-105. As shown in Table 1, SEQ ID NOs: 1-10 contain N which can be any nucleotide. Here, and in any applicable embodiment of the present application, the N at position 1 of the guide strand is complementary to the N at position 19 of the corresponding complementary (sense) strand, and the N at position 19 of the guide strand is complementary to the N at position 1 of the corresponding sense strand, and this position is counted from the 5' end with respect to the sequence of the oligonucleotide.
[0034] According to some embodiments, the RNAi oligonucleotide that inhibits the expression of NCAN is an siRNA comprising or consisting of a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95. According to another embodiment, the siRNA that inhibits the expression of NCAN comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20, and 96-105, and this complementary strand contains nucleic acids complementary to the nucleic acids at the corresponding positions in the guide strand sequence at positions 1 and 19. According to some embodiments, the siRNA that inhibits the expression of NCAN comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 1 and 5, (ii) SEQ ID NO: 2 and 7, (iii) SEQ ID NO: 3 and 8, or (iv) SEQ ID NO: 4 and 9, (v) SEQ ID NO: 5 and 10, and the N nucleotides in the guide strand are complementary to the Ns in the complementary strand at the corresponding positions. According to some embodiments, the siRNA that inhibits the expression of NCAN comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 11 and 16, (ii) SEQ ID NO: 12 and 17, (iii) SEQ ID NO: 13 and 18, or (iv) SEQ ID NO: 14 and 9, (v) SEQ ID NO: 15 and 20, (vi) SEQ ID NO: 86 and 96, (vii) SEQ ID NO: 87 and 77, (viii) SEQ ID NO: 88 and 88, (ix) SEQ ID NO: 89 and 99, (x) SEQ ID NO: 90 and 100, (xi) SEQ ID NO: 91 and 101, (xii) SEQ ID NO: 92 and 102, (xiii) SEQ ID NO: 93 and 103, (xiv) SEQ ID NO: 94 and 104, or (xv) SEQ ID NO: 95 and 105. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 16. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 17. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 18.
[0035] According to some embodiments, the present invention provides an siRNA comprising a guide strand containing the nucleic acid sequence of SEQ ID NO: 86 and a complementary strand containing the nucleic acid sequence of SEQ ID NO: 96. According to some embodiments, the present invention provides an siRNA comprising a guide strand containing the nucleic acid sequence of SEQ ID NO: 87 and a complementary strand containing the nucleic acid sequence of SEQ ID NO: 97. According to some embodiments, the present invention provides an siRNA comprising a guide strand containing the nucleic acid sequence of SEQ ID NO: 88 and a complementary strand containing the nucleic acid sequence of SEQ ID NO: 98. According to some embodiments, the present invention provides an siRNA comprising a guide strand containing the nucleic acid sequence of SEQ ID NO: 89 and a complementary strand containing the nucleic acid sequence of SEQ ID NO: 99. According to some embodiments, the present invention provides an siRNA comprising a guide strand containing the nucleic acid sequence of SEQ ID NO: 90 and a complementary strand containing the nucleic acid sequence of SEQ ID NO: 100. According to some embodiments, the present invention provides an siRNA comprising a guide strand containing the nucleic acid sequence of SEQ ID NO: 91 and a complementary strand containing the nucleic acid sequence of SEQ ID NO: 101. According to some embodiments, the present invention provides an siRNA comprising a guide strand containing the nucleic acid sequence of SEQ ID NO: 92 and a complementary strand containing the nucleic acid sequence of SEQ ID NO: 102. According to some embodiments, the present invention provides an siRNA comprising a guide strand containing the nucleic acid sequence of SEQ ID NO: 93 and a complementary strand containing the nucleic acid sequence of SEQ ID NO: 103. According to some embodiments, the present invention provides an siRNA comprising a guide strand containing the nucleic acid sequence of SEQ ID NO: 94 and a complementary strand containing the nucleic acid sequence of SEQ ID NO: 104. According to some embodiments, the present invention provides an siRNA comprising a guide strand containing the nucleic acid sequence of SEQ ID NO: 95 and a complementary strand containing the nucleic acid sequence of SEQ ID NO: 105. According to some embodiments, the RNAi oligonucleotide that inhibits the expression of NCAN is an shRNA comprising a guide strand containing a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95 or consisting of them. According to another embodiment, the shRNA that inhibits the expression of NCAN comprises a complementary strand containing a nucleic acid sequence selected from SEQ ID NOs: 6-10 and 96-105, and this complementary strand contains nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand at positions 1 and 19.According to some embodiments, the shRNA that inhibits the expression of NCAN comprises a pair of oligonucleotides comprising or consisting of the nucleic acid sequences (i) SEQ ID NO: 1 and 6, (ii) SEQ ID NO: 2 and 7, (iii) SEQ ID NO: 3 and 8, or (iv) SEQ ID NO: 4 and 9, (v) SEQ ID NO: 5 and 10, wherein the N at position 19 of the guide strand is complementary to the N at position 19 of the corresponding sense strand, the N at position 19 of the guide strand is complementary to the N at position 1 of the corresponding sense strand, and the position is counted from the 5' end with respect to the sequence of the oligonucleotide. According to some embodiments, the shRNA that inhibits the expression of NCAN comprises a pair of oligonucleotides comprising or consisting of the nucleic acid sequences (i) SEQ ID NO: 11 and 16, (ii) SEQ ID NO: 12 and 17, (iii) SEQ ID NO: 13 and 18, or (iv) SEQ ID NO: 14 and 9, (v) SEQ ID NO: 15 and 20, (vi) SEQ ID NO: 86 and 96, (vii) SEQ ID NO: 87 and 77, (viii) SEQ ID NO: 88 and 88, (ix) SEQ ID NO: 89 and 99, (x) SEQ ID NO: 90 and 100, (xi) SEQ ID NO: 91 and 101, (xii) SEQ ID NO: 92 and 102, (xiii) SEQ ID NO: 93 and 103, (xiv) SEQ ID NO: 94 and 104, or (xv) SEQ ID NO: 95 and 105. According to some embodiments, the present invention provides an shRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 16. According to some embodiments, the present invention provides an shRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 17. According to some embodiments, the present invention provides an shRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 18.
[0036] According to some embodiments, the RNAi oligonucleotides of the present invention are conjugated to another moiety. According to some embodiments, the RNAi oligonucleotides of the present invention are conjugated to a hydrophilic moiety. According to some embodiments, the RNAi oligonucleotides of the present invention are conjugated to a hydrophobic moiety. Thus, according to some embodiments, the siRNA or shRNA oligonucleotides of the present invention are conjugated to a hydrophobic moiety. According to some embodiments, the hydrophobic molecule is bound to the guide strand. According to some embodiments, the hydrophobic molecule is bound to the complementary strand. According to some embodiments, the moiety is a loading moiety. The term "loading moiety" refers to a moiety that enables or enhances the loading of the molecule into EVs.
[0037] According to one embodiment, this hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, peptides, and combinations thereof. According to one embodiment, the RNA interference oligonucleotide is conjugated to a sterol. In an exemplary embodiment, this moiety is the sterol cholesterol molecule, and thus, according to such an embodiment, the RNA interference oligonucleotide is conjugated to cholesterol. According to some embodiments, one of the strands of the double-stranded RNAi is conjugated to a hydrophobic molecule such as cholesterol. According to other embodiments, the two strands of the double-stranded RNAi are conjugated to a hydrophobic molecule such as cholesterol. According to other embodiments, the RNA interference oligonucleotide is conjugated to a molecule selected from monosialotetrahexosylganglioside (GM1), lipid, vitamin, small molecule, peptide, or combinations thereof. In some embodiments, this moiety is a lipid. For example, in certain embodiments, this moiety is palmitoyl. In some embodiments, this moiety is a sterol, such as cholesterol. Additional hydrophobic moieties include, for example, phospholipids, vitamin D, vitamin E, squalene, and fatty acids. In another exemplary embodiment, the RNAi oligonucleotide is conjugated to myristic acid or a derivative thereof (e.g., myristoylated oligonucleotide cargo). In some embodiments, the hydrophobic moiety is conjugated at the end of the oligonucleotide cargo (i.e., "end modification"). In other embodiments, the hydrophobic moiety is conjugated to another part of the oligonucleotide molecule.
[0038] According to some embodiments, the RNAi oligonucleotide of the present invention is conjugated to a hydrophobic moiety selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof.
[0039] According to some embodiments, the siRNA is conjugated to cholesterol. According to some embodiments, cholesterol is conjugated to the guide strand of the siRNA. According to other embodiments, cholesterol is conjugated to the complementary strand of the siRNA. According to some embodiments, cholesterol is conjugated to the shRNA.
[0040] According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 16, wherein the siRNA is conjugated to cholesterol. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 17, wherein the siRNA is conjugated to cholesterol. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 18, wherein the siRNA is conjugated to cholesterol.
[0041] According to some embodiments, the siRNA or shRNA oligonucleotide of the present invention for inhibiting the expression of tenascin-R is conjugated with a hydrophilic moiety. According to some embodiments, the hydrophilic molecule is bound to the guide strand. According to some embodiments, the hydrophilic molecule is bound to the complementary strand. According to some embodiments, the hydrophilic moiety is a loading moiety. In some embodiments, the hydrophilic loading moiety is a carbohydrate or a derivative thereof. In some embodiments, the hydrophilic loading moiety is a carbohydrate. According to some embodiments, the carbohydrate derivative is a conjugate of a carbohydrate with a lipid. According to some embodiments, the carbohydrate derivative comprises a carbohydrate bound to a lipid. According to some embodiments, the lipid is selected from phospholipids, fatty acids, triglycerides, and amino alcohols such as serine and hydroxyproline. According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides. According to some embodiments, the carbohydrate is a monosaccharide. According to some embodiments, the monosaccharide is selected from glucose, fructose, ribose, arabinose, galactose, mannose, and xylose. According to some embodiments, the monosaccharide is glucose. According to some embodiments, the monosaccharide is fructose. According to some embodiments, the monosaccharide is arabinose. According to some embodiments, the carbohydrate is a disaccharide. According to some embodiments, the disaccharide is selected from sucrose, lactose, and maltose. According to some embodiments, the disaccharide is sucrose. According to some embodiments, the carbohydrate is a trisaccharide. According to some embodiments, the trisaccharide is selected from maltotriose and raffinose. According to some embodiments, the carbohydrate is a tetrasaccharide. According to some embodiments, the carbohydrate is an oligosaccharide. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose, and maltotriose. According to some embodiments, the hydrophilic loading moiety is glucose.
[0042] According to some embodiments, the siRNA is conjugated with glucose. According to some embodiments, the glucose is conjugated to the guide strand of the siRNA. According to other embodiments, the glucose is conjugated to the complementary strand of the siRNA. According to some embodiments, the glucose is conjugated to the shRNA.
[0043] According to some embodiments, the loading moiety is bound to the siRNA or shRNA via a linker. According to some embodiments, the linker is selected from hydrophilic, hydrophobic, and amphiphilic linkers. According to some embodiments, the linker is DBCO-C6-azide.
[0044] According to some embodiments, the present invention provides an siRNA comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 11 and SEQ ID NO: 16, respectively, and optionally conjugated to glucose via a linker. According to some embodiments, the present invention provides an siRNA comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 12 and SEQ ID NO: 17, respectively, and optionally conjugated to glucose via a linker. According to some embodiments, the present invention provides an siRNA comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 13 and SEQ ID NO: 18, respectively, and optionally conjugated to glucose via a linker.
[0045] The siRNA and shRNA molecules promote sequence-specific degradation of the mRNA by RNAi to achieve inhibition of the expression of the NCAN protein gene or a reduction in the expression level of the NCAN gene, for example, by 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%.
[0046] According to another aspect, the present invention provides a composition comprising an RNAi molecule of the present invention and a carrier. Any one of the above definitions, terms, and embodiments is incorporated herein and applies equally. As used herein, the term "carrier" refers to any class of compounds or compositions useful for facilitating the storage, stability, administration, cell targeting, and / or delivery of a topical composition, and includes suitable vehicles, skin conditioning agents, skin protectants, diluents, emollients, solvents, excipients, pH adjusters, salts, colorants, rheology modifiers, thickeners, lubricants, humectants, defoamers, erodible polymers, hydrogels, surfactants, emulsifiers, emulsion stabilizers, adjuvants, surfactants, preservatives, chelating agents, fatty acids, mono-, di-, and tri-glycerides and their derivatives, waxes, oils, and water, but is not limited thereto. According to some embodiments, the present invention provides a composition comprising an siRNA molecule comprising a pair of guide strand and complementary strand, wherein the pair comprises or consists of the nucleic acid sequences of SEQ ID NO: 11 and 16, SEQ ID NO: 12 and 17, or SEQ ID NO: 13 and 18, and optionally, the siRNA is conjugated to cholesterol or glucose. According to some embodiments, the present invention provides a composition comprising an siRNA molecule comprising a pair of guide strand and complementary strand, wherein the pair comprises or consists of the nucleic acid sequences of SEQ ID NO: 86 and 96, SEQ ID NO: 87 and 77, SEQ ID NO: 88 and 88, SEQ ID NO: 89 and 99, SEQ ID NO: 90 and 100, SEQ ID NO: 91 and 101, SEQ ID NO: 92 and 102, SEQ ID NO: 93 and 103, SEQ ID NO: 94 and 104, or SEQ ID NO: 95 and 105, and optionally, the siRNA is conjugated to cholesterol or glucose. Some embodiments are that the carrier is a pharmaceutically acceptable carrier and the composition is a pharmaceutical composition.
[0047] TNR In one aspect, the present invention provides an RNA silencing oligonucleotide for inhibiting the expression of tenascin-R (TNR). According to some embodiments, the RNA silencing oligonucleotide is an RNA interference oligonucleotide. According to some embodiments, the RNAi oligonucleotide, i.e., siRNA or shRNA, is designed to bind to the sequence of TNR mRNA within the region of nucleotide numbers 1600 - 2000, preferably within the region of nucleotide numbers 1700 - 1850, in the sequence of SEQ ID NO: 22. According to some embodiments, the RNAi oligonucleotide, i.e., siRNA or shRNA, is designed to bind to the sequence of TNR mRNA within the region of nucleotide numbers 4300 - 4700, preferably within the region of nucleotide numbers 4400 - 4500, in the sequence of SEQ ID NO: 22. According to some embodiments, the RNAi that inhibits the expression of TNR comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30 - 43. According to some embodiments, the RNAi that inhibits the expression of TNR comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 58 - 71. According to some embodiments, the RNAi is selected from siRNA and shRNA. Thus, according to some embodiments, the present invention provides an RNAi oligonucleotide selected from siRNA and shRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30 - 43 and 58 - 71. According to some embodiments, the RNAi oligonucleotide is for inhibiting the expression of TNR.
[0048] According to some embodiments, the oligonucleotide consists of 2 to 150, 10 to 100, or 14 to 50 nucleotides. According to other embodiments, the oligonucleotide consists of 15 to 40, 17 to 35, or 18 to 30 nucleic acids.
[0049] According to some embodiments, the RNAi is selected from siRNA, miRNA, and shRNA.
[0050] According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the siRNA that inhibits the expression of TNR comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30-43. According to some embodiments, the siRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 30-43. According to some embodiments, the siRNA that inhibits the expression of TNR comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 58-71. According to some embodiments, the siRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 58-71.
[0051] According to some embodiments, the RNAi is shRNA. According to some embodiments, the shRNA that inhibits the expression of TNR comprises a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71.
[0052] The term "tenascin-R" refers to a human extracellular matrix glycoprotein belonging to the tenascin family and having UniProtKB of Q92752.
[0053] According to some embodiments, an RNAi oligonucleotide, e.g., siRNA or shRNA, comprises a complementary strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14 to 19 nucleotides. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 44 to 57, wherein the complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. As shown in Table 1, SEQ ID NOs: 30 to 57 contain N, where N can be any nucleotide, the N at position 1 of the guide strand is complementary to the N at position 19 of the corresponding sense strand, the N at position 19 of the guide strand is complementary to the N at position 1 of the corresponding sense strand, and the positions are counted from the 5' end with respect to the sequence. In the sequence listing file, T represents U in the sequence of the RNA molecule. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 72 to 85.
[0054] According to some embodiments, the RNAi oligonucleotide is an siRNA that inhibits the expression of TNR and includes a guide strand that includes or consists of a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to another embodiment, the siRNA includes a complementary strand that includes a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, and this complementary strand includes, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to some embodiments, the present invention provides an siRNA that includes or consists of a pair of oligonucleotides that include the nucleic acid sequences (i) SEQ ID NO: 30 and 44, (ii) SEQ ID NO: 31 and 45, (iii) SEQ ID NO: 32 and 46, (iv) SEQ ID NO: 33 and 47, (v) SEQ ID NO: 34 and 48, (vi) SEQ ID NO: 45 and 49, (vii) SEQ ID NO: 56 and 50, (viii) SEQ ID NO: 37 and 51, (ix) SEQ ID NO: 38 and 52, (x) SEQ ID NO: 39 and 53, (xi) SEQ ID NO: 40 and 54, (xii) SEQ ID NO: 41 and 55, (xiii) SEQ ID NO: 42 and 56, or (xiv) SEQ ID NO: 43 and 57, and the N nucleotides in the guide strand are complementary to the N in the complementary strand at the corresponding positions. According to some embodiments, the siRNA includes or consists of a pair of oligonucleotides that include the nucleic acid sequences (i) SEQ ID NO: 58 and 72, (ii) SEQ ID NO: 59 and 73, (iii) SEQ ID NO: 60 and 74, (iv) SEQ ID NO: 61 and 75, (v) SEQ ID NO: 62 and 76, (v) SEQ ID NO: 63 and 77, (vii) SEQ ID NO: 64 and 78, (viii) SEQ ID NO: 65 and 79, (ix) SEQ ID NO: 66 and 80, (x) SEQ ID NO: 67 and 81, (xi) SEQ ID NO: 68 and 82, (xii) SEQ ID NO: 69 and 83, (xiii) SEQ ID NO: 70 and 84, or (xiv) SEQ ID NO: 71 and 85. According to some embodiments, the present invention provides an siRNA that includes a guide strand that includes the nucleic acid sequence of SEQ ID NO: 58 and a complementary strand that includes the nucleic acid sequence of SEQ ID NO: 72. According to some embodiments, the present invention provides an siRNA that includes a guide strand that includes the nucleic acid sequence of SEQ ID NO: 61 and a complementary strand that includes the nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides an siRNA that includes a guide strand that includes the nucleic acid sequence of SEQ ID NO: 62 and a complementary strand that includes the nucleic acid sequence of SEQ ID NO: 76.
[0055] According to some embodiments, the RNAi oligonucleotide is an shRNA that inhibits the expression of tenascin-R and includes a guide strand that includes or consists of a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to another embodiment, the shRNA includes a complementary strand that includes a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 82-85. According to some embodiments, the shRNA includes or consists of a pair of oligonucleotides that includes the nucleic acid sequences (i) SEQ ID NO: 30 and 44, (ii) SEQ ID NO: 31 and 45, (iii) SEQ ID NO: 32 and 46, (iv) SEQ ID NO: 33 and 47, (v) SEQ ID NO: 34 and 48, (vi) SEQ ID NO: 45 and 49, (vii) SEQ ID NO: 56 and 50, (viii) SEQ ID NO: 37 and 51, (ix) SEQ ID NO: 38 and 52, (x) SEQ ID NO: 39 and 53, (xi) SEQ ID NO: 40 and 54, (xii) SEQ ID NO: 41 and 55, (xiii) SEQ ID NO: 42 and 56, or (xiv) SEQ ID NO: 43 and 57, and the N nucleotides in the guide strand are complementary to the Ns in the complementary strand at the corresponding positions. According to some embodiments, the shRNA includes or consists of a pair of oligonucleotides that includes the nucleic acid sequences (i) SEQ ID NO: 58 and 72, (ii) SEQ ID NO: 59 and 73, (iii) SEQ ID NO: 60 and 74, (iv) SEQ ID NO: 61 and 75, (v) SEQ ID NO: 62 and 76, (vi) SEQ ID NO: 63 and 77, (vii) SEQ ID NO: 64 and 78, (viii) SEQ ID NO: 65 and 79, (ix) SEQ ID NO: 66 and 80, (x) SEQ ID NO: 67 and 81, (xi) SEQ ID NO: 68 and 82, (xii) SEQ ID NO: 69 and 83, (xiii) SEQ ID NO: 70 and 84, or (xiv) SEQ ID NO: 71 and 85. According to some embodiments, the present invention provides an shRNA that includes a guide strand that includes the nucleic acid sequence of SEQ ID NO: 58 and a complementary strand that includes the nucleic acid sequence of SEQ ID NO: 72. According to some embodiments, the present invention provides an shRNA that includes a guide strand that includes the nucleic acid sequence of SEQ ID NO: 61 and a complementary strand that includes the nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides an shRNA that includes a guide strand that includes the nucleic acid sequence of SEQ ID NO: 62 and a complementary strand that includes the nucleic acid sequence of SEQ ID NO: 76.
[0056] According to some embodiments, the RNAi oligonucleotide for inhibiting the expression of tenascin-R of the present invention is conjugated to another moiety. According to some embodiments, the RNAi oligonucleotide of the present invention is conjugated to a hydrophobic moiety. According to some embodiments, the RNAi oligonucleotide of the present invention is conjugated to a hydrophobic molecule / moiety. According to some embodiments, the siRNA or shRNA oligonucleotide of the present invention is conjugated to a hydrophobic molecule. According to some embodiments, the hydrophobic molecule is bound to the guide strand. According to some embodiments, the hydrophobic molecule is bound to the complementary strand.
[0057] According to one embodiment, this hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, peptides, and combinations thereof. According to one embodiment, the RNA interference oligonucleotide is conjugated to a sterol. In an exemplary embodiment, this moiety is the sterol cholesterol molecule, and thus, according to such an embodiment, the RNA interference oligonucleotide is conjugated to cholesterol. According to some embodiments, one of the strands of the double-stranded RNAi is conjugated to a hydrophobic molecule such as cholesterol. According to other embodiments, the two strands of the double-stranded RNAi are conjugated to a hydrophobic molecule such as cholesterol. According to other embodiments, the RNA interference oligonucleotide is conjugated to a molecule selected from monosialotetrahexosylganglioside (GM1), lipid, vitamin, small molecule, peptide, or combinations thereof. In some embodiments, this moiety is a lipid. For example, in certain embodiments, this moiety is palmitoyl. In some embodiments, this moiety is a sterol, such as cholesterol. Additional hydrophobic moieties include, for example, phospholipids, vitamin D, vitamin E, squalene, and fatty acids. In another exemplary embodiment, the RNAi oligonucleotide is conjugated to myristic acid or a derivative thereof (e.g., myristoylated oligonucleotide cargo). In some embodiments, the hydrophobic moiety is conjugated at the end of the oligonucleotide cargo (i.e., "end modification"). In other embodiments, the hydrophobic moiety is conjugated to another part of the oligonucleotide molecule.
[0058] According to some embodiments, the RNAi oligonucleotide of the present invention is conjugated to a hydrophobic moiety selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof.
[0059] According to some embodiments, the siRNA for inhibiting the expression of tenascin-R is conjugated with cholesterol. According to some embodiments, cholesterol is conjugated to the guide strand of the siRNA. According to other embodiments, cholesterol is conjugated to the complementary strand of the siRNA. According to some embodiments, cholesterol is conjugated to the shRNA. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 72, wherein the siRNA is conjugated with cholesterol. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 75, wherein the siRNA is conjugated with cholesterol. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 76, wherein the siRNA is conjugated with cholesterol.
[0060] According to some embodiments, the siRNA or shRNA oligonucleotide of the present invention for inhibiting the expression of tenascin-R is conjugated with a hydrophilic moiety. According to some embodiments, the hydrophilic molecule is bound to the guide strand. According to some embodiments, the hydrophilic molecule is bound to the complementary strand. According to some embodiments, the hydrophilic moiety is a loading moiety. In some embodiments, the hydrophilic loading moiety is a carbohydrate or a derivative thereof. In some embodiments, the hydrophilic loading moiety is a carbohydrate. According to some embodiments, the sugar is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides. According to some embodiments, the carbohydrate derivative is a conjugate of a carbohydrate with a lipid. According to some embodiments, the carbohydrate derivative comprises a carbohydrate conjugated with a lipid. According to some embodiments, the lipid is selected from phospholipids, fatty acids, triglycerides, and amino alcohols such as serine and hydroxyproline. According to some embodiments, the carbohydrate is a monosaccharide. According to some embodiments, the monosaccharide is selected from glucose, fructose, ribose, arabinose, galactose, mannose, and xylose. According to some embodiments, the monosaccharide is glucose. According to some embodiments, the monosaccharide is fructose. According to some embodiments, the monosaccharide is arabinose. According to some embodiments, the carbohydrate is a disaccharide. According to some embodiments, the disaccharide is selected from sucrose, lactose, and maltose. According to some embodiments, the disaccharide is sucrose. According to some embodiments, the carbohydrate is a trisaccharide. According to some embodiments, the trisaccharide is selected from maltotriose and raffinose. According to some embodiments, the carbohydrate is a tetrasaccharide. According to some embodiments, the carbohydrate is an oligosaccharide. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose, and maltotriose. According to some embodiments, the hydrophilic loading moiety is glucose.
[0061] According to some embodiments, the siRNA is conjugated to glucose. According to some embodiments, glucose is conjugated to the guide strand of the siRNA. According to other embodiments, glucose is conjugated to the complementary strand of the siRNA. According to some embodiments, glucose is conjugated to the shRNA.
[0062] According to some embodiments, the loading moiety is bound to the siRNA or shRNA via a linker. According to some embodiments, the linker is selected from hydrophilic, hydrophobic, and amphiphilic linkers. According to some embodiments, the linker is DBCO-C6-azide.
[0063] According to some embodiments, the present invention provides an siRNA comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 58 and SEQ ID NO: 72, respectively, optionally conjugated to glucose via a linker. According to some embodiments, the present invention provides an siRNA comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 61 and SEQ ID NO: 75, respectively, optionally conjugated to glucose via a linker. According to some embodiments, the present invention provides an siRNA comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 62 and SEQ ID NO: 76, respectively, optionally conjugated to glucose via a linker.
[0064] According to another aspect, the present invention provides a composition comprising an RNAi oligonucleotide that inhibits the expression of the TNR of the present invention and a carrier. Any one of the above definitions, terms, and embodiments is incorporated herein and applied similarly. As used herein, the term "carrier" refers to any class of compounds or compositions useful for facilitating the storage, stability, administration, cell targeting, and / or delivery of a topical composition, and includes suitable vehicles, skin conditioning agents, skin protectants, diluents, emollients, solvents, excipients, pH adjusters, salts, colorants, rheology modifiers, thickeners, lubricants, humectants, defoaming agents, erodeable polymers, hydrogels, surfactants, emulsifiers, emulsion stabilizers, adjuvants, surfactants, preservatives, chelating agents, fatty acids, mono-, di-, and tri-glycerides and their derivatives, waxes, oils, and water, but is not limited thereto.
[0065] According to some embodiments, the present invention provides a composition comprising an siRNA molecule comprising a pair of a guide strand and a complementary strand, wherein the pair comprises or consists of the nucleic acid sequences of SEQ ID NO: 58 and 72, SEQ ID NO: 61 and 75, or SEQ ID NO: 62 and 76, and optionally, the siRNA is conjugated with cholesterol or glucose. In some embodiments, the carrier is a pharmaceutically acceptable carrier and the composition is a pharmaceutical composition.
[0066] siRNA and shRNA molecules promote sequence-specific degradation of mRNA by RNAi to achieve inhibition of the expression of the TNR protein or a reduction in the expression level of the TNR gene, for example, by 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%.
[0067] EV According to another aspect, the present invention provides an isolated EV comprising an RNA interference (RNAi) oligonucleotide that inhibits the expression of a protein selected from neurocan (NCAN), tenascin-R (TNR), and combinations thereof. The present invention provides an isolated EV loaded with an RNA interference (RNAi) oligonucleotide that inhibits the expression of a protein selected from neurocan (NCAN), tenascin-R (TNR), and combinations thereof. Any one of the above definitions, terms, and embodiments is incorporated herein and applies equally. For EVs, the terms "loaded" and "comprising" when referring to an RNAi oligonucleotide can be used interchangeably.
[0068] According to some embodiments, the present invention provides an isolated EV comprising an RNAi oligonucleotide that inhibits the expression of neurocan. According to some embodiments, the present invention provides an isolated EV comprising an RNAi oligonucleotide that inhibits the expression of tenascin-R. According to some embodiments, the present invention provides an isolated EV comprising an RNAi oligonucleotide that inhibits the expression of neurocan and tenascin-R.
[0069] According to some embodiments, the RNAi oligonucleotide is exogenous. As used herein, the term "exogenous" refers to a molecule or substance (e.g., a compound, nucleic acid, or protein) that is derived from outside of a given membrane vesicle, such as an EV, and is not naturally present in the vesicle. For EVs, this term refers to a molecule or substance that is not naturally present in the vesicle and is also not present in the cell from which the EV is derived. According to some embodiments, the term "exogenous" refers to a synthetic (artificially synthesized) non-natural molecule. According to some embodiments, the substance is artificially loaded into the EV or the cell from which the EV is derived. For peptides, proteins, and nucleic acids, this term means that the compound is either artificially loaded into the EV or the cell from which the vesicle is derived, or is artificially expressed within the cell from which the vesicle is derived, but the compound is not naturally expressed in the parental cell.
[0070] The terms "extracellular vesicles" and "EVs" are used interchangeably herein and refer to vesicles derived from cells that contain a membrane surrounding an internal space. Generally, EVs range in diameter from 30 nm to 1500 nm, more frequently in the range of 40 nm to 1200 nm, and can contain various cargo molecules that are present on the outer surface of the extracellular vesicle, span the membrane, and / or are within the internal space. This cargo molecule can include nucleic acids, proteins, carbohydrates, lipids, small molecules, and / or combinations thereof. EVs can be classified into the following three subpopulations: (I) exosomes: having a diameter of 30 nm to 150 nm and derived from the endosomal compartment, (II) microvesicles: having a diameter of 100 nm to 1 μm and released from the cell surface by "blebbing", and (III) apoptotic bodies: having a diameter of 1 μm to 5 μm and released from apoptotic cells. The term EVs also includes the terms "exosomes" and "microvesicles". The terms "exosomes" and "nanovesicles" are used interchangeably herein and refer to EVs having a size of 30 nm to 150 nm. In some references, exosomes refer to EVs having a size of 30 nm to 100 nm. The term "microvesicles" as used herein refers to EVs having a size of 150 nm to 1000 nm. Generally, EVs can contain at least a portion of the molecular contents of the cells from which they are derived, such as lipids, fatty acids, polypeptides, polynucleotides, proteins, and / or saccharides.
[0071] The EVs of the present invention are mostly spherical, and the terms "size", "particle size", "average particle size", and "particle diameter size" as used herein interchangeably refer to the diameter of the EV or the maximum dimension of the EV. The size of the EVs of the present invention can be determined using any known method for measuring particle size. A non-limiting example is nanoparticle-tracking analysis (NTA).
[0072] According to some embodiments, the isolated EVs are exosomes. According to one embodiment, the exosomes have a diameter of 30 nm to 150 nm, 40 nm to 120 nm, 50 nm to 100 nm, 30 nm to 100 nm, 30 nm to 80 nm, or 60 nm to 80 nm.
[0073] According to another embodiment, the EVs are microvesicles. According to one embodiment, the microvesicles have a diameter of 100 nm to 1000 nm, 120 nm to 800 nm, 150 nm to 600 nm, or 200 nm to 400 nm. According to another embodiment, the microvesicles have a size of 100 nm to 300 nm or 150 nm to 250 nm.
[0074] According to some embodiments, the EVs have a diameter of 30 nm to 250 nm or 50 nm to 200 nm. According to some embodiments, the EVs have a diameter of 70 nm to 170 nm or 80 nm to 150 nm.
[0075] The EVs can have a size range such as 2 nm to 20 nm, 2 nm to 50 nm, 2 nm to 100 nm, 2 nm to 150 nm, or 2 nm to 200 nm. The EVs can have a size of 20 nm to 50 nm, 20 nm to 100 nm, 20 nm to 150 nm, or 20 nm to 200 nm. The EVs can have a size of 50 nm to 100 nm, 50 nm to 150 nm, or 50 nm to 200 nm. The EVs can have a size of 100 nm to 150 nm or 100 nm to 200 nm. The EVs can have a size of 150 nm to 200 nm. The EVs can have a size of 100 to 600 nm, 150 to 500 nm, or 200 to 400 nm.
[0076] The size can be determined by various means. In principle, the size can be determined by size fractionation and filtration through a membrane with an appropriate size cutoff.
[0077] According to a further embodiment, the isolated EVs are a combination of small vesicles and large vesicles, such as microvesicles and exosomes.
[0078] As described above, EVs are derived from cells. The terms "derived from" and "originating from" are used interchangeably herein and refer to vesicles produced within, within, by, or from a particular cell, cell type, or cell population. As used herein, the terms "parent cell", "producer cell", and "original cell" include any cell from which extracellular vesicles are derived and isolated. The term also encompasses cells that share the protein, lipid, sugar, or nucleic acid components of the extracellular vesicles. For example, a "parent cell" or "producer cell" includes a cell that functions as a source of extracellular vesicles. According to some embodiments, the cell is a eukaryotic cell.
[0079] Extracellular vesicles (EVs) can be obtained from living cells by any of several means, such as secretion, budding, or dispersion from living cells. EVs are isolable from mesenchymal stem cells (MSCs), neural crest cells (NCCs), mesenchymal stem cell conditioned medium (MSC-CM), or neural crest cell conditioned medium. EVs can have or at least assume the activity of parent cells such as MSCs, NCCs, NCC-CM, or MSC-CM. EVs can assume and perform substantially most or all of the functions of the activity of parent cells such as MSCs, NCCs, NCC-CM, or MSC-CM. For example, EVs can be a substitute (or biological substitute) for MSCs, NCCs, NCC-CM, or MSC-CM. For example, EVs can be generated, exuded, released, or emitted from living cells. When the living cells are in cell culture, the particles can be secreted into the cell culture medium.
[0080] Examples of living cells from which EVs can be derived include adherent cells that express mesenchymal markers such as mesenchymal stem cells, oral mucosal stem cells or olfactory ensheathing cells, astrocytes, and neural crest cells. Thus, according to some embodiments, the present invention provides a pharmaceutical composition comprising EVs loaded with the RNAi of the present invention, wherein the EVs are derived from adherent cells that express mesenchymal markers. According to one embodiment, the adherent cells that express mesenchymal markers are selected from mesenchymal stem cells (MSCs), oral mucosal stem cells, and olfactory ensheathing cells. According to one embodiment, the cells are mesenchymal stem cells (MSCs). According to one embodiment, the EVs are derived from mesenchymal stem cells (MSCs).
[0081] The term "mesenchymal stem cell" refers to multipotent stromal cells that can differentiate into a variety of cell types well known in the art, including osteoblasts (bone cells), chondrocytes (cartilage cells), myocytes (muscle cells), and adipocytes (fat cells).
[0082] In their pluripotent state, mesenchymal stem cells typically express the following markers: CD105, CD166, CD29, CD90, and CD73, and do not express CD34, CD45, and CD133.
[0083] Mesenchymal stem cells can be isolated from various tissues including, but not limited to, bone marrow, adipose tissue, dental pulp, oral mucosa, peripheral blood, and amniotic fluid. According to one embodiment, mesenchymal stem cells are isolated from bone marrow. According to one embodiment, mesenchymal stem cells are derived from a site selected from bone marrow, adipose tissue, umbilical cord, dental pulp, oral mucosa, peripheral blood, and amniotic fluid. According to some embodiments, EVs are derived from bone marrow-derived MSCs. According to other embodiments, EVs are derived from adipose tissue-derived MSCs. According to such some embodiments, EVs are selected from exosomes, microvesicles, and combinations thereof. According to some embodiments, the cells express CD105, CD166, CD29, CD90, and CD73 markers. According to a further embodiment, the cells express CD105, CD166, CD29, CD90, and CD73 and do not express CD34, CD45, and CD133. According to some embodiments, the cells are selected from dental pulp stem cells (DPSC), stem cells from human exfoliated deciduous teeth (SHED), periodontal ligament stem cells (PDLSC), stem cells from apical papilla (SCAP), and dental follicle progenitor cells (DFPC).
[0084] According to some such embodiments, EVs contain or express at least a fraction of the markers expressed by the cells from which the EVs are derived.
[0085] EVs can contain one or more proteins, oligonucleotides, or polynucleotides secreted by specific cell types, such as mesenchymal stem cells or neural crest cells. EVs can contain one or more proteins or polynucleotides present in mesenchymal stem cell conditioned medium (MSC-CM). In certain embodiments, EVs can contain miRNAs derived from MSCs or neural crest cells. For example, EVs can contain 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, or 70% or more of these proteins and / or polynucleotides. EVs can contain substantially about 75% of these proteins and / or polynucleotides. Proteins can be defined by reference to a list of proteins or gene products of a list of genes.
[0086] EVs can have at least one property of mesenchymal stem cells. The particles can have biological properties such as biological activity. The particles can have any of the biological activities of MSCs. The particles can have, for example, the therapeutic or restorative activity of MSCs.
[0087] Methods for isolating, purifying, and expanding mesenchymal stem cells (MSCs) are known in the art and include, for example, the methods disclosed in U.S. Patent No. 5,486,359 by Caplan and Haynesworth, and Jones E.A. et al., 2002, Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells, Arthritis Rheum. 46(12):3349-60.
[0088] Mesenchymal stem cell cultures can be generated by diluting BM aspirates (usually 20 ml) with an equal volume of Hank's balanced salt solution (HBSS; GIBCO Laboratories, Grand Island, NY, USA) and layering the diluted cells on approximately 10 mL of a Ficoll column (Ficoll-Paque; Pharmacia, Piscataway, NJ, USA). After centrifugation at 2,500×g for 30 minutes, the mononuclear cell layer is removed from the interface and suspended in HBSS. The cells are then centrifuged at 1,500×g for 15 minutes and resuspended in complete medium (α-MEM without deoxyribonucleotides or ribonucleotides; GIBCO), 100 units / ml penicillin (GIBCO), 100 μg / mL streptomycin (GIBCO), and 2 mM L-glutamine (GIBCO). The resuspended cells are seeded into approximately 25 mL of medium in a 10-cm culture dish (Corning Glass Works, Corning, NY) and incubated at 37°C in 5% humidified CO2. After 24 hours of culture, non-adherent cells are discarded and adherent cells are washed twice thoroughly with phosphate buffered saline (PBS). The medium is replaced with fresh complete medium every 3 or 4 days for approximately 14 days. The adherent cells are then harvested with 0.25% trypsin and 1 mM EDTA (trypsin / EDTA, GIBCO) at 37°C for 5 minutes and reseeded into 6-cm plates for a further 14 days of culture. Next, the cells are trypsinized and counted using a cell counting device such as a hemocytometer (Hausser Scientific, Horsham, PA). The cultured cells are recovered by centrifugation and resuspended in 5% DMSO and 30% FCS at a concentration of 1×10 6 cells to 2×10 6 cells per ml. Approximately 1 ml aliquots are slowly frozen and stored in liquid nitrogen.
[0089] To expand the mesenchymal stem cell fraction, frozen cells are thawed at 37°C, diluted with complete medium, recovered by centrifugation to remove DMSO. The cells are resuspended in complete medium and seeded at approximately 5,000 cells / cm 2Seed at a concentration of. After 24 hours of culture, remove non-adherent cells, collect adherent cells using trypsin / EDTA, dissociate them by passing through a narrow Pasteur pipette, preferably at about 1.5 cells / cm 2 ~ about 3.0 cells / cm 2 and reseed at a density of. Under these conditions, MSC cultures can grow during about 50 population doublings and can increase about 2000-fold (Colter DC., et al., Proc Natl Acad Sci USA. 97:3213-3218, 2000).
[0090] MSC cultures utilized by some embodiments of the present invention contain three cell populations defined by their morphological characteristics: small non-granular cells (hereinafter referred to as RS-1 herein), small granular cells (hereinafter referred to as RS-2 herein), and large moderately granular cells (hereinafter referred to as mature MSCs herein). The presence and concentration of such cells in culture can be assayed by identifying the presence or absence of various cell surface markers, for example, by using immunofluorescence, in situ hybridization, and activity assays.
[0091] According to certain embodiments, EVs are derived from cells expressing markers from neural crest cells. According to certain embodiments, EVs are derived from neural crest cells. According to another embodiment, the neural crest cells are cranial neural crest cells. According to some embodiments, cranial neural crest cells include, but are not limited to, dental pulp stem cells (DPSCs), stem cells from exfoliated deciduous teeth (SHED), periodontal ligament stem cells (PDLSCs), stem cells from the apical papilla (SCAP), and dental follicle progenitor cells (DFPC). According to some embodiments, such cells express mesenchymal markers as defined above.
[0092] EVs can be produced or isolated in various ways. Such methods can include isolating EVs from mesenchymal stem cells (MSCs) or neural crest cells (NCCs).
[0093] Thus, the EVs of the present invention are isolated EVs.
[0094] As used herein, the terms "purify", "purified", "purifying", "isolate", "isolated", and "isolating" are used interchangeably and refer to the state (e.g., multiple known or unknown amounts and / or concentrations) of a population of EVs that has undergone one or more purification / isolation processes, such as the selection of the desired EVs, or the removal or reduction of remaining biological products, and / or the removal of unwanted EVs, such as the removal of EVs of a particular size. According to one embodiment, the ratio of EVs to residual parental cells is at least 2, 3, 4, 5, 6, 8, or 10 times higher, or in certain advantageous embodiments, at least 50, 100, 1000, or 2000 times higher than in the initial material. According to some embodiments, the ratio is a weight ratio. In some advantageous embodiments, the term "isolated" has a substantially cell-free or acellular meaning and may thereby be substituted.
[0095] According to some embodiments, EVs, such as exosomes, are derived from adherent cells that express mesenchymal markers. According to some embodiments, the adherent cells that express mesenchymal markers are selected from mesenchymal stem cells (MSCs) and olfactory ensheathing cells.
[0096] According to some embodiments, the present invention provides isolated EVs loaded with RNAi oligonucleotides that inhibit the expression of the protein NCAN. According to some embodiments, the RNAi oligonucleotides are as defined in any one of the above embodiments and aspects. According to some embodiments, the RNAi is selected from siRNA and shRNA. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the siRNA or shRNA that inhibits the expression of NCAN comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95. Thus, in some embodiments, the present invention provides isolated EVs comprising siRNA and shRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95. According to some embodiments, the siRNA or shRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95. According to some embodiments, the siRNA comprises a complementary strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20, and 96-105, wherein the complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to one embodiment, the siRNA or siRNA is conjugated to a hydrophobic moiety. According to some embodiments, the hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, peptides, and combinations thereof. According to one embodiment, the siRNA or shRNA is conjugated to a sterol.In an exemplary embodiment, this moiety is a sterol cholesterol molecule, and thus, according to such an embodiment, the siRNA or shRNA is conjugated to cholesterol. According to one embodiment, the siRNA or siRNA is conjugated to a hydrophilic moiety. According to some embodiments, the hydrophilic moiety is a carbohydrate. According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose, and maltotriose. According to one embodiment, the siRNA or shRNA is conjugated to a carbohydrate. In an exemplary embodiment, this moiety is a glucose molecule, and thus, according to such an embodiment, the siRNA or shRNA is conjugated to glucose.
[0097] According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a pair of oligonucleotides comprising nucleic acid sequences (i) SEQ ID NO: 1 and 6, (ii) SEQ ID NO: 2 and 7, (iii) SEQ ID NO: 3 and 8, or (iv) SEQ ID NO: 4 and 9, (v) SEQ ID NO: 5 and 10, wherein the N nucleotides in the guide strand are complementary to the N in the complementary strand at the corresponding positions. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a pair of oligonucleotides comprising nucleic acid sequences (i) SEQ ID NO: 11 and 16, (ii) SEQ ID NO: 12 and 17, (iii) SEQ ID NO: 13 and 18, or (iv) SEQ ID NO: 14 and 9, (v) SEQ ID NO: 15 and 20, (vi) SEQ ID NO: 86 and 96, (vii) SEQ ID NO: 87 and 77, (viii) SEQ ID NO: 88 and 88, (ix) SEQ ID NO: 89 and 99, (x) SEQ ID NO: 90 and 100, (xi) SEQ ID NO: 91 and 101, (xii) SEQ ID NO: 92 and 102, (xiii) SEQ ID NO: 93 and 103, (xiv) SEQ ID NO: 94 and 104, or (xv) SEQ ID NO: 95 and 105. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 16. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 17. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 18. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand each comprising the nucleic acid sequences of SEQ ID NO: 86 and 96. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand each comprising the nucleic acid sequences of SEQ ID NO: 87 and 97. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand each comprising the nucleic acid sequences of SEQ ID NO: 88 and 98.According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 89 and 99, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 90 and 100, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 91 and 101, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 92 and 102, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 93 and 103, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 94 and 104, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 95 and 105, respectively. According to some embodiments, the siRNA is conjugated with cholesterol. According to some embodiments, the siRNA is conjugated with glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is an exosome. According to some embodiments, the EV is derived from mesenchymal stem cells. According to some embodiments, the EV is derived from bone marrow MSC. According to some embodiments, the EV is an exosome.
[0098] According to some embodiments, the RNAi oligonucleotide that inhibits the expression of the protein NCAN is shRNA. According to some embodiments, the present invention provides an isolated EV loaded with shRNA that inhibits the expression of NCAN and contains a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95. According to another embodiment, the shRNA contains a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20, and 96-105, and this complementary strand contains nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand at positions 1 and 19. According to some embodiments, the shRNA that inhibits the expression of NCAN contains or consists of pairs of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 1 and 6, (ii) SEQ ID NO: 2 and 7, (iii) SEQ ID NO: 3 and 8, or (iv) SEQ ID NO: 4 and 9, (v) SEQ ID NO: 5 and 10, and the N nucleotides in the guide strand are complementary to the Ns in the complementary strand at the corresponding positions. According to some embodiments, the shRNA that inhibits the expression of NCAN contains or consists of pairs of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 11 and 16, (ii) SEQ ID NO: 12 and 17, (iii) SEQ ID NO: 13 and 18, (iv) SEQ ID NO: 14 and 9, (v) SEQ ID NO: 15 and 20, (vi) SEQ ID NO: 86 and 96, (vii) SEQ ID NO: 87 and 77, (viii) SEQ ID NO: 88 and 88, (ix) SEQ ID NO: 89 and 99, (x) SEQ ID NO: 90 and 100, (xi) SEQ ID NO: 91 and 101, (xii) SEQ ID NO: 92 and 102, (xiii) SEQ ID NO: 93 and 103, (xiv) SEQ ID NO: 94 and 104, or (xv) SEQ ID NO: 95 and 105. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 16. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 17. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 18.According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NO: 86 and 96, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NO: 87 and 97, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NO: 88 and 98, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NO: 89 and 99, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NO: 90 and 100, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NO: 91 and 101, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NO: 92 and 102, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NO: 93 and 103, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NO: 94 and 104, respectively. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NO: 95 and 105, respectively. According to some embodiments, the shRNA is conjugated with cholesterol. According to some embodiments, the shRNA is conjugated with glucose. According to some embodiments, the EV is an exosome, macrovesicles, or a combination thereof. According to some embodiments, the EV is an exosome. According to some embodiments, the EV is derived from mesenchymal stem cells.According to some embodiments, the EVs are derived from bone marrow mesenchymal stem cells. According to some embodiments, the EVs are exosomes.
[0099] According to some embodiments, the present invention provides isolated EVs loaded with RNA interference (RNAi) oligonucleotides such as siRNA or shRNA that inhibit the expression of tenascin-R. According to some embodiments, the RNAi oligonucleotide is as defined in any one of the above embodiments. According to some embodiments, the RNAi oligonucleotide is selected from siRNA and shRNA. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the siRNA or shRNA that inhibits the expression of TNR comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to some embodiments, the present invention provides siRNA or shRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to some embodiments, the siRNA or shRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to some embodiments, the siRNA comprises a complementary strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14-19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, wherein the complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to one embodiment, the siRNA or siRNA is conjugated to a hydrophobic moiety. According to some embodiments, the hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, peptides, and combinations thereof. According to one embodiment, the siRNA or shRNA is conjugated to a sterol. In an exemplary embodiment, this moiety is the sterol cholesterol molecule, and thus, according to such an embodiment, the siRNA or shRNA is conjugated to cholesterol.According to one embodiment, the siRNA or shRNA is conjugated to a hydrophilic moiety. According to some embodiments, the hydrophilic moiety is a carbohydrate. According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose, and maltotriose. According to one embodiment, the siRNA or shRNA is conjugated to a carbohydrate. In an exemplary embodiment, this moiety is a glucose molecule, and thus, according to such an embodiment, the siRNA or shRNA is conjugated to glucose. According to some embodiments, the present invention provides an isolated EV loaded with siRNA comprising or consisting of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 30 and 44, (ii) SEQ ID NO: 31 and 45, (iii) SEQ ID NO: 32 and 46, (iv) SEQ ID NO: 33 and 47, (v) SEQ ID NO: 34 and 48, (vi) SEQ ID NO: 45 and 49, (vii) SEQ ID NO: 56 and 50, (viii) SEQ ID NO: 37 and 51, (ix) SEQ ID NO: 38 and 52, (x) SEQ ID NO: 39 and 53, (xi) SEQ ID NO: 40 and 54, (xii) SEQ ID NO: 41 and 55, (xiii) SEQ ID NO: 42 and 56, or (xiv) SEQ ID NO: 43 and 57, wherein the N nucleotides in the guide strand are complementary to the N in the complementary strand at the corresponding positions. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising or consisting of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 58 and 72, (ii) SEQ ID NO: 59 and 73, (iii) SEQ ID NO: 60 and 74, (iv) SEQ ID NO: 61 and 75, (v) SEQ ID NO: 62 and 76, (v) SEQ ID NO: 63 and 77, (vii) SEQ ID NO: 64 and 78, (viii) SEQ ID NO: 65 and 79, (ix) SEQ ID NO: 66 and 80, (x) SEQ ID NO: 67 and 81, (xi) SEQ ID NO: 68 and 82, (xii) SEQ ID NO: 69 and 83, (xiii) SEQ ID NO: 70 and 84, or (xiv) SEQ ID NO: 71 and 85.According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 72. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 76. According to some embodiments, the siRNA is conjugated to cholesterol. According to some embodiments, the siRNA is conjugated to glucose. According to some embodiments, the EV is an exosome, macrovesicles, or a combination thereof. According to some embodiments, the EV is an exosome. According to some embodiments, the EV is derived from mesenchymal stem cells. According to some embodiments, the EV is derived from bone marrow mesenchymal stem cells.
[0100] According to some embodiments, the RNAi oligonucleotide that inhibits the expression of tenascin-R is shRNA. According to some embodiments, the present invention provides an isolated EV loaded with shRNA that inhibits the expression of TNR, which comprises a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to another embodiment, the shRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, and this complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 30 and 44, (ii) SEQ ID NO: 31 and 45, (iii) SEQ ID NO: 32 and 46, (iv) SEQ ID NO: 33 and 47, (v) SEQ ID NO: 34 and 48, (vi) SEQ ID NO: 45 and 49, (vii) SEQ ID NO: 56 and 50, (viii) SEQ ID NO: 37 and 51, (ix) SEQ ID NO: 38 and 52, (x) SEQ ID NO: 39 and 53, (xi) SEQ ID NO: 40 and 54, (xii) SEQ ID NO: 41 and 55, (xiii) SEQ ID NO: 42 and 56, or (xiv) SEQ ID NO: 43 and 57, wherein the N nucleotides in the guide strand are complementary to the N in the complementary strand at the corresponding positions. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 58 and 72, (ii) SEQ ID NO: 59 and 73, (iii) SEQ ID NO: 60 and 74, (iv) SEQ ID NO: 61 and 75, (v) SEQ ID NO: 62 and 76, (vi) SEQ ID NO: 63 and 77, (vii) SEQ ID NO: 64 and 78, (viii) SEQ ID NO: 65 and 79, (ix) SEQ ID NO: 66 and 80, (x) SEQ ID NO: 67 and 81, (xi) SEQ ID NO: 68 and 82, (xii) SEQ ID NO: 69 and 83, (xiii) SEQ ID NO: 70 and 84, or (xiv) SEQ ID NO: 71 and 85. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 72.According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 76. According to some embodiments, the shRNA is conjugated with cholesterol. According to some embodiments, the shRNA is conjugated with glucose. According to some embodiments, the EV is an exosome, macrovesicles, or a combination thereof. According to some embodiments, the EV is derived from mesenchymal stem cells. According to some embodiments, the EV is derived from bone marrow mesenchymal stem cells. According to some embodiments, the EV is an exosome.
[0101] According to some embodiments, the present invention provides an isolated EV loaded with an RNA interference (RNAi) oligonucleotide such as an siRNA or shRNA that inhibits the expression of NCAN and TNR. According to some embodiments, the siRNA and / or shRNA molecules that inhibit the expression of NCAN and TNR are as described hereinabove.
[0102] According to some embodiments, the isolated EV of the present invention further comprises chondroitinase ABC or a nucleic acid molecule encoding the same. According to some embodiments, the isolated EV of the present invention further comprises a compound selected from matrix metalloproteinase (MMP), disintegrin and metalloproteinase with thrombospondin motif (ADAMTS), a nucleic acid molecule encoding the same, and hyaluronic acid (HA).
[0103] EVs derived from mesenchymal stem cells can be produced by culturing mesenchymal stem cells in a medium for preparation.
[0104] The cells can be cultured for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 days or more, for example, for 3 days. The conditioned medium can be obtained by separating the cells from the medium. The conditioned medium may be centrifuged, for example, at 500×g. It may be concentrated by filtration through a membrane. The membrane may include a membrane with >1000 kDa. The conditioned medium can be concentrated about 50-fold or more.
[0105] It will be understood that polynucleotides or oligonucleotides such as siRNA or shRNA may be directly loaded into EVs. In one embodiment, direct loading of RNAi oligonucleotides into EVs is performed by electroporation and / or with the use of transfection agents. In alternative embodiments, loading is performed in the absence of electroporation and / or in the absence of transfection agents.
[0106] According to one embodiment, the EVs are incubated for a time sufficient to load the nucleic acid-based inhibitor together with the RNAi oligonucleotide inhibitor onto the particles. The time sufficient to load the nucleic acid-based inhibitor cargo into the EVs can be optimized for a particular type of cargo and, if modified to include a hydrophobic modification, can be optimized for that type of modification. Generally, an incubation of about 1 hour or less is sufficient to efficiently load the nucleic acid cargo onto the particles. In many cases, hydrophobically modified cargo is efficiently loaded into exosomes in a very short time, for example, within 5 minutes. Thus, in some embodiments, efficient loading is performed during an incubation of 5 minutes or less, for example, between 1 minute and 5 minutes. In an exemplary embodiment, efficient loading is performed during an incubation of 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, etc. In other embodiments, efficient loading can be performed within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 7 hours, within 8 hours, within 9 hours, within 10 hours, within 12 hours, within 24 hours, within 48 hours, etc.
[0107] The loading of oligonucleotides into EVs is not highly dependent on temperature. In an exemplary embodiment, exosomes are loaded at 37°C or about 37°C. In other embodiments, EVs (e.g., exosomes) can be loaded at room temperature or near room temperature. In other embodiments, exosomes can be loaded at 4°C or about 4°C.
[0108] According to some embodiments, EVs can be loaded without using ultracentrifugation. According to other embodiments, the loading further includes ultracentrifugation. According to some embodiments, the preparation method further includes a step of purifying or isolating the loaded EVs. According to one embodiment, the isolation is performed by centrifugation, e.g., ultracentrifugation. According to another embodiment, the isolation is performed via filtration. According to one embodiment, the ratio of EVs to residual parental cells after purification is at least 2, 3, 4, 5, 6, 8, or 10 times higher, or in certain advantageous embodiments, at least 50, 100, or 1000 times higher than the starting material. According to some embodiments, the EVs are cell-free EVs.
[0109] According to some embodiments, the present invention provides a method for preparing EVs, e.g., exosomes, the method including incubating the EVs with a conjugated RNAi oligonucleotide, such as siRNA or shRNA, at a temperature of 25°C to 42°C for 0.5 hour to 5 hours. According to some embodiments, the conjugate of siRNA or shRNA is conjugated with cholesterol. According to some embodiments, the conjugate of siRNA or shRNA is conjugated with glucose.
[0110] According to one embodiment, the method further includes a step of isolating the loaded EVs using centrifugation, e.g., ultracentrifugation. According to some embodiments, another hydrophobic moiety can be used instead of cholesterol. According to one embodiment, the RNAi oligonucleotide is siRNA.
[0111] According to other embodiments, the EVs loaded with the RNAi oligonucleotides of the present invention can be obtained from cells artificially loaded with RNAi oligonucleotides or polynucleotides that encode and can express or produce RNAi inhibitors intracellularly. In this case, the polynucleotide / oligonucleotide agent is linked to a nucleic acid construct under the control of a cis-acting regulatory element (e.g., a promoter) that can direct the expression of the agent in a constitutive or inducible manner.
[0112] The nucleic acid agent can be delivered using appropriate gene delivery vehicles / methods (such as transfection, transduction, etc.). Optionally, an appropriate expression system is used. Examples of suitable constructs include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, PzeoSV2(+ / -), pDisplay, pEF / myc / cyto, pCMV / myc / cyto, each of which is available from Invitrogen Co.
[0113] The expression construct may be a virus. Examples of viral constructs include, but are not limited to, adenovirus vectors, retrovirus vectors, vaccinia virus vectors, adeno-associated virus vectors, polyomavirus vectors, alphavirus vectors, rhabdovirus vectors, lentivirus vectors, and herpesvirus vectors.
[0114] Viral constructs, such as retroviral constructs, contain at least one transcriptional promoter / enhancer or locus defining element, or other elements that control gene expression by other means, such as alternative splicing, nuclear RNA export, and post-transcriptional modification of the messenger. Such vector constructs also contain a packaging signal, a long terminal repeat (LTR) or a portion thereof, and appropriate plus and minus strand primer binding sites for the virus used, unless already present in the viral construct. Further, such constructs typically contain a signal sequence for the secretion of peptides from the host cell in which it is placed. Preferably, the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of a peptide variant of the present invention. Optionally, the construct may also contain a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence. By way of example, such constructs typically contain a 5’ LTR, a tRNA binding site, a packaging signal, an origin of second strand DNA synthesis, and a 3’ LTR or a portion thereof.
[0115] The viral dose of infection is at least 10 3 、10 4 、10 5 、10 6 、10 7 、10 8 、10 9 、10 10 、10 11 、10 12 、10 13 、10 14 、10 15 or more pfu or viral particles.
[0116] Double-stranded RNA can be synthesized by adding two opposing promoters to the ends of a gene segment, with one promoter placed immediately 5’ of the gene and the opposing promoter placed immediately 3’ of the gene segment. The dsRNA can then be transcribed with an appropriate polymerase.
[0117] In another embodiment, a polynucleotide or oligonucleotide agent can be incubated with cells in culture to effect efficient uptake of the nucleic acid by the cells. In such embodiments, preferably, as further described below herein, the nucleic acid agent is hydrophobically modified.
[0118] Regardless of the method used to load the nucleic acid agents described herein onto the particles, the cells are then incubated for a time sufficient for the production of EVs, such as exosomes. Exosomes isolated from the medium contain exosomes loaded with nucleic acid molecules taken up, produced, or expressed by the cells. Thus, in one embodiment, a method of loading an oligonucleotide cargo onto an EV is provided, comprising incubating cells capable of EV production (e.g., exosome production) with an oligonucleotide for a time sufficient for the oligonucleotide to be internalized by the cells, culturing the cells for a time sufficient for exosome secretion, and isolating exosomes loaded with the oligonucleotide from the medium.
[0119] According to some embodiments, the invention provides an isolated EV prepared by any one of the above embodiments.
[0120] According to another aspect, the invention provides a composition comprising a plurality of EVs according to any one of the above embodiments and a carrier. According to some embodiments, the carrier is a pharmaceutically acceptable carrier and the composition is a pharmaceutical composition.
[0121] According to another aspect, the present invention provides a pharmaceutical composition comprising (i) an RNAi oligonucleotide of any one of the above aspects and embodiments, (ii) an isolated EV of any one of the above aspects and embodiments, or (iii) a combination of (i) and (ii), and a pharmaceutically acceptable carrier. Any one of the above definitions, terms, and embodiments is incorporated herein and applied similarly. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an RNA interference (RNAi) oligonucleotide that inhibits the expression of a protein selected from neurocan (NCAN), tenascin-R (TNR), aggrecan (ACAN), versican (VCAN), brevican (BCAN), and combinations thereof. According to one embodiment, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an RNA interference (RNAi) oligonucleotide that inhibits the expression of a protein selected from neurocan, tenascin-R, and combinations thereof.
[0122] According to some embodiments, the present invention provides a pharmaceutical composition comprising an anti-NCAN siRNA or shRNA as described in any one of the above aspects and embodiments, and a pharmaceutically acceptable carrier. According to some embodiments, the present invention provides a pharmaceutical composition comprising an anti-TNR siRNA or shRNA as described in any one of the above aspects and embodiments, and a pharmaceutically acceptable carrier.
[0123] According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with RNAi oligonucleotides that inhibit the expression of the protein NCAN. According to some embodiments, the RNAi oligonucleotides are as defined in any one of the above embodiments. According to some embodiments, the RNAi oligonucleotides are selected from siRNA and shRNA. According to some embodiments, the RNAi oligonucleotides are siRNA. According to some embodiments, the siRNA or shRNA that inhibits the expression of NCAN comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95. According to some embodiments, the siRNA or shRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95. According to some embodiments, the siRNA comprises a complementary strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20, and 96-105, wherein the complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to one embodiment, the siRNA or siRNA is conjugated to a hydrophobic moiety. According to some embodiments, the hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, peptides, and combinations thereof. According to one embodiment, the siRNA or shRNA is conjugated to a sterol. In an exemplary embodiment, this moiety is the sterol cholesterol molecule, and thus, according to such an embodiment, the siRNA or shRNA is conjugated to cholesterol. According to one embodiment, the siRNA or siRNA is conjugated to a hydrophilic moiety. According to some embodiments, the hydrophilic moiety is a carbohydrate.According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose, and maltotriose. According to one embodiment, the siRNA or shRNA is conjugated to a carbohydrate. In an exemplary embodiment, this moiety is a glucose molecule, and thus, according to such an embodiment, the siRNA or shRNA is conjugated to glucose.
[0124] According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA comprising pairs of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 1 and 6, (ii) SEQ ID NO: 2 and 7, (iii) SEQ ID NO: 3 and 8, or (iv) SEQ ID NO: 4 and 9, (v) SEQ ID NO: 5 and 10, wherein the N nucleotides in the guide strand are complementary to the N in the complementary strand at the corresponding positions. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA comprising pairs of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 11 and 16, (ii) SEQ ID NO: 12 and 17, (iii) SEQ ID NO: 13 and 18, or (iv) SEQ ID NO: 14 and 9, (v) SEQ ID NO: 15 and 20, (vi) SEQ ID NO: 86 and 96, (vii) SEQ ID NO: 87 and 77, (viii) SEQ ID NO: 88 and 88, (ix) SEQ ID NO: 89 and 99, (x) SEQ ID NO: 90 and 100, (xi) SEQ ID NO: 91 and 101, (xii) SEQ ID NO: 92 and 102, (xiii) SEQ ID NO: 93 and 103, (xiv) SEQ ID NO: 94 and 104, or (xv) SEQ ID NO: 95 and 105. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 16. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 17. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 18. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with an siRNA molecule comprising a guide strand and a complementary strand each comprising the nucleic acid sequences of SEQ ID NO: 86 and 96. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with an siRNA molecule comprising a guide strand and a complementary strand each comprising the nucleic acid sequences of SEQ ID NO: 87 and 97.According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA molecules comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 88 and 98, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA molecules comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 89 and 99, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA molecules comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 90 and SEQ ID NO: 100, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA molecules comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 91 and 101, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA molecules comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 92 and 102, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA molecules comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 93 and 103, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA molecules comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 94 and 104, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA molecules comprising a guide strand and a complementary strand comprising the nucleic acid sequences of SEQ ID NO: 95 and 105, respectively. According to some embodiments, the siRNA is conjugated to cholesterol. According to some embodiments, the siRNA is conjugated to glucose. According to some embodiments, the EVs are exosomes, macrovesicles, or a combination thereof. According to some embodiments, the EVs are derived from mesenchymal stem cells.
[0125] According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA comprising a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 1 and 6, (ii) SEQ ID NO: 2 and 7, (iii) SEQ ID NO: 3 and 8, or (iv) SEQ ID NO: 4 and 9, (v) SEQ ID NO: 5 and 10, wherein the N nucleotides in the guide strand are complementary to the N in the complementary strand at the corresponding position. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA comprising a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 11 and 16, (ii) SEQ ID NO: 12 and 17, (iii) SEQ ID NO: 13 and 18, or (iv) SEQ ID NO: 14 and 9, (v) SEQ ID NO: 15 and 20, (vi) SEQ ID NO: 86 and 96, (vii) SEQ ID NO: 87 and 77, (viii) SEQ ID NO: 88 and 88, (ix) SEQ ID NO: 89 and 99, (x) SEQ ID NO: 90 and 100, (xi) SEQ ID NO: 91 and 101, (xii) SEQ ID NO: 92 and 102, (xiii) SEQ ID NO: 93 and 103, (xiv) SEQ ID NO: 94 and 104, or (xv) SEQ ID NO: 95 and 105. According to some embodiments, the shRNA is conjugated to cholesterol. According to some embodiments, the shRNA is conjugated to glucose. According to some embodiments, the EV is an exosome, macrovesicles, or a combination thereof. According to some embodiments, the EV is derived from mesenchymal stem cells.
[0126] According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with RNAi oligonucleotides that inhibit the expression of protein TNR. According to some embodiments, the RNAi oligonucleotides are as defined in any one of the above embodiments. According to some embodiments, the RNAi is selected from siRNA and shRNA. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the siRNA or shRNA that inhibits the expression of TNR comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to some embodiments, the siRNA or shRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to some embodiments, the siRNA comprises a complementary strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, wherein the complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to one embodiment, the siRNA or siRNA that inhibits the expression of TNR is conjugated to a hydrophobic moiety. According to some embodiments, the hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, peptides, and combinations thereof. According to one embodiment, the siRNA or shRNA is conjugated to a sterol. In an exemplary embodiment, this moiety is the sterol cholesterol molecule, and thus, according to such embodiments, the siRNA or shRNA is conjugated to cholesterol. According to one embodiment, the siRNA or siRNA is conjugated to a hydrophilic moiety. According to some embodiments, the hydrophilic moiety is a carbohydrate.According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose, and maltotriose. According to one embodiment, the siRNA or shRNA is conjugated to a carbohydrate. In an exemplary embodiment, this moiety is a glucose molecule, and thus, according to such an embodiment, the siRNA or shRNA is conjugated to glucose.
[0127] According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV loaded with an siRNA molecule that inhibits the expression of TNR, the siRNA molecule comprising a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to another embodiment, the siRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, the complementary strand comprising at positions 1 and 19 nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule comprising or consisting of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NOs: 30 and 44, (ii) SEQ ID NOs: 31 and 45, (iii) SEQ ID NOs: 32 and 46, (iv) SEQ ID NOs: 33 and 47, (v) SEQ ID NOs: 34 and 48, (vi) SEQ ID NOs: 45 and 49, (vii) SEQ ID NOs: 56 and 50, (viii) SEQ ID NOs: 37 and 51, (ix) SEQ ID NOs: 38 and 52, (x) SEQ ID NOs: 39 and 53, (xi) SEQ ID NOs: 40 and 54, (xii) SEQ ID NOs: 41 and 55, (xiii) SEQ ID NOs: 42 and 56, or (xiv) SEQ ID NOs: 43 and 57, wherein the N nucleotides in the guide strand are complementary to the N in the complementary strand at the corresponding positions. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule comprising or consisting of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NOs: 58 and 72, (ii) SEQ ID NOs: 59 and 73, (iii) SEQ ID NOs: 60 and 74, (iv) SEQ ID NOs: 61 and 75, (v) SEQ ID NOs: 62 and 76, (vi) SEQ ID NOs: 63 and 77, (vii) SEQ ID NOs: 64 and 78, (viii) SEQ ID NOs: 65 and 79, (ix) SEQ ID NOs: 66 and 80, (x) SEQ ID NOs: 67 and 81, (xi) SEQ ID NOs: 68 and 82, (xii) SEQ ID NOs: 69 and 83, (xiii) SEQ ID NOs: 70 and 84, or (xiv) SEQ ID NOs: 71 and 85. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 72.According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 76. According to some embodiments, the siRNA is conjugated with cholesterol. According to some embodiments, the siRNA is conjugated with glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from mesenchymal stem cells.
[0128] According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA molecule comprising a pair of oligonucleotides comprising or consisting of the nucleic acid sequences (i) SEQ ID NO: 30 and 44, (ii) SEQ ID NO: 31 and 45, (iii) SEQ ID NO: 32 and 46, (iv) SEQ ID NO: 33 and 47, (v) SEQ ID NO: 34 and 48, (vi) SEQ ID NO: 45 and 49, (vii) SEQ ID NO: 56 and 50, (viii) SEQ ID NO: 37 and 51, (ix) SEQ ID NO: 38 and 52, (x) SEQ ID NO: 39 and 53, (xi) SEQ ID NO: 40 and 54, (xii) SEQ ID NO: 41 and 55, (xiii) SEQ ID NO: 42 and 56, or (xiv) SEQ ID NO: 43 and 57, wherein the N nucleotides in the guide strand are complementary to the N in the complementary strand at the corresponding positions. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA molecule comprising a pair of oligonucleotides comprising or consisting of the nucleic acid sequences (i) SEQ ID NO: 58 and 72, (ii) SEQ ID NO: 59 and 73, (iii) SEQ ID NO: 60 and 74, (iv) SEQ ID NO: 61 and 75, (v) SEQ ID NO: 62 and 76, (v) SEQ ID NO: 63 and 77, (vii) SEQ ID NO: 64 and 78, (viii) SEQ ID NO: 65 and 79, (ix) SEQ ID NO: 66 and 80, (x) SEQ ID NO: 67 and 81, (xi) SEQ ID NO: 68 and 82, (xii) SEQ ID NO: 69 and 83, (xiii) SEQ ID NO: 70 and 84, or (xiv) SEQ ID NO: 71 and 85. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 72. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 76. According to some embodiments, the siRNA is conjugated to cholesterol. According to some embodiments, the siRNA is conjugated to glucose.According to some embodiments, the EVs are exosomes, microvesicles, or a combination thereof. According to some embodiments, the EVs are derived from mesenchymal stem cells.
[0129] According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with the RNAi oligonucleotide of the present invention that inhibits the expression of the protein NCAN and an EV loaded with the RNAi oligonucleotide of the present invention that inhibits the expression of the protein TNR.
[0130] siRNA and shRNA molecules promote sequence-specific degradation of mRNA by RNAi to achieve inhibition of the expression of a desired protein, such as NCAN or TNR, or a reduction in the expression level of a desired gene, such as NCAN or TNR, by 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%.
[0131] As used herein, the term "pharmaceutical composition" refers to a composition comprising an siRNA, shRNA, or EV loaded with the RNAi of the present invention, particularly an EV such as an exosome formulated with one or more pharmaceutically acceptable carriers.
[0132] The formulation of the pharmaceutical composition may be adjusted according to the intended use. In particular, the pharmaceutical composition may be formulated using methods well known in the art to provide rapid release, continuous release, or delayed release of the active ingredient after administration to a mammal. For example, the formulation may be any formulation selected from plasters, granules, lotions, liniments, limonades, aromatic waters, powders, syrups, ophthalmic ointments, liquids and solutions, aerosols, sprays, extracts, elixirs, ointments, fluid extracts, emulsions, suspensions, decoctions, infusions, eye drops, tablets, suppositories, injections, spirits, capsules, creams, troches, tinctures, pastes, pills, soft or hard gelatin capsules.
[0133] As used herein, "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to any solvent, dispersion medium, preservative, antioxidant, coating agent, isotonic agent, absorption delaying agent, surfactant, filler, disintegrant, binder, diluent, lubricant, glidant, pH adjuster, buffer, enhancer, wetting agent, solubilizer, surfactant, antioxidant, etc. that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may contain other active compounds that provide supplementary, additional, or enhanced therapeutic functions, and a solid carrier or excipient such as lactose, starch, or talc, or a liquid carrier such as water, fatty oil, or liquid paraffin. Other examples of carriers include media such as DMEM or RPMI, a hypothermic preservation medium containing components that remove free radicals, provide pH buffering, colloidal osmotic / osmotic pressure support, an energy substrate, and ion concentrations that maintain the balance of the intracellular state at low temperatures, and a mixture of an organic solvent and water.
[0134] According to any one of the above embodiments, the pharmaceutical composition is formulated for administration via an administration route selected from intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, and intracerebral administration routes. According to one embodiment, the pharmaceutical composition is formulated for intranasal administration. According to some embodiments, such a pharmaceutical composition is in the form of a liquid solution, nasal drops, spray, measured stray, or powder. According to other embodiments, the pharmaceutical composition is formulated for injection, for example, for intralesional, intrathecal, or intravenous injection. According to such embodiments, the pharmaceutical composition is in the form of a sterile injection solution.
[0135] According to some embodiments, the pharmaceutical composition is formulated for administration via an administration route selected from intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, and intracerebral administration routes.
[0136] According to one embodiment, the pharmaceutical composition is formulated for intranasal administration.
[0137] According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with an siRNA or shRNA molecule that inhibits the expression of NCAN and comprises a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95, wherein the complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to another embodiment, the siRNA or shRNA that inhibits the expression of NCAN comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20, and 96-105, and this complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with an siRNA or shRNA molecule that inhibits the expression of NCAN and comprises a guide strand comprising or consisting of nucleic acids from (i) SEQ ID NOs: 1 and 6, (ii) SEQ ID NOs: 2 and 7, (iii) SEQ ID NOs: 3 and 8, or (iv) SEQ ID NOs: 4 and 9, (v) SEQ ID NOs: 5 and 10, wherein the N nucleotides in the guide strand are complementary to the Ns in the complementary strand at the corresponding positions. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with an siRNA or shRNA molecule that inhibits the expression of NCAN and comprises a guide strand comprising or consisting of the nucleic acid sequences (i) SEQ ID NOs: 11 and 16, (ii) SEQ ID NOs: 12 and 17, (iii) SEQ ID NOs: 13 and 18, or (iv) SEQ ID NOs: 14 and 9, (v) SEQ ID NOs: 15 and 20, (vi) SEQ ID NOs: 86 and 96, (vii) SEQ ID NOs: 87 and 77, (viii) SEQ ID NOs: 88 and 88, (ix) SEQ ID NOs: 89 and 99, (x) SEQ ID NOs: 90 and 100, (xi) SEQ ID NOs: 91 and 101, (xii) SEQ ID NOs: 92 and 102, (xiii) SEQ ID NOs: 93 and 103, (xiv) SEQ ID NOs: 94 and 104, or (xv) SEQ ID NOs: 95 and 105. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand each comprising the nucleic acid sequence of SEQ ID NOs: 11 and 16. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule comprising a guide strand and a complementary strand each comprising the nucleic acid sequence of SEQ ID NOs: 12 and 17.According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising isolated EVs loaded with siRNA molecules comprising a guide strand and a complementary strand containing the nucleic acid sequences of SEQ ID NOs: 13 and 18, respectively. According to some embodiments, the siRNA or shRNA is conjugated with cholesterol. According to some embodiments, the siRNA or shRNA is conjugated with glucose. According to some embodiments, the EVs are exosomes, microvesicles, or a combination thereof. According to some embodiments, the EVs are derived from mesenchymal stem cells.
[0138] According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with an siRNA or shRNA molecule that inhibits the expression of TNR and comprises a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to another embodiment, the siRNA or shRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, which complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with an siRNA or shRNA molecule that inhibits the expression of TNR and comprises a guide strand comprising or consisting of the nucleic acid sequences (i) SEQ ID NO: 30 and 44, (ii) SEQ ID NO: 31 and 45, (iii) SEQ ID NO: 32 and 46, (iv) SEQ ID NO: 33 and 47, (v) SEQ ID NO: 34 and 48, (vi) SEQ ID NO: 45 and 49, (vii) SEQ ID NO: 56 and 50, (viii) SEQ ID NO: 37 and 51, (ix) SEQ ID NO: 38 and 52, (x) SEQ ID NO: 39 and 53, (xi) SEQ ID NO: 40 and 54, (xii) SEQ ID NO: 41 and 55, (xiii) SEQ ID NO: 42 and 56, or (xiv) SEQ ID NO: 43 and 57, wherein the N nucleotides in the guide strand are complementary to the Ns in the complementary strand at the corresponding positions. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with an siRNA or shRNA molecule that inhibits the expression of TNR and comprises a guide strand comprising or consisting of the nucleic acid sequences (i) SEQ ID NO: 58 and 72, (ii) SEQ ID NO: 59 and 73, (iii) SEQ ID NO: 60 and 74, (iv) SEQ ID NO: 61 and 75, (v) SEQ ID NO: 62 and 76, (v) SEQ ID NO: 63 and 77, (vii) SEQ ID NO: 64 and 78, (viii) SEQ ID NO: 65 and 79, (ix) SEQ ID NO: 66 and 80, (x) SEQ ID NO: 67 and 81, (xi) SEQ ID NO: 68 and 82, (xii) SEQ ID NO: 69 and 83, (xiii) SEQ ID NO: 70 and 84, or (xiv) SEQ ID NO: 71 and 85. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 72.According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO: 76. According to some embodiments, the siRNA or shRNA is conjugated to cholesterol. According to some embodiments, the siRNA or shRNA is conjugated to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from mesenchymal stem cells.
[0139] According to some embodiments, the isolated EV of the present invention further comprises chondroitinase ABC (chABC) or a nucleic acid molecule encoding the same. According to some embodiments, the isolated EV of the present invention further comprises a compound selected from matrix metalloproteinase (MMP), a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS), a nucleic acid molecule encoding the same, and hyaluronic acid (HA).
[0140] According to any one of the above embodiments, the pharmaceutical composition of the present invention is for use in inducing nerve regeneration after neuronal injury. According to any one of the above embodiments, the pharmaceutical composition of the present invention is for use in preventing the inhibition of nerve regeneration after neuronal injury. According to any one of the above embodiments, the pharmaceutical composition of the present invention is for use in treating neurological diseases, disorders, injuries or conditions. According to one embodiment, the neurological condition is a spinal cord injury.
[0141] The pharmaceutical composition according to any one of the above embodiments is for use in treating a neurological disease, disorder or condition. According to some embodiments, the pharmaceutical composition is for use in treating neuronal damage or injury in a subject.
[0142] The term "neurological disease, disorder or condition" refers to a disease, disorder or condition of the brain, spinal cord and / or the nerves connecting them.
[0143] According to certain embodiments, the condition is due to injury. According to one embodiment, the injury is to the spinal cord, i.e., spinal cord injury (SCI). According to other embodiments, the neurological disease, disorder or condition is neuronal injury.
[0144] The terms "spinal cord injury" and "SCI" are used interchangeably herein and refer to an injury to the spinal cord. According to one embodiment, the injury is the result of trauma. According to another embodiment, the injury or damage is the result of degeneration or disease. Depending on where the spinal cord and nerve roots are damaged, the symptoms can vary widely, for example, from pain to paralysis and incontinence. Spinal cord injuries are described at various levels of "incomplete", which can vary from those that do not affect the patient to "complete" injuries that mean a complete loss of function. There are many causes of spinal cord injury, but it is usually associated with major trauma due to motor vehicle accidents, falls, sports injuries, and violence. Thus, according to one embodiment, SCI is selected from complete and incomplete SCI. According to some embodiments, the spinal cord injury is selected from acute or chronic SCI. Spinal cord injury may be susceptible to the effects of secondary tissue damage including, but not limited to, glial scarring, myelin inhibition, demyelination, cell death, lack of neurotrophic support, ischemia, free radical formation, and excitotoxicity.
[0145] Diseases of the spinal cord include, but are not limited to, autoimmune diseases (e.g., multiple sclerosis), inflammatory diseases (e.g., meningitis), neurodegenerative diseases, polio, split spine, and spinal tumors.
[0146] Subjects that can be treated according to the teachings of the present invention include mammalian subjects such as humans, mice, rats, monkeys, dogs, and cats. In one embodiment, the subject is a human subject.
[0147] The term "treating" a condition or patient refers to taking measures to obtain a beneficial or desired outcome, including clinical outcomes. Beneficial or desired clinical outcomes include improving, arresting, substantially suppressing, delaying, or reversing the progression of a disease, condition, or disorder; substantially improving or alleviating the clinical or aesthetic symptoms of a condition; substantially preventing the onset of the clinical or aesthetic symptoms of a disease, condition, or disorder; and protecting against adverse or bothersome symptoms, but are not limited thereto. Treating further refers to achieving one or more of the following: (a) reducing the severity of a disorder; (b) limiting the onset of symptoms characteristic of the disorder being treated; (c) limiting the worsening of symptoms characteristic of the disorder being treated; (d) limiting the recurrence of a disorder in a patient who has previously had the disorder; and / or (e) limiting the recurrence of symptoms in a patient who was previously asymptomatic with respect to the disorder. According to some embodiments, the term "treating" includes nerve regeneration, axonal growth, and a decrease in astrogliosis and microgliosis at the site of injury. According to other embodiments, the term encompasses improvement of symptoms associated with a disease or condition. According to one embodiment, the term "treating" includes improvement of motor parameters. According to one embodiment, improvement of motor parameters includes a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% improvement in motor parameters compared to an untreated subject. According to some embodiments, treatment includes reducing astrogliosis and / or microgliosis at the site of injury. According to one embodiment, the reduction of astrogliosis and / or microgliosis includes a 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% reduction in astrogliosis and / or microgliosis compared to an untreated subject.
[0148] The pharmaceutical composition of the present invention can be administered using any known method. The terms "administer" or "administration" of a substance, compound or agent to a subject can be carried out using one of a variety of methods known to those skilled in the art. For example, a compound or agent can be administered intranasally (e.g., by inhalation), intrathecal (within the spinal canal, or intrathecal), intraarterially, intradermally, intramuscularly, intraperitoneally, intravenously, subcutaneously, intravitreally, sublingually, orally (by ingestion), intracranially, and transdermally (by absorption, e.g., through a skin conduit). A compound or agent can also be suitably introduced by a rechargeable polymer device or a biodegradable polymer device or other devices, such as patches and pumps, or formulations, resulting in sustained release, extended release, or controlled release of the compound or agent. Administration can also be carried out, for example, once, multiple times, and / or over one or more extended periods. According to some embodiments, the composition is administered 1, 2, 3, 4, 5, or 6 times a day. According to other embodiments, the composition is administered 1, 2, 3, 4, 5, or 6 times a month. In some embodiments, administration includes both direct administration, including self-administration, and indirect administration, including the act of prescribing a drug. For example, as used herein, a physician who instructs a patient to self-administer a drug or to administer the drug to another person and / or provides a prescription for the drug to the patient administers the drug to the patient. According to one embodiment, the pharmaceutical composition of the present invention is administered intranasally. According to another embodiment, the pharmaceutical composition of the present invention is administered intralesionally. According to another embodiment, the pharmaceutical composition of the present invention is administered near a damaged or injured area. According to one embodiment, the pharmaceutical composition is administered orally.
[0149] According to one embodiment, the pharmaceutical composition is administered intranasally.
[0150] Exemplary dosages of membrane vesicles (exosomes) that can be administered (e.g., intranasally) for each treatment can be between 1×10 6 ~1×10 20 and / or 1×10 9 ~1×10 15 for a 70 kg human.
[0151] According to some embodiments, the pharmaceutical composition according to any one of the above embodiments is for use in enhancing nerve regeneration. According to some embodiments, the pharmaceutical composition according to any one of the above embodiments is for use in enhancing neuronal plasticity.
[0152] According to another aspect, the present invention provides a method for treating neuronal damage or injury in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated EV comprising an inhibitor of the expression of a protein selected from the group consisting of neurocan (NCAN), tenascin-R (TNR), aggrecan (ACAN), versican (VCAN), brevican (BCAN), and combinations thereof. According to some embodiments, the present invention provides a method for inducing nerve regeneration after neuronal injury in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated EV comprising an inhibitor of the expression of a protein selected from the group consisting of neurocan (NCAN), tenascin-R (TNR), aggrecan (ACAN), versican (VCAN), brevican (BCAN), and combinations thereof. According to some embodiments, the administering is intranasal. According to other embodiments, the method further comprises administering chondroitinase ABC. According to other embodiments, the method further comprises administering matrix metalloproteinase (MMP), disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS), or HA.
[0153] The term "therapeutically effective amount" of EV when administered to a subject has the intended therapeutic effect, for example, treatment of neuronal damage or injury such as SCI. A complete therapeutic effect does not necessarily occur upon administration of a single dose and may occur only after a series of dose administrations. Thus, a therapeutically effective amount can be administered in one or more administrations. The exact effective amount required for a subject depends, for example, on the size, health and age of the subject, the nature and extent of the cognitive impairment, and the treatment or combination of treatments selected for administration, and the mode of administration. One of ordinary skill in the art can readily determine the effective amount for a given situation by routine experimental methods.
[0154] In another aspect, the present disclosure provides a method for inhibiting or reducing the expression level of the NCAN gene in cells in vivo or in vitro, comprising introducing into the cells an siRNA or shRNA molecule, an EV, or a pharmaceutical composition according to any of the above embodiments and aspects such that the expression level of the NCAN gene is inhibited or reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%. According to some embodiments, the siRNA or shRNA that inhibits the expression of the NCAN molecule comprises or consists of a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95. According to another embodiment, the siRNA or shRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20, and 96-105, wherein the complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to some embodiments, the siRNA or shRNA that inhibits the expression of NCAN comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NOs: 1 and 6, (ii) SEQ ID NOs: 2 and 7, (iii) SEQ ID NOs: 3 and 8, or (iv) SEQ ID NOs: 4 and 9, (v) SEQ ID NOs: 5 and 10, wherein the N nucleotides in the guide strand are complementary to the Ns in the complementary strand at the corresponding positions. According to some embodiments, the siRNA or shRNA that inhibits the expression of NCAN comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NOs: 11 and 16, (ii) SEQ ID NOs: 12 and 17, (iii) SEQ ID NOs: 13 and 18, or (iv) SEQ ID NOs: 14 and 9, (v) SEQ ID NOs: 15 and 20, (vi) SEQ ID NOs: 86 and 96, (vii) SEQ ID NOs: 87 and 77, (viii) SEQ ID NOs: 88 and 88, (ix) SEQ ID NOs: 89 and 99, (x) SEQ ID NOs: 90 and 100, (xi) SEQ ID NOs: 91 and 101, (xii) SEQ ID NOs: 92 and 102, (xiii) SEQ ID NOs: 93 and 103, (xiv) SEQ ID NOs: 94 and 104, or (xv) SEQ ID NOs: 95 and 105.According to some embodiments, the siRNA or shRNA that inhibits the expression of NCAN comprises or consists of an oligonucleotide pair comprising the nucleic acid sequences of SEQ ID NOs: 11 and 16. According to some embodiments, the siRNA or shRNA that inhibits the expression of NCAN comprises or consists of an oligonucleotide pair comprising the nucleic acid sequences of SEQ ID NOs: 12 and 17. According to some embodiments, the siRNA or shRNA that inhibits the expression of NCAN comprises or consists of an oligonucleotide pair comprising the nucleic acid sequences of SEQ ID NOs: 13 and 18. According to some embodiments, the siRNA or shRNA is conjugated with cholesterol. According to some embodiments, the siRNA or shRNA is conjugated with glucose.
[0155] In another aspect, the present disclosure provides a method for inhibiting or reducing the expression level of the TNR gene in cells in vivo or in vitro, comprising introducing into the cells an siRNA or shRNA molecule, an EV, or a pharmaceutical composition according to any of the above embodiments and aspects such that the expression level of the TNR gene is inhibited or reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%. According to some embodiments, the siRNA or shRNA that inhibits the expression of the TNR molecule comprises or consists of a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to another embodiment, the siRNA or shRNA that inhibits the expression of TNR comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, the complementary strand comprising at positions 1 and 19 nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. According to some embodiments, the siRNA or shRNA that inhibits the expression of TNR comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 30 and 44, (ii) SEQ ID NO: 31 and 45, (iii) SEQ ID NO: 32 and 46, (iv) SEQ ID NO: 33 and 47, (v) SEQ ID NO: 34 and 48, (vi) SEQ ID NO: 45 and 49, (vii) SEQ ID NO: 56 and 50, (viii) SEQ ID NO: 37 and 51, (ix) SEQ ID NO: 38 and 52, (x) SEQ ID NO: 39 and 53, (xi) SEQ ID NO: 40 and 54, (xii) SEQ ID NO: 41 and 55, (xiii) SEQ ID NO: 42 and 56, or (xiv) SEQ ID NO: 43 and 57, wherein the N nucleotides in the guide strand are complementary to the Ns in the complementary strand at the corresponding positions.According to some embodiments, the siRNA or shRNA that inhibits the expression of TNR comprises or consists of pairs of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 58 and 72, (ii) SEQ ID NO: 59 and 73, (iii) SEQ ID NO: 60 and 74, (iv) SEQ ID NO: 61 and 75, (v) SEQ ID NO: 62 and 76, (v) SEQ ID NO: 63 and 77, (vii) SEQ ID NO: 64 and 78, (viii) SEQ ID NO: 65 and 79, (ix) SEQ ID NO: 66 and 80, (x) SEQ ID NO: 67 and 81, (xi) SEQ ID NO: 68 and 82, (xii) SEQ ID NO: 69 and 83, (xiii) SEQ ID NO: 70 and 84, or (xiv) SEQ ID NO: 71 and 85. According to some embodiments, the siRNA or shRNA that inhibits the expression of TNR comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences of SEQ ID NO: 58 and 72. According to some embodiments, the siRNA or shRNA that inhibits the expression of TNR comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences of SEQ ID NO: 61 and 75. According to some embodiments, the siRNA or shRNA that inhibits the expression of TNR comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences of SEQ ID NO: 62 and 76. According to some embodiments, the siRNA or shRNA is conjugated to cholesterol. According to some embodiments, the siRNA or shRNA is conjugated to glucose.
[0156]
Table 1-1
[0157]
Table 1-2
[0158] The terms "a", "an", and "the" are used interchangeably herein and mean one or more. The term "and / or" is used to indicate that one or both of the stated cases may occur; for example, A and / or B includes (A and B) as well as (A or B).
[0159] The term "or" as used herein indicates alternatives that may be combined where appropriate. That is, the term "or" includes each of the alternatives listed separately as well as combinations thereof where the combinations are not mutually exclusive.
[0160] The terms "comprising", "comprises", "include(s)", "include", "having", "has", and "contain(s)" are used interchangeably herein and have the meaning of "consisting at least in part of". When interpreting each description herein that includes the term "comprising", there may also be other features or features starting with this term. Related terms such as "comprise" and "comprises" are interpreted similarly. The terms "have", "has", "having", and "comprising" may also encompass the meanings of "consisting of" and "consisting essentially of" and may be replaced by these terms. The term "consisting of" excludes components, steps, or procedures not specifically described or recited. The term "consisting essentially of" means that a composition or component may include additional ingredients, but only if the additional ingredients do not substantially change the basic and novel features of the composition or method according to the claim.
[0161] As used herein, the term "about" when referring to a measurable value such as an amount, a temporal duration, etc., is intended to encompass variations of + / - 10%, or + / - 5%, + / - 1%, or + / - 0.1% from the specified value.
[0162] Although the present invention has been generally described above, these will be more readily understood with reference to the following examples, which are provided by way of illustration and not intended to limit the present invention.
Example
[0163] Example 1. Design of siRNA Inhibiting Neurocan Expression To find the best sequences that can be used to design siRNAs that inhibit the expression of neurocan (NCAN, the mRNA sequence is SEQ ID NO: 21), an extended bioinformatics analysis was performed. The sense and antisense (guide) sequences of the obtained siRNAs are presented in Table 2. In some cases, the sequences complementary to the guide (antisense) polynucleotide contain 14 to 19 nucleotides. The siRNAs against three specific regions on the sequence of the NCAN gene provided the most significant effects. These regions are nucleotide numbers 1000 - 1300, 3700 - 4000, 500 - 800, and 1 - 150.
[0164]
Table 2
[0165] These sequences were selected according to the best inhibition probabilities after considering the maximum homology and mismatches among multiple species including human, mouse, rat, and rhesus monkey (monkey).
[0166] Example 2. Design of siRNA Inhibiting Tenascin - R Expression To find the best sequences that can be used to design siRNAs that inhibit the expression of tenascin-R (TNR, the mRNA sequence is SEQ ID NO: 22), an extended bioinformatics analysis was performed. The sense and antisense (guide) sequences of the obtained siRNAs are presented in Table 3. In some cases, the sequences complementary to the guide (antisense) polynucleotide contain 14 to 19 nucleotides. The siRNAs against two specific regions on the sequence of the TNR gene provided the most significant effects. These regions are nucleotide numbers 1600 - 2000 and 4300 - 4700.
[0167] [Table 3] S - sense; A - antisense; From / to indicate positions on the gene having the nucleic acid sequence of SEQ ID NO: 22.
[0168] These sequences were selected based on the maximum homology among multiple species including human, mouse, rat, and rhesus monkey (monkey) and their best inhibition probabilities after considering mismatches.
[0169] Example 3 Exosome Purification Protocol Human MSCs were purchased from Lonza (Basel, Switzerland). The cells were cultured and expanded. The cells were cultured in platelet lysate without exosomes (Rabin Medical Center, Israel), and the medium was collected after 3 days. Exosomes were purified using a standard differential centrifugation protocol that included isolating the culture fluid and centrifuging it at 300 g for 10 minutes. The supernatant was collected and centrifuged at 2,000 g for 10 minutes, and then recentrifuged at 10,000 g for 30 minutes. The supernatant was then passed through a 0.22 μm filter and centrifuged at 100,000 g for 70 minutes. The pellet containing exosomes and proteins was washed in PBS and then centrifuged at 100,000 g for 70 minutes. The pellet was resuspended in 200 μl of sterile PBS. All centrifugations were performed at 4°C. Exosomes were characterized using NanoSight technology, electron microscopy, and Western blotting for calnexin as a negative marker and CD9 and CD81 as positive markers.
[0170] Loading of NCAN or TNR siRNA into MSC-exo siRNA, such as those obtained in Examples 1 and 2, is conjugated to cholesterol-TEG at the 3’ of the sense (guide) strand. Cholesterol is used as a siRNA loading reagent / enhancer into exosomes. The loading protocol is performed by co-incubating cholesterol-teg-siRNA molecules (1 μl of 100 μM) with 40 μl of 10 6 / μl ~ 10 8 / μl of exosomes at 37°C for 2 to 4 hours.
[0171] After incubation, free cholesterol-teg-siRNA is washed for 2 to 4 hours, for example, by 30 kDa Amicon and / or 100G ultracentrifugation. The pellet containing the loaded exosomes is used for in-vivo and in-vitro experiments.
[0172] To quantify the amount of siRNA in the loaded exosomes, a fluorescent marker (e.g., cy3) is conjugated to the 5' of the sense strand, and the fluorescence signal is compared with a calibration curve.
[0173] Specifically, the following anti-NCAN siRNAs were loaded into EVs: sirna_3816G (containing oligonucleotides with sequences UACAGUGGCAUGGACAUUCUA and GAAUGUCCAUGCCACUGUA), sirna_1172 GA (containing oligonucleotides with sequences UGAGCUCGGAAGCAGUAGCCG and GCUACUGCUUCCGAGCUCA), and sirna_632 GA (containing oligonucleotides with sequences UGGGCCUCAGCGAAGGUCCGU and GGACCUUCGCUGAGGCCCA); and anti-TNR siRNAs: sirna_1715 (containing oligonucleotides with sequences CUAAUGACAGCGUAGACGCUG and GCGUCUACGCUGUCAUUAG), sirna_4436 (containing oligonucleotides with sequences UUGGUCCGGUGGCAGUUCUUA and AGAACUGCCACCGGACCAA), and sirna_1809 (containing oligonucleotides with sequences CACGGUGGUCUCUGUGAUCGU and GAUCACAGAGACCACCGUG).
[0174] A further analytical method for determining loading efficacy is HPLC, which enables the detection of siRNA in exosomes according to its molecular characteristics and provides an analytical measurement of the amount.
[0175] Example 4 The effectiveness of several sequences with the best SVM scores, and their ability to reduce TNR gene expression, were tested in SK-N-SH cells (neuroblastoma cell line). The results were obtained after transfecting the cells for 24 hours using Lipofectamine reagent and 20 nM siRNA molecules against TNR. From these results, the inventors selected the most potent duplexes for further study. The anti-TNR siRNAs tested are shown in Table 4. Some of the siRNAs were conjugated with cholesterol (chol), cy3 or FAM as described in the table. In all siRNAs, the guide oligonucleotide contains 21 nt and the sense oligonucleotide contains 19 nt, except for TNR6 which contains 20 nt and 15 nt respectively. This initial screening revealed the most effective molecules.
[0176]
Table 4
[0177] Figure 1 presents the effects of different anti-TNR siRNAs (20 nM) on the expression of TNR in SK-N-SH cells transfected with Lipofectamine™ 3000 reagent. Relative expression was evaluated by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control.
[0178] As can be seen from the results, TNR2 (sirna_1715, sequences CUAAUGACAGCGUAGACGCUG and GCGUCUACGCUGUCAUUAG) and TNR7 (sirna_1809, sequences CACGGUGGUCUCUGUGAUCGU and GAUCACAGAGACCACCGUG) showed the best results. These siRNAs target two different sites on the TnR gene. TNR2 is conjugated with cholesterol and TNR7 is not conjugated.
[0179] To find the optimal conditions for analysis, the inventors tracked using sirna_1715 and sirna_1809 siRNAs, with or without cholesterol conjugation, sirna_1715-TNR1 and TNR2 (conjugated with cholesterol), and sirna_1809-TNR7 and TNR8 (not conjugated with cholesterol). Different time points and different siRNA concentrations were tested to find the most effective siRNA duplexes and the optimal conditions for transfection.
[0180] The results of the 24-hour transfection are presented in Figure 2. Relative expression was evaluated by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control. From these results, it can be seen that TNR1 and TNR2 (sirna_1715) provided the best results with a 40-50% decrease in the expression of TNR. These results are statistically significant. These siRNAs were further investigated to determine their ability to reduce TnR expression in cells when loaded into EVs.
[0181] The protein expression of TNR after transfection and after the addition of EVs loaded with siTNR is evaluated using Western blot or ELISA (of lysates and media) with an antibody specific for TNR.
[0182] Example 5 The effectiveness of several arrays having the best SVM scores, and their ability to reduce NCAN gene expression, were tested in SK-N-SH cells. The inventors first evaluated the effectiveness of a novel double-stranded NCAN siRNA against the reduction of NCAN-RNA levels as follows: SK-N-SH cells were transfected with si-NCAN double-strand (20 nM) using Lipofectamine™ 3000 reagent for 24 hours. Relative expression was evaluated by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control. Then, the most potent double-strands were selected for further study. The anti-NCAN siRNAs tested are shown in Table 5. Some of the siRNA sequences were conjugated with cholesterol (chol), cy3 or FAM as described in the table.
[0183] [Table 5]
[0184] The results are shown in Figure 3. NCAN1 siRNA is shown as duplex 1 in the figure, and NCAN2 is shown as duplex 2, etc. It can be seen that siRNA sirna_1172 (sequences UGAGCUCGGAAGCAGUAGCCG and GCUACUGCUUCCGAGCUCA), which contains no cholesterol or contains cholesterol (NCAN5 and NCAN6, respectively), provided the best results.
[0185] To find the optimal conditions for analysis, the inventors checked another time point and different siRNA concentrations (10 nM). The inventors found that the RNA expression level decreased at 48 hours after transfection compared to 24 hours after transfection, and the relative NCAN expression was not significantly different after transfection at 10 nM compared to 20 nM (Figure 4). Relative expression was evaluated by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control.
[0186] Furthermore, the effectiveness of NCAN5 and NCAN6 was compared with that of commercially available anti-NCAN siRNAs purchased from IDT (Integrated DNA Technologies) and designated as IDT1, IDT2, and IDT3. SK-N-SH cells were transfected by reverse transfection with 20 nM of anti-NCAN siRNA duplexes (NurExone or IDT) using Lipofectamine™ 3000 reagent. Relative expression was evaluated by qRT-PCR using TaqMan probes 48 hours after transfection. The expression of the GAPDH gene was used as an internal control. As can be seen from Figure 5, NCAN5 and NCAN6 have higher effectiveness than commercially available siRNAs.
[0187] Example 6 Since NCAN is a secreted chondroitin sulfate proteoglycan, the effects of different anti-NCAN siRNA duplexes on the secretion of NCAN protein in the medium were evaluated. SK-N-SH cells were transfected with si-NCAN duplexes (20 nM) using Lipofectamine™ 3000 reagent. RNA was isolated 48 hours after transfection and the medium was collected. Protein levels were evaluated with an NCAN ELISA kit. Relative expression was evaluated by qRT-PCR using TaqMan probes. The results are presented in Figures 6A and 6B. It can be seen that gene expression was reduced by more than 50% by NCAN5 and NCAN6, and protein expression was reduced by approximately 80% by NCAN5 and approximately 60% by NCAN6.
[0188] Example 7 ReN cells VM (catalog number SCC008, Millipore) were seeded at 5×10 4 cells / cm 2Cultivate at the seeding density, while replacing the normal medium every 48 hours. The ReN cell growth medium consists of ReNcell NSC Maintenance Medium (catalog number SCM005, Sigma) supplemented with 20 ng / ml hEGF (catalog number GF001, Merck) and hbFGF (catalog number GF003, Merck). When the cells reach confluence approximately 4 days after seeding, replace the growth medium with a differentiation medium consisting of a maintenance medium without supplements. Continuously monitor the cells. Replace the medium every 48 hours. After 2 weeks, following the manufacturer's instructions, the cells will fully differentiate into adult neurons with the formation of PNN (perineuronal net).
[0189] To confirm the success of differentiation into neurons, perform Wisteria floribunda agglutinin (WFA) (catalog number FL-1351-2, Vector laboratories) staining and neuronal NeuN (1:500) (Ab177487, Abcam) labeling.
[0190] Furthermore, use RT-qPCR with the NeuN Taqman Assay (catalog number AB431182, Rhenium) to evaluate the enrichment levels of neural markers. The evaluation of enrichment is calculated according to relative quantification calculations (ΔΔCT) compared to undifferentiated REn cells.
[0191] Subsequently, the cells are treated with previously optimized EVs (2×108 particles / cm2) for 48 hours. The treatments include naive EVs, EVs loaded with anti-NCAN-siRNA, or EVs loaded with anti-NCAN-siRNA. The anti-NCAN-siRNAs used are sirna_3816G (SEQ ID NOs: 11 and 16), sirna_1172 GA (SEQ ID NOs: 12 and 17), and sirna_632 GA (SEQ ID NOs: 13 and 18). The anti-TNR-siRNAs used are sirna_1715 (SEQ ID NOs: 58 and 72), sirna_4436 (SEQ ID NOs: 51 and 75), and sirna_1809 (SEQ ID NOs: 62 and 76). Subsequently, RNA isolation is performed using the QIAGEN RNeasy Mini Kit (catalog number 74104), and the levels of NCAN and TNR RNAs are evaluated using RT-qPCR. Furthermore, fluorescence staining using the WFA antibody is performed to visualize the reduction of PNN formation according to the manufacturer's instructions. Note that the protocol can be further optimized.
[0192] Furthermore, a similar assay is performed on differentiated REN cells after scratch injury of the cells, and the outgrowth and proliferation of neuron cells are observed and quantified by confocal microscopy to determine the effect of the treatment on nerve regeneration.
[0193] Example 8. PNN structural integrity can be measured by histological staining of the spinal cord and brain by labeling one or more of its structural proteins, as described, for example, in Christensen et al., Nat Commun. 2021;12(1):1-17.doi:10.1038 / s41467-020-20241-w or Lensjo et al., J Neurosci. 2017;37(5):1269-1283.doi:10.1523 / JNEUROSCI.2504-16.2016). For this procedure, rats or mice are treated directly with intranasal administration of 20 μl of the selected target siRNA and loaded into exosomes (10 7 ~10 8exosomes / μl). In some examples, the mouse or rat is treated with exosomes loaded with siRNA that inhibits the production of NCAN. The exosomes are, for example, as described in Example 3. Specifically, exosomes containing the siRNAs described in Tables 1 and 2 are used. After treatment, the animals are sacrificed, and the brain / spinal cord is fixed with 5% paraformaldehyde (PFA), and the PNN-related structural proteins are labeled using a primary antibody and a secondary antibody. Comparative analysis is performed between the structures of PNNs from treated animals and untreated animals to measure the inhibitory effect of siRNA on PNN formation / completeness / collapse.
[0194] Another efficacy experiment is performed in vivo to test the efficacy of the above-described treatment after complete transection and / or implantation of the spinal cord. Motor function is examined. The efficacy of the treatment is measured by motor improvement and sensory recovery on a scale called the BBB score.
[0195] Example 9. In Vivo Efficacy of Anti-NCAN and Anti-TNR siRNAs Rats were surgically treated at T10 for complete transection of the spinal cord and divided into four treatment groups. 1. Exosomes loaded with anti-NCAN siRNA sirna_3816G (sequences UACAGUGGCAUGGACAUUCUA and GAAUGUCCAUGCCACUGUA); 2. Exosomes loaded with anti-NCAN siRNA sirna_1172 GA (sequences UGAGCUCGGAAGCAGUAGCCG and GCUACUGCUUCCGAGCUCA); 3. Exosomes loaded with anti-NCAN siRNA sirna_632 GA (sequences UGGGCCUCAGCGAAGGUCCGU and GGACCUUCGCUGAGGCCCA); 4. Exosomes loaded with anti-TNR siRNA sirna_1715 sequences CUAAUGACAGCGUAGACGCUG and GCGUCUACGCUGUCAUUAG) 5. Exosomes loaded with anti-TNR siRNA sirna_4436 (sequences UUGGUCCGGUGGCAGUUCUUA and AGAACUGCCACCGGACCAA) 6. Exosomes loaded with anti-TNR siRNA sirna_1809 (containing oligonucleotides with sequences CACGGUGGUCUCUGUGAUCGU and GAUCACAGAGACCACCGUG). 7. siRNA sirna_3816G 8. siRNA sirna_1172 GA 9. siRNA sirna_632 GA 10. siRNA sirna_1715 11. siRNA sirna_4436 12. Exosomes only (n = 4) 13. Physiological saline (n = 6)
[0196] Rats were treated for 5 days starting on the day of surgery, had a 2-day break, and then were treated for another 5 days.
[0197] Starting 1 week after surgery, rats were exercised on a treadmill 5 days a week, tested for Dorsal Von Frey, had their body weights measured, and their walking was recorded for the weekly BBB score. At week 10, the spinal cords of the rats were scanned by MRI.
[0198] The recovery of the tail and foot pinch reflexes was tested 2 weeks after surgery.
[0199] The health of the rats was evaluated by the self-feeding tendency of the treated rats after injury. Rats surgically treated for SCI tend to self-feed.
[0200] Sagittal MRI images, axial slices, and cross-sectional area images 4 mm caudal and rostral to the T10 center in healthy rats, or to the injury center in untreated and treated rats were analyzed, and the ratio of the caudal area to the rostral area was calculated to represent the regeneration of the tissue downstream of the injury.
[0201] Example 10. Loading of NCAN or TNR siRNA into MSC-exo The siRNA, such as those obtained in Examples 1 and 2, is conjugated with glucose or sucrose at the 3’ of the sense (guide) strand. Glucose or sucrose is used as a loading reagent / enhancer of siRNA into exosomes. The loading protocol is carried out by co-incubating glucose-siRNA molecules (1 μl of 100 μM) with 40 μl of 10 6 ~10 8 / μl exosomes at 37 °C for 2 to 4 hours.
[0202] After incubation, the free glucose-siRNA or sucrose-siRNA is washed for 2 to 4 hours, for example, by 30 kDa Amicon and / or 100G ultracentrifugation. The pellet containing the loaded exosomes is used for in-vivo and in-vitro experiments.
[0203] To quantify the amount of siRNA in the loaded exosomes, a fluorescent marker (e.g., cy3) is conjugated to the 5’ of the sense strand, and the fluorescence signal is compared with a calibration curve.
[0204] Specifically, load the following anti-NCAN siRNAs conjugated with glucose into the EVs: sirna_3816G (containing oligonucleotides having the sequences UACAGUGGCAUGGACAUUCUA and GAAUGUCCAUGCCACUGUA), sirna_1172 GA (containing oligonucleotides having the sequences UGAGCUCGGAAGCAGUAGCCG and GCUACUGCUUCCGAGCUCA), and sirna_632 GA (containing oligonucleotides having the sequences UGGGCCUCAGCGAAGGUCCGU and GGACCUUCGCUGAGGCCCA); and anti-TNR siRNAs: sirna_1715 (containing oligonucleotides having the sequences CUAAUGACAGCGUAGACGCUG and GCGUCUACGCUGUCAUUAG), sirna_4436 (containing oligonucleotides having the sequences UUGGUCCGGUGGCAGUUCUUA and AGAACUGCCACCGGACCAA), and sirna_1809 (containing oligonucleotides having the sequences CACGGUGGUCUCUGUGAUCGU and GAUCACAGAGACCACCGUG).
[0205] Although the present invention has been described above in its preferred embodiments herein, it can be modified without departing from the spirit and nature of the invention as defined in the appended claims.
Claims
1. An RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA, comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5 and 30-43, for inhibiting the expression of proteins in the perineuronal network.
2. The RNAi oligonucleotide according to claim 1, wherein the protein in the perineuronal network is selected from neurocan (NCAN) and tenascin-R (TNR).
3. The RNAi oligonucleotide according to claim 2, wherein the RNAi oligonucleotide inhibits the expression of the neurocan protein, and the guide strand comprises a nucleic acid sequence selected from SEQ ID NOs: 1-5.
4. The RNAi oligonucleotide according to claim 3, wherein the RNAi oligonucleotide inhibits the expression of the neurocan protein, and the guide strand comprises a nucleic acid sequence selected from SEQ ID NOs: 11-15 and 86-95.
5. The RNAi oligonucleotide according to claim 3 or 4, wherein the RNAi is siRNA, and the guide strand consists of a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95.
6. The RNAi oligonucleotide according to any one of claims 3-5, comprising a strand complementary to the guide strand, wherein the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand.
7. The RNAi oligonucleotide according to claim 6, wherein the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 6-10, and the complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand.
8. The RNAi oligonucleotide according to claim 7, wherein the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 16-20 and 96-105.
9. The RNAi oligonucleotide according to claim 3, wherein the RNAi oligonucleotide is an siRNA comprising a guide strand and a complementary strand, the guide strand comprises a nucleic acid sequence selected from SEQ ID NOs: 11-15 and 86-95, and the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 16-20 and 96-105.
10. The RNAi is siRNA comprising a pair of a guide strand and a complementary strand, and the pair comprises or consists of nucleic acid sequences of SEQ ID NO: 11 and 16, SEQ ID NO: 12 and 17, or SEQ ID NO: 13 and 18. The RNAi oligonucleotide according to claim 3.
11. The RNAi oligonucleotide is siRNA comprising a pair of a guide strand and a complementary strand, and the pair comprises or consists of nucleic acid sequences of SEQ ID NO: 86 and 96, SEQ ID NO: 87 and 77, SEQ ID NO: 88 and 88, SEQ ID NO: 89 and 99, SEQ ID NO: 90 and 100, SEQ ID NO: 91 and 101, SEQ ID NO: 92 and 102, SEQ ID NO: 93 and 103, SEQ ID NO: 94 and 104, or SEQ ID NO: 95 and 105. The RNAi oligonucleotide according to claim 3.
12. The RNAi oligonucleotide inhibits the expression of tenascin-R (TNR), and the guide strand comprises a nucleic acid sequence selected from SEQ ID NOs: 30 to 43. The RNAi oligonucleotide according to claim 2.
13. The RNAi oligonucleotide inhibits the expression of tenascin-R (TNR), and the guide strand comprises a nucleic acid sequence selected from SEQ ID NOs: 58 to 71. The RNAi oligonucleotide according to claim 12.
14. The RNAi is siRNA, and the guide strand consists of a nucleic acid sequence selected from SEQ ID NOs: 30 to 43 and 58 to 71. The RNAi oligonucleotide according to claim 12 or 13.
15. Comprising a strand complementary to the guide strand, and the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. The RNAi oligonucleotide according to any one of claims 12 to 14.
16. The complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 44 to 57, and the complementary strand comprises, at positions 1 and 19, nucleic acids complementary to the nucleic acids at the corresponding positions in the sequence of the guide strand. The RNAi oligonucleotide according to claim 15.
17. The complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 72 to 85. The RNAi oligonucleotide according to claim 16.
18. The RNAi is siRNA containing a guide strand and a complementary strand, the guide strand contains a nucleic acid sequence selected from SEQ ID NOs. and 44 to 57, and the complementary strand contains a nucleic acid sequence selected from SEQ ID NOs. and 72 to 85. The RNAi oligonucleotide according to claim 12.
19. The RNAi is siRNA containing a pair of a guide strand and a complementary strand, and the pair contains or consists of nucleic acid sequences of SEQ ID NO. 58 and 72, SEQ ID NO. 61 and 75, or SEQ ID NO. 62 and 76. The RNAi oligonucleotide according to claim 12.
20. The RNAi oligonucleotide according to any one of claims 1 to 19, conjugated with a hydrophobic molecule.
21. The hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof. The RNAi oligonucleotide according to claim 20.
22. The hydrophobic moiety is cholesterol. The RNAi oligonucleotide according to claim 21.
23. The RNAi oligonucleotide according to any one of claims 1 to 19, conjugated with a carbohydrate.
24. The carbohydrate is selected from glucose and sucrose. The RNAi oligonucleotide according to claim 23.
25. An isolated extracellular vesicle (EV) containing an RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA that inhibits the expression of proteins in the perineuronal network.
26. The protein is selected from neurocan (NCAN), tenascin-R, aggrecan (ACAN), versican (VCAN), brevican (BCAN), and any combination thereof. The isolated EV according to claim 25.
27. The EV is selected from exosomes, microvesicles, and combinations thereof. The isolated EV according to claim 25 or 26.
28. The extracellular vesicle is an exosome. The isolated EV according to claim 27.
29. The extracellular vesicle is derived from adherent cells expressing a mesenchymal marker. The isolated EV according to any one of claims 25 to 28.
30. The adherent cells expressing the mesenchymal marker are selected from mesenchymal stem cells (MSCs) and olfactory ensheathing cells. The isolated EV according to claim 29.
31. The isolated EV according to any one of claims 26 to 30, wherein the RNAi oligonucleotide inhibits the expression of NCAN.
32. The isolated EV according to claim 31, wherein the RNAi oligonucleotide is the RNAi oligonucleotide according to any one of claims 3 to 11.
33. The isolated EV according to claim 32, wherein the RNAi oligonucleotide is siRNA containing a pair of a guide strand and a complementary strand, and the pair contains or consists of the nucleic acid sequences of SEQ ID NO: 11 and 16, SEQ ID NO: 12 and 17, SEQ ID NO: 13 and 18, SEQ ID NO: 86 and 96, SEQ ID NO: 87 and 77, SEQ ID NO: 88 and 88, SEQ ID NO: 89 and 99, SEQ ID NO: 90 and 100, SEQ ID NO: 91 and 101, SEQ ID NO: 92 and 102, SEQ ID NO: 93 and 103, SEQ ID NO: 94 and 104, or SEQ ID NO: 95 and 105.
34. The isolated EV according to claim 33, wherein the isolated EV is an exosome.
35. The isolated EV according to claim 34, wherein the isolated EV is isolated from mesenchymal stem cells.
36. The isolated EV according to any one of claims 26 to 30, wherein the RNAi oligonucleotide inhibits the expression of tenascin-R.
37. The isolated EV according to claim 36, wherein the RNAi oligonucleotide is the RNAi according to any one of claims 12 to 19.
38. The isolated EV according to claim 37, wherein the RNAi oligonucleotide is siRNA containing a pair of a guide strand and a complementary strand, and the pair contains or consists of the nucleic acid sequences of SEQ ID NO: 58 and 72, SEQ ID NO: 61 and 75, or SEQ ID NO: 62 and 76.
39. The isolated EV according to claim 38, wherein the isolated EV is an exosome.
40. The isolated EV according to claim 39, wherein the isolated EV is isolated from mesenchymal stem cells.
41. The isolated EV according to any one of claims 26 to 40, wherein the EV contains an RNAi oligonucleotide that inhibits the expression of NCAN and tenascin-R.
42. The RNAi oligonucleotide that inhibits the expression of NCAN is the RNAi oligonucleotide according to any one of claims 3 to 11, and the RNAi oligonucleotide that inhibits the expression of tenascin-R is the RNAi oligonucleotide according to any one of claims 12 to 19. The isolated EV according to claim 41.
43. The isolated EV according to any one of claims 25 to 40, further comprising a compound selected from chondroitinase ABC, matrix metalloproteinase (MMP), a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS), a nucleic acid molecule encoding the same, and hyaluronic acid (HA).
44. A pharmaceutical composition comprising the RNAi oligonucleotide according to any one of claims 1 to 24 or the isolated EV according to any one of claims 25 to 43 and a pharmaceutically acceptable excipient.
45. The pharmaceutical composition according to claim 44, formulated for administration via an administration route selected from intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, and intracerebral administration routes.
46. The pharmaceutical composition according to claim 45, formulated for intranasal administration.
47. The pharmaceutical composition according to any one of claims 44 to 46, further comprising a compound selected from chondroitinase ABC, HA, matrix metalloproteinase (MMP), and a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS).
48. The pharmaceutical composition according to any one of claims 44 to 47, for use in nerve regeneration after nerve injury, or the treatment of neuronal injury or damage in a subject, or the induction of nerve regeneration.
49. The pharmaceutical composition for use according to claim 48, wherein the neuronal injury or damage is spinal cord injury (SCI).
50. The pharmaceutical composition for use according to claim 48 or 49, wherein the use comprises intranasal administration of the composition.
51. A method of inducing nerve regeneration or treating neuronal injury or disorder in a subject in need thereof, the method comprising administering to the subject an isolated extracellular vesicle comprising an RNAi oligonucleotide that inhibits the expression of a protein selected from the group consisting of neurocan (NCAN), tenascin-R, aggrecan (ACAN), versican (VCAN), brevican (BCAN), and combinations thereof, in a therapeutically effective amount.
52. The method according to claim 51, wherein the RNAi oligonucleotide that inhibits the expression of NCAN is the RNAi oligonucleotide according to any one of claims 3 to 11, and the RNAi oligonucleotide that inhibits the expression of tenascin-R is the RNAi oligonucleotide according to any one of claims 12 to 19.
53. The method according to claim 51 or 52, wherein the administration is by intranasal administration or injection.
54. The method according to any one of claims 51 to 53, further comprising a compound selected from the group consisting of chondroitinase ABC, matrix metalloproteinase (MMP), a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS), a nucleic acid molecule encoding the same, and hyaluronic acid (HA).