Enrichment of variant alleles by unidirectional dual-probe primer extension
The unidirectional dual-probe primer extension method efficiently enriches specific variant alleles, addressing the limitations of current methods by providing rapid, cost-effective, and high-on-target enrichment in nucleic acid sequencing.
Patent Information
- Application Number
- JP2025500957
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-04-12
- Filing Date
- 2023-07-12
- Publication Date
- 2025-07-17
AI Technical Summary
Current methods for enriching specific variant alleles in nucleic acid sequencing are slow, cumbersome, and expensive, failing to accommodate unknown structural variations efficiently.
A method involving unidirectional dual-probe primer extension, where oligonucleotides are hybridized and extended with polymerases to create primer extension complexes, captured, and amplified using adapter-specific primers, allowing for rapid and simple enrichment of target nucleic acids.
Enables rapid, cost-effective, and high-on-target enrichment of specific variant alleles, reducing sequencing costs and turnaround time while accommodating unknown structural variations.
Smart Images

Figure 2025522981000018 
Figure 2025522981000019 
Figure 2025522981000020
Abstract
Description
Technical Field
[0001] Description of Sequence Listing The sequence listing related to this application is provided in xml format instead of a paper copy and is incorporated herein by reference. The name of the xml file containing the sequence listing is P37667-WO_sequence_listing.xml. The xml file is 32.3KB, was created on July 5, 2023, and is electronically submitted.
[0002] Field of the Invention The present disclosure generally relates to the enrichment of nucleic acid targets in a sample, and more particularly to the enrichment of targets for nucleic acid sequencing, including high-throughput sequencing. Even more particularly, the present disclosure relates to the enrichment of specific variant alleles by unidirectional dual probe primer extension.
Background Art
[0003] Background of the Invention The present invention belongs to a class of technologies that enable a user to focus on regions of interest within nucleic acids to be sequenced. This reduces the costs associated with sequencing reactions and subsequent data analysis. Currently, there are three general types of technologies for selectively capturing regions of interest within nucleic acids present in a sample. The first technology is hybridization capture, in which regions of interest are captured by hybridization of probes that can selectively bind to a capture surface. This capture enables removal of non-target nucleic acids and subsequent release and collection of the captured target molecules. This type of technology has advantages, including the ability to capture exome-sized regions and regions containing unknown structural variations. Disadvantages include a long and complex protocol that tends to require up to 8 hours to complete. The complexity is mainly caused by the need to prepare a randomly fragmented shotgun library prior to hybridization. The hybridization step alone can take up to 3 days to complete. Examples of this type of technology include the SECAP EZ Target Enrichment System (ROCHE) and the SURESELECT Target Enrichment System (AGILENT).
[0004] Another method of target enrichment is amplification based on dual target primers. In this method, two probes on the boundary of the target are used to enrich the region of interest. This method tends to take less than 8 hours to complete and is simpler than the hybridization capture method. However, dual primer-based techniques cannot enrich sequences with unknown structural variations. The most established dual primer approach is multiplex polymerase chain reaction (PCR). This is a very simple one-step process, but it can only amplify dozens of targets per reaction tube. Other newer technologies are now available, including the TRUSEQ Amplicon Sequencing Kit (ILLUMINA) and the ION TORRENT AMPLISEQ Sequencing Kit (LIFE TECHNOLOGIES) products, which can amplify hundreds to thousands of targets in a single reaction tube and require only a few handling steps.
[0005] The third technique is amplification based on single target primers. In this method, the target is enriched by amplification of the region defined by a single target primer and a ligated universal primer. Similar to hybridization-based approaches, these techniques require the generation of a randomly fragmented shotgun library prior to the selective hybridization of target oligonucleotides. However, instead of using this oligonucleotide to capture the target and wash away non-target molecules, an amplification step is used to selectively amplify the region between the randomly generated ends and the target-specific oligonucleotide. The advantage of this technique is that, unlike dual primer techniques, it allows the detection of sequences with unknown structural variations. It is also faster and simpler than hybridization-based techniques. However, this type of technique is still slower and more complex than dual primer-based approaches. Examples of this type of technique are ARCHER's Anchored Multiplex PCR (ARCHER DX) and the OVATION Target Enrichment System (NUGEN).
[0006] The need for a rapid and simple target enrichment method that also accommodates unknown structural variations in target sequences is not met.
[0007] In some applications of next-generation sequencing, target enrichment methods are used to enrich specific variant alleles over reference alleles. By enriching these variant alleles relative to the reference alleles prior to sequencing, the number of sequencing reads required to detect the variant alleles is reduced. This reduces the overall sequencing cost in applications where the minor variant allele fraction is low frequency (< 10%, < 1%, < 0.1%, < 0.01%, etc.). To achieve this, probe hybridization capture methods have been used (Gydush, et al., “Massively parallel enrichment of low-frequency alleles enables duplex sequencing at low depth,” Nat. Biomed. Eng. 6(3):257-266 (2022)). However, these methods are slow, cumbersome, and expensive.
[0008] There remains an unmet need for a rapid, simple, and cost-effective method for enriching specific variant alleles. SUMMARY OF THE INVENTION
[0009] SUMMARY OF THE INVENTION According to one embodiment, the present disclosure provides a method for enriching at least one target nucleic acid in a nucleic acid library. The method includes hybridizing a first oligonucleotide to the target nucleic acid in the nucleic acid library. Each nucleic acid in the nucleic acid library has a first end including a first adapter and a second end including a second adapter. The method further includes extending the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex including the target nucleic acid and the extended first oligonucleotide. The method includes capturing the first primer extension complex, enriching the first primer extension complex relative to the nucleic acid library, hybridizing a second oligonucleotide to the target nucleic acid, extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex including the target nucleic acid and the extended second oligonucleotide, and thereby releasing the extended first oligonucleotide from the first primer extension complex. The method further includes amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, wherein the first amplification primer has a 3′ end complementary to the first adapter and the second amplification primer has a 3′ end complementary to the second adapter.
[0010] In one aspect, the method further includes sequencing the amplified target nucleic acid.
[0011] In another aspect, the first oligonucleotide includes a capture moiety.
[0012] In another aspect, capturing the first primer extension complex includes capturing the capture moiety on a solid support.
[0013] In another aspect, the capture moiety is biotin and the solid support includes streptavidin.
[0014] In another aspect, before hybridizing the first oligonucleotide to the target nucleic acid, the first oligonucleotide is bound to a solid support, the first oligonucleotide is hybridized to the target nucleic acid, and the hybridized first oligonucleotide is extended with a polymerase, thereby capturing the first primer extension complex on the solid support.
[0015] In another aspect, capturing the first primer extension complex is performed after extending the hybridized first oligonucleotide.
[0016] In another aspect, the method further includes incorporating at least one modified nucleotide into at least one of the extended first oligonucleotide in the first primer extension complex and the extended second oligonucleotide in the second primer extension complex.
[0017] In another aspect, the modified nucleotide is selected from dUTP and a nucleotide having a capture moiety.
[0018] In another aspect, the method further includes incorporating at least one modified nucleotide into the extended first oligonucleotide in the first primer extension complex, and the at least one modified nucleotide has a capture moiety.
[0019] In another aspect, capturing the first primer extension complex includes capturing a capture moiety on the solid support.
[0020] In another aspect, the method further includes incorporating at least one uracil into at least one of the extended first oligonucleotide in the first primer extension complex and the extended second oligonucleotide in the second primer extension complex, thereby forming a uracil-containing oligonucleotide product.
[0021] In another aspect, the method further comprises digesting the uracil-containing oligonucleotide product.
[0022] In another aspect, digesting the uracil-containing oligonucleotide product is achieved using at least one of uracil DNA glycosylase and DNA glycosylase-lyase.
[0023] In another aspect, the DNA glycosylase-lyase is selected from endonuclease IV and endonuclease VIII.
[0024] In another aspect, the method further comprises contacting the nucleic acid library with a blocking oligonucleotide.
[0025] In another aspect, the blocking oligonucleotide is at least partially complementary to at least one of the first adapter and the second adapter.
[0026] In another aspect, the blocking oligonucleotide is a universal blocking oligonucleotide.
[0027] In another aspect, the first adapter and the second adapter have the same nucleic acid sequence.
[0028] In another aspect, the first adapter and the second adapter have different nucleic acid sequences.
[0029] In another aspect, the first adapter and the second adapter are fork-type adapters.
[0030] In another aspect, the first adapter and the second adapter contain at least one uracil.
[0031] In another aspect, at least one of the first polymerase and the second polymerase is a uracil-incongruent polymerase.
[0032] In another aspect, the third polymerase is a uracil-compatible polymerase.
[0033] In another aspect, the second oligonucleotide hybridizes to the target nucleic acid at the 5' position relative to the first oligonucleotide.
[0034] In another aspect, the third polymerase is a uracil-incompatible polymerase.
[0035] In another aspect, at least one of the first adapter, the second adapter, the first amplification primer, and the second amplification primer includes at least one of a unique identifier (UID) sequence and a molecular identifier (MID) sequence.
[0036] In another aspect, the method includes repeating the step of hybridizing the first oligonucleotide to the target nucleic acid after the step of amplifying the enriched library fragments through the step of amplifying the enriched library fragments.
[0037] In another aspect, the method includes denaturing the first primer extension complex to release the target nucleic acid after the step of concentrating the first primer extension complex, followed by repeating the step of hybridizing the first oligonucleotide to the target nucleic acid through the step of concentrating the first primer extension complex, followed by amplifying the target nucleic acid and including the step of hybridizing the second oligonucleotide to the target nucleic acid.
[0038] In another aspect, the method includes performing the second primer extension reaction, followed by performing the second primer extension reaction, followed by repeating the step of hybridizing the first oligonucleotide to the target nucleic acid through the step of amplifying the target nucleic acid.
[0039] According to another embodiment, the present disclosure provides a kit for enriching at least one target nucleic acid in a nucleic acid library. The kit includes a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library, wherein each nucleic acid in the nucleic acid library has a first end including a first adapter and a second end including a second adapter. The kit further includes a second oligonucleotide complementary to the target nucleic acid, a first amplification primer, and a second amplification primer. The first oligonucleotide includes a capture moiety, the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide, the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter.
[0040] According to another embodiment, the present disclosure provides a kit for enriching at least one target nucleic acid in a nucleic acid library. The kit includes a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library, wherein each nucleic acid in the nucleic acid library has a first end including a first adapter and a second end including a second adapter. The kit further includes a modified nucleotide having a capture moiety, a second oligonucleotide complementary to the target nucleic acid, a first amplification primer, and a second amplification primer. The second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide, the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter.
[0041] In one aspect, the kit further includes at least one of uracil nucleotide, uracil-compatible polymerase, uracil-incompatible polymerase, and a blocking oligonucleotide.
[0042] In one aspect, the capture moiety in the first oligonucleotide is a capture sequence that is at least partially complementary to a capture oligonucleotide, and the kit further includes the capture oligonucleotide.
[0043] According to another embodiment, the present disclosure provides a composition comprising a nucleic acid library comprising at least one target nucleic acid. Each nucleic acid in the nucleic acid library has a first end comprising a first adapter, a second end comprising a second adapter, and a region of interest intermediate the first adapter and the second adapter. The composition further comprises an extended first oligonucleotide hybridized to the region of interest of the target nucleic acid. The extended first oligonucleotide comprises at least one capture moiety. The composition further comprises a solid support bound to the at least one capture moiety, a second oligonucleotide hybridized to the target nucleic acid at a position 5' to the first extended oligonucleotide, and a polymerase associated with the 3' end of the second oligonucleotide.
[0044] In one aspect, the composition further comprises a blocking oligo hybridized to each of the first adapter and the second adapter.
[0045] In another aspect, the at least one capture moiety is located at the 5' end of the extended first oligonucleotide.
[0046] In another aspect, the at least one capture moiety is incorporated into the extended portion of the extended first oligonucleotide.
[0047] In another aspect, the extended first oligonucleotide further comprises at least one uracil and at least one thymine.
[0048] In another aspect, the polymerase is a uracil-incongruent polymerase.
[0049] In another aspect, at least one of the first adapter and the second adapter comprises at least one uracil and at least one thymine.
[0050] In another aspect, releasing the extended first oligonucleotide from the first primer extension complex is accomplished using an enzyme having an activity selected from strand displacement activity, 5' to 3' exonuclease activity, and flap endonuclease activity.
[0051] In another aspect, the capture moiety is such that capturing the first primer extension complex is by hybridizing a capture oligonucleotide to a capture sequence of the first oligonucleotide present in the first primer extension complex, and the capture oligonucleotide has a capture sequence that is at least partially complementary to the capture moiety. In another aspect, the capture oligonucleotide comprises a capture moiety. In another aspect, the capture oligonucleotide comprises modified nucleotides that raise the melting temperature of the capture oligonucleotide, such as 5-methylcytosine, 2,6-diaminopurine, 5-hydroxybutynyl-2'-deoxyuridine, 8-aza-7-deazaguanosine, ribonucleotides, 2'O-methyl ribonucleotides, or locked nucleic acids. In another aspect, the capture oligonucleotide is modified to inhibit digestion by nucleases, such as digestion by phosphorothioate nucleotides.
[0052] One aspect relates to a method for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, and the method comprises: (a) hybridizing a first oligonucleotide to the target nucleic acid in the nucleic acid library, wherein each nucleic acid in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first primer extension complex relative to the nucleic acid library; (e) hybridizing a second oligonucleotide to the target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; and (g) amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, wherein the first amplification primer has a 3'-end complementary to the first adapter and the second amplification primer has a 3'-end complementary to the second adapter. In another embodiment, the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the last 3' base of the first oligonucleotide. In another embodiment, the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the second last 3' base of the first oligonucleotide. In another embodiment, the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the third last 3' base of the first oligonucleotide. In another embodiment, the frequency of at least one variant base in the nucleic acid library is less than 1%.In another embodiment, the frequency of at least one variant base in the nucleic acid library is less than 0.1%. In another embodiment, the frequency of at least one variant base in the nucleic acid library is less than 0.01%. In another embodiment, the frequency of at least one variant base in the nucleic acid library is less than 0.001%. In another embodiment, the method further comprises an additional oligonucleotide in step (a), and the additional oligonucleotide hybridizes to the strand opposite the strand hybridized by the first oligonucleotide. In a related embodiment, the additional oligonucleotide is complementary to the target nucleic acid at at least one variant base. In another embodiment, one or more additional mismatches or non-annealing bubbles are generated in the first oligonucleotide. In another embodiment, the first oligonucleotide comprises one or more modified bases. In another embodiment, the one or more modified bases comprise locked nucleic acid (LNA), methyl C, or 7-deaza dGTP, or any combination thereof. In another embodiment, the first DNA polymerase, the second DNA polymerase, and / or the third DNA polymerase is KAPA 2G polymerase, Delta Z05 polymerase, AS-1 polymerase, or KAPA HiFi Exo(-) polymerase, or any combination thereof. In another embodiment, the second oligonucleotide is complementary to the target nucleic acid at at least one variant base. In another embodiment, the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the last 3' base of the second oligonucleotide. In another embodiment, the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the second last 3' base of the second oligonucleotide. In another embodiment, the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the third last 3' base of the second oligonucleotide. In another embodiment, the second oligonucleotide comprises one or more modified bases. In another embodiment, the one or more modified bases comprise locked nucleic acid (LNA), methyl C, or 7-deaza dGTP, or any combination thereof.In another embodiment, one or more additional mismatches or non-annealing bubbles are generated in the second oligonucleotide. In another embodiment, the method further comprises hybridizing a nucleic acid in a nucleic acid library that is not the target nucleic acid with a poison primer. In related embodiments, the poison primer depletes nucleic acids in a nucleic acid library that is not the target nucleic acid. In another embodiment, the method further comprises sequencing the amplified target nucleic acid. In another embodiment, the first oligonucleotide comprises a capture moiety. In another embodiment, prior to hybridizing the first oligonucleotide to the target nucleic acid, the first oligonucleotide is bound to a solid support, the first oligonucleotide is hybridized to the target nucleic acid, and the hybridized first oligonucleotide is extended with a polymerase, thereby capturing the first primer extension complex on the solid support. In another embodiment, the method further comprises incorporating at least one uracil into at least one of the extended first oligonucleotide in the first primer extension complex and the extended second oligonucleotide in the second primer extension complex, thereby forming a uracil-containing oligonucleotide product. In another embodiment, the method further comprises contacting the nucleic acid library with a blocking oligonucleotide. In another embodiment, the first adapter and the second adapter are fork-type adapters. In another embodiment, the first adapter and the second adapter comprise at least one uracil. In another embodiment, the second oligonucleotide hybridizes to the target nucleic acid at a position 5' to the first oligonucleotide. In another embodiment, at least one of the first adapter, the second adapter, the first amplification primer, and the second amplification primer comprises at least one of a unique identifier (UID), a molecular identifier (MID) sequence.
[0053] Another embodiment relates to a kit for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, and the kit comprises: (a) a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library, wherein each nucleic acid in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at at least one variant base; (b) a second oligonucleotide complementary to the target nucleic acid; (c) a first amplification primer; and (d) a second amplification primer, wherein the first oligonucleotide comprises a capture moiety, the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide, the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter. In related embodiments, the second oligonucleotide is complementary to the target nucleic acid at at least one variant base.
[0054] Another embodiment relates to a kit for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, and the kit comprises: (a) a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library, wherein each nucleic acid in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at at least one variant base; (b) a modified nucleotide having a capture moiety; (c) a second oligonucleotide complementary to the target nucleic acid; (d) a first amplification primer; and (e) a second amplification primer, wherein the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide, the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter. In related embodiments, the second oligonucleotide is complementary to the target nucleic acid at at least one variant base.
[0055] Another aspect relates to a method for double enrichment of at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, and the method comprises the following steps: (a) hybridizing a first oligonucleotide to the target nucleic acid in the nucleic acid library, wherein each nucleic acid in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first primer extension complex relative to the nucleic acid library; (e) hybridizing a second oligonucleotide to the target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; (g) amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer to produce a sample of amplified target nucleic acid, wherein the first amplification primer has a 3' end complementary to the first adapter and the second amplification primer has a 3' end complementary to the second adapter; and (h) repeating each of steps (a) to (g) in sequence on the sample of amplified target nucleic acid of step (g).
[0056] Another aspect relates to a method for double enrichment of at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, and the method comprises the following steps: (a) hybridizing a first oligonucleotide to the target nucleic acid in the nucleic acid library, wherein each nucleic acid in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first primer extension complex relative to the nucleic acid library; (e) denaturing the first primer extension complex to release the target nucleic acid from the first primer extension complex; (f) repeating each of steps (a) to (d) in sequence for the target nucleic acid of step (e); (g) hybridizing a second oligonucleotide to the target nucleic acid; (h) extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; and (i) amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, wherein the first amplification primer has a 3' end complementary to the first adapter and the second amplification primer has a 3' end complementary to the second adapter.
[0057] Another aspect relates to a method for the double enrichment of at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, and the method comprises the following steps: (a) hybridizing a first oligonucleotide to the target nucleic acid in the nucleic acid library, wherein each nucleic acid in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first primer extension complex relative to the nucleic acid library; (e) hybridizing a second oligonucleotide to the target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; (g) repeating each of steps (a) to (f) in order with respect to the target nucleic acid of step (f); and (h) amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, wherein the first amplification primer has a 3′ end complementary to the first adapter and the second amplification primer has a 3′ end complementary to the second adapter.
[0058] The foregoing and other aspects and advantages of the present invention will become apparent from the following description. In the description, reference is made to the accompanying drawings which form a part hereof and in which are shown, by way of illustration, preferred embodiments of the invention. However, such embodiments do not necessarily represent the full scope of the invention, and reference is therefore made to the claims and this specification to interpret the scope of the invention.
Brief Description of the Drawings
[0059] The patent or application file contains at least one drawing created in color. Copies of this patent or patent application publication that include color drawing(s) will be provided by the Patent Office upon request and payment of the necessary fees.
[0060]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6A
Figure 6B
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figure 19
Figure 20
Figure 21
Figure 22
Figure 23
Figure 24
Figure 25
Figure 26
Best Mode for Carrying Out the Invention
[0061] Detailed Description of the Invention I. Definitions In this application, unless otherwise clear from the context, (i) the term "a" can be understood to mean "at least one", (ii) the term "or" can be understood to mean "and / or", (iii) the terms "comprising" and "including" can be understood to encompass item-by-item components or steps, whether alone or together with one or more additional components or steps, (iv) the terms "about" and "approximately" can be understood to allow for standard variations as would be understood by one of ordinary skill in the art, and (v) when ranges are provided, the endpoints are included.
[0062] Adapter: As used herein, "adapter" means a nucleotide sequence that can be added to an array to confer additional properties to that array. The adapter can be single-stranded or double-stranded, or can have both single-stranded and double-stranded portions.
[0063] Approximately: As used herein, the term "approximately" or "about" when applied to one or more values of interest refers to a value similar to the recited reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater than or less than) of the recited reference value, unless otherwise specified or otherwise apparent from the context (except where such numbers would exceed 100% of the possible values).
[0064] Related: As used herein, two events or entities are "related" to each other if the presence, level, and / or form of one event or entity correlates with the presence, level, and / or form of the other. For example, a particular entity (e.g., a polypeptide, gene signature, metabolite, etc.) is considered related to a disease, disorder, or condition if its presence, level, and / or form correlates with the incidence and / or susceptibility to the disease, disorder, or condition (e.g., throughout a relevant population). In some embodiments, two or more entities are physically "related" to each other if they interact directly or indirectly, such that they are physically proximate to and / or remain proximate to each other. In some embodiments, two or more entities that are physically related to each other are covalently bonded to each other, and in some embodiments, two or more entities that are physically related to each other are not covalently bonded to each other but are non-covalently bonded, for example, by hydrogen bonds, van der Waals interactions, hydrophobic interactions, magnetism, and combinations thereof.
[0065] Barcode: As used herein, "barcode" refers to a nucleotide sequence that confers identity to a molecule. The barcode can confer a unique identity to individual molecules (and their copies). This barcode is a unique ID (UID). The barcode can confer identity to an entire population of molecules (and their copies) derived from the same source (e.g., patient). This barcode is a multiplex ID (MID).
[0066] Biological sample: As used herein, the term "biological sample" typically refers to a sample obtained or derived from a biological source of interest (e.g., a tissue or an organism or a cell culture), as described herein. In some embodiments, the source of interest includes or consists of an organism, such as an animal or a human. In some embodiments, the biological sample comprises or consists of biological tissue or fluid. In some embodiments, the biological sample may be or include bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; cell-free nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph fluid; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; lavage or wash fluids such as ductal lavage or bronchoalveolar lavage; aspirates; scrapings; bone marrow material; tissue biopsy material; surgical material; other body fluids, secretions and / or excretions; and / or cells derived from or contained therein, or may consist of these. In some embodiments, the biological sample comprises or consists of cells obtained from an individual. In some embodiments, the cells obtained are cells derived from or contain cells from the individual from whom the sample was obtained. In some embodiments, the sample is a "primary sample" obtained directly from the source of interest by any suitable means. For example, in some embodiments, the primary biological sample is obtained by a method selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluids (e.g., blood, lymph fluid, feces, etc.). In some embodiments, as will be apparent from the context, the term "sample" refers to a preparation obtained by processing a primary sample (e.g., by removing one or more components and / or by adding one or more agents). For example, passing through a filter using a semi-permeable membrane. Such a "processed sample" may contain, for example, nucleic acids or proteins obtained by subjecting the primary sample to techniques such as extraction from the sample, or amplification or reverse transcription of mRNA, isolation and / or purification of certain components.
[0067] Blocking oligonucleotide: An oligonucleotide that is complementary to another nucleic acid present in a reaction mixture and can hybridize to such a nucleic acid to prevent unwanted hybridization of such a nucleic acid. Such another nucleic acid can be a synthetic nucleic acid, such as a primer or an adapter. The unwanted hybridization to be prevented can occur when a primer or an adapter is incorporated into a library nucleic acid molecule. The blocking oligonucleotide need not be completely complementary to the nucleic acid protected from unwanted hybridization, but must form a hybrid that is stable enough to prevent the unwanted event from occurring. For that purpose, the blocking oligonucleotide can contain universal bases or m modified bases.
[0068] Comprising: As used herein, a composition or method described as "comprising" one or more named elements or steps is open-ended, meaning that while the named element or step is essential, other elements or steps may be added within the scope of the composition or method. It is understood that a composition or method described as "comprising" (or "including") one or more named elements or steps also describes a corresponding more limited composition or method "consisting essentially of" (or "consisting essentially of") the same named elements or steps, meaning that the composition or method includes the named essential element or step and may also include additional elements or steps that do not substantially affect the basic and novel characteristics (s) of the composition or method. Any composition or method described herein as "comprising" or "consisting essentially of" one or more named elements or steps also describes a corresponding more limited and closed-ended composition or method "consisting of" (or "consisting of") the named elements or steps, excluding other unnamed elements or steps. In any composition or method disclosed herein, a known or disclosed equivalent of any named essential element or step can be used in place of that element or step.
[0069] Designed: As used herein, the term "designed" refers to (i) an agent whose structure has been selected by human hand, or a selected agent, (ii) an agent produced by a process that requires human hand, and / or (iii) an agent that is different from natural substances and other known agents.
[0070] To determine: One of ordinary skill in the art reading this specification will understand that "to determine" can be accomplished by using any of a variety of techniques available to the skilled artisan, including, for example, the specific techniques expressly recited in this specification, or through the use of any of such techniques. In some embodiments, to determine includes manipulating a physical sample. In some embodiments, to determine includes examining and / or manipulating data or information, e.g., by using a computer or other processing device adapted to perform relevant analysis. In some embodiments, to determine includes receiving relevant information and / or materials from an information source. In some embodiments, to determine includes comparing one or more characteristics of a sample or entity to a comparable reference.
[0071] Identity: As used herein, the term "identity" refers to the overall relatedness between polymer molecules, such as between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules), and / or between polypeptide molecules. In some embodiments, polymer molecules are considered to be "substantially identical" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. For example, the percent identity of two nucleic acid or polypeptide sequences can be calculated by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced into one or both of the first and second sequences for optimal alignment. Non-identical sequences can be ignored for comparison). In certain embodiments, the length of the aligned sequences for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. Next, the nucleotides at the corresponding positions are compared. A molecule is identical at that position when the position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap required to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17) incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, the comparison of nucleic acid sequences performed using the ALIGN program uses the PAM120 weight residue table, a 12 gap length penalty, and a 4 gap penalty.Alternatively, the percent identity between two nucleotide sequences can be determined using the GAP program of the GCG software package with the NWSgapdna.CMP matrix.
[0072] Ligation site: As used herein, a "ligation site" is part of a nucleic acid molecule (other than blunt ends of a double-stranded molecule) that can facilitate ligation. "Compatible ligation sites" present on two molecules allow the two molecules to ligate preferentially to each other.
[0073] Sample: As used herein, the term "sample" refers to a substance that is or contains a composition of interest for qualitative and / or quantitative evaluation. In some embodiments, the sample is a biological sample (i.e., from something living (e.g., cells or organisms)). In some embodiments, the sample is derived from a geological, aquatic, astronomical, or agricultural source. In some embodiments, the source of interest includes or consists of an organism, such as an animal or human. In some embodiments, samples for forensic analysis are biological tissues, biological fluids, organic or inorganic substances, such as clothing, stains, plastics, water, or contain them. In some embodiments, agricultural samples include or consist of organic materials such as leaves, petals, bark, wood, seeds, plants, fruits.
[0074] Single-strand ligation: As used herein, "single-strand ligation" is a ligation procedure that starts with at least one single-stranded substrate and typically involves one or more double-stranded or partially double-stranded adapters.
[0075] Solid support: As used herein, the term "solid support" refers to any solid material that can interact with a capture moiety. The solid support can be a solution-phase support (e.g., glass beads, magnetic beads, or another similar particle) that can be suspended in a solution or a solid-phase support (e.g., a silicon wafer, a glass slide, etc.). Examples of solution-phase supports include superparamagnetic spherical polymer particles such as Dynabeads magnetic beads manufactured by Invitrogen, or magnetic glass particles as described in U.S. Patent Nos. 656568, 6274386, 7371830, 6870047, 6255477, 6746874, and 6258531.
[0076] Substantially: As used herein, the term "substantially" refers to a qualitative condition that exhibits an overall or nearly overall degree or extent of a feature or characteristic of interest. Those of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, complete and / or proceed to completion, or achieve or avoid absolute results. Therefore, the term "substantially" is used herein to capture the possibility of lack of completion inherent in many biological and chemical phenomena.
[0077] Synthetic: As used herein, the word "synthetic" means being in a form that does not exist in nature, having a structure produced by human hand and thus not existing in nature, or being associated with one or more other components that do not exist in nature or are not associated in nature, or not being associated with one or more other components that are associated in nature.
[0078] Universal primer: As used herein, "universal primer" and "universal priming site" refer to a primer and a priming site that do not naturally exist in the target sequence. Typically, the universal priming site is present in an adapter or a target-specific primer. The universal primer can bind to the universal priming site and direct primer extension therefrom.
[0079] Variant: As used herein, the term "variant" refers to an entity that exhibits significant structural identity with a reference entity, but whose structure differs from the reference entity in the presence or level of one or more chemical moieties. In many embodiments, a variant also differs functionally from its reference entity. Generally, whether a particular entity is appropriately considered a "variant" of a reference entity is based on the degree of its structural identity with the reference entity. As will be understood by those skilled in the art, any biological or chemical reference entity has certain characteristic structural elements. By definition, a variant is a distinct chemical entity that shares one or more of such characteristic structural elements. To give but a few examples, a small molecule may have a characteristic core structural element (e.g., a macrocycle core) and / or one or more characteristic pendant moieties such that a variant of the small molecule shares the core structural element and the characteristic pendant moieties, but differs in other pendant moieties and / or the type of bonds (single vs. double, E vs. Z, etc.) present within the core; a polypeptide may have characteristic sequence elements that are composed of a plurality of amino acids having specified positions relative to each other in linear or three-dimensional space and / or that contribute to a particular biological function; and a nucleic acid may have characteristic sequence elements that are composed of a plurality of nucleotide residues having specified positions relative to each other in linear or three-dimensional space. For example, a variant polypeptide may differ from a reference polypeptide as a result of one or more differences in the amino acid sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, etc.) covalently attached to the polypeptide backbone. In some embodiments, a variant polypeptide exhibits overall sequence identity with a reference polypeptide that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% or 99%. Alternatively, or in addition, in some embodiments, a variant polypeptide does not share at least one characteristic sequence element with the reference polypeptide. In some embodiments, the reference polypeptide has one or more biological activities. In some embodiments, a variant polypeptide shares one or more of the biological activities of the reference polypeptide.In some embodiments, the variant polypeptide lacks one or more of the biological activities of the reference polypeptide. In some embodiments, the variant polypeptide exhibits reduced levels of one or more biological activities as compared to the reference polypeptide. In many embodiments, a polypeptide of interest is considered a "variant" of the parent or reference polypeptide if it has an amino acid sequence that is identical to the parent amino acid sequence except for a small number of sequence changes at specific positions. Typically, less than 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, or 2% of the residues in the variant are substituted compared to the parent. In some embodiments, the variant has 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 substituted residue compared to the parent. In many cases, the variant has a very small number (e.g., less than 5, 4, 3, 2, or 1) of substituted functional residues (i.e., residues involved in a particular biological activity). Further, the variant typically has 5, 4, 3, 2, or 1 or fewer additions or deletions compared to the parent, and in many cases, has no additions or deletions. Further, any additions or deletions are typically less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and generally less than about 5, about 4, about 3, or about 2 residues. In some embodiments, the variant may also have one or more functional defects and / or may otherwise be considered a "variant". In some embodiments, the parent or reference polypeptide is one that is found in nature. As will be understood by those of skill in the art, particularly where the polypeptide of interest is an infectious agent polypeptide, multiple variants of a particular polypeptide of interest may commonly be found in nature.
[0080] II. Detailed Description of Certain Embodiments In many nucleic acid enrichment techniques, it may be useful to first provide a shotgun library of nucleic acids, whereby longer nucleic acid sequences derived from a sample are fragmented into smaller pieces compatible with short-read sequencing techniques (i.e., about 50 to 500 nucleotides). To prepare a shotgun library, high molecular weight nucleic acid strands (typically, cDNA or genomic DNA) are randomly fragmented, optionally modified by ligation of common end sequences (i.e., adapters), and size selected for downstream processes and analysis. For example, it may be useful to selectively capture a subset of the nucleic acids within the shotgun library.
[0081] Currently, there are two general categories of capture techniques: hybridization-based capture and amplification-based capture. Hybridization-based capture methods offer the advantage of enabling the recovery of the entire original shotgun library fragment, as opposed to only replicating and recovering a subset of the original library fragments. However, the on-target rate associated with hybridization-based capture is generally low compared to amplification-based methods. In particular, the lower on-target rate results in a waste of sequencing capacity as off-target capture products need to be sequenced. Additionally, the workflow associated with hybridization-based capture methods can be complex with a long turnaround time compared to amplification-based approaches. In contrast, amplification-based approaches such as the anchored multiplex PCR method offer the advantages of a simple workflow, a faster turnaround time, and a higher on-target rate compared to hybridization-based methods, but some drawbacks remain. For example, target-specific primer sequences incorporated into library fragments after amplification result in a waste of sequencing capacity. Further, since the template is necessarily cleaved at the target-specific primer binding site, the library fragments do not necessarily represent the original shotgun library. Thus, the need for a rapid and simple target enrichment method that also accommodates unknown structural variations of the target sequence is not met.
[0082] These and other problems can be overcome by a method for target enrichment by unidirectional dual probe primer extension according to the present disclosure. In one aspect, the present disclosure describes both a general approach for enrichment based on unidirectional dual probe primer extension and improvements thereof. For this purpose, the present disclosure provides a combination of primer extension and hybridization-based capture onto a solid support for enrichment of one or more target nucleic acids from a target nucleic acid library. The present disclosure further provides an overall workflow having many of the advantages of the above-described enrichment methods and hybridization capture methods based on immobilized multiplex amplification without many of the above-mentioned drawbacks. Advantages of the kits, compositions and methods of the present disclosure include recovery of library molecules obtained from the entire shotgun library, a simple workflow (e.g., fewer total steps and less hands-on time), rapid turnaround time, a higher on-target rate, and a lower overall material cost compared to many existing hybridization-based capture methods and immobilized multiplex amplification-based capture methods.
[0083] In one embodiment, the invention is a method for enriching at least one target nucleic acid in a nucleic acid library. The method can include hybridizing a first oligonucleotide to a target nucleic acid in the nucleic acid library. Each nucleic acid in the nucleic acid library can be provided with a first end comprising a first adapter and a second end comprising a second adapter. The method further includes extending the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide.
[0084] In one aspect, the method can further include capturing a first primer extension complex and enriching the first primer extension complex with respect to a nucleic acid library. The extension product of the first oligonucleotide can be captured via a capture moiety present on the first oligonucleotide. Alternatively, the method can utilize a capture oligonucleotide, e.g., an oligonucleotide complementary to at least a portion of the first oligonucleotide. The first oligonucleotide can include a universal sequence that is at least partially complementary to the capture oligonucleotide. The capture oligonucleotide can include a capture moiety and can be bound to a solid matrix via the capture moiety. In another aspect, the method can include hybridizing a second oligonucleotide to a target nucleic acid and extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex that includes the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex. The method can further include amplifying the target nucleic acid using a third polymerase, a first amplification primer, and a second amplification primer. The first amplification primer has a 3’ end complementary to the first adapter and the second amplification primer has a 3’ end complementary to the second adapter.
[0085] The first, second, and third polymerases can be any suitable polymerase. An example of a polymerase is Taq or a Taq-derived polymerase (e.g., KAPA 2G polymerase from KAPA BIOSYSTEMS). Another exemplary polymerase is a B-family DNA polymerase (e.g., KAPA HIFI polymerase from KAPA BIOSYSTEMS).
[0086] In another embodiment, the present disclosure provides a kit for enriching at least one target nucleic acid in a nucleic acid library. The kit can include a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library. Each nucleic acid in the nucleic acid library has a first end including a first adapter and a second end including a second adapter. The kit can further include a second oligonucleotide complementary to the target nucleic acid, a first amplification primer, and a second amplification primer. The first oligonucleotide can include a capture moiety. The first oligonucleotide may include a capture moiety. Alternatively, the kit may include a capture oligonucleotide complementary to at least a portion of the first oligonucleotide, and the first oligonucleotide includes a universal sequence at least partially complementary to the capture oligonucleotide. The capture oligonucleotide may include a capture moiety, may be bound to a solid matrix via the capture moiety, or may have a capture moiety supplied separately in the kit. The second oligonucleotide can hybridize to the target nucleic acid at a position 5' to the first oligonucleotide. The first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter.
[0087] In another embodiment, the present disclosure provides a kit for enriching at least one target nucleic acid in a nucleic acid library. The kit can include a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library. Each of the nucleic acids in the nucleic acid library can have a first end comprising a first adapter and a second end comprising a second adapter. The kit can further include a modified nucleotide having a capture moiety, a second oligonucleotide complementary to the target nucleic acid, a first amplification primer, and a second amplification primer. The second oligonucleotide hybridizes to the target nucleic acid at a position 5' to the first oligonucleotide, the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter. The kit can further include a capture oligonucleotide that is complementary to at least a portion of the first oligonucleotide and that is optionally bound to a solid support or supplied with the solid support.
[0088] In a further embodiment, the present disclosure provides a composition comprising a nucleic acid library comprising at least one target nucleic acid. Each nucleic acid in the nucleic acid library has a first end comprising a first adapter, a second end comprising a second adapter, and a region of interest intermediate the first adapter and the second adapter. The composition further comprises an extended first oligonucleotide hybridized to the region of interest of the target nucleic acid. The extended first oligonucleotide comprises at least one capture moiety. The composition further comprises a solid support bound to the at least one capture moiety, a second oligonucleotide hybridized to the target nucleic acid at a position 5' to the first extended oligonucleotide, and a polymerase associated with the 3' end of the second oligonucleotide. The composition may further comprise a capture oligonucleotide, for example, an oligonucleotide complementary to at least a portion of the first oligonucleotide. The first oligonucleotide may comprise a universal sequence at least partially complementary to the capture oligonucleotide. The capture oligonucleotide may comprise a capture moiety. The capture oligonucleotide may be bound to a solid matrix (e.g., beads) via the capture moiety.
[0089] The method of the present invention can be used as part of a sequencing protocol, including a high-throughput single molecule sequencing protocol. The method of the present invention generates a library of target nucleic acids to be sequenced. The target nucleic acids in the library may incorporate barcodes for molecule identification and sample identification.
[0090] The present invention includes at least one linear primer extension step using target-specific primers. The linear extension step has several advantages over the exponential amplification practiced in the art. Each target nucleic acid is characterized by a unique synthesis rate that depends on the annealing rate of the target-specific primer and the rate at which the polymerase can read a particular target sequence. The difference between the extension rate and the synthesis rate results in a bias that can result in a slight difference in a single round of synthesis. However, the slight difference is exponentially amplified during PCR. The resulting gap is called PCR bias. The bias can obscure any differences in the initial amounts of each sequence in the sample and make any quantitative analysis impossible.
[0091] The present invention limits the extension of target-specific primers (including gene-specific primers and degenerate primers that are accidentally specific to binding sites within the genome) to a single step. Any exponential amplification is performed using universal primers that are not subject to template-dependent bias or are subject to less bias than the target-specific primers.
[0092] Referring now to FIG. 1, a method 100 for target enrichment by unidirectional dual-probe primer extension includes a step 102 of preparing nucleic acid library fragments. In one aspect, the nucleic acid library fragments can be prepared from any nucleic acid source that contains one or more target nucleic acids. Generally, the target nucleic acids contain regions or sequences of interest, and method 100 allows for the preferential enrichment of one or more target nucleic acids compared to non-target nucleic acids in the nucleic acid library for downstream detection and analysis of these regions or sequences of interest.
[0093] Continuing to refer to step 102, the nucleic acid is optionally fragmented and adapters are ligated to each end of the nucleic acid. Exemplary methods for preparing a library of nucleic acid fragments for use with the present disclosure include transposon-mediated fragmentation and labeling, mechanical shearing, enzymatic digestion, overhang (e.g., T / A) or blunt-end ligation, template-switching-mediated adapter ligation, and the like and combinations thereof. Finally, the product of step 102 for preparing nucleic acid library fragments can result in a nucleic acid library, and each of the nucleic acids in the nucleic acid library has a first end containing a first adapter and a second end containing a second adapter. In particular, the first and second adapters may be the same or different and, without limitation, can further take various forms including fork-shaped or Y-shaped adapters having complementary and non-complementary portions, blunt-end adapters, overhang adapters, hairpin adapters, and the like, and combinations thereof. Generally, at least a portion of the aforementioned adapters is double-stranded. However, other adapter configurations can also be used for preparing a library of nucleic acid fragments according to the present disclosure. Further, in the case of hairpin adapters, it may be useful to include a blocking element (e.g., 3'dideoxynucleotide or phosphate group) to prevent self-priming events.
[0094] The next step 104 of method 100 can include hybridization of a first oligonucleotide primer to a target nucleic acid present in a nucleic acid library, thereby forming an unextended first primer - target complex. In one embodiment, the first oligonucleotide primer is a target - specific primer having a defined sequence complementary to the sequence of the target nucleic acid. An example of a target - specific primer is a gene - specific primer designed to hybridize to or near (e.g., upstream of, or 5' to) a gene of interest (e.g., cDNA, genomic DNA). The target nucleic acid can be RNA, DNA, or a combination thereof. The first oligonucleotide primer can be an oligonucleotide primer composed of ribonucleic acid, deoxyribonucleic acid, modified nucleic acid (e.g., biotinylated, locked nucleic acid, inosine, Seela base, etc.), or other nucleic acid analogs known in the art.
[0095] In various embodiments of the present disclosure, the first oligonucleotide primer can include one or more modified bases, capture moieties, or combinations thereof. If the first oligonucleotide primer includes a capture moiety, prior to step 104 of hybridizing the first oligonucleotide primer to the target nucleic acid, the first oligonucleotide primer can be attached to a solid support or released into solution (i.e., not bound to a solid support or attached in another way). In embodiments where the first oligonucleotide primer containing a capture moiety is not attached to the solid support via the capture moiety, step 104 can be performed in solution. In embodiments where the first oligonucleotide primer containing a capture moiety is attached to the solid support via the capture moiety, step 104 can be performed in situ. In particular, in the case of an in - situ reaction, the resulting unextended primer - target complex attaches to the solid support. Any non - target nucleic acid or target nucleic acid not annealed to the first oligonucleotide primer remaining in solution can be removed by separating the solution from the solid support to which the primer - target complex is bound.
[0096] The next step 106 of method 100 involves performing a first primer extension reaction. In one aspect, step 106 involves extending the hybridized first oligonucleotide primer with a first polymerase. Following the hybridization of the first oligonucleotide primer to the target nucleic acid template in step 104, the first oligonucleotide primer is extended by the first polymerase, thereby generating a first primer extension product or complex comprising the 3' region of the extended first oligonucleotide primer that includes at least a partial reverse complement of the target nucleic acid template. As described herein, the hybridization and extension reactions can optionally be performed simultaneously, but in other embodiments, the hybridization and extension reactions are performed separately (e.g., sequentially) and can be separated by a washing step that removes unannealed and uncaptured target nucleic acid from the reaction mixture. Further, step 104 can further include terminating the primer extension reaction to control the length of the extended first oligonucleotide primer. In particular, the length of the extended first oligonucleotide primer product can be actively controlled by techniques such as inactivating the polymerase added in step 104, or by enabling the reaction to be completed by, for example, consumption of the limiting reactant in step 102 of method 100, or passively controlled by controlling / selecting the size of the nucleic acid fragments in the nucleic acid library.
[0097] Method 100 further includes step 108 of capturing a first primer extension complex. The capture of the first primer extension complex can be achieved by various methods as disclosed herein and can be achieved either before, simultaneously with, or after either step 104 or step 106 of method 100. As described above, the first oligonucleotide can include a capture moiety that can be used to capture the first oligonucleotide primer on a solid support either before, during, or after step 104 or step 106 of method 100. In another example, the extension of the first oligonucleotide primer after hybridization to the target nucleic acid includes the incorporation of one or more modified nucleotides. The modified nucleotide can include a capture moiety or can be configured to allow for the attachment or otherwise incorporation of a capture moiety to an extended portion of the first primer extension complex by a downstream modification of the modified nucleotide. Thus, the first primer extension complex can be captured by a capture moiety associated with one or more modified nucleotides either during or after step 106. The choice of whether the target nucleic acid, annealed primer-target complex, or target-extended primer complex is captured further determines whether steps 104 and 106 of the method are performed in solution or in situ.
[0098] The next step 110 of method 100 can include concentrating the first primer extension complex. In one aspect, step 110 includes one or more purification and concentration steps for recovering the first primer extension complex from non-target nucleic acids and unused reaction components (e.g., nucleotides, primer molecules, ATP, etc.), enzymes, buffers, and other molecules in the library. In some embodiments, step 110 includes enzymatic digestion, size-exclusion based purification, affinity based purification, etc., or combinations thereof. In particular, the concentration of the first primer extension product can be measured relative to the entire nucleic acid library. In one aspect, concentration includes increasing the concentration of the target nucleic acid by depletion (i.e., removal) of other members of the nucleic acid library that are not the target nucleic acid.
[0099] The next step 112 of method 100 can include hybridization of a second oligonucleotide primer to a target nucleic acid present in the nucleic acid library. In one aspect, the second oligonucleotide primer is a target-specific primer that binds to a region of interest within the target nucleic acid (as opposed to hybridizing to or being complementary to one or both of the first adapter and the second adapter). In another aspect, the target nucleic acid is part of the first primer extension complex during step 112. For example, the second oligonucleotide primer can hybridize to the target nucleic acid at the 5' position (i.e., upstream) with respect to the extended first oligonucleotide primer in the first primer extension complex. The resulting unextended second primer-target complex includes the first extended oligonucleotide primer, the target nucleic acid hybridized to the first extended oligonucleotide primer, and the second (unextended) oligonucleotide primer. If the first primer extension product attaches to the solid support during step 112, the unextended second primer-target complex also attaches to the solid support in the same manner. In other embodiments, the first primer extension product is released from the solid support (e.g., after removal of non-target nucleic acids from the reaction mixture) and is in solution to allow hybridization of the second oligonucleotide primer in step 112 in solution.
[0100] The next step 114 of method 100 involves performing a second primer extension reaction. Following the hybridization of the second oligonucleotide primer to the target nucleic acid template in step 112, the second oligonucleotide primer is extended by a second polymerase, thereby generating a second primer extension product or complex containing the target nucleic acid. The extended second oligonucleotide primer includes a 3' region that includes at least a partial reverse complement of the target nucleic acid template. In one aspect, the extension of the second oligonucleotide primer by the second polymerase releases the extended first oligonucleotide primer from the complex with the target nucleic acid. Releasing the extended first oligonucleotide from the first primer extension complex can include one or more of strand displacement (e.g., by a polymerase) or digestion (e.g., by a nuclease). For example, release of the extended first oligonucleotide can be achieved using an enzyme having at least one of strand displacement activity, 5' to 3' exonuclease activity, and flap endonuclease activity.
[0101] As described herein, steps 112 and 114 are optionally performed simultaneously, but in other embodiments, steps 112 and 114 are performed separately (e.g., sequentially). Further, step 114 can further include terminating the primer extension reaction to control the length of the extended second oligonucleotide primer. In particular, the length of the extended second oligonucleotide primer product can be actively controlled by techniques such as inactivating the polymerase added in step 114, or passively controlled by allowing the reaction to complete, such as by consumption of limiting reactants, or by controlling / selecting the size of the nucleic acid fragments in the nucleic acid library.
[0102] If the extended first primer included one or more capture moieties attached to a solid support, the release of the extended first oligonucleotide in step 114 results in a second primer extension complex that is free in solution as opposed to being attached to the solid support. Thus, as described in step 110 of method 100, one or more purification techniques can be performed after step 114 to recover unbound second extension products or complexes containing the target nucleic acid from the first extended oligonucleotide primer attached to the support, the second polymerase, other reaction components, etc., and combinations thereof.
[0103] In some embodiments, the first primer and the extended primer have a capture sequence that is at least partially complementary to the capture oligonucleotide. This sequence can be referred to as a "universal capture sequence". The capture oligonucleotide contains a sequence that is at least partially complementary to the capture sequence in the first primer. The capture oligonucleotide can be referred to as a "universal capture oligonucleotide". The capture oligonucleotide is not extendable by a nucleic acid polymerase and cannot itself act as a primer. In some embodiments, the capture oligonucleotide includes a capture moiety. In other embodiments, the capture oligonucleotide is attached to a solid support. See FIGS. 8A, 8B, 8C, 8D, and 8E, and FIGS. 9A and 9B for a detailed description of these embodiments).
[0104] Method 100 further includes an amplification step 116. Step 116 may include linear or exponential amplification (e.g., PCR). Generally, step 116 includes amplifying a target nucleic acid using a third polymerase, a first amplification primer, and a second amplification primer. In one aspect, the first and second amplification primers are designed to be complementary to the sequences of the adapters incorporated into the target nucleic acid in the nucleic acid library in step 102. For example, the first amplification primer can have a 3' end complementary to the first adapter, and the second amplification primer can have a 3' end complementary to the second adapter. However, the primers for amplification can include any sequence present within the target nucleic acid to be amplified (e.g., gene / target-specific primers, universal primers, etc.) and can support the synthesis of one or both strands (i.e., both the upper and lower strands of the double-stranded nucleic acid corresponding to the template of the amplification reaction).
[0105] In some embodiments, step 116 enables selective amplification of the target nucleic acid from the nucleic acid library, as opposed to amplification of either the first or second extended oligonucleotide primer derived from the target nucleic acid. In one example, uracil-compatible polymerase and dUTP are included in one or both of the extension reactions performed in steps 106 and 114. The extended oligonucleotide primer resulting from the reaction contains at least one uracil nucleotide, but the target nucleic acid template can be a DNA template that does not have uracil nucleotides. Subsequently, a uracil-incompatible polymerase is included in step 116 for amplification of the target nucleic acid. The uracil-incompatible polymerase can amplify the target nucleic acid that does not have uracil nucleotides. However, the uracil-incompatible polymerase cannot replicate the uracil-containing extended oligonucleotide primer. Alternatively or additionally, the uracil-containing products can be selectively digested or otherwise degraded, such that only the original molecules from the nucleic acid library remain.
[0106] After step 116 of amplification, method 100 can include step 118 of analyzing the amplified target nucleic acid. Step 116 can include any method for determining the nucleic acid sequence of one or more products of method 100. Step 116 can further include sequence alignment, identification of sequence variations, counting of unique primer extension products, etc., or combinations thereof.
[0107] In addition to the elements of the present disclosure outlined in method 100, it may be useful to consider some additional considerations when practicing the kits, compositions, and methods described herein. In one aspect, the primer hybridization step is mediated by the target-specific region of the primer. In some embodiments, the target-specific region can hybridize to a region of a gene located in an exon, intron, or untranslated portion of the gene, or a non-transcribed portion of the gene (e.g., a promoter or enhancer). In some embodiments, the gene is a protein-coding gene, while in other embodiments, the gene is not a protein-coding gene, such as an RNA-coding gene or a pseudogene. In still other embodiments, the target-specific region is located in an intergenic region. For mRNA or cDNA targets, the primer may contain an oligo dT sequence.
[0108] Instead of a pre-designed target-specific region, the primer can contain a degenerate sequence (i.e., a series of randomly incorporated nucleotides). Such a primer can also find a binding site within the genome and act as a target-specific primer for that binding site. In particular, a fully degenerate primer where each nucleotide position is degenerate may not be useful for targeted enrichment. However, a partially degenerate primer where only some of the nucleotide positions are degenerate may be useful for use according to the present disclosure. For example, a primer with partial degeneracy at a single nucleotide position may be useful for capturing target sequences containing one or more single nucleotide polymorphisms (SNPs).
[0109] In addition to the target-specific region, the primer may include additional sequences. In some embodiments, these sequences are located at the 5' end of the target-specific region. In other embodiments, as long as the target-specific region can hybridize to the target and drive the primer extension reaction as described below, these sequences may be included at other locations within the primer. The additional sequences within the primer may include one or more barcode sequences, such as a unique molecular identifier sequence (UID) or a multiplex sample identifier sequence (MID). The barcode sequence may exist as a single sequence or as two or more sequences.
[0110] In some embodiments, the additional sequences include sequences that facilitate ligation to the 5' end of the primer. The primer may contain a universal ligation sequence that enables ligation of an adapter, as described in the following section.
[0111] In some embodiments, the additional sequences include one or more binding sites for one or more universal amplification primers.
[0112] In some embodiments, the primer includes a universal capture sequence that enables capture of the primer and primer extension products by hybridization to a capture oligonucleotide (see FIGS. 8A, 8B, 8C, 8D, and 8E, and FIGS. 9A and 9B).
[0113] The primer extension step is performed by a nucleic acid polymerase. Depending on the type of nucleic acid being analyzed, the polymerase can be a DNA-dependent DNA polymerase ("DNA polymerase") or an RNA-dependent DNA polymerase ("reverse transcriptase").
[0114] In some embodiments, it is desirable to control the length of the nucleic acid strand synthesized in the primer extension reaction. As described below, the length of this strand determines the length of the nucleic acid to be used in subsequent steps of the method and any downstream applications. The extension reaction can be terminated by any method known in the art. For example, the reaction may be physically stopped by a temperature shift or the addition of a polymerase inhibitor. In some embodiments, the reaction is stopped by placing the reaction on ice. In other embodiments, the reaction is stopped by raising the temperature to inactivate a thermally unstable polymerase. In yet other embodiments, the reaction is stopped by the addition of a chelating agent such as EDTA that can sequester an important cofactor of the enzyme, or another chemical or biological compound that can reversibly or irreversibly inactivate the enzyme.
[0115] Another way to control the length of the primer extension product is to limit key components (e.g., dNTPs) to limit the length of the extension or Mg 2+ by directly limiting and slowing the rate of extension and depleting the extension reaction by improving the ability to control the extension stop point. One of ordinary skill in the art can experimentally or theoretically determine the appropriate amount of key components that allow limited primer extension to predominantly yield products of the desired length.
[0116] Another way to control the length of primer extension products is the addition of terminator nucleotides that include reversible terminator nucleotides. One of ordinary skill in the art can determine experimentally or theoretically the appropriate ratio of terminator nucleotides to non-terminator nucleotides that allows for a field in which limited primer extension predominantly yields products of the desired length. Examples of terminator nucleotides include dideoxynucleotides, 2'-phosphate nucleotides (described in U.S. Patent No. 8,163,487 to Gelfand et al.), 3'-O-blocked reversible terminators, and 3'-unblocked reversible terminators (e.g., U.S. Application Publication 2014 / 0242579 to Zhuo et al., and Guo, J. et al., Four-color DNA sequencing with 3'-O-modified nucleotide reversible terminators and chemically cleavable fluorescent dideoxynucleotides, P.N.A.S. 2008 105(27)9145-9150). Yet another way to control the length of primer extension products is to add a limited amount of uracil (dUTP) to the primer extension reaction. The uracil-containing DNA can then be treated with uracil-N-DNA glycosylase to generate abasic sites. DNA having abasic sites can be degraded by heat treatment with the optional addition of alkali to improve the degradation efficiency, as described in U.S. Patent No. 8,669,061 to Gupta et al. One of ordinary skill in the art can determine experimentally or theoretically the appropriate ratio of dUTP to dTTP in the extension reaction that allows for limited inclusion of dUTP to predominantly yield products of the desired length upon endonuclease treatment.
[0117] In some embodiments, the length of the extension product is essentially limited by the length of the input nucleic acid. For example, cell-free DNA present in maternal plasma is less than 200 bp in length, and most is 166 bp in length. Yu, S.C.Y., et al., Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing, PNAS USA 2014;111(23):8583-8. The median length of cell-free DNA found in the plasma of healthy and cancer patients is about 185-200 bp. Giacona, M.B., et al., Cell-free DNA in human blood plasma: length measurements in patients with pancreatic cancer and healthy controls, Pancreas 1998;17(1):89-97. Samples with inadequate preservation or chemically treated samples may contain chemically or physically degraded nucleic acids. For example, formalin-fixed paraffin-embedded tissue (FFPET) typically yields nucleic acids with an average length of 150 bp.
[0118] In some embodiments, the method of the invention includes one or more purification steps after primer extension by DNA polymerase or reverse transcriptase. Purification removes unused primer molecules and template molecules used to create primer extension products. In some embodiments, all nucleic acid fragments other than the template nucleic acid and the extended primer are removed by exonuclease digestion. In such embodiments, the primer used for primer extension may have a 5' end modification that renders the primer and any extension products resistant to exonuclease digestion. Examples of such modifications include phosphorothioate linkages. In other embodiments, the RNA template can be removed by enzyme treatments that conserve DNA, such as RNase digestion including RNaseH digestion. In still other embodiments, the primer and large template DNA are separated from the extension products by size exclusion methods, such as gel electrophoresis, chromatography, or isotachophoresis or epitachophoresis.
[0119] In some embodiments, the purification is by affinity binding. In variations of this embodiment, the affinity is for a specific target sequence (sequence capture). In other embodiments, the primer includes an affinity tag. Any affinity tag known in the art can be used, such as biotin, or an antigen for which an antibody or specific antibody exists. The affinity partner for the affinity tag may be present in solution, such as on a solution-phase solid support such as suspended particles or beads, or may be bound to a solid support. During the affinity purification process, unbound components of the reaction mixture are washed away. In some embodiments, additional steps are performed to remove unused primers. In some embodiments, the affinity capture changes the charge of the primer extension product. For example, the inclusion and binding of one or more biotinylated nucleotides or streptavidin generates a changed charge on the nascent nucleic acid strand. The changed charge can be utilized for the separation of the nascent strand (primer extension product) by isotachophoresis or epitope electrophoresis.
[0120] In particular, the methods of the present disclosure do not require a ligation step (e.g., to add a sequence common to an extended first or second oligonucleotide primer). However, in some embodiments, the invention includes a ligation step. For example, it is possible to add a homopolymer tail to the 3' end of a nucleic acid. In this embodiment, the homopolymer can function as a binding site for a reverse complementary homopolymer (similar to the poly T primer and poly A tail of mRNA). Ligation adds one or more adapter sequences to the primer extension product generated in the previous step. The adapter sequences provide one or more universal priming sites (for amplification or sequencing) and optionally one or more barcodes. The exact manner of ligating the adapter is not critical as long as the adapter associates with the primer extension product and enables the subsequent steps described below.
[0121] In some of the above embodiments, the method includes a universal priming sequence ("priming site") and a target-specific primer that results in a primer extension product having a single priming site. In such embodiments, only one additional priming sequence ("priming site") needs to be provided to enable exponential amplification. In other embodiments, the target-specific primer does not include a universal priming site. In such embodiments, two priming sites need to be provided to enable exponential amplification. An adapter having a universal priming site can be added by any single-strand ligation method available in the art.
[0122] One example of a single-strand ligation method can be used in embodiments where the extension primer contains a universal ligation site. In such embodiments, an adapter having a double-stranded region complementary to the universal ligation site in the primer and a single-stranded overhang may be annealed and ligated. Annealing of the single-stranded 3'-overhang of the adapter to the universal ligation site at the 5'-end of the primer creates a double-stranded region having a nick in the strand containing the primer extension product. The two strands can be ligated at the nick by a DNA ligase or another enzyme, or a non-enzyme reagent, that can catalyze the reaction between the 5'-phosphate of the primer extension product and the 3'-OH of the adapter. By connecting the adapter, ligation provides a universal priming site at one end of the primer extension product.
[0123] Another example of a single-strand ligation method can be used to add a universal priming site to the opposite end of the primer extension product (or to both ends of the extension product in embodiments where the extension primer does not contain a universal ligation site). In this embodiment, one or both ends of the primer extension product to be ligated do not have a universal ligation site. Further, in some embodiments, at least one end of the primer extension product to be ligated has an unknown sequence (e.g., due to a random termination event or an unknown sequence variation). In such embodiments, a sequence-independent single-strand ligation method is used. An exemplary method is described in U.S. Patent Application Publication No. 20140193860. Essentially, this method uses a population of adapters having a single-stranded 3'-end overhang with a random sequence, such as a random hexamer sequence, instead of a universal ligation site. In some embodiments of that method, the adapter also has a hairpin structure. Another example is the method enabled by the ACCEL-NGS 1S DNA Library Kit (Swift Biosciences, Ann Arbor, Michigan).
[0124] The ligation step of this method utilizes a ligase or another enzyme or non-enzyme reagent having similar activity. The ligase can be a DNA or RNA ligase, such as a viral or bacterial origin like T4 or E. coli ligase, or a thermostable ligase such as Afu, Taq, Tfl, or Tth. In some embodiments, alternative enzymes, such as topoisomerase, can be used. Additionally, non-enzyme reagents can be used to form a phosphodiester bond between the 5'-phosphate of the primer extension product and the 3'-OH of the adapter, as described and referenced in U.S. Patent Application Publication No. 2014 / 0193860 to Bevilacqua et al.
[0125] In some embodiments of this method, optional primer extension follows the first ligation of the adapter. The ligated adapter has a free 3' end that can be extended to create a double-stranded nucleic acid. Then, the opposite end of the adapter becomes suitable for blunt-end ligation of another adapter. This double-stranded end of the molecule can be ligated to a double-stranded adapter by any ligase or other enzymatic or non-enzymatic means, avoiding the need for a single-stranded ligation procedure. The double-stranded adapter sequence provides one or more universal priming sites (for amplification or sequencing) and optionally one or more barcodes.
[0126] In some embodiments, the method of the present invention includes one or more purification steps after the ligation step. Purification removes unused adapter molecules. The adapter and large ligation products are separated from the extension products by size exclusion methods, such as gel electrophoresis, chromatography, or isotachophoresis.
[0127] In some embodiments, purification is by affinity binding. In variations of this embodiment, the affinity is for a specific target sequence (sequence capture). In other embodiments, the adapter includes an affinity tag. Any affinity tag known in the art (e.g., biotin, or an antigen for which an antibody or specific antibody exists) can be used. The affinity partner for the affinity tag may be associated with a solution-phase support (e.g., on suspended particles or beads), or bound to a solid-phase support. During the process of affinity purification, unbound components of the reaction mixture are washed away. In some embodiments, additional steps are performed to remove unused adapters.
[0128] In some embodiments, the invention includes an amplification step. This step can include linear or exponential amplification (e.g., PCR). Primers for amplification can include any sequence that is present within the nucleic acid to be amplified and that can assist in the synthesis of one or both strands. Amplification may be isothermal or may include thermal cycling.
[0129] In some embodiments, the amplification is exponential and involves PCR. It is desirable to reduce PCR amplification bias. When using one or more gene-specific primers, to reduce bias, this method includes a limited number of amplification cycles (e.g., 10 cycles or less). In other variations of these embodiments, universal primers are used to synthesize both strands. The universal primer sequence can be part of the original extension primer of one or both ligated adapters. One or two universal primers can be used. The above-mentioned extension primer and one or both adapters can be engineered to have the same primer binding site. In that embodiment, a single universal primer can be used to synthesize both strands. In other embodiments, the extension primer (or adapter) on one side of the molecule to be amplified and the adapter on the other side contain different universal primer binding sites. The universal primer may pair with another universal primer (of the same or different sequence). In other embodiments, the universal primer may pair with a gene-specific primer. Since PCR with universal primers reduces sequence bias, the number of amplification cycles need not be limited to the same extent as PCR with gene-specific primers. The number of amplification cycles in which universal primers are used may be low, but may be as high as about 20, 30 or more cycles.
[0130] The present invention involves the use of molecular barcodes. The barcodes typically consist of 4 to 36 nucleotides. In some embodiments, the barcodes are designed to have melting temperatures within 10°C of each other. The barcodes can be designed to form a minimal cross-hybridization set, i.e., a combination of sequences that form as few stable hybrids with each other as possible under the desired reaction conditions. The design, placement, and use of barcodes for sequence identification and counting are known in the art. See, for example, U.S. Patent Application Publication Nos. 7,393,665; 8,168,385; 8,481,292; 8,685,678; and 8,722,368.
[0131] Barcodes can be used to identify each nucleic acid molecule in a sample and its progeny (i.e., the set of nucleic acid molecules produced using the original nucleic acid molecule). Such barcodes are "unique identifiers" (UIDs).
[0132] Barcodes can also be used to identify the sample from which the nucleic acid molecules being analyzed are derived. Such barcodes are "multiplex sample identifiers" ("MIDs"). All molecules derived from the same sample share the same MID.
[0133] A barcode contains a unique sequence of nucleotides characteristic of each barcode. In some embodiments, the barcode sequences are pre-designed. In other embodiments, the barcode sequences are random. All or some of the nucleotides within a barcode can be random. Random sequences and random nucleotide bases within a known sequence are referred to as "degenerate sequences" and "degenerate bases," respectively. In some embodiments, a molecule contains two or more barcodes: one for molecule identification (UID) and one for sample identification (MID). Occasionally, the UID or MID each contains several barcodes that together enable the identification of the molecule or sample.
[0134] In some embodiments, the number of UIDs in the reaction can exceed the number of molecules to be labeled. In some embodiments, one or more barcodes are used to group or bin sequences. For example, in some embodiments, one or more UIDs are used to group or bin sequences, and the sequences within each bin contain the same UID, i.e., amplicons derived from a single target molecule. In some embodiments, UIDs are used to align sequences. In other embodiments, target-specific regions are used to align sequences. In some embodiments of the present invention, the UID is introduced in the first primer extension event while the sample barcode (MID) is introduced into the ligated adapter.
[0135] After performing ligation, the nucleic acid product can be sequenced. Sequencing can be performed by any method known in the art. High-throughput single molecule sequencing is particularly advantageous. Examples of such technologies include the 454 LIFE SCIENCES GS FLX platform (454 LIFE SCIENCES), the ILLUMINA HISEQ platform (ILLUMINA), the ION TORRENT platform (LIFE TECHNOLOGIES), the PACIFIC BIOSCIENCES platform (PACIFIC BIOSCIENCES) utilizing SMRT sequencing technology, and any other currently existing or future single molecule sequencing technology with or without sequencing by synthesis. In variations of these embodiments, sequencing utilizes universal primer sites present in one or both adapter sequences or one or both primer sequences. In yet other variations of these embodiments, gene-specific primers are used for sequencing. However, it should be noted that universal primers are associated with a reduction in sequencing bias compared to gene-specific primers.
[0136] In some embodiments, the sequencing step includes sequence alignment. In some embodiments, the alignment is used to derive a consensus sequence from a plurality of sequences, e.g., a plurality having the same unique molecular identifier (UID). In some embodiments, the alignment is used to identify sequence variations such as single nucleotide variations (SNVs). In some embodiments, the consensus sequence is derived from a plurality of sequences all having the same UID. In other embodiments, the UID is used to exclude artifacts, i.e., variations present in the progeny of a single molecule (characterized by a particular UID). Such artifacts resulting from PCR errors or sequencing errors can be excluded using the UID.
[0137] In some embodiments, the number of each sequence in the sample can be quantified by quantifying the relative number of sequences having each UID within a population having the same multiplex sample ID (MID). Since each UID represents a single molecule in the original sample, by counting the different UIDs associated with each sequence variant, the fraction of each sequence variant in the original sample can be determined where all molecules share the same MID. One of ordinary skill in the art can determine the number of sequence reads necessary to determine a consensus sequence. In some embodiments, a reasonable number is the number of reads per UID (the "sequence depth") necessary for accurate quantification results. In some embodiments, the desired depth is 5 to 50 reads per UID.
[0138] Samples used in the methods of the invention include any individual (e.g., human, patient) or environmental sample containing nucleic acids. Polynucleotides can be extracted from the sample or the sample can be directly subjected to the methods of the invention. The starting sample can also be an extracted or isolated nucleic acid, DNA or RNA. The sample can comprise any tissue or fluid obtained from an organism. For example, the sample can be a tumor biopsy or a blood or plasma sample. In some embodiments, the sample is a formalin-fixed paraffin-embedded (FFPE) sample. The sample can contain nucleic acids from one or more sources, e.g., one or more patients. In some embodiments, the tissue can be infected with a pathogen and thus can contain nucleic acids of the host and the pathogen.
[0139] Methods for DNA extraction are well known in the art. See, e.g., J. Sambrook et al., “Molecular Cloning: A Laboratory Manual,” 1989, 2nd Ed., Cold Spring Harbor Laboratory Press: New York, N.Y.). A variety of kits are commercially available for extracting nucleic acids (DNA or RNA) from biological samples (e.g., BD BIOSCIENCES CLONTECH (Palo Alto, Cal.), EPICENTRE TECHNOLOGIES (Madison, Wisc.); GENTRA SYSTEMS, INC. (Minneapolis, Minn.); and QIAGEN, INC. (Valencia, Cal.), AMBION, INC. (Austin, Tex.); BIORAD LABORATORIES (Hercules, Cal.); etc.
[0140] In some embodiments, the starting sample used in the methods of the invention is a library, such as a genomic library or an expression library containing a plurality of polynucleotides. In other embodiments, the library is created by the methods of the invention. Where the starting material is a biological sample, the method creates an amplified library, or a collection of amplicons that represent diversity or sequence. The library can be stored and used multiple times for further amplification or sequencing of the nucleic acids in the library.
[0141] According to one embodiment of the present disclosure, a method for primer extension target enrichment can include primer-mediated capture in a solution of target nucleic acid. Referring now to FIGS. 2A, 2B, 2C, 2D, and 2E, a nucleic acid library includes a target nucleic acid 200 that includes a region of interest (ROI) 202 (FIG. 2A). The target nucleic acid 200 further includes a first end that includes a first adapter 204 and a second end that includes a second adapter 206. In FIGS. 2A, 2B, 2C, 2D, and 2E, the target nucleic acid 200 is shown as a single-stranded nucleic acid, the first adapter 204 is located at the 3′ end (i.e., the first end) of the target nucleic acid 200, and the second adapter 206 is located at the 5′ end (i.e., the second end) of the target nucleic acid 200. A first oligonucleotide 208 hybridizes to the target nucleic acid 200 in the nucleic acid library. The first oligonucleotide 208 includes a 3′ target-specific region 210 that is complementary to the target nucleic acid and a capture moiety 212. In the illustrated embodiment, the target-specific region 210 is complementary to the ROI 202.
[0142] As shown in FIG. 2B, the hybridized first oligonucleotide 208 is extended by a first polymerase (not shown), thereby producing a first primer extension complex 214 that includes the target nucleic acid 200 and the extended first oligonucleotide 216 (the dashed line indicates the extended portion of the extended first oligonucleotide 216). The first primer extension complex 214 is captured on the solid support 218. The solid support can be a solution-phase support (e.g., beads or other similar particles) or a solid-phase support (e.g., a silicon wafer, a glass slide, etc.). For example, magnetic glass particles and devices using the same as described in U.S. Patent Nos. 656568, 6274386, 7371830, 6870047, 6255477, 6746874, and 6258531 can be used. In the embodiment shown in FIG. 2B, the first primer extension complex 214 is captured on the solid support via the capture moiety 212. After capture, the first primer extension complex 214 is concentrated with respect to the nucleic acid library.
[0143] Referring to FIG. 2C, the second oligonucleotide 220 hybridizes to the target nucleic acid 200. The second oligonucleotide 220 is complementary to the target nucleic acid 200 and hybridizes to the target nucleic acid 200 at the 5' position relative to the target-specific region 210 of the first oligonucleotide 208. In the illustrated embodiment, the second oligonucleotide 220 is complementary to and hybridizes to the target nucleic acid 200 at a position just outside the ROI 202. However, it will be understood that the first oligonucleotide 208 and the second oligonucleotide 220 can be designed to hybridize to a second oligonucleotide 220 that hybridizes to the target nucleic acid 200 at the 5' position relative to the target-specific region 210 of the first oligonucleotide 208 at any defined position along the length of the target nucleic acid 200. From FIG. 2C, it can be seen that both the first extended oligonucleotide 216 (attached to the solid support 218) and the second oligonucleotide 220 are hybridized to the target nucleic acid 200.
[0144] Referring to FIG. 2D, the hybridized second oligonucleotide 220 is extended with a second polymerase (not shown), thereby producing a second primer extension complex 222 that includes the target nucleic acid 200 and the extended second oligonucleotide 224 (the dashed line indicates the extended portion of the extended second oligonucleotide 224). In one embodiment, the extension of the hybridized second oligonucleotide 220 releases the extended first oligonucleotide 216 from the first primer extension complex 214. In another embodiment, the extended first oligonucleotide 216 (including the first oligonucleotide primer 208) remains attached to the solid support 218.
[0145] As shown in FIG. 2E, the target nucleic acid 200 is amplified with a third polymerase (not shown), a first amplification primer 226, and a second amplification primer 228. The first amplification primer 226 includes a 3′ end complementary to the first adapter 204, and the second amplification primer 228 includes a 3′ end complementary to the same sequence as the second adapter 206.
[0146] According to another embodiment of the present disclosure, a method for primer extension target enrichment can include in situ primer-mediated capture of a target nucleic acid. Referring to FIGS. 3A and 3B, a nucleic acid library includes a target nucleic acid 300 that includes a region of interest (ROI) 302 (FIG. 3A). The target nucleic acid 300 further includes a first end that includes a first adapter 304 and a second end that includes a second adapter 306. In FIGS. 3A and 3B, the target nucleic acid 300 is shown as a single-stranded nucleic acid, the first adapter 304 is located at the 3′ end (i.e., the first end) of the target nucleic acid 300, and the second adapter 306 is located at the 5′ end (i.e., the second end) of the target nucleic acid 300. A first oligonucleotide 308 hybridizes to the target nucleic acid 300 in the nucleic acid library. The first oligonucleotide 308 includes a 3′ target-specific region 310 that is complementary to the target nucleic acid 300 and a capture moiety 312. In the illustrated embodiment, the target-specific region 310 is complementary to the ROI 302.
[0147] Compared with the embodiments shown in FIGS. 2A, 2B, 2C, 2D and 2E, the first oligonucleotide 308 is captured on the solid support 318 before or simultaneously with the hybridization of the first oligonucleotide 308 to the target nucleic acid 300. The solid support 318 can be a solution-phase support (e.g., beads or another similar particle) or a solid-phase support (e.g., a silicon wafer, a glass slide, etc.). In the embodiment shown in FIG. 3A, the first oligonucleotide 308 is captured on the solid support 318 via the capture moiety 312. Referring to FIG. 2B, the hybridized first oligonucleotide 308 is extended with a first polymerase (not shown), thereby producing a first primer extension complex 314 comprising the target nucleic acid 300 and the extended first oligonucleotide 316 (the dashed line indicates the extended portion of the extended first oligonucleotide 316). In particular, the first primer extension complex 314 is captured on the solid support 318, enabling the enrichment of the target nucleic acid 300 relative to the nucleic acid library. Thereafter, after performing the second primer hybridization and extension reactions as shown in FIGS. 2C and 2D, an amplification step can be performed as shown in FIG. 2E.
[0148] According to yet another embodiment of the present disclosure, a method for primer extension target enrichment can include extension-mediated capture of a target nucleic acid. Referring to FIGS. 4A, 4B, 4C, and 4D, a nucleic acid library includes a target nucleic acid 400 that includes a region of interest (ROI) 402 (FIG. 4A). The target nucleic acid 400 further includes a first end that includes a first adapter 404 and a second end that includes a second adapter 406. In FIGS. 4A, 4B, 4C, and 4D, the target nucleic acid 400 is shown as a single-stranded nucleic acid, the first adapter 404 is located at the 3' end (i.e., the first end) of the target nucleic acid 400, and the second adapter 406 is located at the 5' end (i.e., the second end) of the target nucleic acid 400. A first oligonucleotide 408 hybridizes to the target nucleic acid 400 in the nucleic acid library. The first oligonucleotide 408 is complementary to the target nucleic acid 400. Note that the first oligonucleotide 408 may not include a capture portion as compared to the first oligonucleotide 208 that includes the capture portion 212 of FIG. 2A. In the embodiment shown in FIG. 4A, the first oligonucleotide 408 is complementary to a portion of the ROI 402.
[0149] As shown in FIG. 4B, the hybridized first oligonucleotide 408 is extended by a first polymerase (not shown), thereby producing a first primer extension complex 414 that includes the target nucleic acid 400 and the extended first oligonucleotide 416 (the dashed line indicates the extended portion of the extended first oligonucleotide 416). According to the embodiments shown in FIGS. 4A, 4B, 4C, and 4D, the extension of the first oligonucleotide 408 is performed in the presence of one or more modified nucleic acids 412. Each modified nucleic acid can include a capture moiety 412a or can be modified to add a capture moiety 412a either simultaneously with or after the extension of the first oligonucleotide 416. Incorporation of one or more modified nucleic acids 412 that include a capture moiety 412a enables extension-mediated capture of the target nucleic acid 400 on the solid support 418. The solid support 418 can be a solution-phase support (e.g., beads or another similar particle) or a solid-phase support (e.g., a silicon wafer, a glass slide, etc.). In the embodiment shown in FIG. 4B, the first primer extension complex 414 is captured on the solid support 418 via a modified nucleic acid 412 that includes a capture moiety 412a. After capture, the first primer extension complex 414 is concentrated relative to the nucleic acid library.
[0150] Referring to FIG. 4C, a second oligonucleotide 420 hybridizes to the target nucleic acid 400. The second oligonucleotide 420 is complementary to the target nucleic acid 400 and hybridizes to the target nucleic acid 400 at a 5′ position relative to the first oligonucleotide 408. In the illustrated embodiment, the second oligonucleotide 420 is complementary to and hybridizes to the target nucleic acid 400 at a position immediately inside the ROI 402. However, it will be understood that the first oligonucleotide 408 and the second oligonucleotide 420 can be designed to hybridize to a second oligonucleotide 420 that hybridizes to the target nucleic acid 400 at a 5′ position relative to the target-specific region 410 of the first oligonucleotide 408 at any defined position along the length of the target nucleic acid 400.
[0151] Continuing to refer to FIG. 4C, the hybridized second oligonucleotide 420 is extended with a second polymerase (not shown), thereby producing a second primer extension complex 422 that includes the target nucleic acid 400 and the extended second oligonucleotide 424 (the dashed line indicates the extended portion of the extended second oligonucleotide 224). Prior to the extension of the second oligonucleotide 420 by the second polymerase, the first extended oligonucleotide 416 (attached to the solid support 418) and the second oligonucleotide 420 each hybridize to the target nucleic acid 400. The extension of the hybridized second oligonucleotide 420 releases the extended first oligonucleotide 416 from the first primer extension complex 414. In another embodiment, the extended first oligonucleotide 416 (including the first oligonucleotide primer 408 and the modified nucleic acid 412) remains attached to the solid support 418.
[0152] As shown in FIG. 4D, the target nucleic acid 400 is amplified with a third polymerase (not shown), a first amplification primer 426, and a second amplification primer 428. The first amplification primer 426 includes a 3' end complementary to the first adapter 404, and the second amplification primer 428 includes a 3' end complementary to the same sequence as the second adapter 406.
[0153] In one aspect, the target nucleic acid and non-target nucleic acids in the nucleic acid library can exhibit intermolecular interactions that result in a daisy chain structure. As shown in FIG. 5, the target nucleic acid 200 (see also FIG. 2A) includes an ROI, a first adapter 204, and a second adapter 206. A first oligonucleotide 208 hybridizes to the target nucleic acid 200. The first oligonucleotide 208 includes a 3' target-specific region 210 and a capture moiety 212. The nucleic acid library can further include one or more non-target nucleic acids, including a first non-target nucleic acid 500 and a second non-target nucleic acid 500'. Similar to the target nucleic acid 200, the first non-target nucleic acid 500 and the second non-target nucleic acid 500' each include a first end that includes a first adapter 504 and 504', respectively, and a second end that includes a second adapter 506 and 506', respectively. In one aspect, the first adapter 204 is at least partially complementary to the first adapter 504, and the second adapter 506 is at least partially complementary to the second adapter 506'. Thereby, the target nucleic acid 200 can daisy chain connect to the non-target nucleic acid 500 and the non-target nucleic acid 500' as shown in FIG. 5.
[0154] According to yet another embodiment of the present disclosure, a method for primer extension target enrichment can include primer-mediated capture of the target nucleic acid in solution by a hybridization-driven capture mechanism. In contrast to the methods shown in FIGS. 2A, 2B, 2C, 2D, and 2E, the capture moiety in the first oligonucleotide is replaced with a universal capture sequence. Capture is achieved by contacting the sample with a universal capture oligonucleotide that can hybridize to the capture sequence in the first oligonucleotide. The capture oligonucleotide can be referred to as a "universal capture oligonucleotide".
[0155] The capture oligonucleotide cannot be extended by a nucleic acid polymerase and cannot itself function as a primer. In some embodiments, the capture oligonucleotide comprises a capture moiety (FIGS. 8A, 8B, 8C, 8D, 8E). In some embodiments, the capture moiety renders the capture oligonucleotide non-extendable. For example, the capture moiety can be biotin conjugated to the 3' end of the capture oligonucleotide. By having a universal capture oligonucleotide that includes a universal biotinylated capture oligonucleotide, a substantial cost reduction is possible as compared to generating a panel of multiple biotinylated target-specific primers (“first primers”) for each application. By reducing the cost of the target-specific oligonucleotides (“first primers”), it is further possible to increase their concentration and improve the recovery of the target nucleic acid. In some embodiments, the concentration of the first primer having a universal capture sequence (e.g., FIGS. 8A, 8B, 8C, 8D, and 8E) can be increased 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold or more as compared to the first primer having a capture moiety (e.g., biotin, e.g., FIGS. 2A, 2B, 2C, 2D, and 2E). The excess first primer can be removed, for example, by exonuclease digestion, prior to capture with the capture oligonucleotide.
[0156] As shown in FIGS. 8A, 8B, 8C, 8D, and 8E, the nucleic acid library includes a target nucleic acid 800 that includes a region of interest (ROI) 802 (FIG. 8A). The target nucleic acid 800 further includes a first end that includes a first adapter 804 and a second end that includes a second adapter 806. In FIGS. 8A, 8B, 8C, 8D, and 8E, the target nucleic acid 800 is shown as a single-stranded nucleic acid, the first adapter 804 is located at the 3' end (i.e., the first end) of the target nucleic acid 800, and the second adapter 806 is located at the 5' end (i.e., the second end) of the target nucleic acid 800. A first oligonucleotide 808 hybridizes to the target nucleic acid 800 in the nucleic acid library. The first oligonucleotide 808 includes a 3' target-specific region 810 that is complementary to the target nucleic acid. The oligonucleotide 808 further includes a universal sequence 812 in its 5' portion.
[0157] As shown in FIG. 8B, the hybridized first oligonucleotide 808 is extended with a first polymerase (not shown), thereby producing a first primer extension complex 814 that includes the target nucleic acid 800 and the extended first oligonucleotide 816 (the dashed line indicates the extended portion of the extended first oligonucleotide 816). A universal capture oligonucleotide 813 present in the solution hybridizes to the universal sequence 812. The universal capture oligonucleotide 813 includes a capture portion 815.
[0158] In some embodiments, two or more capture oligonucleotides can be used. For example, different types of target nucleic acids (e.g., abundant target sequences and less abundant target sequences) can have target-specific primers ("first oligonucleotides" 808) with different capture sequences. Since the capture sequences can have different melting temperatures (Tm), capture of different target sequences (e.g., abundant sequences and less abundant target sequences) can occur at different temperatures, and one type of target can be depleted or removed before the other type of target is captured. In some embodiments, the use of different capture sequences enables the generation of a more evenly distributed library (normalized library) of captured nucleic acids.
[0159] In some embodiments, the capture oligonucleotide can contain one or more modified nucleotides that change the melting temperature (Tm) of double-stranded DNA. The modified nucleotides can be selected from 5-methylcytosine, 2,6-diaminopurine, Super T (5-hydroxybutyne-2-deoxyuridine), and Super G (8-aza-7-deazaguanosine). Further, modified nucleotides that increase Tm include non-DNA nucleotides such as locked nucleic acid (LNA) nucleotides, ribonucleotides, or 2'-O-methylribonucleotides.
[0160] As further shown in FIG. 8C, the first primer extension complex 814 is captured on the solid support 818 by capturing the capture moiety 815 conjugated to the universal capture oligonucleotide 813. The solid support 818 can be a solution-phase support (e.g., beads or other similar particles) or a solid-phase support (e.g., silicon wafer, glass slide, etc.). For example, the magnetic glass particles described in U.S. Patent Nos. 6,274,386, 7,371,830, 6,870,047, 6,255,477, 6,746,874, and 6,258,531 and devices using the same can be used. After capture, the first primer extension complex 814 is enriched against the nucleic acid library containing the target nucleic acid 800. As further shown in FIG. 8C, the second oligonucleotide 820 hybridizes to the target nucleic acid 800 within the captured complex 814. The second oligonucleotide 820 is complementary to the target nucleic acid 800 and hybridizes to the target nucleic acid 800 at the 5′ position relative to the target-specific region 810 of the first oligonucleotide 808. From FIG. 8C, it can be seen that both the first extended oligonucleotide 816 and the second oligonucleotide 820 are hybridized to the target nucleic acid 800. The second oligonucleotide 820 can be referred to as a “release primer”.
[0161] As shown in FIG. 8D, the hybridized release primer 820 is extended by a second polymerase (not shown), thereby producing a second primer extension complex 822 that includes the target nucleic acid 800 and the extended release primer 824 (the dashed line indicates the extended portion of the extended release primer 824). In one embodiment, the extension of the hybridized release primer 820 releases the extended first oligonucleotide 816 from the first primer extension complex 814. The released extended first oligonucleotide 816 (including the first oligonucleotide primer 808) remains attached to the solid support 818 via the capture moiety 815 conjugated to the universal capture oligonucleotide 813. In some embodiments, the release of the extended first oligonucleotide 816 is achieved by the strand displacement activity, 5' to 3' exonuclease activity, or flap endonuclease activity of a DNA polymerase.
[0162] As shown in FIG. 8E, the target nucleic acid 800 is amplified by a third polymerase (not shown), the first amplification primer 826, and the second amplification primer 828. The first amplification primer 826 includes a 3' end complementary to the first adapter 804, and the second amplification primer 828 includes a 3' end complementary to the same sequence as the second adapter 806.
[0163] According to another embodiment of the present disclosure, the universal capture oligonucleotides shown in FIGS. 8A, 8B, 8C, 8D, and 8E are not present in solution but are bound to a solid support. As shown in FIGS. 9A and 9B, a sample is contacted with a solid support (e.g., beads) coated with the universal capture oligonucleotides. As shown in FIG. 9A, the nucleic acid library includes a target nucleic acid 900 that includes a region of interest (ROI) 902. The target nucleic acid 900 further includes adapters 904 and 906. A first oligonucleotide 908 hybridizes to the target nucleic acid 900. The first oligonucleotide 908 includes a 3' target-specific region 910 and a universal sequence 912 at its 5' portion. Simultaneously or after the extension of the first oligonucleotide 908 to form an extension product 914 (the extended portion 916 is shown in dashed lines), the first oligonucleotide 908 is contacted with a universal capture oligonucleotide 913 that hybridizes to the universal sequence 912. In this embodiment, the universal capture oligonucleotide 913 is bound to the solid support 918 via a capture moiety 915. Each unit of the solid support may have a plurality of capture oligonucleotides (not shown) bound thereto.
[0164] In various situations, it may be useful to minimize or eliminate the formation of daisy-chain structures. For example, capture of a target nucleic acid 200 by hybridization and extension of a first oligonucleotide 208 can be captured by the association of a non-target nucleic acid 500' and a non-target nucleic acid 500, which can result in a reduction in the specificity of the capture and enrichment method. To reduce intermolecular interactions between the adapter ends of target and non-target nucleic acids in a nucleic acid library, a blocking oligonucleotide can be hybridized to the adapter end sequence.
[0165] To promote the reduction of off-target hybridization, the blocking oligonucleotide has a sequence complementary to the adapters (e.g., the first adapter 204 and the second adapter 206) and preferentially hybridizes to these adapter sequences. The blocking oligo can be used in both singleplex and multiplex formats. If multiplexing is desired, various sample index sequences can be incorporated into the adapters. However, this requires the use of matching blocking oligonucleotides. When a large number of sample indexes are used (e.g., 24, 96, etc.), one possibility is to use one "universal" blocking oligonucleotide. The universal blocking oligonucleotide has a unique sequence that includes unnatural nucleotides that can bind to a large number of different sample index sequences. As a result, only a single blocking oligonucleotide is added to the nucleic acid sample. Alternatively (or additionally), the single universal blocking oligonucleotide can be a mixture of oligonucleotides that collectively constitute the universal blocking oligonucleotide composition.
[0166] In one aspect, the universal blocking oligonucleotide includes a non-specific region adjacent to the first and second specific regions. The non-specific region includes, for example, a series of inosines that align with the sample index sequence when the universal blocking oligonucleotide hybridizes to the target adapter sequence. The specific region of the universal blocking oligonucleotide is complementary to the invariant portion of the adapter sequence and contains one or more melting temperature (T m ) modifying bases to increase the T m of the blocking oligonucleotide-adapter duplex. Examples of T m modifying base substitutions are shown in Table 1.
[0167]
Table 1
[0168] In another aspect, a non-amplified nucleic acid library prepared using two different adapter arrays can be processed without blocking oligonucleotides if the adapter ends do not hybridize to each other. Adapter types suitable for this approach include fork-type and Y-shaped adapters.
[0169] In some applications of next-generation sequencing, target enrichment methods are used to enrich specific variant alleles over reference alleles. As used herein, a variant allele comprises a nucleic acid sequence having one or more variant bases (i.e., differences in nucleic acid bases) compared to a reference allele. An example of a variant allele is a single nucleotide variant (SNV). By enriching these variant alleles relative to the reference allele prior to sequencing, fewer sequencing reads are required to detect the variant alleles. This reduces the overall sequencing cost in applications where the minor variant allele fraction is at low frequency (<10%, <1%, <0.1%, <0.01%, etc.). An example application is the enrichment of variant alleles present in circulating tumor DNA (ctDNA), which is typically at a very low frequency (<1%, <0.1%, <0.01%, 0.001%, etc.). To achieve this, probe hybridization capture methods have been used (Gydush, et al., “Massively parallel enrichment of low-frequency alleles enables duplex sequencing at low depth,” Nat. Biomed. Eng. 6(3):257-266 (2022)).
[0170] The present disclosure also relates to a faster and easier method of target capture using a primer extension reaction (KAPA HyperPETE) that can improve ease of use, turnaround time, and variant allele specificity. This is achieved by modifying and improving existing target enrichment methods (such as those described in US Patent Application Publication Nos. 2020 / 0032244 and 2020 / 0392483, both of which are incorporated herein by reference in their entirety), designing target enrichment primers to specifically enrich library fragments based on the relative positions of variant base(s) in the primer, utilizing a polymerase with better priming specificity, designing variant bases in the capture primer, designing variant bases in the release primer, and / or designing variant-specific primers for both the plus and minus strands of the target library fragment. An additional method that can be used to further improve the specificity of variant allele capture is to further deplete reference alleles by being enriched in the primer extension reaction by use of "poison primers" (such as those described in International Publication No. 2022 / 008578, which is incorporated herein by reference in its entirety). These poison primers are designed to target reference alleles but not contain a biotin capture moiety. They are extended and then prevent the reference allele fragments from being inadvertently primed by the biotinylated variant allele primers.
[0171] In certain embodiments, the present disclosure relates to a method of target capture using a primer extension reaction (KAPA HyperPETE) that can improve variant allele specificity by extending certain enrichment methods disclosed herein (e.g., as described with reference to FIGS. 1 and 2). Exemplary methods can include more than one cycle or round of target capture or target enrichment. For example, the method can include a dual capture workflow that repeats one or more of the following steps (a)-(g) that describe a workflow for unidirectional dual-probe primer extension or enrichment of a target nucleic acid containing at least one variant base (e.g., a “variant allele”). Step (a): Hybridize a first oligonucleotide (e.g., a “capture primer”) to a target nucleic acid in a nucleic acid library. In certain embodiments, each nucleic acid in the library includes a heterologous adapter ligated to both the 5’ and 3’ termini. The capture primer can be “off-target” or “on-target” with respect to the variant base in certain embodiments. For example, an “off-target” capture primer can hybridize to a sequence in the target nucleic acid outside the position of the variant base, e.g., “upstream” or “downstream” of the variant base. In contrast, an “on-target” capture primer can hybridize to a sequence in the target nucleic acid that includes the variant base. In one embodiment, the target primer can be designed such that the 3’-terminal base of the primer hybridizes to the variant base in the target nucleic acid. Step (b): Extend the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex that includes the target nucleic acid and the extended first oligonucleotide. Step (c): Capture the first primer extension product. Step (d): Enrich the first primer extension product for the nucleic acid library, e.g., via one or more purification steps. Step (e): Hybridize a second oligonucleotide (e.g., a “release primer”) to the target nucleic acid. In certain embodiments, the capture primer can similarly be “off-target” or “on-target” with respect to the variant base.Step (f): Extend the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex. In certain embodiments, the extended first oligonucleotide comprises a capture moiety attached to a solid support such that release of the extended first oligonucleotide from the first primer extension product releases the second primer extension complex from the solid support into solution. One or more purification techniques can be performed after this step to recover the second primer extension product or complex comprising the target nucleic acid from other reaction components. Step (g): Amplify the target nucleic acid with a third polymerase and amplification primers suitable for the application. In certain embodiments, the amplification primers are designed to hybridize to adapters ligated to the 5' and 3' termini of the ends of the target nucleic acid. Advantageously, this enables amplification of the entire target nucleic acid, which may include genomic or circulating tumor DNA (ctDNA) in certain embodiments.
[0172] In an exemplary dual capture enrichment method, the single capture method described above with reference to steps (a)-(g) can be extended by repeating each of the ordered steps (a)-(g) a second time, i.e., by performing a second round of the enrichment method. In some embodiments, the same capture and release primer pair (e.g., the first oligonucleotide and the second oligonucleotide of steps (a) and (e)) can be used in the first round of enrichment and the second round of enrichment. In other embodiments, different capture and release primer pairs can be used for the first round of enrichment and subsequent rounds of enrichment. In certain embodiments, the amplification of the enriched target nucleic acid (e.g., the amplification of the target variant in step (g)) can include a different number of cycles in the first round of enrichment (i.e., the first PCR amplification) compared to a subsequent round of enrichment (e.g., the second PCR amplification). For example, the first PCR amplification step can include a greater number of PCR cycles than the second PCR amplification step.
[0173] In another exemplary dual capture method, the single capture method enrichment described above with reference to steps (a)-(g) can be expanded by first performing steps (a)-(d) and then introducing a new step in which the first primer extension complex is subjected to denaturing conditions so that the target nucleic acid is released from the complex into solution. For example, the target nucleic acid can be "melted" from the first primer extension complex bound to the solid support by heat treatment. The sample of unbound released target nucleic acid can then be recovered and subjected to a second round of enrichment by performing the original steps (a)-(g).
[0174] In yet another exemplary dual capture enrichment method, the single capture method described above with reference to steps (a)-(g) can be expanded by first performing steps (a)-(f) to produce a sample of unbound target nucleic acid released from the first primer extension complex bound to the solid support. The sample can then be recovered and subjected to a second round of enrichment by performing the ordered steps (a)-(g).
[0175] To design target enrichment primers to specifically enrich library fragments, any position(s) within the sequence of the capture primer can be modified / targeted, including but not limited to the last 3' base, the second last 3' base, the third last 3' base, etc., or any combination thereof. To design target enrichment primers to specifically enrich library fragments, any position(s) within the sequence of the release primer can be modified / targeted, including but not limited to the last 3' base, the second last 3' base, the third last 3' base, etc., or any combination thereof. Similarly, to design a specific poison primer, any position(s) within the sequence of the poison primer can be modified / targeted, including but not limited to the last 3' base, the second last 3' base, the third last 3' base, etc., or any combination thereof. Additionally, variant allele primers (e.g., capture primers or release primers or poison primers) designed for both the plus and minus strands and used in combination to enhance capture efficiency. Further, the primers can contain modified bases (such as LNA, methyl C, 7-deaza dGTP, etc.) in the primer to add specificity to the extension. Primers containing a mismatch or non-annealing bubble in the primer relative to the variant allele base in the primer-variant allele primer (1 base apart, 2 bases apart, 3 bases apart, 4 bases apart, nth base apart, etc.) have only a single mismatch to the variant allele target, while the reference target has two mismatches. That is, adding an intentional mismatch somewhere else in the primer designed for the variant makes priming against the reference less likely here as there will be two mismatches: (i) the variant base, and (ii) the intentional mismatch. Thus, introducing random mismatches into the primer can further enhance the enrichment of the variant base / allele.Furthermore, the use of a DNA polymerase with increased specificity in combination with variant allele-specific primers, and any number, for example, KAPA 2G polymerase, Taq polymerase, Delta Z05 (a truncated form of Z05 lacking the 5' nuclease domain), AS-1 (=Z05 D580G E493K, selected for high allele specificity), and KAPA Hifi Exo(-), or any combination thereof can be used.
Example
[0176] Example 1: Primer Extension Target Enrichment by Primer-Mediated Capture in Solution (PETE-Cap) According to the following protocol, primer extension target enrichment by primer-mediated capture in solution was performed. Duplicate nucleic acid libraries were prepared from 10 ng and 100 ng of NA12878 human genomic DNA (CORIELL) using the KAPA HYPERPLUS library preparation kit according to the manufacturer's instructions up to the 0.8X ligation followed by clean-up step (Figure 6A). Subsequently, the target nucleic acids in the nucleic acid library were enriched by primer extension target enrichment including primer-mediated capture in solution according to the embodiment shown in Figure 2. Primers complementary to the plus or minus strand of the target nucleic acid were designed for the same exon of each gene of interest (i.e., the target). The first (inner) oligonucleotide primer was 20-25 nucleotides in length and the second (outer) oligonucleotide primer was 50-60 nucleotides in length. The additional length associated with the second oligonucleotide primer (compared to the first oligonucleotide primer) was due to the inclusion of a 5' non-complementary tail sequence. In particular, the 5' non-complementary tail sequence can be omitted to reduce the overall length of the second oligonucleotide primer.
[0177] The hybridization and extension reactions of the first oligonucleotide (inner) primer were set according to Table 2. The nucleic acid library consisted of the unamplified product prepared with the above-mentioned KAPA HYPERPLUS library preparation kit. The total volume of the nucleic acid library recovered after elution following the 0.8X ligation and post-cleanup step was included in the reaction. The final concentration of the nucleic acid library was not determined (n.d.). The master mix consisted of a custom KAPA 2G polymerase PCR master mix. The primer mixture consisted of a set of 377 first oligonucleotide target-specific inner primers present at equimolar concentrations. In particular, each of the first oligonucleotide target-specific inner primers contained a 5’ biotin capture moiety.
[0178]
Table 2
[0179] The first oligonucleotide primer was hybridized to the target nucleic acid in the nucleic acid library and extended with polymerase for a total of about 1 hour according to the thermal profile of Table 3. In particular, the protocol of Table 3 omits the use of thermal cycling.
[0180]
Table 3
[0181] After hybridization and extension using the biotinylated first oligonucleotide primer, the sample was mixed with DYNABEADS MYONE streptavidin T1 capture beads (THERMO FISHER SCIENTIFIC) at a 1:1 ratio. The capture beads were prepared before addition to the DNA sample by washing twice with 1X binding and wash buffer and resuspending in 2X binding and wash buffer. The composition of the binding and wash buffer is listed in Table 4.
[0182]
Table 4
[0183] The sample was incubated with 50 μL of MYONE capture beads at room temperature for 10 minutes in an automatic sample rotator. Once the biotinylated DNA was bound to the beads, the sample was placed on a magnet for 3 minutes to capture the beads, and the supernatant was removed and discarded. The beads were washed twice, once with the 1X binding and wash buffer listed in Table 3 and once with 10 mM Tris-HCl (pH 8.0) to remove non-biotinylated DNA. The beads were then resuspended in 20 μL of 10 mM Tris-Cl (pH 8.0).
[0184] The resuspended beads were added to the second oligonucleotide (outer) primer hybridization reaction mixture according to Table 5.
[0185]
Table 5
[0186] The reaction mixture listed in Table 5 was incubated at 55 °C for 165 minutes to allow the second oligonucleotide primer to hybridize to the target nucleic acid in the nucleic acid library and increase the specificity of target capture.
[0187] The sample was then washed and eluted as described above (i.e., one wash with 1x binding and wash buffer and one wash with 10 mM Tris-HCl, followed by resuspension in 20 μL of 10 mM Tris-HCl).
[0188] When the resuspended beads were added to the second extension reaction, the second oligonucleotide primer was extended and the target nucleic acid molecule was released into the solution. The composition of the second extension reaction is listed in Table 6.
[0189]
Table 6
[0190] After the second extension reaction, the sample was incubated at 50 °C for 2 minutes and then placed directly on a magnet on ice for 1 minute. The supernatant was removed from the sample (without disturbing the beads) and added to an equal volume of KAPA PURE BEADS capture beads (KAPA BIOSYSTEMS). A 1X cleanup was performed and the sample was eluted in 15 μL of 10 mM Tris-Cl, pH 8.0.
[0191] The next step of the target enrichment protocol was an amplification reaction and cleanup with KAPA PURE BEAD capture beads (KAPA BIOSYSTEMS) according to the manufacturer's instructions for the KAPA HYPERPLUS library preparation kit. The final product was eluted in 25 μL of Tris-HCl. The concentrated target nucleic acid was then amplified and purified using the KAPA HYPERPLUS library preparation kit (KAPA BIOSYSTEMS) according to the manufacturer's instructions (Figure 6B). The concentrated and amplified library was sequenced on a MINISEQ DNA sequencer (ILLUMINA) using an intermediate output kit containing 2 × 150 bp reads, a loading concentration of 1.6 pM, and 1% PhiX DNA. The resulting sequencing data was processed using a pipeline developed for the analysis of SEQCAP EZ target enrichment system (ROCHE) data to evaluate the degree of target enrichment (Figure 7).
[0192] Example 2: Primer Extension Target Enrichment (PETE) Using Capture Oligos In this example, a universal capture sequence was added to the 5'-end of the target-specific primers in the 88 kb capture primer panel. The nucleotide sequences of the target-specific primers with universal tails (SEQ ID NO: 1) and the universal capture oligonucleotides (SEQ ID NO: 2) are as shown in Table 7. Furthermore, the following modified universal capture oligonucleotides were designed: universal capture oligonucleotide, 3'-biotin, universal capture oligo, 3'-biotin-TEG (biotin-TEG is a modified biotin containing a tetraethylene glycol spacer arm available, for example, from Integrated DNA Technologies (Coralville, Iowa)); universal capture oligo, 3'-biotin, phosphorothioate, and universal capture oligo, 3'-biotin, 5-methyl-dC (iMedC).
[0193]
Table 7
[0194] Primer extension was performed as described in Example 1, except that the sample was contacted with 15, 45, or 150 picomoles of the capture oligonucleotide (see 15, 45, and 150 in Figure 10) before adding DYNABEADS MYONE streptavidin T1 capture beads (THERMO FISHER SCIENTIFIC). A second primer was added, and the captured nucleic acids were further processed as described in Example 1, including amplification and sequencing of the captured library on an Illumina MiniSeq sequencer. The extended first primer was presumably released during the second primer extension by the flap endonuclease activity of the DNA polymerase. Referring to Figure 10, the sequencing data was evaluated to determine the n target rate (on-target read %), uniformity (base % within 2-fold range), and deduplicated coverage depth (deduplicated_depth).
[0195] Referring to all panels of FIG. 10, it is a technical replication of various experimental conditions. "Combined_15", "Combined_45", and "Combined_150" were experimental conditions in which 15, 45, or 150 picomoles of 3'-biotinylated universal capture oligo were added during hybridization of the inner primer (the capture primer exemplified by SEQ ID NO: 1) as described in Example 1. In the "control" reaction, the biotinylated capture primer described in Example 1 was used and no universal capture oligonucleotide was present. All "prehyb" experimental conditions first bound excess universal biotinylated oligo to streptavidin beads, washed away unbound oligo, and then used the beads with the bound universal oligo to perform hybridization and extension reactions using the universal tail capture primer, followed by capturing the hybridized and extended products using a protocol. The "prehyb" portion of the experiment was used to demonstrate, along with the control and "combined" workflows, that the universal capture oligo can be used directly in the capture primer extension reaction and can also be used separately to functionalize streptavidin beads (similar to the polyT beads used for mRNA enrichment) upstream of capturing the extended capture primer product.
[0196] Example 3: Specific Variant Allele Enrichment Using Variant Primers in a Primer Extension Target Enrichment (PETE) Workflow When using a sample having a single nucleotide polymorphism (SNP) and subsequently performing the target enrichment protocol described herein, it was discovered that the allele frequency ("AF") increases by placing a primer on the variant (data not shown). To further investigate this effect, allele frequencies were determined under the following conditions: (a) when the capture primer was on the variant; (b) when the release primer was on the variant; and (c) when the variant was between or beyond the capture and release primer pairs. The results are shown in Figure 11, which shows that the relative enrichment of the variant target was higher under the condition where the capture primer was on the variant (designated "Capture" in pink) compared to the other conditions (i.e., when the release primer was on the variant (designated "Release" in green), or when the variant was between or beyond the capture and release primer pairs (designated "None" in blue)) (see Figure 11). Thus, Figure 11 demonstrates which allele is designed to have the capture target enriched more than the other alleles when the capture primer is designed across the variant position. Figure 11 also suggests that designing the target enrichment capture primer such that the variant base is located within the capture primer (i.e., the capture primer is on the variant) tends to improve the enrichment of that variant target. To further investigate the effect of the position of the variant base within the sequence of the capture or release primer on the relative ability to enrich the variant target, variants were introduced into the capture primer at the 5' end, the middle, or the 3' end, and into the middle release primer. The results of this study are shown in Figure 12. Figure 12 shows that the relative targeted allele enrichment is greater when the variant base is located at the 3' end (designated "3'" in blue) and in the middle (designated "MID" in green) compared to when the variant base is located at the 5' end (designated "5'" in pink). Figure 12 also shows that any variant base introduced into the capture primer (regardless of the position of the variant base) resulted in a greater relative targeted allele frequency compared to the variant base introduced into the middle of the release primer.These studies suggest that capture primers with variant bases are likely to be better in the enrichment of specific variant targets compared to release primers with variant bases. These studies also suggest that variant bases should be introduced into the center and / or 3' end of the capture primer for higher efficiency of enrichment of targeted variants. Figure 13 shows exemplary mapping of reference primers to a reference target with various degrees of overlap (having positions in the reference sequence where cytosine (C) is present and a common variant having thymine (T) at the same position). In particular, Figure 13 shows a primer with no overlap (designated "no overlap", SEQ ID NO: 3, 5'ACCAGAGTAAATGCTCACTTTTCAATC), a primer that overlaps at the last 3' position (designated "Ult", SEQ ID NO: 4, 5'CCAGAGTAAATGCTCACTTTTCAATCC), a primer that overlaps at the second last 3' position (designated "Penult", SEQ ID NO: 5, 5'AGAGTAAATGCTCACTTTTCAATCCC), and a primer that overlaps at the third last 3' position (designated "Antepenult", SEQ ID NO: 6, 5'AGTAAATGCTCACTTTTCAATCCCC).
[0197] In summary, these studies demonstrate the ability to improve variant allele enrichment efficiency by designing target enrichment primers that specifically enrich library fragments based on the relative position of variant base(s) in the primer(s).
[0198] Example 4: Specific Variant Allele Enrichment Using Variant Primers in a Dual Capture Primer Extension Target Enrichment (PETE) Workflow In an attempt to improve the on-target rate in variant allele enrichment, we investigated a PETE workflow that introduced iterative capture for the enrichment library (i.e., the "duplex capture" workflow). The library was prepared using the Twist cfDNA Pan-cancer Reference Standard at 0.1% variant allele frequency (VAF) or 0% VAF (available from Twist Biosciences, San Francisco, CA). The reference standard consists of synthetically designed variant sequences that mimic circulating tumor DNA (ctDNA) combined with background DNA derived from human cell-free DNA (cfDNA). The ctDNA sequences are designed as a tiled pool of approximately 167 bp sequences that closely mimic native ctDNA and cover 458 individual mutations with 132 clinically actionable variants across 84 genes related to cancer. Three replicates of each of the Twist Reference Standards 0% and 0.1% were prepared in triplicate into libraries using 50 ng input, the KAPA HyperPrep library preparation kit, KAPA Universal UMI adapters, and KAPA UDI primer mix (available from Roche Sequencing). Libraries from the same input samples were pooled, religated overnight, and re-aliquoted after cleanup with solid-phase reversible immobilization (SPRI) beads.
[0199] For target enrichment, capture primers were designed for 24 single nucleotide variants (SNVs) on both the positive (i.e., “sense”) and negative (i.e., “antisense”) strands, and 21 of the 24 SNVs were present at the Twist Pan-cancer Reference Standard 0.1% VAF. The capture primers were designed to hybridize to either the upstream of the variant position (“off-variant”) or the 3’ last base of the primer at the variant position (“on-variant”). Release primers were designed to hybridize upstream of the off-variant capture primers. The primer length was 18 - 30 nucleotides long. Figure 15 shows an exemplary mapping of reference capture (blue) primers, both off-variant and on-variant, and release (orange) primers for both the plus and minus strands of the reference target variant alleles. The capture primers and release primers are shown in Table 8.
[0200]
Table 8
[0201] Generally, the PETE target enrichment protocol is performed using the KAPA HyperPETE reagent kit containing 15 μL of library sample as input and 19 cycles of PCR as described herein and according to Chapter 4 of the KAPA HyperPETE Somatic Plasma cfDNA Workflow (v1.0) Instructions for Use (available from Roche Sequencing).
[0202] For this experiment, three replicates of the Twist 0.1% VAF Reference Standard were prepared into libraries as described above and captured twice with the on-variant capture primers. The samples subjected to double capture were eluted at 15 μL at the end of the first capture and then picked up a second time in the PETE workflow. 19 cycles of PCR amplification were performed following the first capture, and 8 cycles of PCR amplification were performed following the second capture.
[0203] The concentrated library was sequenced on an Illumina® NextSeq™ 500 System and analyzed using an in-house analysis pipeline with 5M, 4M, 2M, and 1M subsampled reads. Two replicates of the Twist 0% VAF on-variant capture primer enriched sample had 2.04M and 4.7M reads. All reads from these two samples were used at a subsampling level beyond the maximum available reads. The observed allele frequency (AF) was determined using non-redundant reads. The on-target rate determination results are shown in Figure 16. It was observed that the percentage of on-target reads, i.e., the on-target rate (OTR), was higher for samples captured once with off-variant capture primers (median 64.1%, orange bar) than for samples captured once with on-variant capture primers, consistent with the fact that the allele variant specificity of on-variant capture primers results in a significant reduction in the number of target sequences within low VAF samples and a corresponding lower OTR. The OTR is not affected by low VAF in off-variant capture primer enrichment because the off-variant capture primers are upstream of the variant position. However, importantly, samples captured twice with on-variant capture primers showed an improved OTR (median 54.2%, green bar) compared to samples captured once with on-variant capture primers (median 7.9%, blue bar).
[0204] Figure 17 shows the allele frequency percentage (AF) observed for three samples. It was observed that the AF of samples captured once with on-variant capture (blue bar) was much higher than the AF of samples captured once with off-variant capture primers (orange bar), resulting in an AF similar to the expected VAF of the samples (median 0.0881%). In particular, samples captured twice with on-variant capture primers showed a higher AF (median 63.8%, green bar) compared to samples captured once with on-variant capture primers (median 3.71%, blue bar).
[0205] In summary, these results show that duplex capture using variant-specific capture primers improves OTR and observed AF, and thus can potentially reduce the sequencing depth required to call low AF variants.
[0206] Example 5: Heterozygous Single Nucleotide Polymorphism (SNP) Variant Enrichment The purpose of this experiment was to design and test variant-specific primers that overlap the variant at different positions within the primer for variant enrichment.
[0207] Variant enrichment capture primers were designed to overlap 10 heterozygous SNPs (see Table 9) present in genomic DNA derived from the NA12878 cell line (human B lymphocyte).
[0208]
Table 9
[0209] A primer placement scheme for exemplary SNP targets is shown in Figure 18. Capture primers were designed at either the 5’ third (5’, e.g., SEQ ID NO: 28), middle third (Mid, e.g., SEQ ID NO: 27), third from the last 3’ base (third from the last, e.g., SEQ ID NO: 25), second from the last 3’ base (second from the last, e.g., SEQ ID NO: 24) or the last 3’ base (last, e.g., SEQ ID NO: 23) of the primer over the variant base in the target. Capture primers were also designed to be located immediately upstream of the SNP (「off」, e.g., SEQ ID NO: 22). One set of variant overlapping capture primers was designed to be complementary to the variant allele (variant). Another set of variant overlapping capture primers was designed to be complementary to the reference allele (WT). Another set of variant overlapping capture primers designed to be complementary to the reference allele did not contain a 5’ biotin moiety for use in reference allele depletion (i.e., 「poison primer」).
[0210] For both the variant and WT capture primer sets, two release primers were designed. One of them (3’Rel, e.g., SEQ ID NO: 21) was designed to be located upstream of the “off” capture primer so that it could release the off, third from the last, second from the last, and the last capture primers. The other release primer (5’Rel, e.g., SEQ ID NO: 26) was designed to be located upstream of the 5’ capture primer so that it could release the 5’ and Mid capture primers for both the variant and WT capture primer sets. Capture and release primer sets were designed for both the plus (+) (e.g., SEQ ID NOs: 21 - 28) and minus (-) (e.g., SEQ ID NOs: 29 - 36) strands of the genomic DNA target. The 5’ to 3’ nucleic acid sequences of the primers are shown in Table 10.
[0211]
Table 10
[0212] Primers were designed to the reference sequence using the “Primer 3” software program with a Tm range of 57.2 - 66.5°C, a GC content of 0 - 100%, and a length of 18 - 30 bases. Variant-specific primers were generated by modifying the relevant bases of the reference allele to be complementary to the variant allele. The entire array of primers useful for this analysis is shown in Table 11. (In the experiments described in this example, the plus-strand primer pool was tested).
[0213]
Table 11 - 1
Table 11 - 2
[0214] Genomic DNA (gDNA) from the NA12878 cell line was prepared into 48 libraries for 10 ng of non-formalin-damaged gDNA according to Chapter 4 of the Instruction for Use (IFU) KAPA HyperPETE Somatic Tissue DNA Workflow (v1.0). To minimize the variation of the input libraries prior to target enrichment for an accurate comparison of the designed variant enrichment panels, a step was added after Step 5 (0.8X purification after ligation using KAPA HyperPure Beads) to pool the eluate and aliquots into 20 μL tubes in order to proceed with amplification.
[0215] Target enrichment was performed according to Chapter 5 of the above-mentioned IFU using 10 μL of the input library, the KAPA HyperPETE HotSpot capture panel (used as an internal process control, data not shown), and the spike-in variant capture panel for each variant described in Table 9. Five overlapping variant capture primer positions with WT allele complementarity, variant allele complementarity, or variant allele complementarity with WT poison primers at the same overlapping position resulted in 15 different spike-in variant enrichment panel conditions. When including the off-capture primer panel, there were a total of 16 different spike-in panel conditions. Each individual target enrichment procedure was performed in triplicate, and each panel was tested in 3 separate target enrichment sets. Set 1 included the Mid+ variant and 5’+ variant, with and without the corresponding poison primers. Set 2 was the third from the last + variant and second from the last + variant, with and without the corresponding poison primers. Set 3 was the last + variant and off variant, with and without the corresponding poison primers. The design of this experiment is shown in Table 12 (where “b” indicates biotinylation).
[0216]
Table 12
[0217] Variant enrichment capture primers were used at the same concentration as the HyperPETE capture panel, and poison primer panels were used at 10 times the HyperPETE capture panel concentration. Release hybridization was performed using either the KAPA HyperPETE hot spot panel release primer and the 5’+ variant enrichment release pool (for Mid+ and 5’+ capture primers, variant or WT, with or without corresponding poison primers) or the 3’+ variant enrichment release pool (for third from last +, second from last +, or last +, variant or WT, with or without corresponding poison primers). Release panels were used at the same concentration as the HyperPETE release panel. 17 cycles were used for amplification.
[0218] For next-generation sequencing, the enriched libraries were pooled and sequenced on an Illumina Nextseq 500 system. Sequencing data were analyzed with an in-house pipeline and subsampled to 15M total reads. Observed variant allele frequencies were determined by dividing the variant allele depth by the total depth from the barcode-duplicate-removed SNV frequency file. Fold enrichment was calculated by dividing the observed variant allele frequency by 50% of the expected variant allele frequency. The results of this experiment are shown in Figures 19 and 20.
[0219] As shown in Figure 19, the observed percent variant allele frequency (AF) was close to 50% when using the "off-variant" capture primers as expected (pink "off-variant"). In contrast, the observed variant AF was higher than the expected value of 50% when using variant capture primers (green "Var" and turquoise "Var + poison", indicated by the vertical arrows). The "last 3' variant" capture primers generated the highest observed variant AF, which decreased as the position of the variant base duplication moved towards the 5' end of the variant capture primers. When poison primers were included in target enrichment, these values were higher and less variable was observed (turquoise "Var + poison", indicated by the vertical arrow). The observed variant AF was less than 50% of the expected value when using WT capture primers (purple "WT"). The observed variant AF was lowest with the "last 3' WT" capture primers and increased as the variant base duplication position moved towards the 5' end of the WT capture primers.
[0220] Figure 20 shows the results of variant enrichment represented as the correlation of multiplex enrichment to total coverage (red variant data points indicated by a single vertical arrow and blue variant + poison data points indicated by a double vertical arrow). As can be seen from the figure, low multiplex enrichment tended to have a high total coverage of enriched variants.
[0221] In summary, the results of this experiment show that the PETE workflow can significantly enrich SNP variants when it includes variant-specific capture primers. The highest variant AF was observed when the last 3' base of the capture primer hybridized to the variant base in the target sequence. Furthermore, the inclusion of poison primers in the enrichment procedure was observed to optimize variant enrichment. Finally, an inverse relationship was observed between the observed variant allele frequency and the total coverage.
[0222] Example 6: Optimization of Variant Enrichment - Strand Testing and Poison Primer Titration for Low AF Cell Line Mixtures The purpose of this experiment was to optimize variant enrichment performance by using different amounts of poison primers, either alone or in combination with primers that hybridize to the plus strand of the target template, to hybridize to the minus strand of the target template.
[0223] Genomic DNA isolated from the human B lymphocyte cell lines NA24143 and NA12878 was mixed, and eight SNP variants (Example 5) not shared between the two cell lines were used to evaluate low AF variant enrichment using the panel described in Example 5. The NA12878 and NA24143 cell line DNAs were diluted to the same concentration, and the NA12878 DNA was mixed with the NA24143 DNA at ratios of 1:50, 1:100, and 1:1000 to obtain predicted variant AFs of 1%, 0.5%, and 0.1%, respectively.
[0224] The 1%, 0.5%, and 0.1% variant AF cell line DNA mixtures were prepared into shotgun libraries with 12 replicates each for a total of 36 libraries for 10 ng of non-formalin-damaged gDNA according to Chapter 4 of the IFU KAPA HyperPETE Somatic Tissue DNA Workflow (v1.0). To minimize variation in the input libraries going into target enrichment for an accurate comparison of the designed variant enrichment panels, a step was added after Step 5 (0.8X purification after ligation using KAPA HyperPure Beads) to pool the eluate and aliquots into 20 μL tubes prior to proceeding to amplification.
[0225] The prepared library was used as input into the target enrichment procedure of the HyperPETE workflow according to Chapter 5 of the IFU KAPA HyperPETE Somatic Tissue DNA Workflow (v1.0). Only 5 μL of the input library per target enrichment reaction was used to enable the volume required for the combination of capture primer pools. Each target enrichment reaction still provided more than the minimum required 500 ng input suggested by the IFU. As summarized in Table 13, two sets of target enrichment were performed. The variant enrichment panel was used alone at the same primer concentration as the HyperPETE capture panel.
[0226]
Table 13
[0227] The first set of target enrichment was performed using only the plus strand, only the minus strand, or the last 3’ variant primers of the plus and minus strands, with or without poison primers (the last 3’ poison primers of the corresponding plus strand only, minus strand only, or plus and minus strands). The poison primers were used at 10 times the normal capture panel concentration. The target sample was a 0.5% cell line mixture input library. The enrichment reactions were performed in duplicate for a total of 12 samples. Release hybridization was similarly performed using either only the plus strand, only the minus strand, or the 3’ release primers of the plus and minus strands. The samples were amplified using 23 cycles of PCR.
[0228] The second set of target enrichment was performed using the last 3’ variant primers of the plus and minus strands and the corresponding poison primers of the plus and minus strands at 1X, 5X, 10X, and 20X the normal HyperPETE capture primer concentration for 1% and 0.1% cell line mixture input libraries, and replicated 3 times for a total of 24 samples each. Release hybridization was performed using the 3’ release primers of the plus and minus strands. The samples were amplified using 23 cycles of PCR.
[0229] The enriched libraries were pooled and sequenced on an Illumina Nextseq500 system. The sequencing data were analyzed with an in-house pipeline and subsampled to 3M total reads. The observed variant allele frequencies were determined by dividing the variant allele depth by the total depth from the non-duplicate-filtered frequency file. The fold enrichment was calculated by dividing the observed variant allele frequency by the predicted variant allele frequency of 0.5%. The recovery percentage was determined from the barcode non-duplicate-filtered SNV frequency file, and the observed variant allele coverage was calculated by dividing the observed variant allele coverage by the predicted variant allele copy number based on the input amount and predicted variant AF. The results of this experiment are shown in FIGS. 21-23.
[0230] As shown in FIG. 21, the median recovery percentage was higher for samples captured with both the plus-strand and minus-strand final variant capture primers ("PlusMinus") compared to samples captured with only the plus-strand primer or the minus-strand primer. The addition of the poison primer did not improve the recovery to a significant level in this experiment.
[0231] As shown in FIG. 22, the median fold enrichment increased as the concentration of the poison primer added to the capture extension increased. Due to the fact that the predicted variant AF was lower, the theoretical maximum fold enrichment (when the variant AF is 100%) was much higher for the 0.1% AF sample (1000X) compared to the 1% AF sample (100%). Thus, the observed fold enrichment was also higher for the 0.1% AF sample compared to the 1% AF sample.
[0232] As shown in FIG. 23, the average recovery percentage did not vary significantly between different amounts of the poison primer in the capture extension reaction.
[0233] In summary, these data indicate that the recovery percentage of variant allele copies is highest when using both plus-strand and minus-strand variant capture and corresponding release primers. Increasing the poison primer concentration significantly increased variant enrichment but did not increase the recovery percentage of variant allele copies. High-fold enrichment is likely due to more complete depletion of the WT allele. The use of poison primers may be more beneficial when more variants are detected and the unwanted capture of WT allele fragments may result in reduced capture or sequencing of other variant targets.
[0234] Example 7: Variant Enrichment Optimization - Ligation Time Test and PETE Input Test The purpose of this experiment was to optimize variant enrichment performance by increasing the ligation time and the input percentage to target enrichment.
[0235] A mixture of genomic DNA from a cell line with 0.1% AF and genomic DNA from only the NA24143 cell line (as 0% variant AF) was prepared into a shotgun library for 10 ng of non-formalin-damaged gDNA according to Chapter 4 of the IFU KAPA HyperPETE Somatic Tissue DNA Workflow (v1.0). For ligation, the library was incubated at 20°C for 15 minutes or overnight (16 - 18 hours) at 16°C as instructed in the IFU. For each AF level and ligation time, 12 replicate libraries were prepared for a total of 48 libraries. To minimize the variation of the input libraries going into target enrichment for accurate comparison of the designed variant enrichment panel, an additional step was added after Step 5 (0.8X purification after ligation using KAPA HyperPure Beads) to pool the eluate and aliquots into 20 μL tubes for amplification. The final library was eluted in 20 μL instead of 25 μL as indicated in the IFU to allow for a higher input into target enrichment.
[0236] Either 40% (8 uL) or 75% (15 uL) of the prepared library was used as input into the target enrichment procedure of the HyperPETE workflow according to Chapter 5 of the IFU KAPA HyperPETE Somatic Tissue DNA Workflow (v1.0). The plus- and minus-strand final or off-variant enrichment panels were used alone at the same primer concentration as the HyperPETE capture panel. Release hybridization was performed using the 3’ release primers for both the plus- and minus-strands. Samples were amplified using 23 cycles of PCR.
[0237] The enriched libraries were pooled and sequenced on the Illumina Nextseq500 system. Sequencing data were analyzed with an in-house pipeline and subsampled to 3M total reads. The recovery percentage was determined from the barcode deduplicated SNV frequency files and the observed variant allele coverage was calculated by dividing the observed variant allele coverage by the expected variant allele copy number based on the input amount and expected variant AF. The experimental setup is shown in Table 14.
[0238]
Table 14
[0239] As shown in Figure 24, overnight ligation with 75% input showed the best variant allele copy recovery percentage, followed by 15-minute ligation with 75% input.
[0240] In summary, these data indicate that overnight ligation with 75% input results in a higher recovery percentage of variant alleles.
[0241] Example 8: Low AF Variant Enrichment Using Reference Samples The purpose of this experiment was to demonstrate variant detection performance using variant enrichment in reference samples with known variant AF.
[0242] As shown in Table 15, a variant enrichment panel was designed in the same manner as described in Example 5 for 24 SNVs in the Seracare Seraseq™ ctDNA Mutation Mix v2 product. Of the 24 variant targets, 21 are present in the Twist cfDNA Pan-cancer Reference Standard at VAF 0.1%.
[0243]
Table 15
[0244] Seracare Seraseq™ ctDNA Mutation Mix v2 AF0.5%, Seracare Seraseq™ ctDNA Mutation Mix v2 WT (0%), Twist cfDNA Pan-cancer Reference Standard VAF0.1%, and Twist cfDNA Pan-cancer Reference Standard VAF0% (WT) samples were prepared into shotgun libraries for 50 ng of cfDNA according to Chapter 3 of the IFU KAPA HyperPETE Somatic Plasma cfDNA Workflow (v1.0). The libraries were incubated at 16 °C overnight (16 - 18 hours) for ligation. A total of 24 libraries were prepared with 6 replicate libraries for each sample, and each replicate set was prepared into libraries separately. An additional step was added after Step 5 of Chapter 4 (0.8X purification after ligation using KAPA HyperPure Beads) to pool the eluate and aliquots into 20 μL tubes to minimize variation in the input libraries going into target enrichment for accurate comparison of the designed variant enrichment panel. The final libraries were eluted in 20 μL instead of 25 μL as indicated in the IFU to allow for a higher input into target enrichment.
[0245] 15 μL of the prepared library was used as input into the target enrichment procedure of the HyperPETE workflow according to Chapter 4 of the IFU KAPA HyperPETE Somatic Plasma cfDNA Workflow (v1.0). As shown in Table 16, the plus- and minus-strand last variant or off-variant enrichment panels were used alone, at the same primer concentration as the HyperPETE capture panel, with 3 replicates per input sample. Release hybridization was performed using the 3’ release primers for both the plus- and minus-strands. Samples were amplified using 19 cycles of PCR.
[0246]
Table 16
[0247] The enriched libraries were pooled and sequenced on an Illumina Nextseq500 sequencing system. Sequencing data were analyzed with an in-house pipeline, subsampled to 5M total reads, and downsampled to 4M, 3M, 2M, and 1M total reads. Two replicates of the Twist0% VAF last capture primer enrichment samples had 2.04M and 4.7M reads. All reads from these two samples were used at subsampling levels beyond the maximum available reads. The observed allele frequency (AF) was determined using non-duplicate reads. UMI deduplicated reads were used for variant calling, and the cut-off was set at a number of UMI families greater than 15 for changes from C to T, greater than 8 for changes from G to T, and greater than 7 for all other base changes. False positives were determined from the 0% VAF samples.
[0248] As shown in Figure 25, the AF percentage observed for the sample captured using the on-variant (last) capture primer was much higher than the AF percentage observed for the sample captured using the off-variant capture primer, showing an AF percentage similar to the predicted VAF of the sample indicated by the horizontal line. The median fold enrichment (on-variant observed AF / off-variant observed AF) was 38.1-fold for the Seraseq™ 0.5% VAF sample and 42.2-fold for the Twist 0.1% VAF sample.
[0249] As shown in Figure 26, the off-variant capture primer enriched sample (indicated by a single vertical arrow) did not reach 100% variant calling performance, even though it was 2.5 times the sequencing reads required to achieve 100% calling of the on-variant capture primer enriched sample. At 2M reads, Seraseq® 0.5% VAF had 100% of the variants called with on-variant capture primer enrichment (indicated by a double vertical arrow), while off-variant capture primer enrichment with no false positives called was only 75%.
[0250] Importantly, these data demonstrate that using the KAPA HyperPETE workflow, variants with a low AF value of 0.1% can be enriched with variant-specific primers. Low AF variants can be called with less sequencing required when using the "last" capture primer compared to the off-variant capture primer.
[0251] The described features, structures, or characteristics of the present invention can be combined in any suitable way in one or more embodiments. In the following description, numerous specific details are set forth in order to provide a thorough understanding of embodiments of the system. However, one of ordinary skill in the art will recognize that the system and method can be practiced without one or more of the specific details, or with other methods, components, materials, and the like. In other instances, well-known structures, materials, or operations are not shown or described in detail to avoid obscuring aspects of the present invention. Accordingly, the foregoing description is intended to be illustrative and not to limit the scope of the concept of the present invention.
Claims
1. A method for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid contains at least one variant base, and the method comprises: (a) hybridizing a first oligonucleotide to a target nucleic acid in a nucleic acid library, wherein each of the nucleic acids in the nucleic acid library has a first end containing a first adapter and a second end containing a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex containing the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first primer extension complex with respect to the nucleic acid library; (e) hybridizing a second oligonucleotide to the target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex containing the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; and (g) amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, wherein the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter. A method comprising the above steps.
2. The method according to claim 1, wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the last 3' base of the first oligonucleotide.
3. The method according to claim 1, wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the second last 3' base of the first oligonucleotide.
4. The method according to claim 1, wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the third 3' base from the end of the first oligonucleotide.
5. The method according to any one of claims 1 to 3, wherein the frequency of the at least one variant base in the nucleic acid library is less than 1%.
6. The method according to any one of claims 1 to 3, wherein the frequency of the at least one variant base in the nucleic acid library is less than 0.1%.
7. The method according to any one of claims 1 to 3, wherein the frequency of the at least one variant base in the nucleic acid library is less than 0.01%.
8. The method according to any one of claims 1 to 3, wherein the frequency of the at least one variant base in the nucleic acid library is less than 0.001%.
9. The method according to any one of claims 1 to 8, further comprising an additional oligonucleotide in step (a), wherein the additional oligonucleotide hybridizes to the strand opposite to the strand hybridized by the first oligonucleotide.
10. The method according to claim 9, wherein the additional oligonucleotide is complementary to the target nucleic acid at the at least one variant base.
11. The method according to any one of claims 1 to 10, wherein one or more additional mismatches or non-annealing bubbles are generated in the first oligonucleotide.
12. The method according to any one of claims 1 to 11, wherein the first oligonucleotide comprises one or more modified bases.
13. The method according to claim 11, wherein the one or more modified bases comprise locked nucleic acid (LNA), methyl C, or 7-deaza dGTP, or any combination thereof.
14. The method according to any one of claims 1 to 13, wherein the first DNA polymerase, the second DNA polymerase, and / or the third DNA polymerase is KAPA 2G polymerase, delta Z05 polymerase, AS-1 polymerase, or KAPA HiFi Exo(-) polymerase, or any combination thereof.
15. The method according to any one of claims 1 to 14, wherein the second oligonucleotide is complementary to the target nucleic acid at the at least one variant base.
16. The method according to claim 15, wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the last 3' base of the second oligonucleotide.
17. The method according to claim 15, wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the second last 3' base of the second oligonucleotide.
18. The method according to claim 15, wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the third last 3' base of the second oligonucleotide.
19. The method according to any one of claims 1 to 18, wherein the second oligonucleotide comprises one or more modified bases.
20. The method according to claim 19, wherein the one or more modified bases comprise locked nucleic acid (LNA), methyl C, or 7-deaza dGTP, or any combination thereof.
21. The method according to any one of claims 1 to 20, wherein one or more additional mismatches or non-annealing bubbles are generated in the second oligonucleotide.
22. The method according to any one of claims 1 to 21, further comprising hybridizing the nucleic acid in the nucleic acid library that is not the target nucleic acid with a poison primer.
23. The method according to claim 22, wherein the poison primer depletes the nucleic acid in the nucleic acid library that is not the target nucleic acid.
24. The method according to any one of claims 1 to 23, further comprising sequencing the amplified target nucleic acid.
25. The method according to any one of claims 1 to 24, wherein the first oligonucleotide comprises a capture moiety.
26. Before hybridizing the first oligonucleotide to a target nucleic acid, binding the first oligonucleotide to a solid support, hybridizing the first oligonucleotide to the target nucleic acid, extending the hybridized first oligonucleotide with a polymerase, thereby capturing the first primer extension complex on the solid support, the method according to any one of claims 1 to 25.
27. The method according to any one of claims 1 to 26, comprising incorporating at least one uracil into at least one of the following: The extended first oligonucleotide in the first primer extension complex and the extended second oligonucleotide in the second primer extension complex, thereby forming a uracil-containing oligonucleotide product.
28. The method according to any one of claims 1 to 27, further comprising contacting the nucleic acid library with a blocking oligonucleotide.
29. The method according to any one of claims 1 to 28, wherein the first adapter and the second adapter are fork-type adapters.
30. The method according to any one of claims 1 to 29, wherein the first adapter and the second adapter contain at least one uracil.
31. The method according to any one of claims 1 to 30, wherein the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide.
32. The method according to any one of claims 1 to 31, wherein at least one of the first adapter, the second adapter, the first amplification primer, and the second amplification primer contains at least one of a unique identifier (UID) and a molecular identifier (MID) sequence.
33. A kit for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid contains at least one variant base, and the kit comprises (a) A first oligonucleotide complementary to a target nucleic acid in a nucleic acid library, wherein each of the nucleic acids in the nucleic acid library has a first end containing a first adapter and a second end containing a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) A second oligonucleotide complementary to the target nucleic acid; (c) A first amplification primer; and (d) A second amplification primer comprising, wherein the first oligonucleotide comprises a capture moiety, the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide, the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter.
34. The kit according to claim 33, wherein the second oligonucleotide is complementary to the target nucleic acid at the at least one variant base.
35. A kit for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid contains at least one variant base, and the kit comprises (a) A first oligonucleotide complementary to a target nucleic acid in a nucleic acid library, wherein each of the nucleic acids in the nucleic acid library has a first end containing a first adapter and a second end containing a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) A modified nucleotide having a capture moiety; (c) A second oligonucleotide complementary to the target nucleic acid; (d) A first amplification primer; and (e) A second amplification primer comprising, wherein the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide, the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' complementary to the second adapter.
36. The kit according to claim 34, wherein the second oligonucleotide is complementary to the target nucleic acid at the at least one variant base.
37. A method for double enrichment of at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid contains at least one variant base, and the method comprises: (a) hybridizing a first oligonucleotide to the target nucleic acid in the nucleic acid library, wherein each of the nucleic acids in the nucleic acid library has a first end containing a first adapter and a second end containing a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first primer extension complex with respect to the nucleic acid library; (e) hybridizing a second oligonucleotide to the target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; (g) amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer to produce a sample of the amplified target nucleic acid, wherein the first amplification primer has a 3'-end complementary to the first adapter and the second amplification primer has a 3'-end complementary to the second adapter; and (h) repeating each of steps (a) to (g) in sequence on the sample of the amplified target nucleic acid of step (g). A method comprising the above steps.
38. A method for double enrichment of at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid contains at least one variant base, and the method comprises: (a)hybridizing a first oligonucleotide to a target nucleic acid in a nucleic acid library, wherein each of the nucleic acids in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b)extending the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c)capturing the first primer extension complex; (d)concentrating the first primer extension complex with respect to the nucleic acid library; (e)denaturing the first primer extension complex to release the target nucleic acid from the first primer extension complex; (f)repeating each of steps (a) to (d) in order with respect to the target nucleic acid of step (e); (g)hybridizing a second oligonucleotide to the target nucleic acid; (h)extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; and (i)amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, wherein the first amplification primer has a 3′ end complementary to the first adapter and the second amplification primer has a 3′ end complementary to the second adapter, A method comprising.
39. A method for double - enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the method comprising (a)Hybridizing a first oligonucleotide to a target nucleic acid in a nucleic acid library, wherein each of the nucleic acids in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter, and the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b)Extending the hybridized first oligonucleotide with a first polymerase, thereby producing a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c)Capturing the first primer extension complex; (d)Concentrating the first primer extension complex with respect to the nucleic acid library; (e)Hybridizing a second oligonucleotide to the target nucleic acid; (f)Extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; (g)Repeating each of steps (a) to (f) in order with respect to the target nucleic acid of step (f); and (h)Amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, wherein the first amplification primer has a 3′ end complementary to the first adapter and the second amplification primer has a 3′ end complementary to the second adapter. A method comprising the steps of amplifying.