Compositions and Methods for Epigenetic Regulation of TRAC Expression

The epigenetic editor system addresses the safety concerns of conventional gene manipulation by using DNMT and CRISPR Cas domains to suppress TRAC gene expression in immune cells, offering a safer and more efficient method for treating diseases.

JP2025524455APending Publication Date: 2025-07-30NCHROMA BIO
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024575381
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-23
Filing Date
2023-06-23
Publication Date
2025-07-30

AI Technical Summary

Technical Problem

Conventional gene manipulation methods for genetically modifying immune cells, such as T lymphocytes and NK cells, involve risks like chromosomal translocations, unwanted nucleotide insertions, and off-target mutations, necessitating a safer and more efficient approach.

Method used

An epigenetic editor system comprising fusion proteins with DNA methyltransferase (DNMT) domains, transcriptional repressor domains, and DNA binding domains is used to suppress TRAC gene expression, utilizing DNMT3A, DNMT3L, and CRISPR Cas domains for targeted epigenetic modification.

Benefits of technology

The system achieves reversible and safe suppression of TRAC gene expression, reducing alloreactivity and minimizing genetic risks, with potential applications in treating cancer and autoimmune diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025524455000001
    Figure 2025524455000001
  • Figure 2025524455000002
    Figure 2025524455000002
  • Figure 2025524455000003
    Figure 2025524455000003
Patent Text Reader

Abstract

The present invention relates to compositions and methods comprising an epigenetic editor for epigenetic modification of TRAC, and nucleic acids and vectors encoding the same. Also disclosed are cells epigenetically modified by the epigenetic editor.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 355,062, filed Jun. 23, 2023, entitled "COMPOSITIONS AND METHODS FOR EPIGENETIC REGULATION OF TRAC EXPRESSION", the entire disclosure of which is hereby incorporated by reference in its entirety.

[0002] Reference to a Sequence Listing Submitted via Electronic Media The content of the sequence listing submitted via electronic media (C169870009WO00 - SEQ - AXW.xml; size: 1,189,305 bytes; and created on Jun. 23, 2023) is hereby incorporated by reference in its entirety.

Background Art

[0003] Background of the Invention Adoptive cell therapy using genetically modified immune cells has emerged as a promising approach for treating cancer, infectious diseases, autoimmune diseases, and other diseases. However, conventional gene manipulation methods are usually based on permanent manipulation at the genomic level of cells, which involves certain risks such as chromosomal translocations, unwanted nucleotide insertions and deletions at the target site, and off - target mutations. An efficient and safe method for genetically engineering immune cells is still needed.

Summary of the Invention

Means for Solving the Problems

[0004] Summary of the Invention The present disclosure provides a system and composition (referred to herein as an "epigenetic editor" or "epigenetic editing system") for epigenetic modification, and methods of using said system and composition to effect epigenetic modification in a target such as a host cell and an organism.

[0005] In some embodiments, the present disclosure provides a system for suppressing transcription of the human TRAC gene in human cells, optionally human T lymphocytes or human NK cells, wherein the system a) one or more fusion proteins collectively comprising a DNA methyltransferase (DNMT) domain and / or a domain that recruits DNMT, and a transcriptional repressor domain, wherein optionally the DNMT domain and / or the recruiter domain may comprise a DNMT3A domain and / or a DNMT3L domain, and optionally the recruited DNMT may be DNMT3A, said fusion protein wherein each domain is linked to a DNA binding domain that binds to a target region within the human TRAC gene, or b) one or more nucleic acid molecules encoding said one or more fusion proteins comprising.

[0006] In some embodiments, the system a) a single fusion protein comprising a DNMT3A domain, a DNMT3L domain, a transcriptional repressor domain, and a DNA binding domain, or b) a nucleic acid molecule encoding this single fusion protein comprising.

[0007] In some embodiments, the DNA binding domain comprises a dead CRISPR Cas (dCas) domain, a ZFP domain, or a TALE domain. For example, the DNA binding domain may comprise a dCas9 domain, and the system may further comprise (i) one or more guide RNAs comprising any one of SEQ ID NOs: 990 to 1218, or (ii) a nucleic acid molecule encoding said one or more guide RNAs.

[0008] In certain embodiments, the dCas domain comprises a dCas9 sequence, such as a sequence having at least 90% identity to SEQ ID NO: 12 or 13.

[0009] In some embodiments, the DNA binding domain binds to the target sequence of SEQ ID NO: 1219 or 1220.

[0010] In some embodiments, the DNA binding domain comprises a ZFP domain that targets a nucleotide sequence selected from SEQ ID NOs: 700 to 760.

[0011] In some embodiments, the DNMT3A domain comprises a sequence having at least 90% identity to SEQ ID NO: 574 or 575.

[0012] The DNMT3L domain may comprise, for example, a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 578 to 581. In some embodiments, the DNMT3L domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 582 to 603. In some embodiments, the DNMT3L domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 601 to 603.

[0013] In some embodiments, the transcriptional repressor domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 33 to 570. In certain embodiments, the transcriptional repressor domain is a KRAB domain derived from KOX1, ZIM3, ZFP28, or ZN627. The KRAB domain can comprise, for example, a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 89, 116, 245, and 255. In some embodiments, the transcriptional repressor domain comprises a fusion of the N-terminal and C-terminal regions of ZIM3 and KOX1 KRAB, optionally comprising the amino acid sequence of SEQ ID NO: 571 or 572. In certain embodiments, the transcriptional repressor domain is derived from KAP1, MECP2, HP1a / CBX5, HP1b, CBX8, CDYL2, TOX, TOX3, TOX4, EED, EZH2, RBBP4, RCOR1, or SCML2.

[0014] In some embodiments, the system a) comprises a DNMT3A domain, a DNMT3L domain, a transcriptional repressor domain, and a DNA binding domain, wherein optionally one or both of the DNMT3A domain and the DNMT3L domain are of human origin, wherein optionally the DNA binding domain is a dead CRISPR Cas domain or a ZFP domain, a fusion protein, or b) a nucleic acid molecule encoding the fusion protein and comprises.

[0015] In certain embodiments, the fusion protein comprises, from the N-terminus to the C-terminus, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA binding domain, a third peptide linker, and a transcriptional repressor domain. For example, the fusion protein can comprise, from the N-terminus to the C-terminus, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a first nuclear localization signal (NLS), a DNA binding domain, a second NLS, a third peptide linker, and a transcriptional repressor domain. The fusion protein can comprise, from the N-terminus to the C-terminus, a first NLS, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA binding domain, a third peptide linker, a transcriptional repressor domain, and a second NLS. The fusion protein can comprise, from the N-terminus to the C-terminus, first and second NLSs, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA binding domain, a third peptide linker, a transcriptional repressor domain, and third and fourth NLSs. In certain embodiments, the transcriptional repressor domain is a KRAB domain, such as the human KOX1, ZFP28, ZN627, or ZIM3 KRAB domain. In certain embodiments, one or both of the second and third peptide linkers are XTEN linkers, which can be selected from XTEN80 (e.g., SEQ ID NO: 643) and XTEN16 (e.g., SEQ ID NO: 638), for example, the second peptide linker is XTEN80 and the third peptide linker is XTEN16.

[0016] In some embodiments, the fusion protein can comprise, from the N-terminus to the C-terminus, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a first NLS, a dSpCas9 domain, a second NLS, an XTEN16 peptide linker, and a human KOX1 KRAB domain. In certain embodiments, the fusion protein comprises a sequence that is at least 90% identical to SEQ ID NO: 658.

[0017] In some embodiments, the fusion protein, from the N-terminus to the C-terminus, comprises a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a first NLS, a ZFP domain, a second NLS, an XTEN16 linker, and a human KOX1 KRAB domain. In certain embodiments, the fusion protein comprises a sequence that is at least 90% identical to SEQ ID NO: 659.

[0018] In some embodiments, the fusion protein, from the N-terminus to the C-terminus, comprises a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human KOX1 KRAB domain, and a third and a fourth NLS. In certain embodiments, the fusion protein may comprise the amino acid sequence of SEQ ID NO: 660 or a sequence that is at least 90% identical thereto.

[0019] In some embodiments, the fusion protein, from the N-terminus to the C-terminus, comprises a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human KOX1 KRAB domain, and a third and a fourth NLS.

[0020] In some embodiments, the fusion protein, from the N-terminus to the C-terminus, comprises a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZFP28 KRAB domain, and a third and a fourth NLS. In certain embodiments, the fusion protein may comprise the amino acid sequence of SEQ ID NO: 661 or a sequence that is at least 90% identical thereto.

[0021] In some embodiments, the fusion protein, from the N-terminus to the C-terminus, comprises a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZFP28 KRAB domain, and a third and a fourth NLS.

[0022] In some embodiments, the fusion protein, from the N-terminus to the C-terminus, comprises a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZN627 KRAB domain, and a third and a fourth NLS. In certain embodiments, the fusion protein may comprise the amino acid sequence of SEQ ID NO: 662 or a sequence that is at least 90% identical thereto.

[0023] In some embodiments, the fusion protein, from the N-terminus to the C-terminus, comprises a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZN627 KRAB domain, and a third and a fourth NLS.

[0024] In some embodiments, the fusion protein, from the N-terminus to the C-terminus, comprises a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZIM3 KRAB domain, and a third and a fourth NLS. In certain embodiments, the fusion protein may comprise the amino acid sequence of SEQ ID NO: 663 or a sequence that is at least 90% identical thereto.

[0025] In some embodiments, the fusion protein, from the N-terminus to the C-terminus, comprises a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZIM3 KRAB domain, and third and fourth NLSs.

[0026] In some embodiments, at least one of the NLSs in the fusion proteins described herein is an SV40 NLS (e.g., SEQ ID NO: 644).

[0027] In some embodiments, the system a) a first fusion protein comprising a first DNA binding domain and comprising or recruiting a DNMT3A domain a second fusion protein comprising a second DNA binding domain and comprising or recruiting a DNMT3L domain a third fusion protein comprising a third DNA binding domain and comprising or recruiting a transcriptional repressor domain, or b) one or more nucleic acid molecules encoding the fusion protein and comprises.

[0028] The present disclosure also provides human cells comprising the systems described herein, or progeny of such cells. In some embodiments, the cells are T lymphocytes or NK cells.

[0029] The present disclosure also provides human cells (which may be ex vivo) modified by the systems described herein, or progeny of such cells. In some embodiments, the cells are T lymphocytes or NK cells.

[0030] The present disclosure also provides a pharmaceutical composition comprising the systems described herein and a pharmaceutically acceptable excipient. In some embodiments, the composition comprises lipid nanoparticles (LNPs) comprising the system and / or the DNA binding domain is a dCas domain, and the LNP further comprises one or more gRNAs.

[0031] The present disclosure also provides a pharmaceutical composition comprising the human cells described herein and a pharmaceutically acceptable excipient.

[0032] The present disclosure also provides a method of treating a patient in need thereof, comprising administering to the patient (e.g., intravenously) the systems, human cells, or pharmaceutical compositions described herein. In some embodiments, the patient has cancer or an autoimmune disease.

[0033] The present disclosure also provides the systems, human cells, or pharmaceutical compositions described herein for use in treating a patient in need thereof, e.g., in the methods described herein.

[0034] The present disclosure also provides the use of the systems or human cells described herein in the manufacture of a medicament for treating a patient in need thereof, e.g., in the methods described herein.

[0035] The present disclosure also provides articles and kits comprising the systems or human cells described herein.

[0036] Other features, objects, and advantages of the invention will be apparent from the following detailed description. However, it should be understood that the detailed description is provided for purposes of illustration only and is not intended to be limiting. Various changes and modifications within the scope of the invention will be apparent to those skilled in the art from the detailed description.

[0037] Detailed Description of the Invention The present disclosure provides an epigenetic editor for suppressing the expression of the human TRAC gene. By altering the expression of TRAC, the editors herein can be used to generate allogeneic cells (e.g., T cells, NK cells, etc.) with reduced alloreactivity. Unless otherwise specified, "TRAC" (italicized) herein refers to the human TRAC gene. The sequence of the human TRAC gene can be obtained with Ensembl Accession No. ENSG00000277734. The epigenetic editors of the present invention have several advantages compared to other genome engineering methods, including reversibility, reduced risk of chromosomal translocation, and long-term heritable silencing.

[0038] In some embodiments, the region of the human TRAC gene targeted for epigenetic regulation (epigenetic control) is approximately 2 kb in length and is approximately ±1 kb from the TRAC transcription start site (TSS). In certain embodiments, that region has the nucleotide sequence of SEQ ID NO: 1220 (below). In some embodiments, the targeted TRAC region is approximately 1000 bp in length and is approximately ±500 bp from the TRAC TSS. In certain embodiments, the region to be targeted has the nucleotide sequence of SEQ ID NO: 1219 (below). The TRAC TSS is at #chr14:22547506 of genome GRCh38:CM000676.2.

[0039] TGTGATAGATTTCCCAACTTAATGCCAACATACCATAAACCTCCCATTCTGCTAATGCCC AGCCTAAGTTGGGGAGACCACTCCAGATTCCAAGATGTACAGTTTGCTTTGCTGGGCCTT TTTCCCATGCCTGCCTTTACTCTGCCAGAGTTATATTGCTGGGGTTTTGAAGAAGATCCT ATTAAATAAAAGAATAAGCAGTATTATTAAGTAGCCCTGCATTTCAGGTTTCCTTGAGTG GCAGGCCAGGCCTGGCCGTGAACGTTCACTGAAATCATGGCCTCTTGGCCAAGATTGATA GCTTGTGCCTGTCCCTGAGTCCCAGTCCATCACGAGCAGCTGGTTTCTAAGATGCTATTT CCCGTATAAAGCATGAGACCGTGACTTGCCAGCCCCACAGAGCCCCGCCCTTGTCCATCA CTGGCATCTGGACTCCAGCCTGGGTTGGGGCAAAGAGGGAAATGAGATCATGTCCTAACC CTGATCCTCTTGTCCCACAGATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGA CTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGT GTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTC TATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGC AAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGGTAAGGG CAGCTTTGGTGCCTTCGCAGGCTGTTTCCTTGCTTCAGGAATGGCCAGGTTCTGCCCAGA GCTCTGGTCAATGATGTCTAAAACTCCTCTGATTGGTGGTCTCGGCCTTATCCATTGCCA CCAAAACCCTCTTTTTACTAAGAAACAGTGAGCCTTGTTCTGGCAGTCCAGAGAATGACA CGGGAAAAAAGCAGATGAAGAGAAGGTGGCAGGAGAGGGCA (SEQ ID NO: 1219)

[0040] CATGCTAATCCTCCGGCAAACCTCTGTTTCCTCCTCAAAAGGCAGGAGGTCGGAAAGAAT AAACAATGAGAGTCACATTAAAAACACAAAATCCTACGGAAATACTGAAGAATGAGTCTC AGCACTAAGGAAAAGCCTCCAGCAGCTCCTGCTTTCTGAGGGTGAAGGATAGACGCTGTG GCTCTGCATGACTCACTAGCACTCTATCACGGCCATATTCTGGCAGGGTCAGTGGCTCCA ACTAACATTTGTTTGGTACTTTACAGTTTATTAAATAGATGTTTATATGGAGAAGCTCTC ATTTCTTTCTCAGAAGAGCCTGGCTAGGAAGGTGGATGAGGCACCATATTCATTTTGCAG GTGAAATTCCTGAGATGTAAGGAGCTGCTGTGACTTGCTCAAGGCCTTATATCGAGTAAA CGGTAGTGCTGGGGCTTAGACGCAGGTGTTCTGATTTATAGTTCAAAACCTCTATCAATG AGAGAGCAATCTCCTGGTAATGTGATAGATTTCCCAACTTAATGCCAACATACCATAAAC CTCCCATTCTGCTAATGCCCAGCCTAAGTTGGGGAGACCACTCCAGATTCCAAGATGTAC AGTTTGCTTTGCTGGGCCTTTTTCCCATGCCTGCCTTTACTCTGCCAGAGTTATATTGCT GGGGTTTTGAAGAAGATCCTATTAAATAAAAGAATAAGCAGTATTATTAAGTAGCCCTGC ATTTCAGGTTTCCTTGAGTGGCAGGCCAGGCCTGGCCGTGAACGTTCACTGAAATCATGG CCTCTTGGCCAAGATTGATAGCTTGTGCCTGTCCCTGAGTCCCAGTCCATCACGAGCAGC TGGTTTCTAAGATGCTATTTCCCGTATAAAGCATGAGACCGTGACTTGCCAGCCCCACAG AGCCCCGCCCTTGTCCATCACTGGCATCTGGACTCCAGCCTGGGTTGGGGCAAAGAGGGA AATGAGATCATGTCCTAACCCTGATCCTCTTGTCCCACAGATATCCAGAACCCTGACCCT GCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGAT TTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAA ACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAAC AAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTC TTCCCCAGCCCAGGTAAGGGCAGCTTTGGTGCCTTCGCAGGCTGTTTCCTTGCTTCAGGA ATGGCCAGGTTCTGCCCAGAGCTCTGGTCAATGATGTCTAAAACTCCTCTGATTGGTGGT CTCGGCCTTATCCATTGCCACCAAAACCCTCTTTTTACTAAGAAACAGTGAGCCTTGTTC TGGCAGTCCAGAGAATGACACGGGAAAAAAGCAGATGAAGAGAAGGTGGCAGGAGAGGGC ACGTGGCCCAGCCTCAGTCTCTCCAACTGAGTTCCTGCCTGCCTGCCTTTGCTCAGACTG TTTGCCCCTTACTGCTCTTCTAGGCCTCATTCTAAGCCCCTTCTCCAAGTTGCCTCTCCT TATTTCTCCCTGTCTGCCAAAAAATCTTTCCCAGCTCACTAAGTCAGTCTCACGCAGTCA CTCATTAACCCACCAATCACTGATTGTGCCGGCACATGAATGCACCAGGTGTTGAAGTGG AGGAATTAAAAAGTCAGATGAGGGGTGTGCCCAGAGGAAGCACCATTCTAGTTGGGGGAG CCCATCTGTCAGCTGGGAAAAGTCCAAATAACTTCAGATTGGAATGTGTTTTAACTCAGG GTTGAGAAAACAGCTACCTTCAGGACAAAAGTCAGGGAAGGGCTCTCTGAAGAAATGCTA CTTGAAGATACCAGCCCTACCAAGGGCAGGGAGAGGACCCTATAGAGGCCTGGGACAGGA GCTCAATGAGAAAGGAGAAGA (SEQ ID NO: 1220)

[0041] In some embodiments, the target site can be 10 to 50 bp (e.g., 10 to 40, 10 to 30, 10 to 20, 15 to 30, 15 to 25, or 15 to 20 bp) in length. In some embodiments, the target strand of the target region is the sense strand of the gene. In other embodiments, the target strand of the target region is the antisense strand of the gene.

[0042] In some embodiments, the epigenetic editors described herein can include one or more fusion proteins, each of which includes a DNA binding domain linked to one or more effector domains for epigenetic modification. In certain embodiments, when the DNA binding domain is a DNA binding domain guided to a polynucleotide, the epigenetic editor may further include one or more guide polynucleotides. The DNA binding domains, effector domains, and guide polynucleotides of the epigenetic editors described herein can be selected in any functional combination from, for example, those described below.

[0043] The epigenetic editors described herein may be transiently expressed in a host cell or may be integrated into the genome of the host cell; such cells and their progeny are also contemplated in the present disclosure. Both transiently expressed epigenetic editors and integrated epigenetic editors, or their components, can effect stable epigenetic modifications. For example, after introducing an epigenetic editor described herein into a host cell, a target gene within the host cell can be stably or permanently repressed or silenced. In some embodiments, the expression of the target gene is repressed or silenced for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 1 year, at least 2 years, or over the entire lifespan of the cell or subject bearing the cell, compared to the expression level in the absence of the epigenetic editor. Epigenetic modifications can be inherited by progeny of the host cell into which the epigenetic editor has been introduced.

[0044] The epigenetic editor of the present invention can be introduced into cells (e.g., human T lymphocytes or human NK cells) that are introduced into a patient (e.g., a human patient) in need thereof.

[0045] I. DNA Binding Domain The epigenetic editors described herein can include one or more DNA binding domains that direct the effector domain of the epigenetic editor to a target sequence within or near the TRAC locus. The DNA binding domains described herein can be, for example, DNA binding domains guided by a polynucleotide, zinc finger protein (ZFP) domains, transcription activator-like effector (TALE) domains, meganuclease DNA binding domains, and the like. Examples of DNA binding domains can be found in U.S. Patent No. 11,162,114, which is hereby incorporated by reference in its entirety.

[0046] In some embodiments, the DNA binding domains described herein are encoded by their native coding sequences. In other embodiments, the DNA binding domains are encoded by nucleotide sequences that are codon-optimized for optimal expression in human cells.

[0047] A. DNA Binding Domain Guided by a Polynucleotide In some embodiments, the DNA binding domain herein can be a protein domain that is directed to a target site at the TRAC locus by a guide nucleic acid sequence (e.g., a guide RNA sequence). In certain embodiments, the protein domain can be derived from a CRISPR-associated nuclease, e.g., a class I or II CRISPR-associated nuclease. In some embodiments, the protein domain can be derived from a Cas nuclease, e.g., a type II, IIA, IIB, IIC, V, or VI Cas nuclease. In certain embodiments, the protein domain can be derived from a class II Cas nuclease selected from Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas14a, Cas14b, Cas14c, CasX, CasY, CasPhi, C2c4, C2c8, C2c9, C2c10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, and homologs and modified versions thereof. "Derived from" is used to mean that the protein domain includes the full-length polypeptide sequence of the parent protein or a variant thereof (e.g., having deletions, insertions, and / or substitutions of amino acid residues). The variant retains the desired function of the parent protein (e.g., the ability to form a complex with a guide nucleic acid sequence and target DNA).

[0048] In some embodiments, the CRISPR-related protein domain can be the Cas9 domain described herein. Cas9 can refer to, for example, a polypeptide having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity and / or sequence similarity to the wild-type Cas9 polypeptide described herein. In some embodiments, the wild-type polypeptide is Cas9 derived from Streptococcus pyogenes (NCBI reference number NC_002737.2 (SEQ ID NO: 1)) and / or UniProt reference number Q99ZW2 (SEQ ID NO: 2). In some embodiments, the wild-type polypeptide is Cas9 derived from Staphylococcus aureus (SEQ ID NO: 3). In some embodiments, the CRISPR-related protein domain is a Cpf1 domain or protein, or a polypeptide having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity and / or sequence similarity to the wild-type Cpf1 polypeptide described herein (e.g., Cpf1 derived from Franscisella novicida (UniProt reference number U2UMQ6 or SEQ ID NO: 4)). In certain embodiments, the CRISPR-related protein domain can be a modified form, fusion, or chimera of the wild-type protein, including changes in one or more amino acid residues, such as deletions, insertions, or substitutions, or any combination thereof.

[0049] The structures of Cas9 arrays and variant Cas9 orthologs have been described for various organisms. Exemplary organisms from which the Cas9 domains herein can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gamma proteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckiidelbrueckii), Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionium, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus wassonii, Nitrosococcuswatsoni), Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, and Acaryochloris marina, but are not limited thereto. The Cas9 sequences also include those derived from the organisms and loci disclosed by Chylinski et al., RNA Biol. (2013) 10(5):726-37.

[0050] In some embodiments, the Cas9 domain is derived from Streptococcus pyogenes (spCas9). In some embodiments, the Cas9 domain is derived from Staphylococcus aureus (saCas9).

[0051] Other Cas domains are also contemplated for use in the epigenetic editors herein. These include, for example, those derived from CasX (Cas12E) (e.g., SEQ ID NO: 5), CasY (Cas12d) (e.g., SEQ ID NO: 6), Casφ (CasPhi) (e.g., SEQ ID NO: 7), Cas12f1 (Cas14a) (e.g., SEQ ID NO: 8), Cas12f2 (Cas14b) (e.g., SEQ ID NO: 9), Cas12f3 (Cas14c) (e.g., SEQ ID NO: 10), and C2c8 (e.g., SEQ ID NO: 11).

[0052] Regarding epigenetic editing, a protein domain derived from a nuclease (e.g., Cas9 or Cpf1 domain) may have reduced or no DNA cleavage activity while still retaining the ability to form a complex with a guide nucleic acid sequence (e.g., guide RNA) and target DNA. For example, nuclease activity may be reduced by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% compared to the wild-type domain. In some embodiments, the CRISPR-related protein domains described herein are catalytically inactive ("dead"). Examples of such domains include, for example, dCas9 ("dead" Cas9), dCpf1, ddCpf1, dCasPhi, ddCas12a, dLbCpf1, and dFnCpf1. The dCas9 protein domain may contain, for example, one, two, or more mutations that suppress its nuclease activity compared to wild-type Cas9. The DNA cleavage domain of Cas9 is known to contain two subdomains, the HNH nuclease subdomain and the RuvC1 subdomain. The HNH subdomain cleaves the strand complementary to the gRNA, while the RuvC1 subdomain cleaves the non-complementary strand. Mutations within these subdomains can silence the nuclease activity of Cas9. For example, the mutations D10A (in the case of RuvC1) and H840A (in the case of HNH) completely inactivate the nuclease activity of SpCas9. Similarly, SaCas9 can be inactivated by the mutations D10A and N580A. In some embodiments, dCas9 contains at least one mutation that reduces or suppresses nuclease activity in the HNH subdomain and / or the RuvC1 subdomain. In some embodiments, dCas9 contains only the RuvC1 subdomain or only the HNH subdomain.It should be understood that any mutation that inactivates the RuvC1 and / or HNH domain, such as an insertion, deletion, or single or multiple amino acid substitutions in the RuvC1 domain and / or HNH domain, can be included in the dCas9 herein.

[0053] In some embodiments, the dCas9 protein herein is numbered in the sequence provided by UniProt accession number Q99ZW2 (SEQ ID NO: 2) and contains a mutation at the position corresponding to position D10 (e.g., D10A), position H840 (e.g., H840A), or both in the wild-type SpCas9 sequence. In certain embodiments, dCas9 comprises the amino acid sequence of dSpCas9 (D10A and H840A) (SEQ ID NO: 12).

[0054] In some embodiments, the dCas9 protein described herein contains a mutation at the position corresponding to position D10 (e.g., D10A), position N580 (e.g., N580A), or both in the wild-type SaCas9 sequence (e.g., SEQ ID NO: 3). In certain embodiments, dCas9 comprises the amino acid sequence of dSaCas9 (D10A and N580A) (SEQ ID NO: 13).

[0055] Additional suitable mutations that inactivate Cas9 will be apparent to those skilled in the art based on the present disclosure and knowledge in the art and are within the scope of the present disclosure. Such mutations can include, but are not limited to, D839A, N863A, and / or K603R in SpCas9. The present disclosure contemplates any mutation that reduces or inhibits the nuclease activity of any Cas9 described herein (e.g., a mutation corresponding to any of the Cas9 mutations described herein).

[0056] The dCpf1 protein domain can contain one, two, or more mutations that reduce or inhibit its nuclease activity compared to wild-type Cpf1. The Cpf1 protein has a RuvC-like endonuclease domain similar to the RuvC domain of Cas9 but does not have an HNH endonuclease domain, and the N-terminus of Cpf1 does not have the alpha-helical recognition lobe of Cas9. In some embodiments, dCpf1 contains one or more mutations corresponding to D917A, E1006A, or D1255A numbered in the sequence of the Francisella novicida Cpf1 protein (FnCpf1, SEQ ID NO: 4). In certain embodiments, the dCpf1 protein contains a mutation corresponding to position D917A, position E1006A, position D1255A, position D917A / E1006A, position D917A / D1255A, position E1006A / D1255A, or position D917A / E1006A / D1255A, or a corresponding mutation in any of the Cpf1 amino acid sequences described herein. In some embodiments, dCpf1 contains the D917A mutation. In a particular embodiment, dCpf1 contains the amino acid sequence of dFnCpf1 (SEQ ID NO: 14).

[0057] Additional nuclease-inactive CRISPR-associated protein domains contemplated herein include, for example, those derived from dNmeCas9 (e.g., SEQ ID NO: 15), dCjCas9 (e.g., SEQ ID NO: 16), dSt1Cas9 (e.g., SEQ ID NO: 17), dSt3Cas9 (e.g., SEQ ID NO: 18), dLbCpf1 (e.g., SEQ ID NO: 19), dAsCpf1 (e.g., SEQ ID NO: 20), denAsCpf1 (e.g., SEQ ID NO: 21), dHFAsCpf1 (e.g., SEQ ID NO: 22), dRVRAsCpf1 (e.g., SEQ ID NO: 23), dRRAsCpf1 (e.g., SEQ ID NO: 24), dCasX (e.g., SEQ ID NO: 25), and dCasPhi (e.g., SEQ ID NO: 26).

[0058] In some embodiments, the Cas9 domains described herein can be high-fidelity Cas9 domains that include, for example, one or more mutations that reduce the electrostatic interaction between the Cas9 domain and the DNA sugar-phosphate backbone to confer increased target binding specificity. In certain embodiments, the high-fidelity Cas9 domain can be nuclease-inactive as described herein.

[0059] The CRISPR-related protein domains described herein can recognize protospacer adjacent motif (PAM) sequences in target genes. The "PAM" sequence is typically a 2-6 bp DNA sequence immediately following the sequence targeted by the CRISPR-related protein domain. The PAM sequence is required for CRISPR protein binding and cleavage, but is not part of the target sequence. The CRISPR-related protein domain can either recognize a naturally occurring or canonical PAM sequence or can have altered PAM specificity. CRISPR-related protein domains that bind to non-canonical PAM sequences are described in the art. For example, Cas9 domains that bind to non-canonical PAM sequences are described in Kleinstiver et al., Nature (2015) 523(7561):481-5 and Kleinstiver et al., Nat Biotechnol. (2015) 33:1293-8. Such Cas9 domains can include, for example, those derived from "VRER" SpCas9, "EQR" SpCas9, "VQR" SpCas9, "SpG Cas9", "SpRYCas9", and "KKH" SaCas9. Also contemplated are nuclease-inactive versions of these Cas9 domains, for example, nuclease-inactive VRER SpCas9 (e.g., SEQ ID NO: 27), nuclease-inactive EQR SpCas9 (e.g., SEQ ID NO: 28), nuclease-inactive VQR SpCas9 (e.g., SEQ ID NO: 29), nuclease-inactive SpG Cas9 (e.g., SEQ ID NO: 30), nuclease-inactive SpRY Cas9 (e.g., SEQ ID NO: 31), and nuclease-inactive KKH SaCas9 (e.g., SEQ ID NO: 32). Another example is Cas9 from Francisella novicida engineered to recognize 5'-YG-3' (where "Y" is a pyrimidine).

[0060] Additional suitable CRISPR-related proteins, orthologs, and variants including nuclease-inactive variants and sequences will be apparent to those skilled in the art based on the present disclosure.

[0061] The guide RNAs that can be used with the CRISPR-related protein domains herein are further described in Section II below.

[0062] B. Zinc Finger Protein Domains In some embodiments, the DNA binding domain of the epigenetic editors described herein comprises a zinc finger protein (ZFP) domain (or "ZF domain" as used herein). A ZFP is a protein having at least one zinc finger and binds to DNA in a sequence-specific manner. A "zinc finger" (ZF) or "zinc finger motif" (ZF motif) refers to a polypeptide domain that includes a beta-beta-alpha (ββα) type protein fold stabilized by zinc ions. A ZF binds to 2-4 nucleotide base pairs, typically 3 or 4 base pairs (either continuous or discontinuous). Each ZF typically contains approximately 30 amino acids. A ZFP domain can include multiple ZFs that make tandem contacts with their target nucleic acid sequences. Tandem arrays of ZFs may be engineered to generate artificial ZFPs that bind to a desired nucleic acid target. ZFPs can be rationally designed by using a database that includes triplet (or quadruplet) nucleotide sequences and individual ZF amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with the amino acid sequence of one or more ZFs that bind to a specific triplet or quadruplet sequence. See, e.g., U.S. Pat. Nos. 6,453,242, 6,534,261, and 8,772,453.

[0063] ZFPs are widely present in eukaryotic cells and can belong to, for example, the C2H2 class, CCHC class, PHD class, or RING class. An exemplary motif that characterizes one class of these proteins (the C2H2 class) is -Cys-(X) 2-4 -Cys-(X) 12 -His-(X) 3-5-His-(SEQ ID NO: 657), where X is any independently selected amino acid. In some embodiments, the ZFP domains herein may include a ZF array comprising contiguous C2H2-ZFs each contacting three or more contiguous nucleotides.

[0064] The ZFP domains of the epigenetic editors described herein may include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more ZFs. The ZFP domain may include an array of 2-finger or 3-finger units, e.g., 3, 4, 5, 6, 7, 8, 9, or 10, or more units, where each unit binds to a sub-site in the target sequence. In some embodiments, a ZFP domain comprising at least 3 ZFs recognizes a target DNA sequence of 9 or 10 nucleotides. In some embodiments, a ZFP domain comprising at least 4 ZFs recognizes a target DNA sequence of 12-14 nucleotides. In some embodiments, a ZFP domain comprising at least 6 ZFs recognizes a target DNA sequence of 18-21 nucleotides.

[0065] In some embodiments, the ZFs in the ZFP domains described herein are connected via a peptide linker. The peptide linker can be of a length of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more amino acids. In some embodiments, the linker comprises 5 or more amino acids. In some embodiments, the linker comprises 7-17 amino acids. The linker can be flexible or rigid.

[0066] In some embodiments, the zinc finger array has the sequence: SRPGERPFQCRICMRNFSXXXXXXXHXXTHTGEKPFQCRICMRNFSXXXXXXXHXXTH[Linker]FQCRICMRNFSXXXXXXXHXXTHTGEKPFQCRICMRNFSXXXXXXXHXXTH[Linker]PFQCRICMRNFSXXXXXXXHXXTHTGEKPFQCRICMRNFSXXXXXXXHXXTHLRGS (SEQ ID NO: 650) Or may have a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto, where "XXXXXXX" represents the amino acids of the ZF recognition helix that confers DNA binding specificity to the zinc finger, and each X can be independently selected. In the above sequence, "XX" shown in italics can be TR, LR, or LK, and "[Linker]" represents a linker sequence. In some embodiments, the linker sequence is TGSQKP (SEQ ID NO: 651), and this linker can be used when the sub-site targeted by the ZF is adjacent. In some embodiments, the linker sequence is TGGGGSQKP (SEQ ID NO: 652), and this linker can be used when there are bases between the sub-sites targeted by the zinc finger. The two shown linkers may be the same or different. In some embodiments, the linker sequence is at least 5 amino acids in length. In some embodiments, the linker sequence is at most 250 amino acids in length.

[0067] The ZFP domains herein can include an array of two or more adjacent ZFs that are directly adjacent to each other (e.g., separated by a short (canonical) linker sequence) or separated by a long flexible or structured polypeptide sequence. In some embodiments, directly adjacent fingers bind to contiguous nucleic acid sequences, i.e., adjacent triplets / nucleotides. In some embodiments, adjacent fingers crosslink between their respective target triplets, which can help to enhance or strengthen the recognition of the target sequence and result in binding of overlapping sequences. In some embodiments, distal ZFs within the ZFP domain can recognize (or bind to) non-contiguous nucleotide sequences.

[0068] Exemplary TRAC target genomic sequences are shown in Table 1 below.

[0069] [Table 1] TIFF2025524455000002.tif133142

[0070] In some embodiments, the ZFP domain of this epigenetic editor binds to a target sequence selected from any one of SEQ ID NOs: 700 to 760. The ZF can include the ZF framework sequence of SEQ ID NO: 650, or any other ZF framework known in the art.

[0071] C. TALE In some embodiments, the DNA binding domain of the epigenetic editors described herein comprises a transcription activator-like effector (TALE) domain. The DNA binding domain of TALE contains a highly conserved sequence of about 33-34 amino acids and has repeat variable di-residues (RVDs) that serve as the centers for recognition of specific nucleotides at positions 12 and 13. TALEs can be engineered to bind to virtually any desired DNA sequence. Methods for programming TALEs are known in the art. For example, such methods are described in Carroll et al., Genet Soc Amer. (2011) 188(4):773-82, Miller et al., Nat Biotechnol. (2007) 25(7):778-85, Christian et al., Genetics (2008) 186(2):757-61, Li et al., Nucl Acids Res. (2010) 39(1):359-72, and Moscou et al., Science (2009) 326(5959):1501.

[0072] D. Other DNA Binding Domains Other DNA binding domains are contemplated for the epigenetic editors described herein. In some embodiments, the DNA binding domain includes an Argonaute protein domain, for example, one derived from Natronobacterium gregoryi (NgAgo). NgAgo is an ssDNA-guided endonuclease that is guided to its target site by 5'-phosphorylated ssDNA (gDNA), where it introduces a double-strand break. In contrast to Cas9, the NgAgo-gDNA system does not require a protospacer adjacent motif (PAM). Thus, the use of nuclease-inactive NgAgo (dNgAgo) can greatly expand the bases that can be targeted. The characterization and use of NgAgo are described, for example, in Gao et al., Nat Biotechnol. (2016) 34(7):768-73, Swarts et al., Nature (2014) 507(7491):258-61, and Swarts et al., Nucl Acids Res. (2015) 43(10):5120-9.

[0073] In some embodiments, the DNA binding domain includes an inactivated nuclease, for example, an inactivated meganuclease. Additional non-limiting examples of DNA binding domains include the tetracycline repressor (tetR) DNA binding domain, leucine zipper, helix-loop-helix (HLH) domain, helix-turn-helix domain, β-sheet motif, steroid receptor motif, bZIP domain, homeodomain, and AT hook.

[0074] II. Guide Polynucleotide The epigenetic editors described herein that include a DNA-binding domain guided by a polynucleotide can also include a guide polynucleotide that can form a complex with the DNA-binding domain. The guide polynucleotide can include RNA, DNA, or a mixture of both. For example, when the DNA-binding domain guided by a polynucleotide is a CRISPR-associated protein domain, the guide polynucleotide can be a guide RNA (gRNA). "Guide RNA" or "gRNA" refers to a nucleic acid that can hybridize to a target sequence and direct the binding of a CRISPR-Cas complex to the target sequence. Methods of using guide polynucleotide sequences with programmable DNA-binding proteins (e.g., CRISPR-associated protein domains) for site-specific DNA targeting (e.g., for modifying the genome) are known in the art.

[0075] A guide polynucleotide sequence (e.g., a gRNA sequence) can include two portions: 1) a nucleotide sequence that includes a “targeting sequence” that is complementary to a target nucleic acid sequence (the “target sequence”), e.g., a nucleic acid sequence contained in a genomic target site, and 2) a nucleotide sequence that binds to a DNA binding domain (e.g., a CRISPR-Cas protein domain) that is guided by the polynucleotide. The nucleotide sequence of 1) can include a targeting sequence that is 100% complementary to a genomic nucleic acid sequence, e.g., a nucleic acid sequence contained in a genomic target site, and thus can hybridize to the target nucleic acid sequence. The nucleotide sequence of 1) can be referred to as, for example, a crispr RNA or crRNA. The nucleotide sequence of 2) can be referred to as a scaffold sequence of the guide nucleic acid, e.g., a tracrRNA, or an activation region of the guide nucleic acid, and can include a stem-loop structure. The above-described portions 1) and 2) can be fused to form one single guide (e.g., a single guide RNA or sgRNA), or can be on two separate nucleic acid molecules. In some embodiments, the guide polynucleotide includes portions 1) and 2) connected by a linker. In some embodiments, the guide polynucleotide includes portions 1) and 2) connected by a non-nucleic acid linker, e.g., a peptide linker or a chemical linker.

[0076] Portion 2 (scaffold sequence) of the guide polynucleotide described herein can be, for example, that described in Jinek et al., Science (2012) 337:816-21, U.S. Patent Application Publication No. 2016 / 0208288, or U.S. Patent Application Publication No. 2016 / 0200779. Variants of portion 2) are also contemplated by the present disclosure. For example, the tetraloop and stemloop of the gRNA scaffold (tracrRNA) sequence can be modified to include an RNA aptamer that can be bound by a specific protein domain. In some embodiments, such modified gRNAs can be used to facilitate the recruitment of a repression or activation domain fused to an RNA aptamer that interacts with the protein.

[0077] The gRNAs provided herein typically include a targeting domain and a binding domain. The targeting domain (also referred to as the “targeting sequence”) can include a nucleic acid sequence that binds to a target site, such as a genomic nucleic acid molecule within a cell. The target site can be a double-stranded DNA sequence that includes a PAM sequence and a target sequence that is located directly adjacent thereto on the same strand as the PAM sequence. The targeting domain of the gRNA can include an RNA sequence that corresponds to the target sequence, i.e., it is similar to the sequence of the targeting domain and may have one or more mismatches, but typically includes an RNA sequence instead of a DNA sequence. The targeting domain of the gRNA can thus base pair (with complete or partial complementarity) with the sequence of the double-stranded target site that is complementary to the target sequence and thus with the strand that is complementary to the strand that includes the PAM sequence. It will be understood that the targeting domain of the gRNA typically does not include a sequence similar to the PAM sequence. It will further be understood that the position of the PAM can be 5' or 3' of the target sequence, depending on the nuclease being utilized. For example, the PAM is typically 3' of the target sequence for Cas9 nuclease and 5' of the target sequence for Cas12a nuclease. For an illustration of the position of the PAM and the mechanism by which the gRNA binds to the target site, see, for example, FIG. 1 of Vanegas et al., Fungal Biol Biotechnol. (2019) 6:6, which is incorporated herein by reference. For additional illustrations and explanations of the mechanism of gRNA targeting to the target site of RNA-guided nucleases, see Fu et al., Nat Biotechnol (2014) 32(3):279-84 and Sternberg et al., Nature (2014) 507(7490):62-7, which are each incorporated herein by reference.

[0078] In some embodiments, the targeting domain sequence comprises 17 to 30 nucleotides and is fully complementary to the target sequence (i.e., has no mismatched nucleotides). In some embodiments, however, the targeting domain sequence can contain one or more, typically four or fewer, mismatches, e.g., one, two, three, or four mismatches. The targeting domain is part of the gRNA, which being an RNA molecule will typically contain ribonucleotides, while a DNA targeting domain will contain deoxyribonucleotides.

[0079] An exemplary illustration of a Cas9 target site containing a 22-nucleotide target domain and an NGG PAM sequence, and a gRNA containing a targeting domain that is fully complementary to the target sequence (and thus base pairs with perfect complementarity to the DNA strand complementary to the strand containing the target sequence and PAM) is provided below. TIFF2025524455000003.tif41156

[0080] An exemplary illustration of a Cas12a target site containing a 22-nucleotide target domain and a TTN PAM sequence, and a gRNA containing a targeting domain that is fully complementary to the target sequence (and thus base pairs with perfect complementarity to the DNA strand complementary to the strand containing the target sequence and PAM) is provided below. TIFF2025524455000004.tif39157

[0081] While not wishing to be bound by theory, in at least some embodiments, the length of the targeting domain and its complementarity to the target sequence are thought to contribute to the specificity of the interaction between the gRNA / Cas9 molecular complex and the target nucleic acid. In some embodiments, the targeting domain of the gRNA provided herein is 5 to 50 nucleotides in length. In some embodiments, the targeting domain is 15 to 25 nucleotides in length. In some embodiments, the targeting domain is 18 to 22 nucleotides in length. In some embodiments, the targeting domain is 19 to 21 nucleotides in length. In some embodiments, the targeting domain is 15 nucleotides in length. In some embodiments, the targeting domain is 16 nucleotides in length. In some embodiments, the targeting domain is 17 nucleotides in length. In some embodiments, the targeting domain is 18 nucleotides in length. In some embodiments, the targeting domain is 19 nucleotides in length. In some embodiments, the targeting domain is 20 nucleotides in length. In some embodiments, the targeting domain is 21 nucleotides in length. In some embodiments, the targeting domain is 22 nucleotides in length. In some embodiments, the targeting domain is 23 nucleotides in length. In some embodiments, the targeting domain is 24 nucleotides in length. In some embodiments, the targeting domain is 25 nucleotides in length. In certain embodiments, the targeting domain corresponds exactly, without mismatches, to the target sequence provided herein or a portion thereof. In some embodiments, the targeting domain of the gRNA provided herein includes one mismatch to the target sequence provided herein. In some embodiments, the targeting domain includes two mismatches to the target sequence. In some embodiments, the targeting domain includes three mismatches to the target sequence.

[0082] Methods for designing, selecting, and validating gRNAs are described herein and are known in the art. Software tools can be used to optimize gRNAs corresponding to target DNA sequences, for example, to minimize the overall off-target activity across the genome. For example, a DNA sequence search algorithm can be used to identify the target sequence within the crRNA of a gRNA for use with Cas9. Exemplary gRNA design tools include those described in Bae et al., Bioinformatics (2014) 30:1473-5.

[0083] The guide polynucleotides (e.g., gRNA) described herein can be of various lengths. In some embodiments, the length of the spacer or targeting sequence depends on the CRISPR-associated protein component of the epigenetic editor system used. For example, Cas proteins from different bacterial species have various optimal targeting sequence lengths. Thus, the spacer sequence can include, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more than 50 nucleotides in length. In some embodiments, the spacer includes 10-24, 11-20, 11-16, 18-24, 19-21, or 20 nucleotides in length. In some embodiments, the guide polynucleotide (e.g., gRNA) is 15-100 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides in length and includes a spacer sequence of at least 10 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) consecutive nucleotides complementary to the target sequence. In some embodiments, the guide polynucleotides described herein can have, for example, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, or more nucleotides truncated.

[0084] In certain embodiments, the 3' end of the TRAC target sequence is directly adjacent to a PAM sequence (e.g., a canonical PAM sequence, e.g., NGG for SpCas9). The degree of complementarity between the targeting sequence of the guide polynucleotide (e.g., the spacer sequence of the gRNA) and the target sequence can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In certain embodiments, the targeting sequence and the target sequence can be 100% complementary. In other embodiments, the targeting sequence and the target sequence can include, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.

[0085] The guide polynucleotide (e.g., gRNA) may be modified, for example, by chemical modification and synthetic modification. The modified gRNA can include, for example, one or both of the unlinked phosphate oxygens in the phosphodiester backbone linkage and / or one or more modifications or replacements of the linked phosphate oxygens, modification of the ribose sugar (e.g., the 2'-hydroxyl of the ribose sugar), modification of the phosphate moiety, modification or replacement of the naturally occurring nucleobases, modification or replacement of the ribose-phosphate backbone, modification of the 3' end and / or 5' end of the oligonucleotide, replacement of the terminal phosphate group, or conjugation of a moiety, cap, or linker, or any combination thereof.

[0086] In some embodiments, one or more ribose groups of the gRNA may be modified. Examples of chemical modifications to ribose groups include, but are not limited to, 2'-O-methyl (2'-OMe), 2'-fluoro (2'-F), 2'-deoxy, 2'-O-(2-methoxyethyl) (2'-MOE), 2'-NH2, 2'-O-allyl, 2'-O-ethylamine, 2'-O-cyanoethyl, 2'-O-acetal ester, or bicyclic nucleotides, such as locked nucleic acid (LNA), 2'-(5-constrained ethyl (S-cEt)), constrained MOE, or 2'-0,4'-C-aminomethylene bridged nucleic acid (2',4'-BNANC). 2'-O-methyl modification and / or 2'-fluoro modification can increase the binding affinity and / or nuclease stability of the gRNA oligonucleotide.

[0087] In some embodiments, one or more phosphate groups of the gRNA may be chemically modified. Examples of chemical modifications to phosphate groups include, but are not limited to, phosphorothioate (PS), phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, and phosphotriester modifications. In some embodiments, the guide polynucleotide described herein may contain one, two, three, or more PS linkages at or near the 5' end and / or 3' end, and the PS linkages may be continuous or discontinuous.

[0088] In some embodiments, the gRNA herein contains a mixture of ribonucleotides and deoxyribonucleotides and / or one or more PS linkages.

[0089] In some embodiments, one or more nucleobases of the gRNA may be chemically modified. Examples of chemically modified nucleobases include, but are not limited to, 2-thiouridine, 4-thiouridine, N6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidines, isoguanine, isocytosine, and nucleobases having halogenated aromatic groups. The chemical modification can be performed on the spacer region, the tracr RNA region, the stem-loop, or any combination thereof.

[0090] Table 2 below lists exemplary gRNA target sequences for epigenetic modification of human TRAC, as well as the coordinates of the starting positions of the targeted sites in human chromosome 14 (SEQ: Sequence Number). This table also shows the distance from the starting coordinate of the TRAC gene to the TSS coordinate. Table 3 lists exemplary target sequences of the gRNA.

[0091] [Table 2] TIFF2025524455000006.tif251153TIFF2025524455000007.tif251153TIFF2025524455000008.tif251153TIFF2025524455000009.tif251153TIFF2025524455000010.tif105153

[0092] [Table 3] TIFF2025524455000012.tif250144TIFF2025524455000013.tif250144TIFF2025524455000014.tif250144TIFF2025524455000015.tif250144TIFF2025524455000016.tif70144

[0093] Any tracr sequence known in the art is contemplated for the gRNAs described herein. In some embodiments, the gRNAs described herein have a tracr sequence shown in Table 4 below, or a tracr sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the tracr sequences shown below (SEQ: Sequence No.).

[0094]

Table 4

[0095] In some embodiments, the gRNAs herein are provided directly to the cell (e.g., through an RNP complex together with a CRISPR-associated protein domain). In some embodiments, the gRNA is provided to the cell through an expression vector (e.g., a plasmid vector or a viral vector) introduced into the cell, and the cell then expresses the gRNA from the expression vector. Methods for introducing gRNAs and expression vectors into cells are well known in the art.

[0096] III. Effector Domain The epigenetic editors described herein include one or more effector protein domains (also referred to herein as "epigenetic effector domains" or "effector domains") that effect epigenetic modification of a target gene. An epigenetic editor having one or more effector domains can modulate the expression of a target gene without altering the nucleic acid sequence of the target gene. In some embodiments, the effector domains described herein can provide for suppression or silencing of the expression of a target gene, such as TRAC, for example, by suppressing transcription or by modifying or remodeling chromatin. Such effector domains are also referred to herein as "suppression domains", "repressor domains", or "epigenetic repressor domains". Non-limiting examples of chemical modifications that can be mediated by effector domains include methylation, demethylation, acetylation, deacetylation, phosphorylation, SUMOylation, and / or ubiquitination of DNA or histone residues.

[0097] In some embodiments, the effector domains of the epigenetic editors described herein can effect histone tail modifications, for example, by adding or removing activating marks on histone tails.

[0098] In some embodiments, the effector domains of the epigenetic editors described herein can include or recruit a transcription-related protein, such as a transcription repressor. The transcription-related protein can be endogenous or exogenous.

[0099] In some embodiments, the effector domains of the epigenetic editors described herein can include a protein that directly or indirectly blocks access of a transcription factor to a target gene having a target sequence.

[0100] An effector domain can be a full-length protein or a fragment thereof that retains an epigenetic effector function (a "functional domain"). A functional domain that can modulate (e.g., repress) gene expression can be derived from a larger protein. For example, a functional domain that can reduce target gene expression can be identified based on the sequence of a repressor protein. The amino acid sequence of a protein that modulates gene expression can be obtained from available genome browsers, such as the UCSD Genome Browser or the Ensembl Genome Browser. A protein annotation database, such as UniProt or Pfam, can be used to identify functional domains within a full-length protein sequence. As a starting point, the largest sequence encompassing all regions identified by different databases can be tested for modulation activity of gene expression. Various truncated forms can then be tested to identify the minimal functional unit.

[0101] Variants of the effector domains described herein are also contemplated by the present disclosure. A variant refers to a polypeptide having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity and / or sequence similarity to a wild-type effector domain described herein. In certain embodiments, a variant retains at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the epigenetic effector function of the wild-type effector domain.

[0102] In some embodiments, the effector domain described herein can include a fusion of two or more effector domains (e.g., KOX1 KRAB and ZIM3). The effector domain can include, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 effector domains, e.g., a fusion of effector domains described herein. In certain embodiments, the effector domain includes a fusion of a truncated form of one effector domain and a second effector domain. In certain embodiments, the effector domain includes a fusion of truncated forms of two effector domains (e.g., a fusion of the N-terminal and C-terminal portions of two effector domains).

[0103] In some embodiments, the epigenetic editor described herein can include one effector domain, two effector domains, three effector domains, four effector domains, five effector domains, six effector domains, seven effector domains, eight effector domains, nine effector domains, ten effector domains, or more. In certain embodiments, the epigenetic editor includes one or more fusion proteins (e.g., one, two, or three fusion proteins) having one or more effector domains (e.g., one, two, or three effector domains) each linked to a DNA binding domain. In some embodiments, the effector domain can induce combinations of epigenetic modifications, e.g., transcriptional repression and DNA methylation, DNA methylation and histone deacetylation, DNA methylation and histone demethylation, DNA methylation and histone methylation, DNA methylation and histone phosphorylation, DNA methylation and histone ubiquitination, DNA methylation and histone SUMOylation.

[0104] In certain embodiments, the effector domains described herein (e.g., DNMT3A and / or DNMT3L) are encoded by nucleotide sequences found in the native genome (e.g., human or mouse) for that effector domain. In other embodiments, the effector domains described herein are encoded by nucleotide sequences that are codon-optimized for optimal expression in human cells.

[0105] The effector domains described herein can include, for example, transcriptional repressors, DNA methyltransferases, and / or histone modifiers, as further detailed below.

[0106] A. Transcriptional repressors In some embodiments, the epigenetic effector domain described herein mediates the suppression of the expression (e.g., transcription) of a target gene. The effector domain can include, for example, a Kruppel-associated box (KRAB) repressor domain, a repressor element silencing transcription factor (REST) repressor domain, a KRAB-associated protein 1 (KAP1) domain, a MAD domain, a FKHR (forkhead gene in rhabdomyosarcoma) repressor domain, an EGR-1 (early growth response gene product-1) repressor domain, an ets2 repressor factor repressor domain (ERD), a MAD smSIN3 interaction domain (SID), the WRPW motif of a hairy-related basic helix-loop-helix (bHLH) repressor protein, an HP1 alpha chromoshadow repressor domain, an HP1 beta repressor domain, or any combination thereof. The effector domain can recruit, for example, one or more protein domains that suppress the expression of a target gene through a scaffold protein. In some embodiments, the effector domain can recruit or interact with a scaffold protein domain that recruits a PRMT protein, an HDAC protein, a SETDB1 protein, or a NuRD protein domain.

[0107] In some embodiments, the effector domain includes a functional domain derived from a zinc finger repressor protein, such as a KRAB domain. The KRAB domain is found in approximately 400 human ZFP-based transcription factors. Descriptions of the KRAB domain can be found, for example, in Ecco et al., Development (2017) 144(15):2719-29 and Lambert et al., Cell (2018) 172:650-65.

[0108] In certain embodiments, the effector domain comprises a repressor domain (e.g., KRAB) derived from KOX1 / ZNF10, KOX8 / ZNF708, ZNF43, ZNF184, ZNF91, HPF4, HTF10, or HTF34. In some embodiments, the effector domain comprises a repressor domain (e.g., KRAB) derived from ZIM3, ZNF436, ZNF257, ZNF675, ZNF490, ZNF320, ZNF331, ZNF816, ZNF680, ZNF41, ZNF189, ZNF528, ZNF543, ZNF554, ZNF140, ZNF610, ZNF264, ZNF350, ZNF8, ZNF582, ZNF30, ZNF324, ZNF98, ZNF669, ZNF677, ZNF596, ZNF214, ZNF37, ZNF34, ZNF250, ZNF547, ZNF273, ZNF354, ZFP82, ZNF224, ZNF33, ZNF45, ZNF175, ZNF595, ZNF184, ZNF419, ZFP28-1, ZFP28-2, ZNF18, ZNF213, ZNF394, ZFP1, ZFP14, ZNF416, ZNF557, ZNF566, ZNF729, ZIM2, ZNF254, ZNF764, ZNF785, or any combination thereof. For example, the repressor domain can be a KRAB domain derived from KOX1, ZIM3, ZFP28, or ZN627. In certain embodiments, the repressor domain is the ZIM3 KRAB domain. In further embodiments, the effector domain is derived from a human protein, such as human ZIM3, human KOX1, human ZFP28, or human ZN627.

[0109] Exemplary effector domain sequences, or protein sequences containing them, that can reduce or silence target gene expression are provided in Table 5 below (SEQ: Sequence Number). Further examples of repressors and transcriptional repressor domains can be found, for example, in PCT Patent Application Publication No. 2021 / 226077 and Tycko et al., Cell (2020) 183(7):2020-35, each of which is incorporated herein by reference in its entirety.

[0110]

Table 5

[0111] Any one functional analog of the proteins listed above, i.e., having the same or substantially the same biological function (e.g., 70% or more, 80% or more, 90% or more, 95% or more, or 98% or more of the transcription factor function of the protein) and being retained) is encompassed by the present disclosure. For example, the functional analog can be an isoform or variant of the protein listed above, including, for example, a portion of the above protein with or without additional amino acid residues and / or including a mutation to the above protein. In some embodiments, the functional analog has at least 75, 80, 85, 90, 95, 98, or 99% sequence identity to one of the sequences listed in Table 5. Homologs, orthologs, and mutants of the proteins listed above are also contemplated.

[0112] In certain embodiments, the epigenetic editors described herein include a KRAB domain derived from KOX1, ZIM3, ZFP28, or ZN627, and / or an effector domain derived from KAP1, MECP2, HP1a, HP1b, CBX8, CDYL2, TOX, TOX3, TOX4, EED, EZH2, RBBP4, RCOR1, or SCML2, and optionally, the parent protein is a human protein. In certain embodiments, the epigenetic editors described herein include a domain derived from KOX1, ZIM3, ZFP28, and / or ZN627, and optionally, the parent protein is a human protein. In certain embodiments, the epigenetic editor can include a KRAB domain derived from KOX1 (ZNF10), e.g., human KOX1. In certain embodiments, the epigenetic editor can include a KRAB domain derived from ZIM3 (ZNF657 or ZNF264), e.g., human ZIM3. In certain embodiments, the epigenetic editor can include a KRAB domain derived from ZFP28, e.g., human ZFP28. In certain embodiments, the epigenetic editor can include a KRAB domain derived from ZN627, e.g., human ZN627. In certain embodiments, the epigenetic editors described herein can include a CDYL2, e.g., human CDYL2 and / or a TOX domain (e.g., human TOX domain) in combination with a KOX1 KRAB domain (e.g., human KOX1 KRAB domain).

[0113] In certain embodiments, the epigenetic effector described herein includes a repressor domain (SEQ ID NO: 89) derived from KOX1 / ZNF10. For example, the repressor domain can include the sequence of SEQ ID NO: 89, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 89.

[0114] In certain embodiments, the epigenetic effector described herein comprises a repressor domain derived from KOX1 / ZNF10, as shown in Table 6 below.

[0115] [Table 6]

[0116] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO: 565, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 565.

[0117] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO: 566, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 566.

[0118] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO: 567, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 567.

[0119] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO: 568, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 568.

[0120] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO: 569, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 569.

[0121] In certain embodiments, the repressor domain can include the amino acid sequence of SEQ ID NO: 570, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 570.

[0122] In certain embodiments, the repressor domain can include the amino acid sequence of SEQ ID NO: 571, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 571.

[0123] In certain embodiments, the repressor domain can include the amino acid sequence of SEQ ID NO: 572, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 572.

[0124] B. DNA methyltransferase In some embodiments, the effector domain of the epigenetic editor described herein alters target gene expression through DNA modification, such as methylation. Highly methylated regions of DNA tend to be less transcriptionally active than less methylated regions. DNA methylation occurs primarily at CpG sites (truncated form of the "C-phosphate-G-" or "cytosine-phosphate-guanine" site). A number of mammalian genes have a promoter region near or containing a CpG island (a nucleic acid region having a high frequency of CpG dinucleotides).

[0125] The effector domains described herein can be, for example, a DNA methyltransferase (DNMT) or its catalytic domain, or can be capable of recruiting a DNA methyltransferase. DNMTs include enzymes that catalyze the transfer of a methyl group to a DNA nucleotide, for example, canonical cytosine-5 DNMTs that catalyze the addition of a methyl group to genomic DNA (e.g., DNMT1, DNMT3A, DNMT3B, and DNMT3C). The term also includes non-canonical family members that do not themselves catalyze methylation but recruit (including activating) catalytically active DNMTs, a non-limiting example of such a DNMT being DNMT3L. See, for example, Lyko, Nat Review (2018) 19:81-92. Unless otherwise indicated, the DNMT domain can refer to a polypeptide domain derived from a catalytically active DNMT (e.g., DNMT1, DNMT3A, and DNMT3B) or a catalytically inactive DNMT (e.g., DNMT3L). DNMTs can suppress the expression of target genes through the recruitment of inhibitory regulatory proteins. In some embodiments, methylation is in a CG (or CpG) dinucleotide sequence. In some embodiments, methylation is in a CHG or CHH sequence, where H is any one of A, T, or C.

[0126] In some embodiments, the DNMTs described herein can be animal DNMTs (e.g., mammalian DNMTs), plant DNMTs, fungal DNMTs, or bacterial DNMTs. Bacterial DNMTs can be obtained from bacterial species (e.g., cocci, bacilli, spiral bacteria, or intracellular gram-positive or gram-negative bacteria). In certain embodiments, the bacterial species is a Mycoplasmatales bacterium, Mycoplasma marinum, or Spiroplasma chinense. In certain embodiments, the bacterial species is not M. penetrans, S. monbiae, H. parainfluenzae, A. luteus, H. aegyptius, H. haemolyticus, Moraxella, E. coli, T. aquaticus, C. crescentus, or C. difficile. In certain embodiments, the epigenetic editor described herein includes a DNMT domain comprising SEQ ID NO: 601, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 601. In certain embodiments, the epigenetic editor described herein includes a DNMT domain comprising SEQ ID NO: 602, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 602. In certain embodiments, the epigenetic editor described herein includes a DNMT domain comprising SEQ ID NO: 603, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 603.

[0127] In certain embodiments, the DNMT in the epigenetic editors described herein can include, for example, DNMT1, DNMT3A, DNMT3B, and / or DNMT3C. In some embodiments, the DNMT is a mammalian (e.g., human or mouse) DNMT. In certain embodiments, the DNMT is DNMT3A (e.g., human DNMT3A). In certain embodiments, the epigenetic editors described herein include a DNMT3A domain comprising the sequence of SEQ ID NO: 574, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 574. In certain embodiments, the epigenetic editors described herein include a DNMT3A domain comprising the sequence of SEQ ID NO: 575, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 575. In some embodiments, the DNMT3A domain can have mutations at, for example, position H739 (e.g., H739A or H739E), position R771 (e.g., R771L), and / or position R836 (e.g., R836A or R836Q), or any combination thereof (numbering follows SEQ ID NO: 574).

[0128] In some embodiments, the effector domain described herein can be a DNMT-like domain. As used herein, a "DNMT-like domain" is a regulator of DNMT that can activate or recruit other DNMT domains but does not itself have methylation activity. In some embodiments, the DNMT-like domain is a mammalian (e.g., human or mouse) DNMT-like domain. In certain embodiments, the DNMT-like domain is DNMT3L, which can be, for example, human DNMT3L or mouse DNMT3L. In certain embodiments, the epigenetic editor described herein comprises a DNMT3L domain comprising the sequence of SEQ ID NO: 578, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 578. In certain embodiments, the epigenetic editor herein comprises a DNMT3L domain comprising the sequence of SEQ ID NO: 579, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 579. In certain embodiments, the epigenetic editor described herein comprises a DNMT3L domain comprising the sequence of SEQ ID NO: 580, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 580. In certain embodiments, the epigenetic editor described herein comprises a DNMT3L domain comprising the sequence of SEQ ID NO: 581, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 581. In some embodiments, the DNMT3L domain can have mutations corresponding to those at positions D226 (e.g., D226V), Q268 (e.g., Q268K), or both (numbering follows SEQ ID NO: 578).

[0129] In certain embodiments, the epigenetic editors herein can include both DNMT and DNMT-like effector domains. For example, the epigenetic editor can include the DNMT3A-3L domain, and DNMT3A and DNMT3L may be covalently linked. In other embodiments, the epigenetic editors described herein can include effector domains that contain only the DNMT3A domain (e.g., human DNMT3A), or only the DNMT-like domain (e.g., DNMT3L, which can be human or mouse DNMT3L).

[0130] Table 7 below provides exemplary DNMTs that can be part of the epigenetic effector domains described herein, or from which the effector domains of the epigenetic editors described herein can be derived.

[0131] **Table 7** TIFF2025524455000028.tif251162TIFF2025524455000029.tif24162

[0132] Any one of the functional analogs of the proteins listed above, i.e., those having the same or substantially the same biological function (e.g., 70% or more, 80% or more, 90% or more, 95% or more, or 98% or more of the DNA methylation function or mobilization function of the protein) and retaining it) is encompassed by the present disclosure. For example, the functional analog can be an isoform or variant of the protein listed above, including, for example, a portion of the above protein with or without additional amino acid residues, and / or including a mutation to the above protein. In some embodiments, the functional analog has at least 75, 80, 85, 90, 95, 98, or 99% sequence identity to one of the sequences listed in Table 7. In some embodiments, the effector domain herein includes only the functional domain of the protein listed above (or its functional analog), such as a catalytic domain or mobilization domain. In some embodiments, the effector domain herein includes one or more epigenetic effector domains selected from Table 7, or its functional homolog, ortholog, or variant.

[0133] As used herein, a DNMT domain (e.g., DNMT3A domain or DNMT3L domain) refers to a protein domain that is identical to a parent protein (e.g., human or mouse DNMT3A or DNMT3L) or its functional analog (e.g., a functional fragment of the parent protein, such as a catalytic fragment or mobilization fragment, and / or having a mutation that improves the activity of the DNMT protein).

[0134] The epigenetic editors herein can bring about methylation in the target gene or chromosome, for example, in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 or more CpG dinucleotide sequences. The CpG dinucleotide sequences may be located within or near the target gene in a CpG island, or may be located in a region that is not a CpG island. A CpG island generally refers to a nucleic acid sequence or chromosomal region containing a high frequency of CpG dinucleotides. For example, a CpG island may contain at least 50% GC content. A CpG island may have a high observed-to-predicted CpG ratio, for example, at least 60% observed-to-predicted CpG ratio. As used herein, the observed-to-predicted CpG ratio is determined by the number of CpGs × (length of the sequence) / (number of Cs × number of Gs). In some embodiments, the CpG island has an observed-to-predicted CpG ratio of at least 60%, 70%, 80%, 90%, or more. A CpG island may be, for example, a sequence or region of at least 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 nucleotides. In some embodiments, only 1, or less than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, or 50 CpG dinucleotides are methylated by the epigenetic editor.

[0135] In some embodiments, the epigenetic editors herein effect methylation in hypomethylated nucleic acid sequences, i.e., sequences in which the methyl group on 5-methylcytosine nucleotides (e.g., at CpG) may be absent as compared to a standard control. Hypomethylation can occur, for example, in aged cells or cancer (e.g., early stages of neoplasia) as compared to young or non-cancerous cells, respectively.

[0136] In some embodiments, the epigenetic editors described herein induce methylation in hypermethylated nucleic acid sequences.

[0137] In some embodiments, methylation can be introduced by an epigenetic editor at sites other than CpG dinucleotides. For example, the target gene sequence can be methylated at the C nucleotide of a CpA, CpT, or CpC sequence. In some embodiments, the epigenetic editor comprises a DNMT3A domain and effects methylation in CpG, CpA, CpT, CpC sequences, or any combination thereof. In some embodiments, the epigenetic editor comprises a DNMT3A domain lacking a regulatory subdomain and maintaining only the catalytic domain. In some embodiments, an epigenetic editor comprising a DNMT3A catalytic domain effects methylation exclusively in CpG sequences. In some embodiments, an epigenetic editor comprising a DNMT3A domain comprising a mutation, e.g., an R836A or R836Q mutation (numbering according to SEQ ID NO: 574), has higher methylation activity in CpA, CpC, and / or CpT sequences as compared to an epigenetic editor comprising a wild-type DNMT3A domain.

[0138] C. Histone modifiers In some embodiments, the effector domain of the epigenetic editor herein mediates histone modification. Histone modifications play structural and biochemical roles in gene transcription, for example, by forming or disrupting nucleosome structures that bind to histones and prevent gene transcription. Examples of histone modifications include, for example, acetylation, deacetylation, methylation, phosphorylation, ubiquitination, SUMOylation, etc. at their N-terminus (the "histone tail"). These modifications maintain or specifically convert chromatin structure, thereby controlling responses that occur on chromosomal DNA, such as gene expression, DNA replication, DNA repair, etc. Post-translational modification of histones is an epigenetic regulatory mechanism and is considered essential for gene regulation in eukaryotic cells. Recent studies have shown that chromatin remodeling factors that promote access of transcription factors to DNA by modifying nucleosome structures, such as SWI / SNF, RSC, NURF, NRD, etc., histone acetyltransferases (HATs) that regulate the acetylation state of histones, and histone deacetylases (HDACs) act as important regulatory factors.

[0139] In particular, the unstructured N-terminus of histones can be modified by acetylation, deacetylation, methylation, ubiquitination, phosphorylation, SUMOylation, ribosylation, citrullination, O-GlcN acylation, or crotonylation, or any combination thereof. For example, histone acetyltransferase (HAT) utilizes acetyl-CoA as a cofactor and catalyzes the transfer of an acetyl group to the epsilon amino group of the lysine side chain. This neutralizes the positive charge of lysine, weakens the interaction between histones and DNA, thereby opening the chromosome to which transcription factors bind and initiating transcription. Acetylation of lysines K14 and K9 of histone H3 by histone acetyltransferase enzymes can be associated with transcriptional competence in humans. Lysine acetylation can create binding sites for chromatin-modifying enzymes that regulate transcriptional activation, either directly or indirectly. On the other hand, methylation of lysine 9 of histone H3 can be associated with heterochromatin, or transcriptionally silent chromatin.

[0140] In certain embodiments, the effector domain of the epigenetic editor described herein includes a histone methyltransferase domain. The effector domain can include, for example, a DOT1L domain, a SET domain, an SUV39H1 domain, a G9a / EHMT2 protein domain, an EZH1 domain, an EZH2 domain, a SETDB1 domain, or any combination thereof. In certain embodiments, the effector domain includes the histone-lysine-N-methyltransferase SETDB1 domain.

[0141] In some embodiments, the effector domain includes a histone deacetylase protein domain. In certain embodiments, the effector domain includes an HDAC family protein domain, such as an HDAC1, HDAC3, HDAC5, HDAC7, or HDAC9 protein domain. In certain embodiments, the effector domain includes the nucleosome remodeling and deacetylase complex (NURD), which removes acetyl groups from histones.

[0142] D. Other Effector Domains In some embodiments, the effector domain comprises a tripartite motif-containing protein (TRIM28, TIF1-beta, or KAP1). In certain embodiments, the effector domain comprises one or more KAP1 proteins. The KAP1 protein in the epigenetic editor herein forms a complex with one or more other effector domains of the epigenetic editor or one or more proteins involved in modulation of gene expression in the cellular environment. For example, KAP1 can be recruited by the KRAB domain of a transcriptional repressor. The KAP1 protein domain can interact with or recruit one or more protein complexes that reduce or silence gene expression. In some embodiments, KAP1 interacts with or recruits histone deacetylase proteins, histone-lysine methyltransferase proteins, chromatin remodeling proteins, and / or heterochromatin proteins. For example, the KAP1 protein domain can interact with or recruit heterochromatin protein 1 (HP1) proteins, SETDB1 proteins, HDAC proteins, and / or NuRD protein complex components. In some embodiments, the KAP1 protein domain interacts with or recruits the ZFP90 protein (e.g., isoform 2 of ZFP90) and / or the FOXP3 protein. An exemplary KAP1 amino acid sequence is shown in SEQ ID NO: 629.

[0143] In some embodiments, the effector domain comprises a protein domain that interacts with or is recruited by one or more DNA epigenetic marks. For example, the effector domain can include a methyl-CpG binding protein 2 (MECP2) protein that interacts with methylated DNA nucleotides within a target gene (which may or may not be in the CpG island of the target gene). The MECP2 protein domain in the epigenetic editors described herein can induce a condensed chromatin structure, thereby reducing or silencing the expression of the target gene. In some embodiments, the MECP2 protein domain in the epigenetic editors described herein can interact with a histone deacetylase (e.g., HDAC), thereby suppressing or silencing the expression of the target gene. In some embodiments, the MECP2 protein domain in the epigenetic editors described herein can block access of a transcription factor or transcriptional activator to the target sequence, thereby suppressing or silencing the expression of the target gene. An exemplary MECP2 amino acid sequence is shown in SEQ ID NO: 630.

[0144] As effector domains of the epigenetic editors described in this specification, for example, chromoshadow domain, ubiquitin-2-like Rad60 SUMO-like (Rad60-SLD / SUMO) domain, chromatin organization modifier domain (Chromo) domain, Yaf2 / RYBP C-terminal binding motif domain (YAF2_RYBP), CBX family C-terminal motif domain (CBX7_C), zinc finger C3HC4 type (RING finger) domain (ZF-C3HC4_2), cytochrome b5 domain (Cyt-b5), helix-loop-helix domain (HLH), helix-heparin-helix motif domain (e.g., HHH_3), high mobility group box domain (HMG-box), basic leucine zipper domain (e.g., bZIP_1 or bZIP_2), Myb_DNA binding domain, homeodomain, MYM-type zinc finger domain with FCS sequence domain (ZF-FCS), interferon regulatory factor 2-binding protein zinc finger domain (IRF-2BP1_2), SSX repressor domain (SSXRD), B-box type zinc finger domain (ZF-B_box), CXXC zinc finger domain (ZF-CXXC), regulator of chromosome condensation 1 domain (RCC1), SRC homology 3 domain (SH3_9), sterile alpha motif domain (SAM_1), sterile alpha motif domain (SAM_2), sterile alpha motif / pointed domain (SAM_PNT), Vestigial / Tondu family domain (Vg_Tdu), LIM domain, RNA recognition motif domain (RRM_1), paired amphipathic helix domain (PAH), proteasome ATPase OB C-terminal domain (Prot_ATP_ID_OB), nervy homology 2 domain (NHR2), hinge domain of cleavage stimulation factor subunit 2 (CSTF2_hinge), PPAR gamma N-terminal region domain (PPARgamma_N), CDC48 N-terminal domain (CDC48_2), WD40 repeat domain (WD40), Fip1 motif domain (Fip1), PDZ domain (PDZ_6), von Willebrand factor C-type domain (VWC), NAB conserved region 1 domain (NCD1), S1RNA binding domain (S1), HNF3 C-terminal domain (HNF_C), Tudor domain (Tudor_2), histone-like transcription factor (CBF / NF-Y), and archaeal histone domain (CBFD_NFYB_HMF), zinc finger protein domain (DUF3669), EGF-like domain (cEGF), GATA zinc finger domain (GATA), TEA / ATTS domain (TEA), phorbol ester / diacylglycerol binding domain (C1-1), polycomb-like MTF2 factor 2 domain (Mtf2_C), transactivation domain of the FOXO protein family (FOXO-TAD), homeobox KN domain (Homeobox_KN), BED zinc finger domain (ZF-BED), zinc finger of C3HC4-type RING domain (ZF-C3HC4_4), RAD51 interaction motif domain (RAD51_interact), p55 binding region of methyl-CpG-binding domain protein MBD (MBDa), Notch domain, Raf-like Ras binding domain (RBD), Spin / Ssty family domain (Spin-Ssty), PHD finger domain (PHD_3), low density lipoprotein receptor domain class A (Ldl_recept_a), CS domain, DM DNA binding domain, and QLQ domain are also contemplated.

[0145] In some embodiments, the effector domain is a protein domain that includes the YAF2_RYBP domain, or a homeodomain thereof or any combination thereof. In certain embodiments, the homeodomain of the YAF2_RYBP domain is a PRD domain, an NKL domain, a HOXL domain, or a LIM domain. In particular embodiments, the YAF2_RYBP domain may include the 32 amino acid Yaf2 / RYBP C-terminal binding motif domain (32 aa RYBP).

[0146] In some embodiments, the effector domain comprises a protein domain selected from the group consisting of a SUMO3 domain, a chromodomain derived from mitotic phosphoprotein 8 (MPP8), a chromoshadow domain derived from chromobox 1 (CBX1), and a SAM_1 / SPM domain derived from Scm polycomb group protein homolog 1 (SCMH1).

[0147] In some embodiments, the effector domain comprises an HNF3 C-terminal domain (HNF_C). The HNF_C domain may be derived from FOXA1 or FOXA2. In certain embodiments, the HNF_C domain comprises an EH1 (engrailed homology 1) motif.

[0148] In some embodiments, the effector domain may comprise an interferon regulatory factor 2-binding protein zinc finger domain (IRF-2BP1_2), a Cyt-b5 domain derived from DNA repair factor HERC2 E3 ligase, a variant SH3 domain (SH3_9) derived from Bridging Integrator 1 (BIN1), an HMG box domain derived from transcription factor TOX, or a ZF-C3HC4_2 RING finger domain, a chromodomain-helicase-DNA binding protein 3 (CHD3) domain, or a ZNF783 domain derived from polycomb component PCGF2.

[0149] IV. Epigenetic Editor For example, provided herein is an epigenetic editor (i.e., an epigenetic editing system) that uses one or more DNA binding domains described herein and one or more effector domains described herein (e.g., an epigenetic repressor domain) in any combination to direct an epigenetic modification to a target sequence in a gene of interest. A DNA binding domain (a guide polynucleotide, e.g., one that cooperates with those described herein, where the DNA binding domain is a DNA binding domain guided by a polynucleotide) directs an effector domain to epigenetically modify (modify) a target sequence, resulting in gene repression or silencing that can be inherited persistently and across cell generations. In some embodiments, the epigenetic editors described herein can reversibly or irreversibly repress or silence a gene in a cell.

[0150] In certain embodiments, the epigenetic editors described herein comprise one or more fusion proteins, each comprising (1) a DNA binding domain and (2) an effector domain. The effector domain can be on one or more fusion proteins comprised by the epigenetic editor. For example, a single fusion protein can comprise all effector domains having a DNA binding domain. Alternatively, an effector domain or a subset thereof can be on separate fusion proteins, each having (which can be the same or different) a DNA binding domain. The fusion proteins described herein can further comprise one or more linkers (e.g., peptide linkers), detectable tags, nuclear localization signals (NLSs), or any combination thereof. As used herein, "fusion protein" refers to a chimeric protein in which two or more coding sequences (e.g., of a DNA binding domain and / or an effector domain) are directly or indirectly linked, either covalently or non-covalently.

[0151] In some embodiments, the epigenetic editors described herein include two, three, four, five, six, seven, eight, nine, ten, or more effector (e.g., repressor) domains, which may be the same or different. In certain embodiments, two or more of the effector domains function synergistically. Combinations of effector domains may include DNA methylation domains, histone deacetylation domains, histone methylation domains, and / or scaffold domains that recruit any of the foregoing. For example, the epigenetic editors described herein may include one or more transcriptional repressor domains (e.g., KRAB domain, e.g., KOX1, ZIM3, ZFP28, or ZN627 KRAB) in combination with one or more DNA methylation domains (e.g., DNMT domain) and / or recruiter domains (e.g., DNMT3L domain). Such epigenetic editors may include, for example, a KRAB domain, a DNMT3A domain, and a DNMT3L domain. In some embodiments, the epigenetic editor further includes additional effector domains (e.g., KAP1, MECP2, HP1b, CBX8, CDYL2, TOX, TOX3, TOX4, EED, RBBP4, RCOR1, or SCML2 domain). In some embodiments, the additional effector domain is a CDYL2, TOX, TOX3, TOX4, or HP1a domain. For example, the epigenetic editors described herein may include a CDYL2 and / or TOX domain in combination with a KRAB domain (e.g., KOX1 KRAB domain).

[0152] A. Linker The fusion proteins described herein may include one or more linkers that connect the components of the epigenetic editor. The linker may be a peptide linker or a non-peptide linker.

[0153] In some embodiments, one or more linkers utilized in the epigenetic editors provided herein are peptide linkers, i.e., linkers that contain a peptide moiety. The peptide linker can be of any length applicable to the epigenetic editor fusion proteins described herein. In some embodiments, the linker can comprise a peptide of 1 to 200 (e.g., 1 to 80) amino acids. In some embodiments, the linker has a length of 1 to 5, 1 to 10, 1 to 20, 1 to 30, 1 to 40, 1 to 50, 1 to 60, 1 to 80, 1 to 100, 1 to 150, 1 to 200, 5 to 10, 5 to 20, 5 to 30, 5 to 40, 5 to 60, 5 to 80, 5 to 100, 5 to 150, 5 to 200, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 80, 10 to 100, 10 to 150, 10 to 200, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 80, 20 to 100, 20 to 150, 20 to 200, 30 to 40, 30 to 50, 30 to 60, 30 to 80, 30 to 100, 30 to 150, 30 to 200, 40 to 50, 40 to 60, 40 to 80, 40 to 100, 40 to 150, 40 to 200, 50 to 60, 50 to 80, 50 to 100, 50 to 150, 50 to 200, 60 to 80, 60 to 100, 60 to 150, 60 to 200, 80 to 100, 80 to 150, 80 to 200, 100 to 150, 100 to 200, or 150 to 200 amino acids. Longer or shorter linkers are also contemplated. In some embodiments, the peptide linker has a length of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 25, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids. For example, the peptide linker can have a length of 4, 5, 16, 20, 24, 27, 32, 40, 64, 92, or 104 amino acids. The peptide linker can be a flexible linker or a rigid linker.In certain embodiments, the peptide linker comprises an amino acid sequence of any one of SEQ ID NOs: 631-637 and 664-666, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0154] In certain embodiments, the peptide linker is an XTEN linker. Such a linker may comprise a portion of the XTEN sequence, which is an unstructured hydrophilic polypeptide consisting of only the residues G, S, P, T, E, and A (Schellenberger et al., Nat Biotechnol (2009) 27(1):1186-90). As used herein, the term "XTEN" refers to a recombinant peptide or polypeptide lacking hydrophobic amino acid residues. XTEN linkers are typically unstructured and contain a limited set of natural amino acids. Fusion of XTEN to a protein alters its hydrodynamic properties and reduces the rate of clearance and degradation of the fusion protein. These XTEN fusion proteins are produced using recombinant techniques and degraded by natural pathways without the need for chemical modification. XTEN linkers can be, for example, 5, 10, 16, 20, 26, or 80 amino acids in length. In some embodiments, the XTEN linker is 16 amino acids in length. In some embodiments, the XTEN linker is 80 amino acids in length. In certain embodiments, the XTEN linker can be XTEN10, XTEN16, XTEN20, or XTEN80. In certain embodiments, the XTEN linker may comprise an amino acid sequence of any one of SEQ ID NOs: 638-643, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto. In specific embodiments, the XTEN linker comprises the amino acid sequence of SEQ ID NO: 638. In specific embodiments, the XTEN linker comprises the amino acid sequence of SEQ ID NO: 643.

[0155] In some embodiments, one or more linkers utilized in the epigenetic editors provided herein are non-peptide linkers. For example, the linker can be a carbon bond, a disulfide bond, or a carbon-heteroatom bond. In certain embodiments, the linker is the carbon-nitrogen bond of an amide linkage. In certain embodiments, the linker is a cyclic or acyclic, substituted or unsubstituted, or branched or unbranched aliphatic or heteroaliphatic linker.

[0156] In some embodiments, one or more linkers utilized in the epigenetic editors provided herein are polymers (e.g., polyethylene, polyethylene glycol, polyamide, polyester, etc.). The linker can include, for example, monomers, dimers, or polymers of aminoalkanoic acids, aminoalkanoic acids (e.g., glycine, ethanoic acid, alanine, beta-alanine, 3-aminopropanoic acid, 4-aminobutanoic acid, 5-pentanoic acid, etc.), monomers, dimers, or polymers of aminohexanoic acid (Ahx), or polyethylene glycol moieties (PEG), or aryl or heteroaryl moieties. In certain embodiments, the linker can be based on a carbocyclic moiety (e.g., cyclopentane or cyclohexane) or a phenyl ring. The linker can include a functionalized moiety that facilitates the attachment of a nucleophile (e.g., thiol, amino) from a peptide to the linker. Any electrophile can be used as part of the linker portion. Exemplary electrophiles include, but are not limited to, activated esters, activated amides, alkyl halides, aryl halides, acyl halides, and isothiocyanates.

[0157] The lengths and mobilities of various linkers can be utilized between any two components of an epigenetic editor (e.g., between an effector domain (e.g., a repressor domain) and a DNA-binding domain (e.g., a Cas9 domain), between a first effector domain and a second effector domain, etc.). The linker can range from a very flexible linker, such as a glycine / serine-rich linker, to a more rigid linker in order to achieve an optimal length for effector domain activity with respect to a specific application. In some embodiments, the more flexible linker is a glycine / serine-rich linker (GS-rich linker), with more than 45% (e.g., more than 48%, more than 50%, more than 55%, more than 60%, more than 70%, more than 80%, or more than 90%) of the residues being glycine or serine residues. Non-limiting examples of GS-rich linkers are (GGGGS)n (SEQ ID NO: 664), (G)n, and the W linker (SEQ ID NO: 637). In some embodiments, the more rigid linker is of the form (EAAAK)n (SEQ ID NO: 665), (SGGS)n (SEQ ID NO: 666 and (XP)n). In the above formulas for the flexible linker and the rigid linker, n can be any integer from 1 to 30. In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. In some embodiments, the linker contains a (GGS)n motif, where n is 1, 3, or 7. In some embodiments, the linker contains a (GGGGS)n motif, where n is 4 (SEQ ID NO: 636).

[0158] In some embodiments, the linker in the epigenetic editor described herein includes a nuclear localization signal having, for example, any one of the amino acid sequences of SEQ ID NOs: 644 to 649. In some embodiments, the linker in the epigenetic editor described herein includes an expression tag, such as a detectable tag, such as green fluorescent protein.

[0159] B. Nuclear localization signal The fusion proteins described herein may include one or more nuclear localization signals and, in certain embodiments, may include two or more nuclear localization signals. For example, the fusion protein may include one, two, three, four, five, six, seven, eight, nine, ten, or more nuclear localization signals. As used herein, a "nuclear localization signal" (NLS) is an amino acid sequence that directs a protein to the nucleus. In certain embodiments, the NLS may be the SV40 NLS (e.g., having the amino acid sequence of SEQ ID NO: 644). The fusion protein may include the NLS at its N-terminus, C-terminus, or both, and / or the NLS may be embedded in the middle of the fusion protein (e.g., the N-terminus or C-terminus of the DNA binding domain or effector domain).

[0160] In some embodiments, the fusion protein may include two NLSs. The fusion protein may include two NLSs at its N-terminus or C-terminus. The fusion protein may include one NLS located at its N-terminus and one NLS embedded in the middle of the fusion protein, or may include one NLS located at its C-terminus and one NLS embedded in the middle of the fusion protein. The fusion protein may include two NLSs embedded in the middle of the fusion protein.

[0161] In some embodiments, the fusion protein may include four NLSs. The fusion protein may include at least two (e.g., two, three, or four) NLSs at its N-terminus or C-terminus. The fusion protein may include at least one (e.g., one, two, three, or four) NLS embedded in the middle of the fusion protein. In certain embodiments, the fusion protein may include two NLSs at its N-terminus and two NLSs at its C-terminus.

[0162] The NLS described in this specification can be an endogenous NLS sequence. In certain embodiments, the NLS described in this specification comprises the amino acid sequence of any one of SEQ ID NOs: 644 to 649, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a selected sequence. In a particular embodiment, the NLS comprises the amino acid sequence of SEQ ID NO: 644. Additional NLSs are known in the art.

[0163] In some embodiments, an epigenetic editor comprising a fusion protein having at least one NLS at the N-terminus and at least one NLS at the C-terminus has an efficiency of the epigenetic editor that is increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, at least 600%, at least 700%, at least 800%, at least 900%, at least 1,000%, at least 5,000%, at least 10,000%, at least 50,000%, at least 100,000%, or more, compared to an epigenetic editor having a corresponding fusion protein that does not have at least one NLS at the N-terminus and at least one NLS at the C-terminus.

[0164] In some embodiments, an epigenetic editor comprising a fusion protein having two NLSs at the N-terminus and two NLSs at the C-terminus can increase the efficiency of the epigenetic editor by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, at least 600%, at least 700%, at least 800%, at least 900%, at least 1,000%, at least 5,000%, at least 10,000%, at least 50,000%, at least 100,000%, or more compared to an epigenetic editor having a corresponding fusion protein that does not have two NLSs at the N-terminus and two NLSs at the C-terminus.

[0165] C. Tag The epigenetic editors provided herein may include one or more additional sequences (tags) for tracking, detecting, and localizing the editors. In some embodiments, the epigenetic editor includes one, two, three, four, five, six, seven, eight, nine, ten, or more detectable tags. Each of the detectable tags may be the same or different.

[0166] For example, an epigenetic editor fusion protein may include a cytoplasmic localization sequence, an extracellular transport sequence, such as a nuclear export sequence, or other localization sequences, as well as a sequence tag useful for solubilization, purification, or detection of the fusion protein. Suitable protein tags provided herein include biotin carboxylase carrier protein (BCCP) tag, myc tag, calmodulin tag, FLAG tag, hemagglutinin (HA) tag, polyhistidine tag (also referred to as histidine tag or His tag), maltose binding protein (MBP) tag, nus tag, glutathione-S-transferase (GST) tag, green fluorescent protein (GFP) tag, thioredoxin tag, S tag, Softag (e.g., Softag 1 or Softag 3), strep tag, biotin ligase tag, FlAsH tag, V5 tag, and SBP tag, but are not limited thereto. Additional suitable sequences will be apparent to those skilled in the art.

[0167] D. Composition of the Fusion Protein The fusion proteins of the epigenetic editors described herein may be structured with their components in different configurations. For example, the DNA binding domain may be at the C-terminus, at the N-terminus, or between two or more epigenetic effector domains or additional domains. In some embodiments, the DNA binding domain is at the C-terminus of the epigenetic editor. In some embodiments, the DNA binding domain is at the N-terminus of the epigenetic editor. In some embodiments, the DNA binding domain is linked to one or more nuclear localization signals. In some embodiments, the DNA binding domain is flanked by epigenetic effector domains or additional domains. In some embodiments, when "DBD" indicates the DNA binding domain and "ED" indicates the effector domain, the epigenetic editor is -N']-[ED1]-[DBD]-[ED2]-[C' -N']-[ED1]-[DBD]-[ED2]-[ED3]-[C' -N']-[ED1]-[ED2]-[DBD]-[ED3]-[C' or -N']-[ED1]-[ED2]-DBD]-[ED3]-[ED4]-[C' includes the configuration of.

[0168] In some embodiments, the epigenetic editor includes a DNA binding domain (DBD), a DNA methyltransferase (DNMT) domain, and a transcriptional repressor (the "repressor") domain that suppresses or silences the expression of the target gene. The DBD, DNMT, and transcriptional repressor domains can be any of those described herein in any combination. The DBD, DNMT domain, and repressor domain can be in any configuration having any of said domains at the N-terminus, C-terminus, or central part of the fusion protein. In some embodiments, the epigenetic editor is N']-[DNMT domain]-[DBD]-[repressor domain]-[C' N']-[repressor domain]-[DBD]-[DNMT domain]-[C' N']-[DNMT domain]-[repressor domain]-[DBD]-[C' or N']-[repressor domain]-[DNMT domain]-[DBD]-[C' and includes a fusion protein having the configuration of.

[0169] In some embodiments, the connection structure “]-[” in any one of the epigenetic editor structures is a linker, e.g., a peptide linker, a detectable tag, a peptide bond, a nuclear localization signal, and / or a promoter or regulatory sequence. In the epigenetic editor structure, the plurality of connection structures “]-[” may be the same or each may be a different linker, tag, NLS, or peptide bond. In some embodiments, the DNMT domain may include any one of the domains in Table 7, or any combination or homolog thereof. In certain embodiments, the DNMT domain includes DNMT3A or a truncated version thereof, DNMT3L or a truncated version thereof, or both. In certain embodiments, the DBD is a DNA binding domain (e.g., dCas9) or a ZFP domain guided by a catalytically inactive polynucleotide. In certain embodiments, the repressor domain includes any one of the domains shown in Table 5 or 6, or any combination or homolog thereof. For example, the repressor domain can be a KRAB domain. In certain embodiments, the repressor domain is the ZFP28, ZN627, KAP1, MeCP2, HP1b, CBX8, CDYL2, TOX, Tox3, Tox4, EED, RBBP4, RCOR1, or SCML2 domain, or a fusion of two of the foregoing domains (e.g., a fusion of the N-terminal and C-terminal regions of ZIM3 and KOX1 KRAB). In certain embodiments, the repressor domain is a KRAB domain derived from ZFP28, ZN627, ZIM3, or KOX1.

[0170] In some embodiments, the epigenetic editor is N']-[DNMT3A-DNMT3L]-[DBD]-[repressor]-[C' N']-[repressor]-[DBD]-[DNMT3A-DNMT3L]-[C' N']-[repressor]-[DBD]-[DNMT3A]-[C' N']-[DNMT3A]-[DBD]-[repressor]-[C' N']-[repressor]-[DBD]-[DNMT3A]-[DNMT3L]-[C' N']-[DNMT3A]-[DNMT3L]-[DBD]-[repressor]-[C' N']-[DNMT3A]-[DBD]-[C' N']-[DBD]-[DNMT3A]-[C' N']-[DNMT3L]-[DBD]-[C' N']-[DBD]-[DNMT3L]-[C' comprises a configuration selected from, where [DNMT3A-DNMT3L] indicates that the DNMT3A and DNMT3L domains are directly fused via a peptide bond, and the connecting structure]-[is any one of the linkers described herein, a detectable tag, an affinity domain, a peptide bond, a nuclear localization signal, a promoter, and / or a regulatory sequence. The DBD, KRAB repressor, DNMT3A, and DNMT3L domains can be any of those described herein in any combination. For example, the DNMT3A and DNMT3L domains can be selected from those in Table 7. In certain embodiments, the DBD is a CRISPR-related protein domain (e.g., dCas9) or a ZFP domain, the repressor domain is a KRAB domain derived from KOX1, ZIM3, ZFP28, or ZN627, the DNMT3A domain is a human DNMT3A domain, the DNMT3L domain is a human or mouse DNMT3L domain, and any combination of these components is also contemplated by the present disclosure.

[0171] In some embodiments, the epigenetic editor is N']-[DNMT3A]-[DBD]-[SETDB1]-[C' N']-[DNMT3A]-[DNMT3L]-[DBD]-[SETDB1]-[C' N']-[DNMT3A-DNMT3L]-[DBD]-[SETDB1]-[C' N']-[SETDB1]-[DBD]-[DNMT3A]-[DNMT3L]-[C' N']-[SETDB1]-[DBD]-[DNMT3A]-[C' comprises a configuration selected from wherein, [DNMT3A-DNMT3L] indicates that the DNMT3A and DNMT3L domains are directly fused via a peptide bond, and the connecting structure]-[is any one of the linkers described herein, a detectable tag, an affinity domain, a peptide bond, a nuclear localization signal, a promoter, and / or a regulatory sequence. The DBD, SETDB1, DNMT3A, and DNMT3L domains can be any of those described herein in any combination. In certain embodiments, the DBD is a CRISPR-related protein domain (e.g., dCas9) or a ZFP domain, the SETDB1 domain is derived from human SETDB1, ZIM3, ZFP28, or ZN627, the DNMT3A domain is a human DNMT3A domain, the DNMT3L domain is a human or mouse DNMT3L domain, and any combination of these components is also contemplated by the present disclosure.

[0172] Specific constructs contemplated herein include TIFF2025524455000030.tif34149. DNMT3L and DNMT3A can be derived from human parent proteins, mouse parent proteins, or any combination thereof. In certain embodiments, DNMT3L and DNMT3A are derived from mouse and human parent proteins (mDNMT3L and hDNMT3A), respectively. In certain embodiments, both DNMT3L and DNMT3A are derived from human parent proteins (hDNMT3L and hDNMT3A). In some embodiments, dCas9 is dSpCas9. In some embodiments, KOX1 is human KOX1. Also contemplated are any of Configurations 1-6 in which the KOX1 KRAB domain is replaced by the ZFP28, ZN627, or ZIM3 KRAB domain. In some embodiments, ZFP28, ZN627, and ZIM3 are human ZFP28, ZN627, and ZIM3, respectively. In certain embodiments, the fusion construct has the configuration: may have TIFF2025524455000031.tif43152.

[0173] In certain embodiments, the fusion constructs described herein may have Configuration 1 and may include SEQ ID NO: 658, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto. In SEQ ID NO: 658 below, the XTEN linker is underlined, the W linker is bold, underlined, and italicized, the NLS sequence is bold, the DNMT3A sequence is italicized, the DNMT3L sequence is underlined and italicized, the dCas9 domain is bold and italicized, and the KOX1 KRAB domain is underlined and bold. TIFF2025524455000032.tif185150 (SEQ ID NO: 658)

[0174] In certain embodiments, the fusion constructs (fusion constructs) described herein have Configuration 2 and can include SEQ ID NO: 659, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto. In SEQ ID NO: 659 below, the XTEN linker is underlined, the W linker is bold, underlined, and italicized, the NLS sequence is bold and underlined, the DNMT3A sequence is italicized, the DNMT3L sequence is underlined and italicized, the ZFP domain is bold, and the KOX1 KRAB domain is underlined and bold. The variable amino acids represented by Xs are the amino acids of the DNA recognition helix of the zinc finger, and the italicized XX can be any of TR, LR, or LK.

[0175] TIFF2025524455000033.tif69165

[0176] In certain embodiments, the six "XXXXXXX" regions of SEQ ID NO: 659 include the amino acid sequences that form zinc fingers. In the above sequence, [linker] represents a linker sequence. In some embodiments, one or both of the linker sequences can be TGSQKP (SEQ ID NO: 651). In some embodiments, one or both of the linker sequences can be TGGGGSQKP (SEQ ID NO: 652). In some embodiments, one linker sequence can have the amino acid sequence of SEQ ID NO: 651 and the other linker sequence can have the amino acid sequence of SEQ ID NO: 652.

[0177] In certain embodiments, the fusion constructs described herein have Configuration 7 and can include SEQ ID NO: 660, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0178] In certain embodiments, the fusion constructs described herein have Configuration 9 and can include SEQ ID NO: 661, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0179] In certain embodiments, the fusion constructs described herein have Configuration 11 and can include SEQ ID NO: 662, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0180] In certain embodiments, the fusion constructs described herein have Configuration 13 and can include SEQ ID NO: 663, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0181] In some embodiments, the fusion constructs described herein (e.g., any one of the fusion constructs of Configurations 1-14) are within an expression construct that includes a WPRE sequence, a polyadenylation site, or both. In certain embodiments, the WPRE sequence is in the 3' untranslated region. In certain embodiments, the WPRE sequence is upstream of the polyadenylation site. In certain embodiments, the expression construct includes a WPRE sequence within the 3' untranslated region upstream of (e.g., any one of the fusion constructs of Configurations 1-14) the fusion construct and the polyadenylation site.

[0182] One or more fusion proteins can be used to effect the activation or repression of one or more target genes. For example, an epigenetic editor fusion protein comprising a DNA binding domain (e.g., a dCas9 domain) and an effector domain can be introduced with two or more guide polynucleotides (e.g., gRNAs) that each target a different target DNA sequence. The target sites of two DNA binding domains can be the same or in proximity to each other, but can also be, for example, separated by about 100 base pairs, about 200 base pairs, about 300 base pairs, about 400 base pairs, about 500 base pairs, or about 600 base pairs or more. Additionally, when targeting double-stranded DNA such as an endogenous locus, the guide polynucleotide can target the same strand or different strands (directing one or more to the plus strand and / or one or more to the minus strand).

[0183] In some embodiments, an epigenetic editor targeting TRAC is used in combination with one or more epigenetic editors targeting B2M, TRBC, CIITA, PDCD1, TIM-3, TIGIT, LAG3, CTLA4, AAVS1, CCR5, TET2, TGFBR2, A2AR, CISH, PTPN11, PTPN6, PTPA, PTPN2, JUNB, TOX, TOX2, NR4A1, NR4A2, NR4A3, MAP4K1, REL, IRF4, DGKA, PIK3CD, HLA-A, USP16, DCK, FAS, or any combination thereof.

[0184] V. Target Sequences To effect epigenetic modification of the TRAC gene, the epigenetic editors of the present specification can be directed to a target sequence within TRAC. As used herein, "target sequence", "target site" or "target region" is a nucleic acid sequence present within a gene of interest; in some cases, the target sequence may be present outside or in the vicinity of the gene of interest, and methylation of the target sequence or binding by a repressor suppresses the expression of that gene. In some embodiments, the target sequence can be a hypomethylated or hypermethylated nucleic acid sequence.

[0185] The target sequence can be present in any part of the target gene. In some embodiments, the target sequence is part of or in the vicinity of a non-coding sequence of the gene. In some embodiments, the target sequence is part of an exon of the gene. In some embodiments, the target sequence is part of or in the vicinity of a transcriptional regulatory sequence of the gene, such as a promoter or enhancer. In some embodiments, the target sequence is adjacent to, overlapping with, or encompassing a CpG island. In certain embodiments, the target sequence is within about 3000, 2900, 2800, 2700, 2600, 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, 1000, 900, 800, 700, 600, 500, 400, 300, 200, or 100 base pairs (bp) of the TRAC TSS. In certain embodiments, the target sequence is within 500 bp of the TRAC TSS. In certain embodiments, the target sequence is within 1000 bp of the TRAC TSS.

[0186] In some embodiments, the target sequence can hybridize to a guide polynucleotide sequence (e.g., gRNA) complexed with a fusion protein comprising a DNA binding domain (e.g., a CRISPR protein such as dCas9) and an effector domain(s) guided by the polynucleotide. The guide polynucleotide sequence may be designed to have complementarity to the target sequence, or may be designed to have identity with the opposite strand of the target sequence. In some embodiments, the guide polynucleotide comprises a spacer sequence that is about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the protospacer sequence in the target sequence. In certain embodiments, the guide polynucleotide comprises a spacer sequence that is 100% identical to the protospacer sequence in the target sequence.

[0187] In some embodiments, when the DNA binding domain of the epigenetic editor described herein is a zinc finger array, the target sequence can be recognized by the zinc finger array.

[0188] In some embodiments, when the DNA binding domain of the epigenetic editor described herein is a TALE, the target sequence can be recognized by the TALE.

[0189] The target sequences described herein may be specific for one copy of a target gene or may be specific for one allele of a target gene. Thus, epigenetic modification and its expression regulation can be specific for one copy or one allele of a target gene. For example, an epigenetic editor can suppress the expression of a specific copy (e.g., a copy associated with a disease or disorder, or a copy carrying a mutation associated with a disease or disorder) of a target sequence recognized by the DNA binding domain.

[0190] In some embodiments, the target TRAC genomic region may be included within the sequences shown in SEQ ID NO: 1219 or 1220.

[0191] VI. Epigenetic Modification The epigenetic editors described herein can effect sequence-specific epigenetic modifications (e.g., changes in chemical modifications) of a target gene having a target sequence. Such epigenetic modulation can be safer and more readily reversible than, for example, modulation resulting from gene editing using the generation of double-strand DNA breaks. In some embodiments, the epigenetic modulation can reduce or silence the target gene. In some embodiments, the modification (alteration) is at a specific site of the target sequence. In some embodiments, the modification is at a specific allele of the target gene. Thus, the epigenetic modification can result in modulation (e.g., reduction) of the expression of one copy of a target gene having a specific allele, and not for other copies of the target gene. In some embodiments, the specific allele is associated with a disease, condition, or disorder.

[0192] In some embodiments, the epigenetic modification reduces or halts transcription of a target gene having a target sequence. In some embodiments, the epigenetic modification reduces or halts transcription of a copy of a target gene having a specific allele recognized by the epigenetic editor. In some embodiments, the epigenetic editor reduces the expression level of the protein encoded by the target gene or eliminates its expression. In some embodiments, the epigenetic editor reduces the expression level of the protein encoded by a copy of a target gene having a specific allele recognized by the epigenetic editor or eliminates its expression. The target TRAC gene can be epigenetically modified in vitro, ex vivo, or in vivo.

[0193] The effector domains of the epigenetic editors described herein can alter (e.g., install or remove) chemical modifications in the nucleotides of a target gene or in the histones associated with the target gene. The chemical modifications can be altered in a single nucleotide or a single histone, or in 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, or more nucleotides.

[0194] In some embodiments, the effector domain of the epigenetic editor described herein can modify CpG dinucleotides within the target gene. In some embodiments, all CpG dinucleotides within 2000 bp, 1500 bp, 1000 bp, 500 bp, or 200 bp (e.g., within the modification site described herein) adjacent to the target sequence are modified according to the modification type described herein compared to the gene in its original state or in an equivalent cell not in contact with the epigenetic editor. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, or more of the CpG dinucleotides are modified compared to the gene in its original state or in an equivalent cell not in contact with the epigenetic editor. In some embodiments, at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the CpG dinucleotides are modified compared to the gene in its original state or in an equivalent cell not in contact with the epigenetic editor. In some embodiments, a single CpG dinucleotide is modified compared to the gene in its original state or in an equivalent cell not in contact with the epigenetic editor.

[0195] The effector domain of the epigenetic editor described herein can alter the histone modification state of histones associated or bound to a target gene. For example, the effector domain can install a modification on one or more lysine residues of the histone tail of a histone associated with a target gene. In some embodiments, the effector domain can result in the deacetylation of one or more histone tails of a histone associated with a target gene, thereby reducing or silencing the expression of the target gene. In some embodiments, the histone modification state is a methylation state. For example, the effector domain can result in H3K9, H3K27, or H4K20 methylation (e.g., one or more of H3K9me2, H3K9me3, H3K27me2, H3K27me3, and H4K20me3 methylation) in one or more histone tails associated with a target gene, thereby reducing or silencing the expression of the target gene.

[0196] In some embodiments, all histone tails of histones bound to DNA nucleotides within 2000 bp, 1500 bp, 1000 bp, 500 bp, or 200 bp adjacent to the target sequence are changed according to the modification types described herein as compared to the chromosome in its original state or the chromosome in equivalent cells that have not contacted the epigenetic editor. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, or more histone tails of the bound histones are changed as compared to the chromosome in its original state or the chromosome in equivalent cells that have not contacted the epigenetic editor. In some embodiments, at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the histone tails of the bound histones are changed as compared to the chromosome in its original state or the chromosome in equivalent cells that have not contacted the epigenetic editor. For example, a single histone tail of a bound histone can be changed as compared to the chromosome in its original state or the chromosome in equivalent cells that have not contacted the epigenetic editor. As another example, a single bound histone octamer can be changed as compared to the chromosome in its original state or the chromosome in equivalent cells that have not contacted the epigenetic editor.

[0197] The chemical modifications placed on the target gene DNA nucleotides or histone residues can be those in the target sequence in the target gene or in its vicinity. In some embodiments, the effector domain of the epigenetic editor described herein changes the chemical modification state of nucleotides 100 to 200, 200 to 300, 300 to 400, 400 to 55, 500 to 600, 600 to 700, or 700 to 800 nucleotides 5' or 3' to the target sequence in the target gene or of histone tails attached to the nucleotides. In some embodiments, the effector domain changes the chemical modification state of one nucleotide within 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 nucleotides adjacent to the target sequence or of histone tails attached to the nucleotide. As used herein, "adjacent to" refers to nucleotide positions from the 5' end to the 5' terminus and from the 3' end to the 3' terminus of a particular sequence, e.g., the target sequence.

[0198] In some embodiments, the effector domain mediates or induces a change in the chemical modification of nucleotides distal to the target sequence or histone tails attached to the nucleotides. Such modifications can be initiated in the vicinity of the target sequence and subsequently spread to one or more nucleotides in the target gene distal to the target sequence. For example, the effector domain can initiate a change in the chemical modification state of one or more nucleotides within 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 nucleotides adjacent to the target sequence or one or more histone residues attached to one or more nucleotides, and the change in the chemical modification state can spread from the target sequence within the target gene to at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, or more nucleotides either upstream or downstream. In certain embodiments, the chemical modification can be initiated in less than 2, 3, 5, 10, 20, 30, 40, 50, or 100 nucleotides in the target gene and can spread to at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, or more nucleotides in the target gene. In some embodiments, the chemical modification spreads to the nucleotides throughout the target gene. Additional proteins or transcription factors, such as transcription repressors, methyltransferases, or transcription regulatory scaffold proteins, can be involved in the spread of the chemical modification. Alternatively, the epigenetic editor alone can be involved.

[0199] In some embodiments, the epigenetic editor described herein reduces the expression of a target gene by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or more, as measured by transcription of the target gene in a cell, tissue, or subject, compared to a control cell, control tissue, or control subject (e.g., in the absence of the epigenetic editor). In some embodiments, the epigenetic editor described herein reduces the expression of a copy of a target gene by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or more, as measured by transcription of the copy of the target gene in a cell, tissue, or subject, compared to a control cell, control tissue, or control subject. In certain embodiments, the copy of the target gene has a specific sequence or allele recognized by the epigenetic editor. In specific embodiments, the epigenetically modified copy encodes a functional protein, and thus the epigenetic editor disclosed herein can reduce or abrogate protein expression and / or function.For example, the epigenetic editors described herein can reduce the expression and / or function of the protein encoded by the target gene in a cell, tissue, or subject by at least one-third, at least one-fourth, at least one-fifth, at least one-sixth, at least one-seventh, at least one-eighth, at least one-ninth, at least one-tenth, at least one-eleventh, at least one-twelfth, at least one-thirteenth, at least one-fourteenth, at least one-fifteenth, at least one-twentieth, at least one-twenty-fifth, at least one-thirtieth, at least one-thirty-fifth, at least one-fortieth, at least one-forty-fifth, at least one-fiftieth, at least one-sixtieth, at least one-seventieth, at least one-eightieth, at least one-ninetieth, or at least one-hundredth, as compared to a control cell, control tissue, or control subject.

[0200] Modulation of target gene expression can be assayed by determining any parameter that is indirectly or directly affected by the expression of the target gene. Such parameters include, for example, changes in RNA or protein levels, changes in protein activity, changes in product levels, changes in downstream gene expression, changes in the transcription or activity of reporter genes such as luciferase, CAT, beta-galactosidase, or GFP, changes in signal transduction, changes in phosphorylation and dephosphorylation, changes in receptor-ligand interactions, second messengers such as cGMP, cAMP, IP3, and Ca2 +Changes in concentration, changes in cell growth, changes in angiogenesis, and / or changes in any functional effect of gene expression can be mentioned. The measurement can be carried out in vitro, in vivo, and / or ex vivo, and can be performed by conventional methods, for example, measurement of RNA or protein levels, measurement of RNA stability, and / or identification of downstream or reporter gene expression. The readout can be, for example, chemiluminescence, fluorescence, colorimetric reaction, antibody binding, inducible marker, ligand binding assay, changes in intracellular second messengers such as cGMP and inositol trisphosphate (IP3), changes in intracellular calcium levels, cytokine release, etc.

[0201] Methods for determining the expression level of a gene, for example, a target of an epigenetic editor, may include, for example, determining the transcript level of the gene by reverse transcription PCR, quantitative RT-PCR, droplet digital PCR (ddPCR), Northern blot, RNA sequencing, DNA sequencing (for example, sequencing of complementary deoxyribonucleic acid (cDNA) obtained from RNA), next-generation (Next-Gen) sequencing, nanopore sequencing, pyrosequencing, or nanostring sequencing. The level of the protein expressed from the gene can be determined by, for example, Western blotting, enzyme-linked immunosorbent assay, mass spectrometry, immunohistochemistry, or flow cytometry analysis. The level of the gene expression product may be normalized against an internal standard, for example, total messenger ribonucleic acid (mRNA), or the expression level of a specific gene, for example, a housekeeping gene.

[0202] In some embodiments, the action of epigenetic editors in modulating target gene expression can be tested using a reporter system. For example, an epigenetic editor may be designed to target a reporter gene that encodes a reporter protein, such as a fluorescent protein. The expression of the reporter gene in such a model system can be monitored, for example, by flow cytometry, fluorescence-activated cell sorting (FACS), or fluorescence microscopy. In some embodiments, a cell population can be transfected with a vector having the reporter gene. The vector can be constructed such that the reporter gene is expressed when the vector is transfected into the cell. Suitable reporter genes include genes encoding fluorescent proteins, such as green, yellow, cherry, cyan, or orange fluorescent proteins. A cell population having a reporter system can be transfected with DNA, mRNA, or a vector encoding an epigenetic editor that targets the reporter gene.

[0203] VII. Epigenetically Modified Cells In one aspect, the disclosure provides cells modified using one or more of the epigenetic editors described herein. In some embodiments, one or more nucleic acid molecules encoding the one or more epigenetic editors or one or more components thereof are applied to the cell. Any type of cell can be modified as described herein. The cells can be modified in vitro, in vivo, or ex vivo. Suitable cells for modification can be obtained from a patient or a healthy donor.

[0204] In some embodiments, the cell is an immune cell. Immune cells can include T cells, B cells, natural killer (NK) cells, dendritic cells, and monocytes / macrophages. In some embodiments, the cell is an αβ T cell. In some embodiments, the cell is a γδ T cell. In some embodiments, the cell is a cytotoxic T cell, such as a CD8+ cytotoxic T cell. In some embodiments, the cell is a helper T cell, such as a CD4+ helper T cell. In some embodiments, the cell is a regulatory T cell. In some embodiments, the cell is an NK cell. In some embodiments, the cell is a dendritic cell. In some embodiments, the cell is a macrophage.

[0205] In some embodiments, the cell is a stem cell. A "stem cell" refers to an undifferentiated cell that has the ability to infinitely generate a large number of stem cells of the same type, from which other specialized cells can arise through differentiation. Usually, adult stem cells are multipotent (able to differentiate within a specific range), and induced pluripotent stem cells or embryonic stem cells are pluripotent (able to differentiate into any cell type).

[0206] In some embodiments, the cell is a progenitor cell. A "progenitor cell" is a cell that can differentiate to form one or more types of cells in vitro and in vivo, but has limited self-renewal ability.

[0207] In certain embodiments, the cells can differentiate into the immune cells described above. The cells can be, for example, embryonic stem cells (ESCs), hematopoietic stem cells (HSCs), hematopoietic progenitor cells (HPCs), or hematopoietic stem and progenitor cells (HSPCs). "Hematopoietic stem and progenitor cells" or "HSPCs" refer to cells that express the antigen marker CD34 (CD34+). In certain embodiments, the term "HSPCs" refers to cells identified by the presence of the antigen marker CD34 (CD34+) and the absence of lineage (lin) markers. The cell population that is CD34+ and / or Lin- includes hematopoietic stem cells and hematopoietic progenitor cells.

[0208] In some embodiments, the cells are induced pluripotent stem cells (iPSCs) reprogrammed from somatic cells such as T cells.

[0209] In some embodiments, the cells are obtained from the umbilical cord blood of healthy donors. In some embodiments, the cells are obtained from adult peripheral blood or collected from the bone marrow of healthy donors.

[0210] In some embodiments, cells as described above are modified by a method comprising transfecting the cells with (a) one or more epigenetic editors described herein, or (b) a system comprising one or more nucleic acid molecules encoding said epigenetic editor. In certain embodiments, the modified cells are T cells. In some embodiments, the modified T cells express one or more epigenetic editors capable of selectively reducing or silencing the expression of one or more target genes within the cell. In a particular embodiment, the target gene is TRAC. In some embodiments, the T cells are modified ex vivo. In some embodiments, the modified T cells may further express a modified TCR or CAR against at least one antigen expressed on the surface of a target cell (e.g., a malignant cell or an infected cell). In some embodiments, the modified T cells do not express at least one gene encoding an endogenous TCR component. In certain embodiments, the modified T cells are non-alloreactive. In certain embodiments, the modified T cells are particularly suitable for allotransplantation.

[0211] VIII. Pharmaceutical Compositions In one aspect, the present disclosure provides a pharmaceutical composition comprising, as an active ingredient (or as the only active ingredient), one or more epigenetic editors described herein or one or more components thereof (e.g., fusion proteins and / or guide polynucleotides), or one or more nucleic acid molecules encoding said epigenetic editor or a component thereof. For example, the pharmaceutical composition may comprise one or more nucleic acid molecules (and optionally guide polynucleotides) encoding one or more fusion proteins of the epigenetic editors described herein. In some embodiments, another pharmaceutical composition comprises one or more fusion proteins and one or more guide polynucleotides.

[0212] In one aspect, the present disclosure provides a pharmaceutical composition comprising, as an active ingredient (or as the only active ingredient), a cell that has undergone one or more epigenetic modifications mediated or induced by one or more epigenetic editors described herein. For example, one or more nucleic acid molecules encoding the epigenetic editor are administered to the cell ex vivo.

[0213] Generally, an epigenetic editor described herein, or one or more of its components, one or more nucleic acid molecules encoding the epigenetic editor or its components, or a cell modified by an epigenetic editor of the present disclosure is suitable for administration as a formulation, for example, as follows, together with one or more pharmaceutically acceptable excipients.

[0214] The term "excipient" is used herein to denote any component other than one or more compounds of the present disclosure. The choice of excipient is highly dependent on factors such as the individual mode of administration, the effect of the excipient on solubility and stability, and the properties of the formulation. Pharmaceutically acceptable excipients used herein include any physiologically compatible solvent, dispersion medium, coating, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. Examples of pharmaceutically acceptable excipients include water, physiological saline, phosphate buffered saline, glucose, glycerol, ethanol, and the like, and combinations thereof. In many cases, it is preferred to include an isotonic agent, such as a sugar, a polyhydric alcohol such as mannitol, sorbitol, or sodium chloride, in the composition. Further examples of pharmaceutically acceptable substances include wetting agents or minor amounts of auxiliary substances, such as wetting or emulsifying agents, preservatives, or buffering agents, which enhance the shelf life or effectiveness of the antibody.

[0215] Formulations of pharmaceutical compositions suitable for parenteral administration usually contain the active ingredient in combination with a pharmaceutically acceptable carrier such as sterile water or sterile isotonic saline. Such formulations can be prepared, packaged, or sold in a form suitable for bolus administration or continuous administration. The pharmaceutical compositions described herein can be administered to a subject, for example, subcutaneously, intradermally, intratumorally, intranodally, intramuscularly, intravenously, intralymphatically, or intraperitoneally. In certain embodiments, the pharmaceutical compositions of the present disclosure are administered intravenously to a subject.

[0216] IX. Delivery Methods In some embodiments, the epigenetic editor or a component thereof is introduced into the target cell in the form of the epigenetic editor or a nucleic acid molecule encoding the component thereof, and thus the pharmaceutical compositions herein contain the nucleic acid molecule. Such nucleic acid molecules can be, for example, DNA, RNA, or mRNA, and / or modified nucleic acid sequences (e.g., having chemical modifications, 5' caps, or one or more 3' modifications). In some embodiments, the nucleic acid molecule may be delivered as naked DNA or RNA using, for example, transfection or electroporation, or may be conjugated to a molecule that facilitates uptake by the target cell (e.g., N-acetylgalactosamine). In some embodiments, the nucleic acid molecule may be contained in a nucleic acid expression vector, which may contain expression control sequences such as a promoter, enhancer, transcription signal sequence, transcription termination sequence, intron, polyadenylation signal, Kozak consensus sequence, internal ribosome entry site (IRES), etc. Such expression control sequences are well known in the art. The vector may also contain a sequence encoding a signal peptide (e.g., for nuclear localization, nucleolar localization, or mitochondrial localization) associated with (e.g., inserted or fused to) the sequence encoding the protein.

[0217] Examples of vectors include, but are not limited to, plasmid vectors, vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviruses (e.g., vectors derived from retroviruses such as murine leukemia virus or spleen necrosis virus, Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus), and other recombinant vectors. In certain embodiments, the vector is a plasmid or viral vector. Virus particles or virus-like particles (VLPs) can also be used to deliver nucleic acid molecules encoding the epigenetic editors or components thereof described herein. For example, "empty" virus particles can be assembled to contain any suitable cargo. Viral vectors and virus particles can also be engineered to incorporate targeting ligands to alter target tissue specificity.

[0218] In certain embodiments, the epigenetic editors or components thereof described herein are encoded by nucleic acid sequences present in one or more viral vectors or suitable capsid proteins of any viral vector. Examples of viral vectors include adeno-associated virus vectors (e.g., derived from AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAV10, and / or variants thereof), retroviral vectors (e.g., Moloney murine leukemia virus, MML-V), adenoviral vectors (e.g., AD100), lentiviral vectors (e.g., vectors based on HIV and FIV), and herpesvirus vectors (e.g., HSV-2).

[0219] In some embodiments, delivery comprises an adeno-associated virus (AAV) vector. AAV vector delivery can be particularly useful when the DNA binding domain of the epigenetic editor fusion protein is a zinc finger array. Without wishing to be bound by any theory, the small size of the zinc finger array compared to large DNA binding domains, such as Cas protein domains, may enable such fusion proteins to be conveniently packaged into viral vectors, such as AAV vectors.

[0220] Any AAV serotype, such as a human AAV serotype, can be used in the AAV vectors described herein, including, but not limited to, AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype 10 (AAV10), and AAV serotype 11 (AAV11), and variants thereof. In some embodiments, the AAV variant has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity to wild-type AAV. In certain embodiments, the AAV variant may be engineered such that its capsid protein has reduced immunogenicity or enhanced transduction ability in humans. In some cases, one or more regions of at least two different AAV serotype viruses are shuffled and reassembled to generate chimeric variants. For example, chimeric AAVs can contain inverted terminal repeat sequences (ITRs) that are of a serotype that is heterologous compared to the serotype of the capsid. The resulting chimeric AAV may have different antigen reactivity or recognition compared to its parental serotype. In some embodiments, the chimeric variant of AAV comprises amino acid sequences derived from two, three, four, five, or more different AAV serotypes.

[0221] Non-viral systems are also contemplated for delivery as described herein. Non-viral systems include, but are not limited to, electroporation, sonoporation, calcium phosphate transfection, microinjection, DNA gene gun, lipid-mediated transfection, transfection through heat shock, small DNA-mediated transfection, lipofection, cationic agent-mediated transfection, and nucleic acid transfection methods including transfection with liposomes, immunoliposomes, exosomes, or cationic facial amphiphiles (CFA). In certain embodiments, one or more mRNAs encoding the epigenetic editor fusion proteins described herein can be co-electroporated with one or more guide polynucleotides (e.g., gRNA) described herein. One important category of non-viral nucleic acid vectors are nanoparticles, which can be organic (e.g., lipid) or inorganic (e.g., gold). For example, organic (e.g., lipid and / or polymer) nanoparticles can be suitable for use as delivery vehicles in certain embodiments of the present disclosure.

[0222] In some embodiments, delivery is achieved using lipid nanoparticles (LNP). LNP compositions are typically on the micrometer scale or smaller in size and can include a lipid bilayer. In some embodiments, LNP refers to any particle having a diameter of less than 1000 nm, less than 500 nm, less than 250 nm, less than 200 nm, less than 150 nm, less than 100 nm, less than 75 nm, less than 50 nm, or less than 25 nm. In some embodiments, the nanoparticles can range in size from 1 to 1000 nm, 1 to 500 nm, 1 to 250 nm, 25 to 200 nm, 25 to 100 nm, 35 to 75 nm, or 25 to 60 nm. Nanoparticle compositions include lipid nanoparticles (LNP), liposomes (e.g., lipid vesicles), and lipoplexes.

[0223] The LNPs described herein can be made from cationic, anionic, or neutral lipids. In some embodiments, the LNP can include a neutral lipid, such as the fusogenic phospholipid 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) or cholesterol which is a membrane component, as a helper lipid to enhance transfection activity and nanoparticle stability. In some embodiments, the LNP can include hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids. Any lipid or combination of lipids known in the art can be used to produce the LNP. The lipids can be combined in any molar ratio for producing the LNP. In some embodiments, the LNP is a T cell-targeting (e.g., preferentially or specifically targeting T cells) LNP.

[0224] X. Use of Epigenetic Editors and Modified Cells in Therapy The present disclosure also provides a method for treating or preventing a disease in a subject, comprising administering to the subject a pharmaceutical composition comprising a) one or more epigenetic editors described herein, b) one or more nucleic acid molecules encoding an epigenetic editor, c) a cell modified by an epigenetic editor, or d) any of a)-c).

[0225] In one aspect, the epigenetic editor effects an epigenetic modification of a target polynucleotide sequence within a target gene associated with a disease, disorder, or condition of the subject, thereby regulating the expression of the target gene to treat or prevent the disease, disorder, or condition. In some embodiments, the epigenetic editor reduces the expression of the target gene to an extent sufficient to achieve a desired effect, such as a therapeutically appropriate effect such as prevention or treatment of a disease, disorder, or condition.

[0226] In one aspect, cells (e.g., allogeneic cells) modified by one or more of the epigenetic editors of the present disclosure are administered as a drug to a subject having a disease, disorder, or impairment, whereby the disease, disorder, or impairment can be treated. In some embodiments, the subject receives an administration of allogeneic T cells that are epigenetically modified as described herein, for example, to reduce or silence TRAC expression. In some embodiments, the modified T cells further express a modified TCR or CAR against at least one antigen expressed on the surface of target cells (e.g., malignant cells or infected cells). In some embodiments, the modified T cells do not express at least one gene encoding an endogenous TCR component.

[0227] In some embodiments, the subject can be a mammal, such as a human. In some embodiments, the subject is selected from non-human primates such as chimpanzees, cynomolgus monkeys, or macaques, as well as other apes and monkey species.

[0228] XI. Definitions As used herein, the term "nucleic acid" refers to any oligonucleotide or polynucleotide that contains nucleotides (e.g., deoxyribonucleotides or ribonucleotides) in either single-stranded or double-stranded form, including DNA and RNA. "Nucleotide" contains a sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group, and is linked through the phosphate group. "Base" includes natural compounds such as purines and pyrimidines including adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, as well as synthetic derivatives of purines and pyrimidines with new reactive groups such as amines, alcohols, thiols, carboxylic acids, alkyl halides, etc. Nucleic acids can contain known nucleotide analogs and / or modified backbone residues or linkages, which may be synthetic, naturally occurring, or non-naturally occurring. Such nucleotide analogs, modified residues, and modified linkages are well known in the art and can result in nucleic acid molecules with enhanced cellular uptake, reduced immunogenicity, and / or increased stability in the presence of nucleases.

[0229] As used herein, an "isolated" or "purified" nucleic acid molecule is a nucleic acid molecule that exists separate from its native environment. For example, an "isolated" or "purified" nucleic acid molecule is (1) separated from the nucleic acids of genomic DNA or cellular RNA from which it originated, and / or (2) does not occur in nature. In some embodiments, an "isolated" or "purified" nucleic acid molecule is a recombinant nucleic acid molecule.

[0230] In addition to the specific proteins and nucleic acid molecules referred to herein, it will be understood that the present disclosure also contemplates the use of variants, derivatives, homologs, and fragments thereof. A variant of any given sequence can have a specific sequence of residues (either amino acid residues or nucleic acid residues) that are modified in such a way that the polypeptide or polynucleotide in question substantially retains at least one of its endogenous functions. Variant sequences can be obtained by addition, deletion, substitution, modification, replacement, and / or variation of at least one residue (in some embodiments, one or fewer, two or fewer, three or fewer, four or fewer, five or fewer, six or fewer, seven or fewer, eight or fewer, nine or fewer, ten or fewer, fifteen or fewer, or twenty or fewer residues) present in the naturally occurring sequence. For the specific proteins described herein (e.g., the KRAB, dCas9, DNMT3A, and DNMT3L proteins described herein), the present disclosure also contemplates either the naturally occurring form of the protein or a variant or homolog that retains at least one of its endogenous functions (e.g., at least 50%, 60%, 70%, 80%, 90%, 85%, 96%, 97%, 98%, or 99% of its function as compared to the specific protein described).

[0231] As used herein, a homolog of any polypeptide or nucleic acid sequence contemplated herein includes a sequence having a defined homology to the wild-type amino acid and nucleic acid sequences. The homologous sequences can include sequences that are at least 50%, 55%, 65%, 75%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the subject sequence, for example, amino acid sequences. The term "percent identical" in the context of an amino acid or nucleotide sequence refers to the percentage of residues that are the same in two sequences when aligned for maximum correspondence. In some embodiments, the length of the reference sequence aligned for comparison purposes is at least 30% (e.g., at least 40, 50, 60, 70, 80, or 90%, or 100%) of the reference sequence. Sequence identity can be measured using sequence analysis software (e.g., the Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP / PRETTYBOX programs). Such software can align identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and / or other modifications. In an exemplary approach for determining the degree of identity, the BLAST program can be used, and probability scores of e-3 to e-100 indicate closely related sequences.

[0232] The percent identity of two nucleotide or polypeptide sequences is determined, for example, using BLAST® with its default parameters (available at the website of the U.S. National Library of Medicine's National Center for Biotechnology Information). In some embodiments, the length of the reference sequence aligned for comparison purposes is at least 30% of the reference sequence (e.g., at least 40, 50, 60, 70, 80, or 90%).

[0233] It will be understood that the numbering of a particular position or residue in a polypeptide sequence depends on the specific protein and numbering scheme used. The numbering may, for example, differ between the precursor of a mature protein and the mature protein itself, and sequence differences between species can affect the numbering. One of ordinary skill in the art will be able to identify the respective residues in any homologous protein and the nucleic acid encoding each thereof by methods well known in the art, such as sequence alignment and determination of homologous residues.

[0234] The terms "modulate" or "alter" refer to a change in the amount, degree, or extent of a function. For example, the epigenetic editors described herein can modulate the activity of a promoter sequence by binding to a motif within the promoter, thereby inducing, enhancing, or suppressing the transcription of a gene operably linked to the promoter sequence. As another example, the epigenetic editors described herein can block RNA polymerase from transcribing a gene or inhibit the translation of an mRNA transcript. The terms "inhibit," "suppress," "repress," "silence," etc., when used with reference to the epigenetic editors or components thereof described herein, refer to a decrease or prevention of the activity of a nucleic acid sequence (e.g., a target gene) or protein (e.g., transcription) compared to the activity of the nucleic acid sequence or protein in the absence of the epigenetic editor or its component. This term can include partially or completely blocking the activity, or preventing or delaying the activity. The inhibited activity can be, for example, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% lower than that of a control, or can be, for example, at least one-fifteenth, one-half, one-third, one-fourth, one-fifth, or one-tenth of that of a control.

[0235] The term "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, "about" can mean within one or more standard deviations of a given value according to the convention in the art. When a particular value is recited in the present application and claims, the term "about" is to be assumed to mean within the acceptable error range of that particular value, unless otherwise indicated.

[0236] The ranges provided in this specification are understood to be shorthand for all values within the range. For example, a range of 1 to 50 includes any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50, as well as all intervening fractional values between the aforementioned integers, such as 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9. With respect to sub-ranges, "nested sub-ranges" extended from either endpoint of the range are specifically contemplated. For example, nested sub-ranges of the exemplary range of 1 to 50 can include, in one direction, 1 to 10, 1 to 20, 1 to 30, and 1 to 40, or in the other direction, 50 to 40, 50 to 30, 50 to 20, and 50 to 10.

[0237] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings commonly understood by those of ordinary skill in the art. Although exemplary methods and materials are described below, methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. In case of conflict, the present specification, including definitions, will control. Further, unless the context requires otherwise, singular terms shall include pluralities and plural terms shall include the singular. Throughout this specification and the embodiments, the terms "have" and "comprise" or variations such as "has", "having", "comprises", or "comprising" mean the inclusion of the stated integer or group of integers but are not to be understood as excluding the inclusion of any other integer or group of integers. Unless otherwise indicated, the description of a list of elements in this specification includes any one of the elements alone or in any combination. The description of embodiments in this specification includes that embodiment as a single embodiment or in combination with any other embodiment in this specification. All publications, patents, patent applications, and other references cited in this specification are incorporated by reference in their entirety. To the extent that the references incorporated by reference conflict with the present disclosure included in this specification, this specification is intended to be prior and / or superior to any such conflicting material. Although several documents are cited in this specification, this citation does not establish the recognition that any of these documents forms part of the common general knowledge in the art.

[0238] According to the present disclosure, a backward reference in a dependent claim means a shorthand for the direct and explicit disclosure of each individual combination of the claims indicated by the backward reference. Further, the headings in this specification are provided for ease of construction and are in no way intended to limit the scope of the invention described in the claims.

[0239] To better understand the present disclosure, the following examples are described. These examples are for illustrative purposes only and should never be construed as limiting the scope of the present disclosure.

Example

[0240] (Example 1) Design and synthesis of fusion proteins A fusion protein (“CRISPR-off”) containing dCas9, DNMT3A, DNMT3L, and KOX1 KRAB was prepared. This protein had the following functional domains and linkers from the N-terminus to the C-terminus: huDNMT3A-linker-huDNMT3L-XTEN80-NLS-dSpCas9-NLS-XTEN16-huKOX1 KRAB (SEQ ID NO: 658). The CRISPR-off plasmid construct is described in Nunez et al., Cell (2021) 184(9):2503-19.

[0241] A ZF fusion protein (“ZF-off”) containing DNMT3A, 3L, and KOX1 KRAB was also prepared. These fusion proteins had the following general structure: huDNMT3A-linker-huDNMT3L-XTEN80-NLS-ZFP domain-NLS-XTEN16-huKOX1 Krab (SEQ ID NO: 659).

[0242] (Example 2) Selection of the TRAC region for gRNA targeting Using the Benchling gRNA platform for human TRAC (GRCh38), gRNAs targeting genomic regions within 1 kb from the TSS of the human TRAC gene were computationally designed. gRNAs containing the polyTTTT sequence were excluded first. gRNA off-target analysis was performed using CasOFFinder (Bae et al., Bioinformatics (2014) 30(10):1473-5). Those gRNAs that matched multiple locations within the target genome were excluded.

[0243] A final set of 229 gRNA sequences was selected for primary screening in primary human T cells (see Tables 2 and 3 for gRNA target sequences and targeting domain sequences, respectively). A DNA plasmid containing the coding sequence of the gRNA under the control of the U6 promoter was obtained from a vendor.

[0244] [Table 8] TIFF2025524455000035.tif250148TIFF2025524455000036.tif249148TIFF2025524455000037.tif250148TIFF2025524455000038.tif251149TIFF2025524455000039.tif80140

[0245] (Example 3) Selection of ZF target sites and design of ZFPs Using a library of two-finger ZFPs (2F units) that each recognize a 6-bp DNA site, a large six-finger ZFP array targeting an 18-bp DNA binding site was designed. The source of the 2F units was a set of three-finger Zn finger proteins selected to bind to specific target sites using a bacterial two-hybrid (B2H) selection system (Hurt et al., PNAS (2003) 100:12271-6; Maeder et al., Mol Cell (2008) 31(2):294-301). All possible three-way combinations of the 6-bp binding sites shown in the library were generated, allowing either 0 or 1 bp between the 6-bp target sites to create a list of targetable DNA sites. To identify ZF target sites within human TRAC, sequences within 1 kb from the TSS (human TRAC (GRCh38)) were compared to this list.

[0246] For each identified ZF target site, multiple ZF proteins could be designed. The design of the six recognition helices used to generate the complete protein was made by selecting 2F units, considering factors such as the known binding ability of Zn finger proteins, the frequency with which amino acids at positions -1, 2, 3, and 6 are selected to bind to the desired target bases in the B2H selection system, the avoidance of amino acids at positions -1, 2, 3, 6 selected to bind to multiple different bases in B2H, and the maintenance of context dependence by matching adjacent bases if possible. The entire ZF sequence was derived from the naturally occurring Zif268 protein, and the selected recognition helices were maintained in the sequence configuration selected by B2H (either finger 1-2 or finger 2-3 of Zif268).

[0247] The 2F units were linked with the linker TGSQKP (SEQ ID NO: 651) when the 6bp binding sites were adjacent, and with the linker TGGGGSQKP (SEQ ID NO: 652) when the 6bp binding sites were separated by 1bp. Additionally, a final set of 158 ZFPs targeting 61 different binding sites within 1 kb from the TSS (chr 14:22547506) that did not have a perfect match with the genome (GRCh38) were selected for the primary screening (Table 1).

[0248] (Example 4) Guide RNA Screening in Primary Human T Cells This example describes a study screening the effectiveness of gRNAs targeting TRAC in primary human T cells.

[0249] T cells are isolated from human leukapheresis products (StemCell Technologies, Cat. No. 70500) using the EasySep™ Human T cell Isolation Kit (StemCell Technologies, Cat. No. 17951). The T cells are thawed and activated. Before nucleofection, the T cells are thawed, washed, and stimulated in complete T cell medium (X-VIVO15 medium; Lonza, Cat. No. BEBP04-744Q) supplemented with 5% human AB serum (Gemini Bio-Product, Cat. No. 100-512), 2 mM L-alanyl-L-glutamine, 5 ng / mL IL-7, and 5 ng / mL IL-15 at 37 °C, 5% CO2 for approximately 48 hours using Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation (Thermo Fisher, Cat. 11131D) at a bead:cell ratio of 3:1. Subsequently, the beads are removed from the culture by magnetic force and the T cells are cultured in fresh complete T cell medium for approximately 24 hours. Next, 2 × 10 5 cells / well of 2.5 μg CRISPR-off mRNA (TriLink) + 2.5 μg sgRNA (IDT) are introduced into the T cells by nucleofection using the P3 Primary Cell 96 Well Nucleofector Kit (Lonza, Cat. No. V4SP-3960) and Amaxa 4D Nucleofector® (Lonza) with pulse code EO-115.

[0250] After nucleofection, the T cells are resuspended in complete T cell medium and maintained by medium change and passage twice a week as needed.

[0251] The cell surface CD3 expression of live T cells is evaluated by flow cytometry on days 6, 13, and 20 after nucleofection. Controls without mRNA, CRISPR-off mRNA + non-TRAC-targeting sgRNA, CRISPR-off mRNA without gRNA, WT Cas9 mRNA + exon-targeting sgRNA, staining only (without mRNA or gRNA), isotype (without mRNA or gRNA), and no staining (without mRNA or gRNA) are also run on each screening plate.

[0252] On days 6, 13, and 20 after nucleofection, a portion of the T cells is aliquoted and evaluated by flow cytometry staining, while the remaining cells are maintained in culture. Cells to be stained have the medium aspirated, are washed once with PBS containing 2% FBS, and are stained with a 1:300 dilution of a PE-labeled anti-human CD3 antibody (BioLegend, Cat. No. 317308) and a 1:1000 dilution of Zombie Violet™ Fixable Viability Dye (BioLegend, Cat. No. 423113) in PBS containing 2% FBS, prepared in advance according to the manufacturer's recommendations, for 20 minutes at 4°C. The stained cells are washed and incubated in Fixation Buffer (BioLegend, Cat. No. 420801) for 20 minutes. Next, after washing the cells, data acquisition is performed on an Agilent Novocyte Penteon flow cytometer, collecting a maximum of 20,000 live cell events per well. The screening situation is compared to the expression level of a negative (CRISPR-off mRNA without sgRNA) control to evaluate the percentage of silencing.

[0253] (Example 5) ZF Screening in Primary Human T Cells In the study described in this example, ZFP domains targeting various genomic regions of the TRAC gene are the subject of screening in human primary T cells.

[0254] T cells are isolated from human leukapheresis products and cryopreserved. Before nucleofection, the T cells are thawed and stimulated with CD3 / CD28 beads in complete T cell medium at 37 °C and 5% CO2 for approximately 48 hours. Subsequently, the beads are removed by magnetic force and the T cells are cultured in fresh complete T cell medium. ZF-off mRNA is introduced into the T cells by nucleofection using Lonza Amaxa 4D Nucleofector (registered trademark). After nucleofection, the T cells are resuspended in complete T cell medium and maintained twice a week by medium exchange and splitting of the cell culture system as needed. On days 6, 13, and 20 after nucleofection, the cell surface CD3 protein expression of viable T cells is evaluated by flow cytometry. Controls without mRNA, non-TRAC-targeted ZF-off mRNA, WT Cas9 mRNA + exon-targeted gRNA, staining only, isotype, and no staining are also run on each screening plate.

[0255] CD3 flow cytometry is performed as described in Example 4. The screening situation is compared with the expression level of the negative (non-TRAC-targeted ZF) control, and the silencing ratio is evaluated.

[0256] (Example 6) Full specificity screening of constructs in primary human T cells The specificity of CRISPR-off and ZF-off constructs for silencing TRAC is tested in primary human T cells. The readouts for evaluating specificity are RNAseq, methylation arrays, and whole-genome bisulfite sequencing analysis assays. Characterize genome-wide expression and methylation changes after epigenetic editing compared to negative controls.

[0257] (Example 7) CpG methylation pattern Examine the CpG methylation patterns in primary human T cells treated with CRISPR-off or ZF-off. Perform a hybrid capture assay on bisulfite-treated DNA to examine the methylation patterns of CpG sites induced by CRISPR-off or ZF-off in a 1 kb region near the TRAC TSS.

[0258] (Example 8) Screening follow-up and hit validation The top hits obtained from the gRNA and ZF-off screening are reconfirmed by repeating the screening experimental conditions and appropriately adjusting the dose of CRISPR-off mRNA + gRNA or ZF-off mRNA up and down by about several-fold (about 3.2-fold), and a dose-response profile is established. Select the gRNA and ZF-off mRNA showing the highest potency and long-term durability profiles for downstream candidate development. 0.5 (Example 9)

[0259] (Example 9) Allogeneic functional assays in primary T cells Evaluate the response of TRAC-silencing T cells or mock-modified T cells to allogeneic peripheral blood mononuclear cells (PBMCs) by a mixed lymphocyte co-culture assay and / or a cytotoxicity assay. The proliferation and / or activation of TRAC-silencing T cells or mock-modified T cells are evaluated by measuring the cell dye dilution and the cell surface expression of activation markers by flow cytometry, respectively, after co-culture with allogeneic PBMCs. It is expected that the response of TRAC-silencing T cells is reduced compared to the response of mock-modified T cells, as they show a decrease in proliferation and activation corresponding to allogeneic PBMCs. Furthermore, evaluate the death of allogeneic PBMCs after co-incubation with TRAC-silencing T cells or mock-modified T cells by flow cytometry using a viability dye staining or by image analysis of cell viability. The death of allogeneic PBMCs by TRAC-silencing T cells is expected to be decreased compared to the death of allogeneic PBMCs by mock-modified T cells.

[0260] Sequence Listing The SEQ ID numbers (SEQ) of the nucleotide (nt) and amino acid (aa) sequences described in this specification are listed below. TIFF2025524455000040.tif242166TIFF2025524455000041.tif246168TIFF2025524455000042.tif246168TIFF2025524455000043.tif246168TIFF2025524455000044.tif248167TIFF2025524455000045.tif248167TIFF2025524455000046.tif247166TIFF2025524455000047.tif247166TIFF2025524455000048.tif247166TIFF2025524455000049.tif247166TIFF2025524455000050.tif247166TIFF2025524455000051.tif247166TIFF2025524455000052.tif247166TIFF2025524455000053.tif247166TIFF2025524455000054.tif244168TIFF2025524455000055.tif241168TIFF2025524455000056.tif250168TIFF2025524455000057.tif248166TIFF2025524455000058.tif242165TIFF2025524455000059.tif247166TIFF2025524455000060.tif252167TIFF2025524455000061.tif246167TIFF2025524455000062.tif248167TIFF2025524455000063.tif243167TIFF2025524455000064.tif249168TIFF2025524455000065.tif251168TIFF2025524455000066.tif251168TIFF2025524455000067.tif251168TIFF2025524455000068.tif250168TIFF2025524455000069.tif250168TIFF2025524455000070.tif250168TIFF2025524455000071.tif250168TIFF2025524455000072.tif250168TIFF2025524455000073.tif250167TIFF2025524455000074.tif250167TIFF2025524455000075.tif250167TIFF2025524455000076.tif250167TIFF2025524455000077.tif250167TIFF2025524455000078.tif250167TIFF2025524455000079.tif249166TIFF2025524455000080.tif250168TIFF2025524455000081.tif250168TIFF2025524455000082.tif250168TIFF2025524455000083.tif250168TIFF2025524455000084.tif248168TIFF2025524455000085.tif248168TIFF2025524455000086.tif248168TIFF2025524455000087.tif248168TIFF2025524455000088.tif248168TIFF2025524455000089.tif248168TIFF2025524455000090.tif248168TIFF2025524455000091.tif248168TIFF2025524455000092.tif244168TIFF2025524455000093.tif248168TIFF2025524455000094.tif248168TIFF2025524455000095.tif249167TIFF2025524455000096.tif248166TIFF2025524455000097.tif247167TIFF2025524455000098.tif247167TIFF2025524455000099.tif130167.

Claims

1. A system for suppressing the transcription of the human TRAC gene in human cells, optionally human T lymphocytes or human NK cells, comprising: a) a DNA methyltransferase (DNMT) domain and / or a domain that recruits DNMT, optionally wherein the DNMT domain and / or the recruiter domain comprises a DNMT3A domain and / or a DNMT3L domain, and optionally wherein the recruited DNMT is DNMT3A, and a transcriptional repressor domain collectively, and one or more fusion proteins, wherein each domain is linked to a DNA binding domain that binds to a target region in the human TRAC gene, or b) one or more nucleic acid molecules encoding the one or more fusion proteins A system comprising.

2. The system is a) a single fusion protein comprising a DNMT3A domain, a DNMT3L domain, a transcriptional repressor domain, and a DNA binding domain, or b) a nucleic acid molecule encoding the single fusion protein The system according to claim 1, comprising.

3. The system according to claim 1 or 2, wherein the DNA binding domain comprises a dead CRISPR Cas (dCas) domain, a ZFP domain, or a TALE domain.

4. The DNA binding domain comprises a dCas9 domain, and the system further comprises (i) one or more guide RNAs comprising any one of SEQ ID NOs: 990 to 1218, or (ii) a nucleic acid molecule encoding the one or more guide RNAs. The system according to claim 3.

5. The system according to claim 3 or 4, wherein the dCas domain comprises a dCas9 sequence, optionally a sequence having at least 90% identity to SEQ ID NO: 12 or 13.

6. The system according to any one of claims 1 to 5, wherein the DNA binding domain binds to a target sequence in SEQ ID NO: 1219 or 1220.

7. The system according to claim 3, wherein the ZFP domain targets a nucleotide sequence selected from SEQ ID NOs: 700 to 760.

8. The system according to any one of claims 1 to 7, wherein the DNMT3A domain comprises a sequence having at least 90% identity to SEQ ID NO: 574 or 575.

9. The system according to any one of claims 1 to 8, wherein the DNMT3L domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 578 to 581.

10. The system according to any one of claims 1 to 8, wherein the DNMT3L domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 582 to 603.

11. The system according to any one of claims 1 to 7, wherein the DNMT domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 601 to 603.

12. The system according to any one of claims 1 to 11, wherein the transcriptional repressor domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 33 to 570.

13. The system according to any one of claims 1 to 11, wherein the transcriptional repressor domain comprises a KRAB domain derived from KOX1, ZIM3, ZFP28, or ZN627.

14. The system according to claim 13, wherein the KRAB domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 89, 116, 245, and 255.

15. The system according to any one of claims 1 to 11, wherein the transcriptional repressor domain comprises a fusion of the N-terminal and C-terminal regions of ZIM3 and KOX1 KRAB, optionally comprising the amino acid sequence of SEQ ID NO: 571 or 572.

16. The system according to any one of claims 1 to 11, wherein the transcriptional repressor domain is derived from KAP1, MECP2, HP1a / CBX5, HP1b, CBX8, CDYL2, TOX, TOX3, TOX4, EED, EZH2, RBBP4, RCOR1, or SCML2.

17. The system is a) a fusion protein comprising a DNMT3A domain, a DNMT3L domain, a transcriptional repressor domain, and a DNA binding domain, optionally, one or both of the DNMT3A domain and the DNMT3L domain are of human origin, optionally, the DNA binding domain is a dead CRISPR Cas domain or a ZFP domain, or b) a nucleic acid molecule encoding the fusion protein and comprises the system according to any one of claims 1 to 16.

18. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA binding domain, a third peptide linker, and a transcriptional repressor domain.

19. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a first nuclear localization signal (NLS), a DNA binding domain, a second NLS, a third peptide linker, and a transcriptional repressor domain.

20. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a first nuclear localization signal (NLS), a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA binding domain, a third peptide linker, a transcriptional repressor domain, and a second NLS.

21. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, first and second nuclear localization signals (NLSs), a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA binding domain, a third peptide linker, a transcriptional repressor domain, and third and fourth NLSs.

22. The system according to any one of claims 17 to 21, wherein the transcriptional repressor domain is a KRAB domain, and optionally, a human KOX1, ZFP28, ZN627, or ZIM3 KRAB domain.

23. The system according to any one of claims 18 to 22, wherein one or both of the second and third peptide linkers are XTEN linkers, optionally XTEN linkers selected from XTEN80 and XTEN16, and further optionally, the second peptide linker is XTEN80 and the third peptide linker is XTEN16.

24. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a first NLS, a dSpCas9 domain, a second NLS, an XTEN16 peptide linker, and a human KOX1 KRAB domain.

25. The system according to claim 24, wherein the fusion protein comprises a sequence that is at least 90% identical to SEQ ID NO:

658.

26. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a first NLS, a ZFP domain, a second NLS, an XTEN16 linker, and a human KOX1 KRAB domain.

27. The system according to claim 26, wherein the fusion protein comprises a sequence that is at least 90% identical to SEQ ID NO:

659.

28. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human KOX1 KRAB domain, and a third and a fourth NLS.

29. The system according to claim 28, wherein the fusion protein comprises a sequence that is at least 90% identical to SEQ ID NO:

660.

30. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human KOX1 KRAB domain, and a third and a fourth NLS.

31. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZFP28 KRAB domain, and a third and a fourth NLS.

32. The system according to claim 31, wherein the fusion protein comprises a sequence that is at least 90% identical to SEQ ID NO:

661.

33. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZFP28 KRAB domain, and a third and a fourth NLS.

34. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZN627 KRAB domain, and a third and a fourth NLS.

35. The system according to claim 34, wherein the fusion protein comprises a sequence having at least 90% identity to SEQ ID NO:

662.

36. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZN627 KRAB domain, and a third and a fourth NLS.

37. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZIM3 KRAB domain, and a third and a fourth NLS.

38. The system according to claim 37, wherein the fusion protein comprises a sequence having at least 90% identity to SEQ ID NO:

663.

39. The system according to claim 17, wherein the fusion protein comprises, from the N-terminus to the C-terminus, a first and a second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZIM3 KRAB domain, and a third and a fourth NLS.

40. The system according to any one of claims 19 to 39, wherein at least one of the NLSs is an SV40 NLS.

41. The system comprises a) a first fusion protein comprising a first DNA binding domain and comprising or recruiting a DNMT3A domain, a second fusion protein comprising a second DNA binding domain and comprising or recruiting a DNMT3L domain, and a third fusion protein comprising a third DNA binding domain and comprising or recruiting a transcriptional repressor domain, or b) one or more nucleic acid molecules encoding said plurality of fusion proteins The system according to any one of claims 1 and 3 to 16.

42. A human cell or a descendant of a cell comprising the system according to any one of claims 1 to 41, wherein optionally the cell is a T lymphocyte or an NK cell.

43. A human cell or a descendant of a cell modified by the system according to any one of claims 1 to 41, wherein optionally the cell is a T lymphocyte or an NK cell and optionally the cell is modified ex vivo.

44. A pharmaceutical composition comprising the system according to any one of claims 1 to 41 and a pharmaceutically acceptable excipient, wherein optionally the composition comprises lipid nanoparticles (LNP) comprising the system, and / or the DNA binding domain is a dCas domain and the LNP further comprises one or more gRNAs, A pharmaceutical composition.

45. A pharmaceutical composition comprising the human cell according to claim 42 or 43 and a pharmaceutically acceptable excipient.

46. A method of treating a patient in need of treatment, the method comprising administering to the patient the system according to any one of claims 1 to 41, the human cell according to claim 42 or 43, or the pharmaceutical composition according to claim 44 or 45.

47. The method according to claim 46, wherein the patient has cancer or an autoimmune disease.

48. The system according to any one of claims 1 to 41, the human cell according to claim 42 or 43, or the pharmaceutical composition according to claim 44 or 45 for use in treating a patient in need of treatment, optionally in the method according to claim 46 or 47.

49. For treating a patient in need of treatment, the use of the system according to any one of claims 1 to 41, or the use of human cells according to claim 42 or 43, in the manufacture of a medicament for treating, optionally in the method of claim 46 or 47.