Oligonucleotides for ADAR-mediated RNA editing and uses thereof
Antisense oligonucleotides with modified purine nucleobases form a complex with target RNA to recruit endogenous ADAR enzymes, addressing the challenge of specific RNA editing efficiency and promoting functional protein production.
Patent Information
- Application Number
- JP2025500088
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-01-25
- Filing Date
- 2023-07-14
- Publication Date
- 2025-07-30
AI Technical Summary
Existing RNA editing technologies face challenges in achieving specific and efficient editing of adenosines within target RNA molecules without requiring recombinant ADAR enzymes or genetic modification, often resulting in promiscuous editing and lack of specificity.
The use of antisense oligonucleotides (AONs) that form a double-stranded nucleic acid complex with target RNA, recruiting endogenous ADAR enzymes by incorporating nucleotide analogs capable of inducing a syn conformation with guanosine, particularly using modified purine nucleobases like 3-deazapurines, to enhance specificity and efficiency of adenosine deamination.
This approach enables targeted and efficient deamination of adenosines in specific contexts, such as UGA stop codons, improving the production of functional proteins by overcoming previous limitations of promiscuous editing and enhancing editing efficiency.
Smart Images

Figure 2025524566000014 
Figure 2025524566000015 
Figure 2025524566000016
Abstract
Description
Technical Field
[0001] The present invention relates to the field of medicine, and more specifically, to the field of RNA editing, in which RNA molecules within cells are targeted by antisense oligonucleotides (AONs) to alter the chemical properties of specific nucleotides within the target RNA molecule. The present invention relates to RNA editing AONs (also referred to as "EONs") that contain at least one nucleotide analog and improve their in vivo and in vitro RNA editing effects.
Background Art
[0002] RNA editing is a natural process by which eukaryotic cells change the sequence of their RNA molecules, often in a site-specific and precise manner, thereby increasing the repertoire of RNA encoded by the genome by several orders of magnitude. RNA editing enzymes have been reported for eukaryotic species throughout the animal and plant kingdoms, and these processes play important roles in managing cellular homeostasis in metazoans from the simplest living organisms (e.g., Caenorhabditis elegans) to humans. Examples of RNA editing include the conversion of adenosine (A) to inosine (I) and the conversion of cytidine (C) to uridine (U), which occur through enzymes called adenosine deaminases acting on RNA (ADAR) and APOBEC / AID (cytidine deaminases acting on RNA), respectively.
[0003] ADAR is a multi-domain protein that contains two to three double-stranded RNA recognition domains depending on the catalytic domain and the enzyme in question. Each recognition domain recognizes a specific double-stranded RNA (dsRNA) sequence and / or conformation. The catalytic domain also plays a role in recognizing and binding to a portion of the dsRNA helix, but the main function of the catalytic domain is to convert A to I by deaminating the nucleobase at a position near the target RNA (to some extent pre-specified), where inosine is read as guanosine by the cell's translation machinery, which means that the edited adenosine can recode the protein sequence if it is present in the coding region of the mRNA or pre-mRNA. The conversion from A to I can also occur in the 5′ non-coding sequence of the target mRNA, generating a new translation start site upstream of the original start site, which results in a protein with an extended N-terminus, or it can occur in the 3′ UTR or other non-coding parts of the transcript, which can affect RNA processing and / or stability. In addition, the conversion from A to I can occur in splice elements within the introns or exons of pre-mRNA, thereby changing the splicing pattern. As a result, exons can either be incorporated or skipped. Enzymes that catalyze adenosine deamination belong to the ADAR enzyme family, which includes the human deaminases hADAR1 and hADAR2, and hADAR3. However, hADAR3 has not shown deaminase activity to date.
[0004] The use of oligonucleotides for editing target RNA by applying adenosine deaminase is described below (e.g., Woolf et al. 1995. PNAS 92:8298-8302; Montiel-Gonzalez et al. PNAS 2013, 110(45):18285-18290; Vogel et al. 2014. Angewandte Chemie Int Ed 53:267-271). The drawback of the method described by Montiel-Gonzalez et al. (2013) is that it requires a fusion protein consisting of a genetic fusion between the boxB recognition domain of the bacteriophage λN protein and the adenosine deaminase domain of a truncated native ADAR protein. In this method, target cells need to be introduced with the fusion protein (which is a major obstacle), or the target cells need to be transfected with a nucleic acid construct encoding to express the modified adenosine deaminase fusion protein. The system described by Vogel et al. (2014) also suffers from a similar drawback, where the method of applying this system is not clear without first genetically modifying ADAR and then transfecting or transforming cells that hold the target RNA to supply this genetically modified protein to the cells. US9,650,627 also describes a similar system. The oligonucleotides of Woolf et al. (1995) were 100% complementary to the target RNA sequence but suffered from a severe lack of specificity: that is, almost all adenosines within the target RNA strand complementary to the antisense oligonucleotide were edited.
[0005] In the art, it is known that ADAR can act on any dsRNA. Through a process sometimes called "promiscuous editing", this enzyme edits multiple As within the dsRNA. Therefore, there is a need for methods and means to bypass such promiscuous editing and enable therapeutic application by targeting only specific adenosines within the target RNA molecule. Vogel et al. (2014) showed that such off-target editing can be suppressed by using 2'-O-Me modified nucleosides for nucleotides opposite adenosines that should not be edited and unmodified nucleosides for positions directly opposite specifically targeted adenosines on the target RNA. However, it has not been shown that specific editing effects at the target nucleotide occur without using a recombinant ADAR enzyme that has a covalent bond with the AON. Multiple documents have shown that recruitment of endogenous ADAR (thus not requiring an exogenous and / or recombinant source) is achievable while maintaining specificity when targeting a single adenosine within the target RNA molecule and deaminating it to inosine. WO2016 / 097212 discloses antisense oligonucleotides (AONs) for targeted editing of RNA, said AONs being characterized by a sequence complementary to the target RNA sequence (referred to in the same document as the "targeting portion") and the presence of a stem-loop structure (referred to in the same document as the "recruitment portion") (which is preferably non-complementary to the target RNA). Such oligonucleotides are referred to as "self-looping AONs". The recruitment portion serves to recruit the natural ADAR enzyme present in the cell to the dsRNA formed by hybridization of the targeting portion of the target sequence. The presence of the recruitment portion obviates the need for the presence of a conjugate or modified recombinant ADAR enzyme.WO2016 / 097212 describes the recruitment moiety as a stem-loop structure that mimics a natural substrate (e.g., GluB receptor) or a Z-DNA structure (known to be recognized by the dsRNA-binding domain or Z-DNA-binding domain of the ADAR enzyme). The stem-loop structure can be an intermolecular stem-loop structure formed by two separate nucleic acid strands or an intramolecular stem-loop structure formed within a single nucleic acid strand. The stem-loop structure of the aforementioned recruitment moiety is an intramolecular stem-loop structure formed within the AON itself and can attract (endogenous) ADAR. Systems containing similar stem-loop structures are described in WO2017 / 050306, WO2020 / 001793, WO2017 / 010556, WO2020 / 246560, and WO2022 / 078995.
[0006] WO2017 / 220751 and WO2018 / 041973 describe a next-generation AON that does not contain such stem-loop structures but is (almost completely) complementary to the target region, except for one or more mismatched nucleotides, i.e., "wobbles" or "bulges". The mismatch may be present only at the site of the nucleoside opposite the target adenosine, but in other embodiments, AONs with multiple bulges and / or wobbles are also described when added to the target sequence region. It was thought possible to achieve RNA editing in vitro, ex vivo, and in vivo using AONs lacking a stem-loop structure and the endogenous ADAR enzyme when the AON sequence was carefully selected to attract ADAR. An "orphan nucleoside" is defined as the nucleoside within the AON at the position directly opposite the target adenosine within the target RNA molecule and did not have a 2'-O-Me modification. The orphan nucleoside may also be a deoxyribonucleoside (DNA, lacking a 2' modification on the sugar moiety), and whether the remaining portion of the AON had a 2'-O-alkyl modification (e.g., 2'-O-Me) on the sugar moiety or the nucleotides directly surrounding the orphan nucleoside contained a specific chemical modification (e.g., DNA compared to RNA), resulting in further improvement of RNA editing efficiency and / or improvement of resistance to nucleases. Such effects can be further improved by the use of sense oligonucleotides (SONs) that "protect" the AON from degradation (described in WO2018 / 134301).The use of chemical modifications and specific structures in oligonucleotides that can be used for ADAR-mediated editing of specific adenosines within a target RNA has been the subject of numerous publications in the art, for example, as follows: WO2019 / 111957, WO2019 / 158475, WO2020 / 165077, WO2020 / 201406, WO2020 / 211780, WO2021 / 008447, WO2021 / 020550, WO2021 / 060527, WO2021 / 117729, WO2021 / 136408, WO2021 / 182474, WO2021 / 216853, WO2021 / 242778, WO2021 / 242870, WO2021 / 242889, WO2022 / 007803, WO2022 / 018207, WO2022 / 026928, and WO2022 / 124345. The use of specific sugar moieties is disclosed, for example, in WO2020 / 154342, WO2020 / 154343, WO2020 / 154344, WO2022 / 103839, and WO2022 / 103852.On the one hand, the use of a three-dimensionally defined linker moiety (generally, for example, for exon skipping, gapmers, oligonucleotides that can be used for siRNA, or specifically, for RNA editing oligonucleotides related to a wide variety of target sequences) is disclosed in the following: WO2011 / 005761, WO2014 / 010250, WO2014 / 012081, WO2015 / 107425, WO2017 / 015575 (HTT), WO2017 / 062862, WO2017 / 160741, WO2017 / 192664, WO2017 / 192679 (DMD), WO2017 / 198775, WO2017 / 210647, WO2018 / 067973, WO2018 / 098264, WO2018 / 223056 (PNPLA3), WO2018 / 223073 (APOC3), WO2018 / 223081 (PNPLA3), WO2018 / 237194, WO2019 / 032607 (C9orf72), WO2019 / 055951, WO2019 / 075357 (SMA / ALS), WO2019 / 200185 (DM1), WO2019 / 217784 (DM1), WO2019 / 219581, WO2020 / 118246 (DM1), WO2020 / 160336 (HTT), WO2020 / 191252, WO2020 / 196662, WO2020 / 219981 (USH2A), WO2020 / 219983 (RHO), WO2020 / 227691 (C9orf72), WO2021 / 071788 (C9orf72), WO2021 / 071858, WO2021 / 178237 (MAPT), WO2021 / 234459, WO2021 / 237223, and WO2022 / 099159.
[0007] In addition to these disclosures, there are a very large number of publications related to targeting specific RNA target molecules, or specific adenosines within such RNA target molecules, resulting in mutations that become premature stop codons, or repairing any kind of mutation that causes disease. Examples of such disclosures that target adenosines within specific RNA target molecules include the following: WO2020 / 157008 and WO2021 / 136404 (USH2A); WO2021 / 113270 (APP); WO2021 / 113390 (CMT1A); WO2021 / 209010 (IDUA, Hurler syndrome); WO2021 / 231673 and WO2021 / 242903 (LRRK2); WO2021 / 231675 (ASS1); WO2021 / 231679 (GJB2); WO2019 / 071274 and WO2021 / 231680 (MECP2); WO2021 / 231685 and WO2021 / 231692 (OTOF, autosomal recessive nonsyndromic deafness); WO2021 / 231691 (XLRS); WO2021 / 231698 (argininosuccinate lyase deficiency); WO2021 / 130313 and WO2021 / 231830 (ABCA4); and WO2021 / 243023 (SERPINA1).
[0008] Despite the numerous and extensive results as described above, there remains a need for improved compounds that can utilize (endogenous) cellular pathways and enzymes with deaminating activity (such as the naturally expressed ADAR enzyme) to specifically and more efficiently edit endogenous nucleic acids and alleviate disease in mammalian cells and even in whole organisms.
Summary of the Invention
[0009] [[ID=A]] The present invention relates to an antisense oligonucleotide (AON) capable of forming a double-stranded nucleic acid complex with a target RNA molecule, wherein the double-stranded nucleic acid complex is capable of recruiting an adenosine deaminase to deaminate a target adenosine within the target RNA molecule, The nucleotide directly 5′ of the target adenosine within the target RNA molecule is guanosine, and the nucleotide within the AON opposite the guanosine is a nucleotide analog capable of inducing the syn conformation of the guanosine. This relates to an antisense oligonucleotide. In a preferred embodiment, the nucleotide analog comprises a modified nucleobase, more preferably the nucleotide analog comprises a modified purine nucleobase, and even more preferably the modified purine nucleobase comprises a 3-deazapurine modification, which may include a 3-deazaadenine modification. In one embodiment, the modified purine nucleobase comprises a 7-deazaadenine modification. In one embodiment, the modified purine nucleobase comprises a hydrogen bond donor at N1 with a pKa higher than 3.7 and lower than 9.5.
[0010] In one embodiment, the present invention relates to an AON according to the present invention, and the nucleotide analog is selected from the group consisting of: 7-deaza-2′-deoxyadenosine (7-deazadA); 7-deaza-2′-adenosine (7-deazaA); 7-deaza-2′-deoxy-2′-fluoroadenosine (7-deazafA); 7-deaza-2′-deoxy-2′-ara-fluoroadenosine; 7-deaza-2′-deoxy-2′,2′-difluoroadenosine; 3-deaza-2′-deoxyadenosine (3-deazadA); 3-deaza-2′-adenosine (3-deazaA); 3-deaza-2′-deoxy-2′-fluoroadenosine (3-deazafA); 3-deaza-2′-deoxy-2′-ara-fluoroadenosine; 3-deaza-2′-deoxy-2′,2′-difluoroadenosine; 3,7-dideaza-2′-deoxyadenosine (3,7-dideazadA); 3,7-Dideaza-2'-adenosine (3,7-dideaza A); 3,7-Dideaza-2'-deoxy-2'-fluoroadenosine (3,7-dideaza fA); 3,7-Dideaza-2'-deoxy-2'-ara-fluoroadenosine; 3,7-Dideaza-2'-deoxy-2',2'-difluoroadenosine; 3-Deaza-2'-O-[2-(methoxy)ethyl]adenosine; 3-Deaza-2'-O-[2-methylamino-2-oxoethyl]adenosine; 2'-Deoxy-2'-fluoroguanosine; 2'-ara-Fluoroguanosine (FANA G); 2',2'-Difluoroguanosine; 2'-Deoxyinosine (dI); 2'-OH-Inosine (rI); 2'-Fluoroinosine (2'-F-I); 2'-ara-Fluoroinosine (FANA I); 2',2'-Difluoroinosine; 5-Formylindole-2'-deoxyriboside; 5-Formyl-2'-fluoro-2'-deoxyriboside; 5-Formylindole-2'-ara-fluoro-2'-deoxyriboside; 5-Formylindole-2',2'-difluoro-2'-deoxyriboside; 5-Formylindole-2'-O-methylriboside; 5-Formylindole-2'-O-[2-(methoxy)ethyl]riboside; 5-Formylindole-2'-O-[2-methylamino-2-oxoethyl]riboside; β-(4-Amidin-1H-imidazol-1-yl)riboside; β-(4-Amidin-1H-imidazol-1-yl)2'-deoxyriboside; β-(4-Amidin-1H-imidazol-1-yl)2'-ara-fluoro-2'-deoxyriboside; and β-(4-amidino-1H-imidazol-1-yl)2′,2′-difluoro-2′-deoxyriboside.
[0011] In a preferred embodiment, the adenosine deaminase is an endogenous ADAR enzyme, preferably ADAR1 or ADAR2.
[0012] The present invention further relates to a pharmaceutical composition comprising an AON according to the present invention, and a pharmaceutically acceptable carrier or diluent. The present invention also relates to an AON or a pharmaceutical composition according to the present invention for use in the treatment, amelioration, or delay of progression of a genetic disease caused by an immature UGA stop codon.
[0013] The present invention also relates to a method for deaminating at least one target adenosine present in a target RNA molecule in a cell, wherein the nucleotide 5′ to the target adenosine in the RNA molecule is guanosine, and the method comprises the following steps: (i) providing to the cell an AON according to the present invention, or a pharmaceutical composition according to the present invention; (ii) annealing the AON to the target RNA molecule to form a double-stranded nucleic acid complex capable of mobilizing an adenosine deaminase, preferably an endogenous adenosine deaminase, in the cell; (iii) enabling the adenosine deaminase to deaminate the target adenosine in the target RNA molecule; and (iv) identifying the presence of deaminated adenosine in the target RNA molecule may be included, relates to a method. In a more preferred embodiment, step (iv) comprises: (a) sequencing a region of the target RNA molecule; Said region contains deaminated target adenosine; (b) When said target adenosine is within a UGA stop codon, evaluating the presence of a functional, extended, full-length, and / or wild-type protein; Or (c) Using a functional readout; The deaminated target RNA molecule encodes a functional, full-length, extended, and / or wild-type protein.
[0014] The present invention also relates to a method for deaminating at least one target adenosine present within a target RNA molecule, Said method comprising the following steps: (i) Providing an AON according to the present invention, or a pharmaceutical composition according to the present invention; (ii) Annealing said AON to said target RNA molecule to form a double-stranded nucleic acid complex with said target RNA molecule; (iii) Enabling a mammalian adenosine deaminase to deaminate said target adenosine within said target RNA molecule; Including, and (iv) Identifying the presence of deaminated adenosine within said target RNA molecule May include, Related to a method. Preferably, said adenosine deaminase is an endogenous ADAR enzyme, preferably ADAR1 or ADAR2.
[0015] [Brief Description of the Drawings] One or more embodiments of the present invention will now be described, by way of example only, with reference to the following accompanying drawings:
Brief Description of the Drawings
[0016]
FIG. 1A-1F
FIG. 2A-2C
FIG. 3A-3B
FIG. 4A-4C
FIG. 5A-5B
FIG. 6
FIG. 7
Mode for Carrying Out the Invention
[0017] [Figure 6] FANA A is 2′-fluoro-arabinoadenosine, FANA G is 2′-fluoro-arabinoguanosine, 7-deaza-dA is 7-deaza-2′-deoxyadenosine, 2′F A is 2′-fluoroadenosine, 2′F G is 2′-fluoroguanosine, 2′F I is 2′-fluoroinosine, dI is 2′-deoxyinosine, rI is 2′-OH inosine, 8-azaI is 8-aza-2′-OH inosine, and yC is a monomer according to formula (I): There is a continuing need to improve the pharmacokinetic properties of RNA editing antisense oligonucleotides (AONs, sometimes also referred to as "editing oligonucleotides" or "EONs") without adversely affecting the editing efficiency of target adenosines within the target RNA. There are many chemical modifications that exist and can be applied in the production of AONs, but their properties do not always conform to the desire to achieve efficient RNA editing.
[0018] By mutagenesis studies of human ADAR2, it was revealed that a single mutation from glutamate to glutamine at residue 488 (E488Q) results in a 60-fold improvement in the deamination rate constant compared to the wild-type enzyme (Kuttan and Bass. Proc Natl Acad Sci USA 2012. 109(48):3295-3304). During the deamination reaction, ADAR flips the base to be edited out of its RNA duplex and positions it in the enzyme's active site (Matthews et al. 2016). When ADAR2 edits adenosine in a preferred context (A:C mismatch), the nucleotide opposite the target adenosine is often referred to as the "isolated cytidine". The crystal structure of ADAR2 E488Q bound to double-stranded RNA (dsRNA) revealed that the glutamine (Gln) side chain at position 488 is able to donate a hydrogen bond to the N3 position of the isolated cytidine, which leads to the improvement of the catalytic rate of ADAR2 E488Q. In the wild-type enzyme, glutamate (Glu) is present at position 488 instead of glutamine (Gln), and there is no amide group of glutamine. Instead, it is a carboxylic acid. Therefore, in order to obtain the same contact with the isolated cytidine as that with the E488Q mutant in the wild-type situation, protonation for this contact to occur is required. When using endogenously expressed ADAR2 to correct disease-related mutations, it is important to maximize the editing efficiency of the wild-type ADAR2 enzyme present in the cell. WO2020 / 252376 discloses the use of AONs, particularly modified RNA bases at the position of the isolated cytidine, to mimic the hydrogen-bonding pattern observed with the E488Q ADAR2 mutant. By replacing the nucleotide opposite the target adenosine in the AON with a cytidine analog that functions as a hydrogen-bond donor at N3, it was considered possible to stabilize the same contact that is thought to improve the catalytic rate with the mutant enzyme.Two cytidine analogs have received particular attention: pseudoisocytidine (also referred to as "piC"; Lu et al. J Org Chem 2009. 74(21):8021-8030; Burchenal et al. (1976) Cancer Res 36:1520-1523), and Benner's base Z (also referred to as "dZ"; Yang et al. Nucl Acid Res 2006. 34(21):6095-6101), which were initially selected because they donate a hydrogen bond at N3 with minimal perturbation to the shape of the nucleobase. The presence of cytidine analogs within the AON can occur in addition to modification of the ribose 2′ group. The ribose 2′ group within the AON can be independently selected from: 2′-H (i.e., DNA), 2′-OH (i.e., RNA), 2′-O-Me, 2′-MOE, 2′-F, or a 2′-4′ linkage (i.e., a bridged nucleotide such as a locked nucleic acid (LNA)), or other 2′ substituents. The 2′-4′ linkage can be selected from linkers known in the art, such as a methylene linker or a constrained ethyl linker.
[0019] ADAR is a multi-domain protein with an N-terminal double-stranded RNA-binding domain (dsRBD) and a C-terminal deaminase domain. Two ADAR genes encode ADARs with catalytic activity in humans (ADAR encodes the ADAR1 protein and ADARB1 encodes the ADAR2 protein). ADAR1 is expressed as two protein isoforms (p110 and p150) with different N-terminal structures. Since the substrate of ADAR is double-stranded RNA, the enzyme uses a base-flipping mechanism to access the reactive adenosine (Stephens O.M. et al. Biochemistry. 2000. 39(40): 12243-12251). Also, since ADAR requires double-stranded RNA for activity, these reactions can be directed to specific adenosines within different transcripts using a complementary guide strand for duplex formation at the target site. This approach is currently being pursued in the development of therapeutic guide strands that recruit ADAR to correct mutations in disease-causing RNAs (Qu L. et al. Nat. Biotechnol. 2019. 37(9):1059-1069; Merkle T. et al. Nat. Biotechnol. 2019. 37(2):133-138; Katrekar D. et al. Nat. Methods 2019. 16(3):239-242; Monian P. et al. Nat. Biotechnol. 2022: p. Doi: 10.1038 / s41587-022-01225-1). Although this approach is promising, ADAR has sequence preferences that disfavor specific adenosines for the reaction, limiting the current scope of this approach. For example, the nearest-neighbor nucleotide preference of ADAR shows a strong bias for reactions at adenosines in the 5′-GA site (Eggington J.M. et al. Nat. Commun. 2011. 2(319):DOI:10.1038 / ncomms1324).This preference is explained by structural studies of ADAR2 bound to transition state analog-containing RNAs, suggesting a clash between the 2-amino group of 5′-G and G489 of the ADAR2 loop involved in stabilizing the flip-out conformation required for the adenosine deamination reaction (Matthews et al. 2016). In previous studies using fusion proteins with the ADAR deaminase domain, it was shown that editing efficiency at the 5′-GA site can be improved when G-A or G-G pairs are present in the 5′-nearest neighborhood (Schneider M.F. et al. Nucleic Acids Res. 2014. 42(10):p.e87). However, the basis for this effect has not been reported, and this effect has not been established for full-length ADAR with the native dsRBD RNA-binding domain. Here, it was shown that the presence of G-A and G-G pairs on the 5′ side of the editing site results in improved editing efficiency in full-length ADAR2 and ADAR1 p110 compared to the 5′G-C pair. Using X-ray crystallographic analysis, the structure of an active fragment of human ADAR2 bound to double-stranded RNA with a G:G pair adjacent to the editing site was determined. Here, the inventors show that two guanosines can form (instead of, or together with) a hydrogen-bonded G:G pair, and that the beneficial effect of this pairing is justified by comparison with similar structures with U-A and C-G pairs adjacent to the ADAR editing site (see FIGS. 3A-3B). In addition, the inventors report on the effect of multiple purine analogs pairing with 5′-G on the deamination rate of ADAR at target sites of MECP2 transcripts in which the R255X mutation causes Rett syndrome (see FIGS. 4A-4C). At present, it is unclear whether G:G pairs form only G:G pairs, or whether both types of pairing can occur when guanosine faces guanosine. In any case, the ADAR enzyme is G:G syn :G anti pair (G anti :G anti pair formation, or in addition to it), and that the beneficial effect of this pairing is justified by comparison with similar structures with U-A and C-G pairs adjacent to the ADAR editing site (see FIGS. 3A-3B). In addition, the inventors report on the effect of multiple purine analogs pairing with 5′-G on the deamination rate of ADAR at target sites of MECP2 transcripts in which the R255X mutation causes Rett syndrome (see FIGS. 4A-4C). At present, it is unclear whether G:G pairs form only G syn :G anti pairs, or whether both types of pairing can occur when guanosine faces guanosine. In any case, the ADAR enzyme is G syn :G antiWe found that 5'-G in the syn conformation favors pairing because the 2-amino group of the 5'-G does not clash with the minor groove of the enzyme. Taken together, these results demonstrate that the use of nucleosides capable of stable pairing with 5'-G in the syn conformation allows for more efficient editing within 5'-GA target sites, thereby resolving the problem of deaminating these unfavorable editing sites. This offers the possibility of (therapeutic) editing of adenosine targets in the 5'-GA environment, which was previously an unfavorable setting.
[0020] In one embodiment, the AON is a (single-stranded) AON that targets pre-mRNA or mRNA, where the target nucleotide in the target (pre-)mRNA molecule is adenosine, and the AON, when hybridized to the target RNA molecule, is capable of recruiting adenosine deaminase (as a double-stranded complex), which then deaminates the adenosine to inosine, which is read as guanosine by the translational machinery.
[0021] In one embodiment, the target adenosine is present within a UGA (stop) codon, which is subsequently edited into a UGI codon and read as UGG (Trp) by the translational machinery, allowing readthrough to a full-length protein or allowing readthrough beyond the wild-type stop codon represented by the original UGA codon.
[0022] In one embodiment, the target adenosine is present within a GAU (Asp) codon, which is subsequently edited to a GIU codon, which is then read as GGU (Gly).
[0023] In one embodiment, the target adenosine occurs within a GAC (Asp) codon, which is subsequently edited to a GIC codon, which is then read as GGC (Gly).
[0024] In certain embodiments, the target adenosine is the first adenosine within the GAA (Glu) codon, which is then edited to a GIA codon and subsequently read as GGA (Gly).
[0025] In certain embodiments, the target adenosine is present within the GAG (Glu) codon, which is then edited to a GIG codon and subsequently read as GGG (Gly).
[0026] Editing the adenosine within the CGA codon to CGI, which is then read as CGG, is not particularly useful with respect to the function of the resulting protein, because both the wild-type codon and the edited codon encode arginine. The same is true for the second adenosine within the AGA codon, because both AGA and AGG encode arginine. Similarly, editing the adenosine within the GGA codon results in GGG, but this is also not particularly useful because both of these codons encode glycine.
[0027] It should be noted that when guanosine is present before the first adenosine within a codon and that guanosine is the third nucleotide of the previous codon, editing of this first adenosine can be of interest.
[0028] In certain embodiments, the target adenosine is the first nucleotide of the codon, guanosine precedes the codon on the 5′ side of the codon in which the adenosine is located, the target adenosine is present within the AUU (Ile) codon, which is then edited to an IUU codon and subsequently read as GUU (Val).
[0029] In certain embodiments, the target adenosine is the first nucleotide of the codon, guanosine precedes the codon on the 5′ side of the codon in which the adenosine is located, the target adenosine is present within the AUC (Ile) codon, which is then edited to an IUC codon and subsequently read as GUC (Val).
[0030] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is the first adenosine within an AUA (Ile) codon, which is edited to an IUA codon and then read as GUA (Val).
[0031] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is within an AUG (Met) codon, which is edited to an IUG codon and then read as GUG (Val).
[0032] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is within an ACU (Thr) codon, which is edited to an ICU codon and then read as GCU (Ala).
[0033] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is within an ACC (Thr) codon, which is edited to an ICC codon and then read as GCC (Ala).
[0034] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is the first adenosine within an ACA (Thr) codon, which is edited to an ICA codon and then read as GCA (Ala).
[0035] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is within an ACG (Thr) codon, which is then edited to an ICG codon and then read as GCG (Ala).
[0036] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is the first adenosine within an AAU (Asn) codon, which is then edited to an IAU codon and then read as GAU (Asp).
[0037] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is the first adenosine within an AAC (Asn) codon, which is then edited to an IAC codon and then read as GAC (Asp).
[0038] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is the first adenosine within an AAA (Lys) codon, which is then edited to an IAA codon and then read as GAA (Glu).
[0039] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is the first adenosine within an AAG (Lys) codon, which is then edited to an IAU codon and then read as GAG (Glu).
[0040] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is within an AGU (Ser) codon, which is edited to an IGU codon and then read as GGU (Gly).
[0041] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is within an AGC (Ser) codon, which is edited to an IGC codon and then read as GGC (Gly).
[0042] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is the first adenosine within an AGA (Arg) codon, which is edited to an IGA codon and then read as GGA (Gly).
[0043] In certain embodiments, the target adenosine is the first nucleotide of a codon, guanosine precedes the codon 5′ to the codon in which the adenosine is located, the target adenosine is within an AGG (Arg) codon, which is edited to an IGG codon and then read as GGG (Gly).
[0044] In summary, all of the following editing events (X = A / G / C / U) are embodied by the present invention: 5′-…X-UGA-…-3′ (stop) to 5′-…X-UGG-…-3′ (Trp) 5′-…X-GAU-…-3′ (Asp) to 5′-…X-GGU-…-3′ (Gly) 5′-…X-GAC-…-3′ (Asp) to 5′-…X-GGC-…-3′ (Gly) 5′-…X-GAA-…-3′ (Glu) to 5′-…X-GGA-…-3′ (Gly) From 5′-…X-GAG-…-3′(Glu) to 5′-…X-GGG-…-3′(Gly) From 5′-…G-AUU-…-3′(Ile) to 5′-…G-GUU-…-3′(Val) From 5′-…G-AUC-…-3′(Ile) to 5′-…G-GUC-…-3′(Val) From 5′-…G-AUA-…-3′(Ile) to 5′-…G-GUA-…-3′(Val) From 5′-…G-AUG-…-3′(Met) to 5′-…G-GUG-…-3′(Val) From 5′-…G-ACU-…-3′(Thr) to 5′-…G-GCU-…-3′(Ala) From 5′-…G-ACC-…-3′(Thr) to 5′-…G-GCC-…-3′(Ala) From 5′-…G-ACA-…-3′(Thr) to 5′-…G-GCA-…-3′(Ala) From 5′-…G-ACG-…-3′(Thr) to 5′-…G-GCG-…-3′(Ala) From 5′-…G-AAU-…-3′(Asn) to 5′-…G-GAU-…-3′(Asp) From 5′-…G-AAC-…-3′(Asn) to 5′-…G-GAC-…-3′(Asp) From 5′-…G-AAA-…-3′(Lys) to 5′-…G-GAA-…-3′(Glu) From 5′-…G-AAG-…-3′(Lys) to 5′-…G-GAG-…-3′(Glu) From 5′-…G-AGU-…-3′(Ser) to 5′-…G-GGU-…-3′(Gly) From 5′-…G-AGC-…-3′(Ser) to 5′-…G-GGC-…-3′(Gly) From 5′-…G-AGA-…-3′(Arg) to 5′-…G-GGA-…-3′(Gly) From 5′-…G-AGG-…-3′(Arg) to 5′-…G-GGG-…-3′(Gly)
[0045] One skilled in the art understands that the above-listed arrays in the left column may be the result of mutations, but do not necessarily have to be point mutations of the adenosine that is the target of editing. The codon may be the result of another point mutation within the same codon, or the result of the insertion of nucleotides or even entire codons. What is important is that the editing events shown above also do not necessarily have to be for the purpose of repairing mutations, and may also be applied for the purpose of gain of function or loss of function. For example, changing Asp is useful for changing the signal sequence site (to prevent entry into the secretory pathway and / or cell membrane transport and / or secretion), or for changing the caspase cleavage site (to prevent cleavage by caspase). Changing Ser and Thr is useful for preventing phosphorylation of these residues; if these residues are so-called major regulators of phosphorylation, this can have a large (desirable) effect on the protein phosphorylation pattern of the protein in question. Changing Lys is useful for preventing SUMOylation and thereby preventing protein degradation.
[0046] Performing amino acid changes, including those described herein, is useful for modulating protein-protein interactions that can have a major impact on the protein localization, activation, or function of the protein in question or its interaction partner, and can potentially affect the entire pathway.
[0047] Much of such changes and their effects on protein-protein interactions or post-translational modifications are known from the literature and specialized databases, and one skilled in the art can readily know how to make these changes through RNA editing. The solution provided by the present invention, which relates to target A-to-I editing where the target adenosine has 5'-G as an adjacent base, opens the possibility of performing more mutation repair or mutation alleviation, and even novel changes that bring about beneficial effects, with an efficiency suitable for use in a therapeutic setting.
[0048] Some non-limiting examples of mutations that can be targeted by the AON of the present invention include those observed below: - Breast cancer (transcript of BRCA1): Trp>Stop (UGG>UGA; rs80356914); - Lung cancer (transcript of PPP2R1B): Gly>Asp (GGC>GAC; rs1805076); - α1-Antitrypsin deficiency (transcript of SERPINA1): Trp>Stop (UGG>UGA; rs1445192595); - Usher syndrome (transcript of USH2A): Trp>Stop (UGG>UGA; rs1461319754); - Rett syndrome (transcript of MECP2): R255X (CGA>UGA), R168X (CGA>UGA), and R270X (CGA>UGA); - Hemophilia A (transcript of F8): Gly>Glu (GGA>GAA; rs137852398); - Stargardt disease (transcript of ABCA4): G1961E (GGA>GAA); - Familial hypercholesterolemia type 1 (transcript of LDLR): Trp>Stop (UGG>UGA; rs199570811); - Epileptic encephalopathy 44 (transcript of UBA5): Ala>Thr (GCA> A CA; rs114925667; the target adenosine (underlined) is the first nucleotide in the codon and is preceded by 5′-G in the previous codon); - Cystic fibrosis (transcript of CFTR): G551D (GGU>GAU) and G85E (GGA>GAA); - Marfan syndrome (transcript of FBN1): Gly>Asp (GGC>GAC; rs7897068); - Gaucher disease (transcript of GBA): Gly>Glu (GGG>GAG; rs77829017); - Hereditary cancer predisposition syndrome (transcript of MUTYH): Gly>Asp (GGU>GAU; rs36053993) and - Parkinson's disease (transcript of PRKN): G430D (GGC>GAC).
[0049] The present invention relates to an AON capable of efficiently deaminating a target adenosine in a target RNA molecule through an adenosine deaminase, wherein the nucleotide immediately 5' to the target adenosine is guanosine (often referred to herein as the 5'-G nucleotide).
[0050] The present invention relates to an AON capable of forming a double-stranded nucleic acid complex with a target RNA molecule, wherein the double-stranded nucleic acid complex can recruit an adenosine deaminase to deaminate a target adenosine in the target RNA molecule, the nucleotide immediately 5' to the target adenosine in the target RNA molecule is guanosine, and the nucleotide in the AON opposite the guanosine is a nucleotide analog capable of inducing the syn conformation of the guanosine. In one embodiment, the RNA editing efficiency observed with the AON according to the present invention is higher than that of the same AON when the nucleotide opposite the 5'-G is guanosine (G) or deoxyguanosine (dG), when the nucleotide analog opposite the 5'-G causes the syn conformation of the 5'-G (see FIG. 4C herein). Those skilled in the art can readily determine, based on the teachings herein, whether a nucleotide analog opposite the 5'-G in the target sequence is suitable for effecting RNA editing upon hybridization to the target sequence and whether it exceeds the same AON having guanosine (G) or deoxyguanosine (dG) at that position. As shown herein, nucleotide analogs exemplified by 7-deaza dA, 3,7-deaza dA, and 3-deaza dA fully serve this purpose.
[0051] In certain embodiments, the nucleotide analog adopts an anti conformation when the AON is within a double-stranded nucleic acid complex with the target RNA molecule. In certain embodiments, the nucleotide analog can induce hydrogen bonding to the Hoogsteen face of the 5'-G.
[0052] In one embodiment, at least one nucleotide within the AON comprises an ara-ribose. In one embodiment, at least one nucleotide within the AON is a xeno nucleic acid (XNA), such as, for example, a bridged nucleic acid (e.g., locked nucleic acid (LNA), constrained ethyl (cEt), and amide-bridged nucleic acid (AmNA)), tricyclo DNA (tcDNA), α-anomeric bicyclic DNA (abcDNA), 2'-fluoro-arabinonucleic acid (FANA), glycol nucleic acid (GNA), threose nucleic acid (TNA), 1,5-anhydrohexitol nucleic acid (HNA), cyclohexene nucleic acid (CeNA), phosphorodiamidate morpholino (PMO), L-uncyclic threoninonucleic acid (L-aTNA), D-uncyclic threoninonucleic acid (D-aTNA), unlocked nucleic acid (UNA), serinol nucleic acid (SNA), and peptide nucleic acid (PNA); or derivatives thereof. In one embodiment, the AON comprises one or more combinations of these XNAs.
[0053] The AON according to the present invention may include internucleoside linkage modifications. In one embodiment, such other internucleoside linkages can be, for example: phosphonoacetate, phosphorothioate (PS), methylphosphonate (MP), guanidinophosphoramidate linkage, or sulfonylphosphoramidate (e.g., mesylphosphoramidate, or 4-acetamidobenzenesulfonylphosphoramidate). A preferred linkage is the PS linkage. The preferred positions for the MP linkage are described in WO2020 / 201144. In one embodiment, the internucleotide linkage may be a phosphodiester, where the OH group of the phosphodiester is substituted by an alkyl group, an alkoxy group, an aryl group, an alkylthio group, an acyl group, -NR1R1, an alkenyloxy group, an alkynyloxy group, an alkenylthio group, an alkynylthio group, -S-Z+, -Se-Z+, or -BH3-Z+, R1 is independently hydrogen, an alkyl group, an alkenyl group, an alkynyl group, or an aryl group, Z+ is an ammonium ion, an alkylammonium ion, a heteroaromatic iminium ion, or a heterocyclic iminium ion (all of which are primary, secondary, tertiary, or quaternary), or Z is a monovalent metal ion, and preferably a PS linkage.In one embodiment, the AON includes a steric specification (also referred to as chiral specification) bond and includes those described below: WO2011 / 005761, WO2014 / 010250, WO2014 / 012081, WO2015 / 107425, WO2017 / 015575, WO2017 / 062862, WO2017 / 160741, WO2017 / 192664, WO2017 / 192679, WO2017 / 198775, WO2017 / 210647, WO2018 / 067973, WO2018 / 098264, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, WO2019 / 219581, WO2020 / 118246, WO2020 / 160336, WO2020 / 191252, WO2020 / 196662, WO2020 / 219981, WO2020 / 219983, WO2020 / 227691, WO2021 / 071788, WO2021 / 071858, WO2021 / 178237, WO2021 / 234459, WO2021 / 237223, and WO2022 / 099159.
[0054] In the AON of the present invention, the isolated nucleotide (the nucleotide directly opposite the target adenosine) generally includes ribose having a 2′-OH group, deoxyribose having a 2′-H group, deoxyribose having a 2′-F group (2′-F), arabinose, 2′-deoxy-2′-fluoroarabinose (FANA), or deoxyribose having a 2′,2′-difluoro group, and preferably does not include ribose having a 2′-O-Me modification or a 2′-MOE modification. Further, the AON of the present invention generally does not include a 2′-MOE modification at a specific position relative to the isolated nucleotide, while other positions within the AON may include a 2′-MOE modification and / or a 2′-F modification.
[0055] In one embodiment, the present invention relates to a method for deaminating at least one target adenosine present in a target RNA molecule within a cell, the method comprising: providing to the cell an AON according to the first aspect of the present invention, or a composition according to the second aspect of the present invention; causing the cell to take up the AON; annealing the AON to the target RNA molecule; enabling a mammalian enzyme having nucleotide deaminase activity to deaminate the target nucleotide within the target RNA molecule; and identifying the presence of deaminated nucleotides within the target RNA molecule. Optionally, the presence of the target RNA molecule is detected by any of the following: (i) sequencing the target sequence; (ii) when the target adenosine is located within a UGA stop codon and this is edited to a UGG codon through the deamination, assessing the presence of a functional, extended, full-length, and / or wild-type protein; or (iii) using a functional readout. Here, the target RNA molecule after deamination encodes a functional, full-length, extended, and / or wild-type protein. Thus, the present invention also relates to an AON that targets an immature stop codon (PTC) present in a (pre-)mRNA and changes the adenosine present in the stop codon to inosine (read as G), resulting in read-through during translation and obtaining a full-length functional protein. The teachings of the present invention are applicable to all genetic diseases that can be targeted using an AON and treated through RNA editing, as outlined herein. However, the teachings of the present invention are also applicable to "loss-of-function" editing or, in another embodiment, "gain-of-function" editing. In this case, deamination of adenosine causes a gain of function (e.g., introduction of another secondary protein structure or introduction of a functional site such as a phosphorylation site). In any case, the present invention relates to an AON that can be used to edit adenosine having a neighboring guanosine on the 5'-side.
[0056] In one embodiment, the AON according to the invention comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches, wobbles, and / or bulges with a complementary target RNA region. When the nucleotide opposite the target adenosine is cytidine (generally deoxycytidine (dC), or 2′-deoxycytidine having a substituent other than 2′-O-Me or 2′-MOE, further described herein), or a cytidine analog (e.g., as disclosed in WO2020 / 252376), the AON mismatches with the target RNA molecule at least once. However, in the AON according to the invention, as detailed herein, the 5′-G within the target sequence faces a nucleotide analog that does not have a Watson-Crick base pair with any of its 5′-G. However, in certain embodiments, it is preferred to place a U opposite the target adenosine, which in principle is not a mismatch. In preferred embodiments, one or more additional mismatched nucleotides, wobbles, and / or bulges are present between the AON and the target RNA. These should enhance the RNA editing efficiency at the target adenosine position by ADAR present intracellularly. One skilled in the art can determine whether hybridization under physiological conditions still occurs. The AON of the invention can recruit (involve) mammalian adenosine deaminases present intracellularly. This is preferably an ADAR enzyme, more preferably ADAR1 or ADAR2. However, when the target RNA molecule is tRNA, the adenosine deaminase may also be an adenosine deaminase acting on tRNA (ADAT). The AON according to the invention can specifically edit the target adenosine within the target RNA sequence using endogenous cellular pathways and naturally occurring ADAR enzymes, or enzymes having ADAR activity (which may be an unidentifed ADAR-like enzyme). As disclosed herein, the single-stranded AON of the invention can effect the deamination of a specific target (e.g., adenosine) within the target RNA molecule, where the nucleotide adjacent to the 5′ side of the adenosine is guanosine. Ideally, at least one target nucleotide is deaminated.Alternatively, one, two, or three additional nucleotides that do not necessarily have a 5′-GA configuration are deaminated. This means that a single AON according to the present invention can be applied not only to the deamination of a target adenosine having a 5′-G, but also to the deamination of another adenosine further upstream or downstream of the target adenosine that may have an adjacent nucleotide of 5′-U, 5′-C, or 5′-A. The nucleoside analog according to the present invention is opposite to 5′-G in the target RNA molecule and can be included in the AON that brings about RNA editing. Here, the AON may include, for example, the stem-loop structure (self-loop hairpin structure) disclosed in WO2016 / 097212, WO2017 / 010556, WO2017 / 050306, WO2019 / 111957, WO2020 / 001793, WO2021 / 113270, WO2021 / 243023, WO2022 / 078995, or is completely or almost completely complementary to the sequence of the target RNA molecule and does not necessarily include a hairpin structure as disclosed in WO2017 / 220751 and WO2018 / 041973. It should be noted that the AON of the present invention can also be bound to a recombinant deaminase domain, as shown by Montiel-Gonzalez et al. (2013) and Vogel et al. (2014), because the “initial” techniques that use oligonucleotide sequences to bring about RNA editing can also benefit from the introduction of a nucleoside analog opposite to 5′-G, as further outlined in the present invention. Therefore, the AON of the present invention is not limited in that the AON does not have a stem-loop structure or that the AON is not bound to a deaminase or deaminase domain. Nevertheless, it is preferred that the AON does not have a stem-loop structure and is not bound to a deaminase moiety because it is preferably relatively short enough to allow cell penetration and is therapeutically meaningful when administered in a “naked” form. However, the AON of the present invention can be bound to other moieties that can facilitate cell uptake or intracellular transport to the site of action.As an example, there are oligonucleotides conjugated to GalNAc ligands, as described, for example, in WO2014 / 179620 and WO2017 / 079745, which improve the in vivo delivery of oligonucleotides, particularly to hepatocytes. Another example is formed from the group of saponins that can be conjugated to oligonucleotides and improve cell entry and transport (WO2020 / 126626; WO2021 / 122998; Wang M. et al. Drug Design, Development and Therapy. 2018. 12:3705-3715). In one embodiment, the AON of the present invention is conjugated to one or more GalNAc ligands and / or saponins. Those skilled in the art recognize which ligands and which saponins may be optimal for which therapeutic uses.
[0057] In one embodiment, an AON capable of forming a double-stranded nucleic acid complex with a target RNA molecule, wherein the double-stranded nucleic acid complex can recruit an adenosine deaminase to deaminate at least one target adenosine in the target RNA molecule, the AON comprises a cytidine analog directly opposite the at least one target adenosine, and the cytidine analog functions as a hydrogen bond donor at the N3 position. Preferably, the cytidine analog is pseudoisocytidine (piC) or Benner's base Z. These cytidine analog nucleotides may be in RNA or DNA form or may be modified at the 2′ position. Other cytidine analogs that can be used in the oligonucleotides according to the present invention further include derivatives of pseudoisocytidine (piC), Benner's base Z, 5-hydroxy C-H+, 5-amino C-H+, and 8-oxo A (syn), for example, cytidine C5 methyl, ethyl, propyl, etc., variants of Benner's base Z having substituents other than nitro groups (such as alkyl groups, F, Cl, Br, CN, etc.), and variants of 8-oxo A substituted at C2 (methyl group, ethyl group, propyl group, halogen, etc.). In one embodiment, the cytidine analog does not have a 2′-O-Me or 2′-MOE ribose modification.
[0058] In one embodiment, an AON capable of forming a double-stranded nucleic acid complex with a target RNA molecule, wherein the double-stranded nucleic acid complex can recruit an adenosine deaminase to deaminate at least one target adenosine in the target RNA molecule, the AON contains a uridine analog or a uridine derivative directly opposite the target adenosine, and the uridine analog or the uridine derivative functions as a hydrogen bond donor at the N3 position. Examples of preferred uridine analogs and uridine derivatives are isouridine, pseudouridine, 4-thiouridine, thienouridine, 5-methoxyuridine, dihydrouridine, 5-methyluridine N3-glycosylated uridine, and dihydroisouridine. These uridine analogs / derivatives may be in RNA or DNA form, or may be modified at the 2′ position. Other uridine analogs that can be used in the oligonucleotides according to the present invention further include derivatives of isouridine, for example, substituted isouridine variants (for example, having a nitro group, an alkyl group, F, Cl, Br, CN, etc.).
[0059] In one embodiment, the AON according to the present invention comprises at least one phosphonoacetate, phosphorothioate (PS), methylphosphonate (MP), guanidinophosphoramidate bond, phosphorylguanidine bond, phosphoramidate bond, or sulfonylphosphoramidate (e.g., mesylphosphoramidate, or 4-acetamidobenzenesulfonylphosphoramidate). In a preferred embodiment, the double-stranded nucleic acid complex can recruit an endogenous ADAR enzyme, preferably, the ADAR enzyme is an endogenous ADAR2 enzyme. The double-stranded AON / target RNA molecule complex interacts through Watson-Crick base pairing, except at the position of 5′-G, and generally also except at the position of the target adenosine that is opposite an isolated nucleotide (which can be a nucleotide having a Benner base, cytidine, uridine (= not a mismatch), or uridine analog / derivative as described above). One skilled in the art can determine the level of ability to achieve RNA editing based on the teachings available in the art and compare the ability of the chemically modified position or the entire AON with an AON lacking a specific sugar modification and / or linkage modification at a specific position. The length of the AON can vary depending on the structure present (AONs with a hairpin structure are generally longer, but in the absence of a hairpin structure, the AON can be relatively "short", preferably containing about 15 to 30 nucleotides). The AON of the present invention does not necessarily have a recruitment moiety (e.g., a hairpin or stem-loop structure) for attracting ADAR, but it is not excluded.
[0060] The present invention relates to an antisense oligonucleotide (AON) capable of forming a double-stranded nucleic acid complex with a target RNA molecule, wherein the double-stranded nucleic acid complex can recruit an adenosine deaminase to deaminate a target adenosine in the target RNA molecule, the nucleotide immediately 5′ to the target adenosine in the target RNA molecule is guanosine, and the nucleotide in the AON opposite the guanosine is a nucleotide analog capable of inducing the syn conformation of the guanosine. Whether a 5′-G in a target RNA molecule is achievable is determined based on the teachings outlined herein. Any AON that contains a nucleotide analog capable of inducing the syn conformation of 5′-G and provides a higher RNA editing rate in vitro and / or in vivo compared to the same AON that contains adenosine or guanosine at the position of the nucleotide analog (opposite 5′-G) is an embodiment of the present invention. One of ordinary skill in the art can determine, based on the teachings herein and general knowledge in the field of RNA editing, whether an AON that contains a nucleotide analog at the position opposite 5′-G, preferably an AON that contains a modified purine nucleobase, is superior (works better, more efficiently, and / or faster with respect to bringing about RNA editing) compared to an AON that contains adenosine, deoxyadenosine, guanosine, or deoxyguanosine at the same position opposite 5′-G. One of ordinary skill in the art can also determine, based on the teachings herein and general knowledge in the fields of crystallography and other technical fields, whether 5′-G is induced into the syn conformation when it hybridizes to the guide AON and forms a complex with the deaminase domain of the adenosine deaminase.
[0061] In certain embodiments, the present invention relates to an AON according to the present invention, wherein at least one nucleotide or nucleotide analog in the AON contains a substitution at the 2′ position of ribose, the substitution being selected from the group consisting of: H (DNA); OH (RNA); F; ara-F; diF; 2′-C-methyl′-2′-F; substituted or unsubstituted, straight-chain or branched lower (C1-C 10)Alkyl, alkenyl, alkynyl, alkaryl, aryl, or aralkyl, which may be interrupted by one or more heteroatoms; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; O-, S-, or N-aryl; O-alkyl-O-alkyl; methoxy; aminopropoxy; methoxyethoxy; dimethylaminooxyethoxy; and dimethylaminoethoxyethoxy; provided that the nucleotide opposite the target adenosine does not contain a 2′-O-methyl or 2′-(2-methoxy)ethyl ribose modification. In certain embodiments, the invention relates to an AON according to the invention, wherein at least one nucleotide or nucleotide analog within the AON is an arabinonucleic acid. In certain embodiments, the invention relates to an AON according to the invention, wherein the nucleotide analog comprises a modified nucleobase. In certain embodiments, the invention relates to an AON according to the invention, wherein the nucleotide analog comprises a modified purine nucleobase. In certain embodiments, the invention relates to an AON according to the invention, wherein the modified purine nucleobase comprises a 7-deazapurine modification (preferably a 7-deazaadenine modification), or a 3-deazapurine modification (preferably a 3-deazaadenine modification), or a 3,7-dideaza modification (preferably a 3,7-dideazaadenine modification). In certain embodiments, the invention relates to an AON according to the invention, wherein the modified purine nucleobase comprises a hydrogen bond donor at N1 with a pKa higher than 3.7 and lower than 9.5. In certain embodiments, the invention relates to an AON according to the invention, wherein the nucleotide analog is selected from the group consisting of: 7-deaza-2′-deoxyadenosine (7-deazadA); 7-deaza-2′-adenosine (7-deazaA); 7-deaza-2′-deoxy-2′-fluoroadenosine (7-deazafA); 7-deaza-2′-deoxy-2′-ara-fluoroadenosine; 7-deaza-2′-deoxy-2′,2′-difluoroadenosine; 3-deaza-2′-deoxyadenosine (3-deazadA); 3-Deaza-2'-adenosine (3-deaza A); 3-Deaza-2'-deoxy-2'-fluoroadenosine (3-deaza fA); 3-Deaza-2'-deoxy-2'-ara-fluoroadenosine; 3-Deaza-2'-deoxy-2',2'-difluoroadenosine; 3,7-Dideaza-2'-deoxyadenosine (3,7-dideaza dA); 3,7-Dideaza-2'-adenosine (3,7-dideaza A); 3,7-Dideaza-2'-deoxy-2'-fluoroadenosine (3,7-dideaza fA); 3,7-Dideaza-2'-deoxy-2'-ara-fluoroadenosine; 3,7-Dideaza-2'-deoxy-2',2'-difluoroadenosine; 3-Deaza-2'-O-[2-(methoxy)ethyl]adenosine; 3-Deaza-2'-O-[2-methylamino-2-oxoethyl]adenosine; 2'-Deoxy-2'-fluoroguanosine; 2'-ara-Fluoroguanosine (FANA G); 2',2'-Difluoroguanosine; 2'-Deoxyinosine (dI); 2'-OH-Inosine (rI); 2'-Fluoroinosine (2'-F-I); 2'-ara-Fluoroinosine (FANA I); 2',2'-Difluoroinosine; 5-Formylindole-2'-deoxyriboside; 5-Formyl-2'-fluoro-2'-deoxyriboside; 5-Formylindole-2'-ara-fluoro-2'-deoxyriboside; 5-Formylindole-2',2'-difluoro-2'-deoxyriboside; 5-Formylindole-2'-O-methylriboside; 5-Formylindole-2′-O-[2-(methoxy)ethyl]riboside; 5-Formylindole-2′-O-[2-methylamino-2-oxoethyl]riboside; β-(4-Amidin-1H-imidazol-1-yl)riboside; β-(4-Amidin-1H-imidazol-1-yl)2′-deoxyriboside; β-(4-Amidin-1H-imidazol-1-yl)2′-ara-fluoro-2′-deoxyriboside; and β-(4-Amidin-1H-imidazol-1-yl)2′,2′-difluoro-2′-deoxyriboside.
[0062] In certain embodiments, the nucleotide opposite 5′-G within the target sequence comprises a base moiety having the structure of formula (II), (III), (IV), (V), (VI), or (VII): JPEG2025524566000002.jpg34166JPEG2025524566000003.jpg36166JPEG2025524566000004.jpg36166JPEG2025524566000005.jpg36166JPEG2025524566000006.jpg31166JPEG2025524566000007.jpg31166wherein R is: - H; - an electron donating moiety; - -C(=O)H; - -OR1; - -SR1; or - -NR1R2 wherein R1 is (C1-C6)alkoxy, methoxy, ethoxy, isopropoxy, cyclopropoxy, (C1-C6)alkyl, methyl, ethyl, isopropyl, or cyclopropyl, and R2 is H, (C1-C6)alkoxy, methoxy, ethoxy, isopropoxy, cyclopropoxy, (C1-C6)alkyl, methyl, ethyl, isopropyl, or cyclopropyl.
[0063] In certain embodiments, the nucleotide opposite the 5′-G within the target sequence contains a base structure according to formula (VIII) or (IX): JPEG2025524566000008.jpg58166JPEG2025524566000009.jpg53166where: X = CH, CR6, or N; R1 = H, OH, halogen, SH, (C1-C3) alkoxy, or NH2; R2 = H, OH, NH2, methyl, ethyl, or cyclopropyl; R3 = H, OH, NH2, methyl, ethyl, cyclopropyl, or (C1-C3) alkoxy; R4 = H, OH, NH2, methyl, ethyl, cyclopropyl, or (C1-C3) alkoxy; R5 = H, OH, NH2, methyl, ethyl, cyclopropyl, or (C1-C3) alkoxy; and R6 = an electron-donating moiety, methyl, ethyl, cyclopropyl, or (C1-C3) alkoxy.
[0064] In certain embodiments, the present invention relates to an AON according to the present invention, wherein the adenosine deaminase is an endogenous ADAR enzyme, preferably ADAR2. In certain embodiments, the present invention relates to an AON according to the present invention, wherein the AON comprises at least one phosphorothioate (PS), phosphonoacetate, or methylphosphonate (MP) nucleotide internucleoside linkage. In certain embodiments, the present invention relates to an AON according to the present invention, wherein the AON comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotides and is at most 100 nucleotides in length. The preferred length of the AON according to the present invention is about 15 to about 25 nucleotides. In another embodiment, the AON according to the present invention does not contain a sequence that allows for the formation of an internal stem-loop structure (or hairpin structure). In another preferred embodiment, the AON according to the present invention is not covalently or non-covalently bound to a (recombinant) deaminase or its (recombinant) deaminase domain.
[0065] In certain embodiments, the present invention relates to a pharmaceutical composition comprising an AON according to the present invention and a pharmaceutically acceptable carrier or diluent. Pharmaceutically acceptable carriers or diluents are well known in the art. In certain embodiments, the present invention relates to an AON according to the present invention, or a pharmaceutical composition according to the present invention, for use in the treatment, amelioration, or delay of progression of a genetic disease caused by a premature UGA stop codon.
[0066] In certain embodiments, the present invention relates to a method for deaminating at least one target adenosine present in a target RNA molecule within a cell, wherein the nucleotide 5′ to the target adenosine in the RNA molecule is guanosine, and the method comprises the following steps: (i) providing to the cell an AON according to the present invention, or a pharmaceutical composition according to the present invention; (ii) annealing the AON to the target RNA molecule to form a double-stranded nucleic acid complex capable of recruiting adenosine deaminase, preferably endogenous adenosine deaminase, in the cell; (iii) enabling the adenosine deaminase to deaminate the target adenosine in the target RNA molecule; and (iv) may include identifying the presence of deaminated adenosine in the target RNA molecule. In certain embodiments, step (iv) includes: (a) sequencing a region of the target RNA molecule; the region includes deaminated target adenosine; (b) assessing the presence of a functional, extended, full-length, and / or wild-type protein when the target adenosine is within a UGA stop codon; or (c) using a functional readout; the target RNA molecule after deamination encodes a functional, full-length, extended, and / or wild-type protein.
[0067] In certain embodiments, the invention relates to a method for deaminating at least one target adenosine present in a target RNA molecule, the method comprising the steps of: (i) providing an AON according to the invention, or a pharmaceutical composition according to the invention; (ii) annealing the AON to the target RNA molecule to form a double-stranded nucleic acid complex with the target RNA molecule; (iii) enabling a mammalian adenosine deaminase to deaminate the target adenosine in the target RNA molecule; and (iv) may include identifying the presence of deaminated adenosine in the target RNA molecule. Preferably, the adenosine deaminase is an endogenous ADAR enzyme, preferably ADAR2.
[0068] In certain embodiments, the invention relates to an AON according to the invention, or a pharmaceutical composition according to the invention, preferably for use in the treatment of a genetic disorder selected from the group consisting of: Hurler syndrome, α-1-antitrypsin (A1AT) deficiency, (familial) hypercholesterolemia, Parkinson's disease, Rett syndrome, Stargardt disease, citrullinemia type 1, autosomal recessive nonsyndromic hearing loss, X-linked retinoschisis, argininosuccinate lyase deficiency, Duchenne / Becker muscular dystrophy, non-alcoholic steatohepatitis (NASH), myotonic dystrophy type 1, myotonic dystrophy type 2, Huntington's disease, Usher syndrome (e.g., Usher syndrome type 1, type 2, and type 3), Charcot-Marie-Tooth disease, cystic fibrosis, Alzheimer's disease, leukodystrophy, amyotrophic lateral sclerosis, asthma, β-thalassemia, epileptic encephalopathy, CADASIL syndrome, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), dystrophic epidermolysis bullosa, epidermolysis bullosa, Fabry disease, factor V Leiden-related diseases, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, hereditary cancer predisposition syndromes, Hunter syndrome, inflammatory bowel disease (IBD), inherited polyagglutination syndrome, Leber congenital amaurosis, Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, neurofibromatosis, Niemann-Pick disease (type A, type B, and type C), NY-eso1-related cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary dyskinesia, prothrombin variant-related diseases (e.g., prothrombin G20210A variant), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Tay-Sachs disease, X-linked immunodeficiency, Sturge-Weber syndrome, and cancer (e.g., breast cancer and lung cancer).
[0069] In one embodiment, the present invention relates to a method of treating, preventing, or ameliorating a genetic disease, the method comprising administering an AON according to the present invention to a subject suffering from the genetic disease. In one embodiment, the genetic disease is caused by a mutation that results in a premature stop codon, and the premature stop codon is UGA. In another embodiment, the genetic disease may be the result of a mutation that results in an undesirable codon that causes the disease, the codon comprising a target adenosine having a preceding 5'-G, wherein the 5'-G is within the codon of the target adenosine itself or is the third nucleotide of a codon 5' to a codon that includes the target adenosine as the first nucleotide.In certain embodiments, the genetic disease is selected from the group consisting of: Hurler syndrome, α-1-antitrypsin (A1AT) deficiency, (familial) hypercholesterolemia, Parkinson's disease, Rett syndrome, Stargardt disease, citrullinemia type 1, autosomal recessive nonsyndromic hearing loss, X-linked retinoschisis, argininosuccinate lyase deficiency, Duchenne / Becker muscular dystrophy, non-alcoholic steatohepatitis (NASH), myotonic dystrophy type 1, myotonic dystrophy type 2, Huntington's disease, Usher syndrome (e.g., Usher syndrome type 1, type 2, and type 3), Charcot-Marie-Tooth disease, cystic fibrosis, Alzheimer's disease, leukodystrophy, amyotrophic lateral sclerosis, asthma, β-thalassemia, epilepsy encephalopathy, CADASIL syndrome, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), dystrophic epidermolysis bullosa, epidermolysis bullosa, Fabry disease, factor V Leiden-related diseases, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, hereditary cancer predisposition syndromes, Hunter syndrome, inflammatory bowel disease (IBD), hereditary panhemagglutination syndrome, Leber congenital amaurosis, Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, neurofibromatosis, Niemann-Pick disease (type A, type B, and type C), NY-eso1-related cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary dyskinesia, prothrombin variant-related diseases (e.g., prothrombin G20210A variant), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Tay-Sachs disease, X-linked immunodeficiency, Sturge-Weber syndrome, and cancer (e.g., breast cancer and lung cancer).
[0070] In yet another embodiment, the present invention relates to an AON capable of forming a double-stranded nucleic acid complex with a target RNA molecule, which is related to an AON for use in the treatment of genetic diseases, wherein the double-stranded nucleic acid complex is capable of recruiting an adenosine deaminase to deaminate a target adenosine in the target RNA molecule, the nucleotide immediately 5′ to the target adenosine in the target RNA molecule is guanosine (5′-G), and the nucleotide in the AON opposite the guanosine is a natural nucleotide selected from the group consisting of: guanosine, deoxyguanosine, adenosine, deoxyadenosine, and inosine; and the natural nucleotide is capable of inducing the syn conformation of the 5′-G.In a preferred embodiment of the AON used for the treatment of genetic diseases according to the present invention, the genetic diseases are selected from the group consisting of: Hurler syndrome, α-1-antitrypsin (A1AT) deficiency, (familial) hypercholesterolemia, Parkinson's disease, Rett syndrome, Stargardt disease, citrullinemia type 1, autosomal recessive non-syndromic hearing loss, X-linked retinoschisis, argininosuccinate lyase deficiency, Duchenne / Becker muscular dystrophy, non-alcoholic steatohepatitis (NASH), myotonic dystrophy type 1, myotonic dystrophy type 2, Huntington's disease, Usher syndrome (e.g., Usher syndrome type 1, type 2, and type 3), Charcot-Marie-Tooth disease, cystic fibrosis, Alzheimer's disease, leukodystrophy, amyotrophic lateral sclerosis, asthma, β-thalassemia, epileptic encephalopathy, CADASIL syndrome, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), dystrophic epidermolysis bullosa, epidermolysis bullosa, Fabry disease, factor V Leiden-related diseases, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, hereditary cancer predisposition syndromes, Hunter syndrome, inflammatory bowel disease (IBD), hereditary panhemagglutination syndrome, Leber congenital amaurosis, Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, neurofibromatosis, Niemann-Pick disease (type A, type B, and type C), NY-eso1-related cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary diseases, prothrombin mutation-related diseases (e.g., prothrombin G20210A mutation), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Tay-Sachs disease, X-linked immunodeficiency, Sturge-Weber syndrome, and cancer (e.g., breast cancer and lung cancer).
[0071] In yet another embodiment, the present invention relates to an AON capable of forming a double-stranded nucleic acid complex with a target RNA molecule, which is related to an AON for use in the treatment of genetic diseases, wherein the double-stranded nucleic acid complex is capable of recruiting an adenosine deaminase to deaminate a target adenosine within the target RNA molecule, the nucleotide immediately 5′ to the target adenosine within the target RNA molecule is guanosine (5′-G), and the nucleotide within the AON opposite the guanosine is a natural nucleotide or a nucleotide analog as outlined herein, the natural nucleotide or nucleotide analog is capable of inducing the syn conformation of the 5′-G, and the genetic disease is not caused by the mutation and is used for gain-of-function purposes for the alleviation, treatment, prevention, or amelioration of the disease.
[0072] The (mammalian) enzyme having nucleotide deaminase activity, preferably adenosine deaminase activity, recruited using the AON according to the present invention is preferably an ADAR enzyme, more preferably ADAR1 or ADAR2, and even more preferably an endogenous ADAR1 or ADAR2 enzyme present intracellularly, capable of changing a target nucleotide within the target RNA molecule, which target nucleotide is preferably adenosine that is subsequently deaminated to inosine. Other adenosine deaminases that can be recruited by the AON of the present invention include adenosine deaminases acting on tRNA (ADAT), which are also preferably endogenous, more preferably endogenous human ADAT.
[0073] In another embodiment, the present invention relates to a method for treating a subject, preferably a human subject in need thereof, who suffers from a genetic disease caused by a mutation that results in a premature stop codon such as UGA, which includes the aforementioned undesirable 5′-GA sequence.
[0074] The mutation may not be a G>A mutation (wild-type UGG; from tryptophan), and for example, it may be a C>G (wild-type UCA; from serine), U>G (wild-type UUA; from leucine), C>A (wild-type UGC; from cysteine), or U>A (wild-type UGU; from cysteine) mutation. Even in such cases, deaminating the adenosine within this codon may still be beneficial to patients suffering from diseases caused by the occurrence of UGA premature stop codons. By deaminating the target adenosine to inosine, even if the resulting codon is read as UGG, which is different from the wild-type codon (except when the UGA codon is the result of a G>A mutation, see above), it will reduce, prevent, or improve the disease. The fact that the protein is produced in full length is generally considered beneficial and can be further demonstrated by experiments known to those skilled in the art. Obviously, any adenosine located 3′ to guanosine within the target sequence can be deaminated using the teachings of the present invention. The target adenosine can be the first, second, or third nucleotide of the codon, but only when the nucleotide preceding the adenosine is guanosine, in which case guanosine is then the third, first, or second nucleotide of the codon, respectively. Therefore, any type of sequence around the 5′-GA arrangement may be acceptable.
[0075] In one embodiment, the method includes the following steps: administering an AON or pharmaceutical composition according to the present invention to a subject; enabling the AON to form a double-stranded nucleic acid complex with its specific and complementary target nucleic acid in the cells within the subject; enabling an existing endogenous adenosine deaminase such as ADAR2 to be involved; and enabling the enzyme to deaminate the target adenosine within the target nucleic acid molecule to inosine, thereby reducing, preventing, or improving a genetic disease. The genetic diseases that can be treated by this method are preferably the genetic diseases listed herein, but are not limited thereto, and may be any other disease that is beneficial to a patient who requires deamination of a specific adenosine.
[0076] Those skilled in the art know that oligonucleotides, such as RNA oligonucleotides, generally consist of repeating monomers. Such monomers are most often nucleotides or chemically modified nucleotides. The most common nucleotides in naturally occurring RNA are adenosine monophosphate (A), cytidine monophosphate (C), guanosine monophosphate (G), and uridine monophosphate (U). These consist of a pentose sugar (ribose), a 5′-linked phosphate group (which is linked via a phosphoester), and a 1′-linked base. This sugar is often referred to as the "scaffold" of the nucleotide, as it links the base and the phosphate. Thus, modifications to the pentose sugar are often referred to as "scaffold modifications". The original pentose sugar can be completely replaced by another moiety that similarly links the base and the phosphate. Thus, while the pentose sugar often functions as a scaffold, it is understood that the scaffold need not necessarily be a pentose sugar. Examples of scaffold modifications applicable to the monomers of the AONs of the present invention are disclosed in WO2020 / 154342, WO2020 / 154343, and WO2020 / 154344. The base (sometimes called a nucleobase) is generally adenine, cytosine, guanine, thymine, or uracil, or derivatives thereof. The base (sometimes called a nucleobase) is defined as the moiety that can bind to another nucleobase through hydrogen bonding, polar bonding (e.g., through a CF moiety), or aromatic electronic interactions. Cytosine, thymine, and uracil are pyrimidine bases and are generally bound to the scaffold through their 1-nitrogen. Adenine and guanine are purine bases and are generally bound to the scaffold through their 9-nitrogen.
[0077] Nucleotides are generally linked to adjacent nucleotides through the condensation of the 5′-phosphate moiety thereof to the 3′-hydroxyl moiety of the adjacent nucleotide monomer. Similarly, the 3′-hydroxyl moiety is generally linked to the 5′-phosphate of the adjacent nucleotide monomer. Thereby, a phosphodiester bond is formed. The phosphodiester and the scaffold form an alternating copolymer. The base is joined to this copolymer, i.e., to the scaffold moiety. From this feature, the alternating copolymer formed by the linked scaffolds of the oligonucleotide is often called the “backbone” of the oligonucleotide. Since the phosphodiester bond links adjacent monomers, these are often referred to as “backbone linkages”. Even when the phosphate group is modified and replaced by a similar moiety such as phosphorothioate (PS), it is understood that such a moiety is still referred to as the backbone bond of the monomer. This is called a “backbone linkage modification”. In a general sense, the backbone of an oligonucleotide contains scaffolds and backbone linkages alternately.
[0078] The nucleobases within the AON of the present invention can be adenine, cytosine, guanine, thymine, or uracil, or any other moiety capable of interacting with another nucleobase through hydrogen bonding, polar bonding (e.g., CF), or aromatic electron interactions. Clearly, the nucleobase (within the AON of the present invention) opposite the 5′-G of the target sequence is a modified nucleobase and is also referred to as a “base analog.” The entire monomer or nucleotide may be referred to as a “nucleotide analog.” Any analog at this position within the AON of the present invention that can direct 5′-G into the syn conformation and, by the complex of the AON and the target sequence, as described in the attached examples, can result in more efficient RNA editing compared to what is observed when a “normal” guanosine or deoxyguanosine is present opposite 5′-G while using the same AON is appropriate. Thus, any modification of the scaffold or backbone can also be introduced within the AON and at the position of the nucleotide analog opposite 5′-G as long as the AON does not adversely affect RNA editing efficiency. That is, the ribose may be further chemically modified at the 1′, 2′, 3′, 4′, and / or 5′ position(s), and one of ordinary skill in the art can freely introduce such modifications and still monitor the effect when the base analog interacts with the 5′-G within the target sequence.
[0079] Nucleobases at any position within the AON of the present invention can be modified forms of adenine, cytosine, guanine, or uracil, such as the following: hypoxanthine (the nucleobase in inosine), isouracil, pseudouracil, pseudocytosine, 1-methylpseudouracil, orotic acid, agmatidine, lysidine, 2-thiouracil, 2-thiothymine, 5-halouracil, 5-halomethyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-formyluracil, 5-aminomethylcytosine, 5-formylcytosine, 5-hydroxymethylcytosine, 7-deazaguanine, 7-deazaadenine, 7-deaza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, pseudoisocytosine, N4-ethylcytosine, N2-cyclopentylguanine, N2-cyclopentyl-2-aminopurine, N2-propyl-2-aminopurine, 2,6-diaminopurine, 2-aminopurine, G-clamp, super A, super T, super G, amino-modified nucleobases or derivatives thereof; and modified or universal bases (e.g., 2,6-difluorotoluene), or deletions such as abasic sites (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose, azaribose). As used herein, the terms "adenine", "guanine", "cytosine", "thymine", "uracil", and "hypoxanthine" refer to the nucleobases themselves. The terms "adenosine", "guanosine", "cytidine", "thymidine", "uridine", and "inosine" refer to nucleobases attached to (deoxy)ribose.
[0080] In certain embodiments, the nucleotide analog is an analog of a nucleic acid nucleotide. In certain embodiments, the nucleotide analog is an analog of adenosine, guanosine, cytidine, thymidine, uridine, deoxyadenosine, deoxyguanosine, deoxycytidine, deoxythymidine, or deoxyuridine. In certain embodiments, the nucleotide analog is not guanosine or deoxyguanosine. In certain embodiments, the nucleotide analog is not a nucleic acid nucleotide. In certain embodiments, the nucleotide is not adenosine, guanosine, cytidine, thymidine, uridine, deoxyadenosine, deoxyguanosine, deoxycytidine, deoxythymidine, or deoxyuridine.
[0081] In one embodiment, the AON of the present invention may include one or more nucleotides having a 2′-O-(2-methoxy)ethyl (2′-MOE) ribose modification. In another embodiment, the AON includes one or more nucleotides that do not have a 2′-MOE ribose modification, and the 2′-MOE ribose modification is present at a position where an enzyme having adenosine deaminase activity does not prevent deamination of the target adenosine. In another embodiment, the AON includes a 2′-O-methyl (2′-O-Me) ribose modification at a position that does not include a 2′-MOE ribose modification, and / or wherein the oligonucleotide includes a deoxynucleotide at a position that does not include a 2′-MOE ribose modification. In one embodiment, the AON includes one or more nucleotides that include a 2′ position including a 2′-MOE, 2′-O-Me, 2′-OH, 2′-deoxy, 2′-fluoro (2′-F), 2′,2′-difluoro (2′-2′-diF) modification, or a 2′-4′ linkage (i.e., a bridged nucleic acid such as a locked nucleic acid (LNA)). In another embodiment, other nucleic acid monomers that may be applied include, for example, arabinonucleic acid and 2′-deoxy-2′-fluoroarabinonucleic acid (FANA) for the purpose of improving affinity. The 2′-4′ linkage may be selected from linkers known in the art, such as a methylene linker or a constrained ethyl linker. A wide variety of 2′ modifications are known in the art. Further examples are disclosed in more detail, for example, in WO2016 / 097212, WO2017 / 220751, WO2018 / 041973, WO2018 / 134301, WO2019 / 219581, and WO2019 / 158475. In all cases, the modification must be compatible with editing so that the oligonucleotide serves as an editing oligonucleotide. Also according to the present invention, the modification at the 2′ position of the ribose in the nucleotide analog opposite 5′-G should not prevent the 5′-G from being led to the syn conformation as outlined herein, or prevent the RNA editing ability of the AON and the recruitment of adenosine deaminase enzymes when added to the target RNA molecule.When the monomer contains a locked nucleic acid (UNA) ribose modification, the monomer can have a 2′ position containing the same modifications as described above, such as 2′-MOE, 2′-O-Me, 2′-OH, 2′-deoxy, 2′-F, 2′,2′-diF, arabinonucleic acid, FANA, or a 2′-4′ linkage (i.e., a bridged nucleic acid such as locked nucleic acid (LNA)). Again, in all cases, the modification must be compatible with editing so that the oligonucleotide serves as an AON that can recruit adenosine deaminase when added to the target RNA molecule. In all aspects of the invention, the enzyme having adenosine deaminase activity is preferably ADAR1, ADAR2, or ADAT. In a highly preferred embodiment, the AON is an RNA editing oligonucleotide targeting pre-mRNA or mRNA, where the target nucleotide is an adenosine within the target RNA, the adenosine is deaminated to inosine, which is read as guanosine by the translation machinery, and the nucleotide directly 5′ to the target adenosine is guanosine. In a further preferred embodiment, the adenosine is within a UGA stop codon, which is edited to a UGG codon. The invention also relates to a pharmaceutical composition comprising an AON characterized herein and a pharmaceutically acceptable carrier.
[0082] The term "nucleoside" refers to a nucleobase attached to a (deoxy)ribose without a phosphate group. A "nucleotide" is composed of a nucleoside and one or more phosphate groups. Thus, the term "nucleotide" refers to each nucleobase-(deoxy)ribose-phospho linker, and any chemical modification of the ribose moiety or the phospho group. Thus, this term includes: nucleotides containing a locked ribose moiety (including a 2'-4' bridge including a methylene group or any other group), unlocked nucleic acids (UNA), and nucleotides containing linkers including phosphodiester, phosphonoacetate, phosphotriester, PS, phosphor( di)thioate, MP, phosphoramidate, phosphorylguanidine linkers, etc. The terms adenosine and adenine, guanosine and guanine, cytidine and cytosine, uracil and uridine, thymine and thymidine / uridine, inosine and hypoxanthine refer to the corresponding nucleobase on the one hand and the nucleoside or nucleotide on the other hand, and may be used interchangeably. The terms nucleobase, nucleoside, and nucleotide may be used interchangeably unless the context clearly requires otherwise (e.g., when a nucleoside is attached to an adjacent nucleoside and the bond between these nucleosides is modified). As described above, a nucleotide is a nucleoside + one or more phosphate groups. The terms "ribonucleoside" and "deoxyribonucleoside", or "ribose" and "deoxyribose" are as used in the art. Whenever oligonucleotide, oligo, ON, ASO, oligonucleotide composition, antisense oligonucleotide, AON, (RNA) editing oligonucleotide, EON, and RNA (antisense) oligonucleotide are mentioned, they always mean both oligoribonucleotides and deoxyoligoribonucleotides, unless the context indicates otherwise. Whenever "oligoribonucleotide" is mentioned, it always may contain the bases A, G, C, U, or I. Whenever "deoxyoligoribonucleotide" is mentioned, it always may contain the bases A, G, C, T, or I.However, the AON of the present invention may include a mixture of ribonucleosides and deoxyribonucleosides in addition to the nucleoside analogs opposite 5′-G. When deoxyribonucleosides are used, i.e., when there is no modification at the 2′ position of the sugar, the nucleotides are often abbreviated as dA, dC, dG, or T, where "d" represents the deoxynature of the nucleoside. On the other hand, normal RNA or ribonucleosides modified at the 2′ position are often abbreviated without the "d" as described herein and are often abbreviated together with their respective modifications.
[0083] Whenever a nucleotide is mentioned in an oligonucleotide composition, for example, in the case of cytosine, it includes 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, 5-acetylcytosine, 5-hydroxycytosine, and β-D-glucosyl-5-hydroxymethylcytosine; when adenine is mentioned, it includes N6-methyladenine and 7-methyladenine; when uracil is mentioned, it includes dihydrouracil, isouracil, N3-glycosylated uracil, pseudouracil, 5-methyluracil, N1-methylpseudouracil, 4-thiouracil, and 5-hydroxymethyluracil; when guanine is mentioned, it includes 1-methylguanine, 7-methylguanosine, N2,N2-dimethylguanosine, N2,N2,7-trimethylguanosine, and N2,7-dimethylguanosine. Whenever a nucleoside or nucleotide is mentioned, it always includes ribofuranose derivatives such as 2′-deoxy, 2′-hydroxy, and 2′-O-substituted variants (e.g., 2′-O-methyl), as well as other modifications including 2′-4′ bridged variants. Whenever an oligonucleotide is mentioned, the bond between two mononucleotides may be a phosphodiester bond and its modifications, including phosphonoacetate, phosphodiester, phosphotriester, PS, phosphor(di)thioate, MP, phosphoramidate bond, thiophosphoramidate, phosphorylguanidine, thiophosphorylguanidine, sulfonophosphoramidate, etc.
[0084] The term "comprising" encompasses "including" and "consisting of". For example, a composition "comprising" X may consist only of X or may include something additional (e.g., X + Y). The term "about" with respect to a numerical value x is optional and means, for example, x ± 10%. The term "substantially" does not exclude "completely". For example, a composition "substantially free of" Y may not be completely free of Y. When relevant, the term "substantially" may be omitted from the definitions of the present invention.
[0085] As used herein, the term "complementary" refers to the fact that an AON hybridizes to a target sequence under physiological conditions. This term does not mean that each nucleotide in the AON forms a perfect pair with the opposing nucleotide in the target sequence. In other words, an AON may be complementary to a target sequence, but there may be mismatches, wobbles, and / or bulges between the AON and the target sequence, while still hybridizing to the target sequence under physiological conditions, such that intracellular RNA editing enzymes can edit the target adenosine. Thus, the term "substantially complementary" also means that even in the presence of mismatches, wobbles, and / or bulges, the AON has sufficient nucleotides that match between the AON and the target sequence such that the AON can hybridize to the target RNA under physiological conditions. As shown herein, an AON may be complementary, but may include one or more mismatches, wobbles, and / or bulges with the target sequence, provided that the AON can hybridize to its target under physiological conditions.
[0086] The term "downstream" with respect to a nucleic acid sequence means further along the sequence in the 3' direction; the term "upstream" means the reverse. Thus, in any sequence encoding a polypeptide, the start codon is upstream of the stop codon on the sense strand but downstream of the stop codon on the antisense strand.
[0087] References to "hybridisation" typically refer to specific hybridisation, excluding non-specific hybridisation. Specific hybridisation can occur under experimental conditions selected using techniques well known in the art, and most of the stable interactions between the probe and the target are ensured when the probe and the target have at least 70%, preferably at least 80%, more preferably at least 90% sequence identity. As used herein, the term "mismatch" refers to opposing nucleotides within a double-stranded RNA complex that do not form a complete base pair according to the Watson-Crick base pairing rules. In the traditional sense, mismatch nucleotides are G-A, C-A, U-C, A-A, G-G, C-C, U-U pairs. In some embodiments, the AONs of the invention contain less than 4 mismatches, such as 0, 1, or 2 mismatches. Wobble base pairs are G-U, I-U, I-A, and I-C base pairs. According to the present invention, G:G pair formation and G:analog pair formation are considered mismatches, but this does not necessarily mean that the interaction is unstable, i.e., the term "mismatch" is somewhat out of date based on the current invention that relatively stable even when Hoogsteen base pair formation is considered a mismatch based on the origin of the nucleotide (analog). Isolated G:G pair formation within double-stranded RNA can be very stable, for example, but is still defined as a mismatch.
[0088] The term "splice mutation" refers to a mutation in a gene encoding pre-mRNA, where the splicing mechanism is dysfunctional in the sense that the splicing of introns from exons is disrupted, and this aberrant splicing causes subsequent translation to be out-of-frame, resulting in premature termination of the encoded protein. Such truncated proteins are often rapidly degraded as described herein and have no functional activity. The mutation itself need not be the target of RNA editing; an adenosine adjacent or proximal within the (splice) mutation may be the target nucleotide, and converting that adenosine to I restores the splice mutation to a normal state. One of ordinary skill in the art recognizes methods for determining whether normal splicing has been restored after RNA editing of an adenosine within a splice mutation site or region.
[0089] The AON according to the present invention can be chemically modified almost entirely, for example, by providing 2′-O-methylated sugar moieties (2′-O-Me), 2′-F, and / or 2′-O-(2-methoxy)ethyl sugar moieties (2′-MOE) to nucleotides. However, the isolated nucleotides are nucleotides containing cytidine, cytidine analogs, uridine, uridine analogs / derivatives, or Benner's bases (as detailed above), preferably without 2′-O-Me or 2′-MOE modifications. In yet further embodiments, at least one, and in another embodiment both, of the two adjacent nucleotides flanking each nucleotide opposite the target adenosine do not contain 2′-O-Me modifications. Complete modification where all nucleotides of the AON have 2′-O-Me modifications results in oligonucleotides that are non-functional with respect to RNA editing (known in the art), presumably because they interfere with ADAR activity at the target site. Generally, adenosines within the target RNA can be protected from editing by providing a 2′-O-Me group to the opposing nucleotide or by providing guanine or adenine as the opposing base, but these two nucleobases can also reduce the editing of the opposing adenosine. Various chemical techniques and modifications that can be readily used according to the present invention are known in the field of oligonucleotides. The normal internucleoside linkage between nucleotides can be altered by mono- or dithiolation of the phosphodiester linkage to produce phosphorothioate ester or phosphorodithioate ester, respectively. Other modifications of the internucleoside linkage are possible, including amidation and peptide linkers. In certain embodiments, the AON of the present invention comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides.
[0090] It is known in the art that RNA editors (e.g., human ADAR enzymes) edit dsRNA structures with various specificities depending on several factors. One important factor is the degree of complementarity of the two strands that make up the dsRNA sequence. When the two strands are fully complementary, the catalytic domain of human ADAR usually reacts with all adenosines it encounters, causing non-discriminatory deamination of adenosines. The specificities of hADAR1 and 2 can be enhanced by introducing chemical modifications and / or ensuring multiple mismatches within the dsRNA, which is presumed to help arrange the dsRNA binding domain in a still not clearly defined form. Furthermore, by providing an AON containing a mismatch opposite the adenosine to be edited, the deamination reaction itself can be promoted. The mismatches disclosed herein are created by providing a targeting moiety having a nucleoside analog opposite the 5′-G of the target adenosine. By following the teachings of this application, one of ordinary skill in the art can design the complementary portion of the oligonucleotide according to its needs.
[0091] The most interesting intracellular RNA editing protein used in conjunction with the AONs of the present invention is human ADAR2. It will be understood by those of ordinary skill in the art that to what extent the intracellular editor is redirected to other target sites can be regulated by changing the affinity of the AON's editing molecule recognition domain. The modifications themselves can be determined through some trial and error and / or through computational methods based on the structural interactions between the AON and the recognition domain of the editing molecule. Additionally, or alternatively, the degree of mobilization and redirection of the intracellular editor can be regulated by the dosage and dosing regimen of the AON. This is usually determined by an experimenter (in vitro) or a clinician, typically in phase I and / or phase II clinical trials.
[0092] The present invention relates to the modification of target RNA sequences in eukaryotic cells, preferably metazoans, more preferably mammals, and most preferably human cells. The present invention can be used in cells of any organ, such as skin, lung, heart, kidney, liver, pancreas, intestine, muscle, gland, eye, brain, blood, etc. The present invention is particularly suitable for modifying sequences in cells, tissues, or organs involved in the diseased state of a (human) subject. The cells can be located in vitro, ex vivo, or in vivo. One advantage of the present invention is that it can be used in cells in situ in vivo, but can also be used in cultured cells. In some embodiments, the cells are treated ex vivo and then introduced into the body (e.g., reintroduced into the body from which they originally originated). The present invention can also be used for editing target RNA sequences in transplanted cells or cells in so-called organoids. Organoids are considered three-dimensional in vitro-derived tissues, but are driven to generate individual isolated tissues using specific conditions. In a therapeutic scenario, organoids are generated in vitro from a patient's cells and are useful as autologous material that is less likely to be rejected than normal transplants and are then reintroduced into the patient. The cells to be treated generally have genetic mutations. The mutations can be heterozygous or homozygous. The present invention is typically used to modify point mutations such as mutations from N to A (where N can be G, C, U (T at the DNA level)), preferably mutations from G to A, or mutations from N to C (where N can be A, G, U (T at the DNA level)), preferably mutations from U to C.
[0093] Without wishing to be bound by theory, RNA editing through hADAR2 is thought to occur on primary transcripts in the nucleus during transcription or splicing, or in the cytoplasm, for example, where mature mRNA, miRNA, or ncRNA can be edited.
[0094] Many genetic diseases are caused by G-to-A mutations, which are preferred as target diseases. This is because adenosine deamination at the mutated target adenosine reverses the mutation to a codon that yields a functional, full-length, wild-type protein, especially in the case of PTC. Mutations in which the target adenosine has a 5′-G within the target sequence can be particularly targeted by the AONs of the present invention.
[0095] It should be apparent that the target editing according to the present invention can be applied to any adenosine, whether it is a mutant nucleotide or a wild-type nucleotide. For example, the editing can be used to create RNA sequences with different properties. Such properties can be coding properties (creating proteins with different sequences or lengths and changing the properties or functions of the proteins), or binding properties (causing inhibition or overexpression of the RNA itself or of the target or binding partner; the overall expression pathway can be changed by recoding the miRNA or the corresponding sequences on the target RNA). The function or localization of a protein can be freely altered by functional domains or recognition motifs (including, but not limited to, signal sequences, targeting or localization signals, recognition sites for proteolytic cleavage or co-translational or post-translational modifications, catalytic sites of enzymes, binding sites for binding partners, signals for degradation or activation, etc.). These and other forms of "engineering" of RNA and proteins are encompassed by the present invention for use in medicine or biotechnology as diagnostics, prophylaxis, therapy, research tools, or otherwise, whether for the purpose of preventing, delaying, or treating a disease or for any other purpose.
[0096] The amount of AON administered, the dosage, and the dosing regimen can vary depending on the cell type, the disease being treated, the target population, the mode of administration (e.g., systemic or local), the severity of the disease, and the acceptable level of side effects, but these can be evaluated by trial and error during in vitro studies, preclinical, and clinical trials and should be evaluated. The test is particularly simple when the modified sequence causes an easily detectable phenotypic change. Higher doses of AON may compete for binding to ADAR within the cell, thereby depleting the amount of entities that are free to participate in RNA editing, but such effects for a given AON and a given target will be revealed by periodic dosing studies.
[0097] One appropriate test technique involves delivering the AON to a cell line or test organism and then taking biopsy samples at various time points. The sequence of the target RNA in the biopsy sample is evaluated so that the proportion of cells with the modification can be easily tracked. Once this test has been performed, knowledge is retained thereafter and subsequent deliveries can be made without the need to take biopsy samples. Thus, the method of the present invention can include the step of identifying that a desired change exists within the target RNA sequence of the cell, thereby verifying that the target RNA sequence has been modified. This step typically includes, as described above, sequencing the relevant portion of the target RNA, or its cDNA copy (or, if the target RNA is pre-mRNA, the cDNA copy of its splicing product), so that sequence changes can be easily verified. Alternatively, the change can be evaluated based on the protein level (length, glycosylation, function, etc.) or by some functional readout (e.g., if the protein encoded by the target RNA sequence is an ion channel, the (induced) current, etc.).
[0098] After RNA editing occurs intracellularly, the modified RNA may be diluted over time, for example, by cell division of the edited RNA, its limited half-life, etc. Thus, from the perspective of actual treatment, the method of the present invention may include repeatedly delivering the AON until sufficient target RNA is modified in order to provide a tangible benefit to the patient and / or to maintain that benefit over time.
[0099] The AONs of the present invention are particularly suitable for therapeutic use, and thus the present invention provides a pharmaceutical composition comprising an AON of the present invention and a pharmaceutically acceptable carrier. In some embodiments of the present invention, the pharmaceutically acceptable carrier may simply be a salt solution. This may be useful for being isotonic or hypotonic, particularly for pulmonary delivery. The present invention also provides a delivery device (e.g., a syringe, inhaler, nebulizer) comprising the pharmaceutical composition of the present invention.
[0100] The present invention also provides an AON of the present invention for use in a method for effecting a change in a target RNA sequence in a mammalian, preferably human, cell as described herein. Similarly, the present invention provides the use of an AON of the present invention in the manufacture of a medicament for effecting a change in a target RNA sequence in a mammalian, preferably human, cell as described herein.
[0101] The present invention also relates to a method for deaminating at least one specific target adenosine present within a target RNA sequence in a cell, said method comprising the following steps: providing an AON according to the present invention to said cell; causing said cell to take up said AON; annealing said AON to said target RNA molecule; enabling a mammalian ADAR enzyme comprising a natural dsRNA binding domain found in the wild-type enzyme to deaminate said target adenosine within said target RNA molecule to inosine; comprising, and may further comprise the step of identifying the presence of said inosine within said RNA sequence.
[0102] In a preferred embodiment, depending on the final deamination effect due to the conversion from A to I, the identification step comprises the following: sequencing the target RNA; evaluating the presence of functional, extended, full-length, and / or wild-type proteins; evaluating whether the splicing of pre-mRNA has changed due to the deamination; or using a functional readout; wherein the target RNA after the deamination encodes a functional, full-length, extended, and / or wild-type protein. Since deamination of adenosine to inosine can result in a protein that is no longer adversely affected by the mutated A at the target position, the identification of deamination to inosine can also be a functional readout. For example, when evaluating whether a functional protein is present, or even when evaluating that a disease caused by the presence of adenosine has (partially) recovered. The functional evaluation for each disease mentioned herein generally follows methods well known to those skilled in the art. Methods that are very suitable for identifying the presence of inosine after deamination of the target adenosine are of course RT-PCR and sequencing using methods well known to those skilled in the art.
[0103] The AON according to the present invention is suitably administered in an aqueous solution (e.g., a salt solution) or suspension, and may contain additives, excipients, and other components suitable for pharmaceutical use, and the concentration thereof is in the range of 1 ng / ml to 1 g / ml, preferably 10 ng / ml to 500 mg / ml, more preferably 100 ng / ml to 100 mg / ml. The dosage may suitably be in the range of about 1 μg / kg to about 100 mg / kg, preferably about 10 μg / kg to about 10 mg / kg, more preferably about 100 μg / kg to about 1 mg / kg. Administration can be carried out by inhalation (e.g., through a nebulizer), intranasal, oral, injection or infusion, intravenous, subcutaneous, intradermal, intracranial, intravitreal, intramuscular, intratracheal, intraperitoneal, rectal, parenteral, etc. Administration can be carried out in the form of solid agents, powders, tablets, gels, eye drops, solutions, sustained-release preparations, or any other form suitable for human pharmaceutical use.
[0104] The content of all cited documents (including documents, patents, patent applications, and websites) that may be cited throughout this application is hereby expressly incorporated by reference in its entirety for any purpose, and the documents cited within the cited documents are the same, and they are based on the version publicly available on January 25, 2023. Protein and nucleic acid sequences identified by database accession numbers, and other information included in the target database entries (e.g., content not related to the sequence within the database entry corresponding to a specific Genbank accession number) are incorporated by reference, and these are based on the corresponding database release publicly available on January 25, 2023.
Examples
[0105] [Example 1: General Biochemical Procedures] Bovine serum albumin (BSA) and ribonuclease inhibitor were purchased from New England BioLabs. SDS-polyacrylamide gels were visualized using a Molecular Dynamics 9400 Typhon phosphorimager. Data were analyzed using Molecular Dynamics ImageQuant 5.2 software. All MALDI analyses were performed using a Bruker UltraFlextreme MALDI TOF / TOF mass spectrometer. The mass of oligonucleotides was measured using Mongo Oligo Calculator v2.08. Oligonucleotides for sequencing and PCR were purchased from Integrated DNA Technologies or Dharmacon. All other oligonucleotides were synthesized as described below.
[0106] [Synthesis of Oligonucleotides] The chemical synthesis of all oligonucleotides was performed using an ABI 394 synthesizer. All protected phosphoramidites were purchased from Glen Research, except for the 8-azanebuline (azaN) phosphoramidite, which was purchased from Berry & Associates. Nucleosides were incorporated at a 0.2 or 1.0 μmol scale during the appropriate cycle. Immediately after completion of the synthesis, the column was evaporated under reduced pressure for 4 h. All oligonucleotides were cleaved from the solid support by treatment with 1:3 ethanol / 30% NH4OH at 55 °C for 12 h. The supernatant was transferred to a new screw-cap tube and evaporated under reduced pressure. For all oligonucleotides except the azaN-modified strand, desilylation was performed by resuspending the pellet in anhydrous DMSO and treating with TBAF-THF overnight (O / N) at room temperature. For the azaN strand, desilylation was performed in TEA·3HF as previously reported (Haudenschild B.L. et al. J. Am. Chem. Soc., 2004. 126:11213-11219). 75 mM sodium acetate in butanol was added to each reaction. The oligonucleotide was then precipitated from the 65% butanol solution at -70 °C for 2 h. The solution was centrifuged at 13000 rpm for 20 min, the supernatant was removed, and the pellet was washed twice with cold 95% ethanol. The RNA pellet was then desalted and purified using a Sephadex G-25 column. Single-stranded RNA oligonucleotides were purified by denaturing polyacrylamide gel electrophoresis and visualized by UV shadowing. Bands were excised from the gel, crushed, and soaked overnight at 4 °C in 0.5 M NaOAc, 0.1% sodium dodecyl sulfate (SDS), and 0.1 mM EDTA. Polyacrylamide fragments were removed with a 0.2 μm filter, and the RNA was precipitated from the 75% EtOH solution at -70 °C for 4 h. The solution was centrifuged at 13000 rpm for 20 min, and the supernatant was removed. The RNA solution was lyophilized to dryness, resuspended in nuclease-free water, and quantified by absorbance at 260 nm. The mass of the oligonucleotide was confirmed by MALDI-TOF.
[0107] [Preparation of double-stranded substrates for crystal structure analysis] For crystal structure analysis, unmodified RNA strands were purchased from Horizon Dharmacon and purified as described above. Double-stranded RNA was hybridized by heating at 95 °C for 5 minutes and slowly cooling to 30 °C in a 1:1 ratio in water.
[0108] [In vitro transcription of edited target RNA] Target RNA for deamination kinetics analysis was transcribed from a DNA template using the MEGAScript T7 Kit (ThermoFisher). DNA digestion was performed using RQ1 RNase-free DNase (Promega). The deoxyribonuclease-treated RNA product was purified as described above.
[0109] [Preparation of double-stranded substrates for ADAR deamination kinetics] The purified guide and transcribed RNA were added to a hybridization buffer (180 nM transcribed RNA target, 1.8 μM guide, 1X TE buffer, 100 mM NaCl) in a 10:1 ratio, heated at 95 °C for 5 minutes, and slowly cooled to room temperature.
[0110] [Expression and purification of human ADAR2 constructs for deamination kinetics] Human ADAR2 (hADAR2) was overexpressed in budding yeast (S. cerevisiae) (previously reported in Macbeth M.R. and B.L. Bass. Methods Enzymol. 2007. 424:319-331). Purification of hADAR2 was performed by disrupting cells using a French press in a buffer containing 20 mM Tris-HCl (pH 8.0), 5% glycerol, 1 mM BME, 750 mM NaCl, 35 mM imidazole, and 0.01% Nonidet P-40. The cell lysate was clarified by centrifugation (19,000 rpm for 1 hour). The lysate was passed through a 3 mL Ni-NTA column and then washed in three steps with 20 mL of lysis buffer, Wash I buffer (20 mM Tris-HCl (pH 8.0), 5% glycerol, 1 mM BME, 750 mM NaCl, 35 mM imidazole, 0.01% Nonidet P-40), and Wash II buffer (20 mM Tris-HCl (pH 8.0), 5% glycerol, 1 mM BME, 35 mM imidazole, 500 mM NaCl), and eluted with 20 mM Tris-HCl (pH 8.0), 5% glycerol, 1 mM BME, 400 mM imidazole, 100 mM NaCl. Fractions containing the target protein were pooled and concentrated to 30 - 80 μM for use in biochemical assays. Protein concentration was measured using a BSA standard visualized by SYPRO Orange staining of SDS-polyacrylamide gels. Purified wild-type hADAR2 was stored at -70 °C in 20 mM Tris-HCl (pH 8.0), 100 mM NaCl, 20% glycerol, and 1 mM BME.
[0111] [Expression and Purification of ADAR1 p110 for Deamination Kinetics] The MBP-tagged human ADAR1 p110 construct was cloned into the pSc vector using standard PCR techniques. The resulting construct (yeast codon-optimized) consisted of an N-terminal MBP tag, a tobacco etch virus (TEV) protease cleavage site, followed by the human ADAR1 p110 gene. Budding yeast BCY123 cells were transformed with this plasmid, and the fusion protein was overexpressed (as described in Malik T.N. et al. Nucleic Acids Res. 2021. 49:4020-4036). Purification was performed by disrupting the cells using a microfluidizer in a lysis / binding buffer containing 50 mM Tris-HCl (pH 8.0), 5% glycerol, 5 mM 2-mercaptoethanol, 1000 mM KCl, 0.05% NP-40, and 50 μM ZnCl2. The cell lysate was clarified by centrifugation (39000×g for 50 minutes). The lysate was passed through a 2 mL NEB amylose column (pre-equilibrated with the binding buffer), followed by two-step washing with 50 mL of the binding buffer and then 100 mL of the wash buffer (50 mM Tris-HCl (pH 8.0), 5% glycerol, 5 mM 2-mercaptoethanol, 500 mM KCl, 0.01% NP-40, and 50 μM ZnCl2), and elution with a buffer containing 50 mM Tris-HCl (pH 8.0), 10% glycerol, 5 mM 2-mercaptoethanol, 500 mM KCl, 0.01% NP-40, 50 μM ZnCl2, and 20 mM maltose. The fractions containing the target protein were pooled and dialyzed against a storage buffer containing 50 mM Tris-HCl (pH 8.0), 400 mM KCl, 0.5 mM EDTA, 0.01% NP-40, 10% glycerol, and 1 mM tris(2-carboxyethyl)phosphine. The dialyzed protein was concentrated to 2 - 50 μM and stored as aliquots at -70 °C until use in future biochemical assays. Protein concentration was measured using a BSA standard visualized by SYPRO Orange staining of SDS-polyacrylamide gels.
[0112] [Deamination Assays Using ADAR2 and ADAR1 p110] Deamination assays were performed in 15 mM Tris-HCl (pH 7.5), 3% glycerol, 60 mM KCl, 1.5 mM EDTA, 0.003% Nonidet P-40, 3 mM MgCl2, 160 U / mL RNAsin, 1.0 μg / mL yeast tRNA, 10 nM RNA, and 75 nM human ADAR2 under single-turnover conditions. Each reaction solution was incubated at 30 °C for 30 minutes before adding the enzyme. The reactions were incubated at 30 °C for various times and then stopped using 190 μL of 95 °C water and heated at 95 °C for 5 minutes. cDNA was generated using the reaction products with RT-PCR (Promega Access RT-PCR System). DNA was purified using the DNA Clean&Concentrator kit (Zymo) and subjected to Sanger sequencing using GeneWiz (Azenta). Sequencing peak heights were quantified with SnapGene (Domatics). For ADAR2, the data were fit to the equation [P]t = Pf * [1 - e^(-kobs * t)]. Here, [P]t is the percentage of editing at time t, [P]f is the final value of editing, and kobs is the observed rate constant. For ADAR1 p110, since the reaction was slower and the final reaction value was lower, the data were fit to the equation [P] t = 0.4 * [1 - e^(-k obs * t)]. Each experiment was performed in triplicate, and the k obsare the mean ± standard deviation (SD) of each trial. Statistical significance between groups was determined by one-way analysis of variance (ANOVA) using Prism software (GraphPad). For the ADAR1 p110 enzyme, the deamination reaction was performed as described above, with the following changes: the final reaction solution for ADAR1 p110 contained 15 mM Tris-HCl (pH 7.0), 4% glycerol, 26 mM KCl, 40 mM potassium glutamate, 1.5 mM EDTA, 0.003% Nonidet P-40, 160 U / mL RNAsin, 1.0 μg / mL yeast tRNA, and 10 nM RNA, and 250 nM ADAR1 p110.
[0113] [Expression and Purification of the hADAR2 Double-Stranded RNA-Binding Domain and Deaminase Domain (hADAR2-R2D) for Crystal Structure Analysis] Protein expression and purification were performed by modifying the previously reported protocol (Macbeth M.R. et al. RNA 2004. 10:1563-1571). Budding yeast BCY123 cells were transformed with the pSc-ADAR construct encoding hADAR2-R2D E488Q (corresponding to residues 214 - 701). Cells were streaked onto uracil-deficient yeast minimal medium (CM-ura) plates. A single colony was used to inoculate a 15 mL CM-ura starter culture. After the culture was shaken overnight at 300 rpm and 30 °C, 10 mL of the starter culture was used to inoculate per liter of yeast growth medium. After the cells reached an OD600 of 1.5 (approximately 20 - 24 hours), the cells were induced with 110 mL of sterile 30% galactose per liter, and the protein was expressed for 6 hours. The cells were harvested by centrifugation at 5000×g for 10 minutes and stored at -80 °C. The cells were lysed using a microfluidizer in Buffer A containing 750 mM NaCl (20 mM Tris-HCl (pH 8.0), 5% glycerol, 35 mM imidazole, 1 mM BME, and 0.01% Triton X-100). The cell lysate was clarified by centrifugation (39000×g for 25 minutes). The lysate was passed through a 5 mL Ni-NTA column equilibrated with Buffer A containing 750 mM NaCl, and then washed in three steps using 50 mL of lysis buffer, Wash I buffer (Buffer A + 300 mM NaCl), and Wash II buffer (Buffer A + 100 mM NaCl). The protein was eluted in Wash II buffer at a flow rate of 1 mL / min for 80 minutes using a 35 - 300 mM imidazole gradient. Fractions containing the target protein were pooled and further purified using a 2 mL GE Healthcare Lifesciences Hi-Trap Heparin HP column in Wash II buffer without BME. The His10 fusion protein was washed using 50 mL of Wash II buffer without BME and eluted at a flow rate of 0.8 mL / min for 60 minutes using a 100 - 1000 mM NaCl gradient.The fraction containing the target protein was pooled and cleaved at an optimal ratio of 1 mg of TEV protease per 1 mg of protein. Cleavage was performed for 2 hours at room temperature without stirring, after which the product was passed through another Ni-NTA column at a flow rate of 0.5 mL / min. The flow-through and wash were collected and passed through another Ni-NTA column to remove the remaining uncleaved protein. The flow-through and wash were collected and dialyzed against 20 mM Tris (pH 8.0), 200 mM NaCl, 5% glycerol, and 1 mM BME, and then concentrated to less than 1 mL for gel filtration on a GE Healthcare HiLoad 16 / 600 Superdex 200 PG column. The fractions containing the purified protein were pooled and concentrated to 7 - 9 mg / mL for crystallization trials.
[0114] [Crystallization of hADAR2-R2D E488Q-(GG)RNA complex] Crystals of the hADAR2-R2D E488Q-GLI1(GG)RNA complex were grown at room temperature by the hanging-drop vapor diffusion method. A 0.5 μL solution containing 5.6 mg / ml of protein and 47.5 μM Gli1-GG RNA was mixed with 0.5 μL of 50 mM MOPS (pH 7.0), 200 mM NaCl, 17% PEG4000. It took one and a half weeks for the crystals to grow. The crystal clusters were dissected, and cubic single crystals of approximately 100 μm in size were briefly immersed in a solution with 30% ethylene glycol added to the original solution and then rapidly cooled in liquid nitrogen. Data were collected by wide-φ slicing with an oscillation angle of 1.0° at beamline 12-2 of the Stanford Synchrotron Radiation Lightsource. The crystals showed anisotropic X-ray diffraction, and some diffraction exceeded 2.2 Å resolution. To create a robust complete data set, the resolution was isotropically truncated to 2.8 Å resolution.
[0115] [Processing and refinement of crystallographic data] Diffraction data of the ADAR2-R2D E488Q GLI1(GG) complex structure were processed using XDS and scaled using XSCALE. The hADAR2d GLI1 complex crystal structure (PDB: 5ED2) was used as a model for molecular replacement by PHENIX. The structure was refined using PHENIX, including NCS and zinc coordination restraints. The ideal zinc-ligand distance was determined using the average distance found in similar coordination models within the PDB database, including the deposited ADAR2 structure. The asymmetric unit contains two protein molecules complexed with RNA. The entire double-stranded RNA binding domain of monomer A (residues 215 - 318), and the C-terminal residues 700 and 701 were disordered and not included in the model. The first 20 residues (215 - 233), the 5′-binding loop residues (462 - 475), and the C-terminal proline (701) of monomer B were disordered and not included in the model.
[0116] [Example 2: Acceleration of deamination rates of full-length ADAR2 and ADAR1 p110 through G-G or G-A pairs adjacent to the editing site] In a prior report describing the optimization of guide strands for SNAP-ADAR (the ADAR deaminase domain is fused to the SNAP tag and covalently binds to the guide oligonucleotide), it was shown that by pairing the 5′-G in the 5′-GAG target codon with an A or G in the guide oligonucleotide, the editing efficiency is improved compared to G:C or G:U pairs at that site (Schneider M.F. et al. 2014). Since this position within the RNA substrate is contacted by the ADAR deaminase domain and not by the dsRBD, it was thought that this effect would also be observed with full-length ADAR. However, at the time of the present invention, no such publications were available. WO2021 / 130313 shows an AON that functions as a guide oligonucleotide targeting adenosine in the c.5882G>A mutation of the human ABCA4 gene that causes Stargardt disease. This mutation has a 5′-G adjacent to the target adenosine and thus has an unfavorable GA arrangement. However, all of the AONs tested in that publication contained a thymidine (dT), 2′-O-methyl modified adenosine (a), or deoxyadenosine (dA) that paired opposite the 5′-G. Accordingly, the inventors of the present invention designed model unmodified RNA substrates for ADAR1 and ADAR2, where the target adenosine was within the 5′-GA-3′ sequence and the base pairing partner of the 5′-G in the guide oligonucleotide (3′ side of the single nucleotide) was varied (X = U, A, G, or C) (see Figure 1A). The guide oligonucleotide was also all RNA except at the positions shown in the tables and figures. The target adenosine (A) was paired with 2′-deoxycytidine (Figure 1A) or cytidine (Figure 1E). The efficiency of each ADAR reaction was then evaluated by measuring the deamination rate constant under single turnover conditions (see Tables 1 and 2). Similar to SNAP-ADAR, G:G and G:A pairs deaminated adenosine faster than G:U or G:C. For the sequence shown in Figure 1A, ADAR2 deaminated the substrate with the G:G pair at the fastest rate.However, for ADAR1 p110, substrates with G:A and G:G pairs had similar rates, but were still significantly faster compared to G:U and G:C substrates. For comparison, the rates of the ADAR2 reaction were also measured under conditions where the rates of each of these substrates could be accurately measured, using similar substrate RNAs with 5′U paired with A (which is the ideal 5′ nearest neighbor base pair: Figure 1D). Substrates with ideal nearest neighbor nucleotides reacted faster, but the ADAR2 reaction rate for the 5′G:G substrate was less than two-fold different under these conditions (Table 1). Importantly, the deamination rate of the 5′-G:C substrate was 16-fold slower compared to the ideal substrate under these conditions.
[0117] JPEG2025524566000010.jpg102166 Table 1. Rate constants for in vitro deamination of model RNA substrates (derived from the human IDUA transcript) by ADAR2 and ADAR1 p110. Sequences are the same as those shown in Figure 1A. a Values when 100 nM of ADAR2 acts on 10 nM of RNA. b Values when 250 nM of ADAR1 p110 acts on 10 nM of RNA. c Values when 10 nM of ADAR2 acts on 1 nM of RNA substrate. Y:X indicates base pairing adjacent to the editing site. d ADAR2 data were fit to the equation [P]t = α[1 - exp(-k obs ·t)]. ADAR1 p110 data were fit to the equation [P]t = 0.4·[1 - exp(-k obs ·t)]. e k rel = k for different nucleosides at the Y:X position obs / k for Y:X = G:C obs (for each of conditions a, b, and c).
[0118] Notably, the effect of the G:G pair was not limited to the 5′-GAG′-3′ target sequence. The substrate sequence shown in Fig. 1E (derived from the human MECP2 transcript) has the target adenosine within the 5′-GAA-3′ sequence, and the ADAR2 reaction with the 5′-G:G substrate was nearly 8-fold faster in this sequence context compared to the 5′-G:C substrate (Table 2). As a conclusion, these results confirm the effects of the G:G and G:A pairs in activating editing at the 5′-GA site of full-length ADAR in vitro.
[0119] JPEG2025524566000011.jpg50166 Table 2. In vitro deamination rate constants when 100 nM ADAR2 acts on 10 nM wild-type MECP2 substrate. The sequences are the same as those shown in Fig. 1E. X represents the nucleotide at the -1 position within the AON. a The data were fitted to the equation [P]t = α[1 - exp(-k obs ·t)]. b k rel = k for different nucleosides at the X position obs / k for X = C obs .
[0120] [Example 3: ADAR2 binds to double-stranded RNA substrates with a G (syn) :G (anti) pair adjacent to the editing site] The inventors speculated that the G:G or G:A pairs on the 5′ side of the editing site might be superior in two possibilities to the 5′ G:C pair in terms of deamination of adjacent adenosine by ADAR. First, since ADAR needs to distort double-stranded RNA and flip adenosine out of the double helix, the purine:purine pair adjacent to the editing site might destabilize the double strand and facilitate the necessary conformational changes. On the other hand, the combinations of G:G and G:A form stable hydrogen bond pairs, and their minor groove structures might be more compatible with ADAR binding compared to the minor groove structure of the Watson-Crick type G:C pair. Indeed, multiple different hydrogen-bonding G:G and G:A pairs have been observed in the high-resolution structures of RNA (Leontis N.B. and E. Westhof. RNA 2001. 7:499-512). The inventors inferred that knowledge of the nature of purine:purine interactions could provide information regarding the design and use of nucleoside analogs to enable ADAR editing within the 5′-GA sequence in target RNA molecules. Therefore, to gain a deeper understanding of the structure of the ADAR-RNA complex with a G:G pair adjacent to the editing site, the inventors focused on X-ray crystallographic analysis. A 32-bp double strand with 8-azaneplanocin A (N) at a known editing site (see Matthews et al. 2016) was designed to capture the ADAR-binding complex (see Figure 2A). The use of 8-azaneplanocin A (N) at the editing site enabled a stable ADAR-RNA structure in a catalytically relevant state for structural studies. When N is appropriately positioned within the ADAR substrate RNA, ADAR promotes its covalent hydration and forms a structure that mimics the transition state of adenosine deamination (Matthews et al. 2016; Haudenschild et al. 2004). A G:G pair adjacent to N was introduced, and its interaction with ADAR2 RD E488Q was evaluated. In previous studies, this combination of the ADAR2 mutant and the RNA double strand was found to be suitable for studies by X-ray crystallographic analysis (Thuy-Boun A.S. et al. Nucleic Acids Res. 2020. 48(14):7958-7972).ADAR2 RD E488Q was found to form a distinct complex with this duplex in EMSA gels, with K. d = 6 ± 2 nM (Figure 2B). Using a 32 bp 8-azaneplanocin-containing duplex together with the G:G pair and ADAR2-R2D E488Q, it was found possible to form protein / RNA crystals that diffracted X-rays at a resolution better than 2.8 Å. As previously observed, the protein binds to the RNA as an asymmetric dimer, with the deaminase domain of one monomer involved in direct RNA binding to the flipped-out N nucleosides (crystal structure not shown). Importantly, the G:G adjacent to the editing site was clearly resolved in the electron density, which syn is most consistent with a G anti :G syn pair. Here the guanosine on the 5′ side of N is in the syn conformation, and its Hoogsteen face accepts two hydrogen bonds from the Watson-Crick face of the guanosine on the opposing strand (Figure 2C). The guanosine on the opposing strand is in the anti conformation. G:G pairing involves hydrogen bonds from N1 to O6 and from the 2-amino group to N7, which are also seen in other G anti :G syn pairs in RNA (Burkhard M.E. and D.H. Turner. Biochemistry 2000. 39:11748-11762; Jiang F. et al. Nature 1996. 382:183-186). This orientation of the pairing places the 2-amino group of the guanosine in the strand to be edited within the major groove, avoiding potential clashes with ADAR (Figure 3A; arrow indicates the position of the 2-amino group). Indeed, the minor groove edge of the G anti :G
[0121] [Example 4: Further improvement of editing efficiency using nucleoside analogs that pair with 5′-G] The inventors of the present invention inferred that, due to the clear observation of the G syn :G anti pair within the ADAR-RNA complex, the deamination efficiency could be further adjusted using chemical modification of the nucleoside opposite to 5′-G. To verify this, the first seven 29-nt (nucleotide) ADAR guide oligonucleotides were created, which differed at this position and contained multiple different nucleoside analogs (see Figure 4A). Here, X = guanosine (G), adenosine (A), 2′-deoxyguanosine (dG), 2′-deoxyadenosine (dA), 7-deaza-2′-deoxyguanosine (7-deaza dG), 8-bromo-2′-deoxyguanosine (8-bromo dG), or 3-deaza-2′-deoxyadenosine (3-deaza dA). The analogs selected for testing have different preferred sugar puckers, conformations, and hydrogen bonding abilities. The guide RNA sequence was designed to recruit ADAR and induce editing that has the potential to correct the premature stop codon generated by the R255X mutation of the MECP2 gene associated with Rett syndrome. The disease-related C-to-T mutation results in a UGA stop codon within the MECP2 transcript. Although the wild-type sequence (CGA) cannot be restored by ADAR editing, converting the stop codon to a codon for tryptophan (UGG) leads to the expression of the full-length R255W (although it is a mutant) MECP2 protein. Using RNA transcripts containing the modified guide and the MECP2 R255X sequence, an RNA duplex was formed, and the rate constant of deamination at the target adenosine by ADAR2 was measured under single-turnover conditions (Table 3).
[0122] JPEG2025524566000012.jpg73166Table 3. In vitro deamination rate constants when 100 nM ADAR acts on a 10 nM substrate (containing a nucleoside analog (X position) paired with 5′-G). The sequences are the same as those shown in FIGS. 1E and 4A. X = guanosine (G), adenosine (A), 2′-deoxyguanosine (dG), 2′-deoxyadenosine (dA), 7-deaza-2′-deoxyguanosine (7-deazadG), 8-bromo-2′-deoxyguanosine (8-bromodG), and 3-deaza-2′-deoxyadenosine (3-deazadA). a The data were fit to the equation [P]t = α[1 - exp(-k obs ·t)]. b k rel = k for different nucleosides at the X position obs / k for X = G obs .
[0123] Due to the slow reaction with ADAR1 p110, the rate with this substrate could not be accurately measured in vitro. As seen in the above sequences, ADAR2 reacts faster with substrates having G:G pairs compared to G:A pairs. The 2′-deoxy modification is well tolerated as both dG and dA assist the reaction with ADAR2. This is consistent with the 2′-endo type sugar conformation of G anti observed in the G:G pairs in the above structure. The largest differences in reaction rates were observed with base-modified purines. Both 7-deazadG and 8-bromodG caused very slow deamination reactions. This was not unexpected since, for example, 8-bromodG has a relatively "large" atom attached to carbon 8 of the base, creating sterically unfavorable conditions. This causes this nucleoside within the AON to adopt a syn conformation. Since syn-syn is predicted to be an unfavorable combination for interaction with ADAR and to result in inefficient editing, this analog was predicted to be inefficient, and it was as expected. On the other hand, 3-deazadA paired with 5′-G caused the fastest ADAR2 reaction.
[0124] The MECP2 R255X RNA duplex was an insufficient substrate for ADAR1 p110 in vitro. However, the inventors were able to measure the deamination rate of this enzyme using the model substrate shown in Figure 1A. Therefore, dG, dA, and 3-deaza dA were introduced at sites paired with 5'-G in this substrate RNA, and the rate constants of deamination by ADAR1 p110 were measured (Figures 5A - 5B; Table 4). Similar to ADAR2, it was revealed that ADAR1 p110 also deaminates the substrate having 3-deaza dA paired with 5'-G at the fastest rate.
[0125] JPEG2025524566000013.jpg64166Table 4. In vitro deamination rate constants when 250 nM of ADAR acts on 10 nM of substrate (containing nucleoside analogs (X position) paired with 5'-G). The sequence is the same as that shown in Figure 1A. X = guanosine (G), adenosine (A), 2'-deoxyguanosine (dG), 2'-deoxyadenosine (dA), and 3-deaza-2'-deoxyadenosine (3-deaza dA). a The data was fitted to the equation [P]t = 0.4·[1 - exp(-k obs ·t)]. b k rel = k for different nucleosides at the X position obs / k for X = G obs .
[0126] [Example 5: Further improvement of editing efficiency using nucleoside analogs that pair with 5'-G] An experiment similar to that outlined in Example 4 was performed using an additional set of ADAR guide oligonucleotides that differed at the X position and contained a plurality of different nucleosides, where X was one of the nucleotide analogs shown in FIG. 6. Again, the rate constants for deamination at the target adenosine by ADAR2 were measured under single-turnover conditions (see table in FIG. 7). FIG. 7 also shows the results of the table as a bar graph, indicating the more beneficial properties of the 7-deaza-purine nucleotide analog (7-deaza-2'-deoxyadenosine; 7-deazadA) compared to the 3-deazadA and other nucleotide analogs tested in Example 4.
[0127] [Conclusion] ADAR has an established preference for editing adenosines where the 5′-nearest neighbor base is U (or A), and is less likely to edit at sites where the 5′-nearest neighbor base is G (Eggington et al. 2011; Li J.B. et al. Science, 2009. 324(5931):1210-1213; Eifler T. et al. Biochemistry, 2013. 52(45):7857-7869). This limits the efficiency in the application of RNA editing for therapeutic purposes when the target adenosine has 5′-G (e.g., an immature UGA stop codon). Examples include those caused by the R168X, R255X, and R270X mutations of the MECP2 gene associated with Rett syndrome. Previously, from the structure of ADAR2 bound to RNA where the 5′-nearest neighbor base is U, it was revealed that a protein loop (i.e., amino acids S486 - G489) involved in stabilizing the flipped-out conformation occupies the minor groove of the RNA and spans three base pairs including the nearest neighbor nucleotide and the edited base (Matthews et al. 2016; Thuy-Boun et al. 2020; Monteleone L.R. et al. Cell Chem. Biol. 2019. 26:269-277; Doherty E.E. et al. J. Am. Chem. Soc. 2021. 143:6865-6876). The minor groove edge of the base pair containing the 5′-nearest neighbor base was juxtaposed with the protein backbone at G489. Modeling a G:C pair at this position (i.e., 5′-G) suggested that the 2-amino group of guanine in the minor groove would collide with the protein at G489. In previous studies, it has also been shown that substituting the U-A pair with a U-2-aminopurine (2AP) pair at this position results in an 80% decrease in the deamination rate, further indicating the adverse effect of the amino group in the minor groove at this position (Matthews et al. 2016). G syn :G antiInstead, this obvious steric hindrance problem is solved by changing the glycosidic bond angle at 5′-G from anti to syn and moving the problematic 2-amino group to the major groove where it does not collide with ADAR. This explanation of the effect of the G:G pair seems more likely compared to the simple effect that purine:purine mismatches destabilize the double strand and promote base flipping. This is particularly evident considering the fact that the structure of the purine pairing with 5′-G can have a very large impact on the observed rate enhancement. For example, a substrate with 7-deaza-dA paired with 5′-G reacts with ADAR2 more than 85 times faster than a substrate with 7-deaza-dG paired with 5′-G. Therefore, the G nearest to the 5′ of the editing site in the syn conformation syn :G anti pairing explains why the G:G pair on the 5′ side of the editing site promotes ADAR editing compared to G:C or G:U. However, pairing 5′-G with A also improves the rate of ADAR compared to G:C and G:U. Importantly, A can also form a stable pair with G in the syn conformation. When protonated at N1, AH+ can donate two hydrogen bonds to the Hoogsteen face of G, and G syn :AH+ anti forms a pair (Figure 4C) (Pan et al. 1999). The improvement in deamination rate observed when comparing 7-deaza-dA and 3-deaza-dA with dA paired with 5′-G is consistent with the formation of the G syn :AH+ anti pair. Protonation of the adenine ring is required for the N1H-N7 hydrogen bond of this pair (Figure 4C). The pKa values of N1 protonation for both 3-deazaadenosine (6.8) and 7-deazaadenosine (5.3) are substantially higher than that of adenosine (3.7), so this site is likely to retain protons available for hydrogen bonding in the deazaadenosine system under the conditions of the ADAR reaction. Interestingly, the opposite effect is observed when comparing 7-deaza-dG with dG. In this case, the pKa of N1H of 7-deazaguanosine (10.3) is higher compared to guanosine (9.5), so G syn :Ganti The N1H-O6 hydrogen bond in the base pair is weakened. In fact, previous studies have shown that replacing either guanosine in the G syn :G anti pair with 7-deazaguanosine significantly destabilizes double-stranded RNA, suggesting that this is at least partially due to the weaker N1H-O6 hydrogen bond formed by 7-deazaguanosine (Burkhard and Turner, 2000). Here, it has also been shown that 8-bromodG opposite the 5′-nearest G slows down the reaction of ADAR2. Considering that this nucleoside has a tendency to adopt a syn conformation that does not fit the type of G syn :G anti pair observed in the ADAR complex, this is not surprising (Ikehara M. et al., Biochemistry, 1972, 11(5):830-836).
[0128] In conclusion, the combination of deamination kinetics and structural studies described herein has identified a method for promoting ADAR editing at difficult 5′-GA sites. By using nucleosides that form hydrogen bonds with the Hoogsteen face of 5′-G and induce a syn conformation at this position in RNA, while not introducing additional groups that cause steric hindrance in the minor groove, efficient editing at these sites becomes possible.
[0129] Sequence Listing (all 5′→3′) SEQ ID NO: 1 (RNA) GGAGAACAACUCYAGGCAGAGGUCUCAAA (Y = U / G)
[0130] SEQ ID NOs: 2-4 (RNA and / or DNA) UUUGAGACCUCUGUCCXGAGUUGUUCUCC (SEQ ID NO: 2: X = U, G, C, A) (SEQ ID NO: 3: dA, dG) (SEQ ID NO: 4: 3-deaza-2′-deoxyadenosine (3-deazadA))
[0131] SEQ ID NO: 5 (RNA) CCGGCAGGAAGCGAAAAGCUGAGGCCGAC
[0132] SEQ ID NO: 6 (RNA and / or DNA) GUCGGCCUCAGCUUUCXGCUUCCUGCCGG (X = C / G)
[0133] SEQ ID NO: 7 (RNA) GCUCGCGAUGCGNGAGGGCUCUGAUAGCUACG (N = 8-azaneplanocin)
[0134] SEQ ID NO: 8 (RNA and / or DNA) CGUAGCUAUCAGAGCCCCCGGCAUCGCGAGC
[0135] SEQ ID NO: 9 (RNA) CCGGCAGGAAGUGAAAAGCUGAGGCCGAC
[0136] SEQ ID NOs: 10 to 24 (RNA and / or DNA) GUCGGCCUCAGCUUUCXGCUUCCUGCCGG (SEQ ID NO: 10: X = G, A) (SEQ ID NO: 11: X = dG, dA) (SEQ ID NO: 12: X = 7-deaza-2'-deoxyguanosine (7-deaza dG)) (SEQ ID NO: 13: X = 8-bromo-2'-deoxyguanosine (8-bromo dG)) (SEQ ID NO: 14: X = 7-deaza-2'-deoxyadenosine (7-deaza dA)) (SEQ ID NO: 15: X = 2'-ara-fluoroadenosine (FANA A)) (SEQ ID NO: 16: X = 2'-ara-fluoroguanosine (FANA G)) (SEQ ID NO: 17: X = 2'-fluoroadenosine (2'F-A)) (SEQ ID NO: 18: X = 2'-fluoroguanosine (2'-F-G)) (SEQ ID NO: 19: X = 2'-fluoro-inosine (2'F-I)) (SEQ ID NO: 20: X = 2'-deoxy-inosine (dI)) (SEQ ID NO: 21: X = 2'-OH-inosine (rI)) (SEQ ID NO: 22: X = 8-aza-inosine) (SEQ ID NO: 23: X = 1'-(2-amino-8-methyl-4-oxo-1,4-dihydro-6-quinazolinyl)-2'-deoxyribose (yC)) (SEQ ID NO: 24: X = 3-deaza-2'-deoxyadenosine (3-deaza dA))
Claims
1. An antisense oligonucleotide (AON) capable of forming a double-stranded nucleic acid complex with a target RNA molecule, wherein the double-stranded nucleic acid complex can recruit an adenosine deaminase to deaminate a target adenosine within the target RNA molecule, a nucleotide immediately 5′ to the target adenosine within the target RNA molecule is guanosine, and a nucleotide within the AON opposite the guanosine is a nucleotide analog capable of inducing a syn conformation of the guanosine, antisense oligonucleotide.
2. The AON according to claim 1, wherein at least one nucleotide or nucleotide analog within the AON comprises a substitution at the 2′ position of ribose, and the substitution is selected from the group consisting of: · H (DNA); · OH (RNA); · F; · ara-F · diF; · substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, which may be interrupted by one or more heteroatoms; · O-, S-, or N-alkyl; · O-, S-, or N-alkenyl; · O-, S-, or N-alkynyl; · O-, S-, or N-allyl; · O-alkyl-O-alkyl; · methoxy; · aminopropoxy; · methoxyethoxy; · dimethylaminooxyethoxy; and · dimethylaminoethoxyethoxy, provided that the nucleotide opposite the target adenosine does not contain a 2′-O-methyl or 2′-(2-methoxy)ethyl ribose modification, AON.
3. The AON according to claim 1 or 2, wherein the nucleotide analog comprises a modified nucleobase, AON.
4. The AON according to any one of claims 1 to 3, wherein the nucleotide analog comprises a modified purine nucleobase, AON.
5. The AON according to claim 4, wherein the modified purine nucleobase comprises a 7-deazapurine modification (e.g., 7-deazaadenine modification) or a 3-deazapurine modification (e.g., 3-deazaadenine modification), AON.
6. The AON according to claim 4 or 5, wherein the modified purine nucleobase comprises a hydrogen bond donor at N1 with a pKa higher than 3.7 and lower than 9.5, AON.
7. The AON according to any one of Claims 1 to 6, wherein the nucleotide analog is selected from the group consisting of: 7-deaza-2'-deoxyadenosine (7-deaza dA); 7-deaza-2'-adenosine (7-deaza A); 7-deaza-2'-deoxy-2'-fluoroadenosine (7-deaza fA); 7-deaza-2'-deoxy-2'-ara-fluoroadenosine; 7-deaza-2'-deoxy-2',2'-difluoroadenosine; 3-deaza-2'-deoxyadenosine (3-deaza dA); 3-deaza-2'-adenosine (3-deaza A); 3-deaza-2'-deoxy-2'-fluoroadenosine (3-deaza fA); 3-deaza-2'-deoxy-2'-ara-fluoroadenosine; 3-deaza-2'-deoxy-2',2'-difluoroadenosine; 3,7-dideaza-2'-deoxyadenosine (3,7-dideaza dA); 3,7-dideaza-2'-adenosine (3,7-dideaza A); 3,7-dideaza-2'-deoxy-2'-fluoroadenosine (3,7-dideaza fA); 3,7-dideaza-2'-deoxy-2'-ara-fluoroadenosine; 3,7-dideaza-2'-deoxy-2',2'-difluoroadenosine; 3-deaza-2'-O-[2-(methoxy)ethyl]adenosine; 3-deaza-2'-O-[2-methylamino-2-oxoethyl]adenosine; 2'-deoxy-2'-fluoroguanosine; 2'-ara-fluoroguanosine (FANA G); 2',2'-difluoroguanosine; 2'-deoxyinosine (dI); 2'-OH-inosine (rI); 2'-fluoroinosine (2'-F-I); 2'-ara-fluoroinosine (FANA I); 2',2'-difluoroinosine; 5-formylindole-2'-deoxyriboside; 5-formyl-2'-fluoro-2'-deoxyriboside; 5-formylindole-2'-ara-fluoro-2'-deoxyriboside; 5-formylindole-2',2'-difluoro-2'-deoxyriboside; 5-formylindole-2'-O-methylriboside; 5-formylindole-2'-O-[2-(methoxy)ethyl]riboside; 5-formylindole-2'-O-[2-methylamino-2-oxoethyl]riboside; β-(4-Amidino-1H-imidazol-1-yl)riboside; β-(4-Amidino-1H-imidazol-1-yl)2'-deoxyriboside; β-(4-Amidino-1H-imidazol-1-yl)2'-ara-fluoro-2'-deoxyriboside; and β-(4-Amidino-1H-imidazol-1-yl)2',2'-difluoro-2'-deoxyriboside; AON.
8. The AON according to any one of claims 1 to 7, wherein the adenosine deaminase is an endogenous ADAR enzyme, AON.
9. The AON according to any one of claims 1 to 8, wherein the AON contains at least one phosphorothioate (PS), phosphonoacetate, phosphoramidate, phosphorylguanidine, or methylphosphonate (MP) nucleotide internucleoside linkage, AON.
10. The AON according to any one of claims 1 to 9, wherein the AON contains at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotides and is at most 100 nucleotides in length, AON.
11. A pharmaceutical composition comprising the AON according to any one of claims 1 to 10 and a pharmaceutically acceptable carrier or diluent.
12. The AON according to any one of claims 1 to 10, or the pharmaceutical composition according to claim 11, for use in the treatment, amelioration, or delay of progression of a genetic disease caused by an immature UGA stop codon, AON or pharmaceutical composition.
13. A method for deaminating at least one target adenosine present in a target RNA molecule within a cell, wherein the nucleotide 5' to the target adenosine in the RNA molecule is guanosine, the method comprising the following steps: (i) providing to the cell the AON according to any one of claims 1 to 10, or the pharmaceutical composition according to claim 11; (ii) annealing the AON to the target RNA molecule to form a double-stranded nucleic acid complex capable of mobilizing an adenosine deaminase, preferably an endogenous adenosine deaminase, within the cell; (iii) enabling the adenosine deaminase to deaminate the target adenosine in the target RNA molecule; [[ID= Hurler syndrome, alpha-1-antitrypsin (A1AT) deficiency, (familial) hypercholesterolemia, Parkinson's disease, Rett syndrome, Stargardt disease, citrullinemia type 1, autosomal recessive nonsyndromic hearing loss, X-linked retinoschisis, argininosuccinate lyase deficiency, Duchenne / Becker muscular dystrophy, non-alcoholic steatohepatitis (NASH), myotonic dystrophy type 1, myotonic dystrophy type 2, Huntington's disease, Usher syndrome (e.g., Usher syndrome type 1, type 2, and type 3), Charcot-Marie-Tooth disease, cystic fibrosis, Alzheimer's disease, leukodystrophy, amyotrophic lateral sclerosis, asthma, beta-thalassemia, epileptic encephalopathy, CADASIL syndrome, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), dystrophic epidermolysis bullosa, epidermolysis bullosa, Fabry disease, factor V Leiden-related diseases, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, hereditary cancer predisposition syndromes, Hunter syndrome, inflammatory bowel disease (IBD), inherited polyagglutination syndrome, Leber congenital amaurosis, Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, neurofibromatosis, Niemann-Pick disease (type A, type B, and type C), NY-eso1-related cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary dyskinesia, prothrombin variant-related diseases (e.g., prothrombin G20210A variant), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Tay-Sachs disease, X-linked immunodeficiency, Sturge-Weber syndrome, and cancer (e.g., breast cancer and lung cancer); for use in the treatment of an AON or pharmaceutical composition.