Adeno-Associated Virus Delivery of CLN1 Polynucleotides
Recombinant adeno-associated virus vectors deliver CLN1 polynucleotides to treat CLN1-Batten disease, addressing the lack of therapeutic options by improving neurological symptoms through targeted gene therapy.
Patent Information
- Application Number
- JP2025500109
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-07-06
- Filing Date
- 2023-07-05
- Publication Date
- 2025-07-30
AI Technical Summary
There is currently no effective therapy to reverse the symptoms of CLN1-Batten disease, a severe neurodegenerative disorder caused by mutations in the CLN1 gene, which leads to developmental regression, seizures, and vision loss.
The use of recombinant adeno-associated virus (rAAV) vectors to deliver CLN1 polynucleotides, including specific promoters and polypeptides, to target regions of the central nervous system for gene therapy, administered via intrathecal, intracerebroventricular, or intravenous routes.
The rAAV delivery of CLN1 polynucleotides shows potential in reducing symptoms of CLN1-Batten disease by increasing clearance of lysosomal storage material and reducing astrocyte and microglia activation, thereby improving neurological function.
Smart Images

Figure 2025524569000001_ABST
Abstract
Description
Technical Field
[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 367,752, filed Jul. 6, 2022, which is hereby incorporated by reference in its entirety.
[0002] Incorporation by reference to the Sequence Listing This application contains a Sequence Listing in computer-readable form, which is hereby incorporated by reference in its entirety as a separate part of this disclosure and is identified as follows: 56756_Seqlisting.XML, size: 58,419 bytes, created on Jul. 3, 2023.
[0003] The present disclosure relates to recombinant adeno-associated virus (rAAV) delivery of neuronal ceroid lipofuscinosis neuronal 1 (CLN1) polynucleotides. The present disclosure provides rAAV and methods of using rAAV for CLN1 gene therapy of neuronal ceroid lipofuscinosis (NCL) or CLN1-Batten disease.
Background Art
[0004] Neuronal ceroid lipofuscinosis (NCL) is a group of severe neurodegenerative disorders collectively referred to as Batten disease. These disorders affect the nervous system and typically cause a worsening of problems with vision, movement, and thinking abilities. The various NCLs are distinguished by their genetic causes.
[0005] CLN1-Batten disease is an inherited autosomal recessive disorder caused by mutations in the CLN1 gene (also known as the PPT1 gene). The CLN1 gene encodes a 306-amino acid protein, palmitoyl-protein thioesterase 1 (PPT1). PPT1 is a lysosomal enzyme involved in the removal of palmitic acid residues from proteins. PPT1 is also associated with important cellular pathways including synapse formation and maintenance, endosomal trafficking, and lipid metabolism (Johnson et al., Nat Rev Neurol. 2019 Mar;15(3):161-178).
[0006] The classical onset of CLN1-Batten disease is at 1 year of age and is associated with irritability, developmental arrest and rapid regression, deceleration of head circumference growth, hypotonia, myoclonic seizures, and progressive vision loss with optic nerve atrophy (Johnson et al., Nat Rev Neurol. 2019 Mar;15(3):161-178). However, some children with CLN1 mutations develop symptoms of Batten disease after infancy, around 5 or 6 years of age. Children with CLN1 disease have decreased muscle tone (hypotonia), intellectual and motor disabilities, and are rarely able to speak or walk. Some affected children develop repetitive hand movements. By 2 years of age, individuals with this condition often have muscle jerks (myoclonus), recurrent seizures (epilepsy), and vision loss.
[0007] Currently, there is no therapy that can reverse the symptoms of CLN1-Batten disease. Seizures may sometimes be reduced or suppressed using anti-seizure medications. Therefore, there is a need in the art for treatments for CLN1-Batten disease.
Summary of the Invention
[0008] The present disclosure provides methods and products for treating CLN1-Batten disease. Methods and products for CLN1 gene therapy using recombinant AAV are provided herein. The methods include delivering a CLN1 polynucleotide to a subject using rAAV as a gene delivery vector.
[0009] Polynucleotides are provided herein that include nucleic acid sequences encoding a CLN1 polypeptide. In some embodiments, the CLN1 polypeptide includes an amino acid sequence that is at least 90% identical to SEQ ID NO: 2. In some embodiments, the CLN1 polypeptide includes the amino acid sequence of SEQ ID NO: 2. In some embodiments, the polynucleotide sequence encoding the CLN1 polypeptide includes a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the polynucleotide sequence encoding the CLN1 polypeptide includes the nucleotide sequence of SEQ ID NO: 1.
[0010] In various embodiments, the polynucleotides disclosed herein include a nucleotide sequence that is at least 90% identical to nucleotides 980-3062 of SEQ ID NO: 5. In some embodiments, the polynucleotide includes nucleotides 980-3062 of SEQ ID NO: 5. In various embodiments, the polynucleotides disclosed herein include a nucleotide sequence that is at least 90% identical to nucleotides 610-2786 of SEQ ID NO: 6. In some embodiments, the polynucleotide includes nucleotides 610-2786 of SEQ ID NO: 6.
[0011] In various embodiments, the polynucleotide further includes a P456 promoter or a chicken β-actin (CB) promoter. In some embodiments, the polypeptide includes a P546 promoter having the sequence of SEQ ID NO: 3 and a nucleic acid sequence encoding the CLN1 polypeptide of SEQ ID NO: 2. In some embodiments, the polynucleotide includes a CB promoter having the sequence of SEQ ID NO: 4 and a nucleic acid sequence encoding the CLN1 polypeptide of SEQ ID NO: 2.
[0012] Also provided herein is a recombinant adeno-associated virus (rAAV) vector comprising any of the polynucleotides disclosed herein. In some embodiments, the rAAV is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVRH10, AAVrh74, AAV11, AAV12, AAV13, or Anc80, AAV7m8, and derivatives thereof. Additionally, provided are virus particles comprising any of the disclosed polynucleotides or rAAV vectors. rAAV having a self-complementary or single-stranded genome is also provided.
[0013] Also provided is a recombinant adeno-associated virus (rAAV) virus particle encoding a CLN1 polypeptide, comprising, in 5' to 3' order, a P546 promoter and a polynucleotide encoding the CLN1 polypeptide, and comprising an rAAV9 genome.
[0014] Further provided is a recombinant adeno-associated virus (rAAV) virus particle encoding a CLN1 polypeptide, comprising, in 5' to 3' order, a CB promoter and a polynucleotide encoding the CLN1 polypeptide, and comprising an rAAV9 genome.
[0015] Further provided is a self-complementary recombinant adeno-associated virus (scAAV) comprising any of the polynucleotides disclosed herein, any of the rAAV disclosed herein, or any of the rAAV particles disclosed herein. In some embodiments, the scAAV comprises a single-stranded genome.
[0016] Also provided is a composition comprising any of the nucleotides described herein, any of the rAAV viral particles described herein, or any of the scAAVs described herein, and a pharmaceutically acceptable excipient, carrier, or diluent. In some embodiments, the excipient comprises a nonionic hypotonic compound.
[0017] Further provided is a method of treating CLN1-Batten disease in an individual, the method comprising administering to the individual a composition comprising any of the polynucleotides described herein, any of the rAAV vectors described herein, any of the viral particles described herein, any of the scAAVs described herein, or any of the compositions described herein.
[0018] Also provided is a composition for treating CLN1-Batten disease in a subject, the composition comprising a therapeutically effective amount of any of the polynucleotides described herein, any of the rAAV vectors described herein, any of the viral particles described herein, any of the scAAVs described herein, or any of the compositions described herein for treating CLN1-Batten disease.
[0019] The disclosure also provides the use of a therapeutically effective amount of any of the polynucleotides described herein, any of the rAAV vectors described herein, any of the viral particles described herein, any of the scAAVs described herein, any of the scAAVs described herein, or any of the compositions described herein for the preparation of a medicament for treating CLN1-Batten disease.
[0020] In any of the provided methods, uses, or compositions for treating CLN1-Batten disease, any of the compositions, agents, rAAV vectors, viral particles scAAV, and / or polynucleotides are formulated for administration via an intrathecal route, an intracerebroventricular route, an intraparenchymal route, an intravenous route, or a combination thereof.
[0021] In any of the provided methods, uses, or compositions for treating CLN1-Batten disease, about 1×10 13 ~ about 1×10 15 vg of scAAV or rAAV viral particles are administered.
[0022] In any of the provided methods, uses, or compositions for treating CLN1-Batten disease, further includes placing the individual in the Trendelenburg position after administration of the scAAV, rAAV viral particles, polynucleotide, or composition.
[0023] The headings in this specification are for the convenience of the reader and are not intended to be limiting.
[0024] The use of "may" and "can" in this specification is for the purpose of describing various embodiments included within the scope of the claims and is not intended to indicate uncertainty about the claims.
Brief Description of the Drawings
[0025]
Figure 1
Figure 2
Figure 3
Figure 4
Mode for Carrying Out the Invention
[0026] The present disclosure provides methods and products for treating CLN1-Batten disease. The method includes delivering a CLN1 polynucleotide to a subject using rAAV as a gene delivery vector.
[0027] In one aspect, the invention provides a method for intrathecal administration (i.e., administration into the space under the arachnoid membrane of the brain or spinal cord) of a polynucleotide encoding CLN1 to a patient, the method comprising administering rAAV9 having a genome containing the polynucleotide. In some embodiments, the rAAV9 genome is a self-complementary genome. In other embodiments, the rAAV9 genome is a single-stranded genome.
[0028] The method delivers a polynucleotide encoding CLN1 to the brain and spinal cord of the patient (i.e., the central nervous system of the patient). Some target regions of the brain for which delivery is contemplated include, but are not limited to, the motor cortex and the brainstem. Some target cells of the central nervous system for which delivery is contemplated include, but are not limited to, neurons and glial cells. Examples of glial cells include microglial cells, oligodendrocytes, and astrocytes.
[0029] AAV Gene Therapy As used herein, the term "AAV" is a common abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells where a specific function is provided by a co-infecting helper virus. Currently, there are 13 characterized AAV serotypes. General information and overviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York). However, since it is well known that the various serotypes are very closely related both structurally and functionally, even at the genetic level, it is fully anticipated that these same principles will apply to additional AAV serotypes. (See, for example, Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J.R. Pattison, ed., and Rose, Comprehensive Virology 3:1-61 (1974)). For example, all AAV serotypes exhibit very similar replication properties mediated by homologous rep genes, and they all have three related capsid proteins such as those expressed in AAV2. The degree of relatedness is further suggested by extensive cross-hybridization between serotypes along the length of the genome, and by heteroduplex analysis revealing the presence of similar self-annealing segments at the termini corresponding to the "inverted terminal repeats" (ITRs). Similar infectious patterns also suggest that the replication functions in each serotype are under similar regulatory control.
[0030] As used herein, an "AAV vector" refers to a vector that contains one or more polynucleotides of interest (or transgenes) adjacent to AAV terminal repeat sequences (ITRs). Such AAV vectors can be replicated and packaged into infectious virus particles when present in host cells transfected with a vector that encodes and expresses the rep and cap gene products.
[0031] "AAV virion", "AAV virus particle", or "AAV vector particle" refers to a virus particle consisting of at least one AAV capsid protein and a polynucleotide AAV vector that has formed a capsid. When the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome such as a transgene to be delivered to mammalian cells), it is typically referred to as an "AAV vector particle" or simply an "AAV vector". Thus, since such a vector is contained within an AAV vector particle, the production of an AAV vector particle necessarily includes the production of an AAV vector.
[0032] Adeno-associated virus (AAV) is a replication-defective parvovirus, and its single-stranded DNA genome is approximately 4.7 kb in length, including 145-nucleotide inverted terminal repeats (ITRs), and can be used to refer to the virus itself or its derivatives. This term encompasses all subtypes, as well as both naturally occurring and recombinant forms, unless otherwise specified. There are multiple serotypes of AAV. The serotypes of AAV are each associated with a specific clade, and the members thereof share serological and functional similarities. Thus, AAV can also be referred to by the clade. For example, the AAV9 sequence is referred to as the "clade F" sequence (Gao et al., J. Virol., 78:6381-6388 (2004)). The present disclosure contemplates the use of any sequence within a specific clade, such as clade F. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank accession number NC_002077, the complete genome of AAV-2 is provided in GenBank accession numbers NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983), the complete genome of AAV-3 is provided in GenBank accession number NC_1829, the complete genome of AAV-4 is provided in GenBank accession number NC_001829, the AAV-5 genome is provided in GenBank accession number AF085716, the complete genome of AAV-6 is provided in GenBank accession number NC_001862, at least a part of the genomes of AAV-7 and AAV-8 are provided in GenBank accession numbers AX753246 and AX753249, respectively, the AAV-9 genome is provided in Gao et al., J. Virol., 78:6381-6388 (2004). The genome of AAV-10 is provided in Mol. Ther., 13(1):67-76 (2006). The genome of AAV-11 is provided in Virology, 330(2):375-383 (2004). A part of the genome of AAV-12 is provided in Genbank accession number DQ813647. A part of the genome of AAV-13 is provided in Genbank accession number EU285562.The sequence of the AAV rh.74 genome is provided in U.S. Patent No. 9,434,928, which is incorporated herein by reference. The sequence of the AAV-B1 genome is provided in Choudhury et al., Mol. Ther., 24(7):1247-1257 (2016). Cis-acting sequences that direct viral DNA replication (rep), capsid formation / packaging, and host cell chromosome integration are contained within the ITRs. Three AAV promoters (named p5, p19, and p40 relative to their relative map positions) drive the expression of two AAV internal open reading frames encoding the rep and cap genes. Two rep promoters (p5 and p19), in combination with alternative splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. Rep proteins have multiple enzymatic properties that ultimately participate in the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes three capsid proteins, VP1, VP2, and VP3. Alternative splicing and non-consensus translation start sites are involved in the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).<00001�2><00001�3><00001�4> It should be noted that the tags ,
[0033] , and seem to be some specific identifiers or notations in a particular context. Since they are just presented as they are without clear instructions on how to handle them in a more "translatable" sense, they are left unchanged in the translation. If there are specific rules or meanings associated with these tags that are not provided here, the translation might need to be adjusted accordingly.AAV has unique characteristics that make it attractive as a vector for delivering foreign DNA into cells, for example, in gene therapy. AAV infection of cells in culture is non-cytopathic, and natural infection in humans and other animals is asymptomatic and latent. Furthermore, AAV infects many mammalian cells and allows the possibility of targeting many different tissues in vivo. Additionally, AAV can transduce both slowly dividing and non-dividing cells and can persist essentially throughout the lifespan of those cells as a transcriptionally active nuclear episome (extrachromosomal element). Moreover, since the signals that direct AAV replication, genome capsid formation, and integration are contained within the ITRs of the AAV genome, part or all of the internal approximately 4.3 kb genome (rep-cap, which encodes replication and structural capsid proteins) can be replaced with foreign DNA such as a gene cassette containing a promoter, DNA of interest, and polyadenylation signal. In some cases, the rep and cap proteins are provided in trans. Another important feature of AAV is that it is a very stable and robust virus. This readily withstands the conditions (several hours at 56°C to 65°C) used to inactivate adenovirus, reducing the importance of cryopreservation of AAV. AAV can even be lyophilized. Finally, cells infected with AAV do not show resistance to superinfection.
[0034] As used herein, the term "AAV" refers to wild-type AAV virus or viral particles. The terms "AAV", "AAV virus", and "AAV viral particles" are used interchangeably herein. The term "rAAV" refers to recombinant AAV virus, or recombinant infectious encapsulated viral particles. The terms "rAAV", "rAAV virus", and "rAAV viral particles" are used interchangeably herein.
[0035] The term "rAAV genome" refers to a polynucleotide sequence derived from a modified native AAV genome. In some embodiments, the rAAV genome is modified to remove the native cap and rep genes. In some embodiments, the rAAV genome includes endogenous 5' and 3' inverted terminal repeats (ITRs). In some embodiments, the rAAV genome includes ITRs from an AAV serotype different from the AAV serotype from which the AAV genome is derived. In some embodiments, the rAAV genome includes a transgene of interest (e.g., a CLN1-encoding polynucleotide) flanked by inverted terminal repeats (ITRs) at the 5' and 3' ends. In some embodiments, the rAAV genome includes a "gene cassette". Exemplary gene cassettes are described in detail in FIGS. 1 and 3 and in the nucleic acid sequences of SEQ ID NOs: 5 and 6. The rAAV genome can be a self-complementary (sc) genome referred to herein as an "scAAV genome". Alternatively, the rAAV genome referred to herein as an "ssAAV genome" can be a single-stranded (ss) genome.
[0036] The term "scAAV" refers to an rAAV virus or rAAV viral particle that includes a self-complementary genome. The term "ssAAV" refers to an rAAV virus or rAAV viral particle that includes a single-stranded genome.
[0037] The rAAV genomes provided herein include a polynucleotide encoding a CLN1 polypeptide. The CLN1 polypeptide has an amino acid sequence as set forth in SEQ ID NO: 2, or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 2 and encodes a polypeptide having CLN1 activity (e.g., at least one of an increase in clearance of lysosomal autofluorescent storage material, a reduction or delay in lysosomal storage of ATP synthase subunit C, and a reduction in activation of astrocytes and microglia in a patient when treated compared to the patient prior to treatment).
[0038] The rAAV genomes provided herein, in some cases, include a polynucleotide encoding a CLN1 polypeptide, the polynucleotide having a nucleotide sequence as set forth in SEQ ID NO:1, or a polynucleotide that is at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID NO:1, and encodes a polypeptide having CLN1 activity (e.g., at least one of an increase in clearance of lysosomal autofluorescent storage material, a reduction or delay in lysosomal storage of ATP synthase subunit C, and a reduction in activation of astrocytes and microglia in a treated patient as compared to a pre-treatment patient).
[0039] The rAAV genomes provided herein, in some embodiments, encode a polypeptide having CLN1 activity and include a polynucleotide sequence that hybridizes under stringent conditions to the nucleic acid sequence of SEQ ID NO:1 or its complementary strand. The term "stringent" is used to refer to conditions generally understood in the art as stringent. The stringency of hybridization is determined primarily by temperature, ionic strength, and the concentration of denaturing agents such as formamide. Examples of stringent conditions for hybridization and washing are 0.015 M sodium chloride, 0.0015 M sodium citrate at 65 - 68°C, or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 50% formamide at 42°C. See Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, (Cold Spring Harbor, N.Y. 1989).
[0040] The rAAV genomes provided herein, in some embodiments, include one or more AAV ITRs adjacent to a polynucleotide encoding a CLN1 polypeptide. The CLN1 polynucleotide is operably linked to transcriptional control elements (including, but not limited to, promoters, enhancers and / or polyadenylation signal sequences) that are functional in target cells to form a gene cassette. Examples of promoters are the P546 promoter and the chicken-β-actin promoter. Additional promoters are contemplated herein including, but not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters (e.g., but not limited to, actin promoter, myosin promoter, elongation factor-1a promoter, hemoglobin promoter, and creatine kinase promoter, etc.).
[0041] Also provided herein are P546 promoter sequences, e.g., the P546 promoter sequence set forth in SEQ ID NO: 3, and promoter sequences having P546 transcriptional promoting activity that are at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 3.
[0042] Other examples of transcriptional control elements are tissue-specific control elements, such as promoters that allow for specific expression within neurons or within glial cells. Examples include the neuron-specific enolase and glial fibrillary acidic protein promoters. Inducible promoters are also contemplated. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline-regulated promoter. The gene cassette may also include an intron sequence for promoting the processing of the CLN1 RNA transcript when expressed in mammalian cells. An example of such an intron is the SV40 intron.
[0043] Conservative nucleotide substitutions within the gene cassette within the rAAV9 genome are contemplated, including but not limited to, within the rAAV9 genome. For example, the CLN1 cDNA in the gene cassette may have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the CLN1 nucleotide sequence, such as the nucleotide sequence of SEQ ID NO: 1, which encodes a protein that retains CLN1 activity.
[0044] The terms "sequence identity", "percent sequence identity", or "percent identity" in the context of a nucleic acid sequence or amino acid sequence refer to residues in two sequences that are the same when aligned for maximum correspondence. The length of the sequence identity comparison can span the full length of the genome, the full length of the gene coding sequence, or preferably at least a fragment of about 500 - 5000 nucleotides. However, identity between smaller fragments, e.g., between at least about 9 nucleotides, usually at least about 20 - 24 nucleotides, at least about 28 - 32 nucleotides, at least about 36 or more nucleotides may also be desired. The percentage of sequence identity can be determined by techniques known in the art. For example, homology can be determined by aligning sequence information and directly comparing the sequence information between two polypeptide molecules using readily available computer programs such as ALIGN, ClustalW2, and BLAST. In one embodiment, when BLAST is used as the alignment tool, the following default parameters: genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; matrix = BLOSUM62; descriptions = 50 sequences; sort = high score; database = non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+Swiss protein+Spupdate+PIR.
[0045] "Packaging" refers to a series of intracellular events that result in the assembly and capsid formation of AAV particles. The term "production" refers to the process of production of rAAV (infectious encapsulated rAAV particles) by packaging cells.
[0046] The AAV "rep" and "cap" genes refer to polynucleotide sequences that encode the replication protein and capsid-forming protein of adeno-associated virus, respectively. The rep and cap of AAV are referred to herein as AAV "packaging genes".
[0047] The "helper virus" of AAV refers to a virus that enables AAV (e.g., wild-type AAV) to be replicated and packaged by mammalian cells. Various such helper viruses for AAV, including adenoviruses, herpesviruses, and poxviruses such as vaccinia, are known in the art. Adenoviruses encompass several different subgroups, but adenovirus type 5 of subgroup C is most commonly used. Numerous adenoviruses of human, non-human mammalian, and avian origin are known and are available from depository institutions such as the ATCC. Viruses of the herpes family include, for example, herpes simplex virus (HSV) and Epstein-Barr virus (EBV), as well as cytomegalovirus (CMV) and pseudorabies virus (PRV), and these are also available from depository institutions such as the ATCC.
[0048] "Helper virus function" refers to a function encoded by a helper virus genome that enables (in conjunction with other requirements for replication and packaging described herein) the replication and packaging of AAV. As described herein, "helper virus function" can be provided in a number of ways, such as by providing a helper virus or, for example, by providing in trans to producer cells a polynucleotide sequence encoding the required function.
[0049] The rAAV genomes provided herein lack the AAV rep and cap DNA. The AAV DNA in the rAAV genomes contemplated herein (e.g., ITR) can be derived from any AAV serotype suitable for inducing recombinant viruses including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV rh.10, AAV, rh.74, and AAV-B1. As described above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. rAAV having capsid mutations are also contemplated. For example, as outlined in Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). Modified capsids herein are also contemplated, including capsids having various post-translational modifications such as glycosylation and deamidation. Deamidation of asparagine or glutamine side chains to convert asparagine residues to aspartic acid or isoaspartic acid residues, and conversion of glutamine to glutamic acid or isoglutamic acid are contemplated in the rAAV capsids provided herein. For example, as outlined in Giles et al., Molecular Therapy, 26(12): 2848-2862 (2018). Modified capsids herein are also contemplated to include targeting sequences that direct rAAV to diseased tissues and organs in need of treatment.
[0050] The DNA plasmids provided herein contain the rAAV genomes described herein. The DNA plasmids are transferred to cells that are permissive to infection by an AAV helper virus (e.g., an adenovirus, an E1-deleted adenovirus, or a herpesvirus) to assemble the rAAV genome into infectious virus particles having the AAV9 capsid protein. Techniques for producing rAAV in which the rAAV genome to be packaged, the rep and cap genes, and the helper virus functions are provided to the cells are standard in the art. Production of rAAV requires the presence of the following components in a single cell (referred to herein as a packaging cell): an rAAV genome, AAV rep and cap genes separate from (i.e., not present within) the rAAV genome, and helper virus functions. The AAV rep and cap genes may be derived from any AAV serotype from which the recombinant virus may be derived, and may be derived from an AAV serotype different from the rAAV genome ITR. Production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692, which is hereby incorporated by reference in its entirety. In various embodiments, the AAV capsid protein may be modified to enhance delivery of the recombinant rAAV. Modifications to the capsid protein are generally known in the art. See, for example, US2005 / 0053922 and US2009 / 0202490, the disclosures of which are hereby incorporated by reference in their entireties.
[0051] The rAAV genomes provided herein, in some embodiments, include one or more AAV ITRs adjacent to a transgene polynucleotide sequence. The transgene polynucleotide sequence is operably linked to transcriptional control elements (including, but not limited to, promoters, enhancers and / or polyadenylation signal sequences) that are functional in target cells to form a "gene cassette". Examples of promoters are the pIRF promoter, the P546 promoter comprising the polynucleotide sequence set forth in SEQ ID NO: 3, and the chicken-β-actin promoter (CB or CBA) comprising the polynucleotide sequence set forth in SEQ ID NO: 4. Additional promoters are contemplated herein, including, but not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters (e.g., but not limited to, actin promoter, myosin promoter, elongation factor-1a promoter, hemoglobin promoter, and creatine kinase promoter, etc.).
[0052] The method of generating packaging cells is to create a cell line that stably expresses all the components necessary for the production of rAAV. For example, a plasmid (or plasmids) containing an rAAV genome lacking the AAV rep and cap genes, the AAV rep and cap genes isolated from the rAAV genome, and a selectable marker such as the neomycin resistance gene is integrated into the genome of the cells. The AAV genome can be introduced into a bacterial plasmid by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. Sci. USA, 79:2077-2081), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73), or direct blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). Then, the packaging cell line is infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and suitable for large-scale production of rAAV. Another example of a suitable method is to use an adenovirus or a baculovirus instead of a plasmid to introduce the rAAV genome and / or the rep gene and the cap gene into the packaging cells.
[0053] The general principles of rAAV production are outlined, for example, in Carter, 1992, Current Opinions in Biotechnology, 1533 - 539, and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158:97 - 129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984); Tratschin et al., Mo1. Cell. Biol. 5:3251 (1985), McLaughlin et al., J. Virol., 62:1963 (1988), and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988), Samulski et al. (1989, J. Virol., 63:3822 - 3828), U.S. Patent No. 5,173,414, WO95 / 13365 and corresponding U.S. Patent No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al. (1995) Vaccine 13:1244 - 1250, Paul et al. (1993) Human Gene Therapy 4:609 - 615, Clark et al. (1996) Gene Therapy 3:1124 - 1132, U.S. Patent No. 5,786,211, U.S. Patent No. 5,871,982, and U.S. Patent No. 6,258,595. The above documents are hereby incorporated by reference in their entirety, and the portions of the documents regarding rAAV production are particularly emphasized.
[0054] Packaging cells that produce infectious rAAV are further provided herein. In one embodiment, the packaging cells can be stably transformed cancer cells such as HeLa cells, 293 cells, and PerC.6 cells (a homologous 293 strain). In another embodiment, the packaging cells are cells that are not transformed cancer cells such as low passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (African green monkey fetal lung cells).
[0055] rAAV containing the rAAV genome of the present disclosure (e.g., infectious capsid-forming rAAV particles) is also provided herein. The genome of rAAV lacks AAV rep and cap DNA, that is, there is no AAV rep or cap DNA between the ITRs of the rAAV genome. The rAAV genome can be a self-complementary (sc) genome. rAAV having an sc genome is referred to herein as scAAV. The rAAV genome can be a single-stranded (ss) genome. rAAV having a single-stranded genome is referred to herein as ssAAV.
[0056] An exemplary rAAV provided herein is an scAAV named "scAAV9.P546.CLN1". scAAV9.P546.CLN1 contains an scAAV9 genome containing the human CLN1 cDNA under the control of the truncated methyl CpG-binding protein 2 (MeCP2), referred to herein as the P546 promoter (SEQ ID NO: 3). The scAAV also contains an SV40 intron (upstream of the human CLN1 cDNA) and a bovine growth hormone polyadenylation (BGH polyA) terminator sequence (downstream of the human CLN1 cDNA). The sequence of this scAAV9.P546.CLN1 gene cassette is set forth in SEQ ID NO: 5. The scAAV9 genome is packaged in an AAV9 capsid and contains AAV2 ITRs (one ITR is upstream of the P546 promoter and the other ITR is downstream of the BGH polyA terminator sequence).
[0057] Another exemplary rAAV provided herein is an scAAV designated "scAAV9.CB.CLN1". scAAV9.CB.CLN1 contains an scAAV9 genome comprising the human CLN1 cDNA under the control of the CMV-enhancer chicken β-actin (CB) promoter (SEQ ID NO: 4) referred to herein. The scAAV also contains an SV40 intron (upstream of the human CLN1 cDNA) and a bovine growth hormone polyadenylation (BGH polyA) terminator sequence (downstream of the human CLN1 cDNA). The sequence of this scAAV9.CB.CLN1 gene cassette is set forth in SEQ ID NO: 6. The scAAV9 genome is packaged into an AAV9 capsid and contains AAV2 ITRs (one ITR is upstream of the P546 promoter and the other ITR is downstream of the BGH polyA terminator sequence).
[0058] rAAV can be purified by standard methods in the art, for example, by column chromatography or cesium chloride gradient. Methods for purifying rAAV from helper virus are known in the art and include, for example, the methods disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69:427-443 (2002), U.S. Patent No. 6,566,118, and WO98 / 09657.
[0059] Compositions comprising rAAV are also provided. The compositions comprise rAAV encoding a CLN1 polypeptide. The compositions can comprise two or more rAAV encoding different polypeptides of interest. In some embodiments, the rAAV is scAAV or ssAAV.
[0060] The compositions provided herein comprise rAAV and one or more pharmaceutically acceptable excipients. Acceptable excipients are non-toxic to the recipient, preferably inert at the dosages and concentrations employed, and include buffers such as phosphates [e.g., phosphate buffered saline (PBS)], citrates, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, copolymers such as poloxamer 188, pluronics (e.g., pluronic F68) or polyethylene glycol (PEG), but are not limited thereto. The compositions provided herein can include a pharmaceutically acceptable aqueous excipient containing a nonionic, low osmolality compound such as iodixanol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan, and the aqueous excipient containing the nonionic, low osmolality compound can have one or more of the following properties: a weight osmolality by vapor pressure osmometry of about 180 mOsm / kg water, a volume osmolality of about 273 mOsm / L, an absolute viscosity of about 2.3 cp at 20 °C and about 1.5 cp at 37 °C, and a specific gravity of about 1.164 at 37 °C. Exemplary compositions can include about 20-40% nonionic, low osmolality compound, or about 25-35% nonionic, low osmolar compound. Exemplary compositions include scAAV formulated in 20 mM Tris (pH 8.0), 1 mM MgCl2, 200 mM NaCl, 0.001% poloxamer 188, and about 25%-about 35% nonionic, low osmolality compound. Another exemplary composition includes scAAV formulated in 1X PBS and 0.001% Pluronic F68.
[0061] The sterile injectable solution is prepared by incorporating the required amount of rAAV, along with the various other components enumerated above if necessary, into a suitable solvent and then subjecting it to sterile filtration. Generally, the dispersion is prepared by incorporating the sterilized active ingredient into a sterile vehicle that includes a basic dispersion medium and the other components required from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and lyophilization techniques, whereby the powders of the active ingredient and any additional desired components are obtained from their previously sterile filtered solutions.
[0062] The dosage of rAAV administered by the methods of the present disclosure will vary, for example, depending on the particular rAAV, mode of administration, timing of administration, treatment goals, individual, and cell type targeted, and can be determined by standard methods in the art. The dosage may be expressed in terms of units of viral genome (vg). Dosages contemplated herein are from about 1×10 11 to about 1×10 12 to about 1×10 13 to about 5×10 13 to about 1.2×10 14 to about 1.5×10 14 to about 2×10 14 to about 1×10 15 to about 1×10 16 or more total viral genomes. Dosages of about 1×10 11 to about 1×10 15 vg, 1×10 13 to about 1×10 15 vg, about 1×10 13 to about 5×10 13 to about 1×10 13 to about 2×10 14 vg, about 5×10 13 to about 1×10 14 vg, and about 1.5×10 14 to about 2×10 14 vg are also contemplated. In various embodiments, the dosages of the compositions comprising rAAV provided herein are based on the size and growth rate of the nervous system and cerebrospinal fluid. The dosage is based on an absolute dosage per patient, rather than body weight.
[0063] Exemplary compositions include an agent for increasing the viscosity and / or density of the composition. For example, the composition includes a contrast agent for increasing the viscosity and / or density of the composition. Exemplary compositions include from about 20% to 40% non-ionic hypotonic compound or contrast agent, or from about 25% to about 35% non-ionic hypotonic compound. Exemplary compositions include scAAV or rAAV viral particles formulated in 20 mM Tris (pH 8.0), 1 mM MgCl2, 200 mM NaCl, 0.001% poloxamer 188, and from about 25% to about 35% non-ionic hypotonic compound. Another exemplary composition includes scAAV formulated in 1×PBS and 0.001% Pluronic F68.IG.
[0064] Methods are provided for transducing target cells (including, but not limited to, cells of the nervous system such as neurons or glial cells) with rAAV. Cells of the nervous system include neurons, lower motor neurons, microglial cells, oligodendrocytes, astrocytes, Schwann cells, or combinations thereof.
[0065] The term "transduction" is used to refer to the administration / delivery of a CLN1 polynucleotide to a target cell, either in vivo or in vitro, via a replication-deficient rAAV of the present disclosure that results in the expression of a functional polypeptide by the recipient cell. Transduction of cells with the rAAV of the present disclosure results in the sustained expression of a polypeptide or RNA encoded by the rAAV. Accordingly, the present disclosure provides methods for administering / delivering an rAAV encoding a CLN1 polypeptide to a subject via an intrathecal, intraventricular, intraparechymal, or intravenous route, or any combination thereof. Intrathecal delivery refers to delivery into the space under the arachnoid membrane of the brain or spinal cord. In some embodiments, intrathecal administration is via intracisternal (i.e., into the cerebrospinal fluid) administration.
[0066] In some embodiments of the treatment methods of the present invention, an agent that increases the viscosity and / or density of the composition is administered to the patient. For example, a non-ionic low-osmolar contrast agent is also administered to the patient. Such contrast agents include, but are not limited to, iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol,ioxilan, and mixtures of two or more of the contrast agents. In some embodiments, the treatment method thus further comprises administration of iohexol to the patient. The non-ionic low-osmolar contrast agent is intended to increase the transduction of target cells in the patient's central nervous system. When the rAAV of the present disclosure is used in combination with the contrast agents described herein, it is contemplated that the transduction of cells will increase compared to the transduction of cells when the rAAV of the present disclosure is used alone. In various embodiments, the transduction of cells is at least about 1%, or at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 120%, at least about 150%, at least about 180%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500% or more increased compared to the transduction of the vector of the present disclosure when the vector of the present disclosure is used without combination with the contrast agents described herein. In further embodiments, the transduction of cells is about 10% to about 50%, or about 10% to about 100%, or about 5% to 10%, or about 5% to about 50%, or about 1% to about 500%, or about 10% to about 200%, or about 10% to about 300%, or about 10% to about 400%, or about 100% to about 500%, or about 150% to about 300%, or about 200% to about 500% increased compared to the transduction of the vector of the present disclosure when the vector of the present disclosure is used without combination with the contrast agents described herein.
[0067] In some embodiments of the methods provided herein, the patient is maintained in the Trendelenburg position (head-down position) after administration of rAAV (e.g., for about 5, about 10, about 15, or about 20 minutes). In some embodiments, for example, the patient is tilted to a head-down position of about 1 degree to about 30 degrees, about 15 to about 30 degrees, about 30 to about 60 degrees, about 60 to about 90 degrees, or about 90 to about 180 degrees during or after intrathecal vector infusion. In various embodiments, transduction of the cells is at least about 1%, or at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 120%, at least about 150%, at least about 180%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500% or more increased when the Trendelenburg position is used as described herein compared to when the Trendelenburg position is not used.
[0068] In a further embodiment, transduction of the cells is about 10% to about 50%, or about 10% to about 100%, or about 5% to 10%, or about 5% to about 50%, or about 1% to about 500%, or about 10% to about 200%, or about 10% to about 300%, or about 10% to about 400%, or about 100% to about 500%, or about 150% to about 300%, or about 200% to about 500% increased when the vectors of the present disclosure are used in combination with the contrast agent and the Trendelenburg position as described herein compared to transduction of the vectors of the present disclosure when not used in combination with the contrast agent and the Trendelenburg position.
[0069] The present disclosure also provides embodiments of a method of treatment in which intrathecal administration of the vectors and contrast agents of the present disclosure to the central nervous system of patients in Trendelenburg position who need them results in a further increase in patient survival compared to the survival of patients when the vectors of the present disclosure are administered in the absence of a contrast agent and Trendelenburg position. In various embodiments, administration of the vectors and contrast agents of the present disclosure to the central nervous system of patients in Trendelenburg position who need them results in at least about 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200% or more increase in patient survival compared to the survival of patients when the vectors of the present disclosure are administered in the absence of a contrast agent and Trendelenburg position.
[0070] Intrathecal administration is exemplified herein. These methods include transducing target cells (including but not limited to neuronal cells and / or glial cells) with one or more rAAVs described herein. In some embodiments, rAAV viral particles comprising a polynucleotide encoding a CLN1 polypeptide are administered or delivered to a patient's brain and / or spinal cord. In some embodiments, the polynucleotide is delivered to the brain. Regions of the brain to which delivery is contemplated include, but are not limited to, the motor cortex and the brainstem. In some embodiments, the polynucleotide is delivered to the spinal cord. In some embodiments, the polynucleotide is delivered to neurons or lower motor neurons. In some embodiments, the polynucleotide is delivered to nerves and glial cells. In some embodiments, the glial cells are microglial cells, oligodendrocytes, or astrocytes. In some embodiments, the polynucleotide is delivered to Schwann cells.
[0071] "Treatment" includes the step of administering an effective dose or effective multiple doses of a composition comprising the rAAV of the present invention to a subject animal (including a human patient) via an intrathecal or intravenous route, etc.
[0072] Methods of transducing target cells with rAAV, either in vivo or in vitro, are contemplated by the present disclosure. An in vivo method includes the step of administering a composition comprising an effective dose or effective multiple doses of the rAAV of the present disclosure to an animal (including a human) in need thereof. The methods provided herein include the step of administering an effective dose or effective multiple doses of a composition comprising the rAAV provided herein to a subject (e.g., an animal including, but not limited to, a human patient) in need thereof. When the dose is administered prior to the onset of CLN1-Batten disease, the administration is prophylactic. When the dose is administered after the onset of CLN1-Batten disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disease, delays or prevents the progression of the disease, reduces the degree of the condition, brings about a remission (partial or complete) of the condition, and / or extends survival. In various embodiments, the dose of the composition comprising the rAAV disclosed herein for use in the methods provided is based on the size and growth rate of the nervous system and cerebrospinal fluid. The dose is based on the absolute dose per patient, rather than body weight. The dosing regimen is based on the fact that the size of the nervous system and the volume of the cerebrospinal fluid do not vary as much between individuals as body weight, which can vary widely.
[0073] Compared to a subject before treatment or compared to an untreated subject, the methods provided herein result in stabilization, reduced progression, or improvement in one or more of the measures used to evaluate the progression and / or improvement of CLN1-Batten disease, such as the Unified Batten Disease Rating Scale (UBDRS) rating scale or the Hamburg Motor and Language Scale. The UBDRS rating scale (described in Marshall et al., Neurology. 2005 65(2):275-279) [including the UBDRS Physical Rating Scale, the UBDRS Seizure Rating Scale, the UBDRS Behavioral Rating Scale, the UBDRS Ability Rating Scale, the UBDRS Symptom Onset Order, and the UBDRS Clinical Global Impression (CGI)], the Pediatric Quality of Life Scale (PEDSQOL) scale, motor function, language function, cognitive function, and survival.
[0074] Compared to a subject before treatment or compared to an untreated subject, the methods provided herein result in, among other things, a reduction or delay in the lysosomal accumulation of autofluorescent storage material, a reduction or delay in the lysosomal accumulation of ATP synthase subunit C, a reduction or delay in glial activation (astrocyte and / or microglia) activation, a reduction or delay in astrocytosis, and a reduction or delay in brain volume loss as measured by MRI, a reduction or delay in the onset of seizures, and one or more of stabilization, reduced progression or delay, or improvement in one or more of the UBDRS rating scale or the Hamburg Motor and Language Scale, where the reduction, stabilization, or improvement is compared to a patient before treatment or an untreated CLN1-Batten disease patient.
[0075] Combination therapies are also provided. The combinations used herein include either concurrent treatment or sequential treatment. Combinations of the methods described herein with standard medical procedures and with novel therapies are specifically contemplated. In some embodiments, the combination therapy includes administering an immunosuppressant in combination with the gene therapy disclosed herein.
[0076] Administration of the composition in an effective amount can be by standard routes in the art, including but not limited to intramuscular, parenteral, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraosseous, intraocular, rectal, or vaginal. The route of administration and serotype of the AAV component of the rAAV of the present disclosure (specifically, AAV ITR and capsid protein) can be selected and / or adapted by those skilled in the art considering the condition of the disease to be treated and the target cells / tissues expressing the CLN1 protein.
[0077] The present disclosure provides for local and systemic administration of an effective amount of rAAV and the compositions of the present disclosure. For example, systemic administration is administration to the circulatory system such that the whole body is affected.
[0078] Delivery to a subject in need of delivery after birth is contemplated, but intrauterine delivery to a fetus is also contemplated.
[0079] Immunosuppressive agent The immunosuppressive agent can be administered to the subject before or after the initiation of the immune response to rAAV in the subject after administration of the gene therapy. In addition, the immunosuppressive agent can be administered concomitantly with the gene therapy or protein replacement therapy. The immune response in the subject includes a harmful immune response or inflammatory reaction following or caused by the administration of rAAV to the subject. The immune response can be the production of antibodies in the subject in response to the administered rAAV.
[0080] Exemplary immunosuppressive agents include glucocorticosteroids, Janus kinase inhibitors, calcineurin inhibitors, mTOR inhibitors, cell division inhibitors such as purine analogs, methotrexate, and cyclophosphamide, inosine monophosphate dehydrogenase (IMDH) inhibitors, biologics such as monoclonal antibodies or fusion proteins.
[0081] An immunosuppressant can be an anti-inflammatory steroid that reduces inflammation and suppresses or modulates the immune system of a subject. Exemplary anti-inflammatory steroids are glucocorticoids such as prednisone, betamethasone, dexamethasone, hydrocortisone, methylprednisolone, deflazacort, budesonide, or prednisone.
[0082] A Janus kinase inhibitor is an inhibitor of the JAK / STAT signaling pathway by targeting one or more of the enzymes of the Janus kinase family. Exemplary Janus kinase inhibitors include tofacitinib, baricitinib, upadacitinib, peficitinib, and oclacitinib.
[0083] A calcineurin inhibitor binds to cyclophilin and inhibits the activity of calcineurin. Exemplary calcineurin inhibitors include cyclosporine, tacrolimus, and pimecrolimus.
[0084] An mTOR inhibitor reduces or inhibits the serine / threonine-specific protein kinase mTOR. Exemplary mTOR inhibitors include sirolimus, everolimus, and temsirolimus.
[0085] Immunosuppressants include immunosuppressive macrolides. The term "immunosuppressive macrolide" refers to a macrolide agent that suppresses or modulates the immune system of a subject. A macrolide is a class of drugs that contain a large macrocyclic lactone ring to which one or more deoxy sugars such as cladinose or desosamine are attached. The lactone ring is usually 14, 15, or 16 members. Macrolides belong to the polyketide class of drugs and can be natural products. Examples of immunosuppressive macrolides include tacrolimus, pimecrolimus, and sirolimus.
[0086] Purine analogs block nucleotide synthesis and include IMDH inhibitors. Exemplary purine analogs include azathioprine, mycophenolic acid, and leflunomide.
[0087] Exemplary immunosuppressive biologic agents include abatacept, adalimumab, anakinra, certolizumab, etanercept, golimumab, infliximab, ixekizumab, natalizumab, rituximab, secukinumab, tocilizumab, ustekinenumab, vedolizumab, basiliximab, belatacept, and daclizumab.
[0088] Specifically, the immunosuppressant is an anti-CD20 antibody. The term anti-CD20 specific antibody refers to an antibody that specifically binds to CD20 or inhibits or reduces the expression or activity of CD20. Exemplary anti-CD20 antibodies include rituximab, ocrelizumab, or ofatumumab.
[0089] Additional examples of immunosuppressive antibodies include anti-CD25 antibodies (or anti-IL2 antibodies or anti-TAC antibodies) such as basiliximab and daclizumab, as well as anti-CD3 antibodies such as muromonab-CD3, oterixizumab, teplyzumab, and visilizumab, and anti-CD52 antibodies such as alemtuzumab.
Example
[0090] The following examples illustrate specific embodiments, it being understood that those skilled in the art will envision changes and modifications. Thus, only such limitations as are found in the claims should be imposed on the present invention.
[0091] In the examples, self-complementary AAVs carrying CLN1 cDNA were produced under the control of the P546 promoter (named scAAV9.P546.CLN1) or the cmv enhancer chicken β-actin promoter (named scAAV9.CB.CLN1). The P546 promoter is a truncated form of the methyl CpG-binding protein 2 (MeCP2) promoter and allows for transgene expression at moderate levels in both neurons and astrocytes.
[0092] Example 1 Production of scAAV9.P546.CLN1 A cDNA expression clone of human CLN1 was obtained from Origene (SC119961). The DNA sequence (SEQ ID NO: 1) containing the open reading frame of human CLN1 was amplified from this plasmid and then inserted between the AgeI restriction endonuclease site and the SbfI restriction endonuclease site of a double-stranded AAV2-ITR-based production plasmid. A schematic diagram of the plasmid construct showing the CLN1 DNA inserted between the AAV2 ITRs (the 5’ ITR was modified as previously described by McCarty et al., Gene Therapy 8:1248-1254 (2001) for generating scAAV) is shown in FIG. 1. The plasmid construct also contains the P546 promoter, the SV40 chimeric intron, and the bovine growth hormone (BGH) polyadenylation signal.
[0093] The scAAV9.P546.CLN1 scAAV was produced under cGMP conditions in HEK293 cells by a transient triple-plasmid transfection procedure using a double-stranded AAV2-ITR-based production plasmid together with a plasmid encoding the previously described Rep2Cap9 sequence [Gao et al., J. Virol., 78: 6381-6388 (2004)] and the adenovirus helper plasmid pHelper (Stratagene, Santa Clara, CA). The virus was purified by two cesium chloride density gradient purification steps, dialyzed against PBS, formulated with 0.001% Pluronic-F68 to prevent virus aggregation, and stored at 4°C. All scAAV preparations were titrated by quantitative PCR using Taq-Man technology. The purity of the scAAV was evaluated by sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, CA) at 4-12%.
[0094] Example 2 Production of scAAV9.CB.CLN1 The cDNA expression clone of human CLN1 was obtained from Origene (SC119961). The DNA sequence (SEQ ID NO: 1) containing the open reading frame of human CLN1 was amplified from this plasmid and then inserted between the Age1 restriction endonuclease site and the Sbf1 restriction endonuclease site of the double-stranded AAV2-ITR-based production plasmid. A schematic diagram of the plasmid construct showing the CLN1 DNA inserted between the AAV2 ITRs (the 5’ ITR was modified as previously described by McCarty et al., Gene Therapy 8: 1248-1254 (2001) for generating scAAV) is shown in Figure 3. The plasmid construct also contains the CMV enhancer, the CB promoter (labeled CBA promoter), the SV40 chimeric intron, and the bovine growth hormone (BGH) polyadenylation signal.
[0095] scAAV9.CB.CLN1 scAAV was produced under cGMP conditions by a transient triple-plasmid transfection procedure in HEK293 cells using the double-stranded AAV2-ITR-based production plasmid together with a plasmid encoding the previously described Rep2Cap9 sequence [Gao et al., J. Virol., 78: 6381-6388 (2004)] and the adenovirus helper plasmid pHelper (Stratagene, Santa Clara, CA). The virus was purified by two cesium chloride density gradient purification steps, dialyzed against PBS, formulated with 0.001% Pluronic-F68 to prevent virus aggregation, and stored at 4°C. All scAAV preparations were titrated by quantitative PCR using the Taq-Man technology. The purity of scAAV was evaluated by sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, CA) at 4 - 12%.
[0096] Example 3 Analysis of the expression of CSF-delivered scAAV9.P546.CLN1 scAAV or scAAV9.CB.CLN1 scAAV in PPT-1-deficient mice Cell targeting and expression To confirm the expression and in vivo distribution of virus-introduced human CLN1, scAAV9.P546.CLN1 scAAV or scAAV9.CB.CLN1 scAAV is administered to PPT-1 deficient mice within 24 hours after birth via intracerebroventricular (ICV) injection, and the expression is monitored at various time points over a 2-month period. Wild-type mice and PPT-1 deficient mice are injected with an equal volume of PBS as a control.
[0097] To obtain a detailed in vivo distribution profile of the brain, RNAscope in situ hybridization technology is used to specifically identify human CLN1 mRNA in seven specific brain regions, the cerebral cortex (motor (A), somatosensory (B), visual (C)), thalamus (D), hindbrain (E), cerebellum (F), and spinal cord (G)). This technique involves RNA in situ hybridization with specific probes to detect only the human transgene encoded by AAV9. The analysis demonstrates the expression of the CLN1 transgene in various regions of the brain, including the cortex, thalamus, hindbrain, cerebellum, and spinal cord.
[0098] Accumulation of autofluorescent storage material (ASM) Accumulation of the autofluorescent storage material (ASM) is a prominent histological marker for the progression of Batten disease (Mole et al., Biochim Biophys Acta-Mol Basis Dis. 2015;1852(10):2237-2241, Cotman et al., Clin Lipidol. 2012 Feb;7(1):79-91, Seehafer et al., Neurobiol Aging. 2006;27:576-588). ASM accumulation is a powerful indicator of disease progression for many forms of Batten disease (Bosch et al., J Neurosci. 2016;36(37):9669-9682, Morgan et al., PLoS One. 2013;8(11):e78694). In this specification, it is contemplated that reduction of ASM be used as an indicator of treatment success. Automated quantification of fluorescent pixel area confirms a significant reduction of accumulated ASM in the motor cortex, somatosensory cortex, visual cortex, and thalamus of 2- and 8-month-old PPT-1-deficient mice treated with gene therapy compared to PBS-injected PPT-1-deficient mice.
[0099] Accumulation of the mitochondrial protein ATP synthase subunit C Accumulation of ATP synthase subunit C is analyzed in brain tissue from PPT-1-deficient mice treated with wild-type PBS-injected gene therapy. In healthy individuals, this protein is part of the respiratory chain in the mitochondrial membrane, but in patients with Batten disease, this protein abnormally accumulates in lysosomes (Palmer et al., Am J Med Genet. 1992;42(4):561-567).
[0100] Functional assay In efficacy studies following delivery of scAAV9.P546.CLN1 scAAV or scAAV9.CB.CLN1 scAAV in PPT-1-deficient mice, starting at 2 months of age and continuing at 2-month intervals, treated and control mice are subjected to a series of behavioral testing paradigms, including an accelerating rotarod assay and pole climbing to test motor function and coordination, and a Morris water maze to assess learning and memory.
[0101] The rotarod assay is performed every two months. Mice are placed on an accelerating wheel and the time it takes for them to fall is measured. At each time point, mice are trained in the morning and tested 4 hours later in the afternoon.
[0102] The pole climbing test measures the time it takes a mouse to turn when placed face up on a vertical pole and to descend the pole when placed face down. In addition, the number of falls from the pole while attempting to turn or descend is also measured. This test assesses coordination and balance ability.
[0103] In the Morris water maze test, animals are placed in a water-filled pool containing a hidden platform. After training, the time it takes the animals to find the hidden platform using environmental cues for orientation is measured as an indication of learning and memory ability.
[0104] Example 4 Clinical trial of scAAV9.P546.CLN1 gene therapy scAAV9.P546.CLN1 is delivered intrathecally to human patients with CLN1-Batten disease.
[0105] scAAV for clinical trials will be produced by Nationwide Children's Hospital Clinical Manufacturing Facility under cGMP conditions using a triple transfection method in HEK293 cells as described in Example 1.
[0106] Patients selected for participation have a diagnosis of CLN1 disease determined by genotype. The first cohort (n = 3) receives viral vector gene transfer doses of 1×10 13 ~1×10 15 vg once or twice per patient. scAAV9.P546.CLN1 is formulated with 20 mM Tris (pH 8.0), 1 mM MgCl2, 200 mM NaCl, 0.001% poloxamer 188, and approximately 20% to approximately 40% nonionic hypotonic compounds and is delivered once into the subarachnoid space of the lumbar dural sac via an intrathecal catheter inserted by lumbar puncture between the spinous processes. Safety is evaluated based on clinical grounds and by review of the safety label. There is a minimum of 4 weeks between enrollment of each subject to allow review of safety data on day 30 post-gene transfer. If there are no safety concerns, a second cohort of 4 additional subjects is enrolled after the third subject is evaluated 1 month after injection. Each subject in cohort 2 (n = 4) receives escalating doses of the viral vector. There is a period of at least 6 weeks between the completion of cohort 1 and the start of cohort 2 to allow review of safety analyses and DSMB review from 5 time points (days 1, 2, 7, 14, and 21) prior to dosing the next subject.
[0107] Disease progression is measured using the UBDRS scale or the Hamburg motor and language scale (mentioned in the forms for carrying out the above invention) and the impact of treatment on quality of life using the Pediatric Quality of Life (PEDSQOL) scale, and the likelihood of long-term survival.
[0108] When all patients have completed the 3-year study, a primary analysis regarding efficacy is evaluated. The basis for determining efficacy is based on the well-established Unified Batten Disease Rating Scale (UBDRS) or the Hamburg motor and language scale, specifically developed for CLN1-Batten disease, and is due to stabilization or reduction of disease progression. When the 3-year study period is completed, patients are monitored annually for 5 years in accordance with FDA guidance.
[0109] Preferred embodiments of the present invention are shown and described in the specification, but it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Those skilled in the art will envision numerous variations, modifications, and substitutions without departing from the present invention. It should be understood that various alternative forms to the embodiments described herein may be employed. The following claims define the scope of the present invention, and it is intended that methods and structures within these claims and their equivalents be encompassed thereby.
[0110] All documents referred to in this application are hereby incorporated by reference in their entirety.
[0111] Array SEQ ID NO:1 - CLN1 Nucleotide atggcgtcgcccggctgcctgtggctcttggctgtggctctcctgccatggacctgcgcttctcgggcgctgcagcatctggacccgccggcgccgctgccgttggtgatctggcatgggatgggagacagctgttgcaatcccttaagcatgggtgctattaaaaaaatggtggagaagaaaatacctggaatttacgtcttatctttagagattgggaagaccctgatggaggacgtggagaacagcttcttcttgaatgtcaattcccaagtaacaacagtgtgtcaggcacttgctaaggatcctaaattgcagcaaggctacaatgctatgggattctcccagggaggccaatttctgagggcagtggctcagagatgcccttcacctcccatgatcaatctgatctcggttgggggacaacatcaaggtgtttttggactccctcgatgcccaggagagagctctcacatctgtgacttcatccgaaaaacactgaatgctggggcgtactccaaagttgttcaggaacgcctcgtgcaagccgaatactggcatgaccccataaaggaggatgtgtatcgcaaccacagcatcttcttggcagatataaatcaggagcggggtatcaatgagtcctacaagaaaaacctgatggccctgaagaagtttgtgatggtgaaattcctcaatgattccattgtggaccctgtagattcggagtggtttggattttacagaagtggccaagccaaggaaaccattcccttacaggagacctccctgtacacacaggaccgcctggggctaaaggaaatggacaatgcaggacagctagtgtttctggctacagaaggggaccatcttcagttgtctgaagaatggttttatgcccacatcataccattccttggatga SEQ ID NO: 2 - CLN1 polypeptide MASPGCLWLLAVALLPWTCASRALQHLDPPAPLPLVIWHGMGDSCCNPLSMGAIKKMVEKKIPGIYVLSLEIGKTLMEDVENSFFLNVNSQVTTVCQALAKDPKLQQGYNAMGFSQGGQFLRAVAQRCPSPPMINLISVGGQHQGVFGLPRCPGESSHICDFIRKTLNAGAYSKVVQERLVQAEYWHDPIKEDVYRNHSIFLADINQERGINESYKKNLMALKKFVMVKFLNDSIVDPVDSEWFGFYRSGQAKETIPLQETSLYTQDRLGLKEMDNAGQLVFLATEGDHLQLSEEWFYAHIIPFLG Array No. 3 - P456 promoter gaacaacgccaggctcctcaacaggcaactttgctacttctacagaaaatgataataaagaaatgctggtgaagtcaaatgcttatcacaatggtgaactactcagcagggaggctctaataggcgccaagagcctagacttccttaagcgccagagtccacaagggcccagttaatcctcaacattcaaatgctgcccacaaaaccagcccctctgtgccctagccgcctcttttttccaagtgacagtagaactccaccaatccgcagctgaatggggtccgcctcttttccctgcctaaacagacaggaactcctgccaattgagggcgtcaccgctaaggctccgccccagcctgggctccacaaccaatgaagggtaatctcgacaaagagcaaggggtggggcgcgggcgcgcaggtgcagcagcacacaggctggtcgggagggcggggcgcgacgtctgccgtgcggggtcccggcatcggttgcgcgcgcgctccctcctctcggagagagggctgtggtaaaacccgtccggaaaa Array No. 4 - Hybrid chicken B - actin (CB) promoter ccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggag Sequence number 5 - pscAAV9.P546.CLN1.Kan vector gacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagc SEQ ID NO: 6 - pscAAV9.CB.CLN1.Kan GATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGATTCCGTTGCAATGGCTGGCGGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGTATTGCGACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAAAACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTGTTTAGCTCCCGCT
Claims
1. A polynucleotide comprising a nucleic acid sequence encoding a CLN1 polypeptide.
2. The polynucleotide according to claim 1, wherein the CLN1 polypeptide comprises an amino acid sequence that is at least 90% identical to SEQ ID NO:
2.
3. The polynucleotide according to claim 1, wherein the CLN1 polypeptide comprises the amino acid sequence of SEQ ID NO:
2.
4. The polynucleotide according to any one of claims 1 to 3, wherein the polynucleotide sequence encoding the CLN1 polypeptide comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO:
1.
5. The polynucleotide according to claim 4, wherein the polynucleotide sequence encoding the CLN1 polypeptide comprises the nucleotide sequence of SEQ ID NO:
1.
6. The polynucleotide according to any one of claims 1 to 5, wherein the polynucleotide further comprises a P456 promoter or a chicken β-actin (CB) promoter.
7. The polynucleotide according to any one of claims 1 to 5, comprising a nucleotide sequence that is at least 90% identical to nucleotides 980 to 3062 of SEQ ID NO:
5.
8. The polynucleotide according to any one of claims 1 to 5, comprising nucleotides 980 to 3062 of SEQ ID NO:
5.
9. The polynucleotide according to any one of claims 1 to 5, comprising a nucleotide sequence that is at least 90% identical to nucleotides 610 to 2786 of SEQ ID NO:
6.
10. The polynucleotide according to any one of claims 1 to 5, comprising nucleotides 610 to 2786 of SEQ ID NO:
6.
11. A polynucleotide comprising a P546 promoter comprising the sequence of SEQ ID NO: 3 and a nucleic acid sequence encoding the CLN1 polypeptide of SEQ ID NO:
2.
12. A polynucleotide comprising a CB promoter comprising the sequence of SEQ ID NO: 4 and a nucleic acid sequence encoding the CLN1 polypeptide of SEQ ID NO:
2.
13. A recombinant adeno-associated virus (rAAV) vector comprising the polynucleotide according to any one of claims 1 to 12.
14. The rAAV according to claim 13, wherein the rAAV is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVRH10, AAVrh74, AAV11, AAV12, AAV13 or Anc80, AAV7m8, and derivatives thereof.
15. Recombinant adeno-associated virus (rAAV) particles comprising the polynucleotide according to any one of claims 1 to 12, or the rAAV vector according to claim 13 or 14.
16. The rAAV particles according to claim 15, wherein the rAAV particles comprise a single-stranded genome.
17. Recombinant adeno-associated virus (rAAV) viral particles encoding a CLN1 polypeptide, comprising, in order from 5' to 3', a P546 promoter and a polynucleotide encoding the CLN1 polypeptide, and comprising an rAAV9 genome.
18. Recombinant adeno-associated virus (rAAV) viral particles encoding a CLN1 polypeptide, comprising, in order from 5' to 3', a CB promoter and a polynucleotide encoding the CLN1 polypeptide, and comprising an rAAV9 genome.
19. Self-complementary recombinant adeno-associated virus (scAAV) comprising the polynucleotide according to any one of claims 1 to 12, the rAAV according to claim 13 or 14, or the rAAV particles according to any one of claims 15 to 18.
20. The scAAV according to claim 19, wherein the scAAV comprises a single-stranded genome.
21. A composition comprising the polynucleotide according to any one of claims 1 to 12, the rAAV vector according to claim 13 or 14, the viral particles according to any one of claims 15 to 18, or the scAAV according to claim 19 or 20, and a pharmaceutically acceptable excipient, carrier, or diluent.
22. The composition according to claim 21, wherein the excipient comprises a non-ionic hypotonic compound.
23. A method for treating CLN1-Batten disease in an individual, comprising administering to the individual a composition comprising the polynucleotide according to any one of claims 1 to 12, the rAAV vector according to claim 13 or 14, the viral particle according to any one of claims 15 to 18, the scAAV according to claim 19 or 20, or the composition according to claim 21 or 22.
24. The method according to claim 23, wherein the composition is administered via an intrathecal route, an intracerebroventricular route, an intraparenchymal route, an intravenous route, or a combination thereof.
25. The method according to claim 24, wherein the composition is administered intrathecally.
26. The method according to claim 24, wherein the composition is administered intracerebroventricularly.
27. The method according to claim 24, wherein the composition is administered intravenously.
28. About 1×10 13 to about 1×10 15 The method according to any one of claims 23 to 27, wherein the scAAV or rAAV virus particles of vg are administered.
29. The method according to any one of claims 23 to 28, further comprising placing the individual in a Trendelenburg position after administration of the scAAV, rAAV viral particle, polynucleotide, or the composition.
30. A composition for treating CLN1-Batten disease in a subject, wherein the composition comprises a therapeutically effective amount of the polynucleotide according to any one of claims 1 to 12, the rAAV vector according to claim 13 or 14, the viral particle according to any one of claims 15 to 18, the scAAV according to claim 19 or 20, or the composition according to claim 21 or 22.
31. Use of a therapeutically effective amount of the polynucleotide according to any one of claims 1 to 12, the rAAV vector according to claim 13 or 14, the viral particle according to any one of claims 15 to 18, the scAAV according to claim 19 or 20, or the composition according to claim 21 or 22 for the preparation of a medicament for treating CLN1 Batten disease.
32. The composition or use according to claim 30 or 31, wherein the composition or medicament is formulated for administration via an intrathecal route, an intracerebroventricular route, an intraparenchymal route, an intravenous route, or a combination thereof.
33. The composition or use according to claim 32, wherein the composition or medicament is formulated for intrathecal administration.
34. The composition or agent according to claim 32, wherein the composition or agent is formulated for intracerebroventricular administration.
35. The composition or agent according to claim 32, wherein the composition or agent is formulated for intravenous administration.
36. The composition or agent contains from about 1×10 13 to about 1×10 15 vg of the scAAV or rAAV viral particles, and the composition or use according to any one of claims 30 to 35.
37. The composition or use according to any one of claims 30 to 36, further comprising placing the individual in the Trendelenburg position after administration of the scAAV, rAAV viral particles, polynucleotide, or the composition.