Methods for in vivo editing of KLKB1

A CRISPR/Cas9-based therapy targeting the KLKB1 gene through lipid nanoparticles effectively reduces plasma kallikrein levels, addressing the limitations of current HAE treatments by minimizing side effects and reducing HAE attack frequency.

JP2025524590APending Publication Date: 2025-07-30INTELLIA THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025500294
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-05-03
Filing Date
2023-07-07
Publication Date
2025-07-30

AI Technical Summary

Technical Problem

Current treatments for hereditary angioedema (HAE) involve long-term administration of drugs that can cause side effects and breakthrough attacks, highlighting the need for a gene editing therapy that provides long-term control over bradykinin production without frequent dosing.

Method used

The use of a CRISPR/Cas9-based therapeutic system for in vivo editing of the KLKB1 gene to reduce prekallikrein production, delivered via lipid nanoparticles (LNPs) to the liver, targeting the KLKB1 gene with a guide RNA and Cas9 nuclease to achieve sustained reduction in plasma kallikrein levels.

Benefits of technology

This approach significantly reduces plasma kallikrein levels by at least 60%, leading to a decrease in HAE attacks, minimizing side effects and the frequency of breakthrough episodes, and improving patient quality of life.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025524590000085
    Figure 2025524590000085
  • Figure 2025524590000086
    Figure 2025524590000086
  • Figure 2025524590000087
    Figure 2025524590000087
Patent Text Reader

Abstract

The first systemic administration of a CRISPR / Cas9-based therapeutic for in vivo editing of the liver KLKB1 gene in a clinical trial is described. A method for in vivo editing of the gene is described herein by systemic administration of a lipid nanoparticle composition comprising mRNA encoding Cas9 nuclease and guide RNA targeting the liver KLKB1 gene. Evaluation of biosafety and clinical efficacy metrics, as well as treatment methods, are also described herein.
Need to check novelty before this filing date? Find Prior Art

Description

Background Art

[0001] Hereditary angioedema (HAE) is a rare autosomal dominant genetic disorder characterized by severe recurrent unpredictable inflammatory attacks in various organs and tissues of the body, which are painful, debilitating, and can be life-threatening. Hereditary angioedema is caused by excessive bradykinin in the blood enhancing episodes of vascular permeability and swelling. Most HAE patients are deficient in the C1 inhibitor (also called C1 esterase inhibitor or C1-INH) protein (either the level of functional C1-INH is reduced or the level of a variant with reduced activity is normal). When C1-INH function is insufficient, bradykinin levels increase, vascular leakage begins, and swelling attacks can occur. The production of bradykinin is controlled via the kallikrein-kinin (contact) pathway, which is endogenously inhibited by C1-INH. Bradykinin peptides are formed by cleavage of high molecular weight kininogen (HMWK) by plasma kallikrein (pKal), an active form of the protein prekallikrein. Prekallikrein, also called KLKB1 protein, is encoded by KLKB1. Prekallikrein is produced in the liver, secreted into the plasma, and can be activated by factor XIIa. When KLKB1 is activated to kallikrein, pKal can increase bradykinin levels. When bradykinin in the blood becomes excessive, body fluids leak through the blood vessel wall into body tissues. When body fluids accumulate excessively within body tissues, the swelling episodes seen in individuals with HAE occur.

[0002] Drug therapy is used to prevent attacks (prophylaxis) or to treat attacks on demand. While on-demand treatment is carried out at the onset of HAE attacks, prophylactic agents need to be administered intravenously (IV) or subcutaneously (SC) at a frequency of up to twice a week over a long period or orally daily to ensure a certain degree of pathway inhibition and control the disease. Despite long-term administration, breakthrough attacks still occur.

[0003] The outcomes of HAE patients have been improved by multiple new treatment strategies (Busse and Christiansen, 2020). These strategies are based on a detailed characterization of the biochemical pathways that control the abnormal production of bradykinin and are designed to restore the normal function of the contact activation pathway. These strategies include the replacement of C1-esterase inhibitor (C1-INH) (recombinant or plasma-derived), the inhibition of B2 bradykinin receptor (B2R) (icatibant), and the inhibition of kallikrein (ecallantide, lanadelumab, berotralstat). However, injection site reactions (in the case of lanadelumab) and gastrointestinal side effects (in the case of berotralstat) occurred in a significant proportion of patients (Cohn et al., 2020).

[0004] Adjusting the functional balance of the contact activation pathway, including persistent knockdown of prekallikrein, to improve the control of abnormal bradykinin production may lead to an improvement in the outcomes of HAE subjects. Therefore, there remains an unmet need for gene editing therapies that do not require long-term administration and can have a long-term effect on gene expression, such as knockdown of prekallikrein. SUMMARY OF THE INVENTION

[0005] The present disclosure describes systemic administration of a CRISPR / Cas9-based therapeutic for in vivo editing of KLKB1. In some embodiments, the invention uses a single guide RNA together with a Cas9 nuclease, such as the CRISPR / Cas9 system, to substantially reduce or knockdown the expression of the KLKB1 gene, thereby substantially reducing or eliminating the production of prekallikrein associated with signaling through the contact activation pathway. A substantial reduction or elimination of prekallikrein protein production by modification of the KLKB1 gene can be a long-term reduction or elimination of plasma kallikrein levels, e.g., a sustained reduction of plasma kallikrein. Additional embodiments include a lipid nanoparticle system for use in in vivo liver-targeted LNP delivery of a CRISPR / Cas9 RNA component, e.g., a single guide RNA targeting the KLKB1 gene and an mRNA encoding Cas9 nuclease, to a human subject, and methods of using the same.

[0006] The following non-limiting embodiments are provided.

[0007] 1. In a first embodiment, disclosed herein is a method of treating hereditary angioedema (HAE) in a human subject, the method comprising systemically administering to the human subject a therapeutically effective amount of an LNP composition comprising i. an mRNA encoding a Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene of the liver.

[0008] 2. In a second embodiment, disclosed herein is a method of preventing an HAE attack in a human subject, the method comprising systemically administering to the human subject a therapeutically effective amount of an LNP composition comprising i. an mRNA encoding a Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene of the liver.

[0009] 3. In a third embodiment, disclosed herein is a method for reducing the frequency of angioedema attacks in a human subject with HAE, the method comprising systemically administering to the human subject an LNP composition comprising, i. an mRNA encoding an i.Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene of the liver, in a therapeutically effective amount.

[0010] 4. In a fourth embodiment, disclosed herein is a method for in vivo editing of the kallikrein (KLKB1) gene in a human subject having HAE, the method comprising: a. systemically administering to the human subject an LNP composition comprising, i. an mRNA encoding an i.Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene, in a therapeutically effective amount; and b. editing the KLKB1 gene at the site targeted by the guide RNA in the hepatocytes of the subject, wherein the administration of the composition results in a clinically significant improvement in the human subject, as compared to the baseline level, in the level of a clinical measure.

[0011] 5. In a fifth embodiment, disclosed herein is a method for treating hereditary angioedema (HAE) in a human subject, the method comprising: a. systemically administering to the human subject an LNP composition comprising, i. an mRNA encoding an i.Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene, in a therapeutically effective amount, wherein the guide RNA comprises a targeting sequence comprising the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15), and wherein the administration of the composition reduces the total plasma kallikrein protein level as compared to the baseline total plasma kallikrein protein level.

[0012] 6. In a sixth embodiment, disclosed herein is a method for treating hereditary angioedema (HAE) in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of i. mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene of the liver; b. determining a first level of a clinical measure in the subject prior to administration; c. determining a second level of the clinical measure in the subject at a defined time period after administration; and d. assessing a change between the first level and the second level of the clinical measure, wherein the administration of the composition results in a change in the level of the clinical measure in the subject that is improved compared to the baseline level, thereby treating HAE.

[0013] 7. In a seventh embodiment, disclosed herein is a method for treating hereditary angioedema (HAE) in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of i. mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene of the liver; b. determining a first level of a biosafety measure in the subject prior to administration; c. determining a second level of the biosafety measure in the subject at a defined time period after administration; and d. assessing a change between the first level and the second level of the biosafety measure, wherein the administration of the composition results in an acceptable change in the level of the biosafety measure in the subject compared to the baseline level.

[0014] 8. In the eighth embodiment, disclosed herein is a method for treating hereditary angioedema (HAE) in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising: i. an mRNA encoding a Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene, in a therapeutically effective amount, wherein said administration of said composition results in a clinically significant improvement in the level of a clinical measure in said subject as compared to the baseline level of said clinical measure.

[0015] 9. In the ninth embodiment, disclosed herein is a method for treating HAE in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising: i. an mRNA encoding a Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene, in a therapeutically effective amount, wherein the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene are administered in a total dosage of from about 25 mg to about 75 mg.

[0016] 10. In the tenth embodiment, disclosed herein is a method for treating HAE in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising: i. an mRNA encoding a Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene, in a therapeutically effective amount, wherein the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene are administered in a total dosage of from about 50 mg to about 75 mg.

[0017] 11. Provided herein is the method according to any one of embodiments 1 to 10, wherein the kallikrein protein level is reduced by at least 60% after administration of the composition.

[0018] 12. Provided herein is the method according to any one of embodiments 1 to 11, further comprising reducing the kallikrein activity level by at least 60% after administration of the composition.

[0019] 13. The method according to any one of Embodiments 1 to 4 or 6 to 12, wherein the guide RNA comprises a targeting sequence comprising the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15), is provided herein.

[0020] 14. The method according to any one of Embodiments 1 to 13, wherein the guide RNA further comprises a scaffold sequence comprising the nucleotide sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 387), is provided herein.

[0021] 15. The method according to any one of Embodiments 1 to 14, wherein the guide RNA is a modified guide RNA comprising or consisting of the nucleotide sequence mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 391), wherein m represents a 2'-O-methyl modified nucleotide and * represents a phosphorothioate bond between nucleotides.

[0022] 16. The method according to any one of Embodiments 1 to 15, wherein the subject is co-treated with a HAE prophylaxis method at the time when the LNP composition is systemically administered to the human subject, is provided herein.

[0023] 17. The method of embodiment 16 is provided herein, wherein the HAE prophylaxis method comprises an agent selected from C1-esterase inhibitor (C1-INH) supplementation (e.g., recombinant or plasma-derived), inhibitor of B2 bradykinin receptor (B2R) (e.g., icatibant), kallikrein inhibitor (e.g., ecallantide, lanadelumab, berotralstat), attenuated androgen (e.g., danazol, oxandrolone, stanozolol), or antifibrinolytic agent. In certain embodiments, the HAE prophylaxis method comprises berotralstat. In certain embodiments, the HAE prophylaxis method comprises danazol. In certain embodiments, the HAE prophylaxis method comprises recombinant or plasma-derived C1-esterase inhibitor (C1-INH) supplementation. In certain embodiments, the HAE prophylaxis method comprises icatibant. In certain embodiments, the HAE prophylaxis method comprises ecallantide. In certain embodiments, the HAE prophylaxis method comprises lanadelumab. In certain embodiments, the HAE prophylaxis method comprises oxandrolone. In certain embodiments, the HAE prophylaxis method comprises stanozolol.

[0024] 18. The method according to any one of embodiments 1 to 17 is provided herein, wherein the subject has an attack frequency of at least two confirmed HAE attacks within 90 days immediately prior to systemic administration of the LNP composition to the human subject.

[0025] 19. The method according to any one of embodiments 1 to 17 is provided herein, wherein the subject has an attack frequency of at least three confirmed HAE attacks per 90 days immediately prior to systemic administration of the LNP composition to the human subject.

[0026] 20. The method according to any one of embodiments 1 to 17 is provided herein, wherein the subject has an average attack frequency of at least six confirmed HAE attacks per 90 days immediately prior to systemic administration of the LNP composition to the human subject.

[0027] 21. The method according to any one of embodiments 18-20, wherein the confirmed seizure frequency of the subject is reduced by at least 50% for at least 90 days, optionally for at least 6 months, from immediately after systemic administration of the LNP composition to the human subject, is provided herein.

[0028] 22. The method according to any one of embodiments 18-20, wherein the confirmed seizure frequency of the subject is reduced by at least 80% for at least 90 days, optionally for 6 months, from immediately after systemic administration of the LNP composition to the human subject, is provided herein.

[0029] 23. The method according to any one of embodiments 18-20, wherein the subject has no confirmed seizures for 90 days, optionally for 6 months, from immediately after systemic administration of the LNP composition to the human subject, is provided herein.

[0030] 24. The method according to any one of embodiments 18-20, wherein the confirmed seizure frequency of the subject is reduced by at least 80% on days 29-112, optionally on days 29-216, after systemic administration of the LNP composition to the human subject, is provided herein.

[0031] 25. The method according to any one of embodiments 18-20, wherein the confirmed seizure frequency of the subject is reduced by at least 90% on days 29-112, optionally on days 29-216, after systemic administration of the LNP composition to the human subject, is provided herein.

[0032] 26. In embodiments 18 - 20, a method is provided herein, wherein the subject has no seizures confirmed on any one of days 29 - 112, and optionally on any one of days 29 - 216, after systemic administration of the LNP composition to the human subject.

[0033] 27. In embodiments 16 - 26, a method is provided herein, wherein the prevention method is terminated simultaneously with systemic administration of the LNP composition to the human subject.

[0034] 28. In embodiments 16 - 26, a method is provided herein, wherein the prevention method is terminated after day 36 following systemic administration of the LNP composition to the human subject.

[0035] 29. In embodiments 1 - 28, a method is provided herein, wherein for the subject, the frequency of use of acute therapy for the treatment of HAE attacks is decreased.

[0036] 30. In embodiments 1 - 29, a method is provided herein, wherein for the subject, the frequency of use of hospitalizations related to HAE attacks is decreased compared to a control, for example, the subject before treatment with the composition as a control.

[0037] 31. In embodiments 1 - 30, a method is provided herein, wherein for the subject, the severity of confirmed HAE attacks is reduced.

[0038] 32. In embodiments 1 - 31, a method is provided herein, wherein for the subject, the frequency of confirmed severe HAE attacks is decreased.

[0039] 33. In embodiments 1 - 31, a method is provided herein, wherein for the subject, the frequency of confirmed HAE attacks accompanied by laryngeal edema is decreased.

[0040] 34. A method according to any one of embodiments 1 to 33 is provided herein, wherein for the subject, optionally, the quality of life is improved as determined by an assessment of quality of life for angioedema of MOXIE.

[0041] 35. A method according to any one of embodiments 1 to 34 is provided herein, wherein the subject cannot tolerate long-term treatment with a weak androgen or has an average attack frequency of at least once per 90 days during treatment with a weak androgen.

[0042] 36. A method according to any one of embodiments 1 to 35 is provided herein, wherein the subject is a pediatric subject, a pregnant woman, a subject with liver disease, a subject with breast cancer, a subject with prostate cancer, a subject with cardiovascular risk factors, and a subject with hepatocellular carcinoma.

[0043] 37. A method according to embodiment 36 is provided herein, wherein the subject is a pregnant woman.

[0044] 38. A method according to any one of embodiments 1 to 36 is provided herein, wherein the subject is a woman with the ability to conceive.

[0045] 39. A method according to any one of embodiments 1 to 38 is provided herein, wherein the subject has a confirmed HAE attack accompanied by at least one episode of laryngeal edema.

[0046] 40. A method according to any one of embodiments 1 to 28 is provided herein, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate.

[0047] 41. A method according to any one of embodiments 1 to 40 is provided herein, wherein the LNP comprises a PEG lipid.

[0048] 42. The method according to embodiment 41, wherein the PEG lipid comprises 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000, is provided herein.

[0049] 43. The method according to any one of embodiments 1 to 42, wherein the LNP comprises a neutral lipid, is provided herein.

[0050] 44. The method according to embodiment 43, wherein the neutral lipid comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), is provided herein.

[0051] 45. The method according to any one of embodiments 1 to 44, wherein the LNP composition has an N / P ratio of about 5 to 7, is provided herein.

[0052] 46. The method according to any one of embodiments 1 to 45, wherein the mRNA encoding the guide RNA and the Cas nuclease are present in a weight ratio in the range of about 5:1 to about 1:5, is provided herein.

[0053] 47. The method according to any one of embodiments 1 to 46, wherein the mRNA encodes a Cas9 nuclease, is provided herein.

[0054] 48. The method according to any one of embodiments 1 to 47, wherein the mRNA encodes S. pyogenes Cas9, is provided herein.

[0055] 49. The method according to any one of embodiments 1 to 48, wherein the mRNA encoding the Cas nuclease is codon-optimized, is provided herein.

[0056] 50. The method according to any one of embodiments 1 to 49, wherein the mRNA encoding the effective amount of Cas nuclease and the guide RNA A targeting the KLKB1 gene are in a total dosage of about 25 to 75 mg of total RNA, is provided herein.

[0057] 51. A method according to any one of embodiments 1-50 is provided herein, wherein the mRNA encoding the effective amount of Cas nuclease and the guide RNA A targeting the KLKB1 gene are a total dose of about 25 mg of total RNA.

[0058] 52. A method according to any one of embodiments 1-50 is provided herein, wherein the mRNA encoding the effective amount of Cas nuclease and the guide RNA A targeting the KLKB1 gene are a total dose of about 50 mg of total RNA.

[0059] 53. A method according to any one of embodiments 1-50 is provided herein, wherein the mRNA encoding the effective amount of Cas nuclease and the guide RNA A targeting the KLKB1 gene are a total dose of about 75 mg of total RNA.

[0060] 54. A method according to any one of embodiments 1-53 is provided herein, wherein administration of the composition reduces the total plasma kallikrein protein level by 60%-95%, 60%-90%, 70%-95%, 70%-90%, or 80%-95% compared to the baseline total plasma kallikrein level before administration of the composition.

[0061] 55. A method according to any one of embodiments 1-54 is provided herein, wherein administration of the composition reduces plasma kallikrein activity by 60%-95%, 60%-90%, 70%-95%, 70%-90%, or 80%-95% compared to the baseline plasma kallikrein activity level before administration of the composition.

[0062] 56. A method according to any one of embodiments 54-55 is provided herein, wherein the plasma kallikrein level is determined at least 28 days after administration of the LNP composition.

[0063] 57. The method according to any one of embodiments 54 to 56, wherein the plasma kallikrein level is determined at least 56 days after administration of the LNP composition, is provided herein.

[0064] 58. The method according to any one of embodiments 1 to 57, wherein administration of the composition results in an acceptable change in the level of a biosafety measure in the subject as compared to the baseline level of the biosafety measure, is provided herein.

[0065] 59. The method according to embodiment 58, wherein the biosafety measure is activated partial thromboplastin time (aPTT), is provided herein.

[0066] 60. The method according to embodiment 58 or 59, wherein the biosafety measure is alanine aminotransferase (ALT), is provided herein.

[0067] 61. The method according to any one of embodiments 58 to 60, wherein the biosafety measure is aspartate aminotransferase (AST), is provided herein.

[0068] 62. The method according to any one of embodiments 58 to 61, wherein the change in the biosafety measure recovers within 14 days, is provided herein.

[0069] 63. The method according to any one of embodiments 58 to 62, wherein the biosafety measure is grade 3 or less, is provided herein.

[0070] 64. The method according to any one of embodiments 1 to 63, wherein the composition is administered together with a second therapeutic agent for the treatment of HAE, is provided herein.

[0071] 65. The method according to embodiment 64, wherein the second therapeutic agent is prophylactic treatment for HAE, is provided herein.

[0072] This patent or application documents include at least one drawing created in color. Copies of this patent or patent application publication that include color drawing(s) will be provided by the Patent Office upon payment of the claims and necessary fees.

Brief Description of the Drawings

[0073]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31

Figure 32

Figure 33

Figure 34

Figure 35

Figure 36

Figure 37

Figure 38

Figure 39

Best Mode for Carrying Out the Invention

[0074] Here, a specific embodiment of the present invention will be described in detail. Examples thereof are shown in the accompanying drawings. The present invention will be described in conjunction with the illustrated embodiments, but it should be understood that these embodiments are not intended to limit the present invention to these embodiments. Rather, the present invention is intended to cover all alternative forms, modifications, and equivalents that may be included in the present invention as defined by the appended embodiments.

[0075] Before explaining the teachings of this case in detail, it should be understood that the compositions or process steps can be various, and thus this disclosure is not limited to specific compositions or process steps. As used in this specification and the appended embodiments, it should be noted that the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "(one) conjugate" includes a plurality of conjugates, and reference to "(one) cell" includes a plurality of cells or cell populations, and so on. As used herein, the term "include" and its grammatical variations are intended to be non-limiting, and the listing of items in a list does not exclude other similar items that may be substituted for or added to the items listed.

[0076] Numeric ranges include the numbers defining the range. Measured values and measurable values are understood to be approximate values taking into account significant figures and errors associated with the measurement. Also, the use of "comprise", "comprises", "comprising", "contain", "contains", "containing", "include", "includes", and "including" is not intended to be limiting. It should be understood that all of the above general descriptions and the best mode for carrying out the invention are merely illustrative and explanatory and do not limit the present teachings.

[0077] Unless otherwise noted in this specification, embodiments described in this specification as including various components are also contemplated as consisting of or consisting essentially of the described components, and embodiments described in this specification as consisting of various components are also contemplated as including or consisting essentially of the described components. Also, embodiments described in this specification as consisting essentially of various components are also contemplated as consisting of or including the described components (this interchangeability does not apply to the use of these terms in the claims).

[0078] The term "or" is used in an inclusive sense unless the context clearly dictates otherwise, i.e., equivalent to "and / or".

[0079] The term "about", when used in front of a list or range, modifies each member of the list or range. The terms "about" or "approximately" mean an acceptable error of a particular value determined by one of ordinary skill in the art, which error depends in part on how the value is measured or determined. For example, in some embodiments, about includes within two standard deviations of the mean value. In some embodiments of the present invention, "about" includes ±10% of the specified value, or optionally ±5%. It is understood that some values are inherently variable, e.g., the number of days in a month varies, and that there are acceptable ranges recognized in the art for monitoring at lower frequency intervals for monitoring purposes.

[0080] The term "at least" when preceding a number or series of numbers is understood to include the number adjacent to the term "at least" and all subsequent numbers or integers that can logically be included as apparent from the context. For example, the number of nucleotides within a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 20 nucleotide nucleic acid molecule" means having the indicated property for 18, 19, or 20 nucleotides. When present before a series of numbers or a range, "at least" is understood to modify each of the numbers within the series of numbers or range.

[0081] As used herein, "less than" or "below" is understood to be logical from the context, the value adjacent to the expression and the value down to zero. For example, a double-stranded region "less than 2 nucleotide base pairs" has 2, 1, or 0 nucleotide base pairs. When "less than" or "below" is present before a series of numbers or a range, it is understood to modify each of the series of numbers or range.

[0082] As used herein, a range includes both an upper limit and a lower limit.

[0083] As used herein, when the maximum amount of a value is represented by 100% (e.g., 100% inhibition or 100% encapsulation), that value is understood to be limited by the detection method. For example, 100% inhibition is understood to be inhibition relative to a level below the detection level of the assay, and 100% encapsulation is understood to mean that the substance intended to be encapsulated cannot be detected extracellularly.

[0084] Unless otherwise indicated, the following terms and expressions used herein are intended to have the following meanings.

[0085] As used herein, "mRNA" refers to a polynucleotide comprising an RNA or modified RNA that contains an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by ribosomes and aminoacylated tRNA). The mRNA can contain a phosphate-sugar backbone that includes ribose residues or analogs thereof, such as 2'-methoxyribose residues. In some embodiments, the sugar of the nucleic acid phosphate-sugar backbone consists essentially of ribose residues, 2'-methoxyribose residues, or combinations thereof. Generally, mRNA does not contain a significant amount of thymidine residues (e.g., 0 residues, or less than 30, 20, 10, 5, 4, 3, or 2 thymidine residues; or a thymidine content of less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1%). The mRNA can contain modified uridine at some or all of its uridine positions.

[0086] As used herein, "polynucleotide" and "nucleic acid" refer to multimeric compounds that include nitrogen-containing heterocyclic bases or base analogs covalently linked along a backbone and that include conventional RNA, DNA, hybrid RNA-DNA, and polymers that are analogs thereof, including nucleosides or nucleoside analogs. In some embodiments, the polynucleotide is chemically synthesized or in vitro transcribed. The polynucleotide can be an mRNA, such as in vitro transcribed RNA that contains modified uridine. The nucleic acid "backbone" can be composed of various linkages including one or more of a sugar-phosphate diester bond, a peptide-nucleic acid bond ("peptide nucleic acid" or PNA; PCT WO95 / 32305), a phosphorothioate bond, a methylphosphonate bond, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or a similar compound with substitutions such as 2'-methoxy substitution or 2'-halide substitution. The RNA can include DNA or one or more deoxynucleosides or deoxynucleoside analogs.

[0087] "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to an RNA such as a crRNA (also known as CRISPR RNA) that targets a Cas nuclease to a genomic location, or a combination of a crRNA and a trRNA (also known as a tracrRNA). Homologous guide RNA structures for Cas nucleases such as Cas9 nuclease are known in the art. The crRNA and trRNA sequences of the guide RNA may be related as a single RNA molecule (single guide RNA, sgRNA), or as separate RNA molecules (dual guide RNA, dgRNA), for example. The trRNA may be a naturally occurring sequence or a trRNA sequence having modifications or differences compared to a naturally occurring sequence. The guide RNA may include modified RNAs as described herein.

[0088] As used herein, a "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct the guide RNA to the target sequence for binding or modification (e.g., cleavage) by a Cas nuclease. A "guide sequence" may also be referred to as a "targeting sequence" or a "spacer sequence". The guide sequence may be 20 base pairs in length, and for example, in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs, the length of the guide target sequence is, for example, 18, 19, or 20 consecutive nucleotides. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In some embodiments, the guide sequence and the target region may contain one or two mismatches, and the guide sequence includes a 20-nucleotide target region.

[0089] The target sequences for the Cas protein include both the plus and minus strands of genomic DNA (i.e., the given sequence and its reverse complement) because the nucleic acid substrate for the Cas protein is double-stranded nucleic acid. Thus, it should be understood that when a guide sequence is stated to be "complementary to the target sequence", the guide sequence can direct the guide RNA to bind to the reverse complement of the target sequence. Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to the specific nucleotides of the target sequence (e.g., the target sequence without PAM), except that T in the guide sequence is replaced by U.

[0090] As used herein, "Cas nuclease" means a polypeptide or complex of polypeptides having RNA and DNA binding activities, such as Cas9 nuclease, the DNA binding activity of which is sequence-specific and dependent on the sequence of the guide RNA. Exemplary Cas nucleases (and "Cas proteins") include Cas cleavage enzymes, i.e., Cas nucleases are dsDNA cleavage enzymes that cleave both strands of DNA. As used herein, "Cas9 nuclease" is, for example, a single-stranded polypeptide having dsDNA cleavage enzyme activity. "Cas9" includes Spy Cas9, variants of Cas9 listed herein, and their equivalents. See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36(2015); Shmakov et al., Molecular Cell, 60:385-397(2015). Spy Cas9 dsDNA cleavage enzyme is specifically included herein. As used herein, delivery of a Cas nuclease (e.g., Cas9 nuclease, or S. pyogenes Cas9 nuclease) includes delivery of a polypeptide or mRNA. For example, the LNP compositions described herein can include mRNA encoding a Cas nuclease.

[0091] As used herein, "modified uridine" is used to refer to nucleosides other than thymidine that have the same hydrogen bond acceptors as uridine and one or more structural differences from uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which one or more non-proton substituents (e.g., an alkoxy such as methoxy) replace a proton. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more non-proton substituents (e.g., an alkyl such as methyl) replace a proton, such as N1-methylpseudouridine. In some embodiments, the modified uridine is any of a substituted uridine, pseudouridine, or a substituted pseudouridine.

[0092] As used herein, "uridine position" refers to the position occupied by uridine or modified uridine in a polynucleotide. Thus, for example, a polynucleotide in which "100% of the uridine positions are modified uridine" contains modified uridine at all positions that would be uridine in a conventional RNA of the same sequence (where all bases are standard A, U, C, or G bases). Unless otherwise indicated, U in the polynucleotide sequences in this disclosure or in the sequence listings or sequence listings attached to this disclosure can be uridine or modified uridine.

[0093] As used herein, "treatment" refers to any administration or application of a therapeutic agent to a subject for a disease or disorder, including inhibition of the disease, alleviation of one or more symptoms of the disease, cure of the disease, reduction of the frequency of HAE attacks, reduction of the severity of HAE attacks, improvement of one or more clinical scales described herein (e.g., a suitable quality of life (QoL) questionnaire, such as the Angioedema Quality of Life (AE-QoL) questionnaire for MOXIE), or prevention of recurrence of one or more symptoms of the disease. In some embodiments, treatment of HAE includes reducing the frequency of HAE attacks. In some embodiments, treatment of HAE can include a substantial decrease or knockdown in the expression of the KLKB1 gene, e.g., a sustained decrease in total plasma kallikrein protein levels of at least 60%, thereby substantially reducing or eliminating the production of kallikrein proteins associated with HAE. In some embodiments, treatment of HAE can include a substantial decrease or knockdown in the expression of the KLKB1 gene, e.g., a sustained decrease in total kallikrein protein levels of at least 80%, thereby substantially reducing or eliminating the production of kallikrein proteins associated with HAE.

[0094] As used herein, terms such as "co-treated" are understood to refer to treatment with two or more agents that are likely to have a pharmacodynamic effect, based on pharmacokinetic properties such as half-life. As used herein, with respect to treatment with an HAE prophylaxis agent, "co-treated" at the time of systemic administration of the LNP composition to a human subject is understood to be within 5 half-lives from the time of administration of the HAE prophylaxis agent. The half-life of such agents is known in the art and exemplary values for various agents are provided herein. For particularly long-acting agents, a washout period during which the long-acting agent is likely to have a pharmacodynamic effect can be defined. With respect to treatment with an HAE prophylaxis agent, systemic administration of the LNP composition to a human subject during the washout period would be understood to be co-treatment.

[0095] As used herein, "knockdown" refers to reducing the expression of a specific gene product (e.g., KLKB1 or kallikrein) by gene editing in a sample, such as a cell, cell population, tissue, organ, or body fluid, and the sample is optionally a sample from a subject. In some embodiments, the gene editing can be evaluated by sequencing, such as next-generation sequencing (NGS). The expression can be reduced by at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or less than the detection level of the assay, compared to a suitable control, such as the baseline or pre-treatment of the subject. Methods for measuring mRNA knockdown are known and include sequencing of mRNA isolated from the tissue or cell population of interest, such as hepatocytes. Protein knockdown can be measured by detecting the amount of protein in the tissue, cell population, or body fluid of interest, such as non-human primate plasma, human plasma, and mouse serum. Flow cytometry analysis is a known method for measuring protein expression knockdown. In the case of secreted proteins, knockdown can be evaluated in tissue culture medium or in a liquid such as blood or serum or plasma derived therefrom. Plasma protein levels can be measured by a quantitative assay, such as ELISA, and can be used for detection of knockdown. In some embodiments, "knockdown" can refer to some loss of expression of a specific gene product, such as a decrease in the amount of full-length wild-type mRNA transcribed or translated into the full-length protein, or a decrease in the amount of protein expressed by a cell population. In certain embodiments, the sample may be treated, for example, to activate the product in the sample prior to performing the enzyme assay. In some embodiments, "knockdown" can refer to some loss of expression of a specific gene product, such as kallikrein.

[0096] As used herein, "sustained" (e.g., sustained knockdown) in the context of kallikrein knockdown or "sustained" reduction in the expression of a gene (e.g., the KLKB1 gene) refers to a persistent effect such as a persistent knockdown or persistent reduction in gene expression. In some embodiments, a sustained knockdown of plasma kallikrein is maintained for at least about 6 months, 9 months, 1 year, 2 years, 3 years, 4 years, 5 years or more, as measured at a time point after administration that reaches maximum reduction, for example, about 56 days after administration of the LNP composition, which is about 28 days after administration. In some embodiments, the level that is maintained can vary. In some embodiments, the reduction correlates with the desired clinical efficacy against the disorder being treated. The level of reduction to achieve the desired clinical efficacy against a given disorder, e.g., HAE, is known in the art. For example, a reduction of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more correlates with the desired clinical efficacy against a particular disorder. For example, a reduction of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more correlates with the desired clinical efficacy against HAE.

[0097] As used herein, "effective amount" or "therapeutically effective amount" refers to the amount of mRNA encoding a Cas nuclease and guide RNA capable of producing a therapeutic effect, including a decrease in the frequency of HAE attacks, a decrease in plasma kallikrein activity, a decrease in total plasma kallikrein levels, e.g., at least a 60% decrease in a subject compared to the baseline total plasma kallikrein level, or a decrease in total plasma kallikrein to less than about 20 μg / mL after administration of the mRNA encoding the Cas nuclease and the guide RNA. For example, the LNP composition may contain an effective amount of mRNA encoding a Cas nuclease and guide RNA, e.g., a guide RNA targeting KLKB1 (total RNA or total RNA). In some embodiments, the LNP composition may deliver mRNA encoding Cas9 nuclease and single guide RNA and contain an "effective amount" of RNA as measured by total RNA. In some embodiments, an effective amount of mRNA encoding Cas9 nuclease and single guide RNA reduces serum kallikrein levels in a subject by at least 60%, or 60% - 95%, 60% - 90%, 70% - 95%, 70% - 90%, or 80% - 95% compared to the baseline plasma kallikrein level, e.g., the total plasma kallikrein level. In some embodiments, an effective amount of mRNA encoding Cas9 nuclease and single guide RNA reduces total plasma kallikrein to less than about 20 μg / mL, less than about 15 μg / mL, or less than about 10 μg / mL after administration of the mRNA encoding Cas9 nuclease and the single guide RNA targeting KLKB1.

[0098] As used herein, "biosafety measure" refers to a clinical measure used to monitor safety events associated with the administration of the LNP compositions described herein to human subjects. The biosafety measure can enable the determination of safety events, including adverse events (NCI-CTCAE grade 3 or higher), serious adverse events, particularly notable adverse events, or adverse events that occur under treatment (CTCAE grade 3 or higher), as described herein. Guidelines for defining the severity of safety events (e.g., adverse events) are known in the art (e.g., the Common Terminology Criteria for Adverse Events (CTCAE), e.g., the National Cancer Institute (NCI)-CTCAE version 5.0). In some embodiments, the biosafety measure is liver enzyme levels, e.g., ALT, AST. In some embodiments, the biosafety measure is aPTT. In some embodiments, the adverse event is an infusion-related reaction (IRR), e.g., flushing, dyspnea, chest pain, syncope, rash, increased heart rate, and / or facial edema. In some embodiments, the level of the biosafety measure is measured prior to administration of the LNP composition. In some embodiments, the level of the biosafety measure is measured after administration of the LNP composition. In some embodiments, the level of the biosafety measure is measured before and after administration of the LNP composition, thereby enabling comparison of the levels of the biosafety measure before and after treatment with the LNP composition to determine a change, e.g., an acceptable change. As used herein, an "acceptable" change is a change in the level of the biosafety measure such that the resulting change does not correspond to a safety event (e.g., an adverse event (NCI-CTCAE grade 3 or higher), a serious adverse event, a particularly notable adverse event, an adverse event that occurs under treatment (CTCAE grade 3 or higher)), or an event that otherwise requires discontinuation of the investigational drug at the discretion of the clinician.In some embodiments, the level of a biosafety metric measured prior to administration of the LNP composition can function as a baseline for comparison to one or more levels of the biosafety metric measured after administration of the LNP composition (e.g., measurements taken at specific intervals after administration can be compared to the baseline level). In some embodiments, the baseline is the last available measurement obtained prior to administration of the LNP composition. In some embodiments, if the biosafety metric can be used to determine a safety event based on its value alone, no comparison to a baseline is made.

[0099] As used herein, “safe and well-tolerated” means the absence of the safety events described herein, e.g., no adverse events (NCI-CTCAE grade 3 or higher), serious adverse events, adverse events manifested under treatment (CTCAE grade 3 or higher), or events that separately require discontinuation of the investigational drug at the discretion of the clinician. In some embodiments, “safe and well-tolerated” includes patients who have experienced NCI-CTCAE grade 3 or higher adverse events unrelated to the administration of the compositions described herein, e.g., an LNP composition comprising an mRNA encoding an effective amount of a Cas nuclease and a guide RNA targeting KLKB1, or patients who have recovered, e.g., after an acceptable period for such events, with or without intervention.

[0100] In some embodiments, adverse events of particular note include, for example, infusion-related reactions (IRR) (e.g., requiring discontinuation of treatment or infusion, or grade 3 or higher); occurrence of cytokine release syndrome; occurrence of clinically significant abnormal bleeding or thrombosis or coagulation abnormalities defined by abnormal blood test results of CTCAE grade 2 or higher; CTCAE grade 2 or higher elevation in ALT, CTCAE grade 2 or higher elevation in AST, CTCAE grade 2 or higher elevation in total bilirubin, acute liver injury demonstrated by CTCAE grade 2 or higher.

[0101] In some embodiments, an adverse event is any adverse medical occurrence that is not necessarily causally related to treatment in a subject administered a test article or subjected to a test-related procedure. In some embodiments, an adverse event is an unintended sign (including abnormal laboratory findings), symptom, or disease that is temporally related to treatment, whether or not related to a (test) article. In some embodiments, an adverse event induces clinical signs or symptoms. In some embodiments, an adverse event requires active intervention. In some embodiments, an adverse event requires interruption or discontinuation of treatment. In some embodiments, an adverse event is a clinically significant abnormality in the opinion of the treating investigator. Grading criteria for adverse events are known in the art, such as the Common Terminology Criteria for Adverse Events (CTCAE), including, for example, the CTCAE of the National Cancer Institute (NCI).

[0102] Biosafety metrics generally include, for example, known clinical test evaluations related to coagulation, hematology, clinical chemistry, urine tests, and other biological analysis evaluations (e.g., cytokines, complement). Specific biosafety metrics include liver enzyme levels (e.g., an increase in alanine aminotransferase (ALT) or aspartate aminotransferase (AST) > 5 × ULN over 4 weeks after treatment, an increase in ALT or AST > 3 × ULN and total bilirubin > 2 × ULN (Hy's law) after treatment), activated partial thromboplastin time (aPTT) levels (e.g., an increase in aPTT > 5 × ULN over 4 weeks after treatment), prothrombin time (PT) levels, thrombin generation time (TGT) (e.g., maximum value, lag time, or endogenous thrombin production capacity) levels, fibrinogen levels, prothrombin international normalized (INR) ratio, levels, d-dimer levels, clinical test parameters consistent with disseminated intravascular coagulation, changes in hematology test values (e.g., abnormal blood test results above CTCAE grade 2 after treatment), changes in chemistry test values, changes in coagulation, changes in urine tests, glutamate dehydrogenase levels, C-reactive protein levels, complement (C3a, C5a, Bb) levels, cytokine (GM-CSF, INF-g, IL-1b, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, IL-23, TNF-a, IL-17, MCP-1) levels, acute liver injury (e.g., an increase in ALT, AST, total bilirubin above CTCAE grade 2 after treatment or clinically significant symptoms / signs of liver injury), and changes in 12-lead electrocardiogram, but are not limited thereto. Additional biosafety metrics, including those related to the administration of the LNP composition, are known in the art. Similarly, acceptable levels or changes in biosafety metrics are also known in the art and can be evaluated by conventional methods, e.g., by a clinician or a clinical test.

[0103] As used herein, "clinical efficacy measure" refers to a measure used to evaluate the improvement of a disease in a human subject treated with the LNP compositions described herein. In some embodiments, the level of the clinical efficacy measure is measured after administration of the LNP composition. In some embodiments, the level of the clinical efficacy measure is measured before and after administration of the LNP composition, thereby allowing comparison of the levels of the clinical efficacy measure before and after treatment with the LNP composition. In some embodiments, the efficacy measure is determined over time, for example, the frequency of attacks per month, e.g., the average frequency of attacks per month over a predetermined period, e.g., a 3-month period (e.g., reduction in the number of HAE attacks, breakthrough attacks, the number or percentage of patients without attacks over a predetermined period, the frequency of hospitalizations related to HAE attacks, or the frequency of use of acute therapies related to HAE attacks). In some embodiments, the level of the clinical measure measured before administration of the LNP composition can function as a baseline or control for comparison to one or more levels of the clinical measure measured after administration of the LNP composition, immediately after administration of the LNP, or after an interval allowing onset of action of the LNP composition (e.g., measured from 29 days after administration of the LNP composition). In some embodiments, the baseline is the last available measurement obtained before administration of the LNP composition.

[0104] In the case of a disorder characterized by HAE attacks, clinical efficacy measures include, but are not limited to, a decrease in total plasma kallikrein protein levels (e.g., a 60% decrease in total plasma kallikrein protein measured, for example, by ELISA after therapeutic administration), a decrease in plasma total kallikrein activity (e.g., at least a 60% decrease in plasma kallikrein activity). Additional clinical efficacy measures include the frequency of HAE attacks (e.g., the number of HAE attacks, breakthrough attacks, the number or proportion of patients without attacks over a given period, the frequency of hospitalizations related to HAE attacks, or a decrease in the frequency of use of acute therapy related to HAE attacks), and the severity of HAE attacks. Methods for confirming HAE attacks and methods for grading HAE attacks are provided herein. The criteria for a "confirmed" HAE attack are provided below. In some embodiments, a "confirmed" HAE attack is as determined by a physician.

[0105] Similarly, “clinically significant improvement” in a clinical efficacy measure, i.e., a level or change in a clinical efficacy measure (s) indicating improvement of a disease, including HAE attack frequency, e.g., confirmed HAE attack frequency, and HAE attack severity, is known in the art and can be evaluated by conventional methods, e.g., by medical personnel or clinical tests. For example, plasma kallikrein protein levels, e.g., total plasma kallikrein protein levels, are a clinical efficacy measure for HAE. “Clinically significant improvement” in this clinical efficacy measure for the treatment of HAE includes a decrease in total plasma kallikrein protein levels of at least 60%, 70%, 80%, 85%, 90%, or 95% starting from a baseline, e.g., compared to before treatment with the LNP composition described herein, e.g., after treatment, e.g., immediately after treatment or at a predefined period after treatment. For example, a decrease in the HAE attack frequency, e.g., the attack frequency confirmed per month, e.g., the average attack frequency confirmed per month over a period of 3 months or 6 months, is also a clinical efficacy measure for HAE. “Clinically significant improvement” in this clinical efficacy measure for the treatment of HAE includes a decrease in the attack frequency after treatment of at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95% compared to a baseline, e.g., before treatment with the LNP composition described herein.

[0106] As used herein, the term “lipid nanoparticle” (LNP) refers to a particle comprising a plurality (i.e., two or more) of lipid molecules that physically associate with each other by intermolecular forces and encapsulate RNA. See, e.g., WO2017173054 and WO2019067992, the contents of which are hereby incorporated by reference in their entirety.

[0107] As used herein, the term "pharmaceutically acceptable" generally means non-toxic, not biologically undesirable, and otherwise acceptable for pharmaceutical use, and is useful in the preparation of pharmaceutical compositions. In certain embodiments, the pharmaceutically acceptable composition is sterile. In certain embodiments, the pharmaceutically acceptable composition is non-pyrogenic.

[0108] As used herein, systemic administration can be intravenous infusion. "Infusion" refers to the active administration of one or more agents, for example, over an infusion time of approximately 2 hours. In some embodiments, the infusion time is completed within 6 hours from the opening of the vial(s) containing the LNP composition. In some embodiments, for example, an LNP containing the mRNA encoding the Cas9 nuclease described herein and the sgRNA described herein is systemically administered to a human subject.

[0109] As used herein, "pre-infusion prophylaxis" refers to a regimen administered to a subject prior to treatment (including, for example, administration of an LNP), for example, 8 mg of oral dexamethasone or an equivalent amount 8 - 24 hours prior to the LNP composition; and intravenous steroids (e.g., 10 mg of dexamethasone) approximately 1 - 2 hours prior to administration of the LNP composition; intravenous H1 blocker (e.g., 50 mg of diphenhydramine) or oral H1 blocker (e.g., 10 mg of cetirizine); and intravenous or oral H2 blocker (e.g., 20 mg of famotidine) administration.

[0110] I. Compositions Targeting Genes Disclosed herein are methods for editing a target gene (e.g., KLKB1) in the liver of a human subject, methods for modifying the genes of a subject's hepatocytes, or methods for treating a disease, and related compositions including compositions for use in such methods. Generally, disclosed herein is an LNP composition comprising a Cas nuclease, e.g., an mRNA encoding Cas9, and a guide RNA targeting a gene, e.g., a guide RNA targeting the KLKB1 gene. Subjects treated with such methods and compositions, e.g., subjects with HAE, may have a wild-type or non-wild-type target gene sequence.

[0111] In some embodiments, the methods disclosed herein include systemic administration of a lipid nanoparticle system for in vivo liver delivery of a guide RNA and an mRNA encoding a Cas nuclease.

[0112] 1. Guide RNA (gRNA) The single guide RNA used in the disclosed methods and compositions comprises a guide sequence targeting a target gene (e.g., the KLKB1 gene) comprising at least 18 contiguous nucleotides, preferably 20 nucleotides of the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15).

[0113] In the case of sgRNA, the guide sequence may further include additional nucleotides to form the sgRNA. For example, the following exemplary nucleotide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 387) is included on the 3' side of the 3' end of the guide sequence in the 5'→3' direction, and an sgRNA containing the nucleotide sequence GGAUUGCGUAUGGGACACAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 388) can be obtained. In an alternative embodiment, the sgRNA may include the following exemplary nucleotide sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (SEQ ID NO: 389) on the 3' side of the 3' end of the guide sequence. In an alternative embodiment, the sgRNA may include the following exemplary nucleotide sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAUGGCACCGAGUCGGUGC (SEQ ID NO: 390) on the 3' side of the 3' end of the guide sequence.

[0114] In some embodiments, the sgRNA is modified. In some embodiments, the sgRNA comprises a 5' end modification, a 3' end modification, or both a 5' end and a 3' end modification. In some embodiments, the sgRNA comprises a modification pattern shown in SEQ ID NO: 391 below, and the modified sgRNA has the following sequence: mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 391), where A, C, G, and U represent RNA nucleosides (2'-OH) adenine, cytosine, guanine, and uridine, respectively, and mA, mC, mG, and mU represent 2'-O-methyl modified adenine, cytosine, guanine, and uridine, respectively, and * represents a phosphorothioate bond.

[0115] In some embodiments, the gRNA comprises a guide sequence that directs a Cas9 nuclease, such as SpyCas9 nuclease, to a target DNA sequence. The sgRNA comprises 18, 19, or 20 consecutive nucleotides of the targeting sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15).

[0116] The single guide RNAs provided herein are useful for recognizing a target sequence of the KLKB1 genomic locus by hybridization of the targeting sequence with the target sequence. For example, the target gene target sequence is recognized and cleaved by a provided Cas9 cleavage enzyme comprising the guide RNA. Thus, a Cas9 cleavage enzyme, such as Spy Cas9 cleavage enzyme, is directed by the guide RNA to the target sequence of the KLKB1 genomic locus, the guide sequence of the guide RNA hybridizes with the target sequence, and a Cas9 cleavage enzyme, such as Spy Cas9 cleavage enzyme, cleaves within the target sequence of the genomic locus.

[0117] 2. Modification of gRNA In some embodiments, the gRNA is chemically modified. A gRNA containing one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or "chemically modified" gRNA, used instead of or in addition to the canonical A, G, C, and U residues, to account for the presence of one or more non-natural or naturally occurring components or configurations. In some embodiments, the modified gRNA is synthesized with non-canonical nucleosides or nucleotides and is referred to herein as "modified."

[0118] Modified guide RNAs can include nucleosides or nucleoside analogs having nitrogen-containing heterocyclic bases or base analogs that are covalently bonded together along a backbone, including conventional RNAs, DNAs, hybrid RNA-DNAs, and polymers that are analogs thereof. The guide RNA "backbone" can be composed of various linkages including one or more of a sugar-phosphate diester bond, a phosphorothioate bond, or combinations thereof. The sugar moiety of the guide RNA can be ribose, deoxyribose, or a similar compound with substitutions such as 2'-methoxy. The nitrogen-containing bases are conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine); inosine; derivatives of purines or pyrimidines (e.g., 4 N-methyl-deoxyguanosine, deaza-purines or aza-purines, deaza-pyrimidines or aza-pyrimidines, pyrimidine bases with substituents at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with substituents at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, 6 O-methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and 4 O-alkyl-pyrimidines; (U.S. Patent No. 5,378,825 and PCT No. WO93 / 13121). For a general description of chemical modifications of guide RNAs, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11th See, e.g., (ed., 1992). Guide RNAs may contain only conventional RNA or DNA sugars, bases, and linkages, or both conventional components and substitutions (e.g., conventional bases with 2'-methoxy linkages, or polymers containing both conventional bases and one or more base analogs). RNA and DNA have different sugar moieties and may differ by the presence of uracil or its analogs in RNA, or thymine or its analogs in DNA.

[0119] Unmodified nucleic acids may be susceptible to degradation by, for example, intracellular nucleases or nucleases found in serum. For example, nucleases can hydrolyze the phosphodiester bonds of nucleic acids. Thus, in one aspect, the gRNAs described herein can contain one or more modified nucleosides or nucleotides to introduce, for example, stability against nucleases present in cells or serum.

[0120] A phosphorothioate (PS) linkage or bond refers to a bond in which sulfur replaces one of the non-bridging phosphate oxygens in a phosphodiester bond, such as a bond between nucleotide bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos.

[0121] A "*" can be used to indicate a PS modification. In this application, the terms A*, C*, U*, or G* can be used to indicate a nucleotide that is linked by a PS bond to the following (e.g., 3') nucleotide.

[0122] In this application, the terms "mA*", "mC*", "mU*", or "mG*" can be used to represent a nucleotide that is substituted with 2'-O-Me and is linked by a PS bond to the next (e.g., 3') nucleotide.

[0123] The following figure shows the substitution of S- for non-bridging phosphoryl oxygen to generate a PS bond instead of a phosphodiester bond: [Chemical formula]

[0124] In some embodiments, one or more of the first 3, 4, or 5 nucleotides at the 5' end and one or more of the last 3, 4, or 5 nucleotides at the 3' end are modified. In some embodiments, the modification is 2'-O-Me, 2'-F, inverted abasic nucleotide, PS bond, or other nucleotide modification well known in the art for enhancing stability or performance.

[0125] In some embodiments, the first 4 nucleotides at the 5' end and the last 4 nucleotides at the 3' end are linked by phosphorothioate (PS) bonds.

[0126] In some embodiments, the first 3 nucleotides at the 5' end and the last 3 nucleotides at the 3' end include, for example, 2'-O-methyl (2'-O-Me) modified nucleotides.

[0127] In some embodiments, the guide RNA includes a modified sgRNA. In some embodiments, the sgRNA includes a modification pattern shown in SEQ ID NO: 391, where N is any natural or unnatural nucleotide, and the entirety of N constitutes a guide sequence that directs the nuclease to the target sequence.

[0128] In some embodiments, the guide RNA comprises an sgRNA shown in any one of Table 2 of WO2021158858A1, the content of which is incorporated herein by reference in its entirety. In some embodiments, the guide RNA comprises an sgRNA comprising any one of the guide sequences in Table 1 of WO2021158858A1, the content of which is incorporated herein by reference in its entirety, and the guide sequence may be modified as shown in SEQ ID NO: 391. In some embodiments, the guide RNA comprises an sgRNA shown in any one of Table 24 or Table 25.

[0129] 3. RNA comprising an open reading frame encoding a Cas9 nuclease Any RNA comprising an ORF encoding a Cas9 nuclease such as S. pyogenes Cas9 disclosed herein can be combined with the sgRNA disclosed herein in a composition or method. In any of the embodiments described herein, the nucleic acid comprising an open reading frame encoding a Cas9 nuclease can be an mRNA.

[0130] Codon corresponding to a codon that improves protein expression or a highly expressed tRNA; exemplary codon sets In some embodiments, the nucleic acid comprises an ORF having codons that improve protein expression in mammals such as humans. In further embodiments, the nucleic acid comprises an ORF having codons that improve protein expression in organs such as the human liver. In further embodiments, the nucleic acid comprises an ORF having codons that improve protein expression in cell types such as human hepatocytes. Improvement of protein expression in hepatocytes, the liver, or in humans, etc., can be determined relative to the degree of translation of the wild-type sequence of the ORF, or relative to an ORF having a codon distribution that matches the codon distribution of another organism that is most similar at the biological or amino acid level to the organism from which the ORF is derived, e.g., S. pyogenes, S. aureus, or a Cas nuclease from a prokaryote, e.g., a Cas nuclease from another prokaryote as described hereinafter. Alternatively, in some embodiments, improvement of protein expression of the Cas9 sequence in mammals, cell types, mammalian organs, humans, human organs, etc., is determined relative to the translation of an ORF comprising the sequence of SEQ ID NO: 393 (Table 23), with all other conditions being the same, including any applicable point mutations, heterologous domains, etc. Codons useful for increasing expression in humans, including human liver and human hepatocytes, can be codons corresponding to tRNAs that are highly expressed in human liver / hepatocytes, as discussed in Dittmar KA, PLos Genetics 2(12):e221 (2006). In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons within the ORF are codons corresponding to tRNAs that are highly expressed in mammals such as humans (e.g., the most highly expressed tRNA for each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons within the ORF are codons corresponding to tRNAs that are highly expressed in mammalian organs such as human organs (e.g., the most highly expressed tRNA for each amino acid).In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons within the ORF are codons corresponding to tRNAs that are highly expressed in the liver of a mammal, such as the human liver (e.g., the tRNA most highly expressed for each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons within the ORF are codons corresponding to tRNAs that are highly expressed in hepatocytes of a mammal, such as human hepatocytes (e.g., the tRNA most highly expressed for each amino acid).

[0131] Alternatively, codons corresponding to tRNAs that are highly expressed in a general organism (e.g., human) may be used. Various codon usage schemes are known in the art (see, e.g., WO2019067910, WO2020198641) and can be applied to the ORFs provided herein.

[0132] Exemplary sequences In some embodiments, the ORF encoding the Cas nuclease comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to any of SEQ ID NOs: 393 - 407, 392, and 408.

[0133] In some embodiments, the mRNA comprises an ORF encoding the Cas nuclease, and the Cas nuclease comprises an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to any of SEQ ID NOs: 406 - 407.

[0134] In some embodiments, the ORF encoding the Cas nuclease comprises a sequence codon-optimized according to the sequences provided in Table 3 from a sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to any of SEQ ID NOs: 393-407, 392, and 408, or any of SEQ ID NOs: 393-407, 392, and 408.

[0135] As used herein, when an alignment of a first sequence and a second sequence indicates that X% or more of all positions of the second sequence match the first sequence, the first sequence is considered to "comprise a sequence having at least X% identity" to the second sequence. Exemplary alignment algorithms include the Smith-Waterman and Needleman-Wunsch algorithms well known in the art. One of ordinary skill in the art will know which algorithm and parameter settings are appropriate for aligning a given pair of sequences. For sequences of generally similar length and with expected identity >50% for amino acids or >75% for nucleotides, the Needleman-Wunsch algorithm with the default settings of the Needleman-Wunsch algorithm interface provided by the EBI at the web server of www.ebi.ac.uk is generally appropriate.

[0136] Additional Features of RNA, mRNA, and ORF Any of the additional features described herein can be combined as long as they can be implemented in any of the above-described embodiments.

[0137] Encoded Cas Nuclease In some embodiments, the Cas9 nuclease has cleavage enzyme activity, which may also be referred to as double-strand endonuclease activity. Examples of Cas9 nucleases include those from the type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes, as well as modified forms thereof (e.g., engineered or mutant forms). See, for example, US20160312198; US20160312199.

[0138] PolyA tail In some embodiments, the RNA (e.g., mRNA) further comprises a polyadenyl (polyA) tail. In some cases, the polyA tail is "interrupted" by one or more non-adenine nucleotides "anchors" at one or more positions within the polyA tail, for example, when encoded by a plasmid. The polyA tail can comprise at least 8 consecutive adenine nucleotides, and in some embodiments, the polyA tail also comprises one or more non-adenine nucleotides. As used herein, "non-adenine nucleotide" refers to any natural or non-natural nucleotide that does not contain adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, the polyA tail on a polynucleotide (e.g., mRNA) described herein can comprise consecutive adenine nucleotides located 3' to the Cas nuclease or the nucleotides encoding the target sequence. In some cases, the polyA tail on the mRNA comprises non-consecutive adenine nucleotides located 3' to the Cas nuclease or the nucleotides encoding the target sequence, and the non-adenine nucleotides interrupt the adenine nucleotides at regular or irregular intervals.

[0139] In some embodiments, the polyA tail is encoded in the plasmid used for in vitro transcription of the mRNA and becomes part of the transcript. The polyA sequence encoded in the plasmid, i.e., the number of consecutive adenine nucleotides in the polyA sequence, need not be exact. For example, 100 polyA sequences (SEQ ID NO: 410) in the plasmid can result in up to 100 polyA sequences (SEQ ID NO: 410) in the transcribed mRNA. In some embodiments, the encoded polyA tail is about 90 or 95 nucleotides in length. In some embodiments, the polyA tail is not encoded in the plasmid and is added using PCR tailing or enzymatic tailing, e.g., E. coli poly(A) polymerase.

[0140] UTR; Kozak sequence In some embodiments, the RNA (e.g., mRNA) encoding the Cas nuclease comprises a 5’UTR, a 3’UTR, or both a 5’UTR and a 3’UTR. In some embodiments, the RNA (e.g., mRNA) comprises at least one UTR derived from hydroxysteroid 17-beta dehydrogenase 4 (HSD17B4 or HSD), e.g., a 5’UTR derived from HSD. In some embodiments, the RNA (e.g., mRNA) comprises at least one UTR derived from globin mRNA, e.g., human alpha globin (HBA) mRNA, human beta globin (HBB) mRNA, or Xenopus laevis beta globin (XBG) mRNA. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5’UTR, a 3’UTR, or both a 5’UTR and a 3’UTR derived from globin mRNA such as HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5’UTR derived from bovine growth hormone, cytomegalovirus (CMV), mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 3’UTR derived from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises both a 5’UTR and a 3’UTR derived from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, XBG, heat shock protein 90 (Hsp90), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta-actin, alpha-tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).

[0141] In some embodiments, the polynucleotide (e.g., mRNA) comprises both a 5’UTR and a 3’UTR derived from constitutively expressed mRNA from the same source, e.g., actin, albumin, or globin such as HBA, HBB, or XBG.

[0142] In some embodiments, the polynucleotide (e.g., mRNA) comprises a Kozak sequence. Kozak sequences are known in the art. Kozak sequences can affect translation initiation and the overall yield of the polypeptide translated from the nucleic acid. The Kozak sequence contains a methionine codon that can function as a start codon. The minimal Kozak sequence is NNNRUGN, where at least one of the following is true: the first N is A or G, and the second N is G. In the context of a nucleotide sequence, R means a purine (A or G). In some embodiments, the Kozak sequence is gccgccRccAUGG (SEQ ID NO: 392) with zero mismatches or at most 1, 2, 3, or 4 mismatches relative to the lower case positions.

[0143] Modified nucleotide In some embodiments, the mRNA comprising an ORF encoding Cas9 nuclease contains modified uridine at some or all uridine positions. In some embodiments, the modified uridine is uridine modified at the 5-position, for example, with a halogen or a C1-C3 alkoxy. In some embodiments, the modified uridine is pseudouridine modified at the 1-position, for example, with a C1-C3 alkyl. The modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In certain embodiments, the mRNA contains N1-methyl-pseudouridine at all uridine positions.

[0144] In some embodiments, at least 80%, 85%, 90%, 95%, 98%, or 99%; or 100% of the uridine positions in the nucleic acid are modified uridine. In some embodiments, 80-95% or 90-100% of the uridine positions in the nucleic acid are modified uridine, such as N1-methylpseudouridine, pseudouridine, or a combination thereof. In some embodiments, 80-95% or 90-100% of the uridine positions in the nucleic acid are pseudouridine. In some embodiments, 80-95% or 90-100% of the uridine positions in the nucleic acid are N1-methylpseudouridine.

[0145] 5’ cap In some embodiments, an mRNA comprising an ORF encoding a Cas nuclease (e.g., Cas9) comprises a 5’ cap such as Cap0, Cap1, or Cap2. A 5’ cap is generally a 7-methylguanosine ribonucleotide linked via a 5’-triphosphate to the 5’ position of the first nucleotide of the 5’-3’ strand of the nucleic acid, i.e., the first cap-proximal nucleotide (which may be further modified as described below for ARCA). In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both contain a 2’-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the mRNA contain 2’-methoxy and 2’-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both contain 2’-methoxy. See, e.g., Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30, Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115.

[0146] The cap can be included in the RNA by co-transcription. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanosine 3'-methoxy-5'-triphosphate linked to the 5' position of a guanine ribonucleotide that can be incorporated in vitro into the transcription product at the start. By ARCA, a Cap0 cap is generated in which the 2' position of the first cap-proximal nucleotide is a hydroxyl. See, for example, Stepinski et al., (2001) “Synthesis and properties of mRNAs containing the novel ‘anti-reverse’ cap analogs 7-methyl(3’-O-methyl)GpppG and 7-methyl(3’deoxy)GpppG,” RNA 7:1486-1495. The structure of ARCA is shown below. [Chemical formula]

[0147] To obtain the Cap1 structure by co-transcription, CleanCap™ AG (m7G(5’)ppp(5’)(2’OMeA)pG, TriLink Biotechnologies catalog number N-7113) or CleanCap™ GG (m7G(5’)ppp(5’)(2’OMeG)pG, TriLink Biotechnologies catalog number N-7133) can be used. 3’-O-methylated forms of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies under catalog numbers N-7413 and N-7433, respectively. The structure of CleanCap™ AG is shown below. The structure of CleanCap™ may also be referred to herein using the last three digits of the above catalog numbers (e.g., for TriLink Biotechnologies catalog number N-7113, “CleanCap™ 113”). [Chem.]

[0148] Alternatively, the cap can also be added to the RNA after transcription. For example, vaccinia capping enzymes are commercially available (New England Biolabs catalog number M2080S), which have RNA triphosphatase activity and guanylyltransferase activity provided by their D1 subunit, as well as guanine methyltransferase provided by their D12 subunit. Therefore, in the presence of S-adenosylmethionine and GTP, 7-methylguanine can be added to the RNA to give Cap0. See, for example, Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479. For further discussion of caps and capping approaches, see, for example, WO2017 / 053297 and Ishikawa et al., Nucl. Acids. Symp. Ser. (2009) No. 53, 129-130.

[0149] 4. Delivery of Nucleic Acid Compositions In some embodiments, provided is a method of inducing double-strand breaks (DSBs) or gene editing in KLKB1, comprising systemic administration of a composition comprising the guide RNA described herein. In some embodiments, the guide RNA is systemically administered to induce DSBs in KLKB1. The guide RNA is systemically administered together with an mRNA encoding a Cas9 nuclease, such as S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas9 nuclease are systemically administered in an LNP described herein, such as an LNP comprising an ionizable lipid referred to herein as lipid A ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also referred to as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate). In further embodiments, the LNP comprises a lipid component comprising lipid A, a helper lipid (such as cholesterol), a stealth lipid (such as a PEG lipid such as PEG2k-DMG), and a neutral lipid (such as DSPC).

[0150] In some embodiments, provided is a method of inducing a double-strand break (DSB) within the KLKB1 gene, comprising systemic administration of an LNP composition comprising a single-guide RNA, such as a chemically modified single-guide RNA. The guide RNA is systemically administered together with an mRNA encoding a Cas9 nuclease, such as S. pyogenes Cas9, described herein. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas nuclease are systemically administered in an LNP described herein, such as an LNP comprising lipid A, helper lipid (e.g., cholesterol), stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and a neutral lipid (e.g., DSPC).

[0151] In some embodiments, provided is a method of modifying the KLKB1 gene, comprising systemic administration of a composition comprising a single-guide RNA, such as a chemically modified single-guide RNA. The guide RNA is systemically administered together with an mRNA encoding a Cas9 nuclease, such as S. pyogenes Cas9, described herein. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas nuclease are systemically administered in an LNP described herein, such as an LNP comprising lipid A, helper lipid (e.g., cholesterol), stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0152] In some embodiments, provided is a method of treating HAE that includes systemic administration of a composition comprising a single-guide RNA targeting the KLKB1 gene. The guide RNA is systemically administered with a Cas9 nuclease, such as the mRNA described herein encoding S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acids encoding the guide RNA and the Cas nuclease are systemically administered in an LNP described herein, such as an LNP comprising lipid A, helper lipid (e.g., cholesterol), stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and a neutral lipid (e.g., DSPC).

[0153] In some embodiments, provided is a method of reducing plasma kallikrein protein levels or activity that includes systemic administration of a guide RNA targeting the KLKB1 gene. In some embodiments, the gRNA is systemically administered to reduce plasma kallikrein protein levels or activity. In some embodiments, the plasma kallikrein protein level is the total plasma kallikrein protein level. The gRNA is systemically administered with a nucleic acid encoding a Cas9 nuclease, such as S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the mRNA encoding the guide RNA and the Cas nuclease are systemically administered in an LNP described herein, such as an LNP comprising lipid A, helper lipid (e.g., cholesterol), stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and a neutral lipid (e.g., DSPC).

[0154] In some embodiments, the gRNA comprising the guide sequence induces a DSB with a Cas9 nuclease translated from a nucleic acid, and a mutation occurs in the KLKB1 gene by non-homologous end joining (NHEJ) during repair. In some embodiments, the NHEJ results in a deletion or insertion of nucleotide(s), thereby inducing a frameshift or nonsense mutation in the KLKB1 gene.

[0155] 5. Lipid Composition In some embodiments, the nucleic acid compositions described herein that contain nucleic acids encoding gRNA and a Cas nuclease, such as Cas9, are formulated in lipid nanoparticles or systemically administered via lipid nanoparticles. For example, reference is made to WO2017173054A1 entitled "LIPID NANOPARTICLE FORMULATIONS FOR CRISPR / CAS COMPONENTS" and WO2019067992A1 entitled "FORMULATIONS", the contents of which, particularly the LNP compositions disclosed therein, are incorporated herein by reference in their entirety. Lipid nanoparticles (LNPs), which are known to those skilled in the art to enable delivery of therapeutic RNA, can be utilized together with the nucleic acids encoding the guide RNA and nuclease described herein.

[0156] Compositions containing LNPs can include two active substances, guide RNA and a Cas nuclease, such as RNA encoding a Cas9 nuclease such as Spy.Cas9 nuclease, together with a lipid component containing an ionizable lipid. A lipid nanoparticle means a particle containing a plurality (i.e., two or more) of lipid molecules physically associated with each other by intermolecular forces.

[0157] Ionizable Lipid The lipid composition for delivering CRISPR / Cas mRNA and guide RNA components to liver cells can contain Lipid A, which is (9Z,12Z)-3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, and this is also called 3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate. Lipid A is

Chemical Structure

[0158] Lipid A can be synthesized according to WO2015 / 095340 (for example, pp. 84-86).

[0159] Additional lipid Examples of "neutral lipids" suitable for use in the lipid compositions of the present disclosure include, for example, various neutral lipids, uncharged lipids, or zwitterionic lipids. Examples of neutral phospholipids suitable for use in the present disclosure are 5-heptadecylbenzene-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), phosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauroylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoylphosphatidylcholine (MPPC), 1-palmitoyl-2-myristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stearoylphosphatidylcholine (PSPC), 1,2-diarachidonoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoylphosphatidylcholine (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoylphosphatidylcholine (POPC), lysophosphatidylcholine, dioleoylphosphatidylethanolamine (DOPE), dilinoleoylphosphatidylcholine distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), palmitoyloleoylphosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and combinations thereof, but are not limited thereto. In one embodiment, the neutral phospholipid can be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoylphosphatidylethanolamine (DMPE). In another embodiment, the neutral phospholipid can be distearoylphosphatidylcholine (DSPC).

[0160] "Helper lipids" include steroids, sterols, and alkylresorcinols. Helper lipids suitable for use in the present disclosure include, but are not limited to, cholesterol, 5-heptadecylresorcinol, and cholesteryl hemisuccinate. In one embodiment, the helper lipid can be cholesterol.

[0161] "Stealth lipids" are lipids that change the length of time nanoparticles can exist in vivo (e.g., in the blood), and the stealth lipid can be a PEG lipid. The stealth lipid can assist in the formulation process, for example, by reducing particle aggregation and controlling the particle size. The stealth lipid used herein can modulate the pharmacokinetic properties of the LNP. Stealth lipids suitable for use in the lipid compositions of the present disclosure include, but are not typical, PEG lipids that include a lipid moiety and a polymer moiety based on PEG. PEG lipids known in the art are contemplated, including lipids containing "PEG-2K", also known as "PEG 2000", having an average molecular weight of about 2,000 daltons. PEG-2K is represented herein by the following formula (I), where n is 45, which means it contains subunits with a number average degree of polymerization of about 45. However, other PEG embodiments known in the art may be used.

Chemical formula

[0162] In any of the embodiments described herein, the PEG lipid may be selected from PEG-dilauroylglycerol, PEG-dimyristoyl glycerol (PEG-DMG) (product number GM-020, manufactured by NOF (Tokyo, Japan)), PEG-dipalmitoyl glycerol, PEG-distearoyl glycerol (PEG-DSPE) (product number DSPE-020CN, NOF, Tokyo, Japan), PEG-dilauryl glycamide, PEG-dimyristyl glycamide, PEG-dipalmitoyl glycamide, and PEG-distearoyl glycamide, PEG-cholesterol (1-[8’-(cholesta-5-en-3[beta]-oxy) carboxamide-3’,6’-dioxaoctanyl] carbamoyl-[omega]-methyl-poly(ethylene glycol)), PEG-DMB (3,4-ditetradecyloxybenzyl-[omega]-methyl-poly(ethylene glycol) ether), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DMPE), or 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol-2000 (PEG2k-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSPE) (product number 880120C, manufactured by Avanti Polar Lipids (Alabaster, Alabama, USA)), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG2k-DSG; GS-020, NOF Tokyo, Japan), poly(ethylene glycol)-2000-dimethacrylate (PEG2k-DMA), and 1,2-distearyloxypropyl-3-amine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSA). In one embodiment, the PEG lipid may be PEG2k-DMG.

[0163] In some embodiments, the PEG lipid contains a glycerol group. In some embodiments, the PEG lipid contains a dimyristoyl glycerol (DMG) group. In some embodiments, the PEG lipid contains PEG2k. In some embodiments, the PEG lipid is PEG-DMG. In some embodiments, the PEG lipid is PEG2k-DMG. In some embodiments, the PEG lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000. In some embodiments, PEG2k-DMG is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000.

[0164] LNP formulation The LNP composition may include a lipid component and an RNA component including Cas nuclease mRNA (e.g., Cas9 mRNA, e.g., Spy.Cas9 mRNA) and a gRNA targeting KLKB1. In some embodiments, the LNP composition includes mRNA encoding Cas9 nuclease and gRNA as the RNA component. In certain embodiments, the LNP composition may include an RNA component, lipid A, helper lipid, neutral lipid, and stealth lipid. In a particular LNP composition, the helper lipid is cholesterol. In a particular composition, the neutral lipid is DSPC. In additional embodiments, the stealth lipid is PEG2k-DMG.

[0165] In certain embodiments, the lipid composition is represented according to the respective molar ratios of the component lipids in the formulation. Embodiments of the present disclosure provide lipid compositions described according to the respective molar ratios of the component lipids in the formulation. In one embodiment, the mole % of ionizable lipid, such as Lipid A, is from about 40 mole % to 60 mole %, optionally about 50 mole %. In one embodiment, the mole % of ionizable lipid is about 55 mole %. In some embodiments, the mole % of ionizable lipid in the LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target mole %. In some embodiments, the mole % of ionizable lipid in the LNP batch is ±4 mole %, ±3 mole %, ±2 mole %, ±1.5 mole %, ±1 mole %, ±0.5 mole %, or ±0.25 mole % of the target mole %. All of the mole % numbers are given as percentages of the lipid components of the LNP composition.

[0166] In one embodiment, the mole % of neutral lipid, e.g., neutral phospholipid, is from about 5 mole % to 15 mole %, optionally about 9 mole %. In some embodiments, the mole % of neutral lipid in the LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target neutral lipid mole %.

[0167] In one embodiment, the mole % of helper lipid is from about 20 mole % to 60 mole %. In one embodiment, the mole % of helper lipid is from about 25 mole % to 55 mole %, optionally the mole % of helper lipid is from about 30 mole % to 40 mole %. In one embodiment, the mole % of helper lipid is adjusted based on the ionizable lipid, neutral lipid, and PEG lipid concentrations such that the lipid components total 100 mole %. In one embodiment, the mole % of helper lipid is adjusted based on the ionizable lipid and PEG lipid concentrations such that the lipid components total at least 99 mole %. In some embodiments, the mole % of helper lipid in the LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target mole %.

[0168] In one embodiment, the mol% of the PEG lipid is from about 1 mol% to 10 mol%. In one embodiment, the mol% of the PEG lipid is from about 2 mol% to 4 mol%. In one embodiment, the mol% of the PEG lipid is from about 2.5 mol% to 4 mol%. In one embodiment, the mol% of the PEG lipid is about 3 mol%. In some embodiments, the mol% of the PEG lipid in the LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target PEG lipid mol%.

[0169] In certain embodiments, the cargo comprises a nucleic acid (e.g., mRNA) encoding Cas9 nuclease and an sgRNA. In some embodiments, the ionizable lipid is lipid A. In some embodiments, the LNP composition comprises an ionizable lipid (e.g., lipid A), a neutral lipid, a helper lipid, and a PEG lipid. In certain embodiments, the helper lipid is cholesterol. In certain embodiments, the neutral lipid is DSPC. In certain embodiments, the PEG lipid is PEG2k-DMG. In some embodiments, the LNP composition may comprise lipid A, a helper lipid, a neutral lipid, and a PEG lipid. In additional embodiments, the LNP composition comprises lipid A, cholesterol, DSPC, and PEG2k-DMG.

[0170] Embodiments of the present disclosure also provide lipid compositions represented by the molar ratio between the positively charged ionizable group (N) of the ionizable lipid and the negatively charged phosphate group (P) of the encapsulated nucleic acid. This is mathematically represented by the N / P ratio. In some embodiments, the LNP composition can include a lipid component comprising an ionizable lipid, a helper lipid, a neutral lipid, and a PEG lipid, and a nucleic acid component, wherein the N / P ratio is from about 3 to 10. In some embodiments, the N / P ratio is from about 5 to 7, and optionally, the N / P ratio is about 6. In some embodiments, the N / P ratio is 6 ± 1. In some embodiments, the N / P ratio is 6 ± 0.5. In some embodiments, the N / P ratio is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target N / P ratio.

[0171] In some embodiments, the RNA component includes mRNA such as the nucleic acids disclosed herein encoding Cas9 nuclease, e.g., Spy Cas9 nuclease mRNA and sgRNA described herein. In any of the foregoing embodiments, the sgRNA is the chemically modified sgRNA described herein.

[0172] In certain embodiments, the LNP composition includes Cas9 nuclease mRNA (such as SpyCas9 mRNA) described herein and sgRNA described herein. In certain embodiments, the LNP composition includes Cas9 nuclease mRNA such as Spy Cas9 nuclease mRNA and sgRNA in a ratio of about 10:1 to 1:10, e.g., about 1:1, 1:2, or 1:3.

[0173] In some embodiments, the LNPs are formed by mixing an aqueous RNA solution with an organic solvent-based lipid solution, such as 100% ethanol. Suitable solutions or solvents can include, or can contain, water, PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, diethyl ether, cyclohexane, tetrahydrofuran, methanol, isopropanol. A pharmaceutically acceptable buffer, for example for in vivo administration of the LNPs, can be used.

[0174] In some embodiments, microfluidic mixing, T-junction mixing, or cross mixing is used. In certain aspects, the flow rate, the size of the junction, the geometry of the junction, the shape of the junction, the diameter of the tube, the solution, or the concentration of the RNA and lipid may be varied. The LNPs or LNP compositions can be concentrated or purified, for example, via dialysis, tangential flow filtration, or chromatography. The LNPs can be composed of four lipids including lipid A, DSPC, cholesterol, and DMG-PEG2k. In some embodiments, the LNPs are formulated by suspending them in an aqueous buffer of 50 mM Tris, 45 mM NaCl, and 5% (w / v) sucrose, pH 7.4.

[0175] Dynamic light scattering (''DLS'') can be used to perform characterization analysis of the polydispersity index (pdi) and size of the LNPs of the present disclosure. In DLS, the scattering of light obtained by exposing a sample to a light source is measured. The PDI determined from DLS measurements represents the particle size (approximate average particle size) distribution in a population, and in a completely uniform population, the PDI is zero.

[0176] In some embodiments, the LNPs disclosed herein have a size of 50 to 100 nm. In some embodiments, the LNPs have a size of 85 to 90 nm. Unless otherwise stated, all sizes referred to herein are the average size (diameter) of fully formed nanoparticles measured by dynamic light scattering using a Malvern Zetasizer. The nanoparticle sample is diluted with phosphate buffered saline (PBS) to a count rate of approximately 200 - 400 kcts. The data is presented as the weighted average of the intensity measurements.

[0177] In some embodiments, the LNPs associated with the gRNAs disclosed herein and the mRNAs encoding the Cas9 nucleases disclosed herein, such as Spy Cas9 nuclease, are for use in the preparation of a medicament for treating HAE. In some embodiments, the LNPs associated with the gRNAs disclosed herein and the mRNAs encoding the Cas9 nucleases (e.g., Spy Cas9 nuclease) disclosed herein are for use in the preparation of a medicament for reducing plasma kallikrein in a subject having HAE. In some embodiments, the LNPs associated with the gRNAs disclosed herein and the mRNAs encoding the Cas9 nucleases (e.g., Spy Cas9) disclosed herein are for use in the preparation of a medicament for reducing plasma kallikrein concentration. In some embodiments, the LNPs associated with the gRNAs disclosed herein and the mRNAs encoding the Cas9 nucleases (e.g., Spy Cas9) disclosed herein are for use in the preparation of a medicament for reducing plasma kallikrein activity. In some embodiments, the LNPs associated with the gRNAs disclosed herein and the mRNAs encoding the Cas9 nucleases (e.g., Spy Cas9) disclosed herein are for use in the treatment of HAE in a human subject. In some embodiments, the LNPs associated with the gRNAs disclosed herein and the mRNAs encoding the Cas9 nucleases (e.g., Spy Cas9) disclosed herein are for use in reducing plasma kallikrein protein levels or plasma kallikrein activity levels in a human subject. In some embodiments, the LNPs associated with the gRNAs disclosed herein and the mRNAs encoding the Cas9 nucleases (e.g., Spy Cas9) disclosed herein are for use in reducing total plasma kallikrein protein levels in a human subject.In some embodiments, the LNPs associated with the gRNAs disclosed herein and the mRNAs encoding the Cas9 nucleases (e.g., Spy Cas9) disclosed herein are for use in reducing the frequency of HAE attacks in a human subject.

[0178] In some embodiments, the LNP comprises a lipid component, the lipid component comprising, consisting essentially of, or consisting of about 50 mol% ionizable lipid, e.g., lipid A; about 9 mol% neutral lipid, e.g., DSPC; about 3 mol% stealth lipid, e.g., a PEG lipid such as PEG2k-DMG, and the remainder of the lipid component being a helper lipid such as cholesterol, wherein the N / P ratio of the LNP composition is about 6. In some embodiments, the ionizable lipid is lipid A. In some embodiments, the neutral lipid is DSPC. In some embodiments, the stealth lipid is a PEG lipid. In some embodiments, the stealth lipid is PEG2k-DMG. In some embodiments, the helper lipid is cholesterol. In some embodiments, the LNP comprises a lipid component, the lipid component comprising about 50 mol% lipid A; about 9 mol% DSPC; about 3 mol% PEG2k-DMG, and the remaining lipid component being cholesterol, and the N / P ratio of the LNP composition is about 6.

[0179] II. Systemic Delivery Methods In some embodiments, the LNP compositions described herein comprising an mRNA encoding a Cas9 nuclease, e.g., Spy Cas9, and a guide RNA targeting the KLKB1 gene are administered systemically. As used herein, systemic administration refers to widespread biodistribution in an organism, e.g., intravenous administration.

[0180] In some embodiments, a single administration of the LNP compositions described herein is sufficient to knockdown the expression of the target protein. In some embodiments, a single administration of the LNP composition is sufficient to knockdown the expression of the target protein in a cell population. In other embodiments, more than two administrations of the LNP composition may be beneficial to maximize editing by a cumulative effect. For example, the LNP composition can be administered two or three times (an "additional dose"), e.g., a second dose or a third dose. The dose of the second dose or the third dose can be determined by the clinician to reduce the plasma kallikrein total protein or activity level by, e.g., about 60%, 70%, 80%, or 90% or more compared to the baseline level (e.g., the level before the first LNP administration). The multiple administrations (second dose or third dose) can be administered as a fixed dose, e.g., 25 mg, 50 mg, 75 mg, 100 mg, 125 mg, or 150 mg, or as a dose based on body weight.

[0181] In some embodiments, the LNP compositions described herein are administered by infusion with an infusion time of about 2 to 4 hours. In some embodiments, the LNP compositions described herein are administered by infusion with an infusion time of about 2 to 5 hours. In some embodiments, the LNP compositions described herein are administered by infusion with an infusion time of at least 2 hours.

[0182] III. Dosage In some embodiments, the LNP compositions described herein (e.g., containing mRNA encoding an effective amount of Cas9 nuclease and a guide RNA targeting the KLKB1 gene, e.g., a guide RNA (total dose or combined dose) targeting the KLKB1 gene) are administered using a fixed dose. The fixed dose can be about 25 - 75 mg in a human subject. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are a total dose of about 25 - 100 mg. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are a total dose of about 50 - 75 mg. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are a total dose of about 25 mg. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are a total dose of about 50 mg. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are a total dose of about 75 mg. The LNP composition can be administered in an effective amount in that when the LNP composition is administered based on total RNA, an mRNA encoding an effective amount of Cas9 nuclease and a guide RNA targeting the KLKB1 gene are administered.

[0183] In some embodiments of the present invention, "about" means within ±5% of the specified value. For example, in the case of a value of about 25 mg, it is in the range of 23.75 mg to 26.25 mg, or in the case of a value of about 75 mg, it is in the range of 71.25 mg to 78.75 mg. In some embodiments of the present invention, "about" means within ±10% of the specified value. In some embodiments of the present invention, "about" means within ±20% of the specified value. For example, in the case of a value of about 25 mg, it is in the range of 20 mg to 30 mg, or in the case of a value of about 75 mg, it is in the range of 60 mg to 90 mg. The allowable errors in various technical fields are understood.

[0184] In some embodiments, the LNP compositions described herein (e.g., comprising mRNA encoding an effective amount of Cas9 nuclease and guide RNA targeting the KLKB1 gene (total RNA or sum RNA)) are administered, for example, to pediatric patients using a dose based on body weight.

[0185] In other embodiments, subjects who receive a dose insufficient to effect a sufficient decrease in the level of total plasma kallikrein protein or total plasma kallikrein activity can receive multiple administrations of the LNP composition to maximize editing by cumulative effect. For example, the LNP composition can be administered 2, 3, 4, 5 times or more, for example, it may be administered 2 times, for example, a second administration, a third administration, a fourth administration, or a fifth administration may be performed. In some embodiments, the LNP composition is administered to a human subject who has previously received the LNP composition. In some embodiments, the LNP composition has been previously administered and the total plasma kallikrein protein level, as measured by, for example, ELISA (e.g., prekallikrein and kallikrein human ELISA kit catalog number ab171015), for example, at least 28 days after the first LNP administration, for example, when determined 56 days later, did not achieve a decrease of more than 60%, 70%, or 80% (e.g., the decrease in total plasma kallikrein protein level after administration of the LNP composition is less than 60%, 70%, or 80%) is administered to a human subject. In some embodiments, the LNP composition has been previously administered and the plasma kallikrein activity level, as measured by, for example, an activity assay kit (e.g., SensoLyte® Rh110 Plasma Kallikrein Activity Assay Kit *Fluorimetric*, catalog number AS-72255), for example, at least 28 days after the first LNP administration, for example, when determined 56 days later, did not achieve a decrease of more than 60%, 70%, or 80% (e.g., the decrease in plasma kallikrein activity level after administration of the LNP composition is less than 60%, 70%, or 80%) is administered to a human subject. The rate of decrease is compared to a baseline sample obtained prior to administration of the LNP composition. Commercially available kits for determining total kallikrein protein levels and total kallikrein activity levels are available. Appropriate control selection and methods for validating such kits are well known to those skilled in the art.

[0186] IV. Usage Method Pathology and Therapeutic Intervention of Hereditary Angioedema HAE is a rare autosomal dominant genetic disorder characterized by recurrent, painful, unpredictable, and potentially life-threatening inflammatory attacks of skin and subcutaneous swelling. These symptoms are caused by dysregulation of the production of bradykinin, a peptide that leads to increased vascular permeability and subsequent swelling. Attacks occur at a frequency of once every 7 - 14 days and may last for 48 - 72 hours. Laryngeal edema can lead to airway obstruction and asphyxiation and is particularly life-threatening (Zuraw 2008; Busse 2020, The US HAEA Medical Advisory Board 2020 Guidelines for the Management of Hereditary Angioedema(doi.org / 10.1016 / j.jaip.2020.08.046)).

[0187] The most common form of HAE is caused by a deficiency of C1-esterase inhibitor (C1-INH), an important regulator of the contact activation pathway. The deficiency is due to either low levels of functionally active C1-INH protein (type I) or normal levels of functionally inactive C1-INH (type II). For example, see Figure 1. Factor XII (FXII), when activated to factor XIIa (FXIIa), is a plasma protein at the starting point of the contact activation pathway that converts plasma prekallikrein (PKK) to active kallikrein. Kallikrein catalyzes the conversion of high molecular weight kininogen to bradykinin. In healthy subjects, the homeostasis of FXIIa and kallikrein activities is negatively regulated by C1-INH, a direct inhibitor of FXIIa and kallikrein. However, in HAE types I and II, deficiency or dysfunction of C1-INH results in dysregulation of FXIIa and kallikrein activities, local accumulation of bradykinin, and enhanced vascular permeability and vasodilation, resulting in angioedema (Busse 2020). The US HAEA Medical Advisory Board 2020 Guidelines for the Management of Hereditary Angioedema recommended that HAE should be broadly classified into HAE due to C1INH deficiency (HAE-C1INH) and HAE due to HAE-nl-C1INH (HAE with normal C1INH). HAE-C1INH is further classified into types I and II, which are considered clinically similar. HAE-nl-C1INH is further classified based on the underlying mutation or remains unknown if no mutation is identified.

[0188] Most of the currently approved treatments for HAE are designed to restore the normal function of the contact activation pathway. These strategies include C1-INH replacement (recombinant or plasma-derived), B2 bradykinin receptor inhibition (icatibant), and kallikrein inhibition (ecallantide, lanadelumab, berotralstat). Depending on the agent, these drug therapies are used either to prevent attacks (prophylaxis) or to treat attacks on demand. They are administered intravenously, subcutaneously (SC), or orally. While on-demand treatment is carried out at the onset of HAE attacks, prophylactic agents need to be administered IV or SC long-term at a frequency of up to twice a week or orally daily to ensure a certain degree of pathway inhibition and control the disease. However, breakthrough attacks still occur despite long-term administration.

[0189] Agents for HAE attack prophylaxis can be used in combination with NTLA-2002. Such agents may be particularly useful early after administration of NTLA-2002. The timing of discontinuation of HAE attack prophylaxis can be determined by the healthcare provider. Some agents for HAE attack prophylaxis were not permitted in the context of a trial, but such agents are not necessarily contraindicated for combination with NTLA-2002. Rather, certain agents were not permitted for combination with a trial, for example, because they may interfere with certain diagnostic means in the trial.

[0190] Agents for HAE attack prophylaxis may be discontinued prior to administration of NTLA-2002. The half-life and washout period of such agents are known in the art and are provided herein. Administration of NTLA-2002 can be carried out during or after completion of the washout period.

[0191] 1. In vivo editing method Provided herein is a method for in vivo editing of the KLKB1 gene in a human subject, e.g., a human subject having HAE, in the liver. In some embodiments, the method for in vivo gene editing comprises systemically administering to the human subject an LNP composition described herein comprising a Cas9 nuclease, e.g., an mRNA encoding Spy Cas9; and a guide RNA targeting the KLKB1 gene. In some embodiments, the in vivo editing occurs at the site targeted by the guide RNA in the subject's hepatocytes.

[0192] In these embodiments, administration of the LNP composition to the subject may be associated with a change in the biosafety scale. In some embodiments, the subject is evaluated to determine whether the change in the biosafety scale is an acceptable change. In some embodiments, an acceptable change may be determined by a clinician or a clinical test. In some embodiments, an acceptable change may not correspond to a safety event, including an adverse event (NCI-CTCAE grade 3 or higher), a serious adverse event, a particularly notable adverse event, or an adverse event expressed under treatment (CTCAE grade 3 or higher), as described herein. Biosafety scales are known in the art, including those associated with the administration of the LNP composition. Acceptable levels or changes in the biosafety scale are known in the art and may be evaluated by conventional methods.

[0193] In some embodiments, an acceptable biosafety scale level corresponds to the inclusion criteria of the subject described herein or does not correspond to the exclusion criteria of the subject.

[0194] In some embodiments, an acceptable change in the biosafety metric level is an acceptable change after a certain period of time, e.g., initially deviating from an acceptable level but stabilizing to an acceptable level by, for example, day 2, 3, 4, 5, 6, 7, 14, or 28 after administration. Acceptable changes in the biosafety metric level and acceptable times to recovery are provided for the various means herein. Methods for measuring and grading the biosafety metric level are known in the art.

[0195] In some embodiments, an acceptable biosafety metric level (or an acceptable change in the biosafety metric level) does not correspond to a Grade 3 or higher adverse event according to the CTCAE guidelines, including the National Cancer Institute (NCI)-CTCAE Guidelines, Version 5.0. In some embodiments, a change in the biosafety metric level (e.g., one or more levels related to clinical laboratory parameters, vital signs, ECG data, physical examination, etc. described herein) is an adverse event if the change, for example, induces clinical signs or symptoms, requires active intervention, requires interruption or discontinuation of the LNP composition, or is determined by a clinician to be clinically significant in terms of the change in the biosafety metric.

[0196] In some embodiments, an adverse event is any adverse medical occurrence that is not necessarily causally related to treatment in a subject administered a test article or undergoing a test-related procedure. In some embodiments, an adverse event is an unintended sign (including abnormal laboratory findings), symptom, or disease that is temporally related to treatment, whether or not related to a (test) article of pharmaceutical interest. In some embodiments, an adverse event induces clinical signs or symptoms. In some embodiments, an adverse event requires active intervention. In some embodiments, an adverse event requires interruption or discontinuation of treatment. In some embodiments, an adverse event is a clinically significant abnormality in the opinion of the treating investigator. Grading criteria for adverse events are known in the art, such as the Common Terminology Criteria for Adverse Events (CTCAE), including, for example, the CTCAE of the National Cancer Institute (NCI).

[0197] In some embodiments, an acceptable biosafety metric level (or acceptable change in biosafety metric level) is one that does not correspond to a serious adverse event. In some embodiments, a serious adverse event results in death. In some embodiments, a serious adverse event threatens life (e.g., exposes the subject to an imminent risk of death as determined by a clinician). In some embodiments, a serious adverse event results in persistent or significant disability. In some embodiments, a serious adverse event results in the absence or substantial interference with the ability to perform ordinary life functions. In some embodiments, a serious adverse event results in congenital anomalies or birth defects. In some embodiments, a serious adverse event requires hospitalization of the patient or leads to an extension of hospitalization.

[0198] In some embodiments, an acceptable biosafety metric level (or acceptable change in biosafety metric level) is one that does not correspond to an adverse event that occurs under treatment with a Common Terminology Criteria for Adverse Events (CTCAE) grade of 3 or higher.

[0199] Methods of in vivo editing can generally include, for example, measuring known clinical test evaluations related to coagulation, hematology, clinical chemistry, urine tests, and other biological analysis evaluations (e.g., cytokines, complement). Specific biosafety metrics can include, but are not limited to, one or more of the following non-limiting biosafety metrics: liver enzymes, levels of activated partial thromboplastin time (aPTT), levels of reptilase time (PT), levels of thrombin generation time (TGT) (e.g., maximum value, lag time, or endogenous thrombin potential), levels of fibrinogen, prothrombin international normalized (INR) ratio, levels of d-dimer, HBV, HBsAg, HCVAb, clinical test parameters consistent with disseminated intravascular coagulation, changes in hematology test values, changes in chemistry test values, changes in coagulation, changes in urine tests, levels of C-reactive protein, levels of complement (C3a, C5a, Bb), levels of cytokines (GM-CSF, INF-g, IL-1b, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, IL-23, TNF-a, IL-17, MCP-1), acute liver injury (e.g., an increase in ALT, AST, total bilirubin above CTCAE grade 2 after treatment administration or symptoms / signs of clinically significant liver injury), and changes in 12-lead electrocardiogram. In certain embodiments, the clinical test evaluation is the activated partial thromboplastin time (aPTT) level. In some embodiments, the biosafety metrics include injection site reaction(s) and gastrointestinal symptoms.

[0200] For example, other biosafety measures related to hematology tests, coagulation, chemistry tests, and urine tests are known in the art. For example, biosafety measures related to hematology tests include, but are not limited to, platelet count, RBC count, hemoglobin, hematocrit, RBC indices (MCV, MCH, MCHC, RDW), reticulocyte percentage, white blood cell (WBC) count and differential (neutrophils, lymphocytes, monocytes, eosinophils, basophils). For example, biosafety measures related to coagulation include, but are not limited to, aPTT, PT, INR, fibrinogen, d-dimer, and TGT. For example, biosafety measures related to clinical chemistry include, but are not limited to, albumin, blood urea nitrogen, creatinine, non-fasting glucose, potassium, sodium, chloride, carbon dioxide, calcium, AST, ALT, alkaline phosphatase, total bilirubin and direct bilirubin, total protein, creatine kinase, lactate dehydrogenase, total cholesterol, and LDL cholesterol. For example, biosafety measures related to urine tests include, but are not limited to, specific gravity, pH, glucose, protein, blood, ketones, bilirubin, urobilinogen, nitrite, and white blood cell esterase. In certain embodiments, the biosafety measure is an aPTT level.

[0201] In some embodiments, the level of the biosafety metric is measured after administration of the LNP composition. In some embodiments, the level of the biosafety metric is measured before and after administration of the LNP composition, thereby enabling comparison of the levels of the biosafety metric before and after treatment with the LNP composition. In some embodiments, the level of the biosafety metric measured before administration of the LNP composition can serve as a baseline for comparison to one or more levels of the biosafety metric measured after administration of the LNP composition. In some embodiments, the baseline is the last available measurement obtained before administration of the LNP composition. In these embodiments, administration of the LNP composition results in an acceptable change in liver enzyme levels (e.g., an increase in ALT or AST not exceeding 5×ULN over 4 weeks after treatment administration, an increase in ALT or AST > 3×ULN and total bilirubin > 2×ULN (Hy's law) after treatment administration). In these embodiments, administration of the composition results in an acceptable change in the level of activated partial thromboplastin time (aPTT) (e.g., an increase in aPTT > 5×ULN over 4 weeks after treatment administration). In these embodiments, administration of the composition results in an acceptable change in the level of prothrombin time (PT). In these embodiments, administration of the composition results in an acceptable change in the level of thrombin generation time (TGT) (e.g., maximum value, lag time, or endogenous thrombin potential). In these embodiments, administration of the composition results in an acceptable change in the level of fibrinogen. In some embodiments, administration of the composition results in an acceptable change in the prothrombin international normalized (INR) ratio. In these embodiments, administration of the composition results in an acceptable change in the level of D-dimer. In these embodiments, administration of the composition results in an acceptable change in test parameters consistent with disseminated intravascular coagulation. In these embodiments, administration of the composition results in an acceptable change in hematological test values (e.g., abnormal blood test results exceeding CTCAE grade 2 after treatment administration).In these embodiments, administration of the composition results in acceptable changes in laboratory test values. In these embodiments, administration of the composition results in acceptable changes in findings of abnormal coagulation as defined by clinically significant abnormal bleeding. In these embodiments, administration of the composition results in acceptable changes in urine tests. In these embodiments, administration of the composition results in acceptable changes in the level of C-reactive protein. In these embodiments, administration of the composition results in acceptable changes in the level of complement. In these embodiments, administration of the composition results in acceptable changes in the level of cytokines.

[0202] In these embodiments, administration of the composition results in acceptable changes in biosafety scale levels that do not correspond to adverse events manifested under grade 3 or higher treatment according to the CTCAE guidelines. In these embodiments, administration of the composition results in acceptable changes in biosafety scale levels that do not correspond to the occurrence of thrombosis. In these embodiments, administration of the composition results in acceptable changes in biosafety scale levels that do not correspond to the occurrence of bleeding. In these embodiments, administration of the composition results in acceptable changes in biosafety scale levels that do not correspond to the occurrence of disseminated intravascular coagulation. In these embodiments, administration of the composition results in acceptable changes in biosafety scale levels that do not correspond to the occurrence of cytokine release syndrome. In these embodiments, administration of the composition results in acceptable changes in biosafety scale levels that do not correspond to acute liver injury (e.g., an increase in ALT, AST, total bilirubin exceeding CTCAE grade 2 after treatment administration or clinically significant symptoms / signs of liver injury). In these embodiments, administration of the composition results in acceptable changes in 12-lead electrocardiograms as determined by a clinician.

[0203] In some embodiments, a method of in vivo gene editing comprises systemically administering to a human subject an LNP composition comprising an mRNA encoding an effective amount of Cas9 and a guide RNA targeting the KLKB1 gene, wherein the administration results in an acceptable change in the level of anti-Cas9 antibody.

[0204] In some embodiments, the administration of the LNP composition results in an acceptable change in the pharmacokinetics of lipid A. In some embodiments, the administration of the LNP composition results in an acceptable change in the pharmacokinetics of DMG-PEG2k. In some embodiments, the administration of the LNP composition results in an acceptable change in the pharmacokinetics of Cas9 mRNA. In some embodiments, the administration of the LNP composition results in an acceptable change in the pharmacokinetics of sgRNA.

[0205] 2. Treatment method Provided herein are methods of treating a human subject by in vivo editing of the KLKB1 gene in the liver. In some embodiments, the method of in vivo editing of the KLKB1 gene comprises systemically administering to the human subject an LNP composition described herein (e.g., an mRNA encoding an effective amount of a Cas9 nuclease, such as Spy Cas9; and a guide RNA targeting the KLKB1 gene), wherein the in vivo editing of the KLKB1 gene occurs at the site targeted by the guide RNA in the hepatocytes of the subject. In certain embodiments, the guide RNA comprises a targeting sequence comprising at least 18 contiguous nucleotides, preferably 20 nucleotides of GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15). In some embodiments, the guide RNA comprises the nucleotide sequence of GGAUUGCGUAUGGGACACAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 388). In some embodiments, the sgRNA is modified. In some embodiments, the sgRNA comprises a modification pattern shown in SEQ ID NO: 391 below, and the modified sgRNA comprises the following sequence: mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 391), where A, C, G, and U represent the RNA nucleosides (2'-OH) adenine, cytosine, guanine, and uridine, respectively, and mA, mC, mG, and mU represent 2'-O-methyl modified adenine, cytosine, guanine, and uridine, respectively, and * represents a phosphorothioate bond.

[0206] In some embodiments, as described herein, methods are provided herein for treating a human subject afflicted with HAE (e.g., a reduction in the number of HAE attacks, breakthrough attacks, the number or percentage of patients without attacks over a given period of time, the frequency of hospitalizations associated with HAE attacks, or the frequency of use of acute therapies associated with HAE attacks). In some embodiments, the HAE is type I. In some embodiments, the HAE is type II.

[0207] In some embodiments, a method for treating HAE in a human subject, comprising systemically administering to the human subject an LNP composition as described herein (e.g., an effective amount of a Cas9 nuclease, e.g., an mRNA encoding Spy Cas9; and a guide RNA targeting the KLKB1 gene, e.g., a guide comprising the targeting sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA)), thereby treating the HAE, wherein administration of the composition results in a clinically significant improvement in the level of a clinical measure in the subject as compared to the baseline level of the clinical measure. A method is provided herein.

[0208] In some embodiments, a method for treating HAE in a human subject, comprising systemically administering to the human subject an LNP composition as described herein (e.g., an effective amount of a Cas9 nuclease, e.g., an mRNA encoding Spy Cas9; and a guide RNA targeting the KLKB1 gene, e.g., a guide comprising the targeting sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA)), thereby treating the HAE, wherein the mRNA encoding the Cas9 nuclease and the guide RNA targeting the KLKB1 gene are administered in a total dosage of about 25 - 150 mg, e.g., about 25 - 100 mg. A method is provided herein.

[0209] In some embodiments, a method for treating HAE in a human subject, the method comprising systemically administering to the human subject an LNP composition described herein (e.g., an mRNA encoding an effective amount of a Cas9 nuclease, such as Spy Cas9; and a guide RNA targeting the KLKB1 gene, such as a guide comprising the targeting sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA)), thereby treating HAE, wherein the mRNA encoding the Cas9 nuclease and the guide RNA targeting the KLKB1 gene are administered at a total dose of about 25-75 mg, is provided herein.

[0210] In some embodiments, a method for treating HAE in a human subject, the method comprising systemically administering to the human subject an LNP composition described herein (e.g., an mRNA encoding an effective amount of a Cas9 nuclease, such as Spy Cas9; and a guide RNA targeting the KLKB1 gene, such as a guide comprising the targeting sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA)), thereby treating HAE, wherein the mRNA encoding the Cas9 nuclease and the guide RNA targeting the KLKB1 gene are administered at a total dose of about 50-75 mg, is provided herein.

[0211] In some embodiments, a method for treating HAE in a human subject, the method comprising systemically administering to the human subject an LNP composition described herein (e.g., an mRNA encoding an effective amount of a Cas9 nuclease, e.g., Spy Cas9; and a guide RNA targeting a gene, e.g., a guide RNA targeting the KLKB1 gene, e.g., a guide comprising the targeting sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA)), thereby treating HAE, wherein administration of the composition reduces the total plasma kallikrein protein level or kallikrein activity level compared to the baseline plasma. Methods are provided herein. In some embodiments, the HAE is type I. In some embodiments, the HAE is type II. In some embodiments, the LNP comprises (9Z,12Z)-3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate. In some embodiments, the LNP comprises a PEG lipid. In embodiments where the LNP comprises a PEG lipid, the PEG lipid comprises dimyristoyl glycerol (DMG). In embodiments where the PEG lipid comprises dimyristoyl glycerol (DMG), the PEG lipid comprises PEG-2k. In some embodiments, the LNP composition has an N / P ratio of about 5 to 7. In some embodiments, the guide RNA and the Cas nuclease are present in a weight ratio in the range of about 5:1 to 1:5. In some embodiments, the mRNA encodes a Cas9 nuclease. In some embodiments, the mRNA encodes S.pyogenes Cas9. In some embodiments, the Cas nuclease is codon-optimized. In some embodiments, the guide RNA comprises at least one modification. In embodiments where the guide RNA comprises at least one modification, the guide RNA comprises a 2'-O-methyl modified nucleotide or a phosphorothioate bond between nucleotides.In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 25-150 mg of total RNA. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 25-100 mg of total RNA. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are, for example, at a total dosage of about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 125 mg, or about 150 mg. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 50-75 mg of total RNA. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 25 mg of total RNA. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 75 mg of total RNA. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 50 mg of total RNA. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 0.3-2 mg / kg. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 0.5-1 mg / kg. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 0.3 mg / kg. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 0.5 mg / kg.In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 0.7 mg / kg. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 0.9 mg / kg. In some embodiments, the mRNA encoding an effective amount of Cas nuclease and the guide RNA targeting the KLKB1 gene are at a total dosage of about 1 mg / kg. In some embodiments, administration of the composition reduces total plasma kallikrein protein by at least 60%, or 60% - 95%, 60% - 90%, 70% - 95%, 70% - 90%, or 80% - 95% compared to the baseline total plasma kallikrein protein prior to administration of the composition. In some embodiments, the total plasma kallikrein protein level is less than about 20 μg / mL after administration of the composition. In some embodiments, the total plasma kallikrein protein level is less than about 15 μg / mL after administration of the composition. In some embodiments, the total plasma kallikrein protein level is less than about 10 μg / mL after administration of the composition.

[0212] In certain embodiments, the methods provided herein are for reducing the frequency of HAE attacks in a subject as compared to the subject's past attack frequency.

[0213] In certain embodiments, the methods provided herein are for improving according to one or more clinical measures for HAE described herein, such as a suitable quality of life (QoL) questionnaire, e.g., the Angioedema Quality of Life (AE-QoL) questionnaire for MOXIE's angioedema, or for preventing recurrence of one or more symptoms.

[0214] In certain embodiments, the methods provided herein are for reducing the severity of HAE attacks in a subject as compared to the subject's past attack severity. In certain embodiments, the methods provided herein are for reducing the frequency of attacks with laryngeal edema, which is typically associated with severe overall attack severity, characterized by significant activity limitation, and requires assistance for the subject.

[0215] In certain embodiments, the methods provided herein are for reducing the frequency and severity of HAE attacks in a subject as compared to the subject's past attack frequency and severity.

[0216] In certain embodiments, the subject has a reduced frequency of hospitalizations associated with HAE attacks. In certain embodiments, the subject has a reduced frequency of use of acute therapies associated with HAE attacks.

[0217] In certain embodiments, the methods provided herein can also be used in the treatment of subjects who have rare or low-frequency attacks, or subjects after a single attack, due to the severity of the attack. In certain embodiments, the methods provided herein are used in a subject having a single attack that includes laryngeal edema, which edema can be life-threatening.

[0218] In some embodiments, the treatment method comprises systemically administering to a human subject an LNP composition described herein, for example, an LNP composition comprising mRNA encoding an effective amount of Cas9 nuclease and a guide RNA targeting the KLKB1 gene, wherein the subject has, on average, at least an average of two HAE attacks, e.g., confirmed HAE attacks, per month over a three-month (90-day) period prior to administration of the LNP composition. In some embodiments, the subject has, on average, at least an average of one HAE attack, e.g., confirmed HAE attacks, per month over a three-month (90-day) period prior to administration of the LNP composition.

[0219] Breakthrough attacks due to HAE are common, especially in those with more severe disease, despite HAE prophylaxis. In some embodiments, provided herein are methods for treating a subject undergoing HAE prophylaxis, including methods for treating a subject who has had a breakthrough attack during HAE prophylaxis. In some embodiments, the treatment method includes systemically administering to a human subject an LNP composition described herein, for example, an LNP composition comprising mRNA encoding an effective amount of Cas9 nuclease and a guide RNA targeting the KLKB1 gene, wherein the subject has been treated with a different HAE therapy, for example, a non-acute HAE therapy, i.e., has been treated with HAE prophylaxis or is currently being treated. In some embodiments, the subject has had at least an average of 2 HAE attacks per month, for example, confirmed HAE attacks, on average over a 3-month (90-day) period during HAE prophylaxis prior to administration of the LNP composition. In some embodiments, the subject has had at least an average of 1 HAE attack per month, for example, confirmed HAE attacks, on average over a 3-month (90-day) period during HAE prophylaxis prior to administration of the LNP composition.

[0220] In some embodiments, the subject is intolerant to long-term treatment with at least one HAE prophylaxis method, for example, events that occur under treatment after ongoing non-acute treatment or inadequate treatment due to chronic treatment (e.g., needle fatigue). In certain embodiments, the subject is intolerant to long-term treatment with at least one HAE prophylaxis method due to clinically unacceptable adverse events, such as adverse events of grade 3 or higher. In certain embodiments, the adverse event is clinically acceptable (e.g., weight gain, ■ acne), but is determined to be unacceptable by the subject, and the subject has chosen to discontinue HAE prophylaxis with a particular agent. In certain embodiments, the subject is intolerant to long-term treatment with at least one HAE prophylaxis method because the treatment is contraindicated in the subject, for example, in pregnant women, women who wish to become pregnant, or lactating women, children. In certain embodiments, the subject is intolerant to long-term treatment with at least one HAE prophylaxis method because the treatment is contraindicated in the subject due to existing or previous comorbidities, such as certain liver diseases, breast cancer, prostate cancer, hepatocellular carcinoma, and certain cardiovascular risk factors. In certain embodiments, the HAE prophylaxis method is prophylaxis with a weak androgen, such as danazol, oxandrolone, stanozolol.

[0221] It is understood that subjects intolerant to treatments such as long-term treatment with a particular agent that can be used for HAE prophylaxis (e.g., events that occur under treatment after ongoing non-acute treatment or inadequate treatment due to chronic treatment (e.g., needle fatigue)) may be tolerant to agents for acute therapy, i.e., short-term or intermittent treatment, rather than long-term treatment

[0222] In some embodiments, a method of in vivo editing of the KLKB1 gene comprises administering systemically to a human subject an LNP composition described herein, e.g., an LNP composition comprising mRNA encoding an effective amount of Cas9 nuclease and a guide RNA targeting the KLKB1 gene, which results in a clinically significant improvement in clinical measures, e.g., level of attack frequency, attack severity. In certain embodiments, the attack frequency is measured while the subject is maintained on HAE prophylaxis. In certain embodiments, the attack frequency is measured after HAE prophylaxis has been discontinued from the subject. In certain embodiments, the attack severity is measured while the subject is maintained on HAE prophylaxis. In certain embodiments, the attack severity is measured after HAE prophylaxis has been discontinued from the subject.

[0223] In certain embodiments, the confirmed HAE attack frequency is reduced by at least 60%, 70%, preferably at least 80%, 85%, 90%, or 95% for at least 6 months, optionally for at least 1 year, after administration of the LNP composition, compared to the confirmed HAE attacks per month averaged over a suitable past period, e.g., a fixed period, a period of 3 months (90 days). In certain embodiments, the period for determining the attack frequency after administration of the LNP composition begins immediately (e.g., within 1 day) after administration of the LNP composition. In certain embodiments, the period for determining the attack frequency after administration of the LNP composition begins 4 weeks after administration of the LNP composition, i.e., on the 29th day after administration.

[0224] In some embodiments, a method of in vivo editing of the KLKB1 gene involves systemically administering to a human subject an LNP composition described herein, such as an LNP composition comprising mRNA encoding an effective amount of Cas9 nuclease and a guide RNA targeting the KLKB1 gene, which results in a significant improvement in the level of certain aspects of the quality-of-life assessment, such as the quality-of-life (AE-QoL) assessment for angioedema of MOXIE. In some embodiments, a method of in vivo editing of the KLKB1 gene involves systemically administering to a human subject an LNP composition described herein, such as an LNP composition comprising mRNA encoding an effective amount of Cas9 nuclease and a guide RNA targeting the KLKB1 gene, which results in a significant improvement in the level of the quality-of-life assessment, such as the quality-of-life (AE-QoL) assessment for angioedema of MOXIE.

[0225] Additional clinical efficacy measures, including measures for evaluating the effectiveness of HAE treatment, are known in the art. Similarly, the levels or changes in clinical efficacy measures indicating improvement in HAE are known in the art and can be evaluated by conventional methods, such as by a clinician or clinical testing.

[0226] In some embodiments, a method of treating HAE involves administering an LNP composition described herein and measuring a clinical efficacy measure after administration of the LNP composition. In some embodiments, a method of treating HAE involves administering an LNP composition described herein and measuring a clinical efficacy measure before and after administration of the LNP composition, thereby enabling comparison of the levels of the clinical efficacy measure before and after treatment with the LNP composition.

[0227] For example, plasma kallikrein levels, such as total plasma kallikrein protein levels, are clinical efficacy measures for HAE. In some embodiments, a method of treating HAE includes administering an LNP composition described herein and reducing kallikrein levels, such as total plasma kallikrein protein levels, in a subject. In some embodiments, a method of treating HAE includes administering an LNP composition described herein and reducing the total plasma kallikrein protein level in a subject at least after treatment (e.g., 28 days or about 56 days after administration of the LNP composition) as compared to a baseline, such as prior to treatment. In some embodiments, the method of treating HAE described herein results in at least a 60% reduction in the total plasma kallikrein protein level as compared to the baseline at least 28 days or about 56 days after treatment, such as after administration of the LNP composition. In some embodiments, the method of treating HAE described herein results in a 60% - 95%, 60% - 90%, 70% - 95%, 70% - 90%, or 80% - 95% reduction in kallikrein levels, such as total plasma kallikrein protein levels, as compared to the baseline at least 28 days or about 56 days after treatment, such as after administration of the LNP composition.

[0228] In other embodiments, administration of the LNP composition reduces the total plasma kallikrein protein level to less than about 20 μg / mL in a subject. In some embodiments, administration of the LNP composition reduces the total plasma kallikrein protein level to less than about 15 μg / mL. In some embodiments, administration of the LNP composition reduces the total plasma kallikrein protein level to less than about 10 μg / mL. In certain embodiments, the levels are measured at least 28 days, such as about 56 days, after treatment.

[0229] a. Inclusion Criteria for Subjects In some embodiments, a subject having HAE (HAE type I or HAE type II) to whom an LNP composition described herein is administered, for example, an mRNA encoding a Cas9 nuclease, for example, Spy Cas9; and a guide RNA targeting the KLKB1 gene, for example, an LNP composition comprising a guide RNA targeting the KLKB1 gene, is evaluated for one or more of the following subject inclusion criteria.

[0230] i. Inclusion criteria for HAE subjects In some embodiments, a human subject is diagnosed with HAE before treatment or is diagnosed with HAE concurrently with treatment. In some embodiments, a human subject is diagnosed with HAE based on genetic testing. In some embodiments, a human subject is diagnosed with HAE based on confirmation by evaluation of functional C1-INH levels, C1-INH antigen levels, and C4 levels. Further, the subject must have had a confirmed HAE attack. Subjects in Phase 1 must have had at least 3 past HAE attacks confirmed and documented by the study physician within the 3 months (90 days) prior to the start of screening. Subjects in the Phase 1 portion of this trial can be treated with certain prophylactic methods during the observation period, i.e., within 3 months (90 days) from the start of screening, although various exclusions are described below. Subjects in Phase 2 must have had at least 3 past HAE attacks confirmed and documented by the study physician within the 3 months (90 days) prior to entering the lead-in period and must have had at least 2 past HAE attacks confirmed and recorded by the study physician during the 8-week (56-day) lead-in period in order to be eligible for enrollment and randomization. In the Phase 2 portion of this trial, subjects must consent to refrain from using prophylactic therapy from the start of the 8-week lead-in period until the end of the 16-week initial observation period, and the study physician must confirm that this is medically appropriate and does not impose an undue safety risk on the subject. Exclusions for other prophylactic agents are provided below.

[0231] In both the Phase 1 and Phase 2 trials, subjects must have access to and be able to use one or more acute medications to treat attacks of angioedema.

[0232] In some embodiments, the human subject is at least 18 years of age at the time of dosing. In some embodiments, the human subject has a diagnosis of HAE with frequent attacks, with or without prophylactic treatment, as provided above. In some embodiments, the human subject has HAE type 1. In some embodiments, the human subject has HAE type II. In some embodiments, the human subject has aspartate aminotransferase (AST) levels below the upper limit of normal (ULN) range at screening. In some embodiments, the human subject has alanine aminotransferase (ALT) levels below the upper limit of normal (ULN) range at screening. In some embodiments, the human subject has total bilirubin levels below the upper limit of normal (ULN) range at screening, and subjects with a history of Gilbert's syndrome are permitted to participate in the study if total bilirubin ≤ 2 × ULN at screening evaluation. In some embodiments, the human subject has activated partial thromboplastin time (aPTT), international normalized ratio (INR), fibrinogen, and D-dimer levels within the reference range or determined by the principal investigator (PI) to be not clinically significant at screening. In some embodiments, the human subject has an estimated glomerular filtration rate (GFR) > 45 mL / min / 1.73 m^2 (e.g., measured by the Modification of Diet in Renal Disease formula) at screening. In some embodiments, the human subject has a platelet count ≥ 100,000 cells / mm3 at screening. Body weight is not specified as an inclusion criterion, but the average body weight of subjects in previous clinical trials for the treatment of HAE was approximately 80 kg. Such exemplary body weights can be used to approximate dose conversions between fixed-dose and weight-based dosing.

[0233] In some embodiments, the human subject meets all of the above clinical tests and other criteria at the time of screening in the relevant stage of the present trial. In some embodiments, the human subject is restricted to 1 alcoholic beverage per day of alcohol intake during the screening and up to 28 days after treatment with the composition described herein.

[0234] In some embodiments, the human subject is a male or female subject aged 18 - 90 years (including the endpoints), for example, at the time of signing the informed consent. In some embodiments, high follicle - stimulating hormone (FSH) levels in the post - menopausal range can be used to confirm the post - menopausal state of women who are not using hormonal contraceptives or hormone replacement therapy. In some embodiments, a single FSH measurement is insufficient if there has been no menstruation for 12 months. In some embodiments, female subjects have had infertility surgery (e.g., hysterectomy, bilateral salpingectomy, and bilateral oophorectomy) at least 1 month prior to screening. In some embodiments, male subjects with a pregnancy - capable or pregnant partner(s) agree to use condoms from before screening through 84 days after administration of the investigational drug. In some embodiments, male subjects agree not to donate sperm for 84 days after administration of the investigational drug. If sperm donation is contraindicated based on country - specific guidelines, this time frame can be extended beyond 84 days.

[0235] In some embodiments, the human subject is evaluated for the risk of SARS - CoV - 2 infection or disease, and it is determined that the continuation of elective procedures in a medical institution is acceptable (e.g., documentation such as completion of a series of vaccinations, a recent negative PCR test, or that such a test is no longer necessary).

[0236] In some embodiments, the human subject agrees not to participate in other interventional trials during the study period.

[0237] b. Exclusion Criteria for Subjects In some embodiments, a subject having HAE (HAE type I or HAE type II) to whom an LNP composition described herein is administered, for example, an LNP composition comprising an mRNA encoding a Cas9 nuclease, for example, Spy Cas9; and a guide RNA targeting the KLKB1 gene, is evaluated for one or more of the following subject exclusion criteria.

[0238] i. Exclusion criteria for HAE subjects In some embodiments, a human subject meets the following criteria.

[0239] In a phase 2 trial, the subject has not used a long-term prophylaxis for HAE within 5 half-lives before the start of screening. A list of prophylaxis agents, half-lives, and recommended washout periods is provided in the following table. [Table 1]

[0240] In certain embodiments, the subject has not used C1-INH for HAE within 5 half-lives of the agent before the start of the phase 2 lead-in period. That is, a 24-hour washout is required before the start of the lead-in period after the use of rabbit-purified C1-INH (Ruconest), and a 4-day washout is required before the start of the lead-in period after the use of human plasma-purified C1-INH (Berinert). During the lead-in period, as an exception, C1-INH may be used to treat an acute HAE attack.

[0241] In certain embodiments, the subject does not have a co-diagnosis of any other type of recurrent angioedema, including acquired or idiopathic angioedema.

[0242] In some embodiments, the human subject does not have an allergy to any lipid nanoparticle (LNP) component, or has previously received an LNP and has not experienced any clinical laboratory abnormalities or adverse events related to any treatment (e.g., ALT or AST > 3×ULN if baseline is normal or > 3× baseline if baseline is above normal after administration of an LNP-containing formulation, INR, aPTT, or D-dimer > 1.5×ULN if baseline is normal or > 1.5× baseline if baseline is above normal after administration of an LNP-containing formulation, adverse events related to LNP treatment classified as CTCAE grade 3 or higher, infusion-related reactions (IRR) to an LNP-containing formulation that require discontinuation of treatment or infusion).

[0243] In certain embodiments, the subject has not been exposed to an angiotensin-converting enzyme (ACE) inhibitor or any estrogen-containing drug with systemic absorption within 90 days prior to administration of the investigational drug. In certain embodiments, the subject has not used antithrombotic therapy other than aspirin (e.g., warfarin, dabigatran, apixaban) within 14 days prior to administration of the investigational drug.

[0244] In certain embodiments, the subject does not have a history of thrombotic tendency or a positive result from a genetic test for factor V Leiden or prothrombin 20210. In some embodiments, the human subject does not have a history of cirrhosis. In some embodiments, the human subject has no history or suspicion of systemic infection by virus, parasite, or fungus and has not received antibiotics for bacterial infection. In some embodiments, the human subject does not have a history of infection with hepatitis B or C or a positive test result for hepatitis B surface antigen (HBsAg) or hepatitis C virus antibody (HCV Ab). In some embodiments, the human subject does not have a history of positive human immunodeficiency virus (HIV) status. In some embodiments, the human subject has not previously undergone transplantation of the liver, heart, or other solid organ or bone marrow transplantation, and no transplantation is scheduled within one year of administration. In some embodiments, the human subject does not have a history of alcohol or drug abuse within three years prior to screening. In some embodiments, the human subject is not a pregnant or lactating woman. In some embodiments, the human subject does not have a positive result from a severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) polymerase chain reaction (PCR) test within seven days of administration.

[0245] The clinical trial protocol was amended to include women of childbearing potential, who were initially excluded with caution because non-clinical tests investigating the potential for egg cell editing were underway at the start of the trial. During the conduct of this trial, the final GLP reproductive study in transgenic mice containing the human KLKB1 gene was completed. In this study, no evidence of germline transmission of KLKB1 editing was revealed, suggesting that the overall benefit / risk assessment in women of childbearing potential is equivalent to that in the overall patient population. The benefit / risk assessment was updated to reflect this, and additional changes related to including women of childbearing potential, including pregnancy testing, contraception, and pregnancy reporting requirements, were added.

[0246] The evaluation of these and other exclusion criteria is known in the art.

[0247] In certain embodiments, the subject meets all of the above exclusion criteria.

[0248] 3. Injection prevention method In some embodiments, methods described herein, e.g., methods comprising administering to a subject an LNP composition described herein (e.g., an mRNA encoding a Cas nuclease, e.g., Cas9; and a guide RNA targeting a gene, e.g., a guide RNA targeting the KLKB1 gene), further comprise an injection prevention method. In some embodiments, the injection prevention method is administered to the subject prior to administration of the gene editing composition. In some embodiments, an injection prevention method regimen administered to the subject prior to administering the LNP composition comprises administering an intravenous steroid, an intravenous or oral H1 blocker, and an intravenous or oral H2 blocker. The intravenous steroid can be dexamethasone, e.g., 10 mg. The intravenous H1 blocker can be diphenhydramine, e.g., 50 mg. The oral H1 blocker can be cetirizine, e.g., 10 mg. The intravenous or oral H2 blocker can be famotidine, e.g., 20 mg.

[0249] Clinical trial evaluation protocol and criteria Exemplary kits and methods for use in clinical trials are provided below. For the evaluation of standard clinical test values, e.g., ALT, AST, such methods are routine and well established in the art and thus are not provided.

[0250] Plasma kallikrein protein and activity levels Kits for the detection of total plasma kallikrein (prekallikrein + kallikrein) and for kallikrein activity levels are known in the art, and methods for validating the kits and assays are known in the art.

[0251] The Human ELISA Kit for Prekallikrein and Kallikrein (Abcam, Catalog Number ab171015) provides instructions for use of the kit for quantitatively measuring the concentration of human prekallikrein (Fletcher factor) in plasma, serum, saliva, milk, cerebrospinal fluid, and cell culture medium, and cell lysates.

[0252] The kit provides prekallikrein-specific antibodies pre-coated and blocked on a 96-well plate for this use. Add the standard included in the kit, or the test sample, to the wells, then add the prekallikrein-specific biotinylated detection antibody, and then wash with wash buffer. Add streptavidin-peroxidase conjugate and wash away the unbound conjugate with wash buffer. Then, use TMB to visualize the streptavidin-peroxidase enzyme reaction. TMB is catalyzed by streptavidin-peroxidase to produce a blue product that changes to yellow when an acidic stop solution is added. The density of the yellow color development is directly proportional to the amount of prekallikrein and kallikrein captured on the plate, and the assay is reported to be about 0.77 ng / ml. The protein assay is a quantitative method using a reference standard curve, and the concentration is reported. The validation results demonstrate that the assay is specific, accurate, highly precise, and highly sensitive for its intended use. Verotrast in the sample does not interfere with detection. The method does not detect tissue kallikrein.

[0253] SensoLyte® Rh110 Plasma Kallikrein Activity Assay Kit *Fluorimetric* (AnaSpec, Catalog No. AS-72255) provides instructions for use of a kit for detecting plasma kallikrein activity using a 96-well plate format. The SensoLyte® Rh110 Plasma Kallikrein Activity Assay Kit employs a fluorescent peptide substrate for the detection of enzyme activity. This substrate contains the rhodamine 110 fluorophore (Rh110). Plasma kallikrein cleaves this Rh110 substrate, resulting in the emission of bright green fluorescence, which can be detected at an excitation / emission of 496 nm / 520 nm. Rh110 has a longer wavelength spectrum and a higher extinction coefficient, resulting in high sensitivity and less interference from other reaction components. This assay has been reported to be able to detect as little as 1 ng / mL of active plasma kallikrein. This kit has been reported to be usable for the detection of enzyme activity in purified enzyme preparations and biological samples, and is also applicable to compound screening. The activity assay is a qualitative method and is reported as % inhibition based directly on the slope (signal versus time as the readout of reaction rate). For use in the clinical assay methods provided herein, the samples were first activated to convert all prekallikrein to kallikrein, and then kallikrein activity was measured according to the kit instructions. This fluorescence method is a qualitative assay (without a reference standard curve) based on measuring the reaction rate of the enzyme reaction (fluorescence signal over time). The assay slope (signal over time) in the linear range was determined and reported as the relative signal comparing the activity (slope) after dosing to the slope before dosing.

[0254] For both the total kallikrein protein level and the kallikrein activity level, the inhibition rate at post - administration time points is calculated for each patient based on the pre - administration level (the average of three pre - administration samples, two during the screening period and one pre - dose on the dosing day). The pre - administration samples are tested only once and reported as the individual concentration (protein assay) or the % inhibition based on the post - administration gradient relative to pre - administration (activity assay). The positive control is that of a commercially available kallikrein protein purified from human pooled plasma.

[0255] Normal human plasma (multiple pools) was used to confirm the detection of both protein and activity. Patient samples were not used for method development and validation. Normal plasma samples were from the CRL employee - provided program and were processed using the same procedures as in the clinical trial.

[0256] Data collection and confirmation of hereditary angioedema (HAE) attacks The principal investigator and the study site team were provided the following guidance regarding documentation and review of the attack history, and collection, consideration, and evaluation of events considered potential angioedema attacks. This guidance was provided for the following purposes: · To provide a definition of hereditary angioedema (HAE) attacks · To define the best principles regarding consideration of potential attack(s) · To provide an approach for determining whether a potential event reported by a subject is a true HAE attack

[0257] HAE attacks To be considered an HAE attack, at least one of the following must be included in the signs or symptoms reported as part of the event: · Peripheral angioedema: Swelling of the skin including the extremities, face, neck, trunk, or genital area · Abdominal angioedema: Abdominal pain (regardless of the presence of abdominal distension, nausea, vomiting, or diarrhea) · Angioedema of the larynx: Stridor, dyspnea, dysphonia, dysphagia, a feeling of throat constriction, or swelling of the tongue, palate, uvula, or larynx.

[0258] Even if these signs or symptoms are present, clinically, the event may not yet be an HAE attack in the following cases. · If there is a diagnosis that negates the event · If the reported event persists far beyond the typical attack time of the subject · If there is another etiology.

[0259] To be considered an independent HAE attack different from previously confirmed attacks, the signs or symptoms must be determined to have started more than 24 hours after the recovery of the signs or symptoms of the previous attack.

[0260] The prodromal symptoms themselves are not considered an attack. A report of the use of acute HAE attack treatment for a potential attack alone does not confirm an HAE attack.

[0261] The subject's HAE attack history In accordance with the trial protocol, document the HAE attack history of each subject at the trial site and enter it into the eCRF. The information shall include the following: · Typical attack frequency · Typical attack site(s) and symptoms · Whether the subject has experienced signs and symptoms of laryngeal attacks · Whether the subject has experienced prodromal signs and symptoms · Typical attack severity · Typical attack duration · Use of acute attack therapy · Any history of preventive therapy · Number of attacks in the past 3 months (90 days) · Full history of HAE-related drugs used in the past 90 days

[0262] Training of the subject regarding the diary and recording of potential HAE attacks During screening, site personnel will train subjects (and caregivers) on identifying seizure symptoms, diary completion requirements, and diary seizure reporting requirements. Per the clinical trial protocol, site personnel will assess subject compliance with reporting requirements throughout the study and retrain subjects as needed to maintain protocol compliance.

[0263] Information on potential HAE attacks reported by subjects The subject (or caregiver) must record the following information in their diary when reporting (or as soon as possible) a potential HAE attack or discussing it with study personnel: The date and time when signs or symptoms of the attack were first experienced A description of the signs and symptoms you experienced (including location(s)) Any medications used to treat seizures The severity of the attack Did you need assistance, medical intervention, a doctor's visit, an emergency room visit, or hospitalization? Date and time when the subject stopped experiencing symptoms

[0264] Subjects do not need to wait for complete resolution of their symptoms to report a potential HAE attack in their diary.

[0265] Information regarding ongoing symptoms may be obtained by the site during scheduled study visits or scheduled telehealth visits or phone calls.

[0266] Subjects must not withhold or delay any medical treatment they normally receive for the treatment of seizures in order to enter potential seizure information into the diary.

[0267] Review of potential HAE attack information by clinical trial site personnel and investigators As detailed in the clinical trial implementation plan, the site staff reviews the diary information for overall diary compliance. In addition, at the time of the planned study visit or planned telemedicine visit or phone call, the site staff checks the diary information with the subject or caregiver and collects additional information as needed to further document any potential HAE attacks. This additional information is considered part of the trial source documentation.

[0268] As detailed in the clinical trial implementation plan, the principal investigator or designee reviews the attack information and assesses whether the event is a confirmed HAE attack. If necessary, for the assessment, the principal investigator or designee may contact the subject or caregiver to review and collect additional information. This additional information is considered part of the trial source documentation.

[0269] Reporting of Multiple Attacks If a subject experiences signs and symptoms due to multiple independent attacks, the subject can report this as multiple attacks in the electronic diary. Based on the review by the principal investigator or designee of the reported potential HAE attacks, a determination is made as to whether the individually reported events are confirmed as separate attacks.

[0270] Communication between the Site and the Subject or Caregiver The site staff sets the recommended methods and times for communicating with the subject or caregiver according to the trial schedule. At screening and periodically throughout the trial period (104 weeks), the site verifies the contact information (e.g., email, mobile phone, home phone) for the primary contact person and, if possible, the backup contact person.

[0271] Review of Diary and Potential HAE Attack Information by Clinical Trial Site Staff and Principal Investigator Complete and accurate documentation of each potential HAE attack reported in the clinical evaluation of attacks by the principal investigator or designee. The facility is required to review the diary information and confirm that the following is included in the diary, or the facility documents the following and enters it into the eCRF: · Date and time of contact with the subject · Date and time when the subject first experienced signs and symptoms · Overall potential attack severity · Whether the laryngeal area was involved in the potential attack · Drugs used for the treatment of the potential attack, including HAE acute therapy · Whether assistance, medical intervention, clinic visit, emergency room visit, or hospitalization was required · Date and time when the subject no longer experienced any symptoms of the potential attack · Whether the potential attack is considered a confirmed attack · If the potential attack is not considered a confirmed attack, the reason · Whether the potential attack is considered an adverse event

[0272] The principal investigator's evaluation of potential and confirmed attacks is documented at all facilities and entered into the eCRF by the facility staff.

[0273] Attack severity The overall severity of the subject's potential HAE attack is determined by the subject and the facility using the following guidelines: · Mild: Transient or mild discomfort · Moderate: Mild to moderate activity limitation and some assistance required · Severe: Marked activity limitation and assistance required

[0274] Reporting of HAE attacks and adverse events As described in detail in the clinical trial implementation plan, the facility staff reviews the diary information for overall diary compliance. In addition, at the time of the planned study visit or planned telemedicine visit or phone call, the facility staff verifies the diary information with the subject or caregiver and collects additional information as needed to further document any potential HAE attacks. This additional information is considered part of the trial source documentation.

[0275] At each contact and at the planned study visits, the facility staff asks about any attacks, adverse events, or changes in medications experienced by the subject.

[0276] Potential HAE attacks are recorded in the diary and eCRF and evaluated by the principal investigator or designee. After the principal investigator or designee has considered a potential HAE attack, an alternative diagnosis is made, and even if the event is not considered to be a HAE attack, the event may be registered as an adverse event (AE) in the eCRF by the facility. Regardless of severity, seriousness, or causality to the investigational drug, all AEs are recorded on the AE page of the eCRF. Details of additional AE reporting are provided in the clinical trial implementation plan.

[0277] If a potential HAE attack is considered by the principal investigator to meet any of the following criteria, the attack must be recorded as an attack in the diary and eCRF and also entered in the AE eCRF or SAE case report form (CRF): · If a HAE attack is reported and is considered by the principal investigator to be clinically more severe than an attack reported by the subject as part of their HAE attack history · If according to the HAE attack history, the location of the attack is new or the subject has never experienced it before · If a HAE attack is reported and is considered by the principal investigator to be clinically longer in duration than an attack reported by the subject as part of their HAE attack history ·When an HAE attack requires medical or clinical interventions that are different from or far greater than those reported by the subject as part of their HAE attack history before the attack recovers ·When an HAE attack leads to hospitalization ·In any other clinical evaluation or judgment by the principal investigator (PI) where the HAE attack is considered clinically significant as it is different from the attacks reported by the subject as part of their HAE attack history

[0278] Quality of life due to angioedema The MOXIE Angioedema Quality of Life (AE-QoL) questionnaire is a patient-reported outcome measure developed to assess the QoL impairment in subjects with recurrent angioedema, regardless of the underlying cause (Weller et al, 2012). To develop the assessment method, 110 angioedema patients participated in the validation of AE-QoL. AE-QoL was found to have not only a valid total score but also a four-dimensional structure. The questionnaire includes four domains (function, fatigue / mood, fear / shame, diet) and 17 questions. Test-retest demonstrated good reliability for the total score and domain scores of the measurement. Gender and disease activity as self-determined by the patient were found to be predictors of the AE-QoL total score. This is a short assessment that can be used in clinical trials and routine patient care. The recall period for this assessment tool is four weeks. The assessment can be performed at desired intervals and is completed in less than five minutes. This can help with the good characterization of affected patients, support treatment decisions, and may be useful for monitoring the treatment burden that can be significant in HAE. In the trials provided herein, this assessment was used at the initial observation period and at one time point (week 16) after the baseline of the initial observation period. Subsequently, further assessments were added, specifically, the EuroQol Group EQ-5D-5L, a brief and multi-attribute measure of general health status consisting of five questions, and the Work Productivity and Activity Impairment Questionnaire: General Health (WPAI:GH).

Example

[0279] Example 1. LNP Particle-Based Composition for KLKB1 Gene Editing In Vitro Transcription of Nuclease mRNA (「IVT」) Capped and polyadenylated mRNA containing N1-methylpseudo-U was generated by in vitro transcription using conventional methods. Briefly, a linearized plasmid DNA template and T7 RNA polymerase. Plasmid DNA containing the T7 promoter, sequences for transcription, and a polyadenylation region was linearized with XbaI according to the manufacturer's protocol. XbaI was inactivated by heating. The linearized plasmid was purified from the enzymes and buffer salts. The IVT reaction to generate the modified mRNA was performed by incubating 50 ng / μL of the linearized plasmid; 2 - 5 mM each of GTP, ATP, CTP, and N1-methylpseudo-UTP (Trilink); 10 - 25 mM of ARCA (Trilink); 5 U / μL of T7 RNA polymerase; 1 U / μL of mouse RNase inhibitor (NEB); 0.004 U / μL of inorganic E. coli pyrophosphatase (NEB); and 1x reaction buffer at 37°C. TURBO DNase (ThermoFisher) was added to a final concentration of 0.01 U / μL, and the reaction was incubated at 37°C to remove the DNA template.

[0280] mRNA was purified using either the MegaClear Transcription Clean-up Kit (ThermoFisher) or the RNeasy Maxi Kit (Qiagen) according to the manufacturer's protocol. Alternatively, mRNA was purified by precipitation protocol followed by HPLC-based purification in some cases. Briefly, after DNase digestion, LiCl precipitation, ammonium acetate precipitation, and sodium acetate precipitation were used to purify mRNA. For mRNA purified by HPLC, after LiCl precipitation and reconstitution, the mRNA was purified by RP-IP HPLC (see, for example, Kariko, et al. Nucleic Acids Research, 2011, Vol. 39, No. 21 el42). The fractions selected for pooling were combined and desalted by sodium acetate / ethanol precipitation as described above. In a further alternative method, mRNA was purified by sedimentation with LiCl and then further purified by tangential flow filtration. RNA concentration was determined by measuring absorbance at 260 nm (Nanodrop), and the transcripts were analyzed by capillary electrophoresis using a Bioanalyzer (Agilent).

[0281] Streptococcus pyogenes ("Spy") Cas9 mRNA was generated from plasmid DNA encoding the open reading frames described in the Sequence Listing. It is understood that when the sequences cited in this paragraph are referred to RNA below, T should be replaced by U (which can be such modified nucleosides as described above). The messenger RNAs used in the examples contain a 5' cap and a 3' polyadenylation sequence (e.g., up to 100 nt), which are identified in Table 3. Guide RNAs were chemically synthesized by methods known in the art.

[0282] Preparation of LNP formulations containing sgRNA and Cas9 mRNA Generally, lipid nanoparticle components were dissolved in 100% ethanol at various molar ratios. RNA cargos (e.g., Cas9 mRNA and sgRNA) were dissolved in 25 mM citric acid, 100 mM NaCl, pH 5.0, and the concentration of the RNA cargos was set to approximately 0.45 mg / mL. The LNP used, also referred to as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate), and also referred to herein as Lipid A, is an ionizable lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate) that contains cholesterol, DSPC, and PEG2k-DMG at molar ratios of 50:38:9:3, respectively. The LNP was formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a weight ratio of gRNA to mRNA of 1:2. The LNP used contained Cas9 mRNA and sgRNA.

[0283] LNPs were prepared using a cross-flow technique that utilizes collision jet mixing of lipid-containing ethanol with a two-fold volume of RNA solution and a one-fold volume of water. The lipid-containing ethanol was mixed with a two-fold volume of RNA solution by a mixing cross. A fourth stream of water was mixed with the outlet stream from the cross via an in-line T-piece (see Figure 2 of WO2016010840). The LNPs were held at room temperature for 1 hour and further diluted with water (approximately 1:1 v / v). The diluted LNPs were concentrated using tangential flow filtration on a flat sheet cartridge (Sartorius, 100kD MWCO) and then buffer exchanged into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) using a PD-10 desalting column (GE). The resulting mixture was then filtered using a 0.2 μm sterile filter. Final characterization of the LNPs was performed to determine encapsulation efficiency, polydispersity index, and mean particle size. The final LNPs were stored at 4 °C or -80 °C until further use. The total RNA content in the LNPs was determined using reversed-phase ion-pair high-performance liquid chromatography (IP-RP-HPLC). Prior to IP-RP chromatography with UV detection, the lipid nanoparticles were de-formulated to release the RNA. The concentration of each RNA was calculated by comparing the absorbance signal from the sgRNA or cas9 mRNA peak to the corresponding standard curve generated using a reference standard for the release assay. The sum of the sgRNA concentration and the cas9 mRNA concentration was reported as the total RNA concentration in mg / mL units.

[0284] Next-generation sequencing (“NGS”) and analysis of editing efficiency Genomic DNA was extracted from cells or tissues according to methods known in the art, for example using QuickExtract DNA Extraction solution (Epicentre, catalog number QE09050) or Quick Extract (Lucigen, catalog number SS000035-D2). Sequencing was utilized to identify the presence of insertions and deletions introduced by gene editing in order to quantitatively determine the editing efficiency at the target position in the genome. PCR primers were designed around the target site within the gene of interest (e.g., KLKB1) to amplify the genomic region of interest. The design of the primer sequences was performed according to standard methods in the art.

[0285] Additional PCR was performed according to the manufacturer's (Illumina) protocol and chemical reactions for sequencing were added. Amplicon sequencing was performed on an Illumina MiSeq instrument. After removing those with low quality scores, the reads were aligned to a reference genome (e.g., hg38). The resulting file containing the reads was mapped to the reference genome (BAM file), reads overlapping the target region of interest were selected, and the number of reads containing insertions or deletions ("indels") was calculated relative to the number of wild-type reads.

[0286] The editing percentage (e.g., "editing efficiency" or "editing rate") is defined as the total number of sequence reads containing insertions or deletions ("indels") relative to the total number of sequence reads including wild-type.

[0287] Example 2. Selection of sgRNAs targeting the KLKB1 gene (including off-target analysis) After a comprehensive off-target characterization workflow applying a combination of both in-silico and empirical approaches, an sgRNA targeting the KLKB1 gene sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15; within the genomic locus chr4:186251793-186251812 of the human genome build hg38) was selected for efficient knockout and specificity. To select for a high therapeutic index (the ratio of on-target editing to off-target editing), a genome-wide assay and target sequencing were performed using SITE-Seq, an empirical off-target discovery assay, to identify and validate candidate sgRNA off-target sites for G012267, the guide RNA of NTLA-2002.

[0288] SITE-Seq, a biochemical and empirical CRISPR / Cas9 off-target discovery assay, is the most sensitive for the discovery of potential off-target editing and is a cell-free biochemical method that relies on isolated gDNA (Cameron 2017). SITE-Seq was performed on human gDNA derived from peripheral blood mononuclear cells of two independent male blood donors. Each gDNA sample was digested in vitro with an assembled RNP of Cas9 and the human KLKB1 sgRNA (hu-G012267) used in NTLA-2002 to induce DNA cleavage at the on-target site and potential off-target sites homologous to the sgRNA sequence. After digestion of the gDNA, the ends of the released gDNA fragments were ligated to adapters to facilitate enrichment of edited fragments and NGS library construction. Sequencing of the NGS library was performed and reads were analyzed by bioinformatics to determine the genomic coordinates of the free DNA ends. The positions within the human genome where reads accumulated were then annotated as potential off-target sites.

[0289] Using SITE-Seq, 61 potential off-target loci of the KLKB1 targeting guide hu-G012267 were discovered. Using the potential off-target editing loci of hu-G012267 identified by SITE-Seq (Cameron 2017), as an orthogonal discovery technique, the computational off-target editing discovery method Cas-OFFinder (Bae 2014) was complemented. In SITE-Seq, 61 off-target sites were discovered, and in Cas-OFFinder, 47 sites were designated. As a preventive additional measure, including the potential off-target loci discovered by SITE-Seq from two additional experiments using alternative hu-G012267 sgRNA synthesis chemistry in the validation of off-target editing, the number of potential off-target loci increased from 108 (47 Cas-OFFinder and 61 SITE-Seq loci) to 196.

[0290] Subsequently, the 196 potential off-target editing loci identified and collected by Cas-OFFinder and SITE-Seq were characterized for off-target indel detection by targeted amplicon sequencing (rhAmpSeq or AMP-Seq) using PHH treated with a supersaturating dose of NTLA-2002. Targeted amplicon sequencing can determine whether off-target editing at each potential site is effective in the relevant cell type, PHH. To better interpret off-target editing at therapeutically relevant doses, the editing frequency in the dose-response curve (DRC) was determined for each validated off-target site.

[0291] To maximize the detection sensitivity of off-target editing, Intellia performed in vitro genome editing with a guide RNA at a supersaturated dose (6 nM) that is 50-fold greater than the empirically determined therapeutically relevant dose (0.12 nM) at which an 80% reduction in kallikrein protein was achieved in PHH. Genomic DNA (gDNA) purified from two PHH donor lots edited with the supersaturated dose of NTLA-2002 LNP was then characterized by rhAMPSeq, a multiplex amplicon PCR method. Due to the limitations of PCR primer compatibility and technical failures in amplicon enrichment, rhAMPSeq was unable to characterize all of the potential off-target editing sites discovered by Cas-OFFinder and SITE-Seq. Potential off-target loci were successfully characterized by rhAMPSeq or, alternatively, by singleplex AMP-Seq to complete the characterization of all potential off-target editing loci. rhAmpSeq and AMP-Seq were empirically determined to have lower limits of indel detection of 0.3% and 0.5%, respectively (TREP-0079 and TREP-0120, respectively).

[0292] The validated off-target loci were further characterized by the DRC of NTLA-2002 to perform validation and indel frequency of off-target editing in the context of the therapeutically relevant dose of NTLA-2002 that achieves more than 80% reduction in kallikrein protein in PHH. Two PHH donor lots (Hu8290 and Hu8317) were treated with NTLA-2002 within the DRC, and editing at on-target and off-target sites was evaluated.

[0293] In rhAmpSeq, one validated off-target editing site was detected in the first intron of the MAPK1 gene (chr22:21837431-21837451) at frequencies of 0.90% and 0.60% in PHH lots Hu8290 and Hu8317, respectively, at a concentration 50-fold greater than the empirically determined therapeutically relevant dose at which an 80% decrease in kallikrein protein is achieved. No validated off-target sites were detected by AMP-Seq.

[0294] In the DRC experiments, on-target editing at the KLKB1 locus at saturation levels of 85% or greater was achieved at high doses in PHH from both donors (Figure 2). The maximum MAPK1 intron locus editing observed was 1.5% at doses exceeding 50-fold the therapeutically relevant dose at which an 80% decrease in kallikrein protein was achieved. At the therapeutically relevant dose (0.12 nM guide RNA), no detectable MAPK1 editing was observed in any lot of PHH (limit of detection = 0.5%).

[0295] Of the 196 potential off-target sites designated by Cas-OFFinder and SITE-Seq, only one site was shown to be an effective edit via CRISPR / Cas9 in the treated PHH. This site was located in intron 1 of MAPK1. Editing of the MAPK1 off-target site was not detected with therapeutically relevant doses of NTLA-2002, suggesting that the risk associated with editing at this site is low.

Table 2

[0296] To further characterize the potential impact of off-target editing in the MAPK1 intron, MAPK1 mRNA transcripts were quantified by Droplet Digital™ PCR (ddPCR).

[0297] To maximize any potential phenotypes associated with editing at this locus, a guide with perfect homology to the MAPK1 intron site hu-G018729 was designed. This guide was formulated into individual LNPs using Cas9 mRNA000042, in addition to hu-G012267 (the KLBK1 targeting guide of NTLA-2002) and ctl-G000739 (a non-targeting control sgRNA) for in vitro testing: LNP-G018729 (LNP containing MAPK1 intron targeting hu-G018729), NTLA-2002, and ctl-LNP-G000739 (LNP containing non-targeting ctl-G000739), respectively. In the dose-response analysis, PHHs were treated with each of the three LNPs. Three days after treatment, gDNA was extracted from these cells and sequenced to determine the indel rate at the edited locus. Also, 10 days after treatment, RNA was extracted from these cells for MAPK1 expression analysis. A paired two-sided t-test was performed to estimate the true mean difference between the treatment group and the non-targeting control (LNP-G000739) group, using the ratio of the difference in group means to the pooled standard error of both groups. The Benjamini-Hochberg (B-H) procedure was used as a tool to reduce the false discovery rate.

[0298] PHHs from both donors achieved editing at the MAPK1 locus at saturation levels when treated with MAPK1-targeting LNP-G018729 (Figure 3). Subsequently, MAPK1 mRNA was quantified 10 days after treatment for all doses of both PHHs treated with NTLA-2002 and PHHs treated with MAPK1-targeting LNP-G018729. When compared to control samples using a paired t-test with the B-H procedure, no significant difference was observed in MAPK1 transcripts (Table 3).

[0299] These results indicate that, due to the lack of change in MAPK1 mRNA transcript levels, it is expected that the off-target sites are located within the non-coding intron region of the MAPK1 gene. Considering that the intron positions of the verified off-target sites do not affect MAPK1 mRNA levels, even with LNP-G018729 which achieves over 90% editing at this locus, and that there is no detectable editing at this locus with therapeutically relevant doses of NTLA-2002, it is suggested that the risk associated with off-target editing is low.

Table 3

[0300] Example 3. Evaluation of DNA Structural Variant Characteristics in Primary Human Hepatocytes To characterize potential DNA structural variants (SVs), two complementary techniques were applied: the identified unique identifier tagging (UnIT) NGS assay and long-range PCR followed by long-read sequencing using Pacific Biosciences technology, to characterize potential DNA structural variants that could result from genome stability and genome editing by NTLA-2002. Target PCR-based amplicon sequencing using Illumina-based NGS has limitations in characterizing and quantifying DNA structural variants (SVs) such as deletions, duplications, inversions, and translocations over 100 bp.

[0301] The DNA SV discovery technique called UnIT was developed based on reports published using Illumina NGS (Giannoukos 2018; Klein 2011). This method enables the simultaneous measurement of small indels (<100 bp) at on-target sites and potential structural variants resulting from rearrangements such as inversions, duplications, and interchromosomal translocations after DNA repair.

[0302] DNA SVs were detected using split and discordant NGS alignments. When NGS reads or read pairs aligned to more than one locus within the genome, the two relevant fragments (two segments from the same read in the case of split alignments or two reads from the same pair in the case of discordant alignments) were used to classify the SVs.

[0303] A complementary long-range sequencing approach was implemented to capture large deletions around editing sites that may be missed by short-read NGS sequencing. Long-range PCR followed by long-read sequencing using Pacific Biosciences technology characterized the potential for large deletions near the on-target site resulting from the DNA repair process after genome editing by NTLA-2002.

[0304] After genome editing by NTLA-2002, the UnIT DNA SV characterization assay was applied in triplicate to gDNA purified from two PHH donors. DNA SVs above the empirically determined detection limit of 0.5% were not detected.

[0305] Characterization of potential large deletions using long-range PCR and long-read sequencing was performed on PHHs from two distinct donors. No large deletions above the detection limit (0.5%) were observed in either PHH lot.

[0306] No DNA structural variants above the empirically determined detection limit of 0.5% were identified, and the identified translocations were not associated with any known cancer risk. Thus, genomic rearrangements at the on-target locus do not pose a known safety risk.

[0307] Example 4. In Vitro Evaluation of the Potency of NTLA-2002 In vitro. In vitro pharmacological tests for NTLA-2002 and cyn-LNP-G013901 were performed in primary human and cynomolgus monkey hepatocytes, respectively. In vitro activities (gene editing, reduction of KLKB1 mRNA, and reduction of kallikrein protein) were tested in human hepatocytes. At saturating levels of NTLA-2002, more than 85% indel formation (editing) occurred in the KLKB1 gene, resulting in more than 85% reduction of KLKB1 mRNA and more than 99% reduction of kallikrein protein. In primary monkey hepatocytes, in vitro activities comparable to cyn-LNP-G013901 were observed. The relative in vitro activities of cyn-LNP-G013901 and NTLA-2002 were considered when predicting the in vivo human PD effect (reduction of kallikrein protein) using the pharmacokinetics (PK) / pharmacodynamics (PD) data from the monkey studies.

[0308] Example 5. In Vitro Evaluation of the Potency of NTLA-2002 in Transgenic Mice Functional verification of the in vivo pharmacology of NTLA-2002 was performed in a transgenic mouse model (huKLKB1 mouse) expressing the human KLKB1 gene. The Hu KLKB1 mouse model contains a humanized KLKB1 locus in which the region from the start codon to the stop codon of mouse KLKB1 was replaced with the corresponding human genomic sequence. The body weights of the animals were measured and administered in amounts corresponding to their individual body weights. NTLA-2002 was administered with a total RNA of 0.3, 0.1, 0.03, and 0.01 mg per kg body weight.

[0309] On day 13 after LNP administration, the mice were euthanized. They were lysed using a Zymo Research Bashing Bead Lysis Rack, and RNA was extracted using a Qiagen RNeasy Mini Kit (Qiagen, Cat. 74106) according to the manufacturer's protocol. RNA was quantified using a Nanodrop 8000 (ThermoFisher Scientific, Catalog ND-8000-GL). The RNA samples were stored at -20 °C until use.

[0310] PCR reactions were performed using the SuperScript III Platinum One-Step qRT-PCR Kit (Invitrogen, catalog 11732-088). Quantitative PCR probes targeting Hu KLKB1 and the internal control Ms PPIB were used in the reactions. Quantitative PCR assays were performed using the Hu KLKB1 and Ms PPIB probes described above, scaled to the appropriate reaction volume according to the manufacturer's specifications. Real-time PCR reactions and transcript quantification were performed using the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, catalog 4376600) according to the manufacturer's protocol.

[0311] Hu KLKB1 mRNA was quantified using a standard curve starting with 20 ng / uL of pooled mRNA from the vehicle control group, followed by five 3-fold dilutions and ending at 0.06 ng / uL. Ct values were determined using a StepOnePlus Real-Time PCR System. Reduction of total secreted human prekallikrein protein in cells treated with the KLKB1 reagent was determined by ELISA as described in Example 1.

[0312] Table 4 and Figure 4 show the editing rate, percent serum prekallikrein levels in mice treated with the TSS vehicle control, and percent mRNA transcript levels in animals treated with the TSS vehicle control. [Table 4]

[0313] A proof-of-concept study was conducted to evaluate KLKB1 gene editing, total kallikrein protein expression, and vascular leakage in humanized mice. There were six groups (N = 5, 2 males and 3 females per group). Animal weights were measured and dosed at an amount corresponding to each individual weight. Based on the total RNA cargo, NTLA-2002 or vehicle control (TSS) at a volume of 10 ml per kg body weight was administered via the lateral tail vein at 0.03 mg / kg, 0.1 mg / kg, or 0.3 mg / kg.

[0314] One day prior to the vascular leakage test, blood was collected and processed to measure secreted human prekallikrein by ELISA to detect total kallikrein. The Evans blue vascular permeability assay is a well-established model of edema and vascular leakage that can be used as a model in HAE testing (see, for example, Bhattacharjee et al., 2013). Briefly, 13 days after dosing, vascular permeability was induced using an intraperitoneal injection of captopril, an angiotensin-converting enzyme (ACE) inhibitor, at 2.5 mg / kg. Fifteen minutes later, a mixture of Evans blue dye (30 mg / kg) and dextran sulfate (0.3 mg / kg) was administered by intravenous tail injection. Fifteen minutes after this injection, the animals were euthanized and the outflow of dye into the colon was evaluated by the optical density (OD) at 600 nm using a Clariostar plate reader (BMG LabTech). Liver and serum were collected and huKLKB1 gene editing and kallikrein protein were quantified, respectively.

[0315]

[0001] The results of the editing rate, serum hu-prekallikrein levels, and vascular leakage are shown in Table 5 and Figures 5 and 6.

Table 5

[0316] The dose-dependent increase in KLKB1 gene editing and decrease in serum kallikrein reduced the vascular permeability induced by captopril. At the highest dose tested, the induced permeability was comparable to the baseline level.

[0317] Example 7. Editing via LNP in non-human primates Cynomolgus monkeys were treated in a cohort of n = 3. This study was conducted with the LNP formulation according to Example 1. Each LNP formulation contained polyadenylated Cas9 mRNA (including SEQ ID NO: 408) and gRNA (G013901, mG*mG*mA*UUACAUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 409)), a KLKB1 guide RNA specific for cynomolgus monkeys, at an mRNA:gRNA weight ratio of 2:1. The animals were dosed at 1.5 mg, 3 mg, or 6 mg per kg based on the total RNA cargo. Indel formation (editing rate) was measured by NGS. Total kallikrein activity and plasma kallikrein protein levels were measured as described above.

[0318] This study showed that knocking out KLKB1 with G013901, which is part of the biological pathway that leads to the release of bradykinin, resulted in a robust response in the NHP group that exceeded the target activity (60% reduction in kallikrein activity; Banerji, 2017) that achieved up to a 90% reduction in kallikrein activity or even a therapeutically meaningful effect on the HAE attack rate. This study showed that there was a dose-dependent correlation between the increase in editing rate, the decrease in plasma kallikrein levels, and the decrease in kallikrein activity. The response persisted in NHP for up to 1 year. Tables 6 and 7; as well as Figures 7 and 8 provide the circulating kallikrein protein and activity levels. [Table 6] [Table 7]

[0319] In the test of the selected NHP samples, when comparing the TSS buffer control group and the treatment group, no effect on the coagulation pathway biomarkers of KLKB1 knockout in NHP was observed at week 10 or week 15 (based on the measurement of prothrombin, APTT, and fibrinogen (all at week 10), and factor XII (at week 15)).

[0320] Using guide G012267, which contains a guide sequence that is fully complementary to human KLKB1, an NHP test was repeated to evaluate the total kallikrein protein expression and total kallikrein activity levels in cynomolgus monkeys. The guide sequence of G012267 has a one-nucleotide difference compared to G013901, which has a guide sequence that is fully complementary to cynomolgus monkey KLKB1. The experimental protocol and LNP formulation in this test were essentially the same as those described in the above experiment, except that the animals (n = 3) were administered only 3 mg per kg based on the total RNA cargo. Total kallikrein activity and kallikrein protein levels were measured using the methods described in Example 1.

[0321] This test showed that knocking down KLKB1 with G012267 resulted in a maximum 65% decrease in kallikrein activity in the NHP group. The response persisted in NHP for 9 months. Circulating kallikrein protein and activity levels are provided in Tables 8 and 9; as well as Figures 9 and 10.

Table 8

Table 9

Table 10

[0322] Example 8. In Vivo Distribution and Tissue Editing Test A pharmacokinetic study was conducted in NHP using the cynomolgus monkey surrogate LNP formulation containing the sgRNA G013901 described in the above example. The exposure of the LNP components was approximately dose-proportional or supra-dose-proportional in males and approximately dose-proportional or supra-dose-proportional at dose levels three-fold or greater in females. The exposure to the components was generally similar in male and female monkeys. In the study using the surrogate cyn-LNP-G013901, the components disappeared from circulation in less than 5 days.

[0323] Both NTLA-2002 and its surrogate cyn-LNP-G013901 were used to evaluate in vivo distribution to the NHP liver (target tissue) and other tissues, as well as tissue editing. As described in the pharmacology summary, dose-dependent liver editing was observed. In sexually mature male NHP treated with either 1.5 mg / kg or 4.5 mg / kg of cyn-LNP-G013901, at these dose levels, the mean editing in the adrenal gland was 2.4% and 18.7%, respectively, and the mean editing in the spleen was 12.2% and 18%, respectively. No editing was detected in semen or testes. In animals treated with 3 mg / kg, 6 mg / kg, or 9 mg / kg of NTLA-2002, at these dose levels, the mean editing in the adrenal gland was 1.2%, 4.0%, and 5.1%, respectively, and the mean editing in the spleen was 2.4%, 3.1%, and 6.0%, respectively. Similar to the males treated with cyn-LNP-G013901, males treated with NTLA-2002 did not show detectable editing in testicular tissue. In females, low-level editing in the range of 0.8 - 1.8% was detected in bulk ovarian tissue in some, but not all, females.

[0324] Similar findings were also observed in transgenic mice containing the human KLKB1 gene (huKLKB1). These findings in bulk ovarian tissue provided a reason to further investigate the possibility that genome editing events are erroneously transmitted to the germline. This risk was evaluated in a GLP breeding study in transgenic huKLKB1 mice. Female huKLKB1 mice (n = 70) were treated with NTLA-2002 at a dose more than 17-fold higher than the expected effective dose (3 mg / kg) and mated with naive male huKLKB1 mice. The mean liver editing in treated females was 78%, with the highest activity shown in the target organ. None of the 382 offspring showed the KLKB1-edited genotype. Therefore, this study did not provide evidence that editing events via NTLA-2002 are transmitted to the germline, supporting the inclusion of women of childbearing potential (WOCBP) in clinical trials.

[0325] Example 9. Clinical Trials The initial overall treatment design is summarized in Figure 11. The treatment design was modified to reduce the dose of the third cohort from 150 mg to 50 mg.

[0326] A. HAE Dose Escalation Trial Introduction: Hereditary angioedema (HAE) is a rare genetic disorder characterized by recurrent, debilitating, and potentially life-threatening swelling attacks. Prophylactic treatments targeting kallikrein, a protease encoded by the KLKB1 gene, significantly reduce the frequency of attacks. NTLA-2002 is an investigational CRISPR / Cas9-based therapy targeting KLKB1 in hepatocytes, aiming to achieve lifelong control of HAE attacks after a single administration.

[0327] Methods: NCT05120830 is a first-in-human Phase 1 / 2 trial of NTLA-2002 in HAE patients. The primary objectives of the Phase 1, single ascending dose design are to assess safety and identify up to two doses to proceed to a randomized Phase 2 for further evaluation of efficacy and safety.

[0328] Results: Cohort 1 (25 mg; n = 3) completed the initial 16-week observation period. Neither DLT nor clinically significant laboratory abnormalities were observed. Treatment-emergent adverse events (TEAEs) were not severe, resolved spontaneously, and the most common were infusion-related reactions (n = 2; CTCAE G1). All subjects showed a clinically significant and sustained decrease in plasma kallikrein levels (mean 62 ± 27% at week 16) and HAE attack frequency from baseline, and 2 subjects remained attack-free after infusion. In Cohort 2 (75 mg), 3 subjects were treated. Follow-up is ongoing for all subjects in both cohorts.

[0329] Conclusion: A single dose of 25 mg of NTLA-2002 has been well-tolerated to date, with a decrease in plasma kallikrein levels and HAE attack rate maintained over a 16-week period post-infusion and meeting pre-specified criteria to progress to Phase 2. Safety, pharmacodynamics, and HAE attack rate data are presented for both cohorts.

[0330] Cohorts 1, 2, and 3 Enrollment Subjects were screened according to eligibility criteria. According to the protocol, subjects were enrolled into dose-escalation Cohorts 1 and 2 as shown in Figure 11. Cohort 3 was enrolled using the same inclusion and exclusion criteria as Cohorts 1 and 2. The dosing regimen was modified to administer 50 mg of NTLA-2002 to subjects instead of the 150 mg dose in the original protocol.

[0331] Clinical Trial Design and Eligibility Data from two initial cohorts (Cohort 1 and 2) of the international multicenter, open-label, Phase 1 trial are presented herein. Patients were treated with a single dose of NTLA-2002 and received an intravenous infusion of either 25 mg total RNA (3 subjects) or 75 mg total RNA (3 subjects). Data from these patients who were subsequently treated are also reported herein. The primary eligibility criteria for Phase 1 included being at least 18 years of age, having a functional C1-INH level, C1-INH antigen level, and C4 level or a documented diagnosis of HAE (Type I or II) confirmed by genetic testing, and having had at least 3 documented HAE attacks in the 3 months (90 days) prior to screening start as confirmed by the study investigator. Subjects were also required to have access to and use of one or more acute medications to treat angioedema attacks and to meet the following clinical laboratory criteria during screening: a. Aspartate aminotransferase (AST), alanine aminotransferase (ALT), and total bilirubin at screening (see exceptions below for Gilbert's syndrome) ≤ upper limit of normal (ULN) range. b. For subjects with a history of Gilbert's syndrome, total bilirubin at screening evaluation ≤ 2×ULN. c. Serum creatinine ≤ ULN or, for subjects with serum creatinine > ULN, estimated glomerular filtration rate (eGFR) measured by the Modification of Diet in Renal Disease formula at screening > 45 mL / min / 1.73 m^2 could be included. Subsequently, the lower limit was changed to > 60 mL / min / 1.73 m^2. d. Platelet count at screening ≥ 100,000 cells / mm^3. e. Activated partial thromboplastin time (aPTT), international normalized ratio (INR), fibrinogen, and D-dimer levels within the reference range or clinically insignificant as determined by the principal investigator (PI) at screening.

[0332] Subjects who had been treated with a specific therapeutic agent were excluded from the Phase 1 trial as follows: a. Use of ecallantide or lanadelumab within 6 months prior to the start of screening. b. Use of C1-INH for HAE within 5 half-lives of the drug prior to the start of the Phase 2 lead-in period; i.e., a 24-hour washout is required prior to the start of the lead-in period after use of rabbit purified C1-INH (Ruconest), and a 4-day washout is required prior to the start of the lead-in period after use of human plasma purified C1-INH (Berinert). Note: C1-INH may be used during the lead-in period to treat acute HAE attacks. c. Exposure to an angiotensin-converting enzyme (ACE) inhibitor or any estrogen-containing drug with systemic absorption within 90 days prior to administration of the investigational drug. d. Antithrombotic therapy other than aspirin within 14 days prior to administration of the investigational drug (e.g., warfarin, dabigatran, apixaban).

[0333] Subjects with certain infectious diseases or medical conditions, including the following, were excluded: a. Concurrent diagnosis of any other type of recurrent angioedema, including acquired or idiopathic angioedema. b. History of thrombotic tendency or positive results of genetic tests for Factor V Leiden or prothrombin 20210. c. History of cirrhosis. d. History or suspicion of systemic infection with viruses, parasites, or fungi, including coronavirus disease (COVID)-19, or administration of antibiotics within 14 days prior to screening for bacterial infections. e. History of hepatitis B or C infection, or positive test results for hepatitis B surface antigen (HBsAg) or hepatitis C virus antibody (HCVAb) at the time of screening. f. History of human immunodeficiency virus (HIV) positive status.

[0334] Subjects were required to comply with other criteria, including but not limited to the use of effective contraception, and the willingness and ability to comply with the study procedures, including follow-up and cooperation with the study responsible physician.

[0335] The screening period for the first-phase part of the trial was up to 28 days ( + 14 days if necessary). Subjects who met all inclusion criteria and did not meet any exclusion criteria could proceed to dosing. Angioedema attacks were recorded during screening and were used in addition to 3 months of past attack data when evaluating the reduction in attack rate after NTLA-2002 dosing.

[0336] Data collection and confirmation of hereditary angioedema (HAE) attacks The principal investigator and the trial site team were provided with detailed guidance to ensure consistency in documenting and reviewing the attack history and in collecting, considering, and evaluating events considered potential angioedema attacks. Detailed descriptions of the definitions and methods are provided above.

[0337] Dose escalation and dose-limiting toxicity The Phase 1 clinical trial was designed to demonstrate the safety of NTLA-2002 and to identify the appropriate dose for the Phase 2 trial. As shown in Figure 11, Phase 1 consisted of up to three dose-escalation cohorts, with cohorts 1 - 3 consisting of a minimum of 3 and a maximum of 6 subjects evaluable for dose-limiting toxicity (DLT). The trial also permitted up to two optional dose-de-escalation cohorts, each consisting of a minimum of 3 and a maximum of 6 subjects evaluable for DLT. In total, up to 30 subjects evaluable for DLT could be enrolled in Phase 1. NTLA-2002 was administered as shown in the table of cohort dosing profiles shown in Figure 11 and could be modified for dose increases / decreases as described.

[0338] A minimum of 3 subjects evaluable for DLT per cohort is required. Subjects evaluable for DLT are those who have received all of the NTLA-2002 at the assigned dose and completed the day 29 assessment, and any subject who experienced dose-limiting toxicity (DLT), regardless of receipt of all doses.

[0339] Cohort dosing In the single ascending dose phase, to evaluate potential acute toxicity, each cohort is administered to sentinel subjects for 14 days. If the sentinel subjects do not experience DLT, administration can be carried out in parallel to two additional subjects within the cohort. From the administration until the hospital visit assessment on the 15th day, if a subject experiences DLT, after all DLT has recovered to at least grade 1 and after all active drug subjects have completed the hospital visit assessment on the 15th day, administration to the next subject in that dose cohort is carried out. If any subject experiences DLT from the hospital visit assessment on the 14th day until the hospital visit assessment on the 29th day, after all DLT has recovered to at least grade 1, administration to the next subject in that dose cohort can be carried out.

[0340] The last subject administered in each cohort is evaluated for 28 days, and subsequent dose escalation is considered based on the criteria provided below. The sponsor, in cooperation with the principal investigator and the Data Monitoring Committee (DMC), determines whether the event meets the definition of DLT and occurred within the first 28 days. The sponsor may raise the assessment level of the severity, seriousness, or relevance of adverse events (AE) reported by the principal investigator, but it is prohibited for the sponsor to lower the assessment level of AE.

[0341] In any cohort, if 1 out of 3 subjects has DLT, 3 additional subjects can be sequentially enrolled, and the interval between each subject at that dose level is at least 14 days. If 2 or 3 out of 3 subjects experience DLT, enrollment in that cohort is terminated, and the next lower dose cohort is (re)started and 3 subjects can be enrolled. In any cohort, if 3 out of 3 subjects have an aPTT of 125 seconds or more on the 22nd day, that dose level is determined to be the maximum evaluated dose. If these cohort closure events occur in the cohort at the first dose level 1 (25 mg), a reduced dose cohort of 3 subjects is investigated to evaluate whether the lower dose is safe and tolerable based on evidence of pharmacological activity. To confirm safety, up to 6 subjects can be enrolled in the final dose cohort.

[0342] DLT includes the following (events occurring within the first 28 days after dosing): · Any adverse event according to the Common Terminology Criteria for Adverse Events (CTCAE) grade 3 or higher, excluding angioedema, prolonged aPTT, or AEs related to the patient's other co-existing conditions (underlying diseases), which may be related, probably related, or clearly related to the investigational drug. · Any CTCAE grade 3 clinical laboratory abnormality (excluding prolonged aPTT) that persists for 7 days or more and may be related, probably related, or clearly related to the investigational drug. · Any CTCAE grade 4 clinical laboratory abnormality that may be related, probably related, or clearly related to the investigational drug. · Any AE that meets the criteria for registration suspension defined in the protocol, including life-threatening or fatal adverse events; an increase in ALT or AST > 5×ULN lasting for more than 4 weeks or an increase in ALT or AST > 3×ULN and total bilirubin > 2×ULN (in the absence of initial findings of cholestasis [increase in serum alkaline phosphatase]; Hy's law); or clinical laboratory parameters consistent with thrombosis, bleeding, or disseminated intravascular coagulation, where the criteria for registration suspension defined in the protocol are determined by the principal investigator of the trial to be possibly related, probably related, or clearly related to the investigational drug. · Any other adverse event or clinical laboratory abnormality that, in the opinion of the sponsor of the trial, makes further dosing impossible after consultation with the principal investigator of the trial and the DMC.

[0343] Dose escalation, dose reduction, or registration completion After registration into the dose-level cohort and completion of the follow-up assessment of the in-hospital evaluation up to the 29th day for at least 3 subjects, the sponsor shall review all available safety and tolerability data, and after consultation with the principal investigator of the trial and the Data Monitoring Committee (DMC) (in accordance with the DMC charter), determine the next steps. The decision on dose increase / decrease is based not only on safety, efficacy, and PD data, but also on the overall available data including the initial observation of DLT within 28 days after injection and the change in aPTT from baseline to the 22nd day. · If both of the following criteria are met, the sponsor may propose an increase in dose to the next planned dose level: It is confirmed that the administered dose level is safe and well tolerated, and individual aPTT examination shows that at least 1 / 3 of the cohort subjects have an aPTT < 125 seconds at the in-hospital evaluation on the 22nd day. Based on the review of all available data, the dose increase may be adjusted so that the next planned dose level is between the current dose and the next dose specified in the implementation plan. Alternatively, the sponsor may also choose to initiate a cohort where the next planned dose level is a dose reduction. · If any of the following criteria are met, the sponsor may propose a dose reduction to a dose below the current dose level: It is not confirmed that the dose administered to the cohort is safe and well tolerated, or examination of the cohort's aPTT shows that the intended maximum pharmacological effect (≥ 125 seconds) has been achieved in all subjects of the cohort at the in-hospital evaluation on the 22nd day.

[0344] The decision on dose increase, dose reduction, or completion of enrollment in the Phase 1 trial and initiation of Phase 2 shall be determined by the sponsor upon receiving the recommendations from the principal investigator of the trial and the DMC (in accordance with the DMC charter). In addition to the above criteria, at the discretion of the sponsor, for any reason to ensure the safety of the subjects, the trial enrollment may be terminated and the DMC may be convened.

[0345] The completion of the registration of the first - phase trial is declared after all of the 3 - 5 planned dose cohorts have completed the day 29 assessment, or when the maximum - evaluated dose has been identified, or when the trial is prematurely terminated based on the sponsor's assessment in consultation with the principal investigator and the DMC.

[0346] To notify the selection of the doses to be tested in the second - phase trial, the sponsor conducts a comprehensive analysis of all of the first - phase safety, tolerability, PK, PD (decrease in prekallikrein / kallikrein concentration), and therapeutic activity (analysis of the HAE attack rate from weeks 5 - 16). The results are discussed with the principal investigator and the DMC to determine whether to test the doses in the second - phase trial.

[0347] Prior to initiating the second - phase trial, in accordance with national requirements, a summary of the cumulative data using appropriate data - cut - off points is provided to the regulatory authority or the Institutional Review Board (IRB) / Ethics Committee (EC).

[0348] Phase 2 Phase 2 includes a maximum of 25 subjects and 3 groups, with a maximum of 2 groups receiving different doses of NTLA - 2002 and 1 group receiving saline placebo. If two dose levels of NTLA - 2002 are used in Phase 2, the subjects are randomly assigned to NTLA - 2002 dose level 1:NTLA - 2002 dose level 2:placebo in a 2:2:1 ratio. If only one dose level of NTLA - 2002 is used in Phase 2, the subjects are randomly assigned to NTLA - 2002 dose level 1:placebo in a 2:1 ratio for a maximum of 15 subjects. The dose of NTLA - 2002 selected for Phase 2 is the dose determined to be safe and well - tolerated in Phase 1, with at least a 60% decrease in the mean total plasma prekallikrein / kallikrein level from baseline to nadir and evidence of a decrease in HAE attacks.

[0349] The second phase includes up to 25 subjects and 3 groups, with up to 2 groups receiving different doses (25 mg (n = 10) and 50 mg (n = 10)) of NTLA-2002 and 1 group receiving saline placebo (n = 5). The primary objectives are clinical efficacy against seizures up to week 16 and the evaluation of other pharmacodynamics, safety, tolerability, pharmacokinetics, and quality of life.

[0350] Pharmacokinetics Intermediate pharmacokinetic data suggest that the ionizable lipid of NTLA-2002 shows a rapid decline from peak levels after intravenous (IV) injection, followed by a secondary peak and a log-linear phase.

[0351] Example 10. In Vivo CRISPR / Cas9 Editing of KLKB1 in Hereditary Angioedema Patients: First-in-Human Trial Cohort 1: Data are reported for three subjects treated with 25 mg of NTLA-2002 in Cohort 1 of the Phase 1 study described in Example 9. Demographics and HAE attack characteristics for Cohort 1 are listed in Table 13. Subjects completed the 16-week initial observation period. No DLTs were observed in any subjects. No subjects had clinically significant laboratory abnormalities. TEAEs were non-serious and resolved spontaneously, with the most common being infusion-related reactions (n=2; CTCAE G1). All infusion-related reactions resolved without clinical sequelae and were considered mild. No treatment-emergent SAEs or Grade 3 or higher AEs were observed. Subjects demonstrated a reduction from baseline in HAE attack frequency, with two subjects remaining attack-free since the infusion (Tables 11 and 12 and Figures 15 and 16A). Compared to the screening period, Cohort 1 subjects experienced a mean reduction in attack frequency of >90% (mean -91 ± 16% SD) from weeks 1 through 16 post-infusion. In an analysis including the patient-reported 90-day retrospective period, the mean percent change in monthly attack rate was -94%. Subjects also demonstrated a sustained, clinically significant reduction in plasma kallikrein levels (mean 62 ± 27% at week 16) (see, e.g., Figure 12). Figure 13 shows the mean absolute reduction in protein post-infusion. Figure 14 shows the updated results of the mean absolute reduction in protein post-infusion. A single 25 mg dose of NTLA-2002 has been well tolerated to date, with reductions in plasma kallikrein levels and HAE attack rates maintained throughout the 16-week post-infusion period, fulfilling the pre-specified criteria for progression to Phase 2. [Table 11] [Table 12] [Table 13]

[0352] Cohort 2: In Cohort 2 of the Phase 1 trial described in Example 9, three subjects were treated with 75 mg of NTLA-2002.

[0353] In the follow-up analysis of Cohort 2, there were no clinically significant laboratory abnormalities in the subjects. The TEAE were not severe, resolved spontaneously, and the most common were infusion-related reactions (n = 2; CTCAE G1 and n = 2; CTCAE G2). All infusion-related reactions resolved without clinical sequelae and were considered mild. No TEAE of grade 3 or higher were reported. Figure 13 shows the decrease in the mean absolute value of protein after infusion. Figure 14 shows the updated results of the decrease in the mean absolute value of protein after infusion. The percent decrease from baseline to nadir was 65% (25 mg) and 92% (75 mg), and at both dose levels, a pharmacodynamic response was shown that is expected to be related to the effective prevention of HAE attacks.

[0354] Patient demographics and characteristics are provided in Table 14. The individual and total HAE attack history and use of prophylaxis in patients in Cohorts 1 and 2 are shown in Table 15.

Table 14

Table 15

[0355] NTLA-2002 was generally well tolerated at all dose levels. At all dose levels, the most frequent adverse events were fatigue and infusion-related reactions. Most of the adverse events that developed during treatment were of mild severity, and 67% (n = 4) and 33% (n = 2) of the patients reported the most severe adverse events of severity grade 1 or 2, respectively. All infusion-related reactions resolved without clinical sequelae and were considered mild (n = 4) or moderate (n = 1). All patients received all test doses of NTLA-2002.

[0356] No clinically significant laboratory findings were observed. Transient grade 1 elevations were observed in AST (n = 3) and ALT (n = 2). An increase in activated partial thromboplastin time was not observed. SAE or grade 3 or higher AE expressed under treatment was not observed. Adverse events are summarized in Table 16 below. [Table 16]

[0357] All other adverse events (abdominal pain, chest injury, soft tissue injury, pre-disease stage, rhinitis, diarrhea, vomiting, somnolence, myalgia, insomnia, oropharyngeal pain, viral upper respiratory infection) were reported in only 1 patient.

[0358] Single administration of NTLA-2002 resulted in a robust, dose-dependent, and sustained decrease in total plasma kallikrein levels. Mean decreases of 65% (25 mg) and 92% (75 mg) were achieved at week 8. HAE attacks in the 25 mg cohort up to week 16 were reduced by more than 90% on average. All patients in the 25 mg cohort achieved complete attack control. Patients who had received prophylaxis in the past were able to discontinue it and maintain a seizure-free state.

[0359] NTLA-2002 had generally good tolerability at all dose levels, and all AEs were of mild or moderate severity. The 50 mg cohort was enrolled and treated.

[0360] Cohort 3: In cohort 3 of the phase 1 trial described in Example 9, 4 subjects were treated with 50 mg of NTLA-2002.

[0361] In the follow-up analysis of Cohort 3, there were no clinically significant laboratory abnormalities in the subjects. At all dose levels, TEAE were mild (n = 5) to moderate (n = 4) and resolved without clinical sequelae. An increase in activated partial thromboplastin time was not observed. No SAEs or TEAE of grade 3 or higher occurred during treatment. Figure 17 shows the latest results of the decrease in the mean absolute value of the protein after injection. Figure 18 shows the latest results of the mean percent decrease in kallikrein protein compared to baseline after injection. Pharmacodynamic responses expected to be associated with effective prevention of HAE attacks were shown at all three dose levels.

[0362] Patient demographics and characteristics are provided in Table 17. The HAE attack history and use of prophylaxis in patients in Cohorts 1 - 3 are shown in Table 18. [Table 17] [Table 18]

[0363] NTLA-2002 was generally well tolerated at all three dose levels. At all three dose levels, the most frequent adverse events were fatigue and infusion-related reactions. Most of the adverse events that occurred during treatment were of mild severity, with 50% (n = 5) and 40% (n = 4) of patients reporting the maximum adverse event of severity grade 1 or 2, respectively. All infusion-related reactions resolved without clinical sequelae and were considered mild (n = 5) or moderate (n = 2). All patients received all test doses of NTLA-2002.

[0364] No clinically significant laboratory findings were observed. Adverse events are summarized in Table 19 below. [Table 19]

[0365] All other adverse events AE (abdominal discomfort, abdominal pain, epigastric pain, arthralgia, asthenia, chest injury, depression, diarrhea, premonitory symptoms, flank pain, insomnia, myalgia, rhinitis, sinusitis, soft tissue injury, somnolence, vomiting) were reported in only 1 patient.

[0366] Single administration of NTLA-2002 resulted in a robust, dose-dependent, and sustained decrease in total plasma kallikrein levels. An average plasma reduction of 65% (25 mg) to 92% (75 mg) was observed in Nadia, and the response persisted throughout the follow-up period.

[0367] A clinically meaningful reduction in the HAE attack rate was observed in all patients who underwent at least 16 weeks of follow-up. 100% of the patients in Cohort 1 (25 mg) and Cohort 2 (75 mg) maintained a disease-free period of 2.3 to 10.6 months. The first 3 patients treated had no attacks for 5.5 to 10.6 months (Figures 19, 20A, and 20B). The mean percentage change from baseline in attacks was 91% in Cohort 1 and 78% in Cohort 2 at weeks 1 to 16 after administration of NTLA-2002. The mean percentage change from baseline in attacks was 89% in Cohort 1 and 89% in Cohort 2 at weeks 5 to 16 after administration of NTLA-2002 (Figure 21). Patients who discontinued prophylaxis after NTLA-2002 infusion remained attack-free.

[0368] Consistent with the previous analysis, NTLA-2002 had generally good tolerability at all dose levels, and all AEs were of mild or moderate severity.

[0369] Example 11. In Vivo CRISPR / Cas9 Editing of KLKB1 in Hereditary Angioedema Patients: Updated Clinical Data Provide the follow-up investigation analysis of Cohorts 1 - 3 of Example 10. FIG. 22 shows the latest results of the decrease in the average absolute value of the protein after injection. FIG. 23 shows the latest results of the average percent decrease in kallikrein protein compared to the baseline after injection. The average absolute value of plasma kallikrein activity after injection in each cohort is shown in FIG. 28. The average percentage change from the baseline of plasma kallikrein activity after injection in each cohort is shown in FIG. 29. Spaghetti plots of individual patient data of kallikrein protein levels as a percentage change from the baseline are shown in FIGS. 30 - 32. Spaghetti plots of individual patient data of kallikrein activity levels as a percentage change from the baseline are shown in FIGS. 33 - 35. Consistent with the previously reported findings, pharmacodynamic responses that are expected to be associated with effective prevention of HAE attacks were shown at all three dose levels.

[0370] A single administration of NTLA - 2002 resulted in a robust, dose - dependent, and sustained decrease in total plasma kallikrein levels. Average plasma decreases of 65% (25 mg), 81% (50 mg), and 92% (75 mg) were observed in Nadia, and the responses persisted throughout the follow - up period.

[0371] A clinically meaningful reduction in the HAE attack rate was observed in all patients who underwent a follow-up of at least 24 weeks. All patients, except for one patient in Cohort 1 (25 mg), maintained a seizure-free period of 3.7 to 12 months (Figures 24 to 27). One patient in Cohort 1 (25 mg) experienced one mild attack. The mean percentage change from baseline in attacks was 93.8% in Cohort 1 (25 mg), 83.7% in Cohort 2 (75 mg), and 98.3% in Cohort 3 (50 mg) at Weeks 1 to 24 after administration of NTLA-2002. The mean percentage change from baseline in attacks was 95.4% in Cohort 1, 91.2% in Cohort 2, and 98.3% in Cohort 3 during the study period after administration of NTLA-2002 (Tables 20, 21). Of the six patients who combined long-term prophylaxis (Table 18), 100% were able to discontinue prophylaxis and maintain a seizure-free state (Figure 24). The HAE attack history of patients in Cohorts 1 to 3 is shown in Table 20 (HAE attacks confirmed by the principal investigator of the clinical trial) and Table 21 (HAE attacks confirmed by the principal investigator that required acute therapy).

[0372] Consistent with the previous analysis, NTLA-2002 had generally good tolerance at all three dose levels, and all AEs were of mild or moderate severity. All treatment-related TEAEs were grade 2 or less. All patients received NTLA-2002 at all study doses. The adverse events are summarized in Table 22 below.

Table 20-1

Table 20-2

Table 21-1

Table 21-2

Table 22-1

Table 22-2

[0373] Example 12. In Vivo CRISPR / Cas9 Editing of KLKB1 in Hereditary Angioedema Patients: Updated Clinical Data Using the data from Example 11, a correlation plot between plasma kallikrein protein concentration (% change from baseline) and kallikrein activity (% change from baseline) in HAE patients after administration of a single dose of NTLA-2002 (25, 50, or 75 mg) was analyzed (Figure 36). The analysis showed a strong linear correlation (R2 = 0.820) between the % change in kallikrein protein from baseline and the % change in kallikrein activity, with a slope of 0.929 (95% CI: 0.840 to 1.019).

[0374] Example 13. In Vivo CRISPR / Cas9 Editing of KLKB1 in Hereditary Angioedema Patients: Updated Clinical Data, Pharmacokinetic Analysis Blood samples were collected to evaluate the plasma concentration-time profile before injection, during the injection period, and at the end of the injection period. Samples after injection were collected at predetermined time points as shown in the graph (Figure 37). LP01 (lipid A) was quantified using liquid chromatography-tandem mass spectrometry (LC-MS / MS) method. Plasma samples were evaluated using a validated method according to regulatory guidelines. LP01 showed dose-dependent exposure, rapidly decreased to below the limit of quantification by day 15, and the mean t1 / 2 ranged from 16.8 to 21.3 hours.

[0375] Example 14. In Vivo CRISPR / Cas9 Editing of KLKB1 in Hereditary Angioedema Patients: Updated Clinical Data, Pharmacokinetic Analysis Provide a follow-up analysis of cohorts 1-3 of Example 10.

[0376] A clinically meaningful reduction in the HAE attack rate was observed in all patients with at least 24 weeks of follow-up. All patients, except for one patient in Cohort 1 (25 mg), maintained a period of remission of 3.7 to 12 months (Figure 38). Each row shows the angioedema attack data for an individual patient, with the pre-screening historical monthly attack rate shown on the left. Patients are shown in order of their NTLA-2002 treatment days. The length of the colored bar indicates the duration of the attack. The arrow indicates the time of discontinuation of any concomitant long-term prophylaxis (LTP). Patients without an arrow did not receive long-term prophylaxis in combination with the investigational drug.

[0377] Six patients who were on long-term prophylaxis at the time of trial registration and had historical attack rates of 0.9 to 14.0 per month were able to discontinue prophylaxis between 2.6 and 5.4 months after NTLA-2002 administration (Figure 37). These patients reported no attacks after discontinuation of long-term prophylaxis. In all patients, in the absence of background concomitant LTP, the mean monthly attack rate was 0.14 (SD, 0.45) compared to 3.5 (SD, 2.7) at baseline (Figure 39). The angioedema attack rate confirmed by the study physician per month during four periods of the study. The columns show the median, the bars show the interquartile range, and each color represents an individual patient. Baseline is defined as the maximum 42-day screening period before NTLA-2002 administration. During the study period, it is defined as the time from NTLA-2002 administration to the last angioedema attack assessment at the data cut-off date. Long-term prophylaxis is defined as any type of long-term prophylaxis for the treatment of hereditary angioedema, including NTLA-2002. Only angioedema attacks occurring after NTLA-2002 administration are included.

[0378] All patients demonstrated high levels of attack control of angioedema. Patient 1 experienced mild swelling of the hand due to a sports injury on Day 343, which did not require medical intervention or acute therapy and resolved within 2 days.

[0379] The percentage of mean change from baseline of seizures confirmed by the treating investigator per month, in which all patients of the entire cohort were evaluated at various intervals, is shown in Table 26 below. [Table 23]

[0380] Data are mean change % from baseline (standard deviation). Baseline is defined as the maximum 42-day screening period prior to administration of NTLA-2002. Since a minimum number of seizures was not required during screening, the percent change from baseline in monthly seizure rate was calculated only for patients who had seizures at baseline. One patient in the 50 mg cohort did not experience a seizure during screening, so the percent change from baseline could not be determined. During the study period, it is defined as the time from administration of NTLA-2002 to the last evaluation of angioedema attack at the data cut-off date and time.

[0381] Consistent with the previous analysis, NTLA-2002 had generally good tolerability at all three dose levels, and all AEs were of mild or moderate severity. All treatment-related TEAEs were grade 2 or less. All patients received NTLA-2002 at all study doses. Adverse events are summarized in Table 27 below. [Table 24]

[0382] In 10 patients with hereditary angioedema, a single dose of NTLA-2002 had good tolerability. A robust, dose-dependent, and sustained decrease of 65–95% in plasma kallikrein, and a 95% decrease in the monthly rate of angioedema attacks were observed in all patients during the follow-up period. Patients who discontinued concomitant LTP continued to have well-controlled disease. Based on these data, 25 mg and 50 mg doses were selected for investigation in the randomized, double-blind, placebo-controlled Phase 2 part of the trial. These findings provide further clinical validation for targeting kallikrein protein expression as a treatment modality for hereditary angioedema.

[0383] Among the patients enrolled in Phase 1, the monthly rate of angioedema attacks prior to screening varied. Some patients had more severe baseline disease and these patients took longer to achieve attack control. Additionally, the time required (about 4 weeks) to achieve a decrease to steady state in plasma kallikrein was associated with continued attacks early in the initial observation period in some patients. This can be inferred based on the improvement in the decrease in the attack rate, which was in the range of 93–98% when evaluated over the entire follow-up period, compared to 80–97% at weeks 1–16.

[0384] Since treatment with NTLA-2002 resulted in a significant decrease in plasma kallikrein, it can be compared to individuals with congenital plasma prekallikrein deficiency, or “Fletcher factor syndrome,” a rare autosomal recessive disorder. These individuals have been reported to be apparently healthy, and the only well-established feature is an elevated aPTT without obvious clinical consequences. Although plasma kallikrein is involved in coagulation, the incidence of major bleeding events in these individuals was found to be very low and was equivalent to the rate seen in the general population. None of the patients in this trial experienced an elevated aPTT or any thromboembolic or bleeding events.

[0385] The trial was a single-arm trial, and since the combination of LTP was observed after NTLA-2002, it was difficult to isolate the treatment effect of NTLA-2002. When LTP was discontinued, a monthly seizure rate of 0 was achieved in almost all patients, suggesting that clinical benefits were obtained from NTLA-2002 alone. In the ongoing randomized phase 2 trial, washout of LTP is required before treatment with NTLA-2002, which will more accurately define its treatment effect.

Table 25-1

Table 25-2

Table 25-3

Table 25-4

Table 25-5

Table 25-6

Table 25-7

Table 25-8

Table 25-9

Table 25-10

Table 25-11

Table 25-12

Table 25-13

Table 25-14

Table 25-15

Table 25-16

Table 25-17

Table 25-18

Table 25-19

Table 25-20

Table 25-21

Table 25-22

Table 25-23

Table 25-24

Table 25-25

Table 25-26

Table 25-27

Table 25-28

Table 25-29

Table 25-30

Table 25-31

Table 25-32

Table 25-33

Table 25-34

Table 25-35

Table 25-36

Table 25-37

Table 25-38

Table 25-39

Table 26-1

Table 26-2

Table 26-3

Table 26-4

Table 26-5

Table 26-6

Table 26-7

Table 26-8

Table 27-1

Table 27-2

Table 27-3

Table 27-4

[0386]

Table 27-5

Claims

1. 1. A method of treating hereditary angioedema (HAE) in a human subject, comprising administering to the human subject a therapeutically effective amount of: i. mRNA encoding a Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene in the liver The method comprises systemically administering an LNP composition comprising:

2. A method of preventing an HAE attack in a human subject, comprising administering to the human subject a therapeutically effective amount of: i. mRNA encoding a Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene in the liver The method comprises systemically administering an LNP composition comprising:

3. 1. A method of reducing the frequency of angioedema attacks in a human subject with HAE, comprising administering to the human subject a therapeutically effective amount of: i. mRNA encoding a Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene in the liver The method comprises systemically administering an LNP composition comprising:

4. 1. A method for in vivo editing of the kallikrein (KLKB1) gene in a human subject with HAE, comprising: a. administering to the human subject a therapeutically effective amount of: i. mRNA encoding a Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene Systemically administering an LNP composition comprising: b. editing the KLKB1 gene in a liver cell of the subject at the site targeted by the guide RNA; wherein said administering said composition results in a clinically significant improvement in the level of a clinical measure in said subject compared to a baseline level.

5. 1. A method for treating hereditary angioedema (HAE) in a human subject, comprising: a. administering to the human subject a therapeutically effective amount of: i. mRNA encoding a Cas nuclease, and ii. Guide RNA targeting KLKB1 wherein the guide RNA comprises a targeting sequence comprising the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15); The method, wherein said administering said composition reduces total plasma kallikrein protein levels compared to baseline total plasma kallikrein protein levels.

6. 1. A method of treating hereditary angioedema (HAE) in a human subject, comprising: a. administering to the human subject a therapeutically effective amount of: i. mRNA encoding a Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene in the liver Systemically administering an LNP composition comprising: b. determining a first level of a clinical measure in said subject prior to administration; c. determining a second level of the clinical measure in the subject after a period of time following administration; and d. assessing the change between the first level and the second level of the clinical scale, wherein the administration of the composition results in an improved change in the level of the clinical scale in the subject compared to the baseline level, thereby treating HAE.

7. 1. A method of treating hereditary angioedema (HAE) in a human subject, comprising: a. administering to the human subject a therapeutically effective amount of: i. mRNA encoding a Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene in the liver Systemically administering an LNP composition comprising: b. determining a first level of biosafety in said subject prior to administration; c. determining a second level of the biosafety measure in the subject a period of time after administration; and d. assessing a change between the first level and the second level of the biosafety measure, wherein the administration of the composition results in an acceptable change in the level of the biosafety measure in the subject compared to a baseline level.

8. 1. A method of treating hereditary angioedema (HAE) in a human subject, comprising: a. administering to the human subject a therapeutically effective amount of: i. mRNA encoding a Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene systemically administering an LNP composition comprising: wherein said administering said composition results in a clinically significant improvement in the level of a clinical measure in said subject compared to a baseline level of said clinical measure.

9. 1. A method for treating HAE in a human subject, comprising: a. administering to the human subject a therapeutically effective amount of: i. mRNA encoding a Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene systemically administering an LNP composition comprising: wherein the mRNA encoding the Cas nuclease and the guide RNA A targeting the KLKB1 gene are administered in a total dose of about 25 mg to about 75 mg.

10. 1. A method for treating hereditary angioedema (HAE) in a human subject, comprising: a. administering to the human subject a therapeutically effective amount of: i. mRNA encoding a Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene systemically administering an LNP composition comprising: wherein the mRNA encoding the Cas nuclease and the guide RNA A targeting the KLKB1 gene are administered in a total dose of about 50 mg to about 75 mg.

11. 11. The method of any one of claims 1 to 10, wherein kallikrein protein levels are reduced by at least 60% after administration of the composition.

12. 12. The method of any one of claims 1 to 11, further comprising reducing kallikrein activity levels by at least 60% after administration of the composition.

13. 13. The method of any one of claims 1 to 4 or 6 to 12, wherein the guide RNA comprises a targeting sequence comprising the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15).

14. The guide RNA comprises the nucleotide sequence GUUUUAGAGCUAGAAAAUAGCAAGUUAAAAAAAGGCUAGUCCGUUAUCAACUUGAAAAAAGUGGCACCGAGUCGGUGC The method of any one of claims 1 to 13, further comprising a scaffold sequence comprising UUUU (SEQ ID NO: 387).

15. 15. The method of any one of claims 1 to 14, wherein the guide RNA is a modified guide RNA comprising or consisting of the nucleotide sequence mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 391), where m represents a 2'-O-methyl modified nucleotide and * represents a phosphorothioate internucleotide linkage.

16. The method of any one of claims 1 to 15, wherein the human subject is simultaneously treated with HAE prophylaxis at the time the LNP composition is systemically administered to the subject.

17. 17. The method of claim 16, wherein the HAE prophylaxis comprises an agent selected from C1 esterase inhibitor (C1-INH) replacement (recombinant or plasma-derived), an inhibitor of the B2 bradykinin receptor (B2R) (icatibant), a kallikrein inhibitor (ecallantide, lanadelumab, berotralstat), an attenuated androgen (danazol, oxandrolone, stanozolol), or an antifibrinolytic agent.

18. 18. The method of claim 17, wherein the HAE prophylaxis comprises an agent selected from berotralstat and danazol.

19. The method of any one of claims 1 to 18, wherein the subject has an attack frequency of at least two confirmed HAE attacks in the 90 days immediately preceding systemic administration of the LNP composition to the human subject.

20. The method of any one of claims 1 to 18, wherein the subject has an attack frequency of at least three confirmed HAE attacks per 90 days immediately prior to systemic administration of the LNP composition to the human subject.

21. The method of any one of claims 1 to 18, wherein the subject has an average attack frequency of at least 6 confirmed HAE attacks per 90 days immediately preceding systemic administration of the LNP composition to the human subject.

22. The method of any one of claims 19 to 21, wherein the subject's confirmed seizure frequency is reduced by at least 50% for at least 90 days immediately following systemic administration of the LNP composition to the human subject, optionally for at least 6 months immediately following systemic administration of the LNP composition to the human subject.

23. The method of any one of claims 19 to 21, wherein the subject's confirmed seizure frequency is reduced by at least 80% for at least 90 days immediately following systemic administration of the LNP composition to the human subject, optionally for 6 months immediately following systemic administration of the LNP composition to the human subject.

24. The method of any one of claims 19 to 21, wherein the subject is free of confirmed seizures for 90 days immediately after systemic administration of the LNP composition to the human subject, and optionally for 6 months immediately after systemic administration of the LNP composition to the human subject.

25. The method of any one of claims 19 to 21, wherein the subject's confirmed seizure frequency is reduced by at least 80% between 29 and 112 days after systemic administration of the LNP composition to the human subject, optionally between 29 and 216 days after systemic administration of the LNP composition to the human subject.

26. The method of any one of claims 19 to 21, wherein the subject's confirmed seizure frequency is reduced by at least 90% between 29 and 112 days after systemic administration of the LNP composition to the human subject, optionally between 29 and 216 days after systemic administration of the LNP composition to the human subject.

27. The method of any one of claims 19 to 21, wherein the subject does not have a confirmed seizure 29 to 112 days after systemic administration of the LNP composition to the human subject, optionally 29 to 216 days after systemic administration of the LNP composition to the human subject.

28. The method of any one of claims 16 to 27, wherein the prophylaxis is discontinued simultaneously with systemic administration of the LNP composition to the human subject.

29. The method of any one of claims 16 to 28, wherein the prophylaxis is discontinued 36 days or later after systemic administration of the LNP composition to the human subject.

30. 30. The method of any one of claims 1 to 29, wherein the subject reduces the frequency of use of acute therapy for the treatment of HAE attacks.

31. The method of any one of claims 1 to 30, wherein the subject experiences a reduced frequency of hospitalizations associated with HAE attacks compared to a control, e.g., the subject prior to treatment with the composition.

32. 32. The method of any one of claims 1-31, wherein the severity of a confirmed HAE attack is reduced in the subject.

33. 33. The method of any one of claims 1-32, wherein the subject has a reduced frequency of confirmed severe HAE attacks.

34. 33. The method of any one of claims 1-32, wherein the frequency of confirmed HAE attacks accompanied by laryngeal edema is reduced in the subject.

35. 35. The method of any one of claims 1 to 34, wherein the subject has an improved quality of life (QoL) as optionally determined by a suitable quality of life (QoL) assessment.

36. 36. The method of any one of claims 1-35, wherein the subject cannot tolerate long-term treatment with an attenuated androgen or has an average seizure frequency of at least 1 per 90 days during treatment with an attenuated androgen.

37. 37. The method of any one of claims 1 to 36, wherein the subject is a child, a pregnant woman, a subject with liver disease, a subject with breast cancer, a subject with prostate cancer, a subject with cardiovascular risk factors, and a subject with hepatocellular carcinoma.

38. 38. The method of claim 37, wherein the subject is a pregnant woman.

39. The method of any one of claims 1 to 38, wherein the subject is a female of childbearing potential.

40. 40. The method of any one of claims 1 to 39, wherein the subject has at least one confirmed attack of HAE accompanied by laryngeal edema.

41. 41. The method of any one of claims 1 to 40, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate.

42. The method of any one of claims 1 to 41, wherein the LNP comprises a PEG lipid.

43. 43. The method of claim 42, wherein the PEG lipid comprises 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000.

44. The method of any one of claims 1 to 43, wherein the LNP comprises a neutral lipid.

45. 45. The method of claim 44, wherein the neutral lipid comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

46. The method of any one of claims 1 to 45, wherein the LNP composition has an N / P ratio of about 5 to 7.

47. 47. The method of any one of claims 1 to 46, wherein the guide RNA and the mRNA encoding the Cas nuclease are present in a weight ratio ranging from about 5:1 to about 1:

5.

48. 48. The method of any one of claims 1 to 47, wherein the mRNA encodes a Cas9 nuclease.

49. 49. The method of any one of claims 1 to 48, wherein the mRNA encodes S. pyogenes Cas9.

50. 50. The method of any one of claims 1 to 49, wherein the mRNA encoding the Cas nuclease is codon-optimized.

51. 51. The method of any one of claims 1 to 50, wherein the effective amount of mRNA encoding Cas nuclease and guide RNA A targeting the KLKB1 gene is a combined dose of about 25 to 75 mg of total RNA.

52. 52. The method of any one of claims 1 to 51, wherein the effective amount of mRNA encoding Cas nuclease and guide RNA A targeting the KLKB1 gene is a combined dose of about 25 mg of total RNA.

53. 52. The method of any one of claims 1 to 51, wherein the effective amount of mRNA encoding Cas nuclease and guide RNA A targeting the KLKB1 gene is a combined dose of about 50 mg of total RNA.

54. 52. The method of any one of claims 1 to 51, wherein the effective amount of mRNA encoding Cas nuclease and guide RNA A targeting the KLKB1 gene is a combined dose of about 75 mg of total RNA.

55. 55. The method of any one of claims 1-54, wherein administration of the composition reduces total plasma kallikrein protein levels by 60% to 95%, 60% to 90%, 70% to 95%, 70% to 90%, or 80% to 95%, compared to baseline total plasma kallikrein levels before administration of the composition.

56. 56. The method of any one of claims 1-55, wherein administration of the composition reduces plasma kallikrein activity by 60% to 95%, 60% to 90%, 70% to 95%, 70% to 90%, or 80% to 95%, compared to baseline plasma kallikrein activity levels before administration of the composition.

57. The method of any one of claims 55 to 56, wherein the plasma kallikrein level is determined at least 28 days after administration of the LNP composition.

58. 58. The method of any one of claims 55 to 57, wherein the plasma kallikrein level is determined at least 56 days after administration of the LNP composition.

59. 59. The method of any one of claims 1-58, wherein administration of the composition results in an acceptable change in the level of a biosafety measure in the subject compared to a baseline level of the biosafety measure.

60. 60. The method of claim 59, wherein the biosafety measure is activated partial thromboplastin time (aPTT).

61. 61. The method of claim 59 or 60, wherein the biosafety measure is alanine aminotransferase (ALT).

62. 62. The method of any one of claims 59 to 61, wherein the biosafety measure is aspartate aminotransferase (AST).

63. 63. The method of any one of claims 59 to 62, wherein the change in the biosafety measure is reversible within 14 days.

64. 64. The method of any one of claims 59 to 63, wherein the biosafety scale is grade 3 or less.

65. 65. The method of any one of claims 1 to 64, wherein the composition is administered in conjunction with a second therapeutic agent for the treatment of HAE.

66. 66. The method of claim 65, wherein the second therapeutic agent is an HAE preventative treatment.