Adeno-associated virus gene therapy products and methods

AAV gene therapy vectors combining therapeutic and anti-inflammatory agents target neurons and astrocytes, with galectin-1 modulating microglia, effectively addressing neuroinflammation in neurodegenerative disorders like ALS.

JP2025524636APending Publication Date: 2025-07-30RES INST AT NATIONWIDE CHILDRENS HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025501410
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-12
Filing Date
2023-07-11
Publication Date
2025-07-30

AI Technical Summary

Technical Problem

Current treatments for neurodegenerative disorders, such as ALS, fail to effectively address the neuroinflammatory components, despite targeting individual cell types like microglia, astrocytes, and neurons, leading to limited therapeutic benefits and disease progression.

Method used

A combination treatment approach using AAV gene therapy vectors that express therapeutic proteins or RNAs to correct gene deficiencies in neurons and astrocytes, while secreting anti-inflammatory proteins or peptides to modulate microglial activation, including the use of galectin-1 to maintain microglia in a non-inflammatory state.

Benefits of technology

Enhances therapeutic efficacy by reducing neuroinflammation and improving survival and motor function in ALS models, with potential benefits for a range of neurodegenerative disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025524636000002
    Figure 2025524636000002
  • Figure 2025524636000003
    Figure 2025524636000003
  • Figure 2025524636000004
    Figure 2025524636000004
Patent Text Reader

Abstract

Adeno-associated virus (AAV) gene therapy vectors express therapeutic proteins or RNAs that treat gene deficiencies in cells. This disclosure provides AAV gene therapy vectors that further express anti-inflammatory proteins or peptides. When the provided AAV gene therapy vectors are used, for example, in methods of treating neurodegenerative diseases, the therapeutic protein / RNA treats the gene deficiency in cells directly transduced by the AAV vector, while the anti-inflammatory protein / peptide is secreted by the transduced cells into the intercellular environment to treat microglial activation associated with the neuroinflammatory component of the neurodegenerative disease. The therapeutic protein and the anti-inflammatory protein / peptide can be expressed as a fusion protein in which the two are separated by a self-cleaving peptide in the fusion protein. Accordingly, the provided AAV gene therapy vectors and methods are useful for treating neurological and neurodegenerative disorders.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - reference to Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 388,492, filed Jul. 12, 2022, which is hereby incorporated by reference in its entirety.

[0002] Incorporation by Reference of Sequence Listing This application includes, as a separate part of the disclosure, a computer - readable form sequence listing (file name: 58161_SeqListing.xml, a 304,231 - byte XML text file created on Jul. 11, 2023), which is hereby incorporated by reference in its entirety.

[0003] Adeno - associated virus (AAV) gene therapy vectors express therapeutic proteins or RNAs that correct gene deficiencies in cells. The present disclosure provides AAV gene therapy vectors that further express anti - inflammatory proteins or peptides. When the provided AAV gene therapy vectors are used, for example, in methods of treating neurodegenerative diseases, the therapeutic protein / RNA corrects the gene deficiency in the cells directly transduced by the AAV vector, while the anti - inflammatory protein / peptide is secreted into the inter - cellular environment by the transduced cells, treating microglial activation associated with the neuroinflammatory component of the neurodegenerative disease. From the AAV gene therapy vector, the therapeutic protein and the anti - inflammatory protein / peptide can be expressed separately, or as a fusion protein in which the two are separated by a self - cleaving peptide in the fusion protein. The anti - inflammatory protein / peptide can alternatively be expressed from a vector separate from the AAV gene therapy vector. Thus, the provided AAV gene therapy vectors and methods are useful for treating neurological and neurodegenerative disorders such as amyotrophic lateral sclerosis, Duchenne muscular dystrophy, spinal muscular atrophy, Batten disease (CLN1 / 3 / 6 / 8), IGHMBP2 - related disorders, Pitt - Hopkins syndrome, and PGAP3 congenital glycosylation disorders, including the neuroinflammation associated with these disorders.

Background Art

[0004] Neurodegeneration is accompanied by the loss of neuron function and structure. Neuroinflammation is associated with neurodegeneration in neurodegenerative diseases. Neuroinflammation is characterized by the activation of astrocytes and microglia, which are immune cells of the central nervous system [Hernandez et al., Glycoconjugate Journal, https: / / doi.org / 10.1007 / s10719-022-10064-2 (published online on June 2, 2022)].

[0005] Amyotrophic lateral sclerosis (ALS) is an example of a devastating neurodegenerative disease characterized by motor neuron degeneration that leads to progressive paralysis and death. Since no cure has been identified, most patients die within 2 to 5 years of symptom onset. ALS is the most common adult-onset motor neuron disease, with an incidence of 2:100,000, and due to the aging of the population, the number of patients in developed and developing countries is predicted to increase by more than 30% by 2040. Although several therapies have been approved to improve this situation, due to the non-cell-autonomous nature of the ALS etiology, there is probably a lack of a treatment that truly halts disease progression. The four FDA-approved therapies for ALS extend the survival of a subpopulation of patients by a few months, but do not significantly improve muscle strength or quality of life. As patients continue to decline, frequent hospital visits and expensive equipment, as well as specialized patient care, are required.

[0006] Although the cause of ALS is mostly unknown, it has been determined that 20% of familial hereditary ALS cases are caused by gain-of-function mutations in the superoxide dismutase 1 (SOD1) gene. Superoxide dismutase is an enzyme that decomposes harmful free superoxide radicals, thereby eliminating free radical-induced oxidative stress. Mis-folded wild-type SOD1 may play a role in a larger ALS subpopulation. Adeno-associated virus serotype 9 (AAV9)-mediated gene therapy using small hairpin RNA (shRNA) has been used to reduce the abundance of toxic SOD1 protein. The shRNA expressed by this AAV9 results in the degradation of SOD1 mRNA and leads to knockdown of SOD1 protein. Suppression of SOD1 levels extended survival and preserved motor function in two different ALS mouse models (SOD1 G93A and SOD1 G37R mice), but mice treated with AAV9.SOD1.shRNA still succumbed to the disease at a later time point [Foust et al., Mol. Ther., 21: 2148-59 (2013), Bravo-Hernandez, et al., Nat. Med, 26: 118-130 (2020), Iannitti et al., Mol. Ther. Nucleic Acid, 12:75-88 (2018)].

[0007] Research groups have demonstrated the impact of non-neuronal cells (such as astrocytes, oligodendrocytes, and microglia) on motor neuron death in ALS and shown that individual corrections of each cell type have beneficial effects on disease outcome [Di Giorgio et al., Nat. Neurosci., 10: 608-614 (2007), Nagai et al., Nat. Neurosci., 10: 615-622 (2007), Marchetto et al., Cell Stem Cell, 3: 649-657 (2008), Ilieva and Cleveland, Journal of Cell Biology, 187: 761-772 (2009), Lobsiger et al., Proc. Natl. Acad. Sci. U.S.A., 106: 4465-4470 (2009), Haidet-Phillips et al., Nat. Biotechnol., 29: 824-828 (2011), Meyer, Proc. Natl. Acad. Sci. U.S.A., 111: 829-32 (2014), Madill et al., Mol. Brain, 10: 22 (2017): Meyer and Kaspar, Brain Res., 1656: 27-39 (2017), Serio and Patani, Stem Cells, 36: 293-303 (2018), Beckman et al., Trends Neurosci, 24(11 Suppl.): S15-20 (2001)].

[0008] In ALS, microglia are chronically activated, become neurotoxic, rapidly change their transcriptional profiles, and release pro-inflammatory cytokines and chemokines. These inflammatory microglia also undergo changes in the expression of surface receptors and reorganization of the cytoskeleton that enables their migration to sites of neurodegeneration. The exact mechanism of microglia activation is unknown, but mutant SOD1 expressed in microglia is a microglia activation factor and is known to increase the degeneration of motor neurons [Massenzio et al., Biochim. Biophys. Acta - Mol. Basis Dis., 1864:3771 - 3785 (2018)].

[0009] Transgenic reduction of microglia activation is in a mouse model, model SOD1 G93AHaving beneficial effects in mice [Martinez-Muriana et al., Sci. Rep. 6: 25663 (2016), Zhao et al., Journal of Neuropathology and Experimental Neurology, 63(9): 964-977 (2004), Xiao et al., J. Neurochem 102: 2008-2019 (2007), Weydt et al., Glia, 48(2): 179-182 (2004), Frakes et al., Neuron 81: 1009-1023 (2014), Boillee et al., Science, 312: 1389-92 (2006), Liu and Wang, Frontiers in Immunology, 8: Article 1005 (2017)]. This effect is further enhanced by combination with AAV9.SOD1.shRNA [Frakes et al. (2014) (as above), Frakes, Ann. Clin. Transl. Neurol., 4: 76-86 (2017). Also, see the experiments discussed in Kato et al., Current Drug Targets, 6: 407-418 (2005), and Chang-Hong et al., Experimental Neurology, 194:203-211 (2005) for injection of recombinant galectin-1 into the muscles of transgenic mice having the ALS-related SOD1 mutation H46R. However, treatment targeting only this cell type has shown disappointing results in clinical trials [https: / / alsnewstoday.com / 2018 / 04 / 27 / np001-fails-improve-als-disease-severity-pulmonary-function-phase-2-trial / ].

[0010] In the art, there is still a need for products and methods for treating neurodegenerative disorders such as ALS, and specifically for further treating the neuroinflammatory components of such disorders. SUMMARY OF THE INVENTION

[0011] End-stage SOD1 G93A In postmortem brain and spinal cord tissues in mice, very strong microglial inflammation is observed, a finding also observed in the spinal cord of postmortem ALS patients. Considering that microglia are an important cell type that affects the progression of ALS, the methods disclosed herein target this cell type for optimal and potentially curative effects in any ALS treatment regimen. The method focuses on a combination treatment approach that combines gene therapy targeting neurons and astrocytes directly with a treatment that indirectly targets microglia. Specifically, microglia are targeted herein, for example, by adding a galectin-1 (GAL1) expression cassette to an AAV9.SOD1.shRNA gene therapy vector. GAL1 is a secreted protein that can act in trans on microglia. Neurons and astrocytes directly transduced with AAV9 expressing GAL1 overexpress GAL1 and continuously secrete it, and GAL1 acts on adjacent microglia at the site of inflammation, thereby signaling to keep microglia in a non-inflammatory state. Since microglia are not removed by GAL1 treatment, this approach retains the beneficial effects of non-inflammatory microglia.

[0012] Considering that microglial inflammation is an important aspect of most neurodegenerative disorders, and considering that a parallel combination approach can improve gene therapy strategies for a variety of neurodegenerative disorders other than ALS, such as Duchenne muscular dystrophy (DMD), spinal muscular atrophy (SMA), Batten disease (CLN1 / 3 / 6 / 8), IGHMBP2-related disorders, Pitt-Hopkins syndrome, and PGAP3 congenital glycosylation disorders.

[0013] The present disclosure provides a recombinant adeno-associated virus (rAAV) genome that expresses (A) a therapeutic protein or RNA for gene therapy and (B) an anti-inflammatory protein or peptide. The present disclosure also provides an rAAV genome that expresses only an anti-inflammatory protein or peptide.

[0014] The rAAV genome can be an rAAV genome in which (A) is a short hairpin ribonucleic acid (SOD1 shRNA) targeting superoxide dismutase 1, and (B) is galectin, metallothionein protein, metallothionein fusion protein, NBD 1X, or NBD 3X. The sequence of SOD1 shRNA can be SEQ ID NO: 4. Galectin can be human galectin-1 or human galectin-3. The rAAV genome can be an rAAV genome in which (B) is NBD 1X or NBD 3X. The rAAV genome can be an rAAV genome in which (B) is metallothionein protein, metallothionein fusion protein, NBD 1X, or NBD 3X. The expression of (A) can be under the control of the H1 promoter. The expression of (B) can be under the control of the CBA promoter.

[0015] The present disclosure provides an rAAV comprising the provided genome. The rAAV can be scAAV. The rAAV can be ssAAV. The rAAV can comprise an AAV9 capsid.

[0016] The present disclosure provides a composition comprising the rAAV provided herein. The composition can be formulated for administration to a subject (e.g., a human patient) by direct injection into the cerebrospinal fluid, intracerebroventricular delivery, intrathecal delivery, or intravenous delivery.

[0017] The composition can comprise an agent that increases the viscosity or density of the composition, such as a contrast agent.

[0018] The present disclosure provides a method for treating neurological or neurodegenerative disorders (such as ALS, DMD, SMA, Batten disease (CLN1 / 3 / 6 / 8), IGHMBP2-related disorders, Rett syndrome, and PGAP3 congenital glycosylation disorders, etc.) in a subject, which includes administering to the subject an effective amount of the rAAV composition provided herein. The rAAV composition can be administered to the subject by direct injection into the cerebrospinal fluid, intracerebroventricular delivery, intrathecal delivery, or intravenous delivery. Methods for treating diseases (including but not limited to ALS, Batten disease, IGHMBP2-related disorders, Rett syndrome, or PGAP3 congenital glycosylation disorders) in a subject include administering to the subject an effective amount of an rAAV composition that expresses SOD1 shRNA in the case of ALS, CLN1, CLN3, CLN6, or CLN8 protein in the case of Batten disease, IGHMBP2 protein in the case of IGHMBP2-related disorders, or PGAP3 protein in the case of PGAP3 congenital glycosylation disorders.

[0019] The present disclosure provides a plasmid containing the rAAV genome provided herein, and a method for producing rAAV by transforming / transfecting packaging cells with the plasmid and culturing the packaging cells.

Brief Description of the Drawings

[0020]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31

Figure 32

Figure 33

Figure 34

Figure 35

Figure 36

Figure 37

Figure 38

Mode for Carrying Out the Invention

[0021] The present disclosure provides an AAV having a genome comprising (1) a therapeutic protein or peptide, and (2) one or more AAV ITRs adjacent to an expression cassette encoding an anti-inflammatory protein or peptide. The present disclosure also provides a separate vector that expresses an anti-inflammatory protein or peptide (including, but not limited to, rAAV produced using the plasmids shown in FIGS. 17, 37, and 38).

[0022] For example, the present disclosure provides (1) one or more RNAs (including, but not limited to, small hairpin RNAs, antisense RNAs, and / or microRNAs) that target mutant SOD1 polynucleotides, and (2) an AAV gene therapy vector having a genome that expresses galectin. The present disclosure also provides an AAV vector that expresses galectin (including, but not limited to, rAAV produced using the plasmid shown in FIG. 17). Examples illustrate the use of exemplary rAAV encoding small hairpin RNA (shRNA) and galectin. In the rAAV genome, the shRNA-encoding DNA and the galectin-encoding DNA are each operably linked to transcriptional control DNA, particularly promoter DNA that is functional in target cells, to form an expression cassette. The rAAV genome may include an expression cassette encoding an SOD1 shRNA such as: GCATCATCAATTTCGAGCAGAAGGAA (SEQ ID NO: 1), GAAGCATTAAAGGACTGACTGAA (SEQ ID NO: 2), CTGACTGAAGGCCTGCATGGATT (SEQ ID NO: 3), CATGGATTCCATGTTCATGA (SEQ ID NO: 4), GCATGGATTCCATGTTCATGA (SEQ ID NO: 5), GGTCTGGCCTATAAAGTAGTC (SEQ ID NO: 6), GGGCATCATCAATTTCGAGCA (SEQ ID NO: 7), GCATCATCAATTTCGAGCAGA (SEQ ID NO: 8), GCCTGCATGGATTCCATGTTC (SEQ ID NO: 9), GGAGGTCTGGCCTATAAAGTA (SEQ ID NO: 10), GATTCCATGTTCATGAGTTTG (SEQ ID NO: 11), GGAGATAATACAGCAGGCTGT (SEQ ID NO: 12), GCTTTAAAGTACCTGTAGTGA (SEQ ID NO: 13), GCATTAAAGGACTGACTGAAG (SEQ ID NO: 14), TCATCAATTTCGAGCAGAA (SEQ ID NO: 15), TCGAGCAGAAGGAAAGTAA (SEQ ID NO: 16), GCCTGCATGGATTCCATGT (SEQ ID NO: 17), TCACTCTCAGGAGACCATT (SEQ ID NO: 18), or GCTTTAAAGTACCTGTAGT (SEQ ID NO: 19). Commercial providers such as Ambion Inc. (Austin, TX), Darmacon Inc. (Lafayette, CO), InvivoGen (San Diego, CA), and Molecular Research Laboratories, LLC (Herndon, VA) generate custom inhibitory RNA molecules. In addition, commercially available kits such as the SILENCER (trademark) siRNA Construction Kit (Ambion Inc., Austin, TX) or the psiRNA System (InvivoGen, San Diego, CA) are available for producing custom siRNA molecules.

[0023] Galectin, a soluble β-galactoside-binding protein, is widely expressed at sites of inflammation and plays a positive role in amplifying or resolving the inflammatory response [Sundblad et al., J. Immunol. 199:3721-3730 (2017)].

[0024] Galectin-1 (GAL1), a glycan-binding protein, inhibits the synthesis of pro-inflammatory cytokines and exhibits broad anti-inflammatory properties. GAL1 has been shown to attenuate microglial activation by shifting neurotoxic microglia to a neuroprotective M2 phenotype [Starossom et al., Immunity, 37: 249-263 (2012)].

[0025] The human GAL1 DNA sequence is described below. 5’ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA3’ (SEQ ID NO: 20)

[0026] The mouse GAL1 DNA sequence is described below. 5’ATGGCCTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGGGAATGTCTCAAAGTTCGGGGAGAGGTGGCCTCGGACGCCAAGAGCTTTGTGCTGAACCTGGGAAAAGACAGCAACAACCTGTGCCTACACTTCAATCCTCGCTTCAATGCCCATGGAGACGCCAACACCATTGTGTGTAACACCAAGGAAGATGGGACCTGGGGAACCGAACACCGGGAACCTGCCTTCCCCTTCCAGCCCGGGAGCATCACAGAGGTGTGCATCACCTTTGACCAGGCTGACCTGACCATCAAGCTGCCAGACGGACATGAATTCAAGTTCCCCAACCGCCTCAACATGGAGGCCATCAACTACATGGCGGCGGATGGAGACTTCAAGATTAAGTGCGTGGCCTTTGA3’ (SEQ ID NO: 21)

[0027] Galectin-3 also plays a role in neuroinflammation in chronic neurodegenerative diseases [Lerman et al., Brain and Behavior, 2(5): 563-575(2012)].

[0028] The human galectin-3 DNA sequence is described below. 5’ATGGCAGACAATTTTTCGCTCCATGATGCGTTATCTGGGTCTGGAAACCCAAACCCTCAAGGATGGCCTGGCGCATGGGGGAACCAGCCTGCTGGGGCAGGGGGCTACCCAGGGGCTTCCTATCCTGGGGCCTACCCCGGGCAGGCACCCCCAGGGGCTTATCCTGGACAGGCACCTCCAGGCGCCTACCCTGGAGCACCTGGAGCTTATCCCGGAGCACCTGCACCTGGAGTCTACCCAGGGCCACCCAGCGGCCCTGGGGCCTACCCATCTTCTGGACAGCCAAGTGCCACCGGAGCCTACCCTGCCACTGGCCCCTATGGCGCCCCTGCTGGGCCACTGATTGTGCCTTATAACCTGCCTTTGCCTGGGGGAGTGGTGCCTCGCATGCTGATAACAATTCTGGGCACGGTGAAGCCCAATGCAAACAGAATTGCTTTAGATTTCCAAAGAGGGAATGATGTTGCCTTCCACTTTAACCCACGCTTCAATGAGAACAACAGGAGAGTCATTGTTTGCAATACAAAGCTGGATAATAACTGGGGAAGGGAAGAAAGACAGTCGGTTTTCCCATTTGAAAGTGGGAAACCATTCAAAATACAAGTACTGGTTGAACCTGACCACTTCAAGGTTGCAGTGAATGATGCTCACTTGTTGCAGTACAATCATCGGGTTAAAAAACTCAATGAAATCAGCAAACTGGGAATTTCTGGTGACATAGACCTCACCAGTGCTTCATATACCATGATATAA3’ (SEQ ID NO: 22)

[0029] The mouse galectin-3 DNA sequence is described below. 5’ATGGCAGACAGCTTTTCGCTTAACGATGCCTTAGCTGGCTCTGGAAACCCAAACCCTCAAGGATATCCGGGTGCATGGGGGAACCAGCCTGGGGCAGGGGGCTACCCAGGGGCTGCTTATCCTGGGGCCTACCCAGGACAAGCTCCTCCAGGGGCCTACCCAGGACAGGCTCCTCCAGGGGCCTACCCAGGACAGGCTCCTCCTAGTGCCTACCCCGGCCCAACTGCCCCTGGAGCTTATCCTGGCCCAACTGCCCCTGGAGCTTATCCTGGCTCAACTGCCCCTGGAGCCTTCCCAGGGCAACCTGGGGCACCTGGGGCCTACCCCAGTGCTCCTGGAGGCTATCCTGCTGCTGGCCCTTATGGTGTCCCCGCTGGACCACTGACGGTGCCCTATGACCTGCCCTTGCCTGGAGGAGTCATGCCCCGCATGCTGATCACAATCATGGGCACAGTGAAACCCAACGCAAACAGGATTGTTCTAGATTTCAGGAGAGGGAATGATGTTGCCTTCCACTTTAACCCCCGCTTCAATGAGAACAACAGGAGAGTCATTGTGTGTAACACGAAGCAGGACAATAACTGGGGAAAGGAAGAAAGACAGTCAGCCTTCCCCTTTGAGAGTGGCAAACCATTCAAAATACAAGTCCTGGTTGAAGCTGACCACTTCAAGGTTGCGGTCAACGATGCTCACCTACTGCAGTACAACCATCGGATGAAGAACCTCCGGGAAATCAGCCAACTGGGGATCAGTGGTGACATAACCCTCACCAGCGCTAACCACGCCATGATCTAA3’ (SEQ ID NO: 23)

[0030] Another example of the anti-inflammatory protein or peptide provided by the present disclosure is the Nemo-binding domain (NBD) peptide. FIG. 18 shows the DNA and amino acid sequences of the NBD peptide (“NBD 1X peptide”) and an autocleavable fusion protein containing three copies of the NBD peptide (“NBD 3X peptide”).

[0031] Yet another example of the anti-inflammatory protein or peptide provided by the present disclosure is the metallothionein (MT) protein. FIGS. 35-37 show exemplary plasmids and sequences for generating rAAV that expresses the metallothionein (MT) protein.

[0032] AAV is a replication-defective parvovirus, and its single-stranded DNA genome is approximately 4.7 kb in length and contains 145 nucleotide inverted terminal repeats (ITRs).

[0033] There are multiple serotypes of AAV. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank accession number NC_002077, the complete genome of AAV-2 is provided in GenBank accession numbers NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983), corrected by Ruffing et al., J Gen Virol, 75: 3385-3392 (1994), the complete genome of AAV-3 is provided in GenBank accession number NC_1829, the complete genome of AAV-4 is provided in GenBank accession number NC_001829, the AAV-5 genome is provided in GenBank accession number AF085716, the complete genome of AAV-6 is provided in GenBank accession number NC_001862, at least a portion of the genomes of AAV-7 and AAV-8 are provided in GenBank accession numbers AX753246 and AX753249, respectively, the genome of AAV-9 is provided in Gao et al., J. Virol., 78:6381-6388 (2004), the genome of AAV-10 is provided in Mol. Ther., 13(1):67-76 (2006), the genome of AAV-11 is provided in Virology, 330(2):375-383 (2004), a portion of the genome of AAV-12 is provided in Genbank accession number DQ813647, a portion of the genome of AAV-13 is provided in Genbank accession number EU285562. The sequence of the genome of AAV rh.74 is provided in U.S. Patent No. 9,434,928. The sequence of the genome of AAV-B1 is provided in Choudhury et al., Mol. Ther., 24(7):1247-1257 (2016). The sequence of Anc80 is provided in Zinn et al., Cell Reports 12:1056-1068, 2015 and Vandenberghe et al., PCT / US2014 / 060163, and GenBank accession numbers KT235804~KT235812. Cis-acting sequences that direct viral DNA replication (rep), capsid formation / packaging, and host cell chromosome integration are contained within the AAV ITRs.Three AAV promoters (named p5, p19, and p40 relative to their relative map positions) drive the expression of two AAV internal open reading frames encoding the rep and cap genes. The two rep promoters (p5 and p19), in combination with alternative splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. Rep proteins have multiple enzymatic properties that ultimately participate in the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes three capsid proteins, VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are involved in the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0034] AAV has unique features that make it attractive as a vector for delivering foreign DNA into cells, for example, in gene therapy. AAV infection of cells in culture is non-cytopathic, and natural infection in humans and other animals is asymptomatic and latent. Furthermore, AAV infects many mammalian cells and allows the possibility of targeting many different tissues in vivo. Additionally, AAV can transduce both slowly dividing and non-dividing cells and can persist essentially throughout the lifespan of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as DNA cloned into a plasmid that enables the construction of recombinant genomes. Moreover, since the signals that direct AAV replication, genome capsid formation, and integration are contained within the ITRs of the AAV genome, part or all of the internal ~4.3 kb genome (rep-cap, which encodes replication and structural capsid proteins) can be replaced with foreign DNA such as an expression cassette containing a promoter, the DNA of interest, and a polyadenylation signal. The Rep and Cap proteins can be provided in trans. Another important feature of AAV is that it is a very stable and robust virus. This allows it to easily withstand the conditions (several hours at 56 °C to 65 °C) used to inactivate adenovirus, reducing the importance of cryopreservation of AAV. AAV can even be lyophilized. Finally, cells infected with AAV do not show resistance to superinfection.

[0035] Different AAV serotypes provide diverse tissue tropisms. Advancements in the delivery of AAV6 and AAV8 have enabled transduction of skeletal and cardiac muscle by these serotypes following simple systemic intravenous or intraperitoneal injection. See Pacak et al., Circ.Res., 99(4): 3-9(1006) and Wang et al., Nature Biotech., 23(3): 321-8(2005). The use of AAV to target cell types within the central nervous system involves surgical parenchymal injection. See Kaplitt et al. (as above), Marks et al. (as above), and Worgall et al. (as above). For the use of AAV to target cell types within the nervous system, see International Publication No. WO 2010 / 071832. International Publication Nos. WO 2009 / 043936 and WO 2009 / 013290 describe their relevance to gene delivery to the central nervous system. International Publication No. WO 2011 / 133890 describes a recombinant adeno-associated virus useful for targeting a transgene to central nervous system tissue.

[0036] The rAAV genome of the present disclosure lacks AAV rep and cap DNA. The AAV DNA (e.g., ITR) in the rAAV genome can be derived from any AAV serotype from which a recombinant virus can be derived, including but not limited to AAV serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV-anc80, AAV-B1, AAV.PHP.EB, AAV7m8, or AAVv66. The rAAV genome includes at least one or both of the native 5' and 3' terminal inverted repeats (ITRs). The rAAV genome can include ITRs from an AAV serotype different from the AAV serotype from which the AAV genome was derived. The rAAV genome can include three ITRs (e.g., as in scAAV).

[0037] The present disclosure provides a DNA plasmid comprising the rAAV genome of the present disclosure. The DNA plasmid is transferred into cells that are permissive to infection by an AAV helper virus (e.g., an adenovirus, an E1-deleted adenovirus, or a herpes virus) to assemble the rAAV genome into infectious virus particles as well. Techniques for producing rAAV particles in which the AAV genome to be packaged, the rep and cap genes, and the helper virus functions are provided to the cells are standard in the art. Production of rAAV requires the presence of the following components within a single cell (referred to herein as a packaging cell): the rAAV genome, the AAV rep gene and cap gene separate from the rAAV genome (i.e., not present therein), and the helper virus functions. The AAV rep gene may be derived from any AAV serotype from which the recombinant virus may be derived, including but not limited to AAV serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rh10, AAV11, AAV12, AAV13, AAV-anc80, AAV-B1, AAV.PHP.EB, AAV7m8, or AAVv66, and may be derived from an AAV serotype different from the AAV genome ITR. The ITRs in AAV can be derived from different AAV serotypes. AAV can contain ITRs or capsid proteins derived from different serotypes, i.e., different from the rest of the vector. For example, AAV2 or AAV2-based ITRs can be used not only in AAV2 or AAV2-based serotypes, but also in various AAV vector serotypes. Thus, AAV2 ITRs can be used, for example, in different serotypes of AAV vectors including but not limited to AAV9. The AAV2 Rep helper gene can be used. Production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692, which is hereby incorporated by reference in its entirety.

[0038] AAV capsid proteins can be modified to enhance the delivery of recombinant vectors. Modifications to capsid proteins are generally known in the art. See, for example, US20050053922 and US20090202490. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909(2014). The modified capsids provided herein can include capsids having various post-translational modifications such as glycosylation and deamidation. Deamidation of asparagine or glutamine side chains to convert asparagine residues to aspartic acid or isoaspartic acid residues, and conversion of glutamine to glutamic acid or isoglutamic acid, are contemplated in the rAAV capsids provided herein. See, for example, Giles et al., Molecular Therapy, 26(12): 2848-2862(2018). The modified capsids of the present disclosure provided herein can also include targeting sequences that direct rAAV to diseased tissues and organs in need of treatment.

[0039] The method of generating packaging cells is to create a cell line that stably expresses all the components necessary for the production of AAV particles. For example, a plasmid (or plasmids) containing an rAAV genome lacking the AAV rep and cap genes, AAV rep and cap genes isolated from the rAAV genome, and a selectable marker such as a kanamycin or neomycin resistance gene is integrated into the genome of the cells. For example, the kanamycin resistance gene can replace the ampicillin resistance gene in the exemplary plasmids provided herein. The AAV genome is introduced into the plasmid by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. Sci. USA, 79:2077-2081), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73), or direct blunt-end ligation (Senapathy and Carter, 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and suitable for large-scale production of rAAV. Another example of a preferred method is to use an adenovirus or baculovirus instead of a plasmid to introduce the rAAV genome and / or the rep gene and cap gene into the packaging cells.

[0040] "Packaging" refers to a series of intracellular events that result in the assembly and capsid formation of AAV particles. The term "production" refers to the process of production of rAAV (infectious encapsulated rAAV particles) by the packaging cells.

[0041] The AAV "rep" and "cap" genes refer to polynucleotide sequences that encode the replication protein and capsid-forming protein of adeno-associated virus, respectively. The rep and cap of AAV are referred to herein as the AAV "packaging genes".

[0042] The "helper virus" of AAV refers to a virus that enables AAV (e.g., wild-type AAV) to be replicated and packaged by mammalian cells. Various such helper viruses for AAV, including adenoviruses, herpesviruses, and poxviruses such as vaccinia virus, are known in the art. Adenoviruses can include several different subgroups, but adenovirus type 5 of subgroup C is most commonly used. Numerous adenoviruses of human, non-human mammalian, and avian origin are known and are available from depository institutions such as the ATCC. Viruses of the herpes family include, for example, herpes simplex virus (HSV) and Epstein-Barr virus (EBV), as well as cytomegalovirus (CMV) and pseudorabies virus (PRV), and these are also available from depository institutions such as the ATCC.

[0043] "Helper virus function" refers to a function encoded by the helper virus genome that enables (in conjunction with other requirements for replication and packaging described herein) the replication and packaging of AAV. As described herein, "helper virus function" can be provided in a number of ways, such as by providing a helper virus or, for example, by providing in trans to producer cells a polynucleotide sequence encoding the necessary function.

[0044] The general principles of rAAV production are outlined, for example, in Carter, Current Opinions in Biotechnology, 1533-1539 (1992), and Muzyczka, Curr. Topics in Microbiol. and Immunol., 158:97-129 (1992). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984), Hermonat et al., Proc. Natl. Acad. Sci. USA, 81: 6466 (1984), Tratschin et al., Mol. Cell. Biol. 5: 3251 (1985), McLaughlin et al., J. Virol., 62: 1963 (1988), and Lebkowski et al., Mol. Cell. Biol., 7: 349 (1988). Samulski et al., J. Virol., 63: 3822-3828 (1989), U.S. Patent No. 5,173,414, WO95 / 13365 and corresponding U.S. Patent No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al., Vaccine, 13:1244-1250 (1995), Paul et al., Hum. Gene Ther., 4:609-615 (1993), Clark et al., Gene Ther., 3: 1124-1132 (1996), U.S. Patent No. 5,786,211, U.S. Patent No. 5,871,982, U.S. Patent No. 6,258,595, and McCarty, Mol. Ther., 16(10): 1648-1656 (2008). Recombinant linear AAV (rAAV), single-stranded AAV (ssAAV), and self-complementary AAV (scAAV) are all specifically provided.

[0045] Accordingly, the present disclosure provides packaging cells that produce infectious, capsidated rAAV particles. The packaging cells can be stably transformed cancer cells such as HeLa cells, 293 cells, and PerC.6 cells (a 293 cell homolog). The packaging cells can be cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (rhesus fetal lung cells).

[0046] The present disclosure provides rAAV comprising the rAAV genome of the present disclosure. The genome of the rAAV lacks AAV rep and cap DNA, i.e., there is no AAV rep or cap DNA between the ITRs of the genome. Between the ITRs, the rAAV genome of the present disclosure comprises (1) an "expression cassette" comprising DNA encoding a therapeutic protein or RNA operably linked to a transcriptional control element (including, but not limited to, a promoter, enhancer, and / or intron) that is functional in a target cell of interest, and (2) an "expression cassette" comprising galectin DNA (e.g., galectin-1 DNA) operably linked to a transcriptional control element (including, but not limited to, a promoter, enhancer, and / or intron) that is functional in a target cell of interest.

[0047] As used herein, "therapeutic protein or RNA" is a protein or RNA that corrects or ameliorates a genetic deficiency in a subject.

[0048] As used herein, "anti-inflammatory protein or peptide" is a protein or peptide as described herein that has anti-inflammatory activity, such as maintaining microglia in a non-inflammatory state or restoring microglia to a non-inflammatory state.

[0049] Essentially, the U6 promoter controls the expression of U6 RNA and small nuclear RNAs (snRNAs) involved in splicing, which are well-characterized [Kunkel et al., Nature, 322(6074): 73-77(1986), Kunkel et al., Genes Dev. 2(2):196-204(1988), Paule et al., Nuc. Acids Res., 28(6): 1283-1298(2000)]. The U6 promoter has been used to control vector-based expression in mammalian cells [Paddison et al., Proc. Natl. Acad. Sci. USA, 99(3):1443-1448(2002), Paul et al., Nat. Biotechnol., 20(5): 505-518(2002)] because (1) the promoter is recognized by RNA polymerase III (polyIII) and controls high-level constitutive expression of RNA, and (2) the promoter is active in most mammalian cell types. The use of mouse or human U6 promoters to express therapeutic RNAs is contemplated by the present disclosure. U6 promoter 5’CCCCAGTGGAAAGACGCGCAGGCAAAACGCACCACGTGACGGAGCGTGACCGCGCGCCGAGCGCGCGCCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGGTTTATATATCTTGTGGAAAGGACGCGGGATC3’ (SEQ ID NO: 24)

[0050] As another example, an H1 promoter can be used to express RNA. H1 promoter 5’AATTCATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCG3’ (SEQ ID NO: 25)

[0051] Other promoters known in the art are provided herein for expressing therapeutic proteins or anti-inflammatory proteins / peptides. Examples of such promoters provided are as follows: chicken β-actin promoter (CBA), CAG promoter( CMV enhancer +CBA promoter) 5’CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTAC TCGAGGCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAG3’ (SEQ ID NO: 26), A truncated methyl CpG-binding protein 2 (MeCP2) promoter, called the P546 MeCP2 promoter, for example, to drive expression in neurons and astrocytes, P546 promoter 5’TTTTCCGGACGGGTTTTACCACAGCCCTCTCTCCGAGAGGAGGGAGCGCGCGCGCAACCGATGCCGGGACCCCGCACGGCAGACGTCGCGCCCCGCCCTCCCGACCAGCCTGTGTGCTGCTGCACCTGCGCGCCCGCGCCCCACCCCTTGCTCTTTGTCGAGATTACCCTTCATTGGTTGTGGAGCCCAGGCTGGGGCGGAGCCTTAGCGGTGACGCCCTCAATTGGCAGGAGTTCCTGTCTGTTTAGGCAGGGAAAAGAGGCGGACCCCATTCAGCTGCGGATTGGTGGAGTTCTACTGTCACTTGGAAAAAAGAGGCGGCTAGGGCACAGAGGGGCTGGTTTTGTGGGCAGCATTTGAATGTTGAGGATTAACTGGGCCCTTGTGGACTCTGGCGCTTAAGGAAGTCTAGGCTCTTGGCGCCTATTAGAGCCTCCCTGCTGAGTAGTTCACCATTGTGATAAGCATTTGACTTCACCAGCATTTCTTTATTATCATTTTCTGTAGAAGTAGCAAAGTTGCCTGTTGAGGAGCCTGGCGTTGTTC3’ (SEQ ID NO: 27), Human synapsin (hSyn) promoter (e.g., for driving expression in neurons) hSyn promoter 5’GTGTCTAGAC TGCAGAGGGC CCTGCGTATG AGTGCAAGTG GGTTTTAGGA CCAGGATGAG GCGGGGTGGG GGTGCCTACC TGACGACCGA CCCCGACCCA CTGGACAAGC ACCCAACCCC CATTCCCCAA ATTGCGCATC CCCTATCAGA GAGGGGGAGG GGAAACAGGA TGCGGCGAGG CGCGTGCGCA CTGCCAGCTT CAGCACCGCG GACAGTGCCT TCGCCCCCGC CTGGCGGCGC GCGCCACCGC CGCCTCAGCA CTGAAGGCGC GCTGACGTCA CTCGCCGGTC CCCCGCAAAC TCCCCTTCCC GGCCACCTTG GTCGCGTCCG CGCCGCCGCC GGCCCAGCCG GACCGCACCA CGCGAGGCGC GAGATAGGGG GGCACGGGCG CGACCATCTG CGCTGCGGCG CCGGCGACTC AGCGCTGCCT CAGTCTGCGG TGGGCAGCGG AGGAGTCGTG TCGTGCCTGA GAGCGCAGTC GAGAA3’ (SEQ ID NO: 28) Human somatostatin (hSST) promoter (e.g., for driving expression in inhibitory neurons), hSST promoter 5’GCATGTGTGG GAGTGAAATT ATGGAATGTG TATGCTCATA GCACTGAGTG AAAATAAAAG ATTGTATAAA TCGTGGGGCT TGTGGAATTG TGAGTCCCTG TGCGTGTGCA GTATTTTTTT TTTTTTTTAA GTAAGACTCT TTAGATCTTG TCGCCTCCCC TGTCTTCTGT GATTGATTTT GCGAGACTAA TGGTGCGTAA AAGGGCTGGT GAGATCTGGG GGCGCCTCCT AGCCTGACGT CAGAGAGAGA GTTTAAAACC GAGGGAGACG GTTGAGAGCA CACAAGCCGC TTTAGGAGTC GCGAGGTTCG GAGCCATCGC TGCTGCCTGC TGATCCGCGC CTAGAGTTTG3’ (SEQ ID NO: 29) Compact glial fibrillary acidic protein [gfaABC(1)D] promoter (e.g., for driving expression in astrocytes), gfaABC(1)D promoter 5’AACATATCCTGGTGTGGAGTAGGGGACGCTGCTCTGACAGAGGCTCGGGGGCCTGAGCTGGCTCTGTGAGCTGGGGAGGAGGCAGACAGCCAGGCCTTGTCTGCAAGCAGACCTGGCAGCATTGGGCTGGCCGCCCCCCAGGGCCTCCTCTTCATGCCCAGTGAATGACTCACCTTGGCACAGACACAATGTTCGGGGTGGGCACAGTGCCTGCTTCCCGCCGCACCCCAGCCCCCCTCAAATGCCTTCCGAGAAGCCCATTGAGCAGGGGGCTTGCATTGCACCCCAGCCTGACAGCCTGGCATCTTGGGATAAAAGCAGCACAGCCCCCTAGGGGCTGCCCTTGCTGTGTGGCGCCACCGGCGGTGGAGAACAAGGCTCTATTCAGCCTGTGCCCAGGAAAGGGGATCAGGGGATGCCCAGGCATGGACAGTGGGTGGCAGGGGGGGAGAGGAGGGCTGTCTGCTTCCCAGAAGTCCAAGGACACAAATGGGTGAGGGGAGAGCTCTCCCCATAGCTGGGCTGCGGCCCAACCCCACCCCCTCAGGCTATGCCAGGGGGTGTTGCCAGGGGCACCCGGGCATCGCCAGTCTAGCCCACTCCTTCATAAAGCCCTCGCATCCCAGGAGCGAGCAGAGCCA3’ (SEQ ID NO: 30), Glial fibrillary acidic protein (GFAP) promoter, GFAP promoter tMCK promoter, 5’CCACTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCCAACACCTGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAGCGGTTACCCCACCCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAAAAATAACCCTGTCCCTGGTGGANCCACTACGGGTCTANGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCCAACACCTGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAGCGGTTACCCCACCCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAAAAATAACCCTGTCCCTGGTGGACCACTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCCAACACCTGCTGCCCCCCCCCCCCAACACCTGCTGCCTGAGCCTGAGCGGTTACCCCACCCCGGTGCCTGGGTCTTAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAAAAATAACCCTGTCCCTGGTCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCCCGGGTCACT3’ (SEQ ID NO: 32) MHCk promoter, 5’CATGTCTAAGCTAGACCCTTCAGATTAAAAATAACTGAGGTAAGGGCCTGGGTAGGGGAGGTGGTGTGAGACGCTCCTGTCTCTCCTCTATCTGCCCATCGGCCCTTTGGGGAGGAGGAATGTGCCCAAGGACTAAAAAAAGGCCATGGAGCCAGAGGGGCGAGGGCAACAGACCTTTCATGGGCAAACCTTGGGGCCCTGCTGTCTAGCATGCCCCACTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTCTAAAAATAACCCTGTCCCTGGTGGATCCCCTGCATGCGAAGATCTTCGAACAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCAGC3’ (SEQ ID NO: 33) The IRF promoter, neuron-specific enolase promoter, CMV promoter, and Myo7A promoter. Additional promoters are contemplated herein including, but not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters (e.g., actin promoter, myosin promoter, elongation factor-1a promoter, hemoglobin promoter, and creatine kinase promoter).

[0052] Inducible promoters are also provided. Non-limiting examples of inducible promoters include, but are not limited to, the metallothionein promoter, glucocorticoid promoter, progesterone promoter, and tetracycline-regulated promoter.

[0053] The expression cassette may also include intron sequences to facilitate processing of the transgene RNA transcript when expressed in mammalian cells. One example of such an intron is the SV40 intron.

[0054] Accordingly, recombinant AAV (rAAV) (i.e., infectious, capsidated rAAV particles, which may also be referred to herein as "vectors") are provided herein. The genome of rAAV lacks AAV rep and cap DNA, i.e., there is no AAV rep or cap DNA between the ITRs of the rAAV genome.

[0055] Examples of rAAV provided for the treatment of ALS include exemplary rAAV containing a genome that includes an expression cassette encoding SOD1 shRNA129 and an expression cassette encoding human galectin-1 named "AAV.sh129SOD1.hGal1", and exemplary rAAV containing a genome that includes an expression cassette encoding SOD1 shRNA129 and an expression cassette encoding mouse galectin-1 named "AAV.sh129SOD1.msGal1", but are not limited thereto. The plasmids used to produce the two exemplary rAAV are shown in FIGS. 16 and 7, respectively. The SOD shRNA129 nucleotides in the two AAV genomes include the entire hairpin sequence including the sense and antisense arms, stem-loop, and termination sequence. (The target sequence for SOD1 is underlined) The forward-oriented sequence is as follows: 5’AATTCATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCGGATC CATGGATTCCATGTTCATGA TTCAAGAGA TCATGAACATGGAATCCATG CTTTTTTGGAAA 3’ (SEQ ID NO: 34) AAV.sh129SOD1.msGal1 transduces neurons, astrocytes, and oligodendrocytes.

[0056] ; The present disclosure contemplates that rAAV known in the art for the treatment of DMD [rAAV encoding microdystrophin, Mendell et al., JAMA Neurol., 77(9)1122-1131(2020)] [rAAV encoding DMD exon 2 targeting U7snRNA described in WO2014 / 172669, Simmons et al., Mol. Ther.: Methods & Clinical Development, 21: 325-340(2021), Gushchina et al., Human Gene Therapy, 32(17-18): 882-894(2021)] [Wein et al., Nat. Med., 20(9): 992-1000(2014)] and for the treatment of spinal muscular atrophy (SMA) [e.g., Zolgensma (onasemnogene abeparvovec-xioi), e.g., rAAV encoding human survival motor neuron (SMN) protein described in Mendell et al., N. Engl. J. Med., 377: 1713-1722(2017)] can be modified to additionally include the anti-inflammatory protein / peptide (e.g., galectin) gene cassette described herein. These rAAV for DMD transduce skeletal muscle and the heart. The rAAV for SMA transduce neurons, astrocytes, and oligodendrocytes.

[0057] The present disclosure provides additional exemplary rAAV including, but not limited to, AAV.sh129SOD1.hGal1, AAV.hGalactin1, scAAV.P546.CLN1.Gal1, scAAV.CB.CLN1.Gal1, scAAV.P546.CLN3.Gal1, scAAV.CB.CLN3.Gal1, scAAV.CB.CLN6.Gal1, scAAV.P546.CLN8.Gal1, scAAV.CB.CLN8.Gal1, scAAV.P546.IGHMBP2.Gal1, scAAV.CB.IGHMBP2.Gal1, scAAV.546.PGAP3.Gal1, and scAAV.CBA.PGAP3.Gal1.

[0058] The rAAV of the present disclosure can be purified by standard methods in the art, for example, by column chromatography or cesium chloride gradient. Methods for purifying rAAV vectors from helper viruses are known in the art and include, for example, the methods disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69:427-443 (2002), U.S. Patent No. 6,566,118, and WO98 / 09657.

[0059] The present disclosure provides a composition comprising the rAAV of the present disclosure. The composition of the present disclosure comprises rAAV in a pharmaceutically acceptable carrier. The composition may also contain other components such as diluents and adjuvants. Acceptable carriers, diluents, and adjuvants are non-toxic to the recipient and are preferably inert at the dosage and concentration used, and include buffers such as phosphoric acid, citric acid, or other organic acids, antioxidants such as ascorbic acid, low molecular weight polypeptides, proteins such as serum albumin, gelatin, or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine, or lysine, monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin, chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, salt-forming counterions such as sodium, and / or nonionic surfactants such as Tween, Pluronic, or polyethylene glycol (PEG).

[0060] The titer of rAAV administered by the method of the present disclosure varies, for example, depending on the specific rAAV, the method of administration, the treatment goal, the individual, and the targeted cell type, and can be determined by standard methods in the art. The titer of rAAV is about 1×10 2 , about 1×10 3 , about 1×10 4 , about 1×10 5 , about 1×10 6 , about 1×10 7 , about 1×108 , about 1×10 9 , about 1×10 10 , about 1×10 11 , about 1×10 12 , about 1×10 13 ~ about 1×10 14 or more, which can be the range of DNase-resistant particles (DRP). The dosage may be expressed in units of viral genome (vg). The dosage can also vary based on the timing of administration to humans. These dosages of rAAV, in adults, are about 1×10 4 , about 1×10 5 , about 1×10 6 , about 1×10 7 , about 1×10 8 , about 1×10 9 , about 1×10 10 , about 1×10 11 , about 1×10 12 , about 1×10 13 , about 1×10 14 , about 1×10 15 ~ about 1×10 16 or more, which can be the range of viral genome. For newborns, the dosage of rAAV is, per kilogram of body weight, about 1×10 4 , about 3×10 4 , about 1×10 5 , about 3×10 5 , about 1×10 6 , about 3×10 6 , about 1×10 7 , about 3×10 7 , about 1×10 8 , about 3×10 8 , about 1×10 9 , about 3×10 9 , about 1×10 10 , about 3×10 10 , about 1×10 11 , about 3×10 11 , about 1×10 12 , about 3×10 12 , about 1×10 13 , about 3×10 13 , about 1×10 14 , about 3×10 14 , about 1×10 15 , about 3×10 15 , about 1×1016 ~about 3×10 16 and can be within the range of the viral genome described above.

[0061] The present disclosure provides a method of transducing target cells with the rAAV of the present disclosure in vivo or in vitro. The in vivo method includes administering to a subject (including a human) in need thereof a composition comprising an effective dose or effective multiple doses of the rAAV of the present disclosure. When the dose is administered before the onset / development of the disorder / disease, the administration is prophylactic. When the dose is administered after the onset / development of the disorder / disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the condition of the disorder / disease being treated, delays or prevents progression to the condition of the disorder / disease, delays or prevents progression of the condition of the disorder / disease, reduces the degree of the disease, results in remission (partial or complete remission) of the disease, and / or extends survival. Examples of diseases contemplated for prevention or treatment by the methods of the present disclosure are ALS. Other examples are DMD and SMA. Thus, "treatment" according to the present disclosure alleviates (eliminates or reduces) (e.g., weight loss is reduced by at least 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more, eliminated or reduced) at least one symptom associated with the condition of the disorder / disease being treated, delays or prevents progression to (onset / development of) the disorder / disease condition, delays or prevents progression of the disorder / disease condition, reduces the degree of the disease, results in remission (partial or complete) of the disease, and / or extends survival. Survival can be extended by at least 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more.

[0062] Additional combination therapies are also provided by the present disclosure. Combinations as used herein include both concurrent and sequential therapies. For example, combinations of the methods of the present disclosure with standard medical therapies (e.g., riluzole and CuATSM (diacetylbis(N(4)-methylthiosemicarbazonato)copper(II)) for ALS) are specifically provided, as are combinations with novel therapies.

[0063] Administration of an effective amount of the composition can be by standard routes in the art including, but not limited to, systemic intramuscular, parenteral, intravenous, oral, buccal, nasal, pulmonary, intracranial, intrathecal, intraosseous, intraocular, rectal, or vaginal. The route of administration and serotype of the AAV components of the rAAV of the present disclosure (specifically, the AAV ITR and capsid proteins) can be selected and / or adapted by one of ordinary skill in the art considering the infection and / or disease state being treated, as well as the target cell / tissue being transduced. The route of administration can be systemic. The route of administration can be intrathecal. The route of administration can be intraventricular. The route of administration can be intracisternal. The route of administration can be by lumbar puncture.

[0064] In the case of cerebrospinal fluid (CSF) delivery, including but not limited to intrathecal delivery, the compositions provided herein can include a pharmaceutically acceptable aqueous excipient containing a non-ionic, low-osmolarity compound or contrast agent such as iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan. The aqueous excipient containing the non-ionic, low-osmolarity compound can have one or more of the following properties: a weight osmolarity of about 180 mOsm / kg water by vapor pressure osmometry, a volume osmolarity of about 273 mOsm / L, an absolute viscosity of about 2.3 cp at 20 °C and about 1.5 cp at 37 °C, and a specific gravity of about 1.164 at 37 °C. Exemplary compositions can include about 20 - 40% non-ionic, low-osmolarity compound, or about 25 - 35% non-ionic, low-osmolarity compound. Exemplary compositions can include scAAV or rAAV viral particles formulated in 20 mM Tris (pH 8.0), 1 mM MgCl2, 200 mM NaCl, 0.001% poloxamer 188, and about 25% - about 35% non-ionic, low-osmolarity compound. Another exemplary composition can include scAAV formulated in 1×PBS and 0.001% or 0.005% Pluronic F68.

[0065] In the case of intrathecal administration, the subject can be maintained in the Trendelenburg position (head-down position) after injection of rAAV (e.g., for about 5, about 10, about 15, or about 20 minutes). For example, the patient can be tilted at a head-down angle of about 1 degree to about 30 degrees, about 15 to about 30 degrees, about 30 to about 60 degrees, about 60 to about 90 degrees, or about 90 to about 180 degrees.

[0066] Transduction of cells with the rAAV of the present disclosure results in the sustained expression of therapeutic proteins / RNA and anti-inflammatory proteins / peptides (e.g., SOD1 shRNA and galectin, respectively). Accordingly, the present disclosure provides a method of administering / delivering the rAAV provided herein (e.g., those expressing SOD1 shRNA and galectin) to a subject, preferably a human. The term "transduction" refers to the administration / delivery of DNA encoding therapeutic proteins / RNA and anti-inflammatory proteins / peptides to recipient cells, either in vivo or in vitro, via the replication-deficient rAAV of the present disclosure, which results in the expression of therapeutic proteins / RNA and anti-inflammatory proteins / peptides by the recipient cells.

[0067] Accordingly, the present disclosure provides a method of administering an effective dose (or doses administered essentially simultaneously or at intervals) of the rAAV of the present disclosure (e.g., those encoding SOD1 shRNA and galectin) to a patient in need thereof.

[0068] The methods of the present disclosure can be used to deliver polynucleotides to neurons, glial cells, and endothelial cells. The neurons can be lower motor neurons and / or upper motor neurons. The glial cells can be microglial cells, oligodendrocytes, and / or astrocytes. rAAV can be used to deliver polynucleotides to Schwann cells. rAAV can be used to deliver polynucleotides to muscle or liver cells.

[0069] The methods of the present disclosure can be used to treat neurological or neurodegenerative disorders such as ALS, DMD, SMA, Batten disease (CLN1 / 3 / 6 / 8), IGHMBP2-related disorders (SMARD1 / CMT2S), Pitt-Hopkins syndrome, and PGAP3 congenital glycosylation disorders in a subject. The method includes administering to the subject an effective amount of the rAAV composition provided herein.

[0070] Other Terms and Disclosures As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. It should be further noted that the claims may be drafted to exclude any element, e.g., any optional element. Accordingly, this description is intended to serve as a basis for the use of exclusive terms such as "solely", "only", etc. in connection with the recitation of elements of the claims, or for the use of "negative" limitations.

[0071] Throughout this specification and the following claims, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", are to be interpreted to mean the inclusion of the stated element or step, or group of elements or steps, but not the exclusion of any other element or step, or group of elements or steps.

[0072] As used herein, "consisting of" excludes any element, step, or component not specified in the claims. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the elements of the claims.

[0073] Where a range of values is provided herein, each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limits of that range, and any other stated value or intervening value within the stated range, is encompassed within the disclosure, unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit within the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0074] The disclosure herein specifically contemplates fragments and variants of the genomic components of the provided rAAV (e.g., galectin DNA components or promoter components). For example, the disclosure contemplates rAAV encoding fragments or variants of galectin-1 proteins having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the human galectin-1 protein that retains the activity of galectin-1 on microglia, and rAAV comprising DNA having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to human galectin-1 DNA encoding a polypeptide that retains the activity of galectin-1 on microglia. Alternatively, the DNA sequence variant can be described as hybridizing to human galectin-1 DNA, or its complementary strand, under stringent conditions. The term "stringent" is used to refer to conditions generally understood in the art as stringent. The stringency of hybridization is determined primarily by temperature, ionic strength, and the concentration of denaturants such as formamide. Examples of stringent conditions for hybridization and washing are 0.015 M sodium chloride, 0.0015 M sodium citrate at 65-68 °C, or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 50% formamide at 42 °C. See Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, (Cold Spring Harbor, N.Y. 1989).

[0075] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure.

[0076] All publications mentioned in this specification are hereby incorporated by reference into this specification for the purpose of disclosing and describing the methods and / or materials for which the publication is cited. To the extent that the incorporated materials are inconsistent with or conflict with this specification, this specification shall prevail over any such materials.

[0077] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features that can be readily separated from or combined with the features of any of several other embodiments without departing from the scope or spirit of the disclosure. Any of the described methods can be performed in the order of the events described or in any other order that is logically possible. The disclosure is intended to provide support for all such combinations.

[0078] As used herein, "contemplate," "may," "may comprise," "may be," "can," "can comprise," and "can be" all indicate what is contemplated by the inventors as being part of and available for use with the subject matter provided.

Examples

[0079] The following examples illustrate the products and methods of this disclosure, but those skilled in the art will envision changes and modifications. Accordingly, only such limitations as appear in the claims should be imposed on the invention.

[0080] Example 1 A series of experiments were conducted to demonstrate that cell-secreted GAL1 reduces the inflammatory phenotype of M1 microglia in vitro.

[0081] Extracellular galectin-1 reduces ALS microglia-mediated motor neuron toxicity GAL1 DNA or RFP DNA (control) was cloned into a mammalian expression vector and used to transfect HEK-293 cells. HEK-293 cells were maintained in Iscove's modified Dulbecco's medium containing 10% FBS, 1% L-glutamine, and 1% penicillin / streptomycin. When reaching approximately 60% confluence, HEK-293 cells were transfected with pBOB-galectin 1 or pBOB-RFP plasmid in Iscove's modified Dulbecco's medium containing 10% FBS, 1% L-glutamine, and 1% penicillin / streptomycin. Twenty-four hours after transfection, the medium was changed to Iscove's modified Dulbecco's medium containing 2% FBS, 1% L-glutamine, and 1% penicillin / streptomycin. Supernatants were collected at 24-hour intervals for 3 days after transfection. The supernatants were filtered through a 0.2 μ filter and stored frozen at -80°C. GAL1 ELISA confirmed overexpression of GAL1 in cells transfected with pBOB-galectin 1 compared to cells transfected with pBOB-RFP. A corresponding increase in secreted GAL1 was also found in supernatants from cells transfected with GAL1.

[0082] Adult microglia were isolated from the brains of littermates of SOD1 G93A and WT mice with minor modifications as previously described [Moussaud and Draheim, J Neurosci Methods, 187(2): 243-253(2010)]. Four-month-old SOD1 G93AWT littermate mice were deeply anesthetized and perfused transcardially with ice-cold Ringers solution (Fisher Scientific). Brains that appeared not to be completely exsanguinated were discarded. The brains were fragmented with a scalpel and incubated in an enzyme solution containing papain at 37 °C in 5% CO2 for 60 minutes. The papain solution was quenched with 20% FBS in HBSS and centrifuged at 200 g for 4 minutes. The pellet was resuspended in 0.5 mg / ml DNase I (Worthington Biochemicall) in 2 mL of HBSS and incubated at room temperature for 5 minutes. The brain tissue was gently disrupted with a fire-polished Pasteur pipette and then filtered through a 70-micron cell strainer (Fisher Scientific) and centrifuged at 200 g for 4 minutes. The resulting pellet was then resuspended in 20% isotonic Percoll (GE Healthcare) in 20 ml of HBSS. 20 mL of pure HBSS was carefully placed on top of the Percoll layer and centrifuged at 200 g for 20 minutes with slow acceleration and no brake. The interphase layer containing myelin and cell debris was discarded, and the pellet containing the mixed glial cell population was washed once with HBSS and resuspended in Dulbecco's modified Eagle's / F12 medium supplemented with 10% heat-inactivated FBS, antibiotics-antimycotics (all from Life Technologies), and 5 ng / ml of carrier-free mouse recombinant granulocyte and macrophage colony-stimulating factor (GM-CSF) (R&D Systems) in GlutaMAXTM (DMEM / F12). The cell suspension from four mouse brains was seeded onto a 15 cm2 plate (Corning) coated with poly-L-lysine (Sigma) and cultured at 37 °C in 95% air / 5% CO2. The medium was changed every 3 days until the cells reached confluence (after about 2 weeks). After the glial layer became confluent, microglia formed a non-adherent floating cell layer that could be collected, re-seeded, and cultured for a long time. After collecting the floating layer, microglia were incubated for 3 days without GM-CSF and then re-seeded for co-culture with motor neurons. The collected microglia were characterized by immunocytochemistry.

[0083] Late-stage SOD1 G93A Microglia derived from mice and age-matched wild-type mice were treated with HEK293 supernatant containing galectin-1 or RFP for 3 days. Subsequently, the pre-conditioned microglia were co-cultured with HB9:GFP+ motor neurons (MN) as follows.

[0084] Hb9-GFP + MNs were seeded at a density of 6,000 cells per well in 100 μl of MN medium containing DMEM:F12 (Invitrogen), 5% horse serum, 2% N2 (Invitrogen), 2% B27 (Invitrogen) + GDNF (10 ng / ml, Invitrogen), BDNF (10 ng / ml, Invitrogen), and CNTF (10 ng / ml, Invitrogen) in 96-well plates coated with polyornithine (10 μg / ml, Sigma) and laminin (5 μg / ml, Invitrogen). The next day, pre-conditioned microglia were seeded on top of the MNs at a density of 35,000 cells per well in 100 μl of MN medium. The co-culture plates were imaged daily by an IN Cell Analyzer 6000 (GE Healthcare). The images were processed and analyzed using IN Cell Developer Toolbox 1.9 and IN Cell Analyzer Workstation 3.7 software (GE Healthcare) to quantify the number of surviving GFP+ MNs per well. Depending on the assay, culture medium or cell lysates were prepared after 3 days of co-culture.

[0085] SOD1 treated with galectin-1-containing medium G93A Microglia were able to rescue motor neuron toxicity (Figure 1).

[0086] Conditioning of ALS microglia with galectin-1 results in reduced secretion of TNF-α To show that the enhanced survival of motor neurons after preconditioning of ALS microglia with galectin-1 was due to the regulation of the inflammatory phenotype of these microglia, co-culture supernatants were screened for TNF-α levels. HB9:GFP + Wild-type or SOD1 preconditioned with RFP or galectin-1 and co-cultured with motor neurons G93A ELISA-based quantification of TNF-α levels in media collected from microglia showed that galectin-1 conditioning reduced the levels of TNF-α secreted from SOD1 G93A and wild-type microglia (Figure 2).

[0087] Galectin-1 conditioning of ALS microglia affects the expression levels of M1 and M2 markers. qRT-PCR-based quantification of the expression levels of CD68, CD86 (M1 marker), and arginase 1, IL-10 (M2 marker) was performed on HB9:GFP + Wild-type or SOD1 preconditioned with RFP or galectin-1 and co-cultured with motor neurons G93A Microglia. Galectin-1 conditioning reduced the expression of the neurotoxic M1 marker in SOD1 G93A microglia and enhanced the expression of the anti-inflammatory M2 marker. Only a slight change in M1 marker expression was observed, but galectin-1 conditioning significantly increased the expression of arginase 1 (M2 marker) in SOD1 G93A microglia. A similar trend was also observed for IL-10 expression (Figure 3).

[0088] Galectin-1 conditioning regulates NF-κB activation in ALS microglia HB9:GFP + Wild-type and SOD1 preconditioned with RFP or galectin-1 and co-cultured with motor neurons G93A NF-κB activation in microglia was determined by performing ELISA-based quantification of phosphorylated p65 and total p-65. Galectin-1 conditioning of SOD1 G93A microglia reduced NF-κB activation in RFP-treated SOD1G93A Compared with wild-type microglia, it resulted in low levels of phosphorylated p65 / total p-65, suggesting a reduction in NF-κB activity (Figure 4).

[0089] Summary This in vitro data indicates that GAL1-mediated inactivation of ALS microglia leads to enhanced motor neuron survival.

[0090] Example 2 A series of experiments were conducted to demonstrate that cellular secreted GAL1 reduces the inflammatory phenotype of M1 microglia in vivo.

[0091] Mice expressing the SOD1 G93A mutation were assigned to one of the following four treatment groups: AAV9.GAL1 only, AAV9.SOD1.shRNA only, AAV9.SOD1.shRNA.GAL1, or untreated control (Figure 5).

[0092] The AAV9.GAL1 vector (also referred to as the AAV MS galectin-1 vector) contains mouse GAL1 cDNA expressed under the control of the chicken β-actin promoter, resulting in high expression levels in astrocytes and motor neurons. The plasmid used to produce AAV is shown in Figure 6. The AAV9.SOD1.shRNA vector contains an shRNA construct targeting human SOD1, expressed under the control of the H1 promoter, in a vector previously described by Foust et al., Mol. Ther., 21: 2148-2159 (2013) and Iannitti et al., Mol. Ther. Nucleic Acid, 12: 75-88 (2019). The vector also contained a stuffer sequence optimized for efficient packaging of the AAV vector. The AAV9.SOD1.shRNA.GAL1 vector contained SOD1.shRNA expressed under the control of the H1 promoter and GAL1 cDNA expressed under the control of the chicken β-actin promoter. The plasmid used to produce AAV is shown in Figure 7. Self-complementary AAV was produced in 293 cells by a transient transfection procedure using each plasmid together with the adenovirus helper plasmid pHelper (Stratagene, Santa Clara, CA) and a plasmid encoding the Rep2Cap9 sequence, as previously described. The same SOD1.shRNA and SOD1.shRNA.GAL1 constructs were also packaged into the PHP.B capsid. The PHP.B serotype has been shown to increase transduction in neurons of adult mice compared to AAV9. Transfection of HEK293 cells demonstrated that the plasmids and scAAV worked as designed. For example, AAV.SOD1.shRNA.Gal1 reduced SOD1 expression and increased Gal1 expression in transfected HEK293. HEK-293 cells were maintained in Dulbecco's modified Eagle's medium containing 10% FBS, 1% L-glutamine, and 1% penicillin / streptomycin.When reaching approximately 80% confluence, the cells were transfected with plasmid AAV.SOD1.shRNA.Gal1, AAV.SOD1.shRNA, AAV.Gal1, and AAV.GFP. Protein lysates were prepared 72 hours after transfection and analyzed for SOD1 and Gal1 levels by Western blot (Figure 8).

[0093] Thirty mice were utilized for each treatment group. All procedures were conducted in accordance with NIH guidelines and approved by the Abigail Wexner Research Institute at Nationwide Children’s Hospital (Columbus, OH). High-copy SOD1 G93A mice were obtained from Jackson Laboratories (Bar Harbor, ME) and bred. Animals were genotyped prior to treatment to obtain SOD1 G93A expressing mice and their wild-type littermates. Both male and female mice were included in the SOD1 G93A and wild-type mouse experiments. Power analysis was performed to obtain statistically significant results for behavioral and survival analyses. The analysis indicated that a minimum of 8 animals per group per sex were required. To meet this requirement, the group size was set at at least 10 males and 10 females per treatment group to allow for eventual random unrelated health issues in the mice without losing statistical power. An additional 5 males and 5 females per treatment group were added for immunohistochemistry and expression analysis at various time points.

[0094] Mice received either AAV9.GAL1, AAV9.SOD1.shRNA, or AAV9.SOD1.shRNA.GAL1. For intracerebroventricular (ICV) injection of mice at P1, the pups were anesthetized on ice for 10 minutes prior to injection. The injection was performed with a 30G Hamilton syringe as described above 60 . rAAV9 was diluted in phosphate-buffered saline to obtain the correct dosage. The total volume injected for each animal was less than 5 μl. Dosage, 5×10 10The vector genome / animal allowed for widespread targeting of cells throughout the brain and spinal cord. For intrathecal (IT) injections, adult mice were anesthetized with continuous isoflurane, and lumbar injections were performed with a 30G Hamilton syringe and syringe pump. Briefly, a needle was inserted between the L5 / L6 intervertebral discs, and the vector was infused at a rate of 3 μL / min. 5 × 10 10 A dose of 1.65 × 10 vg / mouse was used for the PHP.B vector. 11 A dose of vg / mouse was used for the AAV9 vector in a total volume of 15 μL.

[0095] Consistent with the HEK293 cell expression assay, AAV.SOD1.shRNA.Gal1 significantly inhibited WT / SOD1 G93A Increased Gal1 expression and SOD1 in mice G93A SOD1 expression was reduced in mice. WT and SOD1G93A mice were intracerebroventricularly injected with the AAV9.SOD1.shRNA.Gal1 vector at P1. One month after injection, the animals were sacrificed, and lumbar spinal cord tissue was collected for analysis of SOD1 and Gal1 levels by Western blot analysis (Figure 9).

[0096] Intracerebroventricular delivery of AAV9.SOD1.shRNA.msGal1 improves the survival of SOD1 G93A mice compared to treatment with AAV9.SOD1.shRNA alone Neonatal SOD1 mice received a single ICV injection of AAV9.msGal1, AAV9.SOD1.shRNA, or AAV9.SOD1.shRNA.msGal1 as described above. G93A Mice were monitored until endpoint and compared with controls. Survival analysis was performed using Kaplan-Meier survival analysis. End stage was defined as the point of artificial death when the animal was unable to "right itself" within 20 seconds after being placed on its back and / or had severe urinary incontinence and burns. Disease onset and disease progression were determined from retrospective data analysis. Disease onset was defined as the age at which the animal reached its peak weight. Disease duration was defined as the period between disease onset and end stage.

[0097] AAV9.SOD1.shRNA.msGal1 treatment significantly extended the median survival of SOD1 G93A mice compared to AAV9.SOD1.shRNA, AAV9.msGal1, and non-injected controls (control, n = 21, 139 days, AAV9.msGal1, n = 21, 138 days, AAV9.SOD1.shRNA, n = 20, 187.5 days, AAV9.SOD1.shRNA.msGal1, n = 17, 221 days, one-way ANOVA, P < 0.0001) (Figure 10).

[0098] AAV9.SOD1.shRNA.msGal1 treatment significantly extended the median survival of SOD1 G93A male mice compared to AAV9.SOD1.shRNA, AAV9.msGal1, and non-injected controls (control, n = 9, 139 days, AAV9.msGal1, n = 10, 138 days, AAV9.SOD1.shRNA, n = 9, 179 days, AAV9.SOD1.shRNA.msGal1, n = 8, 235.5 days, one-way ANOVA, P < 0.0001) (Figure 11).

[0099] AAV9.SOD1.shRNA.msGal1 treatment significantly extended the median survival of SOD1 G93A female mice compared to AAV9.SOD1.shRNA, AAV9.msGal1, and non-injected controls (control, n = 12, 141.5 days, AAV9.msGal1, n = 11, 139 days, AAV9.SOD1.shRNA, n = 11, 191 days, AAV9.SOD1.shRNA.msGal1, n = 9, 218 days, one-way ANOVA, P < 0.0001) (Figure 12).

[0100] Intracerebroventricular delivery of AAV9.SOD1.shRNA.msGal1 and AAV9.SOD1.shRNA shows improvement in the motor ability of SOD1 G93A mice treated and control SOD1 G93AMice, as well as wild-type littermates, were monitored twice a week for changes in body weight. Motor coordination was recorded using an accelerating rotarod apparatus (Columbus Instruments, Columbus, OH). Each alternate-week session consisted of three trials on an accelerating rotarod starting at 5 rpm / min. The time each mouse remained on the rod was recorded. SOD1 G93A Both SOD1 G93A and wild-type mice were subjected to bi-weekly assessment of forelimb and hindlimb grip strength using a grip strength meter (Columbus Instruments). Each alternate-week session consisted of three tests per animal.

[0101] Animals treated with AAV9.SOD1.shRNA.msGal1 and AAV9.SOD1.shRNA maintained body weight better and improved hindlimb grip strength and rotarod performance compared to age-matched controls (Figure 13). This indicates that animals treated with AAV9.SOD1.shRNA.msGal1 (n = 20) and AAV9.SOD1.shRNA (n = 21) maintained muscle tone and motor ability compared to AAV9.msGal1 (n = 21) and non-injected controls (n = 24).

[0102] Intrathecal delivery of PHP.B.SOD1.shRNA.msGal1 improves the survival of SOD1 G93A mice Adult SOD1 G93A Mice (age p80 - p95) received a single intrathecal (IT) injection of PHP.B.SOD1.shRNA.msGal1. Treated mice were monitored until the endpoint and compared to vehicle control mice. PHP.B.SOD1.shRNA.msGal1 injection significantly extended the median survival of SOD1 G93A mice (control, n = 3, 136 days, PHP.B.SOD1.shRNA.msGal1, n = 7, 190 days, log-rank test, P < 0.05) (Figure 14).

[0103] Intrathecal delivery of PHP.B.SOD1.shRNA.msGal1 improves the body weight of SOD1 G93A mice Adult SOD1 G93AMice (aged p80 - p95) received a single IT injection of PHP.B.SOD1.shRNA.msGal1. SOD1 mice treated with PHP.B.SOD1.shRNA.msGal1 G93A Mice maintained their body weight relative to vehicle controls (n = 3, PHP.B.SOD1.shRNA.msGal1, n = 7) and may show maintained muscle tone in treated animals (Figure 15).

[0104] Summary Mice treated with the combination of SOD1 shRNA and GAL1 showed a significant increase in motor function and survival compared to the GAL1 only, SOD1 shRNA only, or untreated groups.

[0105] Example 3 A series of experiments were performed to demonstrate that the expression of galectin - 1 itself is also neuroprotective in patient - derived astrocytes or neurons.

[0106] Skin fibroblasts from multiple patients with various neurological and neurodegenerative disorders were directly reprogrammed into neural progenitor cells (NPCs) and further differentiated into induced astrocytes (iA) according to the methods described in Dennys et al. (2014). DOI: 10.3791 / 62016 - v and Meyer et al., Proc. Natl. Acad. Sci. USA, 111: 829 - 832 (2014). iA were treated with AAV9.Gal1 (generated using the plasmid shown in Figure 6) and then co - cultured with mouse GFP neurons for 3 days to determine the effect of astrocytes on neuron survival and morphology. Untreated iA were used as controls.

[0107] Treatment of i normal cells from 3 patients with Pitt - Hopkins syndrome carrying different TCF4 mutations with AAV9.Gal1 showed improved neuron survival in 2 out of the 3 patient lines tested (Figure 19).

[0108] To demonstrate the effect of galectin-1 expression in neurons, skin fibroblasts from patients with various neurological and neurodegenerative disorders were directly converted into induced neurons (iNs) according to the methods described in Ray et al., Cell Rep., 41: 111751 (2022) and Sierra-Delgado et al., Biology (Basel), 12(6): 867 (2023). The iNs were treated with AAV9.Gal1 (generated using the plasmid shown in Figure 6) to determine its effect on the conversion rate and neuronal morphology.

[0109] Treatment of iNs derived from four patients with Batten CLN3 disease with AAV9.Gal1 showed a significant improvement in neurite length for three of the four patient lines tested (Figure 20).

[0110] Example 4 A series of experiments were conducted to show the effect of galectin-1 in combination with other therapeutic proteins of interest. The present disclosure contemplates that targeting astrocytes and neurons with AAV9 to deliver a healthy copy of the gene that expresses the therapeutic protein of interest while also expressing galectin-1 in these cell types has a positive intrinsic effect on these cell types, while providing an exogenous neuroregulatory effect on the surrounding microglia.

[0111] In previous examples herein, galectin-1 was expressed under the RNA PolII promoter with separate expression of the shRNA expression cassette or another transgene expression cassette. In this example, galectin-1 is expressed as a fusion protein with the therapeutic protein of interest using a 2A self-cleaving peptide sequence. Examples of self-cleaving peptide sequences are as follows.

[0112] [Table 1]

[0113] Therapeutic proteins and galectin are expressed from the same RNAPolII promoter, which results in a fusion protein containing the gene product of interest - 2A - galectin - 1 that is cleaved after translation.

[0114] Various galectin - 1 fusion constructs (AAV production plasmids and sequences shown in Figures 23 - 34) were generated according to the underlying neurological / neurodegenerative disorders to be treated, including, for example, Batten disease (CLN1 / 3 / 6 / 8), IGHMBP2 - related disorders, and PGAP3 congenital glycosylation disorders.

[0115] For example, an AAV vector expressing galectin - 1 was generated as a fusion protein having the PGAP3 gene of interest and the P2A self - cleaving peptide. The vector was first tested in HEK293 cells to determine faithful expression of galectin - 1. Western blot analysis revealed 1.78 - to 2 - fold expression of galectin - 1 from the fusion construct compared to untreated cells (Figure 21).

[0116] The vector was further tested in a co - culture assay, and i - astrocytes derived from PGAP3 patients treated with the combination vector showed a significant improvement in neuron survival (Figure 22).

[0117] Example 5 Human MT is encoded by a family of 10 genes (on chromosome 16) that are subdivided into 4 groups, MT-1 to MT-4. The genes / MTs are MT-1A, MT-1B, MT-1E, MT-1F, MT-1G, MT-1H, MT-1X, MT-2A, MT-3, and MT-4. MT is a low molecular weight protein of 6-7 kDa, consisting of a single polypeptide chain containing 60-68 amino acid residues. Importantly, within the central nervous system, MT-1 / 2 and MT-3 are expressed mainly in astrocytes as compared to neurons. The expression of MT is induced by metals, glucocorticoids, cytokines, and various physical stress states, as well as ROS and oxidative stress that are characteristic of multiple neurological and neurodegenerative disorders. The physiological function of MT is thought to be metal cell homeostasis and detoxification of heavy metals. The present disclosure takes into account that MT-1 / 2 also plays an important role in neuroprotection and neuroregeneration. Due to its zinc-binding and antioxidant properties, MT-1 / 2 and MT-3 are also involved in promoting neuron growth, neuron survival, and reducing apoptosis and brain inflammation. Thus, MT is contemplated herein as a therapeutic agent for multiple neurological and neurodegenerative disorders.

[0118] To achieve modification of multiple cell types associated with neurological / neurodegenerative disorders, the present disclosure contemplates providing the endogenous / exogenous effects of neuroimmunomodulatory proteins (such as galectins and NBDs) together with the endogenous / exogenous effects of metallothionein using rAAV and co-expressing them in the CNS. The present disclosure provides exemplary plasmids / constructs (Figs. 35-38) for producing rAAV for the treatment of ALS, in which the SOD1 shRNA expression cassette is combined with the galectin 1-P2A-MT1E expression cassette in the same AAV vector. Depending on the disease / disorder to be treated, the galectin 1-P2A-MT expression cassette can be combined with multiple MTs that can be co-expressed using expression cassettes of other genes of interest and multiple 2A cleavage sequences.

Claims

1. A recombinant adeno-associated virus (rAAV) genome that expresses (A) a therapeutic protein or RNA and (B) an anti-inflammatory protein or peptide.

2. The rAAV genome according to the claim, wherein (A) is a short hairpin ribonucleic acid (SOD1 shRNA) targeting superoxide dismutase 1, or (A) is a CLN1, CLN3, CLN6, CLN8, IGHMBP2, or PGAP3 protein.

3. The rAAV genome according to claim 2, wherein the sequence of the SOD1 shRNA is SEQ ID NO:

4.

4. The rAAV genome according to any one of the preceding claims, wherein (B) is human galectin-1 or human galectin-3.

5. The rAAV genome according to any one of claims 1 to 3, wherein (B) is a metallothionein protein, a metallothionein fusion protein, NBD 1X, or NBD 3X.

6. The rAAV genome according to any one of the preceding claims, wherein the expression of (A) is under the control of an H1 promoter and the expression of (B) is under the control of a CBA promoter.

7. An rAAV comprising the genome according to any one of the preceding claims.

8. The rAAV according to claim 7, which is scAAV or ssAAV.

9. The rAAV according to claim 7 or 8, comprising an AAV9 capsid.

10. An rAAV, wherein the rAAV is AAV.sh129SOD1.hGal1, AAV.hGalactin1, scAAV.P546.CLN1.Gal1, scAAV.CB.CLN1.Gal1, scAAV.P546.CLN3.Gal1, scAAV.CB.CLN3.Gal1, scAAV.CB.CLN6.Gal1, scAAV.P546.CLN8.Gal1, scAAV.CB.CLN8.Gal1, scAAV.P546.IGHMBP2.Gal1, scAAV.CB.IGHMBP2.Gal1, scAAV.546.PGAP3.Gal1, or scAAV.CBA.PGAP3.Gal1. 。

11. A composition comprising the rAAV according to any one of claims 7 to 10.

12. The composition according to claim 11, further comprising an agent that increases the viscosity or density of the composition.

13. The composition according to claim 12, wherein the agent is a contrast agent.

14. The composition according to any one of claims 11 to 13, wherein the composition is formulated for direct injection into cerebrospinal fluid, intracerebroventricular delivery, intrathecal delivery, or intravenous delivery.

15. A method for treating amyotrophic lateral sclerosis in a subject, the method comprising administering to the subject an rAAV composition expressing an effective amount of a short hairpin ribonucleic acid (SOD1 shRNA) targeting superoxide dismutase 1 according to any one of claims 11 to 14.

16. The method according to claim 15, wherein the rAAV composition is administered to the subject by direct injection into cerebrospinal fluid, intracerebroventricular delivery, intrathecal delivery, or intravenous delivery.

17. Use of an rAAV expressing a short hairpin ribonucleic acid (SOD1 shRNA) targeting superoxide dismutase 1 according to any one of claims 7 to 10 in the preparation of a medicament for the treatment of ALS.

18. A plasmid comprising the rAAV genome according to any one of claims 1 to 6.

19. A method for producing rAAV, the method comprising transducing a packaging cell with the plasmid according to claim 18 and culturing the packaging cell.

20. A method for treating Batten disease, IGHMBP2-related disorder (SMARD1 / CMT2S), or PGAP3 congenital glycosylation disorder in a subject, the method comprising administering to the subject an rAAV composition according to claim 2 expressing an effective amount of, in the case of Batten disease, CLN1, CLN3, CLN6, or CLN8 protein, in the case of IGHMBP2-related disorder, IGHMBP2 protein, or in the case of PGAP3 congenital glycosylation disorder, PGAP3 protein.