Recombinant modified saRNA (VRP) and vaccinia virus Ankara (MVA) prime-boost regimen

The saRNA and MVA prime-boost vaccine regimen effectively induces immune responses against EBV by leveraging heterologous vaccination, addressing the need for multiple immunizations in conventional vaccines and enhancing immune response quality.

JP2025525380APending Publication Date: 2025-08-05BAVARIAN NORDIC AS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024575184
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-29
Filing Date
2023-06-29
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

Conventional vaccines often require multiple immunizations to achieve effectiveness, and heterologous prime-boost vaccination regimens have shown to be more effective than homologous approaches in eliciting both humoral and cellular immune responses, but the mechanisms and optimal combinations are not fully understood.

Method used

A vaccine regimen using self-amplifying RNA (saRNA) as a prime and vaccinia virus Ankara (MVA) as a boost, specifically encoding antigenic determinants of infectious diseases like EBV, to induce robust immune responses.

Benefits of technology

This regimen generates high levels of IgG, neutralizing antibodies, and T cell responses, providing effective protection against EBV and potentially other infectious diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025525380000014
    Figure 2025525380000014
  • Figure 2025525380000015
    Figure 2025525380000015
  • Figure 2025525380000016
    Figure 2025525380000016
Patent Text Reader

Abstract

The present invention provides compositions, vaccines, and methods for inducing protective immunity to immunogens in humans. Protective immune responses are obtained by using saRNA, particularly VRP vectors as a prime and MVA vectors for boosting. Specifically, the present invention relates to genetically engineered (recombinant) VRP and MVA vectors that contain at least one heterologous nucleotide sequence encoding an antigenic determinant of an infectious virus (e.g., EBV).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to methods and compositions for enhancing immune responses in a subject, comprising self-amplifying RNA (saRNA), particularly recombinant modified alphavirus replicon (VRP) and vaccinia virus Ankara-based (MVA) vaccines, against infectious diseases (e.g., EBV) in human subjects. The present invention also relates to vaccination methods, particularly heterologous prime-boost vaccination regimens using two viral vector compositions. More specifically, the present invention relates to recombinant VRP and recombinant MVA used in heterologous prime-boost vaccination regimens. The present invention also relates to products, methods, and uses thereof, suitable for, for example, inducing protective immune responses in subjects. [Background technology]

[0002] It is not uncommon for many vaccines to require multiple immunizations to be effective. In pediatric populations, up to five immunizations may be required, as in the case of the diphtheria, tetanus, and pertussis (DTP) vaccine. This is done with three doses administered during the first six months of life, followed by a fourth dose in the second year of life and a final boost at age four to six years. Furthermore, some vaccines require additional boosts even for adults who have already received a full immunization series (e.g., tetanus-diphtheria (Td) vaccine), with boosts recommended every ten years throughout life. While it is not entirely clear why some vaccines require more immunizations than others, it is well accepted that multiple immunizations (i.e., "prime-boost") are important, even for the most effective vaccines. This principle applies to live attenuated vaccines (e.g., oral polio vaccine), inactivated vaccines (e.g., Hepatitis A vaccine), recombinant protein subunit vaccines (e.g., Hepatitis B vaccine), and polysaccharide vaccines (e.g., Haemophilus Influenzae type B vaccine). For these vaccines, the prime-boost is "homologous" because the same vaccine administered in the previous priming immunization is used in the subsequent boost immunization.

[0003] Over the past decade, studies have shown that prime-boost immunizations can be administered in a "heterologous" prime-boost format, using the same antigen but with a unique vaccine delivery method. The most intriguing and unexpected result is that heterologous prime-boost is often more effective than the "homologous" prime-boost approach. Rapid advances in novel vaccination approaches (e.g., DNA vaccines and viral vector-based vaccines) have certainly further expanded the scope of heterologous prime-boost vaccination (Excler JL, Plotkin S. The prime-boost concept applied to HIV preventive vaccines. Aids. 1997;11(Suppl A):S127-S137; Ramshaw IA, Ramsay AJ. The prime-boost strategy: exciting prospects for improved vaccination. Immunol Today. 2000;21:163-165; Lu S. Combination DNA plus protein HIV vaccines. Springer Semin Immunopathol. 2006;28:255-265).

[0004] A landmark 1992 Science report was the first to use a heterologous prime-boost immunization approach in a nonhuman primate model (Hu SL, Abrams K, Barber GN, Moran P, Zarling JM, Langlois AJ, Kuller L, Morton WR, Benveniste RE. Protection of macaques against SIV infection by subunit vaccines of SIV envelope glycoprotein gp160. Science. 1992;255:456-459. First major report on the use of heterologous prime-boost vaccination approach, in the context of AIDS vaccine development). In that study, Macaca fasciculari were first immunized with a recombinant vaccinia virus expressing the SIVmnegp160 antigen and then boosted with gp160 protein produced in baculovirus-infected cells. The animals were protected from intravenous challenge with SIVmne virus, representing one of the most promising protective results in early HIV vaccine development efforts.

[0005] Shiu-Lok Hu, the lead scientist on the study, and his collaborators previously demonstrated that priming with live recombinant virus and boosting with subunit recombinant proteins is more effective in rodents than immunization with either immunogen alone (Hu SL, Klaniecki J, Dykers T, Sridhar P, Travis BM. Neutralizing antibodies against HIV-1 BRU and SF2 isolates generated in mice immunized with recombinant vaccinia virus expressing HIV-1(BRU) envelope glycoproteins and boosted with homologous gp160. AIDS Res Hum Retroviruses. 1991;7:615-620).

[0006] In another study, Girard et al. reported significant increases in antibody titers in chimpanzees primed with recombinant vaccinia virus and boosted multiple times with a mixture of recombinant HIV-1 proteins or synthetic peptides (Girard M, Kieny MP, Pinter A, Barre-Sinoussi F, Nara P, Kolbe H, Kusumi K, Chaput A, Reinhart T, Muchmore E, et al. Immunization of chimpanzees confers protection against challenge with human immunodeficiency virus. Proc Natl Acad Sci U S A. 1991;88:542-546). Furthermore, around the same time, in what may have been the first human trial of heterologous prime-boost immunization, Daniel Zagury of the Pierre and Marie Curie University in Paris inoculated himself with a recombinant vaccinia virus containing the HIV-1 Env gene and then boosted with recombinant Env protein (Zagury D, Bernard J, Cheynier R, Desportes I, Leonard R, Fouchard M, Reveal B, Ittele D, Lurhuma Z, Mbayo K, et al. A group specific anamnestic immune reaction against HIV-1 induced by a candidate vaccine against AIDS. Nature. 1988;332:728-731). Other early studies in the non-HIV field include small animal studies conducted by Eckhart Wimmer's group using synthetic peptides and inactivated poliovirus for prime-boost immunization (Emini EA, Jameson BA, Wimmer E. Priming for and induction of anti-poliovirus neutralizing antibodies by synthetic peptides. Nature. 1983;304:699-703).

[0007] Early efforts at using heterologous prime-boost immunization approaches in HIV-1 vaccine development were based on the following rationale.

[0008] Recombinant envelope (Env) glycoproteins can induce neutralizing antibody responses to specific isolates but fail to induce cytotoxic T cell responses. Immunization with recombinant vaccines expressing HIV-1 antigens can induce good T cell responses but not high levels of protective antibodies. Therefore, combined immunization involving both of these types of vaccines may be more effective than either immunogen alone. (Hu SL, Klaniecki J, Dykers T, Sridhar P, Travis BM. Neutralizing antibodies against HIV-1 BRU and SF2 isolates generated in mice immunized with recombinant vaccinia virus expressing HIV-1 (BRU) envelope glycoproteins and boosted with homologous gp160. AIDS Res Hum Retroviruses. 1991;7:615-620)

[0009] This description established an important principle for the use of heterologous prime-boost immunization to elicit both humoral and cellular immune responses. Modern immunology has established that such a balanced immune response is important not only for protection against viral infections but also for protection against other types of pathogens. Conventional vaccines, particularly inactivated and subunit vaccines, have been less effective at eliciting T cell responses. This requirement is even more important for the development of an HIV vaccine. An ideal HIV vaccine should be able to generate "sterilizing antibodies" that, once HIV-1 is integrated into the genome of the host's peripheral blood mononuclear cells (PBMCs), prevent the establishment of a more difficult-to-clear viral infection.

[0010] At the same time, the T cell immune response plays a critical role in controlling the magnitude of the infection, which can affect the long-term mortality and morbidity of the host.

[0011] Over the past few years, the use of heterologous prime-boost approaches against a wide range of pathogens has gained significant momentum in vaccine research, and several characteristics of this trend have become apparent.

[0012] First, because other vaccination approaches have not been successful, it is common to use heterologous prime-boost approaches to address some of the most challenging vaccine development targets (e.g., malaria and tuberculosis). The idea is to focus on specific antigens of interest and to elicit a high-quality immune response that includes various subsets of the T cell immune response. A DNA prime-MVA boost vaccine encoding thrombospondin-related adhesion protein partially protected healthy malaria-naive adults against Plasmodium falciparum sporozoite challenge (Dunachie SJ, Walther M, Epstein JE, Keating S, Berthoud T, Andrews L, Andersen RF, Bejon P, Goonetilleke N, Poulton I, et al. A DNA prime-modified vaccinia virus ankara boost vaccine encoding thrombospondin-related adhesion protein but not circumsporozoite protein partially protects healthy malaria-naive adults against Plasmodium falciparum sporozoite challenge. Infect Immun. 2006;74:5933-5942). This study also emphasizes the importance of antigen selection for immune protection. This was made clear by the fact that the same combination vaccination using circumsporozoite protein instead of thrombospondin-related adhesion protein did not induce such protection.

[0013] In tuberculosis vaccine development, qualitatively and quantitatively distinct cellular immune responses have been elicited in rhesus macaques receiving a recombinant Bacillus Calmette-Guérin (BCG) prime followed by a boost with adenovirus 35 vectors expressing Ag85A, Ag85B, and TB104 fusion proteins (Magalhaes I, Sizemore DR, Ahmed RK, Mueller S, Wehlin L, Scanga C, Weichold F, Schirru G, Pau MG, Goudsmit J, et al. rBCG induces strong antigen-specific T cell responses in rhesus macaques in a prime-boost setting with an adenovirus 35 tuberculosis vaccine vector. PLoS ONE. 2008;3:e3790). Alternatively, BCG can be used as a boost after a DNA vaccine prime. In one study conducted in calves, a DNA prime with Ag85B, MPT64, and MPT83 antigens followed by a BCG boost was able to induce a higher immune response and better protection against Mycobacterium bovis challenge than BCG alone (Cai H, Yu DH, Hu XD, Li SX, Zhu YX. A combined DNA vaccine-prime, BCG-boost strategy results in better protection against Mycobacterium bovis challenge. DNA Cell Biol. 2006;25:438-447).

[0014] Second, a well-designed heterologous prime-boost approach can broaden the scope of the immune response. When mice were primed with a DNA vaccine expressing ESAT6 and then boosted with the same antigen in recombinant protein form, the production of Th1-type cytokines was significantly increased, as was the ratio of IgG2 to IgG1 (Wang QM, Sun SH, Hu ZL, Yin M, Xiao CJ, Zhang JC. Improved immunogenicity of a tuberculosis DNA vaccine encoding ESAT6 by DNA priming and protein boosting. Vaccine. 2004;22:3622-3627). In another mouse study, priming with a DNA vaccine expressing the herpes simplex virus type 2 (HSV-2) gD antigen (which preferentially induces Th1-type cellular immune responses) and boosting with recombinant gD protein (which induces primarily Th2-biased responses) significantly enhanced antibody, T cell proliferation, and Th1 cytokine production (Sin JI, Bagarazzi M, Pachuk C, Weiner DB. DNA priming-protein boosting enhances both antigen-specific antibody and Th1-type cellular immune responses in a murine herpes simplex virus-2 gD vaccine model. DNA Cell Biol. 1999;18:771-779).

[0015] Third, a prime-boost vaccine approach can also improve the efficacy of existing vaccines. One example is the use of a DNA prime, which increased the level of antibody responses in animals that were subsequently boosted with an inactivated rabies vaccine (Biswas S, Reddy GS, Srinivasan VA, Rangarajan PN. Preexposure efficacy of a novel combination DNA and inactivated rabies virus vaccine. Hum Gene Ther. 2001;12:1917-1922). Similarly, DNA priming can increase the titer and longevity of hyperimmune sera in animals immunized with recombinant PA antigens against anthrax (Herrmann JE, Wang S, Zhang C, Panchal RG, Bavari S, Lyons CR, Lovchik JA, Golding B, Shiloach J, Lu S. Passive immunotherapy of Bacillus anthracis pulmonary infection in mice with antisera produced by DNA immunization. Vaccine. 2006;24:5872-5880). Mice primed with DNA and boosted with a licensed hepatitis B surface protein vaccine were able to generate stronger and more uniform antibody responses in the study group compared with the group receiving only the recombinant protein. Increased secretion of IL-12 and IFN-γ in splenocytes was also observed (Xiao-wen H, Shu-han S, Zhen-lin H, Jun L, Lei J, Feng-juan Z, Yan-nan Z, Ying-jun G. Augmented humoral and cellular immune responses of a hepatitis B DNA vaccine encoding HBsAg by protein boosting. Vaccine. 2005;23:1649-1656).

[0016] Finally, the prime-boost approach may have important practical applications in addressing vaccines with broad public health impacts. In naive animal models of influenza infection, a single heterologous DNA prime and a single inactivated influenza vaccine boost using either DNA or inactivated influenza vaccine alone have been shown to be more immunogenic than two homologous prime-boost doses (Wang S, Parker C, Taaffe J, Solorzano A, Garcia-Sastre A, Lu S. Heterologous HA DNA vaccine prime-inactivated influenza vaccine boost is more effective than using DNA or inactivated vaccine alone in eliciting antibody responses against H1 or H3 serotype influenza viruses. Vaccine. 2008;26:3626-3633). These results may be extremely useful in preparing for pandemic avian influenza. One of the key challenges facing influenza vaccine development is the limited manufacturing capacity and long production cycles required for conventional influenza vaccines. Typically, avian influenza vaccines require two immunizations. Target populations could first receive an avian influenza DNA vaccine prime long before any unexpected pandemic attack. This would significantly reduce the amount of vaccine needed in the event of a pandemic influenza outbreak. This approach could also be useful for other forms of influenza, including human and wild boar influenza viruses. Adding new vaccine strains to current trivalent influenza vaccines would require significant additional resources and time. A multivalent DNA prime could cover a wide range of potential future virus strains at a much lower cost.

[0017] Similar to other novel vaccine formats, heterologous prime-boost approaches are also being investigated as potential cancer treatments. Using the recently identified six-transmembrane epithelial antigen of the prostate (STEAP), a heterologous DNA prime and Venezuelan equine encephalitis virus-like replicon particle (VRP) boost were able to elicit superior immune responses against STEAP, including INF-gamma, TNF-alpha, and IL-12, compared with either vaccine modality alone. This vaccination regimen induced a small but significant delay in the growth of established 31-day-old tumors in mice (Garcia-Hernandez Mde L, Gray A, Hubby B, Kast WM. In vivo effects of vaccination with six-transmembrane epithelial antigen of the prostate: a candidate antigen for treating prostate cancer. Cancer Res. 2007;67:1344-1351).

[0018] A fundamental, yet still puzzling, question is why heterologous prime-boost is more effective than homologous prime-boost, even though the same vaccine components are used in each. One way to study this issue is to determine the importance of the order of administration of heterologous prime-boost vaccines. Using the Mycobacterium bovis model, it was demonstrated that the order of prime-boost vaccination of neonatal calves with BCG and a DNA vaccine encoding Hsp65, Hsp70, and Apa is not critical for enhancing protection against bovine tuberculosis (Skinner MA, Wedlock DN, de Lisle GW, Cooke MM, Tascon RE, Ferraz JC, Lowrie DB, Vordermeier HM, Hewinson RG, Buddle BM. The order of prime-boost vaccination of neonatal calves with Mycobacterium bovis BCG and a DNA vaccine encoding mycobacterial proteins Hsp65, Hsp70, and Apa is not critical for enhancing protection against bovine tuberculosis. Infect Immun. 2005;73:4441-4444).In another DNA prime-protein boost model using murine HSV-2 gD antigen, the importance of DNA priming was evident, as a reverse protein prime-DNA boost regimen produced antibody levels similar to those after allogeneic protein-protein vaccination but failed to further enhance Th cell proliferative responses or cytokine production (Sin JI, Bagarazzi M, Pachuk C, Weiner DB. DNA priming-protein boosting enhances both antigen-specific antibody and Th1-type cellular immune responses in a murine herpes simplex virus-2 gD vaccine model. DNA Cell Biol. 1999;18:771-779). Further analysis using hepatitis C E2 as a model antigen revealed that DNA prime-adenoviral vector boosting induced the highest levels of Th1 CD4+ T cell responses compared with reverse adenoviral prime-DNA boost or allogeneic prime-boost with the same vaccine.More interestingly, the DNA prime-adenovirus vector boost regimen induced CTL responses against three E2-specific epitopes, whereas none of the other three possible prime-boost combinations induced CTL responses against the three E2-specific epitopes, one of which was immunodominant (Park SH, Yang SH, Lee CG, Youn JW, Chang J, Sung YC. Efficient induction of T helper 1 CD4+ T-cell responses to hepatitis C virus core and E2 by a DNA prime-adenovirus boost. Vaccine. 2003;21:4555-4564. The order of prime-boost with DNA and adenovirus vector vaccines is important for the induction of cell-mediated immune responses against HCV E2 antigen).

[0019] In a large-scale nonhuman primate study presented by Dr. Shiu-lok Hu of the University of Washington (Seattle) at the 2008 AIDS Vaccine Conference (Cape Town, South Africa), a vaccinia virus vector or DNA prime followed by a protein boost generated greater antibody responses than boosting with DNA or various viral vector vaccines. These two heterologous prime-boost regimens (containing a protein boost component but without any of the other combinations) resulted in SHIV infection in approximately 40% of immunized animals. sf162.p4 was further able to induce neutralizing antibodies and bactericidal immunity against high-dose intrarectal challenge and protected animals from peripheral CD4+ T cell depletion.

[0020] Several studies have shown that DNA priming can improve the avidity of antibody responses elicited by protein-based vaccines (Richmond JF, Lu S, Santoro JC, Weng J, Hu SL, Montefiori DC, Robinson HL. Studies of the neutralizing activity and avidity of anti-human immunodeficiency virus type 1 Env antibodies elicited by DNA priming and protein boosting. J Virol. 1998;72:9092-9100; Wang S, Arthos J, Lawrence JM, Van Ryk D, Mboudjeka I, Shen S, Chou TH, Montefiori DC, Lu S. Enhanced immunogenicity of gp120 protein when combined with recombinant DNA priming to generate antibodies that neutralize the JR-FL primary isolate of human immunodeficiency virus type 1. J Virol. 2005;79:7933-7937). Because DNA vaccines generate antigens in vivo, priming with DNA vaccines can induce memory B cells specific for sensitive conformational domains of the antigen. In a rabbit study, delivery of primary HIV-1 gp120 antigen using a DNA prime-protein boost approach, but not a vaccine with recombinant gp120 protein alone, was able to induce conformation-dependent CD4 binding site antibodies.This is potentially important for HIV-1 neutralization. (Vaine M, Wang S, Crooks ET, Jiang P, Montefiori DC, Binley J, Lu S. Improved induction of antibodies against key neutralizing epitopes by human immunodeficiency virus type 1 gp120 DNA prime-protein boost vaccination compared to gp120 protein-only vaccination. J Virol. 2008;82:7369-7378. Including a DNA priming immunization was able to elicit conformation-sensitive antibody responses when compared to a protein-only HIV-1 Env vaccine.)

[0021] The immunogenicity of heterologous prime-boost can be further improved by including other factors that can further enhance or enhance vaccine efficacy. For example, the inclusion of plasmid cytokines and colony-stimulating factors can enhance the immunogenicity of DNA prime-viral vector boosting HIV-1 vaccines (Barouch DH, McKay PF, Sumida SM, Santra S, Jackson SS, Gorgone DA, Lifton MA, Chakrabarti BK, Xu L, Nabel GJ, et al. Plasmid chemokines and colony-stimulating factors enhance the immunogenicity of DNA priming-viral vector boosting human immunodeficiency virus type 1 vaccines. J Virol. 2003;77:8729-8735). The efficacy of DNA vaccine primes can be enhanced by using microparticle-based formulations followed by a protein boost (Otten GR, Schaefer M, Doe B, Liu H, Srivastava I, Megede J, Kazzaz J, Lian Y, Singh M, Ugozzoli M, et al. Enhanced potency of plasmid DNA microparticle human immunodeficiency virus vaccines in rhesus macaques by using a priming-boosting regimen with recombinant proteins. J Virol. 2005;79:8189-8200). However, it is unclear whether using different adjuvants in the booster phase of protein vaccines makes any difference.

[0022] Heterologous prime-boost vaccination, using both traditional and novel immunization approaches, offers exciting opportunities to elicit unique immune responses to enable improved immunogenicity and / or protection. Studies have shown that heterologous prime-boost can take a variety of forms, and that the order of prime-boost administration may be important, which may be antigen-dependent and influenced by the host species and type(s) of immune response to be achieved. Future research will be needed to further focus on the mechanisms behind heterologous prime-boost vaccination approaches and to resolve practical issues associated with two-component vaccines (e.g., vaccine cost and any currently unidentified safety issues).

[0023] There remains an unmet need for improved vaccines that induce immune responses against a variety of viruses and utilize heterologous prime-boost vaccination regimens. Summary of the Invention

[0024] In the present invention, it has been discovered that various prime-boost combinations of replication-incompetent vectors result in effective immune protection against infectious diseases, particularly EBV infection.

[0025] Accordingly, one general aspect of the present invention relates to a vaccine combination comprising: (a) a first composition comprising an immunologically effective amount of saRNA comprising a nucleic acid encoding an antigen protein and a pharmaceutically acceptable carrier; and (b) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier. (One of the compositions is a priming composition and the other composition is a boosting composition).

[0026] In a further aspect, the present invention relates to a kit comprising: (a) a first composition comprising an immunologically effective amount of saRNA comprising a nucleic acid encoding an antigen protein and a pharmaceutically acceptable carrier; and (b) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier. (One of the compositions is a priming composition and the other composition is a boosting composition).

[0027] In a further aspect, the present invention relates to a method of inducing an immune response to a virus in a subject, the method comprising administering to the subject: (a) a first composition comprising an immunologically effective amount of saRNA comprising a nucleic acid encoding an antigen protein and a pharmaceutically acceptable carrier; and (b) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier. (One of the compositions is a priming composition and the other composition is a boosting composition).

[0028] In certain embodiments, a first composition is used to prime an immune response and a second composition is used to enhance the immune response, or vice versa.

[0029] In certain embodiments, the present invention relates to recombinant modified vaccinia virus (MVA) and VRP vectors that comprise nucleotide sequences encoding two or more antigenic determinants of viruses that cause infectious diseases.

[0030] In a preferred embodiment, the antigenic protein is any of the structural and non-structural proteins of EBV, hi a preferred embodiment, the antigenic protein is selected from gp350, gH, gL, EBNA3A, and BRLF1 / BZLF1 fusion.

[0031] In another embodiment, the VRP is VEEV TC83 and the MVA is MVA-BN.

[0032] In yet another embodiment, the VRP vector in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0033] In yet another embodiment, the MVA vector in the second composition comprises a nucleic acid encoding an antigen protein selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:4.

[0034] In yet another aspect, the present invention relates to a vaccine combination comprising: (a) a first composition comprising an immunologically effective amount of saRNA comprising a nucleic acid encoding an antigen protein and a pharmaceutically acceptable carrier; and (b) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier. (One of the compositions is a priming composition and the other composition is a boosting composition). The vaccine combinations are used to generate a protective immune response against infectious diseases, with a first composition being used to prime the immune response and a second composition being used to enhance the immune response, or vice versa.

[0035] The boosting composition may include two or more doses of the vector of the boosting composition.

[0036] In a further aspect, the present invention relates to the use of a vaccine combination or kit comprising: (a) a first composition comprising an immunologically effective amount of a saRNA vector comprising a nucleic acid encoding an antigen protein and a pharmaceutically acceptable carrier; and (b) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier. (One of the compositions is a priming composition and the other composition is a boosting composition, and the use is for the manufacture of a pharmaceutical composition or medicament for the treatment and / or prevention of an infectious disease).

[0037] In another aspect, the present invention relates to a pharmaceutical composition comprising a vaccine combination comprising: (a) a first composition comprising an immunologically effective amount of a saRNA vector comprising a nucleic acid encoding an antigen protein and a pharmaceutically acceptable carrier; and (b) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier. (One of the compositions is a priming composition and the other composition is a boosting composition, as well as a pharmaceutically acceptable carrier, diluent, and / or excipient).

[0038] These and other objects of the present invention will be described in more detail in connection with the detailed description of the invention.

[0039] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and, together with the description, serve to explain the principles of the invention. [Brief explanation of the drawings]

[0040] [Figure 1] A shows the structure and genetic organization of MVA-mBN443. B shows the structure and genetic organization of VRP-BN011. UTR = 5' or 3' untranslated region of VEEV; nsp = coding region for nonstructural protein; SUBG PROM = VEEV subgenomic promoter; EBV gp350 multimer: EBV gp350 = Epstein-Barr virus glycoprotein gp350 amino acids 2-434 with a C-terminal fusion of the GCN4 multimerization domain; T2A = 2a peptide sequence; RKRR = furin cleavage site; P2A = 2a peptide sequence; gH = EBV glycoprotein H; gL = EBV glycoprotein L. [Figure 2]Gp350-specific IgG responses by group are shown. Animals (n=3) were dosed IM twice on days 1 and 29 with each prime-boost regimen, outlined in the figure legend by its respective color code and listed in Table 1. Blood was collected pre-dose (pre-dose) and on days 29 and 43. Sera were tested using multiplex ELISA. In this graph, the geometric mean and geometric standard deviation of gp350-specific IgG concentrations are shown as EU. [Figure 3] Neutralizing antibodies by group are shown. Animals (n=3) were dosed IM twice on days 1 and 29 with each prime-boost regimen, outlined in the figure legend by its respective color code and listed in Table 1. Blood was collected pre-dose (pre-dose) and on days 29 and 43, and sera were tested using a flow cytometry-based neutralization assay. Geometric means and geometric standard deviations are shown in the graph. [Figure 4] Figure 4 shows Gp350-specific T cell responses by group. Animals (n=3) were dosed IM twice on days 1 and 29 with each prime-boost regimen, outlined in the figure legend by its respective color code and listed in Table 1. Blood was collected pre-dose (pre-dose) and on days 8 and 36, and PBMCs were tested using ELISPOT analysis. The graph shows the mean and standard error of the mean (SEM) number of spot-forming units (SFU) per 1 x 10 PBMCs. [Figure 5]Figure 1 shows IFN-γ ELISPOT responses of splenocytes two weeks after boost. Mice were immunized intramuscularly (IM) with TNE (buffer control), MVA-EBV, or VRP-EBV on day 0 and boosted on day 21 with the same test substance, either homologous or heterologous. Two weeks after boost, splenocytes were isolated and restimulated in an ELISPOT assay with three gp350 peptides: EBV peptide #1 (MEAALLVCQYTIQSL); EBV gp350 peptide #25 (LGAGELALTMRSKKL); and EBV peptide #26 (ELALTMRSKKLPINV). IFN-γ-positive spots were counted. All counts were background-subtracted (medium control stimulation). Bars represent the mean ± SEM. [Figure 6] OVA-specific CD8 T cell responses in the blood 5 days after boost immunization are shown. Mice were immunized subcutaneously (SC) with TNE (buffer control), MVA-OVA, or VRP-OVA on day 0 and boosted with the same test substance, either homologous or heterologous, on day 21. Five days after the boost, blood was collected and OVA-specific CD8 T cells were measured by flow cytometry analysis using SIINFEKL dextramers. Bars represent the mean ± SEM. N=5 mice per group. [Figure 7] Figure 1 shows OVA-specific CD8 T cell responses in the spleen 4 weeks after booster immunization. Mice were subcutaneously (SC) immunized with TNE (buffer control), MVA-OVA, or VRP-OVA on day 0 and boosted with the same test substance, either homologous or heterologous, on day 21. Four weeks after booster immunization, splenocytes were isolated and restimulated with OVA257-264 peptide or OVA55-62 peptide for 6 hours. Cytokine-producing cells were detected by flow cytometry. Bars represent the mean ± SEM. N = 5 mice per group. [Figure 8]Figure 1 shows OVA-specific serum total IgG titers upon heterologous VRP / MVA immunization. Mice were immunized subcutaneously (SC) with TNE (buffer control), MVA-OVA, or VRP-OVA on day 0 and boosted with the same test substance, either homologous or heterologous, on day 21. Blood was collected and serum isolated on days 14 and 35. OVA-specific total IgG titers were measured by ELISA. Bars represent mean ± SEM. N=5 mice per group. [Figure 9] Figure 1 shows IFN-γ ELISPOT responses of splenocytes two weeks after boost. Mice were immunized intramuscularly (IM) with TNE (buffer control), MVA-EBV, or VRP-EBV on day 0 and boosted with the same test substance, either homologous or heterologous, on day 21. Two weeks after boost, splenocytes were isolated and restimulated in an ELISPOT assay with three gp350 peptides (EBV peptide #1 (MEAALLVCQYTIQSL); EBV gp350 peptide #25 (LGAGELALTMRSKKL); and EBV peptide #26 (ELALTMRSKKLPINV)). IFN-γ-positive spots were counted. All counts were background subtracted (medium control stimulation). Bars represent mean ± SEM.

[0041] A brief description of arrays SEQ ID NO: 1 shows the nucleic acid sequence (1455 nucleotides) of the gp350 multimer. SEQ ID NO: 2 shows the nucleic acid sequence of gH (2121 nucleotides). SEQ ID NO: 3 shows the nucleic acid sequence of gL (414 nucleotides). SEQ ID NO: 4 shows the nucleic acid sequence (2283 nucleotides) of the fusion gene made from the BZLF1-BRLF1 sequence. SEQ ID NO: 5 shows the nucleic acid sequence of EBNA3A (2892 nucleotides). SEQ ID NO: 6 shows the DNA sequence of one loxPV site. SEQ ID NO: 7 shows the nucleic acid sequence of the Pr13.5 long promoter. SEQ ID NO: 8 shows the nucleic acid sequence of the PrS promoter. SEQ ID NO: 9 shows the nucleic acid sequence of the PrH5m promoter. SEQ ID NO: 10 shows the nucleic acid sequence of the Pr1328 promoter. SEQ ID NO: 11 shows the nucleic acid sequence of the 2A peptide (T2A). SEQ ID NO: 12 shows the nucleic acid sequence of the 2A peptide (P2A). SEQ ID NO: 13 shows the nucleic acid sequence of the linker GCN4. DETAILED DESCRIPTION OF THE INVENTION

[0042] It was not predicted from what has been taught and achieved in the prior art that heterologous prime-boost regimens using saRNA (especially VRP) as the prime vaccination and MVA as the booster vaccination were highly immunogenic in terms of gp350-specific IgG and neutralizing antibodies, whereas homologous vaccination regimens using MVA or VRP, or administration of Ad as the booster vaccine, had the lowest immunogenic effect.

[0043] A heterologous prime-boost regimen will generate an immune response in non-human primates that confers protection against viral infections, particularly EBV. Of course, given the data and observations we have generated, it is quite reasonable and plausible to conclude that the vaccine regimen will induce immune responses in humans that are specific not only for EBV but also for other diseases caused by other disease-associated antigens, including infectious disease antigens or tumor-associated antigens. Indeed, the FDA recognizes non-human primate models as evidence that vaccines that provide protection in these non-human primates are similarly appropriate for humans.

[0044] Notably, the inventors also discovered that vaccination regimens including VRP as the prime vaccination resulted in higher gH / gL / gp42 complex and gH-specific IgG responses than did MVA as the prime vaccination. A single vaccination with MVA or VRP of NHPs with pre-existing immunity to gH / gL / gp42 or gH boosted only gH / gL / gp42 complex and gH-specific IgG responses, whereas a second administration provided no or only a minimal additional boosting effect.

[0045] Thus, the present invention provides vaccines or vaccine combinations that can be used to generate immune responses that confer protection against infectious disease or tumor-associated antigens (e.g., caused by EBV), as well as vaccines or vaccine combinations that can be used to manufacture vaccines against said antigens.

[0046] definition Before the present invention is described in detail below, it should be understood that the present invention is not limited to the particular methodology, protocols, and reagents described herein, as these may vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and does not limit the scope of the present invention, which will be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0047] It should be noted that, as used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "structural protein" includes one or more structural proteins, and reference to a "method" includes reference to equivalent steps and methods known to those skilled in the art that may modify or substitute for the methods described herein.

[0048] Unless otherwise indicated, the term "at least" preceding a series of elements should be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0049] The term "about" when used in connection with a numerical value is meant to encompass numerical values within a range having a lower limit of 5% less than the stated numerical value and an upper limit of 5% greater than the stated numerical value, unless the context clearly indicates otherwise.

[0050] As used herein, the conjunction "and / or" between multiple listed elements is understood to encompass both individual and combined options. For example, when two elements are connected by "and / or," the first option indicates that the first element is applicable without the second option. The second option indicates that the second element is applicable without the first option. The third option indicates that the first and second elements are applicable together. Any one of these options is understood to be within the meaning and thus meets the requirements of the term "and / or" as used herein. It is also understood that multiple options can be simultaneously applied and therefore meet the requirements of the term "and / or."

[0051] Throughout this specification and the claims that follow, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising" will be understood to mean the inclusion of a stated integer or step, or group of integers or steps, but not the exclusion of other integers or steps, or group of integers or steps. As used herein, the term "comprising" can be replaced by the terms "containing" or "comprising," or, where appropriate, by the term "having," as used herein. Any of the above terms (comprising, containing, including, having), whenever used herein in the context of an aspect or embodiment of the invention, may also, but is less preferred, replaced by the term "consisting of."

[0052] As used herein, "consisting of" excludes elements, steps, or ingredients not specified in the claim element. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0053] The term "antigen" includes all relevant epitopes of a particular compound, composition, or substance. The terms "epitope" or "antigenic determinant" refer to a site on an antigen to which B cells and / or T cells respond, alone or in combination with another protein (e.g., a major histocompatibility complex ("MHC") protein or a T cell receptor). Epitopes can be formed from contiguous amino acids or from noncontiguous amino acids juxtaposed by secondary and / or tertiary folding of a protein. Epitopes formed from contiguous amino acids typically are retained upon exposure to denaturing solvents, while epitopes formed by tertiary folding typically are lost upon treatment with denaturing solvents. Epitopes typically comprise at least 5, 6, 7, 8, 9, 10, or more amino acids (usually fewer than 20 amino acids) in a unique spatial conformation. Methods for determining the spatial conformation of epitopes include, for example, x-ray crystallography and two-dimensional nuclear magnetic resonance. See, for example, "Epitope Mapping Protocols" in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, Ed. (1996).

[0054] An antigen can be a tissue-specific (or tissue-associated) antigen or a disease-specific (or disease-associated) antigen. These terms are not mutually exclusive, as a tissue-specific antigen can also be a disease-specific antigen. A tissue-specific antigen is expressed in a limited number of tissues. An example of a tissue-specific antigen is prostate-specific antigen ("PSA"). A disease-specific antigen is expressed concurrently with the progression of a disease, and antigen expression correlates with or predicts the onset of a particular disease. An example of a disease-specific antigen is HER-2, which is associated with certain types of breast cancer, or PSA, which is associated with prostate cancer. A disease-specific antigen can be an antigen recognized by T cells or B cells.

[0055] Malignant growths arising from certain bodily tissues that have experienced a loss of characteristic structural differentiation are usually accompanied by increased cell division ability, invasion into surrounding tissues, and metastasis ability. Tumors can be benign or malignant. For example, prostate cancer is a malignant tumor that arises in or from prostate tissue, ovarian cancer is a malignant tumor that arises in or from ovarian tissue, colon cancer is a malignant tumor that arises in or from colon tissue, and lung cancer is a malignant tumor that arises in or from lung tissue. Residual cancer is cancer that remains in a subject after a treatment is administered to the subject to reduce or eradicate cancer. Metastatic cancer is cancer at one or more sites in the body other than the site of appearance of the original (primary) cancer from which the metastatic cancer originated.

[0056] A "conservative" variant is a variant protein or polypeptide having one or more amino acid substitutions that do not substantially affect or reduce the activity or antigenicity of the protein or its antigenic epitope. Generally, a conservative substitution replaces a particular amino acid with another amino acid having the same or similar chemical properties. For example, the substitution of a basic amino acid (e.g., lysine) with another basic amino acid (e.g., arginine or glutamine) is a conservative substitution. The term conservative variant also includes the use of a substituted amino acid in place of the unsubstituted parent amino acid, provided that antibodies generated against the substituted polypeptide are also immunoreactive with the unsubstituted polypeptide and / or the substituted polypeptide retains the function of the unsubstituted polypeptide. Non-conservative substitutions replace a particular amino acid with one having different chemical properties and typically result in a reduction in the activity or antigenicity of the protein or its antigenic epitope.

[0057] Specific non-limiting examples of conservative substitutions include the following: [Table 1]

[0058] A "disease-associated antigen" is expressed concurrently with a particular disease process, and antigen expression correlates with or predicts the onset of the disease. Disease-associated antigens include, for example, HER-2, which is associated with certain types of breast cancer, or prostate-specific antigen (PSA), which is associated with prostate cancer. Disease-associated antigens can be antigens recognized by T cells or B cells. Some disease-associated antigens may also be tissue-specific. Tissue-specific antigens are expressed in a limited number of tissues. Tissue-specific antigens include, for example, prostate-specific antigen (PSA).

[0059] The disease-associated antigen can be, for example, a tumor antigen, a viral antigen, a bacterial antigen, a fungal antigen, or a parasitic antigen.

[0060] The term "tumor antigen" refers to an antigen that is expressed only on, associated with, or overexpressed in tumor tissue. Examples of tumor antigens include, but are not limited to, 5-alpha-reductase, alpha-fetoprotein ("AFP"), AM-1, APC, April, B melanoma antigen gene ("BAGE"), beta-catenin, Bcl12, bcr-abl, Brachyury, CA-125, caspase-8 ("CASP-8," also known as "FLICE"), cathepsin, CD19, CD20, CD21 / complement receptor 2 ("CR2"), CD22 / BL-CAM, CD23 / F cεRII, CD33, CD35 / complement receptor 1 (“CR1”), CD44 / PGP-1, CD45 / leukocyte common antigen (“LCA”), CD46 / membrane cofactor protein (“MCP”), CD52 / CAMPATH-1, CD55 / decay-accelerating factor (“DAF”), CD59 / protectin, CDC27, CDK4, carcinoembryonic antigen (“CEA”), c-myc, cyclooxygenase-2 (“cox-2”), deleted in colorectal cancer (“DCC”), DcR3, E6 / E7, CGFR, EMBP, Dna78, farnesyltransferase Ze, fibroblast growth factor-8a (“FGF8a”), fibroblast growth factor-8b (“FGF8b”), FLK-1 / KDR, folate receptor, G250, G melanoma antigen gene family (“GAGE family”), gastrin 17, gastrin-releasing hormone, ganglioside 2 (“GD2”) / ganglioside 3 (“GD3”) / ganglioside monosialic acid-2 (“GM2”), gonadotropin-releasing hormone (“GnRH”), UDP-GlcNAc:R1Man(α1-6)R2[GlcNAc→Man(α1-6)]β1,6-N-acetylglucosaminyltransferase V (“GnT V”), GP1, gp100 / Pme117, gp-100-in4, gp15, gp75 / tyrosine-related protein-1 (“gp75 / TRP-1”), human chorionic gonadotropin (“hCG”), heparanase, Her2 / neu, human mammary tumor virus (“HMTV”), 70 kilodalton heat shock protein (“HSP70”), human telomerase reverse transcriptase (“hTERT”), insulin-like growth factor receptor-1 (“IGFR-1”), interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-8 (IL-6), interleukin-11 (IL-6), interleukin-12 (IL-6), interleukin-13 (IL-6), interleukin-14 (IL-6), interleukin-15 (IL-6), interleukin-16 (IL-6), interleukin-17 (IL-6), interleukin-18 (IL-6), interleukin-19 (IL-6), interleukin-20 (IL-6), interleukin-21 (IL-6), interleukin-22 (IL-6), interleukin-23 (IL-6), interleukin-24 (IL-6), interleukin-25 (IL-6), interleukin-31 (IL-6), interleukin-16 (IL-6), interleukin-18 (IL-6), interleukin-19 (IL-6), interleukin-19 (IL-6), interleukin-19 (IL-6), interleukin-16 (IL-6), interleukin-19 (IL-6), IL-13 receptor (“IL-13R”), inducible nitric oxide synthase (“iNOS”), Ki67, KIAA0205, K-ras, H-ras, N-ras, KSA, LKLR-FUT, melanoma antigen-encoding family (“MAGE family”, e.g., at least MAGE-1, MAGE-2, MAGE-3, and MAGE-4), mammaglobin, MAP17, melanin A / melanoma antigen 1 recognized by T cells (“MART-1”), mesothelin, MIC A / B, MT-MMP, mucin, testis-specific antigen NY-ESO-1, osteonectin, p15, P170 / MDR1, p53, p97 / melanotransferrin, PAI-1, platelet-derived growth factor ("PDGF"), μPA, PRAME, probasin, progenipoietin, prostate-specific antigen ("PSA"), prostate-specific membrane antigen ("PSMA"), prostatic acid phosphatase ("PAP"), RAGE-1, Rb, RCAS1, SART-1, SSX family, STAT3, STn, TAG-72, transforming growth factor alpha ("TGF-α"), transforming growth factor beta ("TGF-β"), thymosin beta 15, tumor necrosis factor alpha ("TNF-α"), TP1, TRP-2, tyrosinase, vascular endothelial growth factor ("VEGF"), ZAG, p16INK4, and glutathione S-transferase ("GST").

[0061] The term "viral antigen" refers to an antigen derived from any disease-associated pathogenic virus. Examples of disease-associated viral antigens include, but are not limited to, antigens derived from adenovirus, arbovirus, astrovirus, coronavirus, coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus ("CMV"), dengue virus, Ebola virus, Epstein-Barr virus ("EBV"), foot-and-mouth disease virus, Guanarito virus, Hendra virus, herpes simplex virus type 1 ("HSV-1"), herpes simplex virus type 2 ("HSV-2"), human herpesvirus type 6 ("HHV-6"), human herpesvirus type 8 ("HHV-8"), hepatitis A virus ("HAV"), hepatitis B virus ("HBV"), hepatitis C virus ("HCV"), hepatitis D virus ("HDV"), and hepatitis E virus. Hepatitis virus ("HEV"), human immunodeficiency virus ("HIV"), influenza virus, Japanese hepatitis virus ("JHV"), encephalitis virus, Junin virus, Lassa virus, Machupo virus, Marburg virus, measles virus, human metapneumovirus, molluscum contagiosum virus, mumps virus, Newcastle disease virus, Nipah virus, norovirus, Norwalk virus, human papillomavirus ("HPV"), parainfluenza virus, parvovirus, poliovirus, rabies virus, respiratory syncytial virus ("RSV"), rhinovirus, rotavirus, rubella virus, Sabia virus, severe acute respiratory syndrome virus ("SARS"), varicella-zoster virus, smallpox virus, West Nile virus, and yellow fever virus.

[0062] The term "bacterial antigen" refers to an antigen derived from any disease-associated pathogenic virus. Exemplary bacterial antigens include, but are not limited to, antigens derived from Bacillus anthracis, Bordetella pertussis, Borrelia burgdorferi, Brucella abortus, Brucella canis, Brucella melitensis, Brucella suis, Burkholderia mallei, Burkholderia pseudomallei, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydophila psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diptheriae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, enterotoxigenic Escherichia coli, enteropathogenic Escherichia coli, Escherichia coli) 157:H7, Francisella tularensis, Haemophilus influenza, Helicobacter pylori, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitides, Pseudomonas aeruginosa, Rickettsia rickettsia, Salmonella typhi, Salmonella typhimurium, Shigella sonnei, Staphylococcus aureus, Staphylococcusepidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, and Yersinia pestis.

[0063] The term "fungal antigen" refers to an antigen derived from any disease-associated pathogenic fungus. Exemplary fungal antigens include, but are not limited to, antigens derived from: Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Blastomyces dermatitidis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida parapsilosis, Candida rugosa, Candida tropicalis, Cryptococcus albidus, Cryptococcus gattii, Cryptococcus laurentii, Cryptococcus neoformans, Histoplasma capsulatum, Microsporum canis, Pneumocystis carinii, Pneumocystis jirovecii, Sporothrix schenckii, Stachbotrys chartarum, Tinea barbae, Tinea captitis, Tinea corporis, Tinea cruris, Tinea faciei, Tinea incognito, Tinea nigra, Tinea versicolor, Trichophyton rubrum, and Trichophyton tonsurans.

[0064] The term "parasite antigen" refers to an antigen derived from any disease-related pathogenic parasite. Exemplary parasite antigens include, but are not limited to, antigens derived from Anisakis spp., Babesia spp., Baylisascaris procyonis, Cryptosporidium spp., Cyclospora cayetanensis, Diphyllobothrium spp., Dracunculus medinensis, Entamoeba histolytica, Giardia duodenalis, Giardia intestinalis, Giardia lamblia, Leishmania sp., Plasmodium falciparum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Taenia spp., Toxoplasma gondii, Trichinella spiralis, and Trypanosoma cruzi.

[0065] "Epstein-Barr virus," "EBV," "human herpesvirus 4," and "HHV-4" refer to an oncogenic human herpesvirus. EBV is the cause of acute infectious mononucleosis (AIM, also known as glandular fever). It is also associated with certain forms of cancer, including Hodgkin's lymphoma, Burkitt's lymphoma, nasopharyngeal carcinoma, and human immunodeficiency virus (HIV)-related diseases (e.g., hairy leukoplakia and central nervous system lymphoma). EBV infects B cells and epithelial cells of the immune system. Once the initial lytic infection of the virus is controlled, EBV persists latent within an individual's B cells for the remainder of their life through a complex life cycle that includes alternating latent and lytic phases.

[0066] "Symptoms of EBV infection" include the presence of acute infectious mononucleosis (AIM, also known as glandular fever) and / or EBV-associated cancer. "EBV-associated cancer" refers to cancer caused, at least in part, and / or exacerbated by EBV infection (e.g., Hodgkin's lymphoma, Burkitt's lymphoma, nasopharyngeal carcinoma, cervical cancer, hairy leukoplakia, and central nervous system lymphoma).

[0067] The terms "antigen," "immunogen," "antigenic," "immunogenic," "antigenic activity," and "immunologically active," when referred to a molecule, refer to any substance capable of inducing a specific humoral and / or cellular immune response. In certain embodiments, an antigen comprises at least a portion or an extracellular domain.

[0068] "EBV antigen" refers to antigens derived from EBV (eg, gB, gH, gL, and gp350 / 220) and tumor-associated EBV antigens.

[0069] The term "EBV envelope glycoprotein" includes gp350, gB, gp42, gH, gL, gM, gN, BMRF2, BDLF2, BDLF3, BILF1, BILF2, and BARF1. The term "T cell antigen" refers to EBNA1, EBNA2, EBNA3a, EBNA3b, EBNA3c, EBNA leader protein, and LMP2.

[0070] The term "gp350 / 220" refers to the major EBV envelope protein. Interaction of EBV gp350 / 220 with complement receptor type 2 (CR2) CD21 and / or (CR1) CD35 on B cells is required for cell adhesion and initiation of latent infection (SEQ ID NO: 1).

[0071] The term "gH" refers to the glycoprotein gp85 precursor of human herpesvirus 4, exemplified by SEQ ID NO: 2, NCBI Reference Sequence: YP_401700.1.

[0072] The terms "gL" and "BKRF2" are used interchangeably and are exemplified in SEQ ID NO: 3, NCBI Reference Sequence: YP_001129472.1.

[0073] The term "BZLF1-BRLF1 fusion" refers to a transcriptional activator of EBV early genes and is exemplified by SEQ ID NO:4.

[0074] "EBNA-3A" is exemplified by SEQ ID NO: 5, NCBI Reference Sequence: YP_401677.1.

[0075] A "tumor-associated EBV antigen" is an EBV antigen that is associated with a tumor in a subject infected with EBV. Examples of tumor-associated EBV antigens include EBNA1, LMP1, LMP2, and BARF1, as described below: Lin et al., "CD4 and CD8 T cell responses to tumor-associated Epstein-Barr virus antigens in nasopharyngeal carcinoma patients." Cancer Immunol Immunother. 2008 July;57(7):963-75; Kohrt et al., "Dynamic CD8 T cell responses to tumor-associated Epstein-Barr virus antigens in patients with Epstein-Barr virus-negative Hodgkin's disease," Oncol Res. 2009;18(5-6):287-92; Parmita et al., "Humoral immune responses to Epstein-Barr virus-encoded tumor-associated proteins and their putative extracellular domains in nasopharyngeal carcinoma patients and regional controls," J Med Virol. 2011 April;83(4):665-78).

[0076] "Adjuvant" refers to a vehicle for enhancing antigenicity. Adjuvants can include: (1) mineral (alum, aluminum hydroxide, and / or phosphoric acid) suspensions to which antigens are adsorbed; (2) water-in-oil emulsions in which antigen solutions are emulsified in mineral oil (Freund's incomplete adjuvant), optionally including killed mycobacteria (Freund's complete adjuvant) to further enhance antigenicity by suppressing antigen degradation and / or inducing macrophage influx; (3) immunostimulatory substances (e.g., but not limited to, oligonucleotides, e.g., those containing CpG motifs) can also be used as adjuvants (see, e.g., U.S. Pat. Nos. 6,194,388 and 6,207,646); and (4) purified or recombinant proteins, such as costimulatory molecules (e.g., B7-1, ICAM-1, LFA-3, and GM-CSF).

[0077] As used herein, "affecting an immune response" includes the generation in a subject of a humoral and / or cellular immune response to proteins and / or polypeptides produced by the recombinant MVA or VRP of the present invention and / or compositions and / or vaccines comprising the recombinant MVA and VRP. A "humoral" immune response, as this term is known in the art, refers to an immune response that includes antibodies, while a "cellular" immune response, as this term is known in the art, refers to an immune response that includes T lymphocytes and other white blood cells, particularly an immunogen-specific response by HLA-restricted cytolytic T cells (i.e., "CTLs"). A cellular immune response occurs when a processed immunogen (i.e., peptide fragment) is presented in the context of a major histocompatibility complex.

[0078] As used herein, the term "alphavirus" has its conventional meaning in the art and includes the various species of Venezuelan equine encephalitis virus (VEEV), Western equine encephalitis virus (WEEV), and Eastern equine encephalitis virus (EEEV). As used herein, "equine encephalitis virus (EEV)" includes VEEV, WEEV, and EEEV, as well as strains and isolates thereof.

[0079] As used herein, the terms "expressed," "expressing," "expression," and the like, which can be used interchangeably, refer to transcription alone and both transcription and translation of a sequence of interest. Thus, when referring to the expression of a nucleotide sequence present in the form of DNA, the product resulting from this expression can be either RNA (resulting solely from transcription of the sequence to be expressed) or a polypeptide sequence (resulting from both transcription and translation of the sequence to be expressed). Thus, the term "expression" also includes the possibility that both RNA and polypeptide products result from the expression and remain together in the same shared environment. For example, this is the case when mRNA persists after being translated into a polypeptide product.

[0080] As used herein, an "expression cassette" is defined as a portion of a vector or recombinant virus typically used for cloning and / or transformation. An expression cassette typically consists of a) one or more coding sequences (e.g., an open reading frame (ORF), a nucleic acid encoding a gene, protein, and / or antigen), and b) a sequence (e.g., a promoter) that controls the expression of the one or more coding sequences. Additionally, an expression cassette may include a 3' untranslated region (e.g., a transcription terminator, e.g., a vaccinia transcription terminator). The term "expression cassette" can be used interchangeably with the term "transcription unit."

[0081] A "formulation" refers to a composition containing an active pharmaceutical or biological ingredient (e.g., a recombinant MVA of the present invention) together with one or more additional ingredients. The term "formulation" is used interchangeably with the terms "pharmaceutical composition," "vaccine composition," and "vaccine formulation" herein. Formulations can be liquid or solid (e.g., lyophilized).

[0082] The term "gene" is used broadly to refer to any segment of a polynucleotide associated with a biological function. Thus, a gene may include introns and exons, such as in a genomic sequence, or only a coding sequence, such as a cDNA or viral RNA, and / or regulatory sequences required for expression. For example, a gene may also refer to a nucleic acid fragment that expresses mRNA or functional RNA or encodes a specific protein, including regulatory sequences.

[0083] As used herein, a "heterologous" gene, nucleic acid, antigen, or protein is understood to be a nucleic acid or amino acid sequence that is not present in the wild-type poxvirus genome (e.g., MVA or MVA-BN). Those skilled in the art will understand that a "heterologous gene," when present in a poxvirus (e.g., MVA or MVA-BN), is integrated into the poxvirus genome so as to be expressed as the corresponding heterologous gene product (i.e., as a "heterologous antigen" and / or "heterologous protein") after administration of the recombinant poxvirus into a host cell. Expression is usually achieved by operably linking the heterologous gene to regulatory elements that allow expression in poxvirus-infected cells. Preferably, the regulatory elements include a natural or synthetic poxvirus promoter.

[0084] The term "immunogenic composition" or "immunological composition" encompasses compositions that elicit an immune response against an antigen of interest expressed from an MVA. The term "vaccine or vaccine composition" encompasses any composition that induces a protective immune response against an antigen of interest or that effectively protects against an antigen of interest, e.g., after administration or injection into an animal or human, elicits a protective immune response against the antigen or provides effective protection against the antigen expressed from an MVA vector. Compositions can be administered alone or sequentially with other compositions or therapeutic compositions, thereby providing combined compositions, cocktails, or multivalent mixtures of two or more, preferably three, four, five, or six, compositions.

[0085] The terms "nucleic acid," "nucleotide sequence," "nucleic acid sequence," and "polynucleotide" can be used interchangeably and refer to RNA or DNA that is linear or branched, single-stranded, double-stranded, or a hybrid thereof. The term also encompasses RNA / DNA hybrids. The following are non-limiting examples of polynucleotides: genes or gene fragments, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may contain modified nucleotides (e.g., methylated nucleotides and nucleotide analogs), uracil, other sugars, and linking groups (e.g., fluororibose and thiolate), and nucleotide branches. The sequence of nucleotides can be further modified after polymerization (e.g., by conjugation with a labeling component). Other types of modifications included in this definition are capping, substitution of one or more analogs of natural nucleotides, and introduction of a means for attaching a polynucleotide to a protein, metal ion, labeling component, other polynucleotides, or solid support. The polynucleotides may be obtained by chemical synthesis or may be derived from a microorganism.

[0086] The term "open reading frame" (ORF) refers to a sequence of nucleotides that can be translated into amino acids. Typically, such an ORF contains a start codon, followed by a region that is usually a multiple of three nucleotides in length but does not contain a stop codon (TAG, TAA, TGA, UAG, UAA, or UGA) in a given reading frame. Typically, ORFs are naturally occurring or artificially constructed (i.e., by genetic engineering). ORFs encode proteins in which translatable amino acids form a peptide-linked chain. As used herein, the term "essential ORF" refers to an ORF that, when partially or completely deleted experimentally, reduces MVA virus replication, proliferation, or both replication and growth (e.g., at least 15-fold in the mutant compared to MVA without the deletion) in MVA virus. Methods for determining MVA virus replication and growth are well known to those skilled in the art. For example, methods are described in Vaccinia Virus and Poxvirology, Methods and Protocols, Volume 269 Ed. by Stuart N. Isaacs (Humana Press (2004), see, e.g., Chapter 8, Growing Poxviruses and Determining Virus Titer, Kotwal and Abrahams). Viral growth rates of MVA can be determined, for example, using CEF cells or the methods described in Hornemann et al. (2003), Journal of Virology 77:8394-8407, or by GFP fluorescence, as described, for example, in Orubu et al. (2012) PLOS One 7:e40167.

[0087] As used herein, "operably linked" means that the components described are in a relationship that allows them to function in their intended manner (e.g., a promoter for transcribing a nucleic acid to be expressed). A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence when it is positioned so that it can direct transcription of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.

[0088] "Percent (%) sequence homology or identity" with respect to the nucleic acid sequences described herein is defined as the percentage of nucleotides in a candidate sequence that are identical to the nucleotides in the reference sequence (i.e., the nucleic acid sequence from which it is derived), after aligning the sequences and, if necessary, introducing gaps to achieve the maximum percent sequence identity, and any conservative substitutions are not taken into account as part of the sequence identity. Alignment to determine the percentage of identity or homology of nucleotide sequences can be achieved in various ways within the art, for example, using publicly available computer software (e.g., BLAST, ALIGN, or Megalign (DNASTAR) software). Those skilled in the art can determine the appropriate parameters for measuring alignment. This includes any algorithms required to achieve maximum alignment across the entire length of the sequences being compared.

[0089] For example, suitable alignment of nucleic acid sequences is provided by the following local homology algorithm: Smith and Waterman, (1981), Advances in Applied Mathematics 2:482-489. This algorithm can be applied to amino acid sequences by using a scoring matrix developed by: Dayhoff, Atlas of Protein Sequences and Structure, MO Dayhoff ed., 5 suppl. 3:353-358, National Biomedical Research Foundation, Washington, DC, USA, and normalized by Gribskov (1986), Nucl. Acids Res. 14(6):6745-6763. An exemplary implementation of this algorithm for determining percent identity of sequences is provided by the Genetics Computer Group (Madison, Wisconsin) in the "BestFit" utility application. Default parameters for this method are described in the Wisconsin Sequence Analysis Package Programs Manual, Version 8 (1995), available from the Genetics Computer Group, Madison, Wis. In the context of the present invention, a preferred method for determining percent identity is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc., Mountain View, Calif. From this suite of packages, the Smith-Waterman algorithm can be used, using default parameters for the scoring table (e.g., gap open penalty: 12, gap extension penalty: 1, gap: 6). From the data generated, the "match" value reflects "sequence identity." The same applies, mutatis mutandis, to "percent (%) amino acid identity."Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art; for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used with the following default parameters: genetic code = standard; filter = none; strand = both; cutoff = 60; expectation = 10; matrix = BLOSUM62; description = 50 sequences; sort = HIGH SCORE; database = non-redundant; GenBank + EMBL + DDBJ + PDB + GenBank CDS translation + Swiss protein + Spupdate + PIR. Details of these programs can be found at the following internet address: http: / / http: / / blast.ncbi.nlm.nih.gov / .

[0090] The terms "pharmaceutical product," "pharmaceutical composition," and "medicament" are used interchangeably herein and refer to a substance and / or combination of substances used for the prevention or treatment of disease.

[0091] By "pharmaceutically acceptable" it is meant that the carrier or excipient, at the dosages and concentrations employed, does not cause undesirable or adverse effect(s) in the subject(s) to which it is administered.

[0092] "Pharmaceutically acceptable carriers" are described, for example, in Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975); Remington's Pharmaceutical Sciences, 18th Edition, A. R. Gennaro, Ed., Mack Publishing Company (1990); Pharmaceutical Formulation Development of Peptides and Proteins, S. Frokjaer and L. Hovgaard, Eds., Taylor & Francis

[2000] ; and Handbook of Pharmaceutical Excipients, 3rd Edition, A. Kibbe, Ed., Pharmaceutical Press (2000). These describe compositions and formulations using conventional pharmaceutically acceptable carriers suitable for administering the vectors and compositions disclosed herein. Generally, the nature of the carrier used will depend on the particular mode of administration being employed. For example, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids (e.g., water, physiological saline, balanced salt solution, aqueous dextrose, glycerol, or the like) as a vehicle. For solid compositions (e.g., powders, pills, tablets, or capsules), conventional non-toxic solid carriers include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. Pharmaceutical compositions may also contain minor amounts of non-toxic auxiliary substances (e.g., wetting or emulsifying agents, preservatives, pH buffering agents, and the like, for example, sodium acetate or sorbitan monolaurate).

[0093] As used herein, "preventing," "preventing," "preventing," or "prevention" of a disease or infection means preventing such disease from occurring in a subject (e.g., a human or animal).

[0094] The term "prime-boost vaccination" refers to a vaccination strategy that uses an initial priming injection of a vaccine targeting a specific antigen, followed by one or more boost injections of the same vaccine at intervals. Prime-boost vaccination can be homologous or heterologous. Homologous prime-boost vaccination uses a vaccine containing the same immunogen and vector for both the priming injection and one or more boost injections. Heterologous prime-boost vaccination uses a vaccine containing the same immunogen for both the priming injection and one or more boost injections, but uses different vectors for the priming injection and one or more boosting injections. For example, homologous prime-boost vaccination can use a recombinant MVA vector containing the same nucleic acid expressing an alphavirus antigen for both the priming injection and one or more boosting injections. In contrast, heterologous prime-boost vaccination may use a recombinant MVA vector containing a nucleic acid expressing one alphavirus protein for the priming injection and another recombinant MVA vector expressing a second alphavirus protein not contained in the priming injection, or vice versa. Heterologous prime-boost vaccination also encompasses various combinations (e.g., the use of a plasmid encoding an immunogen in the priming injection and a recombinant MVA encoding the same immunogen in one or more boosting injections, or the use of a recombinant protein immunogen in the priming injection and a recombinant MVA vector encoding the same protein immunogen in one or more boosting injections).

[0095] As used herein, the term "promoter" refers to a regulatory region of nucleic acid (usually DNA) located upstream of a nucleic acid sequence to be expressed. This region contains specific DNA sequence elements that are recognized and bound by protein transcription factors and polymerases responsible for synthesizing RNA from the coding region of the promoted gene, for example. Because promoters are usually located immediately adjacent to the gene in question, a position within the promoter is designated relative to the transcription initiation site where transcription of DNA begins for a particular gene (i.e., an upstream position is a negative number counted backward from -1; e.g., -100 is a position 100 base pairs upstream). Thus, a promoter sequence may include nucleotides up to position -1. However, it should be noted that nucleotides from position +1 are not part of the promoter; i.e., the translation initiation codon (ATG or AUG) is not part of the promoter in this regard. Thus, SEQ ID NO: 7 or 8 is a polynucleotide comprising a promoter of the present invention. As used herein, a "native poxvirus promoter" refers to an endogenous promoter of the poxvirus genome. "Synthetic poxvirus promoter" refers to a recombinantly engineered promoter active to direct transcription of a nucleic acid to be expressed by a poxvirus (e.g., MVA in CEF cells). The term "26S promoter" is well known to those skilled in the art and refers to the subgenomic promoter of the 26S RNA of alphaviruses, which is usually contained in a single open reading frame (e.g., capsid E3-E2-6K-E1 of VEEV). mRNAs encoding structural proteins of EEV (e.g., VEEV) are usually transcribed from the replication intermediate and 26S subgenomic RNA promoter.

[0096] The terms "protein," "peptide," "polypeptide," and "polypeptide fragment" are used interchangeably herein to refer to polymers of amino acid residues of any length. A polymer can be linear or branched, it may comprise modified amino acids or amino acid analogs, and it may be interrupted by chemical moieties other than amino acids. The terms also encompass amino acid polymers that are modified naturally or by intervention (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as a label or conjugation with a biologically active moiety).

[0097] The term "recombinant" as applied to nucleic acids, vectors (e.g., MVA), and the like, refers to a nucleic acid, vector, or product created by or containing an artificial combination of two or more heterologous nucleic acid sequence segments. Artificial combination is most commonly achieved by the artificial manipulation of isolated segments of nucleic acid using established genetic engineering techniques. Generally, "recombinant" MVA as used herein refers to MVA produced by standard genetic engineering methods; i.e., the MVA of the present invention is a genetically engineered or genetically modified MVA. Thus, the term "recombinant MVA" includes MVA (e.g., MVA-BN) that has a recombinant nucleic acid stably integrated into its genome, preferably in the form of a transcription unit. The transcription unit may include a promoter, enhancer, terminator, and / or silencer. The recombinant MVA of the present invention can express a heterologous antigenic determinant, polypeptide, or protein (antigen) upon induction of regulatory elements.

[0098] As used herein, the term "protective immunity" or "protective immune response" means that a vaccinated subject is able to control infection with the pathogen against which the vaccine is administered. Typically, a subject who develops a "protective immune response" will develop only mild to moderate clinical symptoms, or no clinical symptoms at all. If the infection is expected to be fatal without treatment, a subject who has a "protective immune response" or "protective immunity" against a particular infectious agent will not die as a result of infection with the infectious agent.

[0099] The term "reference sample" as used herein refers to a sample that is analyzed in substantially the same manner as the sample of interest, and its information is compared with the information of the sample of interest.Therefore, the reference sample provides a standard for evaluating the information obtained from the sample of interest.The reference sample can be identical to the sample of interest, except for one component that can be replaced, missing, or added.

[0100] The term "structural protein" of EEV refers to the structural protein / polyprotein encoded by the RNA of EEV (e.g., any of WEEV, VEEV, or EEEV described herein). Structural proteins are typically produced by the virus as a structural polyprotein of five proteins (i.e., C, E3, E2, 6k, and E1), commonly represented in the literature as C-E3-E2-6k-E1. E3 and 6k are also described as membrane translocation / transport signals for two glycoproteins (E2 and E1). As used herein, a nucleotide sequence encoding a "structural protein" refers to a nucleotide sequence encoding proteins required for encapsidation (e.g., packaging) of the viral genome, including the capsid protein, E1 glycoprotein, and E2 glycoprotein. The "structural polyprotein" of EEV refers to the EEV polyprotein C-E3-E2-6k-E1.

[0101] As used herein, the term "transcription level" or "protein level" with respect to a particular promoter refers to the amount of a gene / nucleic acid product present in a body or sample at a given time. Transcription or protein level (e.g., transcription of a nucleic acid as mRNA or the amount of protein translated from mRNA) can be determined, measured, or quantified by the mRNA or protein expressed from a gene / polynucleotide, for example, encoded by a recombinant MVA of the present invention. Gene expression can result in the production of a protein by transcription of the gene by RNA polymerase to produce messenger RNA (mRNA) containing the same protein-coding information, and translation of the mRNA by ribosomes to produce the protein. The term "transcribed" or "transcription" refers to the process of copying the DNA sequence of a gene into mRNA by RNA polymerase using DNA as a template. The term "translated" or "translation" refers to the process in which the information contained in mRNA is used as a blueprint to synthesize a protein. Transcription or protein levels can be quantified, for example, by normalizing the amount of mRNA or protein of interest present in a sample with the total amount of gene products (mRNA or total protein) of the same category in the same sample or a reference sample (e.g., collected at the same time from the same sample). Transcription can be measured or detected by any method known in the art (e.g., methods for direct detection and measurement of the gene product of interest, which typically act through binding of the gene product of interest to one or more distinct molecules) or by detection means specific for the gene product of interest (e.g., primer(s), probe, antibody, protein scaffold). Such methods include, for example, RT-PCR and / or quantitative PCR. Protein levels can be measured or detected by any known method known to those skilled in the art (e.g., Western blot, ELISA, or mass spectrometry).

[0102] As used herein, a "transcription terminator" consists of a DNA sequence involved in the specific termination of an RNA transcript by an RNA polymerase. Vaccinia viruses containing the MVA RNA polymerase terminate transcription downstream of an RNA signal (at the DNA level, UUUUUNU, TTTTTNT, or T5NT) in the nascent RNA (Earl et al. (1990), J. Virol. 64:2448-2451). A "transcription terminator" is sometimes referred to in the literature as a "termination signal," and therefore can be used interchangeably.

[0103] As used herein, "treat," "treating," or "treatment" of a disease refers to preventing, reducing, ameliorating, partially or completely alleviating, or curing a disease (e.g., a disease caused by EEV), which may be one or more of reducing the severity of the disease, limiting or preventing the onset of symptoms characteristic of the disease being treated, inhibiting the worsening of symptoms characteristic of the disease being treated, limiting or preventing the recurrence of the disease in a subject previously affected by the disease, and limiting or preventing the recurrence of symptoms in a subject.

[0104] As used herein, "trivalent" in connection with a vaccine or recombinant MVA means that the vaccine or recombinant MVA is valenced against three different viruses and generates a protective immune response against antigens (e.g., structural proteins or structural polyproteins) of those different viruses. Thus, in the context of the trivalent MVA vaccine of the present invention, trivalent refers to a valence against three different viruses, where the antigens are encoded in the MVA vaccine or vaccine comprising a recombinant MVA expressing nucleic acids encoding the antigens (e.g., structural proteins or structural polyproteins of VEEV, WEEV, and EEEV). Another example of trivalency that is also included in the meaning of trivalent is where the three different viruses are different viral strains (e.g., two WEEV strains, e.g., 71V-1658 and Fleming, in addition to two VEEV or EEEV strains). In the latter case, the recombinant MVA of the present invention contains nucleotide sequences encoding proteins (e.g., structural proteins, structural polyproteins, envelope proteins) of, for example, WEEV 71V-1658, WEEV Fleming, and EEEV strains (e.g., EEEV V105-00210). By comparison, "monovalent" means that the vaccine or recombinant MVA has a valency against only one virus of a particular species (e.g., only VEEV, only WEEV, or only EEEV) and generates a protective immune response against only one structural protein or structural polyprotein of a virus. However, it does not exclude the generation of a protective immune response against several closely related viral subtypes. Thus, "bivalent" means that the vaccine or recombinant MVA has a valency against two viruses.

[0105] "Vector" refers to a recombinant DNA or RNA plasmid or virus containing a heterologous polynucleotide to be delivered to a target cell, either in vitro or in vivo. The heterologous polynucleotide may contain a sequence of interest for prophylactic or therapeutic purposes and may optionally be in the form of an expression cassette. As used herein, a vector need not be capable of replicating in the ultimate target cell or subject. The term includes cloning vectors and viral vectors.

[0106] The term "viral replicon" as used in the context of the present invention refers to an RNA or DNA comprising a portion of the 49S viral genomic RNA that is essential for transcription and cytoplasmic amplification of the transported RNA and for subgenomic RNA expression of a heterologous nucleic acid sequence. Thus, the replicon encodes and expresses viral nonstructural proteins necessary for cytoplasmic amplification of the viral RNA.

[0107] In the context of the present invention, the term "virus" or "recombinant virus" refers to an infectious or non-infectious virus comprising a viral genome. In this case, the nucleic acids, promoters, recombinant proteins, and / or expression cassettes referred to herein are part of the viral genome of the respective recombinant virus. The recombinant viral genome is packaged, and the resulting recombinant virus can be used to infect cells and cell lines, and in particular to infect live animals, including humans.

[0108] "TCID 50 The term "TCID" is an abbreviation for "tissue culture infectious dose," and the amount of a pathogen that produces pathological changes in 50% of inoculated cell cultures is called the TCID. 50 Expressed in TCID / ml. 50 Methods for determining this are well known to those skilled in the art and are described, for example, in Example 2 of WO03 / 053463.

[0109] As used herein, the term "subject" refers to a living multi-cellular vertebrate organism (e.g., a human, a non-human mammal, or a (non-human) primate). As used herein, the term "subject" may be used interchangeably with the term "animal."

[0110] Self-amplifying RNA Currently, there are two different types of synthetic RNA vaccines: conventional mRNA and self-amplifying RNA (saRNA). The use of conventional mRNA strategies (also called non-replicating or non-amplifying mRNA) against infectious diseases and cancer has been investigated in several preclinical and clinical trials. In vitro-transcribed mRNAs encoding viral antigens have been investigated as vaccines, while those encoding therapeutic proteins (e.g., antibodies or immunomodulatory drugs) are considered immunotherapies. Incorporation of chemically modified nucleotides, sequence optimization, and various purification strategies improve mRNA translation efficiency and reduce inherent immunogenic properties. However, antigen expression is proportional to the number of conventional mRNA transcripts efficiently delivered during vaccination. Therefore, achieving adequate expression for protection or immunomodulation may require large doses or repeated administrations. saRNA vaccines, which are genetically engineered replicons derived from self-replicating single-stranded RNA viruses, address this limitation. They can be delivered as viral replicon particles (VRPs), in which the saRNA is packaged into viral particles, or as fully synthetic saRNA generated after in vitro transcription. To generate replication-defective VRPs, envelope proteins are provided in trans as defective helper constructs during production. Therefore, the resulting VRPs lack the ability to form infectious viral particles after initial infection, and only RNA is capable of further amplification. VRPs can be derived from both positive-strand and negative-strand RNA viruses, but the latter are more complex and require reverse genetics to rescue the VRPs. Similar to gene therapy, there are several issues associated with the use of viral vectors for vaccine development. These include the immunogenicity of the vector itself, which can elicit unwanted immune responses and prevent subsequent booster doses using the same vector. Pre-existing immunity to the viral vector can also render the vaccine ineffective. Like live-attenuated vaccines, replication-competent alphavirus vectors pose the threat of viral reactivation. To circumvent this, saRNA vaccines can be produced and administered in a similar manner to conventional mRNA vaccines.Positive-strand alphavirus genomes commonly used in saRNA vaccine design include Venezuelan equine encephalitis virus (VEE), Sindbis virus (SINV), and Semliki Forest virus (SFV). Alphavirus replicase genes encode RNA-dependent RNA polymerase (RdRP) complexes that amplify synthetic transcripts in situ. Antigen or therapeutic sequences are expressed at high levels as separate, distinct entities, eliminating the need for further proteolytic processing of the immunogen. As a result of their self-replicating activity, saRNA can be delivered at lower concentrations than conventional mRNA vaccines to achieve comparable antigen expression.

[0111] As mentioned above, saRNA constructs have historically been derived from alphaviruses (e.g., Venezuelan equine encephalitis virus (VEEV), Semliki Forest virus (SFV), or Sindbis virus). These saRNA constructs contain four nonstructural proteins, a subgenomic promoter, and a gene of interest (which replaces the viral structural proteins). By deleting the viral structural proteins, the RNA cannot generate infectious virus. After delivery to the cytoplasm, the nonstructural proteins form an RNA-dependent RNA polymerase (RDRP), which replicates both the genomic RNA (the entire RNA strand) and the subgenomic RNA (the gene of interest). Each of the four nonstructural proteins participates in the formation of the RDRP, a complex, multistep process. This RNA replication results in higher antigen expression than non-replicating mRNA.

[0112] EEV virus, protein, and nucleotide sequences EEV is an alphavirus belonging to the Togaviridae family. It is a small, enveloped, positive-strand RNA virus well known in the art. The viral nucleocapsid is surrounded by a host-derived lipid membrane in which a trimer of E1 and E2 heterodimeric envelope proteins is embedded. The nucleocapsid consists of a capsid protein (C) surrounding a single-stranded RNA genome. The EEV viral RNA genome (49S RNA) is approximately 11-12 kb in length, contains a 5' cap and a 3' polyadenylated tail, and is translated immediately upon entry into the cell. The 5' region of the genome encodes four nonstructural proteins (NSP1, NSP2, NSP3, and NSP4). The 3' region of the genome encodes five structural proteins (C, E3, E2, 6k, and E1) that are expressed as a structural polyprotein from the 26S subgenomic RNA. mRNAs encoding the structural proteins are transcribed from replication intermediates and the 26S subgenomic promoter. Proteolytic cleavage of the polyprotein generates the mature structural proteins C, E3, E2, 6k, and E1. The nucleocapsid (C) protein has autoproteolytic activity, which cleaves the C protein from the precursor protein immediately after the ribosome passes through the junction between the C and E3 protein-coding sequences. Subsequently, the envelope glycoproteins E2 and E1 are derived by proteolytic cleavage to form a heterodimer. E2 initially appears in infected cells as a precursor pE2 consisting of E3 and E2. After glycosylation and passage through the endoplasmic reticulum and Golgi apparatus, E3 is cleaved from E2 by a furin-like protease activity at the cleavage site.

[0113] A live attenuated vaccine is used by the US military and laboratory personnel, and a formalin-inactivated vaccine is available for horses.

[0114] One such live attenuated vaccine is TC-83, originally developed by the U.S. Army for use in vaccines (Pittman et al., 1996). TC-83 was generated by serial passage of the Trinidad donkey VEEV strain in guinea pig heart cells (Alevizatos et al., 1967). Point mutations in the E2 and 5' untranslated regions contribute to the attenuated phenotype of TC-83 (Kinney et al., 1993). TC-83 is known to be effective in preventing human disease; however, 15–37.5% of vaccine recipients develop fever symptoms (Berge et al., 1961; McKinney et al., 1963; Alevizatos et al., 1967; Pittman et al., 1996), and only 82% of vaccine recipients seroconvert upon vaccination. The probability of maintaining plaque-reducing neutralizing titers of 1:20 or greater over 5–8 years was 60%. Because TC-83 is available only as an investigational vaccine and in a limited population, additional studies to evaluate the vaccine's immunogenicity in humans over time are unavailable. Of interest to this study is that after intranasal infection with the vaccine strain of VEEV-TC-83, C57BL / 6 (WT) mice developed disseminated brain infection with high infectious titers without mortality (Hart et al., 1997; Steele et al., 1998; Julander et al., 2008; Taylor et al., 2012).

[0115] It should be understood that any combination of any of the above-mentioned WEEVs, EEEVs, and / or VEEVs is encompassed by any of the embodiments described herein.

[0116] Modified Vaccine Virus Ankara (MVA) The artificially attenuated modified vaccine virus Ankara ("MVA") was generated by passage of the chorioallantoic vaccine virus Ankara (CVA) strain in chicken embryo fibroblasts over 570 times (see, for review, Mayr, A., et al., Infection 3, 6-14 (1975)). As a result of these long passages, the genome of the resulting MVA virus lacks approximately 27 kilobases of genomic sequence compared to its predecessor, CVA, and was therefore described as being highly host-cell restricted for replication in avian cells (Meyer, H. et al., J. Gen. Virol. 72, 1031-1038 (1991), Meisinger et al., J. Gen. Virol 88, 3249-3259 (2007)). In various animal models, the resulting MVA has been shown to be non-toxic compared to the fully replicable starting material (Mayr, A. & Danner, K., Dev. Biol. Stand. 41:225-34 (1978)).

[0117] MVA viruses useful in the practice of the present invention may include, but are not limited to, MVA-572 (deposited January 27, 1994 as ECACC V94012707), MVA-575 (deposited December 7, 2000 as ECACC V00120707), MVA-I721 (reviewed in Suter et al., Vaccine 2009), NIH Clone 1 (deposited March 27, 2003 as ATCC® PTA-5095), and MVA-BN (deposited August 30, 2000 with the European Collection of Cell Cultures (ECACC) under number V00083008).

[0118] More preferably, the MVA used in accordance with the present invention includes MVA-BN and MVA-BN derivatives. MVA-BN is described in International PCT Publication WO 02 / 042480. "MVA-BN derivatives" refer to viruses that exhibit essentially the same replication characteristics as MVA-BN described herein, but that exhibit differences in one or more portions of their genome.

[0119] MVA-BN and MVA-BN derivatives are replication-incompetent, meaning that they are incapable of reproductive replication in vivo and in vitro. More specifically, in vitro, MVA-BN or MVA-BN derivatives are capable of reproductive replication in chicken embryo fibroblasts (CEF), but not in the human keratinocyte cell line HaCaT (Boukamp et al. (1988), J. Cell Biol. 106:761-771), the human osteosarcoma cell line 143B (ECACC Accession No. 91112502), the human embryonic kidney cell line 293 (ECACC Accession No. 85120602), and the human cervical adenocarcinoma cell line HeLa (ATCC Accession No. CCL-2). Furthermore, MVA-BN or MVA-BN derivatives have a viral amplification rate that is at least two-fold lower, and more preferably three-fold lower, than MVA-575 in HeLa and HaCaT cell lines. Testing and assays for these properties of MVA-BN and MVA-BN derivatives are described in WO 02 / 42480 (U.S. Patent Application No. 2003 / 0206926) and WO 03 / 048184 (U.S. Patent Application No. 2006 / 0159699).

[0120] As described in the previous paragraph, the terms "incapable of reproductive replication" or "reproductively replication incompetent" in vitro in human cell lines are described, for example, in WO 02 / 42480, which also teaches how to obtain MVA with the desired properties described above. The term applies to viruses that have an in vitro viral amplification factor of less than 1 at day 4 post-infection using the assays described in WO 02 / 42480 or U.S. Patent No. 6,761,893.

[0121] As described in the previous paragraph, viral amplification or replication in human cell lines in vitro is typically expressed as the ratio (called the "amplification factor") of the amount of virus produced from infected cells (output) to the amount of virus used to initially infect the cells (input). An amplification factor of "1" defines an amplification state in which the amount of virus produced from infected cells is the same as the amount initially used to infect the cells, meaning that the infected cells are permissive for viral infection and propagation. In contrast, an amplification factor less than 1 (i.e., a decrease in output compared to input levels) indicates a lack of reproductive replication and, therefore, viral attenuation.

[0122] Integration site into MVA Nucleotide sequences encoding one or more proteins can be inserted into any suitable portion of a virus or viral vector, particularly the viral genome of a recombinant MVA. A suitable portion of a recombinant MVA is a non-essential portion of the MVA genome. The non-essential portion of the MVA genome may be an intergenic region or a known deletion site 1-6 of the MVA genome. Alternatively or additionally, the non-essential portion of a recombinant MVA may be a coding region of the MVA genome that is not essential for viral growth. However, the insertion site is not limited to these preferred insertion sites within the MVA genome. This is because it is within the scope of the present invention that promoters, expression cassettes, and / or nucleotides encoding one, two, three, or more of the protein(s) described herein can be inserted anywhere within the viral genome, as long as a recombinant that can be amplified and propagated in at least one cell culture system (e.g., chicken embryo fibroblasts (CEF cells)) can be obtained. Preferably, nucleotide sequences encoding one, two, three, or more protein(s) may be inserted into one or more intergenic regions (IGRs) of MVA. The term "intergenic region" preferably refers to a portion of the viral genome located between two adjacent open reading frames (ORFs) of the MVA viral genome, preferably between two essential ORFs of the MVA viral genome. In certain embodiments, the IGR is selected from IGR07 / 08, IGR44 / 45, IGR64 / 65, IGR88 / 89, IGR136 / 137, and IGR148 / 149. In certain embodiments, fewer than five, four, three, or two IGRs of the recombinant MVA comprise nucleotide sequences encoding one or more protein(s). The number of insertion sites in the MVA comprising nucleotide sequences encoding one or more protein(s) can be one, two, three, four, five, six, seven, or more. In certain embodiments, nucleotide sequences are inserted into four, three, two, or fewer insertion sites. Preferably, two insertion sites are used, preferably IGR44 / 45 and IGR88 / 89, In a particular embodiment, three insertion sites are used.Preferably, the recombinant MVA comprises at least 2, 3, 4, 5, 6, or 7 genes inserted into two or three insertion sites.

[0123] The nucleotide sequence may additionally or alternatively be inserted into one or more of the known deletion sites (i.e., deletion sites I, II, III, IV, V, or VI of the MVA genome). The term "known deletion site" refers to a portion of the MVA genome that has been deleted from the genome of the parent virus from which the MVA was derived, particularly the parent chorioallantoic vaccinia virus Ankara (CVA), by continuous passage in CEF cells characterized at passage 516 (e.g., as described in Eisinger-Henschel et al. (2007), Journal of General Virology 88:3249-3259). In certain embodiments, fewer than 5, 4, 3, or 2 of the known deletion sites of the recombinant MVA contain nucleotide sequences encoding one, two, three, or more protein(s) described herein.

[0124] The recombinant MVA viruses provided herein can be produced by conventional methods known in the art. Methods for obtaining recombinant MVA or inserting exogenous coding sequences into the MVA genome are well known to those skilled in the art. For example, methods for standard molecular biology techniques (e.g., DNA cloning, DNA and RNA isolation, Western blot analysis, RT-PCR, and PCR amplification techniques) are described in "Molecular Cloning, A Laboratory Manual 2nd Ed. (J. Sambrook et al., Cold Spring Harbor Laboratory Press (1989))," and methods for handling and manipulating viruses are described in "Virology Methods Manual (B.W.J. Mahy et al. (eds.), Academic Press (1996))." Similarly, techniques and know-how for handling, manipulating, and genetically engineering MVA are described in: Molecular Virology: A Practical Approach (AJ Davison & RM Elliott (Eds.), The Practical Approach Series, IRL Press at Oxford University Press, Oxford, UK (1993), see, e.g., Chapter 9: Expression of genes by vaccinia virus vectors) and Current Protocols in Molecular Biology (John Wiley & Son, Inc. (1998), see, e.g., Chapter 16, Section IV: Expression of proteins in mammalian cells using vaccinia viral vectors).

[0125] Various methods known to those skilled in the art can be applied to the generation of the various recombinant MVAs disclosed herein. The DNA sequence to be inserted into the virus can be placed into an E. coli plasmid construct into which DNA homologous to a section of MVA DNA has been inserted. Separately, the DNA sequence to be inserted can be ligated to a promoter. The promoter gene linkage can be placed in the plasmid construct so that it is flanked on both sides by DNA homologous to DNA sequences on either side of the region of MVA DNA containing the nonessential locus. The resulting plasmid construct can be amplified and isolated by growth in E. coli bacteria. The isolated plasmid containing the DNA gene sequence to be inserted can be transfected into a cell culture (e.g., of chicken embryo fibroblasts (CEF)), and the culture can be simultaneously infected with MVA. Recombination between homologous MVA DNA within the plasmid and viral genome can generate MVA modified by the presence of the foreign DNA sequence.

[0126] According to a preferred embodiment, cells of a suitable cell culture (e.g., CEF cells) can be infected with MVA. The infected cells can then be transfected with a first plasmid vector containing a foreign or heterologous gene(s), preferably under the transcriptional control of an expression control element. As explained above, the plasmid vector also contains sequences capable of directing the insertion of the foreign sequence into a selected portion of the MVA genome. Optionally, the plasmid vector also contains a cassette containing a marker and / or selection gene operably linked to a poxvirus promoter. Suitable marker or selection genes are, for example, genes encoding green fluorescent protein, β-galactosidase, neomycin phosphoribosyltransferase, or other markers. The use of a selection or marker cassette simplifies the identification and isolation of the resulting recombinant MVA.

[0127] However, recombinant MVA can also be identified by PCR techniques. Subsequently, additional cells can be infected with the recombinant MVA obtained as described above and transfected with a second vector containing a second foreign or heterologous gene(s). If this gene is introduced into a different insertion site in the MVA genome, the second vector also differs in the MVA homologous sequence that directs the integration of the second foreign gene(s) into the MVA genome. After homologous recombination occurs, recombinant viruses containing two or more foreign or heterologous genes can be isolated. To introduce additional foreign genes into the recombinant virus, the infection and transfection steps can be repeated by using the recombinant virus isolated in the previous step for infection and an additional vector containing the additional foreign gene(s) for transfection.

[0128] Alternatively, the infection and transfection steps described above can be interchanged; i.e., suitable cells can be first transfected with a plasmid vector containing the foreign gene and then infected with MVA. As a further alternative, each foreign gene can be introduced into a different virus, all the resulting recombinant viruses can be co-infected into cells, and recombinants containing all the foreign genes can be screened. A third option is in vitro ligation of the DNA genome and foreign sequence and reconstitution of a recombinant vaccinia virus DNA genome using a helper virus. A fourth option is homologous recombination in E. coli or another bacterial species between a vaccinia virus genome cloned as a bacterial artificial chromosome (BAC) and a linear foreign sequence flanked by DNA sequences homologous to sequences flanking the desired site of integration in the vaccinia virus genome.

[0129] Expression of antigenic proteins In certain embodiments, expression of one, more, or all of the nucleotide sequences encoding proteins (disease-associated antigens), for example, of the EBV virus described herein, is under the control of one or more poxvirus promoters. The promoter according to the present invention may be any synthetic or natural poxvirus promoter. In certain embodiments, the poxvirus promoter is the Pr13.5 promoter, the PrHyb promoter, the Pr7.5 promoter, a hybrid early / late promoter, the PrS promoter, the PrS5E promoter, the Pr1328 promoter, the PrH5m promoter, a synthetic or natural early or late promoter, or the cowpox virus ATI promoter. Suitable promoters are further described in WO2010 / 060632, WO2010 / 102822, WO2013 / 189611, and WO2014 / 063832.

[0130] The nucleic acid encoding the disease-associated antigen can be operably linked to an expression control sequence. The expression control sequence operably linked to the coding sequence is ligated such that expression of the coding sequence is achieved under conditions compatible with the expression control sequence. Expression control sequences include, but are not limited to, an appropriate promoter, enhancer, transcription terminator, a start codon at the beginning of the open reading frame encoding the protein, splicing signals for introns, and in-frame stop codons. Suitable promoters include, but are not limited to, the SV40 early promoter, retroviral LTR, adenovirus major late promoter, human CMV immediate early I promoter, and various poxvirus promoters, including, but not limited to, the following promoters from vaccinia virus or MVA: 30K promoter, I3 promoter, sE / L promoter, Pr7.5K, 40K promoter, C1 promoter, PrSynIIm promoter, PrLE1 promoter, PrH5m promoter, PrS promoter, hybrid early / late promoter, PrS5E promoter, PrA5E promoter, and Pr4LS5E promoter; the cowpox virus ATI promoter, or the following promoters from fowlpox: Pr7.5K promoter, I3 promoter, 30K promoter, or 40K promoter.

[0131] In certain embodiments, the poxvirus promoter is selected from the group consisting of the PrS promoter (SEQ ID NO: 8), Pr1328 (SEQ ID NO: 10), PrH5m (SEQ ID NO: 9), and Pr13.5 promoter (SEQ ID NO: 7).

[0132] Antigenic determinants / proteins The term "antigenic determinant" or "antigenic protein" refers to a molecule that stimulates a host's immune system to generate an antigen-specific immune response, whether a cellular response or a humoral antibody response. Antigenic determinants may include proteins, polypeptides, antigenic protein fragments, antigens, and epitopes that still elicit an immune response in a host and form part of the antigen; homologs or variants of proteins, polypeptides, and antigenic protein fragments, antigens, and epitopes (including, for example, glycosylated proteins, polypeptides, antigenic protein fragments, antigens, and epitopes); and nucleotide sequences encoding such molecules. Thus, proteins, polypeptides, antigenic protein fragments, antigens, and epitopes are not limited to particular naturally occurring nucleotide or amino acid sequences, but include sequences identical to the naturally occurring sequences, as well as modifications to the naturally occurring sequences (e.g., deletions, additions, insertions, and substitutions).

[0133] The term "epitope" refers to a site on an antigen to which B cells and / or T cells respond, alone or in combination with another protein (e.g., a major histocompatibility complex ("MHC") protein or a T cell receptor). Epitopes can be formed from contiguous amino acids or from noncontiguous amino acids juxtaposed by secondary and / or tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents, whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically comprises at least 5, 6, 7, 8, 9, 10, or more amino acids (usually fewer than 20 amino acids) in a unique spatial conformation. Methods for determining the spatial conformation of epitopes include, for example, x-ray crystallography and two-dimensional nuclear magnetic resonance. See, for example, "Epitope Mapping Protocols" in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, Ed. (1996).

[0134] Preferably, homologues or variants have at least about 50%, at least about 60% or 65%, at least about 70% or 75%, at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more typically at least about 90%, 91%, 92%, 93%, or 94%, even more typically at least about 95%, 96%, 97%, 98%, or 99%, and most typically at least about 99% identity at the nucleotide or amino acid sequence level to the referenced proteins, polypeptides, antigenic protein fragments, antigens, and epitopes.

[0135] In some embodiments, the heterologous nucleic acid encodes an antigen domain or fragment of an antigen protein, rather than the entire antigen protein. These fragments can be of any length sufficient to be antigenic or immunogenic. Fragments can be at least 8 amino acids long, preferably 10-20 amino acids long, but can be longer, e.g., at least 50, 100, 200, 500, 600, 800, 1000, 1200, 1600, 2000 amino acids long, or any length in between.

[0136] In some embodiments, at least one nucleic acid fragment encoding an antigenic protein fragment or its immunogenic polypeptide is inserted into a viral vector of the invention. In another embodiment, approximately two to six different nucleic acids encoding different antigenic proteins are inserted into one or more viral vectors. In some embodiments, multiple immunogenic fragments or subunits of different proteins can be used. For example, multiple different epitopes from different portions of a single protein, or from different proteins from the same strain, or from protein orthologs from different strains, can be expressed from a vector.

[0137] Immunogenic compositions and disease-associated antigens In one aspect, provided herein is an immunogenic composition comprising a recombinant poxvirus, such as Modified Vaccinia Virus Ankara (MVA), comprising a nucleic acid sequence encoding a heterologous disease-associated antigen and a VRP encoding same.

[0138] In certain embodiments, the heterologous disease-associated antigen is an infectious disease antigen or a tumor-associated antigen. In certain embodiments, the heterologous disease-associated antigen is a tumor-associated antigen. In certain embodiments, the tumor-associated antigen is selected from the group consisting of 5-alpha-reductase, alpha-fetoprotein ("AFP"), AM-1, APC, April, B melanoma antigen gene ("BAGE"), β-catenin, Bcl12, bcr-abl, Brachyury, CA-125, caspase-8 ("CASP-8", also known as "FLICE"), cathepsin, CD19, CD20, CD21 / complement receptor 2 ("CR2"), CD22 / BL-CAM, CD23 / F cεRII, CD33, CD35 / complement receptor 1 (“CR1”), CD44 / PGP-1, CD45 / leukocyte common antigen (“LCA”), CD46 / membrane cofactor protein (“MCP”), CD52 / CAMPATH-1, CD55 / decay-accelerating factor (“DAF”), CD59 / protectin, CDC27, CDK4, carcinoembryonic antigen (“CEA”), c-myc, cyclooxygenase-2 (“cox-2”), deleted in colorectal cancer (“DCC”), DcR3, E6 / E7, CGFR, EMBP, Dna78, farnesyltransferase Ze, fibroblast growth factor-8a (“FGF8a”), fibroblast growth factor-8b (“FGF8b”), FLK-1 / KDR, folate receptor, G250, G melanoma antigen gene family (“GAGE family”), gastrin 17, gastrin-releasing hormone, ganglioside 2 (“GD2”) / ganglioside 3 (“GD3”) / ganglioside monosialic acid-2 (“GM2”), gonadotropin-releasing hormone (“GnRH”), UDP-GlcNAc:R1Man(α1-6)R2[GlcNAc→Man(α1-6)]β1,6-N-acetylglucosaminyltransferase V (“GnT V”), GP1, gp100 / Pme117, gp-100-in4, gp15, gp75 / tyrosine-related protein-1 (“gp75 / TRP-1”), human chorionic gonadotropin (“hCG”), heparanase, Her2 / neu, human mammary tumor virus (“HMTV”), 70 kilodalton heat shock protein (“HSP70”), human telomerase reverse transcriptase (“hTERT”), insulin-like growth factor receptor-1 (“IGFR-1”), interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-8 (IL-6), interleukin-11 (IL-6), interleukin-12 (IL-6), interleukin-13 (IL-6), interleukin-14 (IL-6), interleukin-15 (IL-6), interleukin-16 (IL-6), interleukin-17 (IL-6), interleukin-18 (IL-6), interleukin-19 (IL-6), interleukin-20 (IL-6), interleukin-21 (IL-6), interleukin-22 (IL-6), interleukin-23 (IL-6), interleukin-24 (IL-6), interleukin-25 (IL-6), interleukin-31 (IL-6), interleukin-16 (IL-6), interleukin-18 (IL-6), interleukin-19 (IL-6), interleukin-19 (IL-6), interleukin-19 (IL-6), interleukin-16 (IL-6), interleukin-19 (IL-6), IL-13 receptor (“IL-13R”), inducible nitric oxide synthase (“iNOS”), Ki67, KIAA0205, K-ras, H-ras, N-ras, KSA, LKLR-FUT, melanoma antigen-encoding family (“MAGE family”, e.g., at least MAGE-1, MAGE-2, MAGE-3, and MAGE-4), mammaglobin, MAP17, melanin A / melanoma antigen 1 recognized by T cells (“MART-1”), mesothelin, MIC A / B, MT-MMP, mucin, testis-specific antigen NY-ESO-1, osteonectin, p15, P170 / MDR1, p53, p97 / melanotransferrin, PAI-1, platelet-derived growth factor ("PDGF"), μPA, PRAME, probasin, progenipoietin, prostate-specific antigen ("PSA"), prostate-specific membrane antigen ("PSMA"), prostatic acid phosphatase ("PAP"), RAGE-1, Rb, RCAS1, SART-1, SSX family, STAT3, STn, TAG-72, transforming growth factor alpha ("TGF-α"), transforming growth factor beta ("TGF-β"), thymosin beta 15, tumor necrosis factor alpha ("TNF-α"), TP1, TRP-2, tyrosinase, vascular endothelial growth factor ("VEGF"), ZAG, p16INK4, and glutathione S-transferase ("GST"). In certain embodiments, the tumor-associated antigen is Brachyury. In certain embodiments, the tumor-associated antigen is PSA. In certain embodiments, the tumor-associated antigen is CEA. In certain embodiments, the tumor-associated antigen is MUC-1. In certain embodiments, the tumor-associated antigens are CEA and MUC-1.

[0139] In certain embodiments, the heterologous disease-associated antigen is an infectious disease antigen, hi certain embodiments, the infectious disease antigen is a viral antigen, a bacterial antigen, a fungal antigen, or a parasitic antigen.

[0140] In certain embodiments, the infectious disease antigen is a viral antigen, hi certain embodiments, the viral antigen is derived from a virus selected from the group consisting of adenovirus, arbovirus, astrovirus, coronavirus, coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus ("CMV"), dengue virus, Ebola virus, Epstein-Barr virus ("EBV"), foot-and-mouth disease virus, Guanarito virus, Hendra virus, herpes simplex virus type 1 ("HSV-1"), herpes simplex virus type 2 ("HSV-2"), human herpesvirus type 6 ("HHV-6"), human herpesvirus type 8 ("HHV-8"), hepatitis A virus ("HAV"), hepatitis B virus ("HBV"), hepatitis C virus ("HCV"), hepatitis D virus ("HDV"), and hepatitis E virus. virus (“HEV”), human immunodeficiency virus (“HIV”), influenza virus, Japanese hepatitis virus (“JHV”), encephalitis virus, Junin virus, Lassa virus, Machupo virus, Marburg virus, measles virus, human metapneumovirus, molluscum contagiosum virus, mumps virus, Newcastle disease virus, Nipah virus, norovirus, Norwalk virus, human papillomavirus (“HPV”), parainfluenza virus, parvovirus, poliovirus, rabies virus, respiratory syncytial virus (“RSV”), rhinovirus, rotavirus, rubella virus, Sabia virus, severe acute respiratory syndrome virus (“SARS”), varicella-zoster virus, smallpox virus, West Nile virus, and yellow fever virus.

[0141] The bedside table is a smooth, smooth bathroom. The active ingredient is one of the most common types of bacteria: Bacillus anthracis pneumoniae、Chlamydia trachomatis、Chlamydophila psittaci、Clostridium botulinum、Clostridium difficile、Clostridium perfringens、Clostridium tetani、Corynebacterium diptheriae、Enterococcus faecalis、Enterococcus faecium、Escherichia coli、Enterotoxigenic Escherichia coli、Enteropathogenic Escherichia coli、Escherichia coli)157:H7 interrogans、Listeria monocytogenes、Mycobacterium leprae、Mycobacterium tuberculosis、Mycoplasma pneumoniae、Neisseria gonorrhoeae、Neisseria meningitides、Pseudomonas aeruginosa、Rickettsia rickettsia、Salmonella typhi、Salmonella typhimurium、Shigella sonnei、Staphylococcus aureus、Staphylococcusepidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, and Yersinia pestis. In a particular embodiment, the bacterial antigen is derived from Bacillus anthracis.

[0142] In certain embodiments, the infectious disease antigen is a fungal antigen. In certain embodiments, the fungal antigen is selected from the group consisting of antigens derived from: Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Blastomyces dermatitidis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida parapsilosis, Candida rugosa, Candida tropicalis, Cryptococcus albidus, Cryptococcus gattii, Cryptococcus laurentii, Cryptococcus neoformans, Histoplasma capsulatum, Microsporum canis, Pneumocystis carinii, Pneumocystis jirovecii, Sporothrix schenckii, Stachbotrys chartarum, Tinea barbae, Tinea captitis, Tinea corporis, Tinea cruris, Tinea faciei, Tinea incognito, Tinea nigra, Tinea versicolor, Trichophyton rubrum, and Trichophyton tonsurans.

[0143] In certain embodiments, the infectious disease antigen is a parasitic antigen selected from the group consisting of antigens derived from Anisakis spp., Babesia spp., Baylisascaris procyonis, Cryptosporidium spp., Cyclospora cayetanensis, Diphyllobothrium spp., Dracunculus medinensis, Entamoeba histolytica, Giardia duodenalis, Giardia intestinalis, Giardia lamblia, Leishmania sp., Plasmodium falciparum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Taenia spp., Toxoplasma gondii, Trichinella spiralis, and Trypanosoma cruzi.

[0144] Epstein-Barr virus (EBV) Epstein-Barr virus (EBV, also known as human herpesvirus 4 or HHV-4) is a human herpesvirus. This enveloped, dsDNA virus is transmitted orally via saliva or genital secretions, can infect epithelial cells and B cells, and undergoes a complex, regulated, two-phase life cycle consisting of a lytic and a latent phase. The lytic phase can cause infectious mononucleosis (glandular fever) in young, previously naive adolescents. Infectious mononucleosis is a risk factor for the development of cancer in later stages. EBV is associated with certain forms of cancer (e.g., Hodgkin's lymphoma, Burkitt's lymphoma, gastric cancer, and nasopharyngeal carcinoma). Furthermore, evidence has emerged for an association between EBV and autoimmune diseases.

[0145] Methods for producing non-recombinant and recombinant poxviruses Methods for obtaining recombinant poxviruses (e.g., MVA) or inserting exogenous coding sequences into poxvirus (e.g., MVA) genomes are well known to those skilled in the art. For example, methods for standard molecular biology techniques (e.g., DNA cloning, DNA and RNA isolation, Western blot analysis, RT-PCR and PCR amplification techniques) can be found in Molecular Cloning, A Laboratory Manual 2 ndEd. (J. Sambrook et al., Cold Spring Harbor Laboratory Press (1989)), and techniques for handling and manipulating viruses are described in Virology Methods Manual (BWJ Mahy et al. (eds.), Academic Press (1996)). Similarly, techniques and know-how for handling, manipulating, and genetically engineering poxviruses are described in Molecular Virology: A Practical Approach (AJ Davison & RM Elliott (Eds.), The Practical Approach Series, IRL Press at Oxford University Press, Oxford, UK (1993), see e.g., Chapter 9: Expression of genes by vaccinia virus vectors); Current Protocols in Molecular Biology (John Wiley & Son, Inc. (1998), see e.g., Chapter 16, Section IV: Expression of proteins in mammalian cells using vaccinia viral vector); and Genetic Engineering, Recent Developments in Applications, Apple Academic Press (2011), Dana M. Santos, see e.g., Chapter 3: Recombinant-mediated Genetic Engineering of a Bacterial Artificial Chromosome Clone of Modified Vaccinia Virus. Ankara (MVA).The construction and isolation of recombinant MVA is also described in: Methods and Protocols, Vaccinia Virus and Poxvirology, ISBN 978-1-58829-229-2 (Staib et al.), Humana Press (2004), see e.g., Chapter 7.

[0146] Methods for producing and purifying viral-based materials (eg, viral vectors and / or viruses) according to the present invention are known to those skilled in the art. The method involves infection of a suitable cell culture (e.g., chicken embryo fibroblasts (CEF cells) or cell line (e.g., DF-1, duck, MDCK, quail or chicken-derived cell lines, and EB66 cells) followed by amplification of the virus under suitable conditions well known to those of skill in the art. While serum-free culture conditions (e.g., media) and serum-containing culture methods can be used for virus production, methods using animal-free materials (e.g., cell culture media) are preferred. The term "serum-free" medium refers to a cell culture medium that does not contain serum of animal or human origin. As used herein, "animal-free" refers to any compound or collection of compounds that was not produced in or by animal cells within an organism (excluding cells or cell lines used for the production and purification of virus-based materials). Suitable cell culture media are known to those of skill in the art. These media include salts, vitamins, buffers, energy sources, amino acids, and other substances. An example of a medium suitable for serum-free culture of preferred CEF cells is Medium 199 (Morgan, Morton and Parker; Proc. Soc. Exp. Biol. Med. 1950). Jan;73(1):1-8;obtainable inter alia from Life Technologies) or VP-SFM (Invitrogen Ltd.). Serum-free methods for virus culture and amplification in CEF cells are described, for example, in WO2004 / 022729. Upstream and downstream processes for the production and purification of viral material are exemplarily described in WO2012 / 010280. Further methods useful for purifying the viruses of the present application are described in: WO03 / 054175, WO07 / 147528, WO2008 / 138533, WO2009 / 100521, and WO2010 / 130753.Suitable methods for propagating and purifying recombinant poxviruses in duck embryo-derived cells (e.g., but not limited to, EB66 cells) are described in Leon et al. (Leon et al. (2016), The EB66 cell line as a valuable cell substrate for MVA-based vaccine production, Vaccine 34:5878-5885).

[0147] Methods for the generation of saRNA Conventional and synthetic saRNA vaccines are generated in essentially the same way. Briefly, a DNA-dependent RNA polymerase promoter (usually derived from T7, T3, or SP6 bacteriophage) and an mRNA expression plasmid (pDNA) encoding the RNA vaccine candidate are engineered as a template for in vitro transcription. The flexibility of the gene synthesis platform is a key advantage. In conventional mRNA vaccines, the antigen or immune regulatory sequence is flanked by 5' and 3' untranslated regions (UTRs). A poly(A) tail can be incorporated from the 3' end of the pDNA template or added enzymatically after in vitro transcription. The saRNA vaccine pDNA template contains additional alphavirus replicon genes and conserved sequence elements. Nonstructural proteins 1, 2, 3, and 4 (nsP1-4) form the RdRP complex and are therefore essential for replicon activity. In vitro transcription is typically performed on a linearized pDNA template or linear DNA fragment, usually using T7 DNA-dependent RNA polymerase, resulting in multiple copies of the RNA transcript. For efficient translation, the 5' end is capped. This can usually be done by co-transcriptional capping with a synthetic cap analog or post-transcriptional enzymatic capping. After the RNA is 5' capped and purified, it is ready for formulation and delivery. In the case of saRNA, the co-transcriptional capping step with a cap analog is usually preferred because the 5' cap differs from that of conventional mRNA.

[0148] The RNA product is then purified, which may include removing in vitro transcription by-products in the form of double-stranded dsRNA. For example, these can be removed by chromatography using the double-strand-specific enzyme RNase or a substance with specific dsRNA affinity. Additional chromatography or other purification steps (e.g., affinity purification, filtration) can be used to enhance the purity and quality of the RNA product. Affinity purification may also include a polyA-specific resin to enrich for full-length and polyadenylated RNA and remove short by-products.

[0149] Vaccines and Pharmaceutical Compositions The recombinant MVA viruses described herein are highly replication-restricted and therefore highly attenuated, making them ideal candidates for the treatment of a wide range of mammals (e.g., humans and immunocompromised humans). Accordingly, pharmaceutical compositions and vaccines for inducing an immune response in living animals, including humans, are provided herein. Additionally, recombinant MVA vectors containing nucleotide sequences encoding antigenic determinants of EBV glycoproteins for use in the treatment and / or prevention of diseases caused by EBV are also provided.

[0150] The vaccine is preferably 4 ~10 9 TCID 50 / ml, 10 5 ~5×10 8 TCID 50 / ml, 10 6 ~10 8 TCID 50 / ml, or 10 7 ~10 8 TCID 50 The preferred vaccination dose for humans is 10 / ml. 6 ~10 9 TCID 50 (e.g., 10 6 TCID 50 , 10 7 TCID50 , or 10 8 TCID 50 (including the dose).

[0151] The pharmaceutical compositions provided herein may generally contain one or more pharmaceutically acceptable and / or approved carriers, additives, antibiotics, preservatives, adjuvants, diluents, and / or stabilizers. Such auxiliary substances can be water, saline, glycerol, ethanol, wetting or emulsifying agents, pH buffering substances, etc. Suitable carriers are usually large, slowly metabolized molecules (e.g., proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates, etc.).

[0152] For the preparation of a vaccine, the recombinant MVA viruses provided herein can be converted into a physiologically acceptable form, as described in H. Stickl et al., Dtsch. med. Wschr. 99:2386-2392 (1974), based on experience in the preparation of poxvirus vaccines used in smallpox vaccination.

[0153] For example, 5×10 β-glucan monophosphate (GMO) was formulated in approximately 10 mM Tris, 140 mM NaCl (pH 7.4). 8 TCID 50 Purified virus with a titer of 10 / ml can be stored at -80°C. To prepare a vaccine injection, e.g., 10 2 ~10 8 or 10 2 ~10 9The virus particles can be lyophilized in ampoules (preferably glass ampoules) in 100 ml of phosphate-buffered saline (PBS) in the presence of 2% peptone and 1% human albumin. Alternatively, vaccine injections can be produced by stepwise lyophilization of the virus in the formulation. This formulation may contain additional additives suitable for in vivo administration (e.g., mannitol, dextran, sugar, glycine, lactose, or polyvinylpyrrolidone) or other adjuvants (e.g., antioxidants or inert gases), stabilizers, or recombinant proteins (e.g., human serum albumin). The glass ampoules can then be sealed and stored at 4°C to room temperature for several months. However, unless necessary, the ampoules are preferably stored at temperatures below -20°C.

[0154] For vaccination or treatment, the lyophilizate can be dissolved in an aqueous solution, preferably saline or Tris buffer, and administered systemically or locally, i.e., parenterally, subcutaneously, intravenously, intramuscularly, intranasally, or by other routes of administration known to skilled practitioners. The method of administration, dosage, and frequency of administration can be optimized by those skilled in the art using known methods. However, most commonly, patients are vaccinated with a second injection approximately one month to six weeks after the first vaccination injection.

[0155] Combination vaccines using heterologous prime-boost regimens The combination vaccines and methods described herein may be used as part of a heterologous prime-boost regimen, in which an initial priming vaccination is administered, followed by one or more boosting vaccinations.

[0156] The MVA and VRP recombinant viral vectors of the present invention may also be used in a heterologous prime-boost regimen, in which one or more initial prime vaccinations are administered with either an MVA or VRP vector as defined herein, and one or more subsequent boosting vaccinations are administered with a poxvirus vector not used in the prime vaccinations (e.g., if an MVA vector as defined herein is administered in the prime-boost, the subsequent boosting vaccinations will be with a VRP vector), or vice versa.

[0157] In a preferred embodiment, the prime vaccination is with a VRP vector and the boosting vaccination is with an MVA. Thus, one aspect of the invention relates to a combination vaccine comprising: (a) a first composition comprising an immunologically effective amount of a VRP vector comprising a nucleic acid encoding an antigen protein and a pharmaceutically acceptable carrier; and (b) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier. (The first composition is a priming composition and the second composition is a boosting composition, preferably the boosting composition comprising two or more doses of the vector of the boosting composition).

[0158] Vaccines and kits containing recombinant MVA and saRNA (VRP) viruses Also provided herein are vaccines and kits comprising any one or more of the recombinant VRP and / or MVA described herein. The kits may include one or more containers or vials of recombinant MVA or VRP and instructions for administering the recombinant MVA and VRP to a subject at risk for infection. In certain embodiments, the subject is a human. In certain embodiments, the instructions indicate that the recombinant MVA is to be administered to the subject in a single dose or multiple doses (i.e., two, three, four, etc.). In certain embodiments, the instructions indicate that the recombinant MVA or VRP virus is to be administered in a first dose (priming) and a second dose (boosting) to a naive or non-naive subject. Preferably, the kit comprises at least two vials for prime / boost immunization containing the recombinant VRP described herein for the first inoculation (the "priming inoculation") in a first vial / container, and for at least the second and / or third and / or more inoculations (the "boosting inoculations") in a second and / or further vials / containers containing the recombinant MVA.

[0159] Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims. [Example]

[0160] Embodiment 1 is a vaccine combination comprising: (a) a first composition comprising an immunologically effective amount of saRNA comprising a nucleic acid encoding an antigen protein and a pharmaceutically acceptable carrier; and (b) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier. (One of the compositions is a priming composition and the other composition is a boosting composition).

[0161] Embodiment 2 is a vaccine combination of embodiment 1, wherein a first composition is used to prime an immune response and a second composition is used to enhance the immune response.

[0162] Embodiment 3 is a vaccine combination of embodiment 1, wherein the second composition is used to prime the immune response and the first composition is used to enhance the immune response.

[0163] Embodiment 4 is a vaccine combination according to any one of embodiments 1 to 3, wherein the antigen protein is an infectious disease antigen or a tumor-associated antigen.

[0164] Embodiment 5 is a vaccine combination according to embodiment 4, wherein the antigenic protein is an infectious disease antigen.

[0165] Embodiment 6 is a vaccine combination according to embodiment 5, wherein the antigenic protein is a viral antigen, a bacterial antigen, a fungal antigen, or a parasitic antigen.

[0166] Embodiment 7 is a vaccine combination according to embodiment 6, wherein the antigenic protein is a viral antigen.

[0167] Embodiment 8 is a vaccine combination of embodiment 7, wherein the viral antigen is derived from a virus selected from the group consisting of adenovirus, arbovirus, astrovirus, coronavirus, coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus ("CMV"), dengue virus, Ebola virus, Epstein-Barr virus ("EBV"), foot-and-mouth disease virus, Guanarito virus, Hendra virus, herpes simplex virus 1 ("HSV-1"), herpes simplex virus 2 ("HSV-2"), human herpesvirus 6 ("HHV-6"), human herpesvirus 8 ("HHV-8"), hepatitis A virus ("HAV"), hepatitis B virus ("HBV"), hepatitis C virus ("HCV"), hepatitis D virus ("HCV"). HDV), Hepatitis E virus ("HEV"), Human Immunodeficiency Virus ("HIV"), Influenza virus, Japanese Hepatitis virus ("JHV"), Encephalitis virus, Junin virus, Lassa virus, Machupo virus, Marburg virus, Measles virus, Human Metapneumovirus, Molluscum contagiosum virus, Mumps virus, Newcastle disease virus, Nipah virus, Norovirus, Norwalk virus, Human Papillomavirus ("HPV"), Parainfluenza virus, Parvovirus, Poliovirus, Rabies virus, Respiratory Syndrome virus ("RSV"), Rhinovirus, Rotavirus, Rubella virus, Sabia virus, Severe Acute Respiratory Syndrome virus ("SARS"), Varicella-Zoster virus, Smallpox virus, West Nile virus, and Yellow Fever virus.

[0168] Embodiment 9 is a vaccine combination according to embodiment 6, wherein the antigenic protein is a bacterial antigen.

[0169] The 10-year-old is a smooth-flowing snack It contains the list of active ingredients in Figure 9: Bacillus anthracis pneumoniae、Chlamydia trachomatis、Chlamydophila psittaci、Clostridium botulinum、Clostridium difficile、Clostridium perfringens、Clostridium tetani、Corynebacterium diptheriae、Enterococcus faecalis、Enterococcus faecium、Escherichia coli、Enterotoxigenic Escherichia coli、Enteropathogenic Escherichia coli、Escherichia coli)157:H7 interrogans、Listeria monocytogenes、Mycobacterium leprae、Mycobacterium tuberculosis、Mycoplasma pneumoniae、Neisseria gonorrhoeae、Neisseria meningitides、Pseudomonas aeruginosa、Rickettsia rickettsia、Salmonella typhi、Salmonella typhimurium、Shigella sonnei、Staphylococcus aureus、Staphylococcus epidermidis、Staphylococcussaprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, and Yersinia pestis.

[0170] Embodiment 11 is a vaccine combination of embodiment 6, wherein the infectious disease antigen is a fungal antigen.

[0171] Embodiment 12 is a vaccine combination according to embodiment 11, wherein the fungal antigen is derived from a fungus selected from the group consisting of Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Blastomyces dermatitidis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida parapsilosis, Candida rugosa, Candida tropicalis, Cryptococcus albidus, Cryptococcus gattii, Cryptococcus laurentii, Cryptococcus neoformans, Histoplasma capsulatum, Microsporum canis, Pneumocystis carinii, Pneumocystis jirovecii, Sporothrix schenckii, Stachabotrys chartarum, Tinea barbae, Tinea captitis, Tinea corporis, Tinea cruris, Tinea faciei, Tinea incognito, Tinea nigra, Tinea versicolor, Trichophyton rubrum, and Trichophyton tonsurans.

[0172] Embodiment 13 is a vaccine combination according to embodiment 6, wherein the antigenic protein is a parasite antigen.

[0173] Embodiment 14 is a vaccine combination according to embodiment 13, wherein the parasite antigen is derived from a parasite selected from the group consisting of Anisakis spp., Babesia spp., Baylisascaris procyonis, Cryptosporidium spp., Cyclospora cayetanensis, Diphyllobothrium spp., Dracunculus medinensis, Entamoeba histolytica, Giardia duodenalis, Giardia intestinalis, Giardia lamblia, Leishmania sp., Plasmodium falciparum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Taenia spp., Toxoplasma gondii, Trichinella spiralis, and Trypanosoma cruzi.

[0174] Embodiment 15 is a vaccine combination according to embodiment 4, wherein the antigenic protein is a tumor-associated antigen.

[0175] Embodiment 16 is a vaccine combination of embodiment 15, wherein the tumor-associated antigen is selected from the group consisting of 5-alpha-reductase, alpha-fetoprotein ("AFP"), AM-1, APC, April, B melanoma antigen gene ("BAGE"), β-catenin, Bcl12, bcr-abl, Brachyury, CA-125, caspase-8 ("CASP-8", also known as "FLICE"), cathepsin, CD19, CD20, CD21 / complement receptor 2 ("CR2"), CD22 / BL-CAM, CD23 / F cεRII, CD33, CD35 / complement receptor 1 (“CR1”), CD44 / PGP-1, CD45 / leukocyte common antigen (“LCA”), CD46 / membrane cofactor protein (“MCP”), CD52 / CAMPATH-1, CD55 / decay-accelerating factor (“DAF”), CD59 / protectin, CDC27, CDK4, carcinoembryonic antigen (“CEA”), c-myc, cyclooxygenase-2 (“cox-2”), deleted in colorectal cancer (“DCC”), DcR3, E6 / E7, CGFR, EMBP, Dna78, farnesyltransferase Ze, fibroblast growth factor-8a (“FGF8a”), fibroblast growth factor-8b (“FGF8b”), FLK-1 / KDR, folate receptor, G250, G melanoma antigen gene family (“GAGE family”), gastrin 17, gastrin-releasing hormone, ganglioside 2 (“GD2”) / ganglioside 3 (“GD3”) / ganglioside monosialic acid-2 (“GM2”), gonadotropin-releasing hormone (“GnRH”), UDP-GlcNAc:R1Man(α1-6)R2[GlcNAc→Man(α1-6)]β1,6-N-acetylglucosaminyltransferase V (“GnT V”), GP1, gp100 / Pme117, gp-100-in4, gp15, gp75 / tyrosine-related protein-1 (“gp75 / TRP-1”), human chorionic gonadotropin (“hCG”), heparanase, Her2 / neu, human mammary tumor virus (“HMTV”), 70 kilodalton heat shock protein (“HSP70”), human telomerase reverse transcriptase (“hTERT”), insulin-like growth factor receptor-1 (“IGFR-1”), interleukin-13 receptor (“IL -13R”), inducible nitric oxide synthase (“iNOS”), Ki67, KIAA0205, K-ras, H-ras, N-ras, KSA, LKLR-FUT, melanoma antigen-encoding gene 1 (“MAGE-1”), melanoma antigen-encoding gene 2 (“MAGE-2”), melanoma antigen-encoding gene 3 (“MAGE-3”), melanoma antigen-encoding gene 4 (“MAGE-4”), mammaglobin, MAP17, melanin A / melanoma antigen recognized by T cells 1 (“MART-1”), mesothelin, MIC A / B, MT-MMP, mucin, testis-specific antigen NY-ESO-1, osteonectin, p15, P170 / MDR1, p53, p97 / melanotransferrin, PAI-1, platelet-derived growth factor ("PDGF"), μPA, PRAME, probasin, progenipoietin, prostate-specific antigen ("PSA"), prostate-specific membrane antigen ("PSMA"), prostatic acid phosphatase ("PAP"), RAGE-1, Rb, RCAS1, SART-1, SSX family, STAT3, STn, TAG-72, transforming growth factor alpha ("TGF-α"), transforming growth factor beta ("TGF-β"), thymosin beta 15, tumor necrosis factor alpha ("TNF-α"), TP1, TRP-2, tyrosinase, vascular endothelial growth factor ("VEGF"), ZAG, p16INK4, and glutathione S-transferase ("GST").

[0176] Embodiment 17 is a vaccine combination according to any one of embodiments 1 to 8, wherein the antigenic protein is any of the structural and non-structural proteins of EBV.

[0177] Embodiment 18 is a vaccine combination according to embodiment 17, wherein the antigenic protein is selected from gp350, gH, gL, EBNA3A, and BRLF1 / BZLF1 fusions.

[0178] Embodiment 19 is a vaccine combination according to embodiment 18, wherein the antigenic proteins are encoded by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:4.

[0179] Embodiment 20 is a vaccine combination according to any one of embodiments 1 to 19, wherein the saRNA is VRP, preferably VEEV, more preferably TC83.

[0180] Embodiment 21 is a vaccine combination according to any one of embodiments 1 to 19, wherein the MVA is MVA-BN.

[0181] Embodiment 22 is a vaccine combination of embodiment 20, wherein the VRP in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH, and gL.

[0182] Embodiment 23 is a vaccine combination according to embodiment 22, wherein the antigenic proteins are encoded by SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0183] Embodiment 24 is a vaccine combination according to any one of embodiments 1 to 23, used to generate a protective immune response against an infectious or tumor-related disease, wherein a first composition is used to prime the immune response and a second composition is used to enhance the immune response.

[0184] Embodiment 25 is a vaccine combination according to any one of embodiments 1 to 23, used to generate a protective immune response against an infectious or tumor-related disease, wherein the second composition is used to prime the immune response and the first composition is used to enhance the immune response.

[0185] Embodiment 26 is a vaccine combination according to any one of embodiments 1 to 25, wherein the boosting composition comprises two or more doses of the vector of the boosting composition.

[0186] Embodiment 27 is a kit comprising: (a) a first composition comprising an immunologically effective amount of saRNA comprising a nucleic acid encoding an antigen protein and a pharmaceutically acceptable carrier; and (b) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier. (One of the compositions is a priming composition and the other composition is a boosting composition).

[0187] Embodiment 28 is the kit of embodiment 27, wherein the first composition is used to prime the immune response and the second composition is used to enhance the immune response.

[0188] Embodiment 29 is the kit of embodiment 27, wherein the second composition is used to prime the immune response and the first composition is used to enhance the immune response.

[0189] Embodiment 30 is the kit according to any one of embodiments 27 to 29, wherein the antigen protein is an infectious disease antigen or a tumor-associated antigen.

[0190] Embodiment 31 is the kit of embodiment 30, wherein the disease-associated antigen is an infectious disease antigen.

[0191] Embodiment 32 is the kit of embodiment 31, wherein the infectious disease antigen is a viral antigen, a bacterial antigen, a fungal antigen, or a parasitic antigen.

[0192] Embodiment 33 is the kit of embodiment 32, wherein the infectious disease antigen is a viral antigen.

[0193] Embodiment 34 is the kit of embodiment 33, wherein the viral antigen is derived from a virus selected from the group consisting of adenovirus, arbovirus, astrovirus, coronavirus, coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus ("CMV"), dengue virus, Ebola virus, Epstein-Barr virus ("EBV"), foot-and-mouth disease virus, Guanarito virus, Hendra virus, herpes simplex virus 1 ("HSV-1"), herpes simplex virus 2 ("HSV-2"), human herpesvirus 6 ("HHV-6"), human herpesvirus 8 ("HHV-8"), hepatitis A virus ("HAV"), hepatitis B virus ("HBV"), hepatitis C virus ("HCV"), hepatitis D virus ("HDV"). V"), Hepatitis E virus ("HEV"), Human Immunodeficiency Virus ("HIV"), Influenza virus, Japanese Hepatitis Virus ("JHV"), Encephalitis virus, Junin virus, Lassa virus, Machupo virus, Marburg virus, Measles virus, Human Metapneumovirus, Molluscum contagiosum virus, Mumps virus, Newcastle disease virus, Nipah virus, Norovirus, Norwalk virus, Human Papillomavirus ("HPV"), Parainfluenza virus, Parvovirus, Poliovirus, Rabies virus, Respiratory Syndrome virus ("RSV"), Rhinovirus, Rotavirus, Rubella virus, Sabia virus, Severe Acute Respiratory Syndrome virus ("SARS"), Varicella-Zoster virus, Smallpox virus, West Nile virus, and Yellow Fever virus.

[0194] Embodiment 35 is the kit of embodiment 32, wherein the infectious disease antigen is a bacterial antigen.

[0195] The 36-year-old is a slightly less expensive one Material: Bacillus anthracis pneumoniae、Chlamydia trachomatis、Chlamydophila psittaci、Clostridium botulinum、Clostridium difficile、Clostridium perfringens、Clostridium tetani、Corynebacterium diptheriae、Enterococcus faecalis、Enterococcus faecium、Escherichia coli、Enterotoxigenic Escherichia coli、Enteropathogenic Escherichia coli、Escherichia coli)157:H7 interrogans、Listeria monocytogenes、Mycobacterium leprae、Mycobacterium tuberculosis、Mycoplasma pneumoniae、Neisseria gonorrhoeae、Neisseria meningitides、Pseudomonas aeruginosa、Rickettsia rickettsia、Salmonella typhi、Salmonella typhimurium、Shigella sonnei、Staphylococcus aureus、Staphylococcus epidermidis、Staphylococcussaprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, and Yersinia pestis.

[0196] Embodiment 37 is the kit of embodiment 32, wherein the infectious disease antigen is a fungal antigen.

[0197] Embodiment 38 is the kit of embodiment 37, wherein the fungal antigen is derived from a fungus selected from the group consisting of Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Blastomyces dermatitidis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida parapsilosis, Candida rugosa, Candida tropicalis, Cryptococcus albidus, Cryptococcus gattii, Cryptococcus laurentii, Cryptococcus neoformans, Histoplasma capsulatum, Microsporum canis, Pneumocystis carinii, Pneumocystis jirovecii, Sporothrix schenckii, Stachabotrys chartarum, Tinea barbae, Tinea captitis, Tinea corporis, Tinea cruris, Tinea faciei, Tinea incognito, Tinea nigra, Tinea versicolor, Trichophyton rubrum and Trichophyton tonsurans.

[0198] Embodiment 39 is the kit of embodiment 32, wherein the infectious disease antigen is a parasitic antigen.

[0199] Embodiment 40 is the kit of embodiment 39, wherein the parasite antigen is derived from a parasite selected from the group consisting of Anisakis spp., Babesia spp., Baylisascaris procyonis, Cryptosporidium spp., Cyclospora cayetanensis, Diphyllobothrium spp., Dracunculus medinensis, Entamoeba histolytica, Giardia duodenalis, Giardia intestinalis, Giardia lamblia, Leishmania sp., Plasmodium falciparum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Taenia spp., Toxoplasma gondii, Trichinella spiralis, and Trypanosoma cruzi.

[0200] Embodiment 41 is the kit of embodiment 30, wherein the disease-associated antigen is a tumor-associated antigen.

[0201] Embodiment 42 is the kit of embodiment 41, wherein the tumor-associated antigen is selected from the group consisting of 5-alpha-reductase, alpha-fetoprotein ("AFP"), AM-1, APC, April, B melanoma antigen gene ("BAGE"), β-catenin, Bcl12, bcr-abl, Brachyury, CA-125, caspase-8 ("CASP-8", also known as "FLICE"), cathepsin, CD19, CD20, CD21 / complement receptor 2 ("CR2"), CD22 / BL-CAM, CD23 / F cεRII, CD33, CD35 / complement receptor 1 (“CR1”), CD44 / PGP-1, CD45 / leukocyte common antigen (“LCA”), CD46 / membrane cofactor protein (“MCP”), CD52 / CAMPATH-1, CD55 / decay-accelerating factor (“DAF”), CD59 / protectin, CDC27, CDK4, carcinoembryonic antigen (“CEA”), c-myc, cyclooxygenase-2 (“cox-2”), deleted in colorectal cancer (“DCC”), DcR3, E6 / E7, CGFR, EMBP, Dna78, farnesyltransferase Ze, fibroblast growth factor-8a (“FGF8a”), fibroblast growth factor-8b (“FGF8b”), FLK-1 / KDR, folate receptor, G250, G melanoma antigen gene family (“GAGE family”), gastrin 17, gastrin-releasing hormone, ganglioside 2 (“GD2”) / ganglioside 3 (“GD3”) / ganglioside monosialic acid-2 (“GM2”), gonadotropin-releasing hormone (“GnRH”), UDP-GlcNAc:R1Man(α1-6)R2[GlcNAc→Man(α1-6)]β1,6-N-acetylglucosaminyltransferase V (“GnT V”), GP1, gp100 / Pme117, gp-100-in4, gp15, gp75 / tyrosine-related protein-1 (“gp75 / TRP-1”), human chorionic gonadotropin (“hCG”), heparanase, Her2 / neu, human mammary tumor virus (“HMTV”), 70 kilodalton heat shock protein (“HSP70”), human telomerase reverse transcriptase (“hTERT”), insulin-like growth factor receptor-1 (“IGFR-1”), interleukin-13 receptor (“IL -13R”), inducible nitric oxide synthase (“iNOS”), Ki67, KIAA0205, K-ras, H-ras, N-ras, KSA, LKLR-FUT, melanoma antigen-encoding gene 1 (“MAGE-1”), melanoma antigen-encoding gene 2 (“MAGE-2”), melanoma antigen-encoding gene 3 (“MAGE-3”), melanoma antigen-encoding gene 4 (“MAGE-4”), mammaglobin, MAP17, melanin A / melanoma antigen recognized by T cells 1 (“MART-1”), mesothelin, MIC A / B, MT-MMP, mucin, testis-specific antigen NY-ESO-1, osteonectin, p15, P170 / MDR1, p53, p97 / melanotransferrin, PAI-1, platelet-derived growth factor ("PDGF"), μPA, PRAME, probasin, progenipoietin, prostate-specific antigen ("PSA"), prostate-specific membrane antigen ("PSMA"), prostatic acid phosphatase ("PAP"), RAGE-1, Rb, RCAS1, SART-1, SSX family, STAT3, STn, TAG-72, transforming growth factor alpha ("TGF-α"), transforming growth factor beta ("TGF-β"), thymosin beta 15, tumor necrosis factor alpha ("TNF-α"), TP1, TRP-2, tyrosinase, vascular endothelial growth factor ("VEGF"), ZAG, p16INK4, and glutathione S-transferase ("GST").

[0202] Embodiment 43 is the kit according to any one of embodiments 27 to 34, wherein the antigen protein is any one of a structural protein and a non-structural protein of EBV.

[0203] Embodiment 44 is the kit of embodiment 43, wherein the antigen protein is selected from gp350, gH, gL, EBNA3A, and BRLF1 / BZLF1 fusion.

[0204] Embodiment 45 is the kit of embodiment 44, wherein the antigenic proteins are encoded by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:4.

[0205] Embodiment 46 is a kit according to any one of embodiments 27 to 45, wherein the saRNA is VRP, preferably VEEV, more preferably TC83.

[0206] Embodiment 47 is a kit according to any one of embodiments 27 to 45, wherein the MVA is MVA-BN.

[0207] Embodiment 48 is the kit of embodiment 46, wherein the VRP in the first composition comprises a nucleic acid encoding an antigen protein selected from the group consisting of gp350, gH, and gL.

[0208] Embodiment 49 is the kit of embodiment 48, wherein the antigenic proteins are encoded by SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0209] Embodiment 50 is a kit according to any one of embodiments 27 to 49, used to generate a protective immune response against an infectious disease or a tumor-related disease, wherein the first composition is used to prime the immune response and the second composition is used to enhance the immune response.

[0210] Embodiment 51 is a kit described in any one of embodiments 27 to 49, which is used to generate a protective immune response against an infectious disease or a tumor-related disease, wherein the second composition is used to prime the immune response and the first composition is used to enhance the immune response.

[0211] Embodiment 52 is a kit according to any one of embodiments 1 to 51, wherein the boosting composition comprises two or more doses of the vector of the boosting composition.

[0212] Embodiment 53 is a vaccine combination according to any one of embodiments 1 to 23, a vaccine combination for use according to any one of embodiments 24 to 26, a kit according to any one of embodiments 27 to 49, or a kit for use according to any one of embodiments 50 to 52, wherein the MVA used to generate the recombinant virus is an MVA-BN virus or derivative that is capable of reproductive replication in vitro in chicken embryo fibroblast (CEF) cells but not in the human keratinocyte cell line HaCat, the human osteosarcoma cell line 143B, the human embryonic kidney cell line 293, or the human cervical adenocarcinoma cell line HeLa.

[0213] Embodiment 54 is a vaccine combination according to any one of embodiments 1 to 23, a vaccine combination for use according to any one of embodiments 24 to 26, a kit according to any one of embodiments 27 to 49, or a kit for use according to any one of embodiments 50 to 52, wherein the MVA used to generate the recombinant virus is MVA-BN deposited at the European Collection of Animal Cell Cultures (ECACC) under accession number V00083008.

[0214] Embodiment 55 is the use of a vaccine combination according to any one of embodiments 1 to 23 or a kit according to any one of embodiments 27 to 49 for the manufacture of a pharmaceutical composition or a medicament for the treatment and / or prevention of an infectious disease.

[0215] Embodiment 56 is a pharmaceutical composition comprising a vaccine combination according to embodiments 1 to 23 and a pharmaceutically acceptable carrier, diluent and / or excipient.

[0216] Embodiment 57 is a method of inducing an immune response to a virus in a subject, the method comprising administering to the subject: (a) a first composition comprising an immunologically effective amount of saRNA comprising a nucleic acid encoding an antigen protein and a pharmaceutically acceptable carrier; and (b) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier. (One of the compositions is a priming composition and the other composition is a boosting composition).

[0217] Embodiment 58 is the method of embodiment 57, wherein a first composition is used to prime an immune response and a second composition is used to enhance the immune response.

[0218] Embodiment 59 is the method of embodiment 57, wherein the second composition is used to prime the immune response and the first composition is used to enhance the immune response.

[0219] Embodiment 60 is the method of any one of embodiments 57 to 59, wherein the disease-associated antigen is an infectious disease antigen or a tumor-associated antigen.

[0220] Embodiment 61 is the method of embodiment 60, wherein the disease-associated antigen is an infectious disease antigen.

[0221] Embodiment 62 is the method of embodiment 61, wherein the infectious disease antigen is a viral antigen, a bacterial antigen, a fungal antigen, or a parasitic antigen.

[0222] Embodiment 63 is the method of embodiment 62, wherein the infectious disease antigen is a viral antigen.

[0223] Embodiment 64 is the method of embodiment 63, wherein the viral antigen is derived from a virus selected from the group consisting of adenovirus, arbovirus, astrovirus, coronavirus, coxsackievirus, Crimean-Congo hemorrhagic fever virus, cytomegalovirus ("CMV"), dengue virus, Ebola virus, Epstein-Barr virus ("EBV"), foot-and-mouth disease virus, Guanarito virus, Hendra virus, herpes simplex virus type 1 ("HSV-1"), herpes simplex virus type 2 ("HSV-2"), human herpesvirus type 6 ("HHV-6"), human herpesvirus type 8 ("HHV-8"), hepatitis A virus ("HAV"), hepatitis B virus ("HBV"), hepatitis C virus ("HCV"), hepatitis D virus ("HDV"). "), Hepatitis E virus ("HEV"), Human Immunodeficiency Virus ("HIV"), Influenza virus, Japanese Hepatitis virus ("JHV"), Encephalitis virus, Junin virus, Lassa virus, Machupo virus, Marburg virus, Measles virus, Human Metapneumovirus, Molluscum contagiosum virus, Mumps virus, Newcastle disease virus, Nipah virus, Norovirus, Norwalk virus, Human Papillomavirus ("HPV"), Parainfluenza virus, Parvovirus, Poliovirus, Rabies virus, Respiratory Syndrome virus ("RSV"), Rhinovirus, Rotavirus, Rubella virus, Sabia virus, Severe Acute Respiratory Syndrome virus ("SARS"), Varicella-Zoster virus, Smallpox virus, West Nile virus, and Yellow Fever virus.

[0224] Embodiment 65 is the method of embodiment 62, wherein the infectious disease antigen is a bacterial antigen.

[0225] The 66-year-old is a slightly less expensive one The active ingredient in the 65-year-old group is: Bacillus anthracis pneumoniae、Chlamydia trachomatis、Chlamydophila psittaci、Clostridium botulinum、Clostridium difficile、Clostridium perfringens、Clostridium tetani、Corynebacterium diptheriae、Enterococcus faecalis、Enterococcus faecium、Escherichia coli、Enterotoxigenic Escherichia coli、Enteropathogenic Escherichia coli、Escherichia coli)157:H7 interrogans、Listeria monocytogenes、Mycobacterium leprae、Mycobacterium tuberculosis、Mycoplasma pneumoniae、Neisseria gonorrhoeae、Neisseria meningitides、Pseudomonas aeruginosa、Rickettsia rickettsia、Salmonella typhi、Salmonella typhimurium、Shigella sonnei、Staphylococcus aureus、Staphylococcus epidermidis、Staphylococcussaprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, and Yersinia pestis.

[0226] Embodiment 67 is the method of embodiment 62, wherein the infectious disease antigen is a fungal antigen.

[0227] Embodiment 68 is the method of embodiment 67, wherein the fungal antigen is derived from a fungus selected from the group consisting of Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus niger, Aspergillus terreus, Blastomyces dermatitidis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida parapsilosis, Candida rugosa, Candida tropicalis, Cryptococcus albidus, Cryptococcus gattii, Cryptococcus laurentii, Cryptococcus neoformans, Histoplasma capsulatum, Microsporum canis, Pneumocystis carinii, Pneumocystis jirovecii, Sporothrix schenckii, Stachbotrys chartarum, Tinea barbae, Tinea captitis, Tinea corporis, Tinea cruris, Tinea faciei, Tinea incognito, Tinea nigra, Tinea versicolor, Trichophyton rubrum, and Trichophyton tonsurans.

[0228] Embodiment 69 is the method of embodiment 62, wherein the infectious disease antigen is a parasitic antigen.

[0229] Embodiment 70 is the method of embodiment 69, wherein the parasite antigen is derived from a parasite selected from the group consisting of Anisakis spp., Babesia spp., Baylisascaris procyonis, Cryptosporidium spp., Cyclospora cayetanensis, Diphyllobothrium spp., Dracunculus medinensis, Entamoeba histolytica, Giardia duodenalis, Giardia intestinalis, Giardia lamblia, Leishmania sp., Plasmodium falciparum, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Taenia spp., Toxoplasma gondii, Trichinella spiralis, and Trypanosoma cruzi.

[0230] Embodiment 71 is the method of embodiment 60, wherein the disease-associated antigen is a tumor-associated antigen.

[0231] Embodiment 72 is the method of embodiment 71, wherein the tumor-associated antigen is selected from the group consisting of 5-alpha-reductase, alpha-fetoprotein ("AFP"), AM-1, APC, April, B melanoma antigen gene ("BAGE"), β-catenin, Bcl12, bcr-abl, Brachyury, CA-125, caspase-8 ("CASP-8", also known as "FLICE"), cathepsin, CD19, CD20, CD21 / complement receptor 2 ("CR2"), CD22 / BL-CAM, CD23 / F cεRII, CD33, CD35 / complement receptor 1 (“CR1”), CD44 / PGP-1, CD45 / leukocyte common antigen (“LCA”), CD46 / membrane cofactor protein (“MCP”), CD52 / CAMPATH-1, CD55 / decay-accelerating factor (“DAF”), CD59 / protectin, CDC27, CDK4, carcinoembryonic antigen (“CEA”), c-myc, cyclooxygenase-2 (“cox-2”), deleted in colorectal cancer (“DCC”), DcR3, E6 / E7, CGFR, EMBP, Dna78, farnesyltransferase Ze, fibroblast growth factor-8a (“FGF8a”), fibroblast growth factor-8b (“FGF8b”), FLK-1 / KDR, folate receptor, G250, G melanoma antigen gene family (“GAGE family”), gastrin 17, gastrin-releasing hormone, ganglioside 2 (“GD2”) / ganglioside 3 (“GD3”) / ganglioside monosialic acid-2 (“GM2”), gonadotropin-releasing hormone (“GnRH”), UDP-GlcNAc:R1Man(α1-6)R2[GlcNAc→Man(α1-6)]β1,6-N-acetylglucosaminyltransferase V (“GnT V”), GP1, gp100 / Pme117, gp-100-in4, gp15, gp75 / tyrosine-related protein-1 (“gp75 / TRP-1”), human chorionic gonadotropin (“hCG”), heparanase, Her2 / neu, human mammary tumor virus (“HMTV”), 70 kilodalton heat shock protein (“HSP70”), human telomerase reverse transcriptase (“hTERT”), insulin-like growth factor receptor-1 (“IGFR-1”), interleukin-13 receptor (“IL -13R”), inducible nitric oxide synthase (“iNOS”), Ki67, KIAA0205, K-ras, H-ras, N-ras, KSA, LKLR-FUT, melanoma antigen-encoding gene 1 (“MAGE-1”), melanoma antigen-encoding gene 2 (“MAGE-2”), melanoma antigen-encoding gene 3 (“MAGE-3”), melanoma antigen-encoding gene 4 (“MAGE-4”), mammaglobin, MAP17, melanin A / melanoma antigen recognized by T cells 1 (“MART-1”), mesothelin, MIC A / B, MT-MMP, mucin, testis-specific antigen NY-ESO-1, osteonectin, p15, P170 / MDR1, p53, p97 / melanotransferrin, PAI-1, platelet-derived growth factor ("PDGF"), μPA, PRAME, probasin, progenipoietin, prostate-specific antigen ("PSA"), prostate-specific membrane antigen ("PSMA"), prostatic acid phosphatase ("PAP"), RAGE-1, Rb, RCAS1, SART-1, SSX family, STAT3, STn, TAG-72, transforming growth factor alpha ("TGF-α"), transforming growth factor beta ("TGF-β"), thymosin beta 15, tumor necrosis factor alpha ("TNF-α"), TP1, TRP-2, tyrosinase, vascular endothelial growth factor ("VEGF"), ZAG, p16INK4, and glutathione S-transferase ("GST").

[0232] Embodiment 73 is the method according to any one of embodiments 57 to 64, wherein the antigenic protein is any one of a structural protein and a non-structural protein of EBV.

[0233] Embodiment 74 is the method of embodiment 73, wherein the antigen protein is selected from gp350, gH, gL, EBNA3A, and a BRLF1 / BZLF1 fusion.

[0234] Embodiment 75 is the method of embodiment 74, wherein the antigenic proteins are encoded by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:4.

[0235] Embodiment 76 is a method according to any one of embodiments 57 to 75, wherein the saRNA is VRP, preferably VEEV, more preferably TC83.

[0236] Embodiment 77 is the method of embodiments 57-75, wherein the MVA is MVA-BN.

[0237] Embodiment 78 is the method of embodiment 76, wherein the VRP in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH, and gL.

[0238] Embodiment 79 is the method of embodiment 78, wherein the antigenic proteins are encoded by SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0239] Embodiment 80 is the method of any one of embodiments 57-79, wherein the boosting composition is administered 1 to 12 weeks after administration of the priming composition.

[0240] Embodiment 81 is the method of any one of embodiments 57 to 81, wherein the boosting composition is administered to the subject two or more times.

[0241] Reference will now be made in detail to the exemplary embodiments of the invention, examples of which are illustrated in the accompanying drawings. [Example]

[0242] The following detailed examples are intended to contribute to a better understanding of the present invention. However, the present invention is not limited to the examples. Other embodiments of the present invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein.

[0243] Example 1: Materials and Methods Construction of recombinant MVA, VRP (alphavirus replicon particle), and adenovirus The following sections describe the construction of recombinant MVA, Ad, and VRP containing one or more heterologous nucleic acids expressing antigenic determinants of Epstein-Barr virus (EBV) glycoproteins and / or additional EBV proteins. All other constructs described herein are made using similar methods.

[0244] Construction of MVA-mBN443B (MVA-BN-EBV) MVA-BN-EBV (MVA-mBN443B) is based on the modified vaccinia Ankara-Bavarian Nordic (MVA-BN®) vector and encodes a fusion of the nonstructural protein EBNA3A and the early transactivator BRLF1 / BZLF1, as well as the structural glycoproteins (gp) gH and gL, and a truncated, soluble form of gp350 (amino acids 2-434) with a flexible linker and a GCN4 multimerization domain for multimerization. Nucleotide sequences, including promoter sequences and sequences required for cloning, were codon-optimized and synthesized. Individual EBV genes were cloned into transfer plasmids along with sequences homologous to the surrounding MVA sequences, where their respective insertion sites (intergenic regions IGR44 / 45 and IGR88 / 89) were targeted for insertion by homologous recombination.

[0245] Construction of VRP-BN011 (alphavirus replicon particle-based recombinant vaccine) The recombinant alphavirus replicon particle VRP-BN011 is a multivalent recombinant VRP encoding three EBV antigens. VRP-BN011 consists of a replicon derived from the attenuated VEEV TC83 strain expressing a soluble truncated gp350 (amino acids 2-434) with the GCN4 multimerization domain, gH, and gL proteins for multimerization. It is based on the sequence of the VEEV TC83 vaccine strain, in which the cap-env polyprotein sequence of the VEEV viral shell has been deleted and replaced with the listed genes of EBV. The three EBV genes are encoded on a polyprotein with 2A peptides between each sequence. The T2A and P2A peptide sequences are inserted between the three EBV coding sequences (EBV gp350-GCN4 and gH without a stop codon) to generate a separate protein that directs the missing peptide bond in the extended protein chain. Additionally, a furin cleavage site was inserted immediately downstream of the gH coding sequence to cleave the P2A sequence from the C-terminus of the maturing gH protein. A codon-optimized and synthesized sequence containing the necessary cloning sequences was used to prepare VRP stocks by cotransfecting HEK293T cells with three plasmids: a CMV promoter-driven packaging plasmid encoding cap or env, and a CMV-driven recombinant replicon containing EBV genes on a plasmid. The supernatant was harvested and subjected to sucrose cushion purification. Following infection and subsequent staining of double-stranded RNA (dsRNA) replicative intermediates with a dsRNA-specific mouse monoclonal antibody (J2, Jena Bioscience), the VRP stocks were titrated at several dilution levels and analyzed by FACS on Vero cells.

[0246] Construction of AdC68gp350 (an adenovirus vector-based recombinant vaccine) The adenoviral vector (AdC68) expresses a truncated, soluble form of the EBV gp350 protein (AdC68 gp350) with a flexible linker and a multimerization domain for multimer formation.

[0247] Multiplex enzyme-linked immunosorbent assay (ELISA) by Luminex EBV antigen gp350, gH / gL / gp42 complex, and gH-specific IgG antibodies were quantified in NHP serum samples using a multiplex ELISA. For this purpose, Luminex magnetic microspheres were coupled to either gp350 protein, gH / gL complex, or gH protein according to the manufacturer's instructions (xMAP® Antibody Coupling Kit, Luminex). Because each microsphere is uniquely addressable, multiple immunoassays can be performed simultaneously using the same sample in the same well. Briefly, to detect NHP IgG antibodies specific to EBV antigen gp350, gH / gL / gp42 complex, and gH, serum was incubated with antigen-coupled microspheres. Various serum dilutions were tested depending on the expected antibody levels (1:200–1:20,000). Additionally, a standard (human serum, purchased from BioIVT, lot number BRH1079042) was included in the analysis. After a washing step, the detection reagent (detection antibody: goat F(ab')2 anti-human IgG-Fc, PE conjugated, pre-absorbed, Abcam, Cat. No. 98596) is incubated with the antibody-bound microspheres. After an additional washing step, the multiplex ELISA plate is measured and analyzed using a Luminex® 200™ system and Luminex Xponent 3.1 software, respectively.

[0248] Neutralization test EBV-specific neutralizing antibodies in NHP serum samples were quantified using a flow cytometry-based neutralization test. Briefly, two-fold serial dilutions of test serum were prepared, and a defined amount of EBV was added to each serum dilution. After one hour, the serum-virus mixture was added to Ramos cells. Infected Ramos cells express EBV proteins. The following day, cells were stained with DAPI and a monoclonal EBV-specific antibody. The percentage of EBV-positive cells was analyzed using an LSRFortessa flow cytometer. Serum samples containing neutralizing antibodies resulted in a reduced percentage of EBV-positive cells. Conversely, serum samples lacking neutralizing antibodies showed the highest percentage of anti-EBV-stained cells. Uninfected "cell-only" wells were used to set the EBV-positive gate. The percentage of EBV-positive cells was used to calculate IC50 titers using GraphPad Prism software.

[0249] Enzyme-linked immunosorbent assay (ELISA) OVA-specific IgG in serum was measured. ELISA was performed by coating 96-well plates with 5 μg / ml OVA, followed by blocking with PBS containing 5% FCS / 0.05% Tween 20. IgG was detected using an HRP-conjugated antibody followed by TMB substrate. Absorbance was measured at 450 nm. ELISA titers were determined using linear regression analysis, and Log10 titers were calculated.

[0250] Example 2: Experimental Design The objective of this analysis was to evaluate and compare serum EBV-specific IgG and neutralizing antibodies induced by different prime-boost vaccination regimens using MVA-BN-EBV, VRP-BN011, and AdC68gp350 administered IM twice, 4 weeks apart, to cynomolgus macaques.

[0251] Twelve female cynomolgus monkeys were administered three different vaccines intramuscularly (in the right thigh) on days 1 and 29 of the treatment period. Terminal necropsies were performed after 6 weeks.

[0252] The main study design for each vaccine dose is summarized in Table 1. To determine immunogenicity from an antibody perspective, EBV-specific IgG and EBV-neutralizing antibodies against the EBV antigen gp350 were determined using multiplex ELISA and flow cytometry-based assays, respectively. Nonhuman primate (NHP) serum samples were analyzed pre-dose, pre-second dose, and 2 weeks (days 29 and 43) after the second dose.

[0253] [Table 2]

[0254] Example 3: Results and Conclusions In the sections that follow, the following abbreviations have been used:

[0255] [Table 3]

[0256] Example 4: Gp350-specific IgG antibody responses in NHPs The geometric mean concentrations (GM) of the EBVgp350-specific population are shown in Table 2 and Figure 2. The lower limit of quantification (LLOQ) was defined as 40 EU. Serum samples with less than 40 EU were reported as negative, corresponding to half the LLOQ of 20 EU.

[0257] Pre-dose serum samples from all groups (Groups 1 to 4) were negative.

[0258] On day 29 (4 weeks after the first dose), complete seroconversion was detected in almost all groups of NHPs as measured by multiplex ELISA. In group 1 (MVA / MVA), only one of three animals expressed measurable gp350-specific IgG. On day 29, the highest gp350-specific IgG concentrations were measured for groups 2 (VRP / MVA) and 4 (VRP / Ad), with GMs of 3563, 3891, and 3731, respectively.

[0259] Complete seroconversion was also observed for Group 1 (MVA / MVA) on Day 43 (2 weeks after the second dose). On Day 29, the second dose boosted gp350-specific antibody responses by 4-fold in Group 3 (VRP / VRP) and 7-fold in Group 2 (VRP / MVA) compared with the respective antibody concentrations. Group 2 had the highest gp350-specific IgG response, with a GM of 26.626 (individual concentrations ranging from 14.406 to 71453), followed by Groups 3 (VRP / VRP) and 4 (VRP / Ad) with GMs of 4800 (individual concentrations ranging from 1180 to 15.032) and 6090 (individual concentrations ranging from 5179 to 7225), respectively.

[0260] These results indicate that VRP significantly increased gp350-specific antibody responses in heterologous combination with Ad or MVA as a boost vaccination, and that the homologous combination of MVA or VRP had the least immunogenic effect in terms of gp350-specific antibody induction.

[0261] [Table 4]

[0262] Example 5: EBV-specific neutralizing antibody responses in NHPs EBV-specific neutralizing antibody responses were measured by flow cytometry-based neutralization assay in all serum samples from each group at pre-dose, day 29, and day 43. The geometric mean concentrations (GM) of the neutralizing groups are shown in Table 3 and Figure 3. The LLOQ was defined as a half-maximal inhibitory concentration (IC50) of 30. Serum samples with IC50s below 30 were reported as negative with an IC50 of 15, which corresponds to half the LLOQ.

[0263] Pre-dose serum samples from all groups (Groups 1 to 4) were negative.

[0264] On day 29 (4 weeks after the first dose), seroconversion was measured in two of three animals in groups 2 (VRP / MVA) and 3 (VRP / VRP), with 100% seroconversion detected in group 4 (VRP / Ad). No animals in group 1 (MVA / MVA) seroconverted at this time point. In general, neutralizing antibody concentrations were low (GM<50) in all seroconverted animals on day 29, regardless of their respective prime vaccinations.

[0265] On day 43 (2 weeks after the second dose), complete seroconversion was observed in all groups except group 1 (MVA / MVA), in which only two of three animals developed measurable neutralizing antibodies.

[0266] The second dose boosted neutralizing antibody levels 14-fold in Group 2 (VRP / MVA). The lowest boosting effect was observed in Group 1 (MVA / MVA, 3-fold), Group 3 (VRP / VRP, 4-fold), and Group 4 (VRP / Ad, 4-fold). The highest neutralizing antibody concentration, with a GM of 605 (individual concentrations ranging from 372 to 1572), was measured in Group 2 (VRP / MVA). Groups 4 (VRP / Ad), Group 3 (VRP / VRP), and Group 1 (MVA / MVA) had the lowest neutralizing antibody levels, with a GM of 176 (individual concentrations ranging from 145 to 219), a GM of 118 (individual concentrations ranging from 31 to 256), and a GM of 49 (individual concentrations ranging from 15 to 214), respectively.

[0267] These results correlated with gp350-specific IgG responses measured by multiplex ELISA, and VRP potently boosted neutralizing antibody responses in heterologous prime-boost combinations, whereas allogeneic prime-boost regimens with MVA or VRP were least immunogenic.

[0268] [Table 5]

[0269] In summary, heterologous prime-boost regimens using VRP as the prime vaccination and MVA as the booster vaccination were highly immunogenic in terms of gp350-specific IgG and neutralizing antibodies, whereas homologous vaccination regimens using MVA or VRP had the least immunogenic effect. A single vaccination with an unrelated vaccine candidate was not sufficient to induce a strong neutralizing antibody response.

[0270] Example 6: EBV-specific T cell responses in NHPs EBV-specific T cell responses were measured by ELISPOT in all blood PBMC samples from each group before administration, on day 29, and on day 43. 6 The spot-forming units (SFU) per PBMC are shown in Figure 4.

[0271] Pre-dose serum samples from the groups (groups 1–3) were below the LLOQ, except for group 4.

[0272] Eight days after the first administration, all four groups showed detectable Gp350-specific T cell responses, with no significant differences between groups. A second vaccination did not further enhance the Gp350-specific T cell responses in Groups 1 (MVA / MVA), 3 (VRP / VRP), and 4 (VRP / Ad) (except Group 2 (VRP / MVA)), which was greater than 1 × 10 6 A further increase in SFU per PBMC was observed (Fig. 4). The data indicate that heterologous immunization with VRP / MVA not only produced superior antibody induction but also the highest EBV-specific T cell response.

[0273] Example 7: EBV-specific T cell responses in mice To assess T cell immunogenicity, mice were primed / boosted with MVA-EBV or VRP-EBV in homologous or heterologous combinations on days 0 and 21 (see Table 4). Two weeks after the boost, the experiment was terminated.

[0274] [Table 6]

[0275] Prior to this experiment, a peptide library screening approach was used to identify immunodominant peptides within Gp350. Three peptides (designated peptide 1, peptide 25, and peptide 26) were identified that were efficiently recognized by T cells after immunization (data not shown). Therefore, these three peptides were used in ELISPOT and 6-hour restimulation assays in the experiments reported below. Figure 5 shows that homologous immunization with MVA / MVA or VRP / VRP induced little T cell response against EBV. In contrast, heterologous immunization with VRP followed by MVA induced only a small number of SFU / 1 × 10 6 The number of EBV-specific T cells was dramatically increased by this immunization regimen, and peptides 25 and 26 were more potent than peptide 1.

[0276] Example 8: OVA-specific T cell responses in mice To investigate whether the advantages of the heterologous combination of VRP and MVA platforms apply to other antigens besides EBV, another experiment was set up. In this experiment, ovalbumin (OVA) was selected as a model antigen, and MVA-OVA and VRP-OVA were used for immunization accordingly (see Table 5). To evaluate the immunogenicity of T cells, mice were primed / boosted on days 0 and 21 using MVA-OVA or VRP-OVA in homologous or heterologous combinations (see Table 5). The experiment was terminated two weeks after the boost.

[0277] [Table 7]

[0278] The primary readout was CD8 T cell responses in peripheral blood 5 days after the boost immunization, and peptide restimulation of splenocytes against dominant and subdominant epitopes of OVA was performed on the day of mouse death (4 weeks after the boost).

[0279] Five days after the boost, when the groups were divided into allogeneic and heterologous treatments, the heterologous treatment showed the strongest response (Figure 6). At this time point, allogeneic treatment with VRP-OVA tended to produce a higher response than allogeneic MVA-OVA treatment (MVA / MVA), but this was not statistically significant. In contrast, boosting the initial VRP-OVA immunization with MVA-OVA immunization significantly enhanced the proliferation of OVA-specific CD8 T cells in the blood 5 days after the boost compared with MVA / MVA treatment and compared with VRP / VRP treatment (Figure 6).

[0280] Four weeks after the boost, the early memory response in splenocytes was examined. To this end, splenocytes were restimulated with the OVA257-264 SIINFEKL peptide and the OVA55-62 subdominant peptide. As shown in Figure 7, combining VRP-OVA prime immunization with MVA-OVA boost immunization resulted in the strongest responses to both the OVA257-264 and OVA55-62 peptides.

[0281] Interestingly, all treatment combinations alone were able to induce OVA257-264 peptide-specific responses, whereas responses to the subdominant OVA55-62 peptide were detected only in the heterologous combination group. This indicates that combining VRP-OVA prime immunization with MVA-OVA boost immunization not only resulted in stronger but also broader immune responses, which are rarely achieved by homologous treatment alone.

[0282] Example 9: OVA-specific CD8 T cell responses in mice We further examined the production of OVA-specific antibodies induced by homologous or heterologous combinations of the VRP-OVA and MVA-OVA platforms. To evaluate antibody immunogenicity, mice were primed / boosted on days 0 and 21 using MVA-OVA or VRP-OVA in homologous or heterologous combinations (see Table 5). Antibody production was measured in serum on days 14 and 35, respectively, 14 days after prime and boost immunizations. As shown in Figure 8, the highest total IgG titers and complete seroconversion were achieved with immunization with VRP-OVA on day 14, whereas mice immunized with MVA-OVA exhibited slightly weaker antibody responses. After the boost immunization (day 35), OVA-specific antibody levels increased in all treatment groups, indicating complete seroconversion, but there was a clear advantage to boosting VRP-OVA prime immunization with MVA-OVA immunization.

[0283] In summary, combining VRP-OVA prime immunization with MVA-OVA boost immunization enhanced the proliferation of antigen-specific CD8+ T cells in peripheral blood and increased the qualitative responses of antigen-specific CD8+ T cells to both dominant and subdominant OVA epitopes. An advantage of heterologous VRP / MVA immunization was also observed in terms of antibody induction.

[0284] Example 10: Gp350-specific T cell responses in mice Previously, the above experiments were performed using VRPs based on Venezuelan equine encephalitis virus (VEEV). However, VRPs can also be based on other alphaviruses. Therefore, we generated Semliki Forest virus (SFV)-based VRPs to investigate whether this type of VRP could also induce a strong immune response or whether it would be even more immunogenic than VEEV-based VRPs. To this end, we tested the immunogenicity of SFV-based VRPs expressing the EBV antigens gp350, gH, and gL (SFV-VRP-EBV).

[0285] To assess T cell immunogenicity, mice were primed / boosted with MVA-EBV or SFV-VRP-EBV in homologous or heterologous combinations on days 0 and 21 (see Table 6). Two weeks after the boost, the experiment was terminated.

[0286] [Table 8]

[0287] Prior to this experiment, a peptide library screening approach was used to identify immunodominant peptides within Gp350. Three peptides (designated peptide 1, peptide 25, and peptide 26) were identified that were efficiently recognized by T cells after immunization (data not shown). Therefore, these three peptides were used in ELISPOT and 6-hour restimulation assays in the experiments reported below. Figure 9 shows that allogeneic immunization with MVA / MVA induced little T cell response against EBV. In contrast, SFV-VRP induced high EBV-specific T cell responses against EBV (Figure 9). Importantly, heterologous immunization with SFV-VRP followed by MVA induced a high SFU / 1 × 10 6 The number of EBV-specific T cells was dramatically increased by this immunization regimen, and peptides 25 and 26 were more potent than peptide 1.

[0288] In conclusion, heterologous immunization with Venezuelan equine encephalitis virus (VEEV) or Semliki Forest virus (SFV)-based VRP is a potent inducer of T cells specific for the vaccine-encoded antigen.

[0289] array SEQ ID NO: 1 Nucleic acid sequence of gp350 multimer (1455 nucleotides). [ka]

[0290] SEQ ID NO: 2 Nucleic acid sequence of gH (2121 nucleotides). [ka]

[0291] SEQ ID NO: 3 Nucleic acid sequence of gL (414 nucleotides). [ka]

[0292] SEQ ID NO: 4 Nucleic acid sequence of BZLF1-BRLF1 (2283 nucleotides). [ka]

[0293] SEQ ID NO: 5 Nucleic acid sequence of EBNA3A (2892 nucleotides). [ka]

[0294] SEQ ID NO: 6: Nucleic acid sequence of one loxPV site. ATAACTTCGTATAGGATACTTTATACGAAGTTAT

[0295] SEQ ID NO: 7 Nucleic acid sequence of the Pr13.5 long promoter. taaaaatagaaactataatcatataatagtgtaggttggtagtattgctcttgtgactagagactttagttaaggtactgtaaaaatagaaactataatcatataatagtgtaggttggtagta

[0296] SEQ ID NO: 8 Nucleic acid sequence of the PrS promoter. aaaaattgaaattttatttttttttttggaatataa

[0297] SEQ ID NO: 9 Nucleic acid sequence of the PrH5m promoter. taaaaattgaaaataaatacaaaggttcttgagggttgtgttaaattgaaagcgagaaataatcataaataatttcattatcgcgatatccgttaagtttgtatcgta

[0298] SEQ ID NO: 10 Nucleic acid sequence of the Pr1328 promoter. tatattattaagtgtggtgtttggtcgatgtaaaatttttgtcgataaaaattaaaaaataacttaatttattattgatctcgtgtgtacaaccgaaatc

[0299] SEQ ID NO: 11 Nucleic acid sequence of 2A peptide (T2A). AGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT

[0300] SEQ ID NO: 12 Nucleic acid sequence of 2A peptide (P2A). GGATCCGGCGCCACCAATTTCTCCCTGCTGAAACAGGCCGGCGATGTGGAAGAGAATCCAGGCCCT

[0301] SEQ ID NO: 13: Nucleic acid sequence of the flexible linker and GCN4 multimerization domain CCTAAGCCCAGCACACCTCCTGGCAGCTCTTGTGGAGGCATGAAAGTGAAGCAGCTGGTGGACAAGGTGGAAGAACTGCTGAGCAAGAACTACCACCTCGTGAATGAGGTGGCACGGCTCGTGAAGCTCGTGGGAGAAAGAGGTGGC

Claims

1. A vaccine combination comprising: (c) a first composition comprising an immunologically effective amount of saRNA comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier; and (d) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier; The vaccine combination, wherein one of the compositions is a priming composition and the other composition is a boosting composition.

2. 2. The vaccine combination of claim 1, wherein the first composition is used to prime an immune response and the second composition is used to enhance the immune response.

3. 2. The vaccine combination of claim 1, wherein the second composition is used to prime an immune response and the first composition is used to enhance the immune response.

4. The vaccine combination according to any one of claims 1 to 3, wherein the antigenic protein is an infectious disease antigen or a tumor-associated antigen.

5. The vaccine combination of claim 4 , wherein the antigenic protein is an infectious disease antigen.

6. The vaccine combination of claim 5 , wherein the antigenic protein is a viral antigen.

7. 7. The vaccine combination of claim 6, wherein the viral antigen is derived from Epstein-Barr virus ("EBV").

8. The vaccine combination according to any one of claims 1 to 7, wherein the antigenic protein is any of a structural protein and a non-structural protein of EBV.

9. 9. The vaccine combination of claim 8, wherein the antigenic protein is selected from gp350, gH, gL, EBNA3A, and BRLF1 / BZLF1 fusion.

10. 10. The vaccine combination of claim 9, wherein the antigenic proteins are encoded by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:

4.

11. 11. The vaccine combination of any one of claims 1 to 10, wherein the saRNA is a VRP, preferably based on an alphavirus, more preferably based on VEEV, even more preferably based on TC83.

12. A vaccine combination according to any one of claims 1 to 10, wherein the MVA is MVA-BN.

13. 12. The vaccine combination of claim 11, wherein the VRP in said first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH, and gL.

14. 14. The vaccine combination of claim 13, wherein the antigenic proteins are encoded by SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:

3.

15. 15. A vaccine combination according to any one of claims 1 to 14, for use in generating a protective immune response against an infectious or tumor-related disease, wherein the first composition is used to prime the immune response and the second composition is used to enhance the immune response.

16. 15. The vaccine combination of any one of claims 1 to 14, for use in generating a protective immune response against an infectious or tumor-related disease, wherein the second composition is used to prime the immune response and the first composition is used to enhance the immune response.

17. The vaccine combination of any one of claims 1 to 16, wherein the boosting composition comprises two or more doses of the vector of the boosting composition.

18. A kit comprising: (c) a first composition comprising an immunologically effective amount of saRNA comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier; and (d) a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier; The kit, wherein one of the compositions is a priming composition and the other composition is a boosting composition.

19. 20. The kit of claim 18, wherein the first composition is used to prime an immune response and the second composition is used to enhance the immune response.

20. 20. The kit of claim 18, wherein the second composition is used to prime an immune response and the first composition is used to enhance the immune response.

21. The kit according to any one of claims 18 to 20, wherein the antigen protein is an infectious disease antigen or a tumor-associated antigen.

22. 22. The kit of claim 21, wherein the disease-associated antigen is an infectious disease antigen.

23. 23. The kit of claim 22, wherein the infectious disease antigen is a viral antigen.

24. 24. The kit of claim 23, wherein the viral antigen is derived from Epstein-Barr virus ("EBV").

25. The kit according to any one of claims 18 to 24, wherein the antigen protein is any one of a structural protein and a non-structural protein of EBV.

26. 26. The kit of claim 25, wherein the antigen protein is selected from gp350, gH, gL, EBNA3A, and a BRLF1 / BZLF1 fusion.

27. 27. The kit of claim 26, wherein the antigenic proteins are encoded by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:

4.

28. The kit of any one of claims 18 to 27, wherein the saRNA is based on a VRP, preferably an alphavirus, more preferably a VEEV-based, even more preferably a TC83-based.

29. The kit according to any one of claims 18 to 27, wherein the MVA is MVA-BN.

30. 29. The kit of claim 28, wherein the VRP in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH, and gL.

31. The kit of claim 30, wherein the antigenic proteins are encoded by SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:

3.

32. 32. The kit of any one of claims 18 to 31, for use in generating a protective immune response against an infectious or tumor-related disease, wherein the first composition is used to prime the immune response and the second composition is used to enhance the immune response.

33. 32. The kit of any one of claims 18 to 31, for use in generating a protective immune response against an infectious or tumor-related disease, wherein the second composition is used to prime the immune response and the first composition is used to enhance the immune response.

34. The kit of any one of claims 18 to 33, wherein the boosting composition comprises two or more doses of the vector of the boosting composition.

35. 35. The vaccine combination according to any one of claims 1 to 14, the vaccine combination for use according to any one of claims 15 to 17, the kit according to any one of claims 18 to 31, and the kit for use according to any one of claims 32 to 34, wherein the MVA used to generate the recombinant virus is MVA-BN virus or a derivative thereof, which is capable of reproductively replicating in vitro in chicken embryo fibroblast (CEF) cells but not in the human keratinocyte cell line HaCat, the human osteosarcoma cell line 143B, the human embryonic kidney cell line 293, and the human cervical adenocarcinoma cell line HeLa.

36. 35. The vaccine combination according to any one of claims 1 to 14, the vaccine combination for use according to any one of claims 15 to 17, the kit according to any one of claims 18 to 31, the kit for use according to any one of claims 32 to 34, wherein the MVA used to generate the recombinant virus is MVA-BN deposited at the European Collection of Animal Cell Cultures (ECACC) under accession number V00083008.

37. Use of a vaccine combination according to any of claims 1 to 14 or a kit according to any of claims 18 to 31 for the manufacture of a pharmaceutical composition or a medicament for the treatment and / or prevention of infectious diseases.

38. A pharmaceutical composition comprising a vaccine combination according to claims 1 to 14 and a pharmaceutically acceptable carrier, diluent and / or excipient.

39. 1. A method of inducing an immune response to a virus in a subject, the method comprising: (c) a first composition comprising an immunologically effective amount of saRNA comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier; and (d) administering to the subject a second composition comprising an immunologically effective amount of an MVA vector comprising a nucleic acid encoding an antigenic protein and a pharmaceutically acceptable carrier; The method, wherein one of the compositions is a priming composition and the other composition is a boosting composition.

40. 40. The method of claim 39, wherein the first composition is used to prime an immune response and the second composition is used to enhance the immune response.

41. 40. The method of claim 39, wherein the second composition is used to prime an immune response and the first composition is used to enhance the immune response.

42. The method of any one of claims 39 to 41, wherein the disease-associated antigen is an infectious disease antigen or a tumor-associated antigen.

43. 43. The method of claim 42, wherein the disease-associated antigen is an infectious disease antigen.

44. 44. The method of claim 43, wherein the infectious disease antigen is a viral antigen.

45. 45. The method of claim 44, wherein the viral antigen is derived from Epstein-Barr virus ("EBV").

46. The method according to any one of claims 39 to 45, wherein the antigenic protein is any one of the structural proteins and non-structural proteins of EBV.

47. 47. The method of claim 46, wherein the antigen protein is selected from gp350, gH, gL, EBNA3A, and BRLF1 / BZLF1 fusion.

48. 48. The method of claim 47, wherein the antigenic proteins are encoded by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO:

4.

49. 49. The method of any one of claims 39 to 48, wherein the saRNA is based on a VRP, preferably an alphavirus, more preferably based on VEEV, even more preferably based on TC83.

50. The method of claims 39 to 48, wherein the MVA is MVA-BN.

51. 50. The method of claim 49, wherein the VRP in the first composition comprises a nucleic acid encoding an antigenic protein selected from the group consisting of gp350, gH, and gL.

52. 52. The method of claim 51 , wherein the antigenic proteins are encoded by SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:

3.

53. 53. The method of any one of claims 39 to 52, wherein the boosting composition is administered 1 to 12 weeks after administration of the priming composition.

54. 54. The method of any one of claims 39 to 53, wherein the boosting composition is administered to the subject two or more times.