Editable cell lines

Editable cell lines expressing antibody constant regions streamline the manufacturing process by integrating antibody variable regions directly, reducing time and costs while ensuring high productivity and stability.

JP2025525429APending Publication Date: 2025-08-05LONZA SALES AG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024576714
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-30
Filing Date
2023-06-29
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

Current antibody manufacturing processes are complex, time-consuming, and costly due to the need for vector construction, gene transfer, and clone selection, leading to potential deviations and defects.

Method used

The development of editable cell lines that express antibody constant regions, allowing for the introduction of antibody variable regions without the need for vector construction, thereby simplifying and accelerating the manufacturing process.

Benefits of technology

This approach reduces manufacturing time and costs by eliminating the need for vector construction and clone selection, providing a reliable and efficient platform for producing customized antibodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025525429000023
    Figure 2025525429000023
  • Figure 2025525429000024
    Figure 2025525429000024
  • Figure 2025525429000025
    Figure 2025525429000025
Patent Text Reader

Abstract

The present disclosure provides editable cell lines, including the use of gene editing proteins to produce these cell lines, which are capable of expressing antibody constant regions that can serve as platforms for antibody variable regions to produce customized antibodies.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure provides editable cell lines, including the use of gene editing proteins to produce these cell lines. By preparing editable cell lines that have the ability to be further modified to individually produce desired antibodies, the cost and time of the antibody manufacturing process can be reduced. [Background technology]

[0002] As the clinical adoption of advanced antibody therapies accelerates, attention is focused on the manufacturing strategies that underpin these therapies to benefit patients worldwide. Although antibody therapies hold great clinical potential, high manufacturing costs relative to reimbursement present a significant barrier to commercialization.

[0003] One of the challenges facing antibody therapy is the complex, multi-step manufacturing process required to produce the desired antibody. Current manufacturing processes rely on introducing vectors to construct cell lines to express genes of interest and obtain the desired antibody. This process requires vector construction for each new antibody to be expressed, followed by gene transfer and pool harvest. This process also requires clone selection to find high-producing clones, which is time-consuming as each clone requires stability evaluation, leading to potential deviations and defects.

[0004] To overcome these challenges, what is needed is a method to shorten and simplify the manufacturing process. Editable cell lines can express antibody constant regions and serve as platforms for antibody variable regions, eliminating the need for vector construction and providing a reliable antibody manufacturing platform. The present invention fulfills these needs. Summary of the Invention

[0005] In some embodiments, the disclosure provides a cell comprising a genomic nucleic acid sequence, the cell comprising: a first sequence encoding antibody heavy chain constant regions 1, 2, and 3, where the first sequence is not adjacent to a sequence encoding an antibody heavy chain variable region; and a second sequence encoding antibody light chain constant region 1, where the second sequence is not adjacent to a sequence encoding an antibody light chain variable region.

[0006] In a further embodiment, a method of producing an editable cell is provided, the method comprising: providing a cell that stably expresses a genomic nucleic acid sequence of an antibody comprising a variable heavy chain region sequence, a constant heavy chain region 1, 2, and 3 sequence, a variable light chain region sequence, and a constant light chain region 1 sequence; excising the sequence encoding the variable heavy chain region with a gene editing protein; and excising the variable light chain region sequence with a gene editing protein.

[0007] Also provided herein is a method of making an antibody producing editable cell, the method comprising: providing a cell comprising a genomic nucleic acid sequence, the genomic nucleic acid sequence comprising: a first sequence encoding antibody heavy chain constant regions 1, 2, and 3, where the first sequence is not contiguous with sequence encoding an antibody heavy chain variable region; and a second sequence encoding antibody light chain constant region 1, where the second sequence is not contiguous with sequence encoding an antibody light chain variable region; introducing the sequence encoding the antibody heavy chain variable region into the cell; and introducing the sequence encoding the antibody light chain variable region into the cell. [Brief explanation of the drawings]

[0008] [Figure 1] FIG. 1 shows a schematic of how an intermediate headless antibody can be modified by the introduction of antibody variable regions to generate a desired customized antibody. [Figure 2A] 1 shows an exemplary representation of the production of an editable cell in which an antibody heavy chain variable region and an antibody light chain variable region are excised from a genomic antibody sequence. [Figure 2B]1 shows an exemplary representation of the production of an editable cell in which an antibody heavy chain variable region and an antibody light chain variable region are excised from a genomic antibody sequence. [Figure 3] 1 shows an exemplary representation of a genomic nucleic acid sequence into which a sequence encoding a gene-editing protein is introduced. [Figure 4] Knockout efficiency of various guide RNAs is shown. [Figure 5A] Excision efficiency as determined by PCR, FACS, and NGS is shown. [Figure 5B] Excision efficiency as determined by PCR, FACS, and NGS is shown. [Figure 5C] Excision efficiency as determined by PCR, FACS, and NGS is shown. [Figure 6] The editing efficiency of various guide RNAs is shown. [Figure 7A] Integration efficiency determined by PCR, FACS, and NGS. [Figure 7B] Integration efficiency determined by PCR, FACS, and NGS. [Figure 7C] Integration efficiency determined by PCR, FACS, and NGS. [Figure 8] Cell viability assessment performed using the Vi-Cell device is shown. [Figure 9] Transfection efficiency determined by PCR is shown. [Figure 10A] Integration efficiencies determined by PCR, FACS, and NGS are shown. [Figure 10B] Integration efficiencies determined by PCR, FACS, and NGS are shown. [Figure 10C] Integration efficiencies determined by PCR, FACS, and NGS are shown. [Figure 11A] Figure 1 shows the knockout efficiency of the light chain variable region of various gRNAs using TIDE analysis. [Figure 11B] 1 shows PCR validation of excision of the light chain variable region from a pre-existing antibody. [Figure 12A]Knockout efficiency of the light chain variable region of various gRNAs using TIDE analysis. [Figure 12B] PCR validation of the excision of the heavy chain variable region from Delta VL antibody. [Figure 12C] PCR validation of heavy chain variable regions from existing antibodies. [Figure 13] Figure 1 shows a schematic diagram of the generation of a headless cell line from a vector (BOB SSI). [Figure 14A] FIG. 1 shows the recovery of cells after transfection with vectors to generate headless cell lines. [Figure 14B] 1 shows FACS analysis demonstrating cassette integration into BOB cells using the SSI system. [Figure 15A] PCR validation of the generation of headless cell lines is shown. [Figure 15B] 1 shows WB validation of the generation of headless cell lines. [Figure 15C] 1 shows a FACS analysis validating the generation of a headless cell line. [Figure 16] Heavy chain variable region—A representation of the DNA template used for puromycin incorporation is shown. [Figure 17A] Figure 1 shows the recovery of cells after transfection of heavy chain variable regions and puromycin antibiotic selection. [Figure 17B] PCR validation showing the incorporation of the heavy chain variable region is shown. [Figure 18] A representation of the DNA template used for light chain variable region-blasticidin incorporation is shown. [Figure 19A] 1 shows transfection of the light chain variable region in Delta VH cells and cell recovery after blasticidin antibiotic selection. [Figure 19B] 1 shows PCR validation demonstrating integration of the light chain variable region in Delta VH cells. [Figure 20A] 1 shows successful transduction, selection, expansion, and cell banking of an inducible Cas9 BOB (SSI) cell line. [Figure 20B]RT-PCR analysis showing Cas9 mRNA expression after induction with DOX. [Figure 20C] ELISA analysis showing Cas9 protein expression after induction with DOX. [Figure 20D] 1 shows WB showing Cas9 protein expression after induction with DOX. [Figure 21A] Figure 1 shows PCR validation demonstrating successful generation of Delta VL iBOB cell line. [Figure 21B] 1 shows FACS analysis verifying successful generation of Delta VL iBOB cell lines. [Figure 21C] 1 shows PCR validation of seamless integration of the light chain variable region into delta VL cells to generate full antibodies in the iCas9 BOB cell line. DETAILED DESCRIPTION OF THE INVENTION

[0009] The words "a" or "an," when used in conjunction with the word "comprising" in the claims and / or specification, may mean "one," but may also be used consistently with the meanings of "one or more," "at least one," and "one or more than one."

[0010] Throughout this application, the term "about" is used to indicate that a value includes the variation of error inherent in the method / device being used to determine the value. Typically, the term is meant to encompass a variation of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% or less, depending on the context.

[0011] Although the use of the term "or" in the claims is used to mean "and / or" unless expressly stated to refer to alternatives only or the alternatives are not mutually exclusive, the present disclosure supports a definition that refers to alternatives only and "and / or."

[0012] As used in the specification and claim(s), the terms "comprising" (and any form of comprising, e.g., comprise and comprise), "having" (and any form of having, e.g., have and has), "including" (and any form of including, e.g., includes and include), or "containing" (and any form of containing, e.g., contains and contain) are inclusive or open-ended and do not exclude additional, unrecited, elements or method steps. It is contemplated that any embodiment discussed herein can be implemented with respect to any method, system, host cell, expression vector, and / or composition of the invention. Furthermore, the compositions, systems, cells, and / or nucleic acids of the invention can be used to achieve any of the methods described herein.

[0013] As described throughout, the present disclosure focuses on editable cell lines that are stable in embodiments, and highly productive in further embodiments, and that can be further modified to individually produce a desired customized antibody. The editable cell lines involve the use of gene editing proteins to further modify the genomic sequence encoding the headless antibody structure. The editable cell line may or may not express the headless antibody structure, as the headless antibody structure is an intermediate. However, once the editable cell line is fully modified with antibody variable regions, the cell line can be expressed to produce a fully customized antibody protein.

[0014] As used herein, a "headless antibody" refers to an antibody protein that does not contain an antibody variable region, but does contain a constant heavy chain region and a constant light chain region. The antibody variable region comprises a heavy chain variable region and a light chain variable region that define the antigen-binding site of the antibody protein. See, for example, FIG. 1, which shows a representation of an antibody containing a heavy chain constant region and a light chain constant region. The headless antibody structure can be modified and is merely an intermediate into which antibody variable regions can be introduced to produce a customized antibody protein.

[0015] As used herein, "genomic nucleic acid" or "genomic sequence" means a nucleic acid that is integrated into the genome of a cell. The term "genome" refers to the complete set of genetic information in the chromosomes of a cell.

[0016] As used herein, "nucleic acid," "nucleic acid molecule," or "oligonucleotide" refers to a polymeric compound comprising covalently linked nucleotides. The term "nucleic acid" includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which may be single-stranded or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA. RNA includes, but is not limited to, gRNA, mRNA, tRNA, rRNA, snRNA, microRNA, miRNA, or miRNA.

[0017] As used herein, "gene" refers to an assembly of nucleotides that encodes a polypeptide, and includes cDNA and genomic DNA nucleic acid molecules. "Gene" also refers to a nucleic acid fragment that can function as a regulatory sequence before (5' non-coding sequences) and after (3' non-coding sequences) the coding sequence. In some embodiments, the gene is integrated in multiple copies. In some embodiments, the gene is integrated in a predetermined number of copies.

[0018] As used herein, "stable" means that a cell line can maintain cellular integrity by using commonly used preservation methods and that the cells can maintain antibody production function over multiple cell divisions. In embodiments, the cell lines described herein are stable cell lines. As used herein, "high production" or "high expression" means producing a molecule of interest in an amount of at least about 1 g / L. The amount considered high production depends on the molecule of interest being produced and can be about 2 g / L, about 3 g / L, about 4 g / L, about 5 g / L, about 6 g / L, about 7 g / L, about 8 g / L, about 9 g / L, about 10 g / L, about 15 g / L, about 20 g / L or more. In embodiments, the cells provided herein are stable, high-expressing cells.

[0019] Figure 1 shows a schematic diagram of how an intermediate headless antibody can be modified by introducing antibody variable regions to generate a desired customized antibody. In Figure 1, the overlapping antibody structure represents the encoded and produced by expressing the DNA sequence. Thus, initially, this sequence represents the headless antibody. Then, the antibody variable regions are introduced into the genome. Finally, the complete structure of the customized antibody is expressed. Various methods for producing such headless antibody structures are described herein.

[0020] The editable cell line of the present disclosure preferably does not require the use of a DNA vector to introduce the gene sequence encoding the antibody for each antibody production. One commonly used method of producing antibodies requires the use of a recombinant DNA vector that is generated, cloned, and introduced into a host cell for each antibody production cycle. However, this common method relies on random / semi-random integration of the DNA vector into the host cell.

[0021] The editable cell line eliminates the need to produce a DNA vector, and can reduce the time and cost of commonly used antibody production methods by introducing the vector into host cells and selecting host cells that have the DNA vector present to produce antibodies. In the disclosed editable cell line, the sequence encoding the headless antibody is integrated into the genomic sequence of the host cell. Thus, once the editable cell is modified to produce a complete antibody, the cell can be selected and cloned to produce the antibody.

[0022] Editable cell lines can be produced by using existing high antibody-producing cell lines, and the sequences encoding the antibody variable regions are removed from the genomic sequence. The resulting cell line still contains the sequences encoding the remainder of the antibody structure, a headless antibody.

[0023] In some embodiments, provided herein are methods of producing an editable cell, wherein a sequence encoding a variable heavy chain region and a sequence encoding a variable light chain region are excised from a genomic sequence encoding a complete antibody of a suitably stable, and in some embodiments, highly expressing, cell.

[0024] In some embodiments, provided herein are methods of producing an editable cell, the method comprising: providing a cell that stably expresses a genomic nucleic acid sequence of an antibody comprising a variable heavy chain region sequence, constant heavy chain regions 1, 2, and 3 sequence, a variable light chain region sequence, and a constant light chain region 1 sequence; excising the sequence encoding the variable heavy chain region with a gene editing protein; and excising the variable light chain region sequence with a gene editing protein. In some embodiments, the sequence encoding the variable heavy chain region is excised with the gene editing protein before the sequence encoding the variable light chain region is excised. In some embodiments, the sequence encoding the variable light chain region is excised with the gene editing protein before the sequence encoding the variable heavy chain region is excised. In some embodiments, the sequence encoding the variable heavy chain region and the sequence encoding the variable light chain region are excised simultaneously.

[0025] Editable cell lines can also be produced by using a targeting vector encoding a headless antibody to integrate the sequence into the genomic sequence of existing high-antibody producing cells, which can be selected and cloned to produce cell lines capable of expressing the headless antibody and engineered to produce the full antibody.

[0026] In some embodiments, provided herein are methods of producing editable cells, in which a sequence encoding a headless antibody is integrated into the genomic sequence of a suitably stable, and in some embodiments, highly expressing, cell, in some embodiments, through site-specific integration of a vector comprising the sequence, the sequence encoding a headless antibody integrated into the genomic sequence of the cell.

[0027] In some embodiments, provided herein are methods of producing an editable cell, further comprising introducing a sequence encoding a gene-editing protein into a genomic nucleic acid sequence prior to excising the sequence encoding the variable heavy chain region and the variable light chain region, and expressing the gene-editing protein prior to excising the variable heavy chain region and the variable light chain region. In some embodiments, provided herein are methods of producing an editable cell, further comprising introducing a ribonucleoprotein (RNP) of a suitable gene-editing protein prior to excising the sequence encoding the variable heavy chain region and the variable light chain region. In some embodiments, provided herein are methods of producing an editable cell, further comprising introducing into the cell a plasmid comprising a sequence encoding a gene-editing protein prior to excising the sequence encoding the variable heavy chain region and the variable light chain region, and expressing the gene-editing protein sequence in the plasmid prior to excising the variable heavy chain region and the variable light chain region.

[0028] As used herein, the terms "engineered nuclease," "engineered gene-editing protein," or "gene-editing protein" refer to a nuclease that has been isolated, modified, mutated, and / or altered from its natural state as a nuclease. A "nuclease" refers to an enzyme that can cleave DNA and / or RNA molecules. By engineering a nuclease, the specific location of cleavage can be designed and tailored to a cell type and / or gene of interest.

[0029] Exemplary engineered nucleases that can be inserted into cells (either from integrated genomic nucleic acids, viruses, or other non-genomic nucleic acids, or produced as RNPs) include, for example, meganucleases, methyltransferases, zinc finger nucleases, transcription activator-like effector-based nucleases (TALENS), FokI nucleases, and CRISPR-associated (Cas) nucleases. Generally, engineered nucleases use DNA-binding proteins that possess both the desired catalytic activity and the ability to bind to a desired target sequence through protein-nucleic acid interactions in a manner similar to restriction enzymes. Examples include meganucleases, which are naturally occurring or engineered rare sequence cleavage enzymes; zinc finger nucleases (ZFNs), which contain a FokI catalytic nuclease subunit linked to a modified DNA-binding domain and can each cleave a specific sequence; or transcription activator-like nucleases (TALENs). In ZFNs, the binding domain consists of a chain of amino acids that folds into a customized zinc finger domain. Similarly, in TALENs, a 34-amino acid repeat derived from a transcription factor folds into a large DNA-binding domain. For gene targeting, these enzymes can cleave genomic DNA to form double-strand breaks (DSBs) or generate nicks, which can be repaired by one of two repair pathways: non-homologous end joining (NHEJ) or homologous recombination (HR). The NHEJ pathway can potentially result in specific mutations, deletions, insertions, or replacement events. The HR pathway results in the replacement of the target sequence with the supplied donor sequence. Exemplary FokI and methyltransferase-based systems are described in U.S. Patent No. 10,220,052 (the disclosure of which is incorporated herein by reference in its entirety).

[0030] Clustered regularly interspaced short palindromic repeats (CRISPR) and associated proteins (CRISPR-associated nucleases, or Cas proteins), comprising the CRISPR-Cas system, were first identified in select bacterial species and form part of the prokaryotic adaptive immune system. See Sorek et al., “CRISPR—a widespread system that provides acquired resistance against phages in bacteria and archaea,” Nat. Rev. Microbiol. 6(3)181-6(2008) (incorporated herein by reference in its entirety). CRISPR-Cas systems have been classified into three main types: Type I, Type II, and Type III. The main defining feature of the different types is the various cas genes used and the respective proteins they encode. The cas1 and cas2 genes appear to be universal across the three major types, while cas3, cas9, and cas10 are thought to be specific to Type I, Type II, and Type III systems, respectively. See, e.g., Barrangou, R. and Marraffini, LA, “CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity,” Mol. Cell. 54(2):234-44 (2014), which is incorporated by reference in its entirety.

[0031] In general, the CRISPR-Cas system functions by capturing short regions of invading viral or plasmid DNA and integrating the captured DNA into the host genome, spaced apart by repeat sequences within the CRISPR locus, to form so-called CRISPR arrays. This DNA capture into the CRISPR array is followed by transcription and RNA processing.

[0032] Depending on the bacterial species, CRISPR RNA processing proceeds differently. For example, in the Type II system first described in Streptococcus pyogenes, the transcribed RNA is paired with a transactivating RNA (tracrRNA) and then cleaved by RNase III to form individual CRISPR-RNAs (crRNAs). The crRNA is further processed after binding by Cas9 nuclease to produce mature crRNAs. The crRNA / Cas9 complex then binds to DNA (called a protospacer) containing a sequence complementary to the capture region. The Cas9 protein then cleaves both strands of DNA in a site-specific manner, forming double-strand breaks (DSBs). This provides DNA-based memory and leads to rapid degradation of viral or plasmid DNA upon repeated exposure and / or infection.

[0033] Since its initial discovery, multiple groups have conducted extensive research on the potential applications of CRISPR systems in genetic engineering, including gene editing (Jinek et al., “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science 337(6096):816-21 (2012); Cong et al., “Multiplex genome engineering using CRISPR / Cas systems,” Science 339(6121):819-23 (2013); and Mali et al., “RNA-guided human genome engineering via Cas9,” Science 339(6121):823-26, each of which is incorporated herein by reference in its entirety). One major development has been the use of chimeric RNAs targeting the Cas9 protein, designed around individual units from a CRISPR array fused to tracrRNA. This generates a single RNA species called a small guide RNA (gRNA), and sequence modifications in the protospacer region enable site-specific targeting of the Cas9 protein. Considerable research has been conducted to understand the nature of the base-pairing interaction between the chimeric RNA and the target site and its tolerance to mismatches, which is highly relevant for predicting and assessing off-target effects (see, e.g., Fu et al., "Improving CRISPR-Cas nucleases using truncated guide RNAs," Nature Biotechnology 32(3):279-84 (2014) and supporting materials, which are incorporated herein by reference in their entirety).

[0034] The CRISPR-Cas9 gene editing system has been successfully used in a wide range of organisms and cell lines to induce the formation of double-strand breaks using wild-type Cas9 protein or to nick single DNA strands using a mutant protein called Cas9n / Cas9 D10A (see, e.g., Mali et al., (2013) and Sander and Joung, “CRISPR-Cas systems for editing, regulating, and targeting genomes,” Nature Biotechnology 32(4):347-55 (2014) (each of which is incorporated herein by reference in its entirety). While the formation of double-strand breaks (DSBs) results in the generation of small insertions and deletions (indels) that can disrupt gene function, wild-type Cas9 as well as Cas9n / Cas9 D10A nickases avoid the generation of indels (a result of repair by non-homologous end joining) while stimulating endogenous homologous recombination machinery. Thus, these systems can be used to insert regions of DNA into genomes with high fidelity.

[0035] In some embodiments, provided herein are methods for producing editable cells, wherein the gene-editing protein utilized in the method to excise variable regions is a CRISPR-associated gene-editing protein. In preferred embodiments, the CRISPR-associated (Cas) nuclease is a Cas9 nuclease or other Cas nucleases, such as Cas12, Cas12i2, Cas13, Cas14, or MAD7 (Cas12a). In some embodiments, the Cas9 nuclease is a Cas9 nuclease with reduced immunogenicity, such as that disclosed in U.S. Published Patent Application No. 2018-0319850, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the gene-editing protein is a zinc finger nuclease. In some embodiments, the gene-editing protein is a TALENS. In some embodiments, the gene-editing protein is a FokI nuclease.

[0036] In addition to Cas9 nuclease, Cas12, Cas13, Cas14, and MAD7 (Cas12a) nucleases can also be utilized in the methods described herein. Cas12 generates staggered cuts in dsDNA (5-nucleotide 5' overhanging dsDNA cuts). Cas12 processes its own guide RNA, resulting in increased multiplexing capacity. Cas13t targets RNA, not DNA. When activated by a ssRNA sequence complementary to the crRNA spacer, nonspecific RNase activity is released, destroying all nearby RNAs regardless of their sequence. See, e.g., Yan et al., "CRISPR-Cas12 and Cas13: the lesser known siblings of CRISPR-Cas9," Cell Biology and Toxicology, pages 1-4 (August 29, 2019), the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, Cas12i2 nucleases can also be utilized in the methods described herein, such as those disclosed in U.S. Pat. No. 10,808,24, which is incorporated by reference in its entirety.

[0037] In further embodiments, provided herein are methods for producing editable cells, in which a gene-editing protein is used to excise a sequence from a genomic sequence of the cell. In some embodiments, excising the sequence encoding the variable heavy chain region with the gene-editing protein occurs at a first guide RNA target sequence and a second guide RNA target sequence, and excising the variable light chain region sequence with the gene-editing protein occurs at a third guide RNA target sequence and a fourth guide RNA target sequence. In some embodiments, the method further comprises introducing the first guide RNA and the second guide RNA. In some embodiments, the method further comprises introducing the third guide RNA and the fourth guide RNA. In some embodiments, the method further comprises introducing the guide RNA via a plasmid that transiently expresses the guide RNA.

[0038] 2A-2B show a representation of a method for producing editable cells by excising sequences encoding antibody variable regions from a genomic antibody sequence. VH represents the sequence encoding the variable heavy chain region, and VL represents the sequence encoding the variable light chain region of the antibody. CH1, CH2, and CH3 represent the sequences encoding constant heavy regions 1, 2, and 3 of the antibody, respectively. L represents a sequence encoding the constant light region of an antibody. CMV represents an exemplary promoter sequence, and the arrow indicates the direction of gene expression. As shown in Figure 2A, the sequence encoding the antibody variable region is excised from the genomic sequence through the use of gene editing proteins, with the first gRNA and second gRNA target sequence suitably targeted to excise the VH and the third gRNA and fourth gRNA target sequence to excise the VL. In Figure 2B, the promoter region has been excised, so no antibody is expressed. In other embodiments, a guide RNA sequence is not required, depending on the selection of the corresponding gene editing protein.

[0039] In some embodiments, provided herein are methods for producing editable cells in which a sequence encoding a gene-editing protein (genomically integrated) is operably linked to an inducible promoter. By placing the gene-editing protein under the control of an inducible promoter, the nuclease can be kept dormant or silenced prior to its desired use as a gene-editing tool. In some embodiments, the inducible promoter is a TET-on system.

[0040] As used herein, a "promoter," "promoter sequence," or "promoter region" refers to a DNA regulatory region / sequence capable of binding RNA polymerase and initiating transcription of a downstream coding or non-coding gene sequence. In other words, a promoter and a gene are in operable combination or operably linked. As referred to herein, the terms "in operable combination," "in operable order," "operably connected," and "operably linked" refer to the linking of nucleic acid sequences in such a manner as to produce a promoter capable of directing the transcription of a given gene and / or the synthesis of a desired protein molecule. The term also refers to the linking of amino acid sequences in such a manner as to produce a protein.

[0041] In some examples of the present disclosure, the promoter sequence includes a transcription initiation site and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at a level detectable above background. In some embodiments, the promoter sequence includes a transcription initiation site and a protein binding domain involved in the binding of RNA polymerase. Eukaryotic promoters often, but do not necessarily, include "TATA" boxes and "CAT" boxes.

[0042] A variety of promoters can be used to drive gene expression. In some embodiments, the promoter is an "inducible promoter," i.e., the promoter does not constitutively express any of the gene products described herein, but is activated in response to a specific stimulus that can be turned on or off depending on the desired regulation of the gene under the promoter's control. In other embodiments described herein, the promoter is a constitutive promoter that initiates mRNA synthesis independent of external regulatory influences.

[0043] Preferably, the promoter used to control the engineered nuclease is a derepressible promoter. As used herein, a "derepressible promoter" refers to a structure comprising a functional promoter and additional elements or sequences that can bind to a repression element, resulting in repression of the functional promoter. "Repression" refers to the reduction or inhibition of initiation of transcription of a downstream coding or non-coding gene sequence by the promoter. A "repression element" refers to a protein or polypeptide that can bind to a promoter (or near a promoter) to reduce or inhibit the promoter's activity. A repression element can interact with a substrate or binding partner of the repression element such that the repression element undergoes a conformational change. This conformational change of the repression element abolishes the ability of the repression element to reduce or inhibit the promoter, resulting in "derepression" of the promoter, thereby allowing the promoter to proceed with transcription initiation. A "functional promoter" refers to a promoter that is capable of transcription initiation in the absence of the action of a repression element. A variety of functional promoters that can be used in the practice of the present invention are known in the art, including, for example, promoters of PCMV, PH1, P19, P5, P40, and adenovirus helper genes (e.g., E1A, E1B, E2A, E4Orf6, and VA).

[0044] Described herein are examples of various regulatable promoters, including inducible promoters and derepressible promoters, as well as methods for inducing expression of a Cas9 nuclease through the introduction of a molecule that induces expression or derepresses a derepressible promoter.

[0045] Exemplary repression elements and their corresponding binding partners that can be used as derepressible promoters are known in the art, and include the cumate gene switch system (CuO operator, CymR repressor, and cumate binding partner) (see, e.g., Mullick et al., "The cumate gene-switch: a system for regulated expression in mammalian cells," BMC Biotechnology 6:43(1-18) (2006), the disclosure of which is incorporated herein by reference in its entirety, including the disclosure of the derepressible promoter system described therein) and the TetO / TetR system described herein (see, e.g., Yao et al., "Tetracycline Repressor, tetR, rather than the tetR-Mammalian Cell Transcription Factor Fusion Derivatives, Regulates Inducible Gene Expression in Mammalian Cells," Human Gene Therapy 9:1939-1950 (1998), the disclosure of which is incorporated herein by reference in its entirety. In exemplary embodiments, the derepressible promoter comprises a functional promoter and one of two tetracycline operator sequences (TetO or TetO2). In such embodiments, the nucleic acid introduced into the T cell further comprises a tetracycline repressor protein for controlling the TetO derepression system (TET-on system).

[0046] As described herein, the method can further include inducing expression of the CRISPR-associated nuclease by activating an inducible promoter. In the case of an inducible promoter (e.g., a 4HT-inducible promoter, a rapamycin-inducible promoter, a hormone-responsive element, or a glutamate-inducible promoter), the promoter is induced by adding, for example, 4-hydroxytamoxifen, rapamycin, a hormone, or glutamate, respectively. In the case of a derepressible promoter (e.g., a TetO sequence described herein linked to a CMV promoter), addition of doxycycline relieves repression and allows expression of the gene (engineered nuclease) via the CMV promoter. Preferably, the nucleic acid molecule encoding Cas9 also encodes a TetR repression element, preferably under the control of another promoter system, such as a constitutive promoter like the hPGK promoter.

[0047] In further embodiments, provided herein are methods of producing an antibody-producing cell, the method comprising providing a cell as described herein, introducing into a genomic nucleic acid sequence an antibody heavy chain variable region encoding sequence and a fifth guide RNA target sequence, and introducing into a genomic nucleic acid sequence an antibody light chain variable region encoding sequence and a sixth guide RNA target sequence. In some embodiments, the antibody heavy chain variable region encoding sequence and the fifth guide RNA target sequence are operably linked to a first sequence encoding antibody heavy chain constant regions 1, 2, and 3. In some embodiments, the antibody light chain variable region encoding sequence and the sixth guide RNA target sequence are operably linked to a second sequence encoding antibody light chain constant region 1.

[0048] In some embodiments, provided herein are methods of making antibody-producing cells, further comprising introducing a sequence encoding an antibody heavy chain variable region and a fifth guide RNA target sequence upstream of a first sequence encoding antibody heavy chain constant regions 1, 2, and 3. In some embodiments, provided herein are methods of making antibody-producing cells, further comprising introducing a sequence encoding an antibody light chain variable region and a sixth guide RNA target sequence upstream of a second sequence encoding antibody light chain constant region 1. In some embodiments, the method further comprises introducing a promoter sequence having a sequence encoding an antibody heavy chain variable region. In some embodiments, the method further comprises introducing a promoter sequence having a sequence encoding an antibody light chain variable region. In some embodiments, the promoter sequence is operably linked to a sequence encoding an antibody heavy chain variable region. In some embodiments, the sequence encoding the antibody heavy chain variable region is operably linked to a first sequence encoding antibody heavy chain constant regions 1, 2, and 3. In some embodiments, the promoter sequence is operably linked to a sequence encoding an antibody light chain variable region. In some embodiments, the sequence encoding the antibody light chain variable region is operably linked to a second sequence encoding the antibody light chain constant region 1.

[0049] In some embodiments, the method further comprises introducing a sequence encoding a selectable marker.

[0050] As used herein, the term "selectable marker" or "selectable marker gene" refers to a gene introduced into a cell that confers a trait suitable for artificial selection. Commonly used selectable markers are well known to those of skill in the art. Drug selectable markers such as ampicillin / carbenicillin, kanamycin, chloramphenicol, nourseothricin N-acetyltransferase, erythromycin, tetracycline, gentamicin, bleomycin, streptomycin, puromycin, hygromycin, blasticidin (blast), and G418 may be used. In other embodiments, selectable markers include, but are not limited to, human nerve growth factor receptor (detected with MAbs such as those described in U.S. Pat. No. 6,365,373), truncated human growth factor receptor (detected with MAbs), mutant human dihydrofolate reductase (DHFR; available fluorescent MTX substrate), secreted alkaline phosphatase (SEAP; available fluorescent substrate), human thymidylate synthase (TS; confers resistance to the anti-cancer drug fluorodeoxyuridine), human glutathione S-transferase alpha (GSTA1; conjugates glutathione to stem cell-selective alkylator sulfonate; CD3 These include the CD4+ chemoprotective selectable marker in CD4+ cells, the CD24 cell surface antigen on hematopoietic stem cells; the human CAD gene conferring resistance to N-phosphonoacetyl-L-aspartate (PALA); human multidrug resistance-1 (MDR-1; a P-glycoprotein surface protein selectable for increased drug resistance or enriched by FACS), human CD25 (IL-2 alpha; detectable by Mab-FITC), methylguanine-DNA methyltransferase (MGMT; selectable by calstatin), rhamnose, and cytidine deaminase (CD; selectable by Ara-C).

[0051] In some embodiments, the method for producing an editable cell is provided herein, wherein the gene-editing protein is a CRISPR-associated gene-editing protein. In preferred embodiments, the CRISPR-associated (Cas) nuclease is a Cas9 nuclease or may be other Cas nucleases such as Cas12, Cas12i2, Cas13, Cas14, MAD7 (Cas12a), etc. In some embodiments, the Cas9 nuclease is a Cas9 nuclease with reduced immunogenicity. In some embodiments, the gene-editing protein is a zinc finger nuclease. In some embodiments, the gene-editing protein is a TALENS. In some embodiments, the gene-editing protein is a FokI nuclease.

[0052] In some embodiments, provided herein are methods for producing editable cells, in which a sequence encoding a gene-editing protein is operably linked to an inducible promoter. By placing the gene-editing protein under the control of an inducible promoter, the nuclease can be kept dormant or silenced prior to its desired use as a gene-editing tool. In some embodiments, the inducible promoter is a TET-on system as described herein.

[0053] In some embodiments, provided herein are methods of producing an editable cell, the method further comprising introducing a first promoter operably linked to a sequence encoding constant heavy chain region 1, and introducing a second promoter operably linked to a sequence encoding constant light chain region 1.

[0054] As described herein, in embodiments, the editable cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell, a yeast cell, an insect cell, an algae cell, or a plant cell. In preferred embodiments, the cell is a Chinese hamster ovary (CHO) cell. Examples of CHO cells include, but are not limited to, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Xceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, CHOZN, GFP-positive CHO cells, HD7876 BOB cells, or CHO-derived cells. In some embodiments, the cell is a Chinese hamster ovary (CHO) cell.

[0055] In preferred embodiments, the cells are human embryonic kidney (HEK) cells. In some embodiments, the cells are selected from the group consisting of HeLa, HEK293, H9, HepG2, MCF7, Jurkat, NIH3T3, PC12, PER.C6, BHK, VERO, SP2 / 0, NS0, YB2 / 0, EB66, C127, L cells, COS, e.g., COS1 and COS7, QC1-3, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Exceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, and CHOZN.

[0056] In further embodiments, provided herein is a cell comprising a genomic nucleic acid sequence, the cell comprising: a first sequence encoding antibody heavy chain constant regions 1, 2, and 3, where the first sequence is not adjacent to a sequence encoding an antibody heavy chain variable region; and a second sequence encoding antibody light chain constant region 1, where the second sequence is not adjacent to a sequence encoding an antibody light chain variable region. See, e.g., Figures 2A and 2B, which illustrate embodiments in which the heavy and light chain regions are on the same genomic sequence. In embodiments, the first and second sequences can be on the same cross section of genomic DNA, including the same DNA strand. However, in other embodiments, the first and second sequences can be on different DNA strands, including on separate chromosomes. Additionally, the first and second sequences can be in any order.

[0057] In some embodiments, the cell further comprises a first promoter operably connected to the first sequence and a second promoter operably connected to the second sequence. In some embodiments, the cell further comprises a single promoter operably connected to either the first sequence or the second sequence, and the first and second sequences are operably connected to each other. In some embodiments, the first and second sequences do not have promoters connected to them.

[0058] In some embodiments, the cell further comprises a sequence encoding a gene-editing protein. In some embodiments, the gene-editing protein is a CRISPR-associated gene-editing protein. In preferred embodiments, the CRISPR-associated (Cas) nuclease is a Cas9 nuclease or may be another Cas nuclease, such as Cas12, Cas12i2, Cas13, Cas14, or MAD7 (Cas12a). In some embodiments, the Cas9 nuclease is a Cas9 nuclease with reduced immunogenicity. In some embodiments, the gene-editing protein is a zinc finger nuclease. In some embodiments, the gene-editing protein is a TALENS. In some embodiments, the gene-editing protein is a FokI nuclease. As described herein, the gene-editing protein may be included as part of a genomic sequence, or may be a separately provided sequence (e.g., via a vector), or may be as an RNP.

[0059] In some embodiments, the sequence encoding the gene-editing protein is operably linked to an inducible promoter. By placing the gene-editing protein under the control of an inducible promoter, the nuclease can be kept dormant or silenced prior to its desired use as a gene-editing tool. In some embodiments, the inducible promoter is a TET-on system as described herein.

[0060] 3 shows an exemplary schematic of the genomic sequence of an editable cell, including the first and second sequences and a sequence encoding a gene-editing protein (e.g., Cas9 as shown). The gene-editing protein is suitably operably linked to an inducible promoter so that the gene-editing protein can be kept dormant prior to its desired use as a gene-editing tool.

[0061] As described herein, the cell is preferably a eukaryotic cell. In some embodiments, the cell is a mammalian cell, a yeast cell, an insect cell, an algae cell, or a plant cell. In a preferred embodiment, the cell is a Chinese hamster ovary (CHO) cell. Examples of CHO cells include, but are not limited to, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Xceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, CHOZN, or a CHO-derived cell. In some embodiments, the cell is a Chinese hamster ovary (CHO) cell. In a preferred embodiment, the cell is a human embryonic kidney (HEK) cell. In some embodiments, the cells are selected from the group consisting of HeLa, HEK293, H9, HepG2, MCF7, Jurkat, NIH3T3, PC12, PER.C6, BHK, VERO, SP2 / 0, NS0, YB2 / 0, EB66, C127, L cells, COS, e.g., COS1 and COS7, QC1-3, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Exceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, and CHOZN.

[0062] Figure 13 shows a schematic diagram of the generation of a headless cell line by site-specific integration of a vector encoding a headless antibody into the genomic sequence of a host cell. Figure 14A shows the recovery of cells after transfection with the vector to generate a headless antibody cell line. As shown, the cell line treated with the vector exhibits increased cell viability compared to the control, indicating that the headless antibody sequence is successfully integrated into the genomic sequence. Figure 14B shows FACS analysis verifying the integration of the cassette.

[0063] Figures 15A-15C show further validation of successful production of headless antibody cell lines from vectors. Figure 15A shows validation by PCR, indicated by a band at 515 bp for delta VL compared to a band at 864 bp for the full ab product, and a band at 800 bp for delta VH compared to a band at 1,222 bp for the full antibody product. Figure 15B shows validation by Western blot, indicated by the full antibody bands in the left column compared to the headless antibody bands in the right column. Figure 15C shows validation by FACS analysis, where the headless antibody is expressed but does not bind to the CD20 antigen compared to the full antibody.

[0064] In some embodiments, the cells further comprise a sequence encoding a selectable marker.

[0065] In some embodiments, provided herein are methods of making an antibody-producing cell, further comprising introducing a promoter operably linked to a sequence encoding an antibody heavy chain region and a promoter operably linked to a sequence encoding an antibody light chain region. In some embodiments, the method further comprises introducing a promoter operably linked to a sequence encoding an antibody.

[0066] In some embodiments, provided herein are methods of making antibody-producing cells, further comprising introducing a first sequence encoding a first selectable marker and a second sequence encoding a second selectable marker. In some embodiments, the method further comprises selecting cells that express the antibody using the first selectable marker. In some embodiments, the method further comprises selecting cells that express the antibody using a second selectable marker. In some embodiments, the method further comprises selecting cells that express the antibody using the first and second selectable markers. In some embodiments, the method further comprises expressing the antibody in the cell.

[0067] Methods for expanding cells produced using the methods described herein, as well as methods for recovering the antibodies produced thereby, are known in the art and include, for example, various column filtration methods, washing steps, as well as bead-based magnetic separation methods.

[0068] It will be readily apparent to those skilled in the relevant art that other suitable modifications and adaptations to the methods and applications described herein can be made without departing from the scope of any of the embodiments.

[0069] While certain embodiments have been illustrated and described herein, it is to be understood that the claims are not limited to the specific forms or arrangements of elements described and shown. Although exemplary embodiments are disclosed herein and specific terms are employed, these terms are used in a generic and descriptive sense only and are not intended to be limiting. Modifications and variations of the embodiments are possible in light of the above teachings. It is therefore to be understood that the embodiments may be practiced otherwise than as specifically described.

[0070] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. [Example]

[0071] Example 1 Selection of sgRNA for excision of the light chain variable region from intact IgG method Subculture of SSI cells and sgRNA preparation Site-specific integration (SSI) cells expressing whole IgG antibodies (see, e.g., WO2020 / 072480) were added to 0.3 x 10 6Subculture the cells at a viable concentration of 1000 cells / mL into appropriately sized Erlenmeyer shake flasks containing CD-CHO medium supplemented with 6 mM L-glutamine. These cells are cultured for at least 4 days and up to 4 weeks, with a viability of greater than 90% prior to transfection.

[0072] sgRNA (3 nmol TrueGuide Synthetic sgRNA (Invitrogen, Catalog No. A35514)) was briefly centrifuged to collect the contents and resuspended in nuclease-free Tris-EDTA (TE) buffer to 100 μM to generate a stock solution. A 10 μM working solution was generated from this stock. All sgRNA solutions were stored at -20°C. The following seven sgRNA sequences were prepared: [Table 1]

[0073] Nucleofection General nucleofection conditions for each individual transfection were as follows: [Table 2]

[0074] Cas9 RNP complex mixtures for each of the above sgRNA sequences were prepared in seven Eppendorf tubes by mixing 3.2 μl of Cas9 protein with 3.2 μl of 10 μM sgRNA. Three control mixtures were also prepared using one Eppendorf tube containing 3.2 μl of Cas9 protein and 3.2 μl of TE buffer, and two Eppendorf tubes each containing 6.4 μl of TE buffer. The mixtures were incubated at room temperature for 30–60 minutes.

[0075] 10 7SSI cells expressing whole IgG antibodies were prepared for nucleofection by transferring 10 cells to a new tube and centrifuging at 300 g for 5 minutes to remove as much medium as possible. The cells were then resuspended in 736 μl of nucleofection solution (656 μl of SF solution with 144 μl of Supplement 1). 73.6 μl of cells were added to each of the 10 Cas9 RNP complex mixtures.

[0076] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a nucleofection 16-well strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of prewarmed CD-CHO medium supplemented with 6 mM L-glutamine warmed to 36.5°C was added and mixed. 20 μl of the final mixture was transferred to a 96-well plate containing 100 μl of CD-CHO medium supplemented with 6 mM L-glutamine and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0077] result Transfection efficiency was evaluated using PCR and TIDE analysis. The results are shown in Figure 4. Based on the transfection efficiency evaluation, sgRNA#1 and sgRNA#7 were selected.

[0078] Example 2: Complete excision of the light chain variable region from a whole IgG using Cas9 RNP complexes method SSI cells expressing whole IgG antibodies were subcultured in the same manner as described in Example 1. sgRNA#1 and sgRNA#7 were selected and prepared in the same manner as described in Example 1 for nucleofection.

[0079] The Cas9 RNP complex was prepared according to Table 1. [Table 3]

[0080] The complex was incubated at room temperature for 30-60 minutes.

[0081] 7x10 6 SSI cells expressing whole IgG antibodies were prepared for nucleofection by transferring cells to a new tube and centrifuging at 200 g for 5 minutes to remove as much medium as possible. The cells were then resuspended in 492.8 μl of nucleofection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of Supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0082] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a nucleofection 16-well strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of prewarmed CD-CHO medium warmed to 36.5°C was added and mixed. The entire 100 μl of the final mixture was transferred to a 12-well plate containing 1.5 ml of CD-CHO medium and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0083] result The excision efficiency was assessed using next-generation sequencing (NGS), PCR, and FACS. The results are shown in Figures 5A-5C. PCR (Figure 5A), FACS (Figure 5B), and NGS (Figure 5C) evaluations demonstrate clear and successful excision of the light chain variable region.

[0084] Example 3 Selection of sgRNA for seamless incorporation of light chain variable regions into IgG lacking light chain variable regions (Delta VL IgG) method SSI cells expressing Delta VL IgG antibody were passaged in the same manner as described in Example 1. sgRNA (TrueGuide Synthetic sgRNA 3 nmol (Invitrogen, Cat. No. A35514)) was prepared in the same manner as described for nucleofection in Example 1. The following three sgRNA sequences were prepared: [Table 4]

[0085] The Cas9 RNP complex was prepared according to Table 2. [Table 5]

[0086] The complex was incubated at room temperature for 30-60 minutes.

[0087] SSI cells expressing Delta VL antibodies (Delta VL-T1 and T2) were cultured at 2 × 10 of each cell type (Delta VL T1 and T2). 6 The cells were prepared for nucleofection by transferring them to a new tube and centrifuging at 200 g for 5 minutes to remove as much medium as possible. The cells were then resuspended in 588.8 μl of nucleofection solution (1200 μl of SF solution prepared by mixing 984 μl of SF solution with 216 μl of Supplement 1). 73.6 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0088] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a nucleofection 16-well strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of prewarmed CD-CHO medium warmed to 36.5°C was added and mixed. 20 μl of the final mixture was transferred to a 96-well plate containing 100 μl of CD-CHO medium and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0089] result Transfection efficiency was evaluated using PCR and NGS, and the results are shown in Figure 6. Based on the transfection efficiency evaluation, sgRNA#9 was selected.

[0090] Example 4 Seamless incorporation of light chain variable regions into IgG lacking light chain variable regions (Delta VL IgG) method SSI cells expressing Delta VL IgG antibody were subcultured in the same manner as described in Example 1. sgRNA#9 was selected and prepared in the same manner as described for nucleofection in Example 1. 100 μg of light chain variable region DNA template was briefly centrifuged to collect the contents and resuspended in 25 μl of TE buffer to obtain a concentration of 4 μg / μl.

[0091] The Cas9 RNP complex was prepared according to Table 3. [Table 6]

[0092] The complex was incubated at room temperature for 30-60 minutes.

[0093] 17x10 6SSI cells expressing the delta VL antibody were prepared for nucleofection by transferring 100 cells to a new tube and centrifuging at 200 g for 5 minutes to remove as much medium as possible. The DNA template listed in Table 3 was added to the appropriate prepared Cas9 RNP complex. The cells were then resuspended in 1196.8 μl of nucleofection solution (1250 μl of SF solution prepared by mixing 1025 μl of SF solution with 225 μl of Supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0094] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a nucleofection 16-well strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of preheated CD-CHO medium warmed to 36.5°C was added and mixed. 100 μl of the final mixture was transferred to a 12-well plate containing 1.5 ml of CD-CHO medium and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0095] result Integration efficiency was evaluated using PCR and TIDE assay. The results are shown in Figures 7A-7C. PCR (Figure 7A), FACS (Figure 7B), and NGS (Figure 7C) evaluations demonstrate clear and successful integration of the light chain variable region into delta VL antibody-expressing cells.

[0096] Example 5 Generation of inducible Cas9 single-site integrated CHO cells method Transduction medium was prepared by diluting polybrene from a stock solution (10 mg / mL) to a final concentration of 10 μg / mL (1:1000 dilution factor), which was then divided into 6 mL and 3 mL tubes 1 and 2, respectively. Edi-R-inducible lentiviral hEF1a-Blast-Cas9 lentiviral nuclease particles were then added to tube 2. The volume of lentiviral particles added was determined by the following formula: V = MOI × CN ÷ VT × 1000 During the ceremony, V = volume of lentiviral stock in μL MOI = desired multiplicity of infection CN = number of cells in the well at the time of transduction VT = lentiviral titer (TU / mL) and multiply by 1000 to convert volume from mL to μL.

[0097] Desired MOI of 1, 0.1 x 10 cells per well at transduction 6 Cell density of cells and 1 x 10 7 25 μL of lentiviral stock per well was calculated based on the lentiviral titer in TU / mL.

[0098] CHO cells were added at 0.6 × 10 6 cells and 0.3 x 10 6 The cells were prepared in tubes A and B in amounts of 100 cells per well and centrifuged at 200 g for 5 minutes. The cells were then resuspended in the transduction medium prepared above, and the contents of tube 1 were added to tube A to contain cells without lentiviral particles, and tube 2 was added to tube B to contain cells with lentiviral particles. These cells were seeded into a 12-well plate at 1 ml per well according to the plate layout in Table 4 and incubated at 37°C in a humidified CO2 incubator for 24 hours. [Table 7]

[0099] After 24 hours, the contents of each well were centrifuged at 200 g for 5 minutes to remove the medium, resuspended in 1 ml of prewarmed CD-CHO / 6 mM L-glutamine medium prepared by adding 10 μL of polybrene to 10 mL of CD-CHO / 6 mM L-glutamine, and seeded into new plates at 1 ml per well according to the plate layout in Table 4. Cells were incubated at 37°C for 72 hours in a humidified CO2 incubator.

[0100] After 72 hours, transduced cells were selected using selection medium containing blasticidin at a concentration of 5 μg / mL. Cells were subcultured as needed, and blasticidin was added to the appropriate wells at each subculture.

[0101] result Cell viability assessment was performed using the Vi-Cell device, and the results are shown in Figure 8. The cell viability results clearly demonstrate successful transduction with Edi-R-inducible lentiviral hEF1a-Blast-Cas9 lentiviral nuclease particles to generate inducible Cas9 HD7876 Bob cells.

[0102] Example 6 Generation of inducible Cas-SSI cell lines expressing IgG antibodies lacking the VL domain method iCas CHO host cells were cultured at 0.3 × 10 6 Subculture the cells at a viable concentration of 1000 cells / mL into appropriately sized Erlenmeyer shake flasks containing CD-CHO medium supplemented with 6 mM L-glutamine. These cells are cultured for at least 4 days but not more than 4 weeks, with a viability of greater than 90% prior to transfection.

[0103] The purified delta VL (eCHO-1) plasmid containing the gene of interest and the pMF35 plasmid containing the FlpE recombinase expression cassette were mixed in a DNase-free sterile tube, and the volume was adjusted to 100 μL using TE buffer according to Table 5. [Table 8]

[0104] 100 μL of the plasmid mix from Table 5 was transferred to a 0.4 cm electroporation cuvette (per transfection) to which 0.8 ml of prepared iCas CHO host cells resuspended in 6.4 ml of CD CHO / 6 mM L-glutamine medium was added. Cells were electroporated by delivering a single exponential decay pulse of 300 V, 900 μF.

[0105] The contents of the cuvette were transferred to each of 20 mL of CD CHO / 6 mM L-glutamine medium added to six T75 flasks and preheated to 36.5° C. in a humidified static CO2 incubator. The flasks were incubated in a humidified static CO2 incubator for 24 hours.

[0106] After 24 hours, the medium in each flask was replaced with 20 ml of pre-warmed CD CHO medium. The cells were then cultured and subcultured.

[0107] result Transfection efficiency was assessed using PCR, and the results are shown in Figure 9. PCR assessment demonstrates clear and successful integration of delta VL into iCas HD7876 Bob host cells to generate an inducible Cas-SSI cell line.

[0108] Example 7 Seamless integration of light chain variable regions into inducible Cas-SSI cell lines expressing IgG antibodies lacking the VL domain method SSI cells expressing Delta VL IgG antibody were cultured at 0.3 × 10 6The cells were subcultured at a viable concentration of 1000 cells / mL into appropriately sized Erlenmeyer shake flasks (CD-CHO medium and blasticidin at a final concentration of 5 μg / mL). One day before transfection, doxycycline was added to the cell culture at a final concentration of 2.5 μg / mL. sgRNA#9 was selected and prepared in the same manner as described in Example 1 for nucleofection. 100 μg of light chain variable region DNA template was briefly centrifuged to collect the contents and resuspended in 25 μl of TE buffer to obtain a concentration of 4 μg / μL.

[0109] The Cas9 RNP complex was prepared according to Table 6. [Table 9]

[0110] The complex was incubated at room temperature for 30-60 minutes.

[0111] 8x10 6 SSI cells expressing the delta VL antibody were prepared for nucleofection by transferring 100 cells to a new tube and centrifuging at 200 g for 5 minutes to remove as much medium as possible. The DNA template listed in Table 6 was added to the appropriate prepared Cas9 RNP complex. The cells were then resuspended in 563.2 μl of nucleofection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of Supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0112] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a 16-well nucleofection strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of prewarmed CD-CHO medium containing 2.5 μg / mL doxycycline preheated to 36.5°C was added and mixed. 100 μl of the final mixture was transferred to a 12-well plate containing 1.5 ml of CD-CHO medium containing 5 μg / mL blasticidin and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C and 5% CO2 for 48 hours.

[0113] result Integration efficiency was evaluated using PCR and TIDE assay. The results are shown in Figures 10A-10C. PCR (Figure 10A), FACS (Figure 10B), and NGS (Figure 10C) evaluations demonstrate clear and successful integration of the light chain variable region into delta VL antibody-expressing cells.

[0114] Example 8 Seamless incorporation of heavy and light chain variable regions into a headless IgG antibody method SSI cells expressing headless IgG antibodies were cultured at 0.3 × 10 6 The cells were subcultured at a viable concentration of 1000 cells / mL into appropriately sized Erlenmeyer shake flasks (CD-CHO medium and blasticidin at a final concentration of 5 μg / mL). One day before transfection, doxycycline was added to the cell culture at a final concentration of 2.5 μg / mL. sgRNA#9 was selected and prepared for nucleofection. 100 μg of DNA template consisting of both the VL and VH domains was briefly centrifuged to collect the contents and resuspended in 25 μl of TE buffer to obtain a concentration of 4 μg / μL.

[0115] Prepare the Cas9 RNP complex according to Table 7. [Table 10]

[0116] The complex is incubated at room temperature for 30-60 minutes.

[0117] 8x10 6 SSI cells expressing headless IgG antibodies were prepared for nucleofection by transferring 100 cells to a new tube and centrifuging at 200 g for 5 minutes to remove as much medium as possible. The DNA template listed in Table 7 was added to the appropriate prepared Cas9 RNP complex. The cells were then resuspended in 563.2 μl of nucleofection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of Supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0118] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a 16-well nucleofection strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and 80 μl of 10 ml of prewarmed CD-CHO medium containing 2.5 μg / mL doxycycline preheated to 36.5°C was added and mixed. 100 μl of the final mixture was transferred to a 12-well plate containing 1.5 ml of CD-CHO medium containing 5 μg / mL blasticidin and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C and 5% CO2 for 48 hours.

[0119] result Integration efficiency assessment will be performed using PCR, NGS, FACS analysis, and Western blot analysis.

[0120] General Materials and Methods SDS-PAGE and Western blotting Cell culture supernatants (CCS) were collected and centrifuged at 3,500 x g for 10 minutes. Protein concentrations were determined using a BCA protein assay kit (Sigma Aldrich #71285-3). Protein extracts (30 μg) were mixed with 4x Laemmli protein sample buffer (Biorad #1610747) incubated at 75°C for 15 minutes and resolved according to their molecular weights on MP TGX 4-20% 12-well SDS page gels in 1x Tris / glycine / SDS buffer (Biorad #4561095) using a Mini-PROTEAN Tetra vertical electrophoresis cell (Biorad #1658004). The gels were run at 120 V at room temperature until adequate separation was achieved.

[0121] Proteins were then transferred onto nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Biorad #1704158). The membranes were then blocked in 5% BSA in PBS-T (0.1% Tween) for 1 hour at room temperature, followed by incubation with the indicated antibody (goat anti-human IgG Fc (HRP) ab97225) diluted in 5% BSA in PBS-T for 1 hour at room temperature. The membranes were then washed 3–5 times with PBS supplemented with 0.2% Tween. Finally, the membranes were developed using Immobilon Forte Western HRP substrate (Sigma-Aldrich #WBLUF0100) using a bright Imaging System (Rhenium).

[0122] DNA extraction and PCR amplification Genomic DNA was extracted using Quick Extract DNA Extraction Solution (Danyel Biotech #QE09050) according to the manufacturer's instructions and quantified using a NanoDrop One / OneC Microvolume UV-Vis Spectrophotometer (ThermoFisher) at 100 ng / PCR reaction. Primers were designed using SnapGene with approximately 50% CG content and a melting temperature below 60°C (Table 8). PCR was performed using a Proflex PCR system (ThermoFisher Scientific) with Phusion® Hot Start Flex 2X Master Mix (New England Biolabs #M0536S) according to the manufacturer's instructions. PCR products were loaded onto a 1% agarose gel (SigmaAldrich #A9539) in 1xTAE (Biological Industries #18701A) and electrophoresed. [Table 11]

[0123] Flow cytometry Cells / cell culture supernatants (CCS) were examined by flow cytometry electroporation to determine cell line generation, VL / VL excision, and integration efficiency. All flow cytometry experiments were performed on a CytoFLEX S Flow Cytometer (Beckman Coulter), and CytExpert 2.4 software was used to analyze the acquired immunofluorescence data.

[0124] For validation of cell line generation, cells were collected in 96-well U-shaped microplates, washed twice in FACS buffer (2% w / v bovine serum albumin (SigmaAldrich #810533) and 0.09% v / v sodium azide (SigmaAldrich #08591) in DPBS), centrifuged at 400 rpm for 3 min, and analyzed using FACS. GFP-positive cells were detected using the GFP channel (488 / 525-40) on a CytoFLEX S Flow Cytometer.

[0125] CCS were collected from cells at a concentration of 5 million cells / mL, centrifuged at 3500xg for 10 minutes, and frozen at -80°C. For excision and integration, 0.5 μl / well of Dynabeads Protein A (Invitrogen, catalog number: 10001D) for immunoprecipitation was added to each 96-well plate and washed twice with assay buffer (PBS containing 0.1% BSA, 0.2 μM filtered). 200 μl of CCS was added to each well and incubated for 30 minutes at room temperature using gentle rotation, followed by a brief wash with assay buffer. Then, 0.525 μg / well of biotinylated human CD20 protein, His, Avitag (Acro Biosystems, catalog number: CD0-H82E5) was added in assay buffer, incubated for 30 minutes at room temperature using gentle rotation, and briefly washed with assay buffer. Next, Alexa Fluor 488-conjugated streptavidin (catalog #016-540-084) was diluted 1:50 in assay buffer into each well and incubated for 30 minutes at room temperature with gentle rotation, protected from light. Next, Alexa Fluor 647-conjugated Affinity Pure F(ab)2 fragment goat anti-human IgG (H+L) (Jackson Immune Research laboratory, catalog #109-606-088) was diluted 1:250 in assay buffer into each well and incubated for 30 minutes at room temperature with gentle rotation, protected from light. Finally, the beads were resuspended in 100 μl of assay buffer and analyzed using FACS. AF488 was detected using a 488 / 525-40 filter and AF647 was detected using a 630 / 660-20 filter on a CytoFLEX S Flow Cytometer.

[0126] Example 9 Selection of sgRNA for excision of the light chain variable region method Subculture of SSI cells and sgRNA preparation Site-specific integration (SSI) cells expressing whole IgG antibodies (see, e.g., WO2020 / 072480) were added to 0.3 x 106 The cells were subcultured into appropriately sized Erlenmeyer shake flasks (containing CD-CHO medium) at a viable concentration of 1000 cells / mL. These cells were cultured for at least 4 days and up to 4 weeks, with a viability of greater than 90% prior to transfection.

[0127] sgRNA (3 nmol TrueGuide Synthetic sgRNA (Invitrogen, Catalog No. A35514)) was briefly centrifuged to collect the contents and resuspended in nuclease-free Tris-EDTA (TE) buffer to 100 μM to generate a stock solution. A 10 μM working solution was generated from this stock. All sgRNA solutions were stored at -20°C. The following seven sgRNA sequences were prepared: [Table 12]

[0128] Nucleofection General nucleofection conditions for each individual transfection were as follows: [Table 13]

[0129] Cas9 RNP complex mixtures for each of the above sgRNA sequences were prepared in seven Eppendorf tubes by mixing 3.2 μl of Cas9 protein with 3.2 μl of 10 μM sgRNA. Three control mixtures were also prepared using one Eppendorf tube containing 3.2 μl of Cas9 protein and 3.2 μl of TE buffer, and two Eppendorf tubes each containing 6.4 μl of TE buffer. The mixtures were incubated at room temperature for 30–60 minutes.

[0130] 10 7SSI cells expressing whole IgG antibodies were prepared for nucleofection by transferring 10 cells to a new tube and centrifuging at 300 g for 5 minutes to remove as much medium as possible. The cells were then resuspended in 736 μl of nucleofection solution (656 μl of SF solution with 144 μl of Supplement 1). 73.6 μl of cells were added to each of the 10 Cas9 RNP complex mixtures.

[0131] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a nucleofection 16-well strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of prewarmed CD-CHO medium supplemented with 6 mM L-glutamine warmed to 36.5°C was added and mixed. 20 μl of the final mixture was transferred to a 96-well plate containing 100 μl of CD-CHO medium supplemented with 6 mM L-glutamine and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0132] result Transfection efficiency was evaluated using TIDE analysis. The results are shown in Figure 11A. Based on the transfection efficiency evaluation, sgRNA#1 and sgRNA#7 were selected.

[0133] Example 10. Complete excision of the light chain variable region from a whole IgG using Cas9 RNP complexes method SSI cells expressing full IgG antibodies were subcultured in the same manner as described in Example 9. sgRNA#1 and sgRNA#7 were selected and prepared in the same manner as described in Example 9 for nucleofection.

[0134] The Cas9 RNP complex was prepared according to Table 9. [Table 14]

[0135] The complex was incubated at room temperature for 30-60 minutes.

[0136] 7x10 6 SSI cells expressing whole IgG antibodies were prepared for nucleofection by transferring cells to a new tube and centrifuging at 200 g for 5 minutes to remove as much medium as possible. The cells were then resuspended in 492.8 μl of nucleofection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of Supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0137] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a nucleofection 16-well strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of prewarmed CD-CHO medium warmed to 36.5°C was added and mixed. The entire 100 μl of the final mixture was transferred to a 12-well plate containing 1.5 ml of CD-CHO medium and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0138] result PCR analysis was used to determine the excision efficiency. The results are shown in Figure 11B. PCR evaluation shows a clear and successful excision of the light chain variable region.

[0139] Example 11 Selection of sgRNA for excision of heavy chain variable region method Subculture of SSI cells and sgRNA preparation Site-specific integration (SSI) cells expressing whole IgG antibodies (see, e.g., WO2020 / 072480) were added to 0.3 x 10 6 The cells were subcultured into appropriately sized Erlenmeyer shake flasks (containing CD-CHO medium) at a viable concentration of 1000 cells / mL. These cells were cultured for at least 4 days and up to 4 weeks, with a viability of greater than 90% prior to transfection.

[0140] sgRNA (3 nmol TrueGuide Synthetic sgRNA (Invitrogen, Catalog No. A35514)) was briefly centrifuged to collect the contents and resuspended in nuclease-free Tris-EDTA (TE) buffer to 100 μM to generate a stock solution. A 10 μM working solution was generated from this stock. All sgRNA solutions were stored at -20°C. The following six sgRNA sequences were prepared: [Table 15]

[0141] Nucleofection General nucleofection conditions for each individual transfection were as follows: [Table 16]

[0142] Cas9 RNP complex mixtures for each of the above sgRNA sequences were prepared in six Eppendorf tubes by mixing 3.2 μl of Cas9 protein with 3.2 μl of 10 μM sgRNA. Three control mixtures were also prepared using one Eppendorf tube containing 3.2 μl of Cas9 protein and 3.2 μl of TE buffer, and two Eppendorf tubes each containing 6.4 μl of TE buffer. The mixtures were incubated at room temperature for 30–60 minutes.

[0143] 10 7SSI cells expressing whole IgG antibodies were prepared for nucleofection by transferring 10 cells to a new tube and centrifuging at 300 g for 5 minutes to remove as much medium as possible. The cells were then resuspended in 736 μl of nucleofection solution (656 μl of SF solution with 144 μl of Supplement 1). 73.6 μl of cells were added to each of the 10 Cas9 RNP complex mixtures.

[0144] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a nucleofection 16-well strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of prewarmed CD-CHO medium warmed to 36.5°C was added and mixed. 20 μl of the final mixture was transferred to a 96-well plate containing 100 μl of CD-CHO medium and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0145] result Transfection efficiency was evaluated using TIDE analysis. The results are shown in Figure 12A. Based on the transfection efficiency evaluation, sgRNA#12 and sgRNA#14 were selected.

[0146] Example 12 Complete excision of heavy chain variable regions from intact IgG or light chain variable region excised cells (Delta VL cells) using Cas9 RNP complexes method SSI cells expressing full IgG antibodies and VL-excised cells (delta VL) were subcultured in the same manner as described in Example 11. sgRNA#12 and sgRNA#14 were selected and prepared in the same manner as described in the evaluation of VH-excised gRNAs for nucleofection.

[0147] The Cas9 RNP complex was prepared according to Table 10. [Table 17]

[0148] The complex was incubated at room temperature for 30-60 minutes.

[0149] 7x10 6 SSI cells were prepared for nucleofection by transferring 100 cells to a new tube and centrifuging at 200 g for 5 minutes to remove as much medium as possible. The cells were then resuspended in 492.8 μl of nucleofection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of Supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0150] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a nucleofection 16-well strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of prewarmed CD-CHO medium warmed to 36.5°C was added and mixed. The entire 100 μl of the final mixture was transferred to a 12-well plate containing 1.5 ml of CD-CHO medium and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C, 5% CO2 for 48 hours.

[0151] result PCR analysis was used to determine the excision efficiency. The results are shown in Figures 12B-12C. PCR evaluation of Delta VL cells (Figure 12B) and SSI cells expressing full IgG antibodies (Figure 12C) shows clear and successful excision of the heavy chain variable region from both cells.

[0152] Clonal selection Delta VH and VL cells were filtered through a 40 μm nylon mesh into 5 mL round-bottom tubes (Corning, Corning, NY, USA) immediately before sorting. Cells were gated according to FCS and SSC in a FACS Aria II using a 100 μm nozzle and subjected to single-cell sorting in 96-well plates.

[0153] Example 13 Seamless incorporation of a heavy chain variable region into an IgG lacking heavy and light chain variable regions (Delta VH VL IgG) method SSI cells expressing Delta VH VL IgG antibody were subcultured in the same manner as before. sgRNA#18, having the following sequence (5' to 3'): AGACAGCACCCGGGTGGCCA (SEQ ID NO: 39), was selected and prepared in the same manner as described above for nucleofection. 100 μg of heavy chain variable region DNA template was briefly centrifuged to collect the contents and resuspended in 25 μl of TE buffer to obtain a concentration of 4 μg / μl. Figure 16 shows a representation of the DNA template used for heavy chain variable region-puromycin incorporation.

[0154] The Cas9 RNP complex was prepared according to Table 11. [Table 18]

[0155] 8x10 6 SSI cells expressing the delta VH VL IgG antibody were prepared for nucleofection by transferring cells to a new tube and centrifuging at 200 g for 5 minutes to remove as much medium as possible. The cells were then resuspended in 563.2 μl of nucleofection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of Supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0156] 220 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a nucleofection 16-well strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of prewarmed CD-CHO medium warmed to 36.5°C was added and mixed. The entire 100 μl of the final mixture was transferred to a 12-well plate containing 1.5 ml of CD-CHO medium and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C, 5% CO2 for 24 hours.

[0157] After 24 hours, the medium was replaced with CD-CHO+6 μg / mL Puro medium for selection. Cells were grown in a static incubator until the negative control cells died. Cell viability assessment was performed using a Vi-Cell device.

[0158] result Incorporation of the heavy chain variable region verified by PCR. Cell selection and viability assessed by puromycin selection as shown in Figure 17A. PCR assessment (Figure 17B) shows seamless integration of the heavy chain variable region.

[0159] Example 14 Seamless incorporation of a light chain variable region into an IgG lacking a light chain variable region (Delta VL IgG) method SSI cells expressing Delta VL IgG antibody were subcultured in the same manner as before. sgRNA#9 was selected and prepared in the same manner as described above for nucleofection. 100 μg of light chain variable region DNA template was briefly centrifuged to collect the contents and resuspended in 27.7 μl of TE buffer to obtain a concentration of 3.6 μg / μl. Figure 18 shows a representation of the DNA template used for light chain variable region-blasticidin integration.

[0160] Cas9 RNP complexes were prepared according to Table 12. [Table 19]

[0161] 8x10 6 SSI cells expressing VH-only IgG antibodies were prepared for nucleofection by transferring cells to a new tube and centrifuging at 200 g for 5 minutes to remove as much medium as possible. The cells were then resuspended in 563.2 μl of nucleofection solution (600 μl of SF solution prepared by mixing 492 μl of SF solution with 108 μl of Supplement 1). 70.4 μl of cells were added to each of the Cas9 RNP complex mixtures.

[0162] 20 μl of the cell-nucleofection solution-RNP complex mixture was transferred to a cuvette in a nucleofection 16-well strip, where the cells were pulsed using a Lonza 4D nucleofector unit using program DU-158. After nucleofection, the cells were left in the nucleofection cuvette for 10 minutes, and then 80 μl of 10 ml of prewarmed CD-CHO medium warmed to 36.5°C was added and mixed. The entire 100 μl of the final mixture was transferred to a 12-well plate containing 1.5 ml of CD-CHO medium and kept in an incubator at 36.5°C. The cells were then incubated in a static incubator at 36.5°C and 5% CO2 for 24 hours.

[0163] After 24 hours, the medium was replaced with CD-CHO + 6 μg / mL Puro + 5 μg / mL Blasticidin medium for selection. Cells were grown in a static incubator until the negative control cells died. Cell viability was assessed using a Vi-Cell device.

[0164] result Integration of the light chain variable region verified by PCR. Cell selection and viability assessed by blastosome selection as shown in Figure 19A. PCR assessment (Figure 19B) shows seamless integration of the light chain variable region, indicated by a band at 764 bp in the three left lanes.

[0165] Example 15 Generation of inducible Cas9 single-site integrated BOB (iBOB) cells method Transduction medium was prepared by diluting polybrene from a stock solution (10 mg / mL) to a final concentration of 10 μg / mL (1:1000 dilution factor), which was then divided into 6 mL and 3 mL tubes 1 and 2, respectively. Edit-R-inducible lentiviral hEF1a-Cas9 nuclease particles were then added to tube 2. The volume of lentiviral particles to be added was determined by the following formula: V = MOI × CN ÷ VT × 1000 During the ceremony, V = volume of lentiviral stock in μL MOI = desired multiplicity of infection CN = number of cells in the well at the time of transduction VT = lentiviral titer (TU / mL) and multiply by 1000 to convert volume from mL to μL.

[0166] Desired MOI of 1, 0.1 x 10 cells per well at transduction 6 Based on the cell density of the cells and a lentiviral titer of 1 x 107 TU / mL, 25 μL of lentiviral stock was calculated per well.

[0167] BOB cells were added to 0.6 × 10 6 cells and 0.3 x 10 6A volume of cells was prepared in tubes A and B and centrifuged at 200 g for 5 minutes. The cells were then resuspended in the transduction medium prepared above, and the contents of tube 1 were added to tube A to contain cells without lentiviral particles, and tube 2 was added to tube B to contain cells with lentiviral particles. These cells were seeded into a 12-well plate at 1 ml per well according to the plate layout in Table 13 and incubated at 37°C in a humidified CO2 incubator for 24 hours. [Table 20]

[0168] After 24 hours, the contents of each well were centrifuged at 200 g for 5 minutes to remove the medium, resuspended in 1 ml of prewarmed CD-CHO / 6 mM L-glutamine medium prepared by adding 10 μL of polybrene to 10 mL of CD-CHO / 6 mM L-glutamine, and seeded into new plates at 1 ml per well according to the plate layout in Table 4. Cells were incubated at 37°C for 72 hours in a humidified CO2 incubator.

[0169] After 72 hours, transduced cells were selected using selection medium containing blasticidin at a concentration of 5 μg / mL. Cells were subcultured as needed, and blasticidin was added to the appropriate wells at each subculture.

[0170] result Assessment of cell viability demonstrates successful transduction, selection, expansion, and cell banking of the inducible Cas9 BOB (SSI) cell line, as shown in Figure 20A. RT-PCR, ELISA, and WB analysis also validate the generation of the inducible Cas9 BOB (iBOB) cell line and assess Cas9 expression, as shown in Figures 20B-20D.

[0171] Example 16 Generation of an inducible Cas-SSI cell line expressing an IgG antibody lacking the VL domain method iBOB host cells were cultured at 0.3 x 106 Subculture the cells at a viable concentration of 1000 cells / mL into appropriately sized Erlenmeyer shake flasks containing CD-CHO medium supplemented with 6 mM L-glutamine. These cells are cultured for at least 4 days but not more than 4 weeks, with a viability of greater than 90% prior to transfection.

[0172] The purified delta VL plasmid containing the gene of interest and the pMF26 plasmid containing the FlpE recombinase expression cassette were mixed in a DNase-free sterile tube, and the volume was adjusted to 100 μL using TE buffer according to Table 14. [Table 21]

[0173] 100 μL of the plasmid mix from Table 6 was transferred to a 0.4 cm electroporation cuvette (per transfection) to which 0.8 ml of prepared iBOB host cells resuspended in 6.4 ml of CD CHO / 6 mM L-glutamine medium was added. Cells were electroporated by delivering a single exponential decay pulse of 300 V, 900 μF.

[0174] The contents of the cuvette were transferred to each of 20 mL of CD CHO / 6 mM L-glutamine medium added to six T75 flasks and preheated to 36.5° C. in a humidified static CO2 incubator. The flasks were incubated in a humidified static CO2 incubator for 24 hours.

[0175] After 24 hours, the medium in each flask was replaced with 20 ml of pre-warmed CD CHO medium. The cells were then cultured and subcultured.

[0176] result PCR and FACS analysis shown in Figures 21A and 21B verify the successful generation of delta VL iBOB cells.

[0177] Example 17 Generation of an inducible Cas-SSI cell line expressing an IgG antibody lacking a VH domain method iCas9 CHO host cells were cultured at 0.3 × 10 6 Subculture the cells at a viable concentration of 1000 cells / mL into appropriately sized Erlenmeyer shake flasks containing CD-CHO medium supplemented with 6 mM L-glutamine. These cells are cultured for at least 4 days but not more than 4 weeks, with a viability of greater than 90% prior to transfection.

[0178] The purified delta VH plasmid containing the gene of interest and the pMF35 plasmid containing the FlpE recombinase expression cassette were mixed in a DNase-free sterile tube, and the volume was adjusted to 100 μL using TE buffer according to Table 15. [Table 22]

[0179] 100 μL of the plasmid mix from Table 10 was transferred to a 0.4 cm electroporation cuvette (per transfection) to which 0.8 ml of prepared iCas CHO host cells resuspended in 6.4 ml of CD CHO / 6 mM L-glutamine medium was added. Cells were electroporated by delivering a single exponential decay pulse of 300 V, 900 μF.

[0180] The contents of the cuvette were transferred to each of 20 mL of CD CHO / 6 mM L-glutamine medium added to six T75 flasks and preheated to 36.5° C. in a humidified static CO2 incubator. The flasks were incubated in a humidified static CO2 incubator for 24 hours.

[0181] After 24 hours, the medium in each flask was replaced with 20 ml of pre-warmed CD CHO medium. The cells were then cultured and subcultured.

Claims

1. A cell comprising a genomic nucleic acid sequence, the genomic nucleic acid sequence comprising: a first sequence encoding antibody heavy chain constant regions 1, 2, and 3, wherein the first sequence is not adjacent to a sequence encoding an antibody heavy chain variable region; a second sequence encoding an antibody light chain constant region 1, wherein the second sequence is not adjacent to a sequence encoding an antibody light chain variable region.

2. The cell of claim 1 , further comprising a first promoter operably linked to the first sequence and a second promoter operably linked to the second sequence.

3. The cell of claim 1 or 2, further comprising a sequence encoding a selectable marker.

4. 4. The cell of any one of claims 1 to 3, further comprising a sequence encoding a gene-editing protein.

5. 5. The cell of claim 4, wherein the gene-editing protein is a Cas gene-editing protein.

6. 5. The cell of claim 4, wherein the gene-editing protein is selected from Cas9, Cas12, Cas12i2, TALENS, MAD7 nuclease, and zinc finger nuclease.

7. 7. The cell of claim 6, wherein the gene-editing protein is Cas9.

8. 8. The cell of any one of claims 4 to 7, wherein the gene-editing protein is operably linked to an inducible promoter.

9. The cell of claim 8, wherein the inducible promoter is a TET-on system.

10. The cell according to any one of claims 1 to 9, wherein the cell is a high-expressing stable clone.

11. The cell of claim 10 , wherein the cell is a Chinese hamster ovary (CHO) cell.

12. 1. A method for producing an editable cell, comprising: providing a cell that stably expresses an antibody genomic nucleic acid sequence comprising a variable heavy chain region sequence, a constant heavy chain region 1, 2, and 3 sequence, a variable light chain region sequence, and a constant light chain region 1 sequence; excising the sequence encoding the variable heavy chain region with a gene editing protein; and excising the variable light chain region sequence with the gene editing protein.

13. introducing a sequence encoding the gene-editing protein into the genomic nucleic acid sequence prior to the excision of the sequence encoding the variable heavy chain region and the variable light chain region; 13. The method of claim 12, further comprising expressing the gene-editing protein prior to excising the variable heavy chain region and the variable light chain region.

14. 14. The method of claim 12 or 13, wherein the gene editing protein is a Cas gene editing protein.

15. 14. The method of claim 12 or 13, wherein the gene-editing protein is selected from Cas9, Cas12, Cas12i2, TALENS, MAD7 nuclease, and zinc finger nuclease.

16. 16. The method of claim 15, wherein the gene-editing protein is Cas9.

17. 17. The method of any one of claims 14 to 16, wherein the excision of the sequence encoding the variable heavy chain region with the gene editing protein occurs at a first guide RNA target sequence and a second guide RNA target sequence, and the excision of the variable light chain region sequence with the gene editing protein occurs at a third guide RNA target sequence and a fourth guide RNA target sequence.

18. 18. The method of claim 17, further comprising introducing a first guide RNA and a second guide RNA.

19. 18. The method of claim 17, further comprising introducing a third guide RNA and a fourth guide RNA.

20. 20. The method of any one of claims 13 to 19, wherein the sequence encoding the gene-editing protein is operably linked to an inducible promoter.

21. 21. The method of claim 20, wherein the inducible promoter is a TET-on system.

22. 22. The method of any one of claims 12 to 21, wherein the editable cell is a high-expressing stable clone.

23. 23. The method of Claim 22, wherein the editable cell is a Chinese hamster ovary (CHO) cell.

24. A method for producing antibody-producing cells, comprising: Providing a cell according to any one of claims 1 to 11; introducing into said cell a sequence encoding an antibody heavy chain variable region; and introducing into said cell a sequence encoding an antibody light chain variable region.

25. 25. The method of claim 24, further comprising introducing a fifth guide RNA target sequence and a sixth guide RNA target sequence.

26. 26. The method of claim 24 or 25, further comprising introducing a first sequence encoding a first selectable marker and a second sequence encoding a second selectable marker.

27. 27. The method of any one of claims 24 to 26, further comprising selecting cells that express the antibody using the first and second selectable markers.

28. The method of any one of claims 24 to 27, further comprising expressing the antibody in the cell.