Nucleic acids, vectors, compositions, and methods for enhancing expression of a protein of interest

Incorporating HSV1 5' leader sequences upstream of transgenes in viral vectors addresses suboptimal translation in infected cells, boosting protein production and improving therapeutic efficacy and safety in viral vector-based therapies.

JP2025525503APending Publication Date: 2025-08-05CHILDRENS HOSPITAL OF EASTERN ONTARIO RES INST INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025500919
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-13
Filing Date
2023-07-12
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

Existing viral vector-based therapies face challenges in achieving optimal transgene protein production due to the innate antiviral response of infected cells, leading to suboptimal therapeutic efficacy and safety concerns from high viral doses.

Method used

Incorporation of specific nucleic acid sequences, such as the HSV1 5' leader sequences (e.g., US11, UL27, UL19), upstream of the transgene to enhance translation efficiency in infected cells, thereby increasing protein production.

Benefits of technology

Enhances transgene protein expression several-fold, improving therapeutic efficacy while reducing the need for high viral doses, thus enhancing safety and targeting in viral vector-based therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025525503000001_ABST
    Figure 2025525503000001_ABST
Patent Text Reader

Abstract

The present invention is directed to nucleic acids, vectors, compositions, kits, and cell lines comprising the US11 5' leader sequence (SEQ ID NO:1 or SEQ ID NO:4), the UL27 5' leader sequence (SEQ ID NO:7 or SEQ ID NO:10), or the UL19 5' leader sequence (SEQ ID NO:13 or SEQ ID NO:16), which can enhance translation of a downstream gene encoding a protein of interest, resulting in increased protein production, expression, or synthesis in HSV1-infected cells. The 5' leader increases protein expression several-fold compared to protein expression in the absence of the leader sequence. Methods for increasing protein production, improving the efficiency of existing gene therapies, and treating medical conditions, cellular defects, diseases, or disorders are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001]

[0001] The present invention relates to nucleic acid sequences that can increase the translation of a gene encoding a protein of interest, as well as vectors, compositions, cells, and kits containing those nucleic acid sequences. More specifically, the present invention relates to nucleic acid sequences that increase protein production or expression when placed upstream or 5' of a gene encoding a protein of interest, and methods for increasing protein production are also provided. [Background technology]

[0002] The use of viruses as vectors to deliver therapeutic payloads has become increasingly important in various biomedical applications, such as viral vector-based vaccines, gene therapy, and oncolytic viruses (OVs). For OVs, high transgene expression within tumors is crucial for eliciting optimal antitumor immune responses and therapeutic efficacy. Therefore, OV platforms in clinical and preclinical development are engineered to encode one or more of the following: 1) immunomodulatory host proteins or tumor-associated antigens that can amplify antitumor immune responses, 2) suicide proteins intended to induce cancer cell death, and 3) reporter proteins (e.g., green fluorescent protein or luciferase) that facilitate tracking and dosing.

[0003]

[0003] Components containing transgene expression cassettes within viral vectors typically encode the transgene as an intronless open reading frame (ORF) adjacent to an upstream promoter and terminated by a poly(A) signal in the HSV1 genome. The remaining sequences from the multiple cloning site (MCS) between the transcription start site (TSS) following the promoter and the start codon, or between the stop codon and the poly(A) signal, serve as short 5' and 3' UTRs, respectively. Much effort has been expended to ensure high transgene transcription in cells prior to infection by incorporating strong host promoters, such as those derived from human phosphoglycerate kinase (PGK) or elongation factor 1α (EF1α), or viral promoters such as the cytomegalovirus (CMV) immediate-early promoter. However, the bottleneck in the subsequent translation of transgene mRNA into protein has not been fully addressed, based on the assumption that differences in translation rate are minimal when the transcript is highly expressed. The innate antiviral response to the presence of replicating viruses challenges this assumption: infected cells undergo dramatic changes in the subset of mRNAs that are translated, and replicating viruses actively reshape the host protein synthesis machinery to promote viral protein production while disrupting host protein production. Therefore, infected cells likely alter the translation rate of transgene mRNA. This could ultimately result in suboptimal transgene protein production, potentially compromising the therapeutic potential of replicating viral vectors by delivering viral units with inappropriate specific activity to cancer patients.

[0004]

[0004] Surprisingly, transgenes are not optimized for their viral platforms, and inadequate expression impacts therapeutic efficacy. One example is T-Vec; in a Phase I clinical trial, GM-CSF mRNA levels detected in fine needle aspirates of several different tumor types plateaued or fell below the limit of detection at mid-range doses, suggesting that expression was suboptimal in humans. In another Phase I trial, Jennerex-594 (JX594), a clinical oncolytic vaccinia virus (VV) candidate also engineered to express GM-CSF, demonstrated that low doses of virus (10 5 ~10 6 In stark contrast, intravenous injection of viral plaque-forming units (pfu / kg) fails to induce detectable GM-CSF. Increasing the viral dose by an order of magnitude results in positive detection of this therapeutic protein. However, minimizing the viral dose is desirable to improve the safety profile of these promising viral therapies, making the need for increased doses inappropriate. In other words, increasing the specific activity of OVs, non-OV-based viral therapies, or any viral or nonviral gene delivery mechanism is desirable to enhance targeting and expression of the transgene(s) while reducing toxic effects associated with the vector or delivery vehicle. Summary of the Invention

[0005]

[0057] The present invention relates to nucleic acids comprising SEQ ID NO:1, or a fragment thereof comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:1, but not including SEQ ID NO:2, SEQ ID NO:3, or both, and not including a fragment of SEQ ID NO:2, SEQ ID NO:3, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO:1.

[0006]

[0058] In some embodiments, the invention relates to a nucleic acid comprising SEQ ID NO:4, or a fragment comprising at least 180 nucleotides thereof, or a sequence at least 90% identical to SEQ ID NO:4, but excluding SEQ ID NO:5, SEQ ID NO:6, or both, and excluding a fragment of SEQ ID NO:5, SEQ ID NO:6, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO:4.

[0007]

[0059] In some embodiments, the invention relates to a nucleic acid comprising SEQ ID NO:7, or a fragment comprising at least 180 nucleotides thereof, or a sequence at least 90% identical to SEQ ID NO:7, but not including SEQ ID NO:8, SEQ ID NO:9, or both, and not including a fragment of SEQ ID NO:8, SEQ ID NO:9, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO:7.

[0008]

[0060] In some embodiments, the invention relates to a nucleic acid comprising SEQ ID NO: 10, or a fragment comprising at least 180 nucleotides thereof, or a sequence at least 90% identical to SEQ ID NO: 16, but not including SEQ ID NO: 11, SEQ ID NO: 12, or both, and not including a fragment of SEQ ID NO: 11, 12, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO: 10.

[0009]

[0061] In some embodiments, the invention relates to a nucleic acid comprising SEQ ID NO: 13, or a fragment comprising at least 180 nucleotides thereof, or a sequence at least 90% identical to SEQ ID NO: 13, but not including SEQ ID NO: 14, SEQ ID NO: 15, or both, and not including a fragment of SEQ ID NO: 14, 15, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO: 13.

[0010]

[0062] In some embodiments, the invention relates to a nucleic acid comprising SEQ ID NO: 16, or a fragment comprising at least 180 nucleotides thereof, or a sequence at least 90% identical to SEQ ID NO: 16, but not including SEQ ID NO: 17, SEQ ID NO: 18, or both, and not including a fragment of SEQ ID NO: 17, 18, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO: 16.

[0011]

[0063] In one embodiment, a nucleic acid is provided that comprises SEQ ID NO:1, or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:1, wherein the nucleic acid does not include SEQ ID NO:2, SEQ ID NO:3, or both. In an alternative embodiment, a sequence at least 90% identical to SEQ ID NO:1, or a fragment comprising at least 180 nucleotides, wherein the nucleic acid does not include SEQ ID NO:2, SEQ ID NO:3, or both. The above nucleic acids do not include a fragment of SEQ ID NO:2, SEQ ID NO:3, or both, that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO:1.

[0012]

[0064] In an alternative embodiment, a nucleic acid is provided that comprises SEQ ID NO:4, i.e., the RNA counterpart of SEQ ID NO:1, or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:4, but does not include SEQ ID NO:5 (i.e., the RNA counterpart of SEQ ID NO:2), SEQ ID NO:6 (i.e., the RNA counterpart of SEQ ID NO:3), or both. In an alternative embodiment, a sequence at least 90% identical to SEQ ID NO:4, or a fragment comprising at least 180 nucleotides, is provided, wherein the nucleic acid does not include SEQ ID NO:5, SEQ ID NO:6, or both. The above nucleic acids do not include a fragment of SEQ ID NO:5, SEQ ID NO:6, or both, that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO:4.

[0013]

[0065] In an alternative embodiment, a nucleic acid is provided that comprises SEQ ID NO: 10, i.e., the RNA counterpart of SEQ ID NO: 7, or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 10, but does not include SEQ ID NO: 11 (i.e., the RNA counterpart of SEQ ID NO: 8), SEQ ID NO: 12 (i.e., the RNA counterpart of SEQ ID NO: 9), or both. In an alternative embodiment, a sequence at least 90% identical to SEQ ID NO: 10, or a fragment comprising at least 180 nucleotides, is provided, wherein the nucleic acid does not include SEQ ID NO: 11, SEQ ID NO: 12, or both. The above nucleic acids do not include a fragment of SEQ ID NO: 11, SEQ ID NO: 12, or both, that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO: 10.

[0014]

[0066] The nucleotide sequences or nucleic acids detailed in the present invention do not contain at least 250, 500, 1000 or more contiguous nucleotides of the complete genome of Human Herpesvirus Type 1, strain KOS, as defined by NCBI Accession Number: JQ673480.1 GI:380776962 or Accession Number: JQ780693.1 GI:384597744, or a sequence 95% identical thereto.

[0015]

[0067] In one embodiment of the present invention, a vector is provided comprising SEQ ID NO:1, SEQ ID NO:7, or SEQ ID NO:13, or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:1, SEQ ID NO:7, or SEQ ID NO:13, or a sequence at least 90% identical to SEQ ID NO:1, SEQ ID NO:7, or SEQ ID NO:13, or a fragment comprising at least 180 nucleotides, as well as a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonuclease or cloning sites, and one or more polyadenylation sites, or any combination thereof. An alternative embodiment is also provided, comprising the RNA counterparts of SEQ ID NOs:1, 7, and 13 (i.e., SEQ ID NOs:4, 10, and 16).

[0016]

[0068] In some alternative embodiments, the nucleic acid may be inserted into a gene delivery vehicle, some non-limiting examples of which are a plasmid, an expression cassette, a live virus, a DNA or RNA construct or a recombinant nucleotide construct, an intronless open reading frame, a nanoparticle, or a lipid nanoparticle. In some embodiments, the gene delivery vehicles detailed above may be HSV or HSV1 based.

[0017]

[0069] In one embodiment of the present invention, there is also provided a cell, composition, or kit comprising the nucleic acid or vector detailed above. In particular, the nucleic acid comprises SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13, or their RNA counterparts, i.e., SEQ ID NO: 4, SEQ ID NO: 10, or SEQ ID NO: 16. In some embodiments, both the nucleic acid and the vector may be present in combination.

[0018]

[0070] In the embodiments detailed above, if the nucleic acid comprises SEQ ID NO:1, then the nucleic acid does not comprise SEQ ID NO:2, SEQ ID NO:3, or both; if the nucleic acid comprises SEQ ID NO:4, then the nucleic acid does not comprise SEQ ID NO:5, SEQ ID NO:6, or both; if the nucleic acid comprises SEQ ID NO:7, then the nucleic acid does not comprise SEQ ID NO:8, SEQ ID NO:9, or both; if the nucleic acid comprises SEQ ID NO:10, then the nucleic acid does not comprise SEQ ID NO:11, SEQ ID NO:12, or both; if the nucleic acid comprises SEQ ID NO:13, then the nucleic acid does not comprise SEQ ID NO:14, SEQ ID NO:15, or both; and if the nucleic acid comprises SEQ ID NO:16, then the nucleic acid does not comprise SEQ ID NO:17, SEQ ID NO:18, or both.

[0019]

[0071] In the case of SEQ ID NO:1, the nucleic acid may not include a fragment of SEQ ID NO:2, 3, or both that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO:1.

[0020]

[0072] In the case of SEQ ID NO:4, the nucleic acid may not include a fragment of SEQ ID NO:5, 6, or both that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO:4.

[0021]

[0073] In the case of SEQ ID NO:7, the nucleic acid may not include a fragment of SEQ ID NO:8, 9, or both that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO:7.

[0022]

[0074] In the case of SEQ ID NO: 10, the nucleic acid may not include a fragment of SEQ ID NO: 11, 12, or both that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO: 10.

[0023]

[0075] In the case of SEQ ID NO: 13, the nucleic acid may not include a fragment of SEQ ID NO: 14, 15, or both that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO: 13.

[0024]

[0076] In the case of SEQ ID NO: 16, the nucleic acid may not include a fragment of SEQ ID NO: 17, 18, or both that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO: 16.

[0025]

[0077] In one embodiment of the present invention, a method for producing a protein of interest in a cell is provided, the method comprising administering a nucleic acid to the cell. The administered nucleic acid comprises a) a promoter, b) SEQ ID NO: 1, SEQ ID NO: 7, or SEQ ID NO: 13, and c) a sequence encoding the protein of interest that is expressed in the cell from the nucleic acid. An alternative embodiment is also provided in which the method uses the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4), SEQ ID NO: 7 (i.e., SEQ ID NO: 10), or SEQ ID NO: 13 (i.e., SEQ ID NO: 16).

[0026]

[0078] In an alternative embodiment, there is provided a method of increasing expression, synthesis, or production of a protein of interest in a cell, comprising administering to the cell a nucleic acid, the nucleic acid comprising a) a promoter, b) SEQ ID NO: 1, SEQ ID NO: 7, or SEQ ID NO: 13, and c) a sequence encoding a protein of interest that is expressed in the cell from the nucleic acid, wherein the increase in expression, synthesis, or production of the protein of interest is compared to a similar step of administering the nucleic acid in the absence of SEQ ID NO: 1, SEQ ID NO: 7, or SEQ ID NO: 13. Also provided is an alternative embodiment in which the method uses an RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4), SEQ ID NO: 7 (i.e., SEQ ID NO: 10), or SEQ ID NO: 13 (i.e., SEQ ID NO: 16).

[0027]

[0079] In one embodiment of the present invention, a method for ameliorating or treating a medical condition, cellular defect, or disease in a subject is provided. The method includes administering a nucleic acid to cells of a subject exhibiting the medical condition, cellular defect, or disease, the nucleic acid comprising: a) a promoter; b) SEQ ID NO: 1, SEQ ID NO: 7, or SEQ ID NO: 13; and c) a sequence encoding a protein of interest that is expressed from the nucleic acid in the cells. The selected protein of interest can ameliorate or treat the medical condition, cellular defect, or disease in the subject, and thus, expression, synthesis, or production of the protein of interest in the subject's cells ameliorates or treats the medical condition, cellular defect, or disease in the subject. Alternative methods are also provided, in which the nucleic acid comprises SEQ ID NO: 4, SEQ ID NO: 7 (i.e., SEQ ID NO: 10), or SEQ ID NO: 13 (i.e., SEQ ID NO: 16). [Brief explanation of the drawings]

[0028] [Figure 1a] Representative nucleic acid sequences of the present invention are shown. [Figure 1b] Representative nucleic acid sequences of the present invention are shown. [Figure 1c] Representative nucleic acid sequences of the present invention are shown. [Figure 2-1]Figures 2-1 and 2-2 generally show the characterization of individual HSV1 transcripts from RNA-seq coverage. Figure 2-1A shows the entire RNA-seq coverage of the HSV1 genome from 4T1-infected cells. Strand-specific RNA reads were mapped to the HSV1 genome and separated by strand orientation to avoid ambiguity in the mapping of overlapping genes. Figure 2-1B shows the RNA-seq coverage of the US1 gene, where intron-spanning reads were also detected and displayed using a Sashimi plot. Figure 2-1C shows the RNA-seq coverage of the 5' region of the US1 gene. The bottom plot shows the region of the predicted TSS at nucleotide resolution. Figure 2-1D shows the RNA-seq coverage of the 3' region of the US1 gene. [Figure 2-2] Figures 2-1 and 2-2 generally show the characterization of individual HSV1 transcripts from RNA-seq coverage. Figure 2-2E provides a schematic diagram of the workflow for identifying HSV1 5' leaders from RNA-seq reads, screening for translation that specifically enhances the 5' leaders in HSV1-infected cells, and incorporating the 5' leaders into transgene expression in oncolytic HSV1 genomes for testing in vivo in tumor models. [Figure 3A] Figures 3A-3H generally show that the HSV1 US11 5' leader sequence enhances expression of protein reporters in HSV1-infected mammalian cells. Figure 3A is a schematic diagram of mRNA expressed from CAT reporter constructs with and without the HSV1 5' UTR. [Figure 3B]Figures 3A-3H generally demonstrate that the HSV1 US11 5' leader sequence enhances protein reporter expression in HSV1-infected mammalian cells. Figure 3B shows a translation reporter assay to screen for HSV1 5' leader sequences that enhance translation during HSV1 infection. 4T1 cells were infected with HSV-1716-GFP at an MOI of 5 and subsequently transfected with a CAT plasmid and a β-GAL expression plasmid, which served as a transfection control. 24 hours postinfection, cells were lysed, and CAT expression was quantified by ELISA, and β-GAL activity was quantified by a colorimetric assay using ONPG substrate. Two-way ANOVA with Tukey's post-hoc test was performed. Only significant results are shown. n = at least three biological replicates. Error bars indicate standard deviation (sd). *p < 0.05, **p < 0.01. [Figure 3C] Figures 3A-3H generally demonstrate that the HSV1 US11 5' leader sequence enhances protein reporter expression in HSV1-infected mammalian cells. Figure 3C shows relative CAT mRNA expression by CAT translational reporter assay. 4T1 cells were treated as in (C) and subsequently lysed using Trizol. RT-qPCR was then used to quantify mRNA expression of CAT mRNA normalized to Rps20 expression. Two-way ANOVA with Sidak's post-hoc test was performed. n = 3 biological replicates. Only significant tests are shown. Error bars indicate standard deviation (sd). *p < 0.05, **p < 0.01, ****p < 0.0001. [Figure 3D] Figures 3A-3H generally show that the HSV1 US11 5' leader sequence enhances protein reporter expression in HSV1-infected mammalian cells. Figure 3D shows a schematic diagram of the pTK-Green plasmid carrying the HSV1 5' leader-reporter construct for insertion into the HSV1 TK gene and the resulting transcripts. A ribosomal skipping sequence, P2A, was inserted between the luciferase and GFP CDSs, allowing synthesis of two proteins from a single cistron. [Figure 3E]Figures 3A-3H generally show that the HSV1 US11 5' leader sequence enhances protein reporter expression in HSV1-infected mammalian cells. Figure 3E shows quantification of GFP fluorescence. Cells were transfected with the LUC-GFP reporter plasmid and subsequently infected with HSV1 (JQ780693 for the KOS strain) at an MOI of 2.5 4 hours post-transfection. Images were taken 24 hours post-infection. [Figure 3F] Figures 3A-3H generally show that the HSV1 US11 5' leader sequence enhances expression of a protein reporter in HSV1-infected mammalian cells. Figure 3F shows Western blots of lysates from 293T cells treated as in (B) with antibodies against GFP, anti-HSV1, or anti-β-actin. (*): Nonspecific band. [Figure 3G] Figures 3A-3H generally show that the HSV1 US11 5' leader sequence enhances expression of protein reporters in HSV1-infected mammalian cells. Figure 3G shows quantification of GFP expression from Western blots in (F). [Figure 3H] Figures 3A-3H show that, overall, the HSV1 US11 5' leader sequence enhances expression of protein reporters in HSV1-infected mammalian cells. Figure 3H shows RT-qPCR quantification of LUC-GFP mRNA from the same experiment. Two-way ANOVA with Sidak's post-hoc test was performed. n = 3 biological replicates. Error bars indicate standard deviation (sd). *p < 0.05, **p < 0.01, ****p < 0.0001, ns, not significant. [Figure 4A] Figures 4A-4F show that recombinant HSV1 viruses exhibit US11 5' leader-dependent enhancement of GM-CSF expression. Figure 4A shows a schematic diagram of the expression cassette insertion scheme from the pTK-CSF2-GFP plasmid into the HSV1 genome (note that the TK gene is on the minus strand) and the resulting transcripts expressed from the inserted cassette. [Figure 4B]Figures 4A-4F show that recombinant HSV1 viruses exhibit US11 5' leader-dependent enhancement of GM-CSF expression. Figure 4B shows viral genotyping to confirm expression cassette insertion. PCR was performed using HSV1 gDNA extracted from purified virus to confirm insertion of the leaderless CSF2-GFP cassette (approximately 400 bp) and the US11 5' leader-CSF2-GFP cassette (approximately 600 bp) into the TK region of the HSV1 genome. [Figure 4C] Figures 4A-4F show that recombinant HSV1 viruses exhibit US11 5' leader-dependent enhancement of GM-CSF expression. Figure 4C shows fluorescent imaging of individual plaques of wild-type HSV1, HSV1 Csf2, and HSV1 US11-Csf2. [Figure 4D] Figures 4A-4F show that recombinant HSV1 viruses exhibit US11 5' leader-dependent enhancement of GM-CSF expression. Figure 4D shows quantification of GM-CSF production in culture supernatants of Vero cells infected with HSV1 expressing leaderless CSF2-GFP or US11 5' leader-CSF2-GFP. Vero cell monolayers were infected with the indicated viruses at an MOI of 5, and culture supernatants were collected 24 hours post-infection. GM-CSF concentrations were quantified by ELISA. One-way ANOVA with Dunnett's post-hoc test was performed. n = 3 biological replicates. Error bars: ± s.d. ****p < 0.0001. [Figure 4E] Figures 4A-4F show that recombinant HSV1 viruses exhibit US11 5' leader-dependent enhancement of GM-CSF expression. Figure 4E shows one-step growth curves of HSV1 Csf2 and HSV1 US11-Csf2. Vero cell monolayers were infected at an MOI of 5, followed by collection and titration of intracellular and extracellular viruses at the indicated time points. [Figure 4F]Figures 4A-4F show that recombinant HSV1 viruses exhibit US11 5' leader-dependent enhancement of GM-CSF expression. Figure 4F shows transcription levels of the HSV1 endogenous gene (US6) and transgene. Vero cell monolayers were infected at an MOI of 5, and cells were subsequently lysed using Trizol at the indicated time points. mRNA abundance was quantified by RT-qPCR and normalized to Rps20. [Figure 5A] Figures 5A-5E show that the HSV1 US11 leader generally enhances translation efficiency of downstream transgenes. Figure 5A shows fluorescence and phase-contrast images of HSV1-infected Vero cells used in the polysome fractionation experiments in (B) and (C). Scale bar: 400 μm. [Figure 5B] Figures 5A-5E generally demonstrate that the HSV1 US11 leader enhances translation efficiency of downstream transgenes. Figure 5B shows polysome trajectories in Vero cells infected with HSV1 Csf2 or HSV1 US11-Csf2 at an MOI of 5. Cells were lysed 24 hours postinfection for polysome fractionation. [Figure 5C] Figures 5A-5E show that the HSV1 US11 leader generally enhances translation efficiency of downstream transgenes. Figure 5C shows the mRNA distribution in polysome fractions of Csf2 (upper panel) and endogenous HSV1 transcripts US6 (middle panel) and US11 (lower panel), as quantified by RT-qPCR. Two-tailed t-tests were performed. n = 3 biological replicates. Error bars indicate standard deviation. **: p < 0.01, *: p < 0.05. [Figure 5D] Figures 5A-5E show that, overall, the HSV1 US11 leader enhances translation efficiency of downstream transgenes. Figure 5D shows the mRNA distribution of Csf2 (top panel), US6 (middle panel), and US11 (bottom panel) transcripts in the untranslated (subpolysome), poorly translated (2-4 ribosome), and highly translated (more than 4 ribosome) fractions. Multiple unpaired t-tests were performed. n = 3 biological replicates. Error bars indicate standard deviation (sd). ***: p < 0.0001. [Figure 5E]Figures 5A-5E generally demonstrate that the HSV1 US11 leader enhances translation efficiency of downstream transgenes. Figure 5E shows quantification of GFP fluorescence in Vero cells transfected with pTK-CSF2-GFP plasmid with or without the US11 leader sequence, cotransfected with poly(I:C), or immediately infected with VSV or wild-type HSV1 at an MOI of 5. [Figure 6A] Figures 6A-6F generally demonstrate that the US11 5' leader enhances the antitumor effects of HSV1-expressing GM-CSF. Figure 6A shows an outline of an in vivo study to characterize the effect of HSV1 US11-Csf2 on tumor inflammation and systemic antitumor T cells. 10 CT26 cells were injected into both flanks of BALB / c mice. When tumors reached approximately 5 x 5 mm, two injections of 5 x 10 PFU of the indicated viruses were administered intratumorally, 2 days apart (days 0 and 2). Tumor size was measured every 2 days. [Figure 6B] Figures 6A-6F generally demonstrate that the US11 5' leader enhances the antitumor effect of HSV1-expressing GM-CSF. Figure 6B shows intratumoral GM-CSF levels in tumors treated with leaderless or HSV1 US11-Csf2. Tumors generated as in (A) were excised 1 day after the second injection and homogenized in PBS. GM-CSF levels were then quantified by ELISA. An unpaired, two-tailed t-test was performed. n = 3 biological replicates. Error bars: ± sd. [Figure 6C] Figures 6A-6F generally demonstrate that the US11 5' leader enhances the antitumor effects of GM-CSF expressing HSV1. Figure 6C shows the expression levels of viral transcripts and inflammatory genes in tumors treated with oHSV1. RNA from tumors in (B) was extracted with Trizol, and mRNA abundance of the indicated transcripts was then quantified by RT-qPCR and normalized to Actb. An unpaired two-tailed t-test was performed. n = 3 biological replicates. Error bars: ± sd. [Figure 6D]Figures 6A-6F show that the US11 5' leader generally enhances the antitumor effect of HSV1-expressing GM-CSF. Figure 6D shows systemic tumor-specific T cell responses after oHSV1 injection, assessed by IFNγ ELISPOT. Eight days after the first injection, splenocytes were isolated from mice and co-cultured with or without UV-irradiated CT26 at a 2:1 responder to stimulator ratio for 24 hours. Representative ELISPOT wells, as well as quantification of CT26-specific spots, are shown in the bar graph. Unpaired two-tailed t-tests were performed. Error bars: ±sd. [Figure 6E] Figures 6A-6F generally show that the US11 5' leader enhances the antitumor effect of HSV1-expressing GM-CSF. Figure 6E shows the effect of leaderless or HSV1 US11-Csf2 administration on tumor growth. Numbers of mice are shown in parentheses. Two-way ANOVA with Tukey's post-hoc test was performed. Error bars: ±sd. [Figure 6F] Figures 6A-6F generally demonstrate that the US11 5' leader enhances the antitumor effect of GM-CSF expressing HSV1. Figure 6F shows Kaplan-Meier survival curves for mice treated with leaderless or US11-Csf2 HSV1. The number of mice is indicated in parentheses. [Figure 7] Individual transcripts (RL2, UL15, US1, US12) identified by RNA-seq coverage on the plus strand (blue) and minus strand (red) are shown. [Figure 8A] The full RNA-seq coverage of the HSV1 genome is shown. RNA-seq data from HSV1-infected 4T1 has been previously published (Hoang et al., 2019). Strand-specific RNA reads were mapped to HSV1 (JQ780693.1) and separated by orientation to avoid ambiguity in the mapping of overlapping genes. The graph shows insets for all identified TSSs in all HSV1 genes. [Figure 8B]The full RNA-seq coverage of the HSV1 genome is shown. RNA-seq data from HSV1-infected 4T1 has been previously published (Hoang et al., 2019). Strand-specific RNA reads were mapped to HSV1 (JQ780693.1) and separated by orientation to avoid ambiguity in the mapping of overlapping genes. The graph shows insets for all identified TSSs in all HSV1 genes. [Figure 8C] The full RNA-seq coverage of the HSV1 genome is shown. RNA-seq data from HSV1-infected 4T1 has been previously published (Hoang et al., 2019). Strand-specific RNA reads were mapped to HSV1 (JQ780693.1) and separated by orientation to avoid ambiguity in the mapping of overlapping genes. The graph shows insets for all identified TSSs in all HSV1 genes. [Figure 8D] The full RNA-seq coverage of the HSV1 genome is shown. RNA-seq data from HSV1-infected 4T1 has been previously published (Hoang et al., 2019). Strand-specific RNA reads were mapped to HSV1 (JQ780693.1) and separated by orientation to avoid ambiguity in the mapping of overlapping genes. The graph shows insets for all identified TSSs in all HSV1 genes. [Figure 9] The relative mRNA expression levels of 10 candidate late genes (heatmap on the left) and 4 immediate-early genes (heatmap on the right) are shown. The mRNA expression was obtained from a previously reported study by Rutkowski et al., 2015. Expression levels were normalized as a percentage of the highest expression level across all time points. [Figure 10]Figure 10 generally shows a translation reporter screen for 5' UTRs that enhance translation upon HSV1 infection. Figure 10A shows agarose gel visualization of other HSV1 5' leaders (including the remainder of the 5' leader from Figures 3A-3H amplified from total RNA of HSV1-infected cells). A negative control (RNA from uninfected cells) confirmed the specificity of the PCR product for HSV1 transcripts alone. (*): Nonspecific band. Figure 10B shows a translation reporter assay to screen for HSV-1 leader sequences that enhance translation upon HSV-1 infection. 4T1 cells were transfected with a CAT plasmid and a β-GAL expression plasmid, which served as a transfection control. Eight hours after transfection, the cells were infected with HSV-1716-GFP at an MOI of 5. 18 hours after infection, cells were lysed, and CAT expression was quantified by ELISA, while β-GAL activity was quantified by a colorimetric assay using ONPG substrate. Figure 10C shows the predicted secondary structure and folding free energy of the US11 (left panel) and UL27 (right panel) leaders using Vienna RNAfold33. The color scale bar represents base pairing probability. Figure 10D shows a heat map depicting the folding free energy of candidate HSV1 leaders calculated using Vienna RNAfold. [Figure 11] We demonstrate that US11 leader enhancement is robust across various cell types and species. Monolayers of the African green monkey kidney cell line Vero, the mouse breast cancer cell line 4T1, the human pancreatic cancer cell line DU145, and the human renal cancer cell line 786-O were infected with HSV1 KOS leaderless or HSV1 US11 5' leader at an MOI of 0.1, and GFP fluorescence intensity was monitored for 48 hours using an Incucyte live-cell imaging system. [Figure 12] We show that leaderless transgene mRNAs are poorly translated compared to viral mRNAs. In the same polysome profiling experiments described in Figures 4A-4F, we compared the distribution of US6 and US11 mRNAs with that of leaderless Csf2 (Figure 12A) or US11-Csf2 (Figure 12B) mRNAs. [Figure 13] Shows the size of individual tumors shown in Fig. 6E. [Figure 14] Shows the raw data of individual wells from the IFNγ ELISPOT experiment in Fig. 6D. [Figure 15] Figure 15 characterizes the enhanced expression by the US11 5’ leader in oncolytic HSV1. Panel A of Figure 15 shows that a monolayer of Vero cells was infected with the indicated virus at an MOI of 5, and the culture supernatant was collected 24 hours after infection. The GM-CSF concentration was quantified by ELISA. One-way ANOVA using Dunnett's post-test was performed. n = 3 biological replicate experiments. Error bars: +sd. **** << p < 0.0001. Panel B of Figure 15 shows representative GFP fluorescence of HSV1 expressing leaderless CSF2-GFP or US11 5’ leader-CSF2-GFP. A monolayer of CT26 was infected with the indicated virus at an MOI of 5, and then fluorescence microscopy images were taken 24 hours after infection. Panel C of Figure 15 shows the time-course of GFP fluorescence of HSV1 expressing leaderless CSF2-GFP or US11 5’ leader-CSF2-GFP. A monolayer of CT26 was infected with the indicated virus at an MOIs of 0.2, 1 or 5, and then GFP fluorescence was monitored over 2 days after infection using an Incucyte live cell imaging system. Panel D of Figure 15 shows a dose-dependent analysis of secreted GM-CSF. CT26 cells were infected with the indicated virus at an MOIs of 0.2, 1 or 5, and then the culture supernatant was collected 24 hours after infection. The GM-CSF concentration was quantified using ELISA. Two-way ANOVA using Sidak's post-test was performed. n = 3 biological replicate experiments. Error bars: +sd. **** p < 0.0001.

Mode for Carrying Out the Invention

[0029]

[0080] The following description is of preferred embodiments by way of example only and is not limited to combinations of features necessary to carry out the invention.

[0030]

[0081] All terms are intended to be understood as understood by those skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0031]

[0082] Although various features of the present disclosure may be described in the context of a single embodiment, the features may also be provided separately or in any suitable combination. Conversely, although the present disclosure may, for clarity, be described herein in the context of separate embodiments, the present disclosure may also be implemented in a single embodiment.

[0032]

[0083] The following definitions supplement those in the art and are directed to the present application. Therefore, the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0033] [Definition]

[0084] In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that as used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0034]

[0085] In this application, the use of "or" means "and / or" unless stated otherwise. As used herein, the terms "and / or" and "any combination thereof," as well as their grammatical equivalents, can be used interchangeably. These terms can convey that any and all combinations are specifically contemplated. The term "or" can be used conjunctively or disjunctively unless the context specifically dictates disjunctive use.

[0035]

[0086] Furthermore, use of the term "including" and other forms such as "include," "includes," and "included" is not limiting.

[0036]

[0087] References herein to "some embodiments," "one embodiment," "one embodiment," "alternative embodiments," or "other embodiments" mean that a particular feature, structure, or characteristic described in connection with an embodiment is included in at least some embodiments of the present disclosure, but not necessarily in all embodiments.

[0037]

[0088] As used in the specification and claims, the terms "comprising" (and any form of including, e.g., "comprise" and "comprises"), "having" (and any form of having, e.g., "have" and "has"), "including" (and any form of including, e.g., "includes" and "include"), or "containing" (and any form of including, e.g., "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the disclosure, and vice versa. Furthermore, the compositions of the disclosure can be used to achieve the methods of the disclosure.

[0038]

[0089] As used herein, the term "about" in connection with a reference numerical value and its grammatical equivalents includes the numerical value itself and a range of values of ±10% from that numerical value. The term "about" or "approximately" means within an acceptable range of error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or more standard deviations, according to practice in the art. Alternatively, "about" can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. In another example, the amount "about 10" includes any amount between 10 and 9-11. In yet another example, the term "about" with respect to a reference numerical value can also include a range of values of ±10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from that value. Alternatively, particularly with respect to biological systems or processes, the term "about" can mean within an order of magnitude of a value, preferably within 5-fold, and more preferably within 2-fold. Where particular values are described in this application and claims, unless otherwise specified, the term "about" should be assumed to mean within an acceptable range of error for the particular value.

[0039]

[0090] The term "isolated" and its grammatical equivalents, as used herein, refers to the removal of a nucleic acid from its natural environment. However, it should be understood that whether the nucleic acid is removed from nature (including genomic DNA and mRNA), synthesized (including cDNA), and / or amplified under laboratory conditions, the nucleic acid and protein can be formulated with a diluent or adjuvant and, for practical purposes, isolated. For example, when used for introduction into a cell, nucleic acid is typically mixed with an acceptable carrier or diluent.

[0040]

[0091] As used herein, the term "gene" refers to a nucleic acid molecule that can be used to produce mRNA, antisense RNA, siRNA, shRNA, miRNA, etc. A gene may or may not be capable of being used to produce a functional protein. A gene can include both coding and non-coding regions (e.g., regulatory elements including introns, promoters, enhancers, termination sequences, and 5' and 3' untranslated regions). A gene may also be "isolated," which refers to a nucleic acid molecule that is substantially or essentially free from components normally found associated with the nucleic acid molecule in its natural state. Such components include other cellular material, media from recombinant production, and / or various chemicals used in chemically synthesizing the nucleic acid molecule. Reference to a "gene" also includes within its scope a reference to a gene that has a contiguous sequence, thereby defining a contiguous nucleic acid entity as defined herein, or a gene that has a discontinuous sequence, thereby defining a discontinuous nucleic acid entity as defined herein. In certain embodiments, the term "gene" includes within its scope an open reading frame encoding a particular polypeptide, introns, and adjacent 5' and 3' non-coding nucleotide sequences involved in regulating expression. In this regard, a gene may further include regulatory sequences, such as promoters, enhancers, termination and / or polyadenylation signals, that are naturally associated with a given gene, or heterologous regulatory sequences. The gene sequence may be cDNA or genomic DNA, or a fragment thereof. The gene may be introduced into an appropriate vector for extrachromosomal maintenance or for introduction into a host.

[0041]

[0092] As used herein, "genome" refers to the entirety of an organism's genetic information represented by genes and non-coding sequences of DNA, either chromosomal or non-chromosomal genetic elements, such as linear polynucleotides, that comprise the gene(s) that undergo assembly and / or recombination. Thus, the term "genome" is intended to include the entirety of an organism's DNA, including nuclear DNA components, chromosomal or extrachromosomal DNA, and cytoplasmic domains (e.g., mitochondrial DNA).

[0042]

[0093] As used herein, the terms "nucleic acid," "polynucleotide," "oligonucleotide," or "nucleotide," or any grammatical equivalents, refer to a polymeric form of nucleotides or nucleic acids of any length, either ribonucleotides or deoxyribonucleotides. The term refers only to the primary structure of the molecule. Thus, the term includes double- and single-stranded DNA, triplex DNA, and double- and single-stranded RNA. It also includes modified forms, for example, by methylation and / or capping of the polynucleotide, as well as unmodified forms. The term is also meant to include molecules containing non-naturally occurring or synthetic nucleotides, and nucleotide analogs. The nucleic acid sequences and vectors disclosed or contemplated herein can be introduced into cells by, for example, transfection, transformation, or transduction.

[0043]

[0094] Nucleic acids and / or nucleic acid sequences are "homologous" if they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Proteins and / or protein sequences are "homologous" if the DNA encoding them is derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Homologous molecules can be referred to as homologs. Homology is generally inferred from sequence identity between two or more nucleic acids (or sequences thereof). The exact percentage of identity between sequences useful for establishing homology varies depending on the nucleic acid and protein in question, but as little as 25% sequence identity is routinely used to establish homology. Higher levels of sequence identity, e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more, can also be used to establish homology. Methods for determining sequence identity percentages (e.g., BLASTP and BLASTN using default parameters) are described herein and are generally available.

[0044]

[0095] As used herein, the term "identical" and its grammatical equivalents, or "sequence identity," in the context of two nucleic acid or amino acid sequences of polypeptides, refers to the residues in the two sequences that are the same when aligned for maximum correspondence over a particular comparison window.

[0045]

[0096] Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be achieved by the local homology algorithm of Smith and Waterman, Adv. Appl. Math., 2:482 (1981), by the alignment algorithm of Needleman and Wunsch, J. Mol. Biol., 48:443 (1970), by the similarity search method of Pearson and Lipman, Proc. Nat. Acad. Sci. USA, 85:2444 (1988), and by computerized implementations of these algorithms (including, but not limited to, CLUSTAL in the PC / Gene program by Intelligences, Inc., Mountain View, Calif., GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis., USA). CLUSTAL is implemented by the algorithm of Higgins and Sharp, Gene, 73:237-244 (1988); and Higgins and Sharp, CABIOS, 5:151-153 (1989); Corpet et al., Nucleic Acids Res., 16:10881-10890 (1988); Huang et al., Computer Applications in the Biosciences, 8:155-165 (1992); and Pearson et al., Methods in Molecular Biology, 24:307-331 (1994). Alignment is also often performed by visual inspection and manual alignment.Nucleic acids can also be described with reference to a starting nucleic acid, e.g., they can be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 98%, 99% or 100% identical to a reference nucleic acid or a fragment thereof, e.g., as measured by BLASTN (or CLUSTAL, or any other available alignment software) using default parameters. When one molecule is said to have a particular percentage sequence identity with a larger molecule, it means that when the two molecules are optimally aligned, that percentage of residues in the smaller molecule will find matching residues in the larger molecule according to the order in which the two molecules are optimally aligned.

[0046]

[0097] The term "substantially identical" and its grammatical equivalents when applied to nucleic acid sequences means that the nucleic acid or amino acid sequence comprises a sequence having at least 90% sequence identity or more, at least 95%, at least 98%, and at least 99%, when compared to a reference sequence using the above-listed programs, e.g., BLAST, using standard parameters. For example, the BLASTN program (for nucleotide sequences) uses as default a word length (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, where the portion of the polynucleotide sequence in the comparison window may contain additions or deletions (i.e., gaps) compared to the reference sequence (which contains no additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base exists in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. In embodiments, substantial identity exists over a region of the sequence that is at least about 25 bases long, 50 bases long, 100 bases long, 125 bases long, 150 bases long, and in embodiments, the sequences are substantially identical over at least about 180 bases. In embodiments, the sequences are substantially identical over the entire length of the coding region.

[0047]

[0098] An "expression vector" or "vector" is any genetic element, e.g., a plasmid, chromosome, virus, or transposon, to which another polynucleotide segment may be attached, bringing about the replication and / or expression of the attached segment, that either behaves as an autonomous unit of polynucleotide replication within a cell (i.e., capable of replication under its own control) or is capable of replication by insertion into a host cell chromosome. Suitable vectors include, but are not limited to, plasmids, transposons, bacteriophages, and cosmids. A vector may contain polynucleotide sequences necessary for effecting ligation or insertion of the vector into a desired host cell and for effecting expression of the attached segment. Such sequences vary depending on the host organism and may include promoter sequences to effect transcription, enhancer sequences to increase transcription, ribosomal binding site sequences, and transcription and translation termination sequences. Alternatively, an expression vector may be capable of directly expressing the product of a nucleic acid sequence encoded therein, without ligation or integration of the vector into host cell DNA sequences. In some embodiments, the vector is an episomal expression vector that can replicate in host cells and persist as an extrachromosomal segment of DNA in host cells under appropriate selection pressure.The vector can also contain a selectable marker gene.As used herein, the term "selectable marker gene" refers to a nucleic acid sequence that allows cells that express a nucleic acid sequence to be specifically selected in the presence of a corresponding selection agent.

[0048]

[0099] As used herein, the term "coding sequence" or "encoding sequence" refers to a segment of a polynucleotide that encodes a protein. This region or sequence is bounded by a start codon near its 5' end and a stop codon near its 3' end. A coding sequence may also be referred to as an open reading frame. The present invention is further directed to a nucleotide construct comprising such a nucleic acid operably linked to one or more regulatory elements or regions. A "regulatory element" or "regulatory region" typically, but not always, refers to a portion of nucleic acid upstream of a gene and may be composed of either DNA or RNA, or both DNA and RNA. Regulatory elements include those that can mediate organ specificity or control developmental or temporal gene activation. Furthermore, "regulatory elements" include promoter elements, core promoter elements, elements that can be induced in response to external stimuli, elements that are constitutively activated, or elements that decrease or increase promoter activity, such as negative regulatory elements or transcriptional enhancers, respectively. A nucleotide sequence exhibiting regulatory element activity means that the nucleotide sequence, when operably linked to a coding sequence of interest, functions as a promoter, a core promoter, a constitutive regulatory element, a negative element or silencer (i.e., an element that reduces promoter activity), or a transcriptional or translational enhancer.

[0049]

[0100] The present invention further includes vectors containing the above-described nucleic acids. Suitable expression vectors for use with the nucleic acid sequences of the present invention include, but are not limited to, plasmids, phagemids, viral particles and vectors, phages, and the like. For insect cells, baculovirus expression vectors are preferred. The entire expression vector, or a portion thereof, can be integrated into the host cell genome.

[0050]

[0101] Those skilled in the art will understand that a wide variety of expression systems can be used to produce the proteins or fragments thereof defined herein. Different host cells have characteristic and specific mechanisms for post-translational processing and modification of proteins and gene products. Those skilled in the art can select an appropriate cell line or host system to ensure the correct modification and processing of the expressed cardiac stem cell proliferation protein.

[0051]

[0102] As used herein, the term "operably linked" refers to the physical and / or functional linkage of a DNA segment to another DNA segment in a manner that allows the segments to function in their intended manner. A DNA sequence encoding a gene product is operably linked to a regulatory sequence, such as a promoter, enhancer, and / or silencer, if it is linked to the regulatory sequence in a manner that directly or indirectly allows regulation of transcription of the DNA sequence. For example, a DNA sequence is operably linked to a promoter if it is ligated to the promoter downstream of the promoter's transcription start site and in the correct reading frame relative to the transcription start site, allowing transcription elongation to proceed through the DNA sequence. An enhancer or silencer is operably linked to a DNA sequence encoding a gene product if it is ligated to the DNA sequence in a manner that increases or decreases transcription of the DNA sequence, respectively. Enhancers and silencers can be located upstream, downstream, or embedded within the coding region of a DNA sequence. DNA for a signal sequence is operably linked to DNA encoding a polypeptide if the signal sequence is expressed as a preprotein that participates in the secretion of the polypeptide. Linking of a DNA sequence to a regulatory sequence is typically accomplished by ligation at appropriate restriction sites or via adapters or linkers inserted into the sequence using restriction endonucleases known to those skilled in the art.

[0052]

[0103] As used herein, the terms "induce," "induction," and their grammatical equivalents refer to an increase in transcription, promoter activity, and / or expression of a nucleic acid sequence brought about by a transcriptional regulatory element relative to some basal level of the transcription or control system being used. Increased nucleic acid sequence transcription, promoter activity, and / or expression can also be brought about by a translational regulatory element, such as a UTR sequence, that enhances translation.

[0053]

[0104] As used herein, regulatory elements also include elements active after transcription initiation or transcription, e.g., regulatory elements that modulate gene expression, such as translational and transcriptional enhancers, translational and transcriptional repressors, and determinants of mRNA stability or instability. In the context of this disclosure, the term "regulatory element" also refers to DNA sequences that are usually, but not always, located upstream (5') of the coding sequence of a structural gene, including sequences that control expression of the coding region by providing recognition for RNA polymerase and / or other factors required for initiation of transcription at a specific site. An example of a regulatory element that provides recognition for RNA polymerase or other transcription factors to ensure initiation at a specific site is a promoter element. Promoter elements include core promoter elements responsible for initiation of transcription, as well as other regulatory elements that modify gene expression. It should be understood that nucleotide sequences located within introns or 3' of the coding region sequence can also contribute to regulating expression of a coding region of interest. Regulatory elements can also include elements located downstream (3') of the transcription initiation site, or within the transcribed region, or both. In the context of the present invention, post-transcriptional regulatory elements can include elements that are active after the initiation of transcription, such as translational and transcriptional enhancers, translational and transcriptional repressors, and mRNA stability determinants.

[0054]

[0105] A regulatory element or fragment thereof may be operably associated (operably linked) with a heterologous regulatory element or promoter to modulate the activity of the heterologous regulatory element. Such modulation includes enhancing or repressing the transcriptional activity of the heterologous regulatory element, modulating post-transcriptional events, or both enhancing / repressing the transcriptional activity of the heterologous regulatory element and modulating post-transcriptional events. For example, one or more regulatory elements or fragments thereof may be operably associated with a constitutive, inducible, or tissue-specific promoter or fragment thereof, or a fragment of a regulatory element, such as, but not limited to, a TATA sequence or a GC sequence, may be operably linked to a regulatory element of the invention to modulate the activity of such a promoter in a plant, insect, fungus, bacterial, yeast, or animal cell.

[0055]

[0106] There are several types of regulatory elements, including developmentally regulated, inducible, and constitutive. Regulatory elements that are developmentally regulated, or that control the differential expression of genes under their control, are activated in a particular organ or tissue of an organ at a particular time during the development of that organ or tissue. However, while some developmentally regulated regulatory elements may be preferentially active in a particular organ or tissue at a particular developmental stage, they may also be active in a developmentally regulated manner or active at a basal level in other organs or tissues within the plant.

[0056]

[0107] The term "promoter" refers to a region of a polynucleotide that initiates transcription of a coding sequence. A promoter is located on the same strand, near the transcription start site of a gene, upstream of the DNA (toward the 5' region of the sense strand). Some promoters are constitutive, being active in all environments within a cell, while other promoters, e.g., inducible promoters, are regulated to become active in response to specific stimuli. The term "promoter activity" and its grammatical equivalents, as used herein, refers to the degree of expression of a nucleotide sequence operably linked to a promoter whose activity is measured. Promoter activity can be measured directly, for example, by determining the amount of RNA transcripts produced by Northern blot analysis, or indirectly by determining the amount of a product encoded by a linked nucleic acid sequence, such as a reporter nucleic acid sequence linked to the promoter. Some non-limiting examples are CMV, EF1a, CAG, PGK, TRE, U6, and UAS.

[0057]

[0108] "Promoter" means a nucleotide sequence 5' of a coding region, or a fragment thereof, that contains all the signals necessary for initiation of transcription and regulation of the rate of transcription. Generally, there are two types of promoters: inducible promoters and constitutive promoters.

[0058]

[0109] A constitutive promoter directs the expression of a gene throughout various parts of an organism and / or continuously throughout the development of the organism. Any suitable constitutive promoter can be used to drive expression of a protein or fragment thereof as described herein.

[0059]

[0110] The term "constitutive" as used herein does not necessarily indicate that a gene is expressed at the same level in all cell types, but rather indicates that the gene is expressed in a wide range of cell types, although some variation in abundance is often observed.

[0060]

[0111] As used herein, the term "inducible promoter" refers to a promoter whose activity is induced by the presence or absence of a transcriptional regulatory factor, e.g., a biotic or abiotic factor. Inducible promoters are useful because the expression of a gene operably linked to them can be turned on or off using an inducer at a specific stage of the development of an organism or in a specific tissue. An inducible promoter is a promoter that can directly or indirectly activate the transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequence or gene will not be transcribed. Typically, the protein factor that specifically binds to an inducible promoter and activates transcription exists in an inactive form, which is subsequently converted directly or indirectly to an active form by the inducer. The inducer can be a protein, a metabolite, a chemical agent such as a growth regulator, or a physiological stress imposed directly by heat, cold, or a toxic element, or indirectly through the action of a pathogen or pathogen such as a virus. Non-limiting examples of inducible promoters include alcohol-regulated promoters, tetracycline-regulated promoters, steroid-regulated promoters, metal-regulated promoters, pathogenicity-regulated promoters, temperature-regulated promoters, and light-regulated promoters, and isopropyl-β-thiogalactopyranoside (IPTG)-inducible promoters.

[0061]

[0112] The nucleic acids and other constructs of the present invention may further comprise a 3' untranslated region. The 3' untranslated region refers to the portion of a gene that contains a DNA segment containing a polyadenylation signal and any other regulatory signals that may effect mRNA processing or gene expression. The polyadenylation signal is typically characterized by the addition of a polyadenylate chain, e.g., an SV-40 polyadenylation site, to the 3' end of the mRNA precursor.

[0062]

[0113] The genetic constructs of the present invention may also contain additional enhancers (either translational or transcriptional enhancers) as may be necessary. These enhancer regions are well known to those skilled in the art and may include the ATG initiation codon and adjacent sequences. The initiation codon must be in phase with the reading frame of the coding sequence to ensure translation of the entire sequence. Translational control signals and initiation codons may be of various origins, both natural and synthetic. The translation initiation region may be provided from the source of the transcription initiation region or from the structural gene. This sequence may also be derived from the regulatory elements selected to express the gene or may be specifically modified to increase translation of mRNA.

[0063]

[0114] The term "transcriptional regulator" or "cis-acting regulatory element" refers to a biochemical element that acts under certain environmental conditions to prevent or inhibit transcription of a DNA sequence driven by a promoter (e.g., a repressor protein or nuclear inhibitory protein), or a biochemical element that acts under certain environmental conditions to enable or stimulate transcription of a DNA sequence driven by a promoter (e.g., an inducer or enhancer).

[0064]

[0115] As used herein, the term "enhancer" or "translation enhancer" refers to a DNA sequence that, for example, increases the transcription of a nucleic acid sequence to which it is operably linked. Enhancers can be located several kilobases away from the coding region of a nucleic acid sequence and can mediate the binding of regulatory factors, DNA methylation patterns, or changes in DNA structure. Numerous enhancers from a variety of different sources are known in the art and are available as or within cloned polynucleotides (e.g., from depositories such as the ATCC, as well as other commercial or individual sources). Some polynucleotides that contain a promoter (such as the commonly used CMV promoter) also contain enhancer sequences. Enhancers can be located upstream, internal, or downstream of a coding sequence.

[0065]

[0116] As used herein, "patient" or "subject" refers to a mammalian subject who has been diagnosed with or is suspected of having or developing a medical condition, cellular defect, or disease or disorder, e.g., a proliferative disorder such as cancer. In some embodiments, the term "patient" refers to a mammalian subject who has a higher than average likelihood of developing a proliferative disorder such as cancer.

[0066]

[0117] A "patient in need thereof" or a "subject in need thereof," as used herein, refers to a patient diagnosed with or suspected of having a cellular defect, medical condition, disease, or disorder, for example, a proliferative disorder, such as, but not limited to, cancer. In some cases, the cancer is a solid tumor or a hematological malignancy. In some cases, the cancer is a solid tumor. In other cases, the cancer is a hematological malignancy. In some cases, the cancer is a metastatic cancer. In some cases, the cancer is a relapsed or refractory cancer. In some cases, the cancer is a solid tumor. Exemplary solid tumors include, but are not limited to, anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain malignancies, breast cancer, cervical cancer, colon cancer, cancer of unknown primary (CUP), esophageal cancer, eye cancer, fallopian tube cancer, gastrointestinal cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer. In some embodiments, the leukemia can be, for example, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CML).

[0067]

[0118] "Administering," as used herein, refers to providing one or more compositions described herein to a patient or subject. By way of example and not limitation, administration, e.g., injection, of a composition can be by intravenous (iv), subcutaneous (sc), intradermal (id), intraperitoneal (ip), or intramuscular (im) injection. One or more such routes can be used. Parenteral administration can be, for example, by bolus injection or by gradual perfusion over time. Alternatively, or concurrently, administration can be by oral route. In addition, administration can also be by bolus or pellet depot surgery or placement of a medical device. In one embodiment, a composition of the present disclosure can include engineered or host cells expressing a nucleic acid sequence described herein, or a vector comprising at least one nucleic acid sequence described herein, in an amount effective to treat or prevent a proliferative disorder. A pharmaceutical composition can include a target cell population described herein in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers, such as neutral buffered saline, phosphate buffered saline; carbohydrates, such as glucose, mannose, sucrose or dextran, mannitol; proteins; polypeptides or amino acids, such as glycine; antioxidants; chelating agents, such as EDTA or glutathione; adjuvants, such as aluminum hydroxide; and preservatives.

[0068]

[0119] As used herein, the terms "treatment," "treating," "amelioration," or grammatical equivalents refer to obtaining a desired pharmacological and / or physiological effect. In embodiments, the effect is therapeutic, i.e., the effect partially or completely cures the disease and / or adverse symptoms resulting from the disease.

[0069] [Embodiment]

[0120] Without wishing to be bound by theory or experimental results, the following paragraphs describe the nature of the present invention by way of example only. The experiments described or the specific examples of materials, promoters, enhancers, regulatory elements, vectors, cell lines, and constructs should not be construed as limiting the scope of the invention. Those skilled in the art will readily understand and recognize that other materials, promoters, enhancers, regulatory elements, vectors, cell lines, and constructs not specifically described also form part of the present invention.

[0070]

[0121] The present invention relates to nucleic acid sequences, vectors, compositions, kits and cells comprising the nucleic acid sequences, and methods for increasing the translation of a protein of interest.

[0071]

[0122] Transgenes have been used to deliver therapeutic payloads to improve the efficacy of gene therapy, oncolytic viral immunotherapy, and viral vector vaccine platforms. Although transgenes encoded in replicative viral therapies are designed to be highly transcribed, protein synthesis is often negatively affected by viral infection, which impairs the amount of therapeutic protein delivered and the efficacy of the corresponding therapy. Standard transgene mRNAs are translated suboptimally in infected cells. The present invention provides a method for identifying viral translation-enhancing 5' leaders that enhance mRNA translation.

[0072]

[0123] Recent studies have revealed that various translation enhancer motifs found in the leader sequences of viral mRNAs, including the nontemplated poly(A) leader in poxviruses or the ICP27-interacting motif in the HSV1 mRNA leader, can facilitate nuclear export. Viral internal ribosome entry sites (IRES), such as those based on encephalomyocarditis virus (EMCV), have also been used in recombinant gene expression to enhance translation of downstream genes or open reading frames (ORFs). However, the inclusion of translation enhancers has not been reported for clinically important oncolytic viruses (OVs), including oncolytic poxviruses and HSV1. For example, the T-VEC GM-CSF expression cassette does not contain a functionally authentic viral 5' leader, but approximately 100 bp of residual cloning sequence derived from the MCS of the pcDNA3 plasmid is used in the cloning process.

[0073]

[0124] We used RNA-Seq reads to determine the transcription start sites and 5' leaders of herpes simplex virus-1 (HSV1) genes from pre-infected cells. We identified HSV1 5' leaders that mediate high translation efficiency of downstream cistron mRNAs and exhibit superior activity during viral replication. We inserted these 5' leaders into a GM-CSF expression cassette in oncolytic HSV1, and compared the translationally adapted oncolytic viruses with conventional leaderless viruses in vitro and in mouse models. Oncolytic viruses carry transgenes encoding important therapeutic payloads. We demonstrated that adding a viral 5' leader to the transgene mRNA enhanced translation in infected cells, enhancing payload expression and ultimately improving virus-mediated antitumor efficacy.

[0074]

[0125] Screening the identified leaders for translation activity using a heterologous reporter identified the 5' leader of the late viral gene US11. This led us to hypothesize that the synthesis of therapeutic payloads from replicative oncolytic platforms could be enhanced by incorporating viral nucleic acid sequences, potentially 5' leader or UTR sequences. Therefore, we used RNA-Seq data from the HSV1 viral genome to identify sequences that could enhance protein expression. HSV-infected cancer cells were isolated, and RNA-Seq data was obtained to identify HSV1 sequences or 5' leaders that mediate high translation efficiency of downstream cistrons during viral replication. We observed that the US11 5' leader sequence from the HSV1 viral genome (i.e., the sequence of SEQ ID NO: 1) could enhance protein expression in cells several-fold when positioned upstream or 5' downstream of a cistron or gene encoding a protein of interest in HSV1-infected cells. The RNA counterpart of the US11 5' leader sequence (i.e., the sequence of SEQ ID NO: 4) also showed similar results. Inclusion of a 5' leader in an expression cassette integrated into the HSV1 genome was observed to enhance translation of a protein of interest (e.g., GM-CSF) in vitro and in vivo. Importantly, treatment with this translation-enhanced oncolytic HSV1 demonstrated superior antitumor immune activity and improved survival compared to leaderless GM-CSF HSV1 in a syngeneic mouse model of colorectal cancer. This demonstrates the therapeutic value of identifying and incorporating vector-specific cis-acting sequences that confer increased protein synthesis upon transgene expression.

[0075]

[0126] Thus, the present invention is directed to nucleic acids, vectors, compositions, kits, and cell lines comprising SEQ ID NO: 1 or SEQ ID NO: 4, wherein the nucleic acid further comprises a gene encoding a protein of interest, and optionally comprises a promoter, translation enhancer, or other regulatory element. More particularly, transcription of SEQ ID NO: 1 or 4 causes increased translation of the gene encoding the protein of interest, resulting in enhanced protein expression in HSV- or HSV1-infected cells.

[0076]

[0127] US11 5' Leader

[0128] Using RNA sequence mapping, the US11 5' leader nucleotide sequence has been identified and is detailed below: 5'GGCCAGAACCGCCGTGCACGACCCGGAGCGTCCCCTGCTGCGCTCCCGGGCTGCTGCCCGAAATCGCCCCCAACGCATCCTTGGGTGTGGCACATCGAAGAACCGGCGGGACCGTGACCGACAGTCCCCGTAATCCGGTAACCCGTTGAGTCCCGGGTACGACCATCACCCGAGTCTCTGGGCGGAGGGTGGTTCCCCCCCGTGTCTCTCGAG3' (hereinafter SEQ ID NO: 1)

[0077]

[0129] The sequence of SEQ ID NO:1 was cross-referenced against HSV1 KOS strain using the BLAST database from NCBI, and the sequence found was 100% identical to SEQ ID NO:1. US11 5' leader sequence: >gi|384597744|gb|JQ780693.1|:c144480-144266 Human herpesvirus type 1 KOS strain, complete genome 5'GGCCAGAACCGCCGTGCACGACCCGGAGCGTCCCCTGCTGCGCTCCCGGGCTGCTGCCCGAAATCGCCCCCAACGCATCCTTGGGTGTGGCACATCGAAGAACCGGCGGGACCGTGACCGACAGTCCCCGTAATCCGGTAACCCGTTGAGTCCCGGGTACGACCATCACCCGAGTCTCTGGGCGGAGGGTGGTTCCCCCCCGTGTCTCTCGAG3'

[0078]

[0130] The US11 5' leader sequence was also observed to be one of the highly conserved sequences in the HSV1 genome across the various strains identified. The NCBI BLASTN database also showed that the sequences upstream and downstream of the US11 5' leader were also highly conserved. 5'GCCGACGTACGCGATGAGATCAATAAAAGGGGGCGTGAGGACCGGGAGGC3' (the sequence upstream of SEQ ID NO: 1 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 2) 5'ATGAGCCAGACCCAACCCCCGGCCCCAGTTGGGCCGGGCGACCCAGATGT3' (the sequence downstream of SEQ ID NO: 1 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 3)

[0079]

[0131] As mentioned above, the desired effect of increased protein expression can be achieved using the RNA counterpart of SEQ ID NO: 1 detailed above. The RNA counterpart, upstream and downstream sequences of the US11 5' leader sequence are provided below. 5'GGCCAGAACCGCCGUGCACGACCCGGAGCGUCCCCUGCUGCGCUCUCCCGGGCUGCUGCCCGAAAUCGCCCCCAACGCAUCCUUGGGUGUGGCACAUCGAAGAACCGGCGGGACCGUGACCGACAGUCCCCGUAAUCCGGUAACCCGUUGAGUCCCGGGUACGACCAUCACCCGAGUCUCUGGGCGGAGGGUGGUUCCCCCCCGUGUCUCUCGAG 3' (RNA counterpart of SEQ ID NO: 1, hereafter SEQ ID NO: 4) 5'GCCGACGUACGCGAUGAGAUCAAUAAAAGGGGGCGUGAGGACCGGGAGGC3' (the RNA counterpart of SEQ ID NO: 2, i.e., the sequence upstream of SEQ ID NO: 4, hereinafter SEQ ID NO: 5) 5'AUGAGCCAGACCCAACCCCCGGCCCCAGUUGGGCCGGGCGACCCAGAUGU3' (the RNA counterpart of SEQ ID NO: 3, i.e., the sequence downstream of SEQ ID NO: 4, hereinafter SEQ ID NO: 6)

[0080]

[0132] UL27 5' Leader

[0133] Using RNA sequence mapping, the UL27 5' leader nucleotide sequence has been identified and is detailed below. 5'ACACTCTTTGCCTCGGTCTACCGGTGCGGGGAGCTCGAGTTGCGCCGCCCGGACTGCAGCCGCCCGACCTCCGAAGGTCGTTACCGTTACCCGCCCGGCGTATATCTCACGTACGACTCCGACTGTCCGCTGGTGGCCATCGTCGAGA GCGCCCCCGACGGCTGTATCGGCCCCCGGTCGGTCGTGGTCTACGACCGAGACGTTTTCTCGATCCTCTACTCGGTCCTCCAGCACCTCGCCCCAGGCTACCTGACGGGGGGCACGACGGGCCCCCGTAGTCCCGCC3' (hereinafter SEQ ID NO: 7)

[0081]

[0134] The sequence of SEQ ID NO:7 was cross-referenced against HSV1 strain KOS using the BLAST database from NCBI, and the sequence found was 100% identical to SEQ ID NO:7.

[0082]

[0135] UL27 5' leader sequence: >gi|384597744|gb|JQ780693.1|:c55744-55459 Human herpesvirus type 1 KOS strain, complete genome 5'ACACTCTTTGCCTCGGTCTACCGGTGCGGGGAGCTCGAGTTGCGCCGCCCGGACTGCAGCCGCCCGACCTCCGAAGGTCGTTACCGTTACCCGCCCGGCGTATATCTCACGTACGACTCCGACTGTCCGCTGGTGGCCATCGT CGAGAGCGCCCCCGACGGCTGTATCGGCCCCGGTCGGTCGTGGTCTACGACCGAGACGTTTTTCTCGATCCTCTACTCGGTCCTCCAGCACCTCGCCCCAGGCTACCTGACGGGGGGCACGACGGGCCCCCGTAGTCCCGCC3'

[0083]

[0136] The UL27 5' leader sequence was also observed to be one of the highly conserved sequences in the HSV1 genome across the various strains identified. The NCBI BLASTN database also showed that the sequences upstream and downstream of the UL27 5' leader were also highly conserved. 5'CCACTCAGCGCGCCGCCTGGCGATATATTCGCGAGCTGATTATCGCCACC3' (the sequence upstream of SEQ ID NO: 7 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 8) 5'ATGCACCAGGGCGCCCCCTCGTGGGGGCGCCGGTGGTTCGTCGTATGGGC3' (the sequence downstream of SEQ ID NO: 7 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 9)

[0084]

[0137] As mentioned above, the desired effect of increased protein expression can be achieved using the RNA counterpart of SEQ ID NO: 7 detailed above. The RNA counterpart, upstream and downstream sequences of the UL27 5' leader sequence are provided below. 5'ACACUCUUUGCCUCGGUCUACCGGUGCGGGGAGCUCGAGUUGCGCCGCCCGGACUGCAGCCGCCCGACCUCCGAAGGUCGUUACCGUUACCCGCCCGGCGUAUAUCUCACGUACGACUCCGACUGUCCGCUGGUGGCCAUCGUCGAGAGCGCCCC CGACGGCUGUAUCGGCCCCCGGUCGGUCGUGGUCUACGACCGCGACGUUUUCUCGAUCCUCUACUCGGUCCUCCAGCACCUCGCCCCCAGGCUACCUGACGGGGGGCACGACGGGCCCCCGUAGUCCCGCC3' (RNA counterpart of SEQ ID NO: 7, hereinafter SEQ ID NO: 10) 5'CCACUCAGCGCGCCGCCUGGCGAUAUAUUCGCGAGCUGAUUAUCGCCACC3' (the RNA counterpart of SEQ ID NO: 8, i.e., the sequence upstream of SEQ ID NO: 10, hereinafter SEQ ID NO: 11) 5'AUGCACCAGGGCGCCCCCUCGUGGGGGCGCCGGUGGUUCGUCGUAUGGGC3' (the RNA counterpart of SEQ ID NO: 9, i.e., the sequence downstream of SEQ ID NO: 10, hereinafter SEQ ID NO: 12).

[0085]

[0138] UL19 5' leader

[0139] Using RNA sequence mapping, the UL19 5' leader nucleotide sequence has been identified and is detailed below. 5'GGTCTGTTGGGGACACTGGGTTCTCTGGAACGAGGCCGCAGCCTTCTCCCGGTGCCTTTCCCCCCCGACCGACACCCGGCCTCTCACACAGCATCCCCCGCCTTTTTGGGTCCGGGCCCGTCGT GTCTTTCGGTGGACCTTGGGCCGTCGGGCACGTACACGGGTGGCCGGGCGTTGGGGTGGATCTTAGCCTCCCCGGGCCAATATCGCTAGAGACAGCCGATCTCCACGCGACCCC3' (hereinafter SEQ ID NO: 13)

[0086]

[0140] When the sequence of SEQ ID NO:13 was cross-referenced against HSV1 strain KOS using the BLAST database from NCBI, the sequence found was 100% identical to SEQ ID NO:13.

[0087]

[0141] UL19 5' leader sequence: >gi|384597744|gb|JQ780693.1|:c40421-40183 Human herpesvirus type 1 KOS strain, complete genome 5'GGTCTGTTGGGGACACTGGGTTCTCTGGAACGAGGCCGCAGCCTTCTCCCGGTGCCTTTCCCCCCCGACCGACACCCGGCCTCTCACACAGCATCCCCCGCCTTTTTGGGTCCGGGCC CGTCGTGTCTTTCGGTGGACCTTGGGCCGTCGGGCACGTACACGGGTGGCCGGGCGTTGGGGTGGATCTTAGCCTCCCCGGGCCAATATCGCTAGAGACAGCCGATCTCCACGCGACCCC3'

[0088]

[0142] The UL19 5' leader sequence was also observed to be one of the highly conserved sequences in the HSV1 genome across the various strains identified. The NCBI BLASTN database also showed that the sequences upstream and downstream of the UL19 5' leader were similarly highly conserved. 5'ACGGGGGTGGGGCGGGGGGGGTATATAAGGCCTGGGATCCCACGTCCCCG3' (the sequence upstream of SEQ ID NO: 13 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 14) 5'ATGGCCGCTCCCAACCGCGACCCTCCGGGATACCGGTATGCCGCGGCCAT3' (the sequence downstream of SEQ ID NO: 13 in the HSV1 viral genome, hereinafter referred to as SEQ ID NO: 15)

[0089]

[0143] As mentioned above, the desired effect of increased protein expression can be achieved using the RNA counterpart of SEQ ID NO: 13 detailed above. The RNA counterpart, upstream and downstream sequences of the UL19 5' leader sequence are provided below. 5'GGUCUGUUGGGGACACUGGGUUCUCCUGGAACGAGGCCGCAGCCUUCUCCCGGUGCCUUUCCCCCCCGACCGACACCCGGCCUCUCACACAGCAUCCCCCGCCUUUUUGGGUCCGGGCCCGUCGUGUCUUUCGGUGGACCUUGGGCCGUCGGGCACGUACACGGGUGGCCGGGCGUUGGGGUGGAUCUUAGCCUCCCCGGGCCAAUAUCGCUAGAGACAGCCGAUCUCCACGCGACCCC 3' (RNA counterpart of SEQ ID NO: 13, hereafter SEQ ID NO: 16). 5'ACGGGGGUGGGGCGGGGGGGGUAUAUAAGGCCUGGGAUCCCACGUCCCCG3' (the RNA counterpart of SEQ ID NO: 14, i.e. the sequence upstream of SEQ ID NO: 13, hereafter SEQ ID NO: 17). 5'AUGGCCGCUCCCAACCGCGACCCUCCGGGAUACCGGUAUGCCGCGGCCAU3' (the RNA counterpart of SEQ ID NO: 15, i.e. the sequence downstream of SEQ ID NO: 13, hereinafter SEQ ID NO: 18).

[0090]

[0144] Representative nucleic acid sequences of the present invention are shown in Figures 1a, 1b, and 1c. As will be appreciated by those of skill in the art, the sequences detailed above are merely representative and should not be construed as limiting the scope of the present invention.

[0091]

[0145] The following description and examples illustrate in detail the embodiments of the present disclosure. It should be understood that the present disclosure is not limited to the specific embodiments described herein and may therefore vary. Those skilled in the art will recognize that there are numerous variations and modifications to the present disclosure that are within the scope of the present disclosure.

[0092]

[0146] The experimental results and data presented in this application demonstrate that the HSV1 US11 5' leader sequence fused upstream of a therapeutic payload encoded within HSV1 can be used to greatly enhance transgene protein expression and improve the therapeutic efficacy of the virus. Similar results are expected from the US11 5' leader sequence of HSV or other HSV variants.

[0093]

[0147] Given the results presented in this application, the sequence of the US11 5' leader (i.e., SEQ ID NO: 1 or 4) can be used to enhance expression of any protein of interest by inserting it into a nucleic acid, vector, gene delivery vehicle, recombinant DNA or RNA construct, cell line, or composition, or a kit containing any of these. For example, a vector or plasmid can be constructed to place the sequence of SEQ ID NO: 1 or 4 upstream of a gene / cistron encoding a protein of interest (e.g., a protein that can ameliorate or treat any medical condition, cellular defect, disease, or disorder, or that can provide any therapeutic effect). Furthermore, constructs containing SEQ ID NO: 1 or 4 can be used with various cell lines in vivo or in vitro, as desired. Accordingly, the inventors propose the following embodiments:

[0094]

[0148] nucleic acid

[0149] The present invention relates to nucleic acids comprising SEQ ID NO:1, or a fragment thereof comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:1, but not including SEQ ID NO:2, SEQ ID NO:3, or both, and not including a fragment of SEQ ID NO:2, SEQ ID NO:3, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO:1.

[0095]

[0150] In some embodiments, the invention relates to a nucleic acid comprising SEQ ID NO:4, or a fragment comprising at least 180 nucleotides thereof, or a sequence at least 90% identical to SEQ ID NO:4, but excluding SEQ ID NO:5, SEQ ID NO:6, or both, and excluding a fragment of SEQ ID NO:5, SEQ ID NO:6, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO:4.

[0096]

[0151] In some embodiments, the invention relates to a nucleic acid comprising SEQ ID NO:7, or a fragment comprising at least 180 nucleotides thereof, or a sequence at least 90% identical to SEQ ID NO:7, but not including SEQ ID NO:8, SEQ ID NO:9, or both, and not including a fragment of SEQ ID NO:8, SEQ ID NO:9, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO:7.

[0097]

[0152] In some embodiments, the invention relates to a nucleic acid comprising SEQ ID NO: 10, or a fragment comprising at least 180 nucleotides thereof, or a sequence at least 90% identical to SEQ ID NO: 16, but not including SEQ ID NO: 11, SEQ ID NO: 12, or both, and not including a fragment of SEQ ID NO: 11, 12, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO: 10.

[0098]

[0153] In some embodiments, the invention relates to a nucleic acid comprising SEQ ID NO: 13, or a fragment comprising at least 180 nucleotides thereof, or a sequence at least 90% identical to SEQ ID NO: 13, but not including SEQ ID NO: 14, SEQ ID NO: 15, or both, and not including a fragment of SEQ ID NO: 14, 15, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO: 13.

[0099]

[0154] In some embodiments, the invention relates to a nucleic acid comprising SEQ ID NO: 16, or a fragment comprising at least 180 nucleotides thereof, or a sequence at least 90% identical to SEQ ID NO: 16, but not including SEQ ID NO: 17, SEQ ID NO: 18, or both, and not including a fragment of SEQ ID NO: 17, 18, or both, whose nucleotide sequence is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO: 16.

[0100]

[0155] In an alternative embodiment, a nucleic acid is provided comprising SEQ ID NO:1, or a sequence at least 90% identical over its entire length to SEQ ID NO:1, wherein the nucleotide sequence does not include SEQ ID NO:2, SEQ ID NO:3, or both. Further, the nucleic acid does not include a fragment of SEQ ID NO:2, SEQ ID NO:3, or both, that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous 5' or 3' to SEQ ID NO:1.

[0101]

[0156] In an alternative embodiment, a nucleic acid is provided comprising SEQ ID NO:4, or a sequence at least 90% identical over its entire length to SEQ ID NO:4, wherein the nucleotide sequence does not include SEQ ID NO:5, SEQ ID NO:6, or both. Further, the nucleic acid does not include a fragment of SEQ ID NO:5, SEQ ID NO:6, or both, that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous 5' or 3' to SEQ ID NO:4.

[0102]

[0157] In an alternative embodiment, a nucleic acid is provided which is SEQ ID NO:7, or a sequence at least 90% identical over its entire length to SEQ ID NO:7, wherein the nucleotide sequence does not include SEQ ID NO:8, SEQ ID NO:9, or both. Furthermore, the nucleic acid does not include a fragment of SEQ ID NO:8, SEQ ID NO:9, or both, that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous 5' or 3' to SEQ ID NO:7.

[0103]

[0158] In an alternative embodiment, a nucleic acid is provided comprising SEQ ID NO: 10, or a sequence at least 90% identical over its entire length to SEQ ID NO: 10, wherein the nucleotide sequence does not include SEQ ID NO: 11, SEQ ID NO: 12, or both. Furthermore, the nucleic acid does not include a fragment of SEQ ID NO: 11, 12, or both that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous 5' or 3' to SEQ ID NO: 10.

[0104]

[0159] In an alternative embodiment, a nucleic acid is provided comprising SEQ ID NO: 13, or a sequence at least 90% identical over its entire length to SEQ ID NO: 13, wherein the nucleotide sequence does not include SEQ ID NO: 14, SEQ ID NO: 15, or both. Further, the nucleic acid does not include a fragment of SEQ ID NO: 14, 15, or both that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous 5' or 3' to SEQ ID NO: 13.

[0105]

[0160] In an alternative embodiment, a nucleic acid is provided comprising SEQ ID NO: 16, or a sequence at least 90% identical over its entire length to SEQ ID NO: 16, wherein the nucleotide sequence does not include SEQ ID NO: 17, SEQ ID NO: 18, or both. Furthermore, the nucleic acid does not include a fragment of SEQ ID NO: 17, 18, or both that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous 5' or 3' to SEQ ID NO: 16.

[0106]

[0161] As discussed above, the US11 gene sequence is highly conserved. Therefore, the nucleic acid identified by the present inventors can exhibit the desired effect when isolated from the genome of the HSV1 virus, i.e., increase protein expression several-fold compared to its expression in the absence of the US11 5' leader. The nucleotide sequences flanking SEQ ID NO:1 are also highly conserved. Therefore, the above embodiment explicitly negates the naturally occurring sequence, i.e., 5' SEQ ID NO:2-SEQ ID NO:1-SEQ ID NO:3 3', and uses only SEQ ID NO:1 or a fragment or sequence that is 90% identical to SEQ ID NO:1. The nucleic acid does not contain the sequence of SEQ ID NO:2 or 3 or any fragment of SEQ ID NO:2 or 3. Therefore, a nucleic acid containing SEQ ID NO:1 can be engineered to insert a gene encoding a protein of interest along with other regulatory elements for increased protein expression. It is appropriate to note that the increase in protein production occurs upon HSV1 infection.

[0107]

[0162] As discussed above, the UL27 gene sequence is highly conserved. Therefore, the nucleic acid identified by the present inventors can exhibit the desired effect when isolated from the genome of the HSV1 virus, i.e., increase protein expression several-fold compared to its expression in the absence of the UL27 5' leader. The nucleotide sequences flanking SEQ ID NO:7 are also highly conserved. Therefore, the above embodiment explicitly negates the naturally occurring sequence, i.e., 5' SEQ ID NO:8-SEQ ID NO:7-SEQ ID NO:9 3', and uses only SEQ ID NO:7 or fragments or sequences 90% identical to SEQ ID NO:7. The nucleic acid does not contain the sequence of SEQ ID NO:8 or 9 or any fragment of SEQ ID NO:8 or 9. Therefore, a nucleic acid containing SEQ ID NO:7 can be engineered to insert a gene encoding a protein of interest along with other regulatory elements to increase protein expression. It is appropriate to note that the increase in protein production occurs upon HSV1 infection.

[0108]

[0163] As discussed above, the UL19 gene sequence is highly conserved. Therefore, the nucleic acid identified by the present inventors can exhibit the desired effect when isolated from the genome of the HSV1 virus, i.e., increase protein expression several-fold compared to its expression in the absence of the UL19 5' leader. The nucleotide sequences adjacent to SEQ ID NO:13 are also highly conserved. Therefore, the above embodiment explicitly negates the naturally occurring sequence, i.e., 5' SEQ ID NO:14-SEQ ID NO:13-SEQ ID NO:15 3', and uses only SEQ ID NO:13 or a fragment or sequence that is 90% identical to SEQ ID NO:13. The nucleic acid does not contain the sequence of SEQ ID NO:14 or 15 or any fragment of SEQ ID NO:14 or 15. Therefore, a nucleic acid containing SEQ ID NO:13 can be engineered to insert a gene encoding a protein of interest along with other regulatory elements to increase protein expression. It is appropriate to note that increased protein production occurs upon HSV1 infection.

[0109]

[0164] Although the HSV1 virus is a dsDNA, increased protein expression occurs due to increased ribosome recruitment during translation, which causes enhanced translation of mRNA transcripts; therefore, the RNA counterpart of SEQ ID NO: 1, i.e., SEQ ID NO: 4, the RNA counterpart of SEQ ID NO: 7, i.e., SEQ ID NO: 10, or the RNA counterpart of SEQ ID NO: 13, i.e., SEQ ID NO: 16, can also provide this desired effect. Accordingly, in an alternative embodiment, a nucleic acid comprising SEQ ID NO: 4, i.e., the RNA counterpart of SEQ ID NO: 1, or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 4, but not including SEQ ID NO: 5 (i.e., the RNA counterpart of SEQ ID NO: 2), SEQ ID NO: 6 (i.e., the RNA counterpart of SEQ ID NO: 3), or both, is provided. Similarly, in an alternative embodiment, a nucleic acid comprising SEQ ID NO: 10, i.e., the RNA counterpart of SEQ ID NO: 7, or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 10, but not including SEQ ID NO: 11 (i.e., the RNA counterpart of SEQ ID NO: 8), SEQ ID NO: 12 (i.e., the RNA counterpart of SEQ ID NO: 9), or both, is provided. Similarly, in an alternative embodiment, there is provided a nucleic acid comprising SEQ ID NO: 16, i.e., the RNA counterpart of SEQ ID NO: 13, or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 13, but excluding SEQ ID NO: 17 (i.e., the RNA counterpart of SEQ ID NO: 14), SEQ ID NO: 18 (i.e., the RNA counterpart of SEQ ID NO: 15), or both.

[0110]

[0165] In an alternative embodiment, there is provided a sequence at least 90% identical to SEQ ID NO: 4, or a fragment comprising at least 180 nucleotides, wherein the nucleic acid does not include SEQ ID NO: 5, SEQ ID NO: 6, or both. The nucleic acid does not include a fragment of SEQ ID NO: 5, 6, or both that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO: 4. Thus, RNA nucleic acids or RNA counterparts of the above-defined nucleic acids are also envisaged.

[0111]

[0166] In one embodiment of the invention, the nucleic acid does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 2 that is immediately contiguous 5' to SEQ ID NO: 1, or the nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 3 that is immediately contiguous 3' to SEQ ID NO: 1. An alternative embodiment is also contemplated that includes the RNA counterparts of SEQ ID NOs: 1, 2, and 3 (i.e., SEQ ID NOs: 4, 5, and 6).

[0112]

[0167] In an alternative embodiment, the nucleic acid does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO:2 that is immediately contiguous 5' to SEQ ID NO:1, and the nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO:3 that is immediately contiguous 3' to SEQ ID NO: 1. An alternative embodiment is also contemplated that includes the RNA counterparts of SEQ ID NOs:1, 2, and 3 (i.e., SEQ ID NOs:4, 5, and 6).

[0113]

[0168] In an alternative embodiment, the nucleic acid does not include the entire length of SEQ ID NO: 2 or the entire length of SEQ ID NO: 3 immediately contiguous 5' or 3' to SEQ ID NO: 1. An alternative embodiment is also contemplated that includes the RNA counterparts of SEQ ID NOs: 1, 2, and 3 (i.e., SEQ ID NOs: 4, 5, and 6).

[0114]

[0169] Alternative embodiments are also contemplated having SEQ ID NO: 7, 13, or their RNA counterparts, i.e., SEQ ID NO: 10 or 16. In each embodiment using SEQ ID NO: 7, the nucleic acid does not include SEQ ID NO: 8, 9, or both. In each embodiment using SEQ ID NO: 10, the nucleic acid does not include SEQ ID NO: 11, 12, or both. In each embodiment using SEQ ID NO: 13, the nucleic acid does not include SEQ ID NO: 14, 15, or both. In each embodiment using SEQ ID NO: 16, the nucleic acid does not include SEQ ID NO: 17, 18, or both.

[0115]

[0170] In one embodiment of the invention, the nucleotide sequence or nucleic acid does not comprise at least 250, 500, 1000 or more contiguous nucleotides of the entire genome of Human Herpesvirus Type 1, strain KOS as defined by NCBI Accession No. JQ673480.1 GI:380776962 or Accession No. JQ780693.1 GI:384597744, or a sequence 95% identical thereto.

[0116]

[0171] In one embodiment of the present invention, a second nucleic acid is also envisaged, consisting of the nucleic acid according to claim 1. In an alternative embodiment, the nucleic acid may be a synthetic or recombinant nucleic acid comprising the sequence of SEQ ID NO: 1. The nucleic acid may also be in the form of an expression vector or plasmid, wherein the expression vector or plasmid is heterologous to HSV1 and drives the production of a protein of interest.

[0117]

[0172] In some embodiments, the nucleic acid further comprises a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonuclease or cloning sites, one or more polyadenylation sites, or any combination thereof, wherein at least one or more of the promoter, the nucleotide sequence encoding the protein of interest, the one or more restriction endonuclease or cloning sites, the one or more polyadenylation sites, or any combination thereof is heterologous to HSV1.

[0118]

[0173] Some non-limiting examples of promoters that can be fused to SEQ ID NO: 1, 4, 7, 10, 13, or 16 include CMV, EF1a, CAG, PGK, TRE, U6, and UAS. The nucleotide sequence encoding the protein of interest can be selected from GM-CSF, TNF-α, p53, GFP, chloramphenicol acetyltransferase (CAT), SMN protein, lipoprotein lipase, Tat protein, Ebola glycoprotein, SARS-CoV-2 spike (S) protein, cytokines, ovalbumin, retinoid isomerohydrolase RPE65, insulin, SIV Env and Nef antigens OR Gag, Env and Tat-Rev-Nef fusion proteins, viral antigens, cyclin G1, immunogenic proteins, immunomodulatory proteins, or cellular regulatory proteins. The protein of interest can be a reporter protein, a cellular regulatory protein, or a cytotoxic protein.

[0119]

[0174] The one or more regulatory sequences can be selected from any known promoter, enhancer, silencer, transcription factor, coactivator, or operator. The one or more restriction endonuclease or cloning sites are palindromic sequences recognizable by restriction endonucleases. The one or more polyadenylation sites can be a stretch of adenine bases or an SV40 site or any other site known in the art.

[0120]

[0175] In the embodiments detailed above, the promoter is located upstream or 5' to the sequence of SEQ ID NO: 1 and the nucleotide sequence encoding the protein of interest is located downstream or 3' to the sequence of SEQ ID NO: 1. In some embodiments, the promoter is located immediately upstream of the sequence of SEQ ID NO: 1 or its RNA counterpart and the nucleotide sequence encoding the protein of interest is located immediately downstream of the sequence of SEQ ID NO: 1 or its RNA counterpart.

[0121]

[0176] In some embodiments, the nucleic acid may be linear, and in an alternative embodiment, the nucleic acid may be circular. The nucleic acid of any of the above embodiments may increase translation of a nucleotide sequence encoding a protein of interest compared to its translation in the absence of SEQ ID NO: 1 or 4.

[0122]

[0177] In one embodiment of the present invention, a nucleic acid is provided consisting of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 4. In an alternative embodiment, the nucleic acid may comprise the sequence of SEQ ID NO: 1, wherein the sequence of SEQ ID NO: 1 is isolated from the genome of HSV1. The nucleic acids detailed herein above do not include the sequence of the UL9 gene downstream or 3' of SEQ ID NO: 1 or the sequence of the UL12 gene upstream or 5' of SEQ ID NO: 1, as found in the naturally occurring HSV1 genome. In addition, the sequence of SEQ ID NO: 1 claimed in the present invention does not include sequence complementary to the sequence of the US10 gene immediately contiguous downstream or 3' of SEQ ID NO: 1. An alternative embodiment encompassing the mRNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4) is also contemplated.

[0123]

[0178] In other embodiments, the nucleic acid sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 2 that is immediately contiguous 5' to SEQ ID NO: 1, or the nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 3 that is immediately contiguous 3' to SEQ ID NO: 1. Alternative embodiments encompassing the corresponding sequences, i.e., SEQ ID NOs: 4, 5, and 6, are also contemplated.

[0124]

[0179] In an alternative embodiment, the nucleic acid nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of SEQ ID NO: 2 that is immediately contiguous 5' to SEQ ID NO: 1, and the nucleotide sequence further does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of SEQ ID NO: 3 that is immediately contiguous 3' to SEQ ID NO: 1. Alternative embodiments encompassing the corresponding sequences, i.e., SEQ ID NOs: 4, 5 and 6, are also envisioned.

[0125]

[0180] In some embodiments, the nucleic acid does not contain SEQ ID NO:2 immediately contiguous to the 5' or 3' side of SEQ ID NO:1, or the nucleic acid does not contain SEQ ID NO:2 immediately contiguous to the 5' side of SEQ ID NO:1. In an alternative embodiment, the nucleic acid does not contain SEQ ID NO:3 immediately contiguous to the 5' or 3' side of SEQ ID NO:1, or the nucleic acid does not contain SEQ ID NO:3 immediately contiguous to the 3' side of SEQ ID NO:1. An alternative embodiment encompassing the corresponding sequences, i.e., SEQ ID NOs:4, 5 and 6, is also contemplated.

[0126]

[0181] In one embodiment of the present invention, there is provided a synthetic / recombinant nucleic acid comprising the nucleic acid of SEQ ID NO: 1 or SEQ ID NO: 4 (in the case of mRNA embodiments), which nucleic acid does not comprise a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 2 that is immediately contiguous to the 5' side of SEQ ID NO: 1, or does not comprise a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases of SEQ ID NO: 5 that is immediately contiguous to the 5' side of SEQ ID NO: 4 ... The sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of SEQ ID NO:3 that is immediately contiguous 3' to SEQ ID NO:1, or the nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of SEQ ID NO:6 that is immediately contiguous 3' to SEQ ID NO:4.

[0127]

[0182] In one embodiment of the invention, there is provided a synthetic / recombinant nucleic acid comprising the nucleic acid of SEQ ID NO:1 or SEQ ID NO:4 (in the case of mRNA embodiments), which nucleic acid does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of SEQ ID NO:2 immediately contiguous to the 5' side of SEQ ID NO:1, and whose nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of SEQ ID NO:3 immediately contiguous to the 3' side of SEQ ID NO:1; The nucleic acid does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of SEQ ID NO:5 that is immediately contiguous to the 5' side of SEQ ID NO:4, and the nucleotide sequence does not include a fragment of at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45 or at least 50 nucleotide bases of SEQ ID NO:6 that is immediately contiguous to the 3' side of SEQ ID NO:4.

[0128]

[0183] In any of the embodiments detailed above, the nucleic acid may further comprise a promoter or a gene encoding a protein of interest, or both. The promoter may be located upstream or 5' to the sequence of SEQ ID NO:1 or SEQ ID NO:4. The gene encoding the protein of interest is located downstream or 3' to the sequence of SEQ ID NO:1 or SEQ ID NO:4. In an alternative embodiment, the promoter may be located 5' to the sequence of SEQ ID NO:1 or SEQ ID NO:4, and the gene encoding the protein of interest is located 3' to the sequence of SEQ ID NO:1 or SEQ ID NO:4. In some embodiments, the promoter is located immediately upstream of the sequence of SEQ ID NO:1 or its RNA counterpart, and the gene encoding the protein of interest is located immediately upstream of the sequence of SEQ ID NO:1 or its RNA counterpart.

[0129]

[0184] In some embodiments, the nucleic acid can be single-stranded RNA, single-stranded DNA, double-stranded RNA, or double-stranded DNA. A nucleic acid comprising the sequence of SEQ ID NO: 1 is transcribed into an RNA sequence corresponding to SEQ ID NO: 1, i.e., mRNA having the sequence of SEQ ID NO: 4.

[0130]

[0185] In some embodiments, the nucleic acids detailed in this application may be in the form of concatemers, i.e., the nucleic acid may comprise several repeating units of SEQ ID NO: 1, or SEQ ID NO: 1 is repeated at least two or more times.

[0131]

[0186] The nucleic acids detailed herein above can enhance translation, thus acting as translation enhancers. More specifically, when located downstream or 3' of SEQ ID NO: 1, transcription of SEQ ID NO: 1 contained in the nucleic acid increases the translation of the gene encoding the protein of interest compared to its translation in the absence of SEQ ID NO: 1. A similar embodiment including the RNA counterpart of SEQ ID NO: 1, i.e., SEQ ID NO: 4, is also feasible.

[0132]

[0187] In some embodiments, the nucleic acid is a transgene or the nucleic acid is inserted into a gene delivery vehicle, some non-limiting examples of which include a plasmid, a vector, a recombinant DNA or RNA construct, or an expression cassette or a nanoparticle, which may be a lipid nanoparticle.

[0133]

[0188] In one embodiment of the present invention, the nucleic acid comprises additional components. For example, the nucleic acid may comprise the sequence of SEQ ID NO: 1 and a restriction endonuclease site for a gene encoding a protein of interest. In an alternative embodiment, the nucleic acid comprises the sequence of SEQ ID NO: 1, a restriction endonuclease site for a gene encoding a protein of interest, and a restriction endonuclease site for a promoter, a regulatory element, or both. The restriction endonuclease site for the gene encoding the protein of interest is located downstream or 3' to SEQ ID NO: 1. The restriction endonuclease site for the promoter or regulatory element is located upstream or 5' to SEQ ID NO: 1. In an alternative embodiment, the restriction endonuclease site for the gene encoding the protein of interest is located immediately contiguous to the 3' side of SEQ ID NO: 1, and the restriction endonuclease site for the promoter or regulatory element is located immediately contiguous to the 5' side of SEQ ID NO: 1. Transcription of the sequence of SEQ ID NO: 1 increases translation of the gene encoding the protein of interest compared to its translation in the absence of SEQ ID NO: 1. More specifically, translation of a sequence encoding a protein of interest in the presence of SEQ ID NO: 1 increases the expression, synthesis, or production of the protein of interest several fold compared to its expression, synthesis, or production in the absence of SEQ ID NO: 1. Analogous embodiments including the RNA counterpart of SEQ ID NO: 1, i.e., SEQ ID NO: 4, can also produce similar results.

[0134]

[0189] In some embodiments, the nucleic acids detailed above may further comprise a polyadenylation sequence, which is downstream or 3' of the sequence encoding the protein of interest. In an alternative embodiment, the polyadenylation sequence is immediately contiguous with the 3' of the sequence encoding the protein of interest. Without wishing to be limiting, the polyadenylation sequence can be selected from any polyadenylation sequence known in the art. In some embodiments, the polyadenylation sequence is an SV40 polyadenylation sequence.

[0135]

[0190] The gene encoding the protein of interest can be a cistron that can encode any of the following proteins: GM-CSF, TNF-α, p53, GFP, chloramphenicol acetyltransferase (CAT), GM-CSF, SMN protein, lipoprotein lipase, Tat protein, Ebola glycoprotein, SARS-CoV-2 spike (S) protein, cytokines, ovalbumin, retinoid isomerohydrolase RPE65, insulin, SIV Env and Nef antigens OR Gag, Env and Tat-Rev-Nef fusion proteins, viral antigens, cyclin G1, immunogenic proteins, immunomodulatory proteins, or cellular regulatory proteins. The protein of interest can be a reporter protein, a cellular regulatory protein, or a cytotoxic protein.

[0136]

[0191] In some embodiments, the cistron encodes a GM-CSF protein or a TNF-α protein. In some embodiments, the cistron encodes a protein that targets the selected cistron to a particular cell line. Some non-limiting examples may be a carcinoma cell line, a melanoma cell line, a neuronal cell line, an epithelial cell line, or a lymphocyte cell line.

[0137]

[0192] In the embodiments detailed above, the regulatory elements used, promoters or translation enhancers, may be cis-acting, non-limiting examples of which are provided above.

[0138]

[0193] In one embodiment of the present invention, a nucleic acid is provided comprising a promoter, the sequence of SEQ ID NO: 1 or 4, and a gene encoding a protein of interest. Thus, in some embodiments, the nucleic acid may comprise SEQ ID NO: 1 or 4, a CMV promoter, and a gene encoding GM-CSF. In some alternative embodiments, the nucleic acid may comprise SEQ ID NO: 1 or 4, a CMV promoter, and a gene encoding TNF-α. The promoter, i.e., CMV, is located upstream or 5' to the sequence of SEQ ID NO: 1 or 4. The gene encoding the protein of interest, i.e., GM-CSF, is located downstream or 3' to the sequence of SEQ ID NO: 1 or 4. In an alternative embodiment, the promoter may be located 5' to the sequence of SEQ ID NO: 1 or 4, and the gene encoding the protein of interest may be located 3' to the sequence of SEQ ID NO: 1 or 4. The promoter can be selected from any of the promoters listed above. The gene encoding the protein of interest can be a cistron, which can be selected from the examples listed herein above. The selected cistron can encode a protein of interest that targets a specific cell line, some non-limiting examples of which are provided in the present application. As discussed above, translation of the sequence gene for a protein of interest in the presence of SEQ ID NO: 1 or 4 increases the expression, synthesis, or production of the protein of interest several fold compared to its expression, synthesis, or production in the absence of SEQ ID NO: 1 or 4. In some embodiments, the increase in protein expression, synthesis, or production is 0.5-fold, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, or 8-fold. Increased protein expression, synthesis, or production typically occurs with HSV1 infection.

[0139]

[0194] In one embodiment of the invention, the nucleic acid may comprise a CMV promoter, the sequence of SEQ ID NO: 1 or 4, and a gene encoding a GM-CSF protein. In an alternative embodiment, the nucleic acid may comprise a CMV promoter, the sequence of SEQ ID NO: 1 or 4, and a gene encoding a TNF-α protein. The CMV promoter is located upstream or 5' to the sequence of SEQ ID NO: 1 or 4. The gene encoding the GM-CSF protein is located 3' to the sequence of SEQ ID NO: 1 or 4. Transcription of the sequence of SEQ ID NO: 1 increases translation of the gene encoding the GM-CSF protein several fold (i.e., 0.5-fold, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, or 8-fold) compared to its translation in the absence of SEQ ID NO: 1 or 4.

[0140]

[0195] In some embodiments, the nucleic acid can be inserted into a gene delivery vehicle such as a plasmid, vector, recombinant DNA or RNA construct, or expression cassette. Some non-limiting examples of vectors that can be used include viral vectors, live viral vectors, oncolytic viral vectors, attenuated viral vectors, recombinant vectors, or amplicon vectors. In some alternative embodiments, the nucleic acid can be inserted and incorporated into a nanoparticle or lipid nanoparticle, or into an HSV1 or HSV1-based gene delivery vehicle or construct. When the nucleic acid is inserted into any part of an HSV1 or HSV1-based construct, the nucleic acid can be inserted into any site or restriction endonuclease site of the HSV1 genome. In an alternative embodiment, the nucleic acid can be inserted into the tk locus of HSV1.

[0141]

[0196] The nucleic acid inserted into an HSV1-based gene delivery vehicle or construct can be used for administration to a patient in need thereof, where the patient is pre-infected with HSV1 virus before administration of the HSV1 virus-based delivery vehicle. Alternatively, the nucleic acid can be inserted into a live HSV1 virus vector or an oncolytic HSV1 vector, and the live virus vector can be used for administration to a patient in need thereof, thereby eliminating the need for pre-infection. The administration of the nucleic acid increases protein expression, synthesis, or production, but the increased production is only evident in cells of a patient pre-infected with HSV1 virus.

[0142]

[0197] In one embodiment of the present invention, the nucleic acid may be inserted into an HSV1 virus, and the virus is modified to include an endonuclease site for the promoter or regulatory element and an endonuclease site for the sequence encoding the protein of interest. The promoter, regulatory element, and downstream cistron can be selected from the examples previously presented herein. The HSV1 virus delivers a nucleic acid containing SEQ ID NO: 1 or 4 to cells, increasing protein production of the downstream cistron several-fold. This can be extremely useful for targeting specific cell lines or treating medical conditions, cellular defects, or diseases, as it allows large amounts of the protein of interest to be delivered to patients in need thereof. As previously mentioned, the increase in protein production requires prior infection with the HSV1 virus, and the increase in protein production is several-fold compared to its production in the absence of SEQ ID NO: 1.

[0143]

[0198] The nucleic acids detailed herein above can be utilized as 5'UTR sequences or leader sequences or cis-acting regulatory elements, which may have a lower folding free energy compared to other 5'UTR sequences in the HSV1 genome.

[0144]

[0199] For all above embodiments detailing SEQ ID NO: 1 or 4, alternative embodiments including the UL27 sequence, i.e., either SEQ ID NO: 7 or 10, and alternative embodiments including the UL19 sequence, i.e., either SEQ ID NO: 13 or 16, are also contemplated in the present invention.

[0145]

[0200] Vectors and other constructs

[0201] In one embodiment of the present invention, a vector is provided comprising SEQ ID NO:1, or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:1, or a sequence at least 90% identical to SEQ ID NO:1, or a fragment comprising at least 180 nucleotides, as well as a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonuclease or cloning sites, and one or more polyadenylation sites, or any combination thereof. An alternative embodiment is also contemplated, comprising the RNA counterparts of SEQ ID NOs:1, 2, and 3 (i.e., SEQ ID NOs:4, 5, and 6).

[0146]

[0202] As mentioned above, both viral and non-viral constructs can be used to insert the US11 5' leader sequence. In some embodiments, commercially available vectors can be modified to include the US11 5' leader, thereby enhancing the efficacy of existing gene therapies. Some examples include T-vec (Amgen), HSV-1716 (Virttu Therapeutics - acquired by Sorrento), Immvira, Virogin, Replimune, Treovir, J&J, BeneVir, and Oncorus.

[0147]

[0203] In one embodiment, the vector is a viral vector recombinantly transformed with a heterologous nucleic acid comprising SEQ ID NO:1, or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:1, or a sequence at least 90% identical to SEQ ID NO:1, or a fragment comprising at least 180 nucleotides, and a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonuclease or cloning sites, and one or more polyadenylation sites, or any combination thereof. An alternative embodiment is also contemplated, including the RNA counterparts of SEQ ID NOs:1, 2, and 3 (i.e., SEQ ID NOs:4, 5, and 6).

[0148]

[0204] The viral vector comprises at least one of SEQ ID NO: 1, a fragment of SEQ ID NO: 1, or a sequence at least 90% identical to SEQ ID NO: 1, wherein the fragment comprises at least 180 nucleotides, a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonuclease or cloning sites, one or more polyadenylation sites, or any combination thereof heterologous to the viral vector. The viral vector may be a live vector, an attenuated vector, an oncolytic vector, or any combination thereof. In one embodiment, the viral vector may be an HSV1 viral vector, and more particularly, the HSV1 viral vector is HSV1. An alternative embodiment is also contemplated, comprising RNA counterparts of SEQ ID NOs: 1, 2, and 3 (i.e., SEQ ID NOs: 4, 5, and 6).

[0149]

[0205] In one embodiment of the present invention, a vector is provided comprising any of the nucleic acids previously detailed herein. In some embodiments, the vector comprises an endonuclease site for a promoter or regulatory element, a nucleic acid comprising SEQ ID NO: 1 or 4, and an endonuclease site for a gene encoding a protein of interest. The nucleic acids detailed herein comprise SEQ ID NO: 1 or a sequence at least 90% identical thereto over the entire length of SEQ ID NO: 1, wherein the nucleotide sequence does not include SEQ ID NO: 2, SEQ ID NO: 3, or both, and wherein the nucleotide sequence does not include a fragment of SEQ ID NO: 2, SEQ ID NO: 3, or both that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous 5' or 3' to SEQ ID NO: 4. In an alternative embodiment, the nucleic acid detailed herein comprises SEQ ID NO:4, or a sequence at least 90% identical thereto over the entire length of SEQ ID NO:4, wherein the nucleotide sequence does not comprise SEQ ID NO:5, SEQ ID NO:6, or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:5, SEQ ID NO:6, or both, that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO:4. The nucleic acid further comprises a gene encoding a protein of interest, and optionally a promoter, regulatory element, or translational enhancer. Transcription of SEQ ID NO:1 or 4 increases translation of the gene encoding the protein of interest, thereby inducing increased protein expression, synthesis, or production in the cell compared to its translation in the absence of SEQ ID NO:1 or 4.

[0150]

[0206] In embodiments of the present invention, the vector may comprise any of the other nucleic acid embodiments detailed above. In addition, the nucleic acid may also comprise any regulatory elements, translation enhancers, or promoters, non-limiting examples of which are provided above.

[0151]

[0207] The vectors detailed hereinbefore can be selected from the following non-limiting examples: viral vectors, live viral vectors, oncolytic viral vectors, attenuated viral vectors, recombinant vectors, or amplicon vectors. In some embodiments, the vector is constructed using HSV1 virus, and the nucleic acid is inserted anywhere in the HSV1 genome, or into any restriction site or tk locus or any other endonuclease site in the HSV1 genome.

[0152]

[0208] In some alternative embodiments, the nucleic acid can be inserted into a gene delivery vehicle, some non-limiting examples of which are a plasmid, an expression cassette, a live virus, a DNA or RNA construct or a recombinant nucleotide construct, an intronless open reading frame, a nanoparticle, or a lipid nanoparticle. In some embodiments, the gene delivery vehicle detailed above may be HSV1-based.

[0153]

[0209] For all of the vector-based embodiments detailed above detailing SEQ ID NO: 1 or 4, alternative embodiments comprising the UL27 sequence, i.e., either SEQ ID NO: 7 or 10, and alternative embodiments comprising the UL19 sequence, i.e., either SEQ ID NO: 13 or 16, are also contemplated in the present invention.

[0154]

[0210] cell line

[0211] In one embodiment of the present invention, a cell is provided that comprises a nucleic acid (comprising SEQ ID NO: 1 or 4) or a vector (comprising SEQ ID NO: 1 or 4). The cell can comprise a nucleic acid or vector comprising SEQ ID NO: 1 or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 1, alone or in combination, wherein the nucleic acid does not comprise SEQ ID NO: 2, SEQ ID NO: 3, or both. In an alternative embodiment, a composition is provided that comprises a sequence at least 90% identical to SEQ ID NO: 1, or a fragment comprising at least 180 nucleotides, wherein the nucleic acid does not comprise SEQ ID NO: 2, SEQ ID NO: 3, or both. As noted above, the nucleic acid does not comprise a fragment of SEQ ID NO: 2, 3, or both that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO: 1. An alternative embodiment is also contemplated that comprises the RNA counterparts of SEQ ID NOs: 1, 2, and 3 (i.e., SEQ ID NOs: 4, 5, and 6).

[0155]

[0212] The cells can be mammalian cells, or particularly cancer cells. In the presence of the 5' leader sequence, the cells exhibit about a 0.5-fold, about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold or more increase in protein expression, synthesis, or production compared to identical control cells lacking SEQ ID NO:1. This is consistent with the experimental results shown above. An alternative embodiment is also contemplated, including RNA counterparts of SEQ ID NOs:1, 2, and 3 (i.e., SEQ ID NOs:4, 5, and 6).

[0156]

[0213] In the embodiment detailed above, the sequence of SEQ ID NO: 1 can be inserted anywhere in the HSV1 genome, or into any restriction site or tk locus of HSV1. In an alternative embodiment, the sequence of SEQ ID NO: 1 can be inserted into any other site of HSV1. Thus, a nucleic acid, vector, or cell comprising the sequence of SEQ ID NO: 1 can have the sequence specifically inserted into the tk locus of HSV1, or optionally any other restriction endonuclease site. However, the desired effect of enhanced protein expression is only observed in cells pre-infected with the HSV1 virus.

[0157]

[0214] In an alternative embodiment, the cell may comprise any of the nucleic acid embodiments detailed hereinabove and a pharmaceutically acceptable carrier or excipient. For example, the cell may comprise a nucleic acid comprising SEQ ID NO: 1 or 4 and a pharmaceutically acceptable carrier or excipient. The nucleic acid may comprise SEQ ID NO: 1, or a sequence at least 90% identical thereto over the entire length of SEQ ID NO: 1, wherein the nucleotide sequence does not comprise SEQ ID NO: 2, SEQ ID NO: 3, or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO: 2, SEQ ID NO: 3, or both that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous 5' or 3' to SEQ ID NO: 1. In an alternative embodiment, the nucleic acid detailed herein may comprise SEQ ID NO:4, or a sequence at least 90% identical thereto over the entire length of SEQ ID NO:4, wherein the nucleotide sequence does not comprise SEQ ID NO:5, SEQ ID NO:6, or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:5, SEQ ID NO:6, or both, that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO:4. The nucleic acid further comprises a gene encoding a protein of interest, and optionally a promoter, regulatory element, or translational enhancer. Transcription of SEQ ID NO:1 or 4 increases translation of the gene encoding the protein of interest, thereby inducing increased protein expression, synthesis, or production in the cell compared to its translation in the absence of SEQ ID NO:1 or 4.

[0158]

[0215] For all above cell line embodiments detailing SEQ ID NO: 1 or 4, alternative embodiments including the UL27 sequence, i.e., either SEQ ID NO: 7 or 10, and alternative embodiments including the UL19 sequence, i.e., either SEQ ID NO: 13 or 16, are also contemplated in the present invention.

[0159]

[0216] composition

[0217] In one embodiment of the present invention, compositions are provided comprising nucleic acids, vectors, or cells, alone or in combination, comprising SEQ ID NO:1, or a fragment comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO:1, wherein the nucleic acid does not include SEQ ID NO:2, SEQ ID NO:3, or both. In an alternative embodiment, compositions are provided comprising a sequence at least 90% identical to SEQ ID NO:1, or a fragment comprising at least 180 nucleotides, wherein the nucleic acid does not include SEQ ID NO:2, SEQ ID NO:3, or both. As noted above, the nucleic acids do not include fragments of SEQ ID NO:2, SEQ ID NO:3, or both, that are at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO:1. An alternative embodiment is also contemplated that includes the RNA counterparts of SEQ ID NOs:1, 2, and 3 (i.e., SEQ ID NOs:4, 5, and 6).

[0160]

[0218] In an alternative embodiment, a composition can include any of the nucleotide embodiments detailed hereinabove and a pharmaceutically acceptable carrier or excipient. For example, the composition can include a nucleic acid comprising SEQ ID NO: 1 or 4 and a pharmaceutically acceptable carrier or excipient. The nucleic acid can include SEQ ID NO: 1, or a sequence at least 90% identical thereto over the entire length of SEQ ID NO: 1, wherein the nucleotide sequence does not include SEQ ID NO: 2, SEQ ID NO: 3, or both, and wherein the nucleotide sequence does not include a fragment of SEQ ID NO: 2, SEQ ID NO: 3, or both that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous 5' or 3' to SEQ ID NO: 1. In an alternative embodiment, the nucleic acid detailed herein may comprise SEQ ID NO:4, or a sequence at least 90% identical thereto over the entire length of SEQ ID NO:4, wherein the nucleotide sequence does not comprise SEQ ID NO:5, SEQ ID NO:6, or both, and wherein the nucleotide sequence does not comprise a fragment of SEQ ID NO:5, SEQ ID NO:6, or both, that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO:4. The nucleic acid further comprises a gene encoding a protein of interest, and optionally a promoter, regulatory element, or translational enhancer. Transcription of SEQ ID NO:1 or 4 increases translation of the gene encoding the protein of interest, thereby inducing increased protein expression, synthesis, or production in the cell compared to its translation in the absence of SEQ ID NO:1 or 4.

[0161]

[0219] Additionally, compositions may be provided in the form of a plasmid, a vector, a recombinant DNA or RNA construct, a gene delivery vehicle, a nanoparticle, and one or more pharmaceutically acceptable excipients.

[0162]

[0220] The composition may be in the form of a capsule, an injectable, a topical cream, or a powder. In some embodiments, the composition may be in the form of an injectable.

[0163]

[0221] In other embodiments, the compositions may include other nucleic acid, vector, and cell-based embodiments detailed above, either alone or in combination, and optionally include one or more pharmaceutically acceptable carriers, excipients, or diluents.

[0164]

[0222] The pharmaceutically acceptable carrier, excipient, or diluent can be selected from the non-limiting examples provided above.

[0165]

[0223] For all of the above composition embodiments detailing SEQ ID NO: 1 or 4, alternative embodiments including the UL27 sequence, i.e., either SEQ ID NO: 7 or 10, and alternative embodiments including the UL19 sequence, i.e., either SEQ ID NO: 13 or 16, are also contemplated by the present invention.

[0166]

[0224] kit

[0225] In one embodiment of the present invention, there is provided a kit comprising any of the nucleic acid embodiments detailed above (including SEQ ID NO: 1 or 4), vector embodiments detailed above (i.e., vectors comprising SEQ ID NO: 1 or 4), or cell embodiments detailed above (i.e., cells comprising SEQ ID NO: 1 or 4), together with one or more pharmaceutically acceptable carriers, excipients, or diluents, or one or more buffers, wash or cell culture media, or one or more containers for containing any of the above detailed, or instructions for expressing or enhancing expression of a protein of interest, or instructions for using any component of the kit, or any combination of the components detailed above.

[0167]

[0226] In an alternative embodiment, the kit can include any of the nucleotide embodiments detailed hereinabove and a pharmaceutically acceptable carrier or excipient. For example, the composition can include a nucleic acid comprising SEQ ID NO: 1 or 4, together with one or more pharmaceutically acceptable carriers, excipients, or diluents, or one or more buffers, wash, or cell culture media, or one or more containers for containing any of the above detailed, or instructions for expressing or enhancing expression of a protein of interest, or instructions for using any component of the kit, or any combination of the above components. The nucleic acid further includes a gene encoding the protein of interest, and optionally a promoter, regulatory element, or translation enhancer. The nucleic acid may comprise SEQ ID NO: 1, or a sequence at least 90% identical thereto over the entire length of SEQ ID NO: 1, wherein the nucleotide sequence does not include SEQ ID NO: 2, SEQ ID NO: 3, or both, and does not include a fragment of SEQ ID NO: 2, 3, or both, that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' of SEQ ID NO: 1. In an alternative embodiment, the nucleic acid detailed herein may comprise SEQ ID NO: 4, or a sequence at least 90% identical thereto over the entire length of SEQ ID NO: 4, wherein the nucleotide sequence does not include SEQ ID NO: 5, SEQ ID NO: 6, or both, and does not include a fragment of SEQ ID NO: 5, 6, or both, that is at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' of SEQ ID NO: 4. The nucleic acid may further comprise a gene encoding a protein of interest, and optionally a promoter or regulatory element. Transcription of SEQ ID NO: 1 or 4 increases translation of the gene encoding the protein of interest, thereby inducing increased protein expression, synthesis, or production in the cell compared to its translation in the absence of SEQ ID NO: 1 or 4.

[0168]

[0227] Additionally, the kit may include nucleic acids provided in the form of a plasmid, vector, recombinant DNA or RNA construct, gene delivery vehicle, nanoparticle, along with one or more pharmaceutically acceptable carriers, excipients, or diluents, or one or more buffers, wash or cell culture media, or one or more containers for housing any of the above, or instructions for expressing or enhancing expression of a protein of interest, or instructions for using any component of the kit, or any combination of the above components.

[0169]

[0228] The kit can include a composition having SEQ ID NO: 1 or 4, which can be in capsule, injectable, topical cream or powder form, or any other form known in the art. In some embodiments, the composition can be in the form of an injectable.

[0170]

[0229] In other embodiments, the kits may include the nucleic acid, vector, and cell-based embodiments detailed above, either alone or in combination, and optionally include one or more pharmaceutically acceptable carriers, excipients, or diluents.

[0171]

[0230] The kits may further comprise container means, which may include at least one vial, test tube, flask, bottle, syringe, or other container means, into which the nucleic acids, vectors, cells, compositions and / or other materials may be placed, and in various embodiments the kits include instructions for use of the materials contained in the kit.

[0172]

[0231] For all of the above kit-based embodiments detailing SEQ ID NO: 1 or 4, alternative embodiments including the UL27 sequence, i.e., either of SEQ ID NO: 7 or 10, and alternative embodiments including the UL19 sequence, i.e., either of SEQ ID NO: 13 or 16, are also contemplated in the present invention.

[0173]

[0232] Methods for Producing or Increasing Expression of a Protein of Interest

[0233] In one embodiment of the present invention, a method for producing a protein of interest in a cell is provided, the method comprising administering a nucleic acid to the cell. The administered nucleic acid comprises a promoter, SEQ ID NO: 1, and a sequence encoding the protein of interest to be expressed from the nucleic acid in the cell. An alternative embodiment is also contemplated, in which the method uses the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4).

[0174]

[0234] In an alternative embodiment, a method is provided for increasing expression, synthesis, or production of a protein of interest in a cell, the method comprising administering a nucleic acid to the cell, the nucleic acid comprising a promoter, SEQ ID NO:1, and a sequence encoding the protein of interest that is expressed in the cell from the nucleic acid, wherein the increased expression, synthesis, or production of the protein of interest is compared to a similar step of administering the nucleic acid in the absence of SEQ ID NO:1. An alternative embodiment is also contemplated in which the method uses the RNA counterpart of SEQ ID NO:1 (i.e., SEQ ID NO:4). In some embodiments, the method may further comprise preparing a nucleic acid wherein the promoter is located upstream or 5' of SEQ ID NO:1 or 4 and the sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO:1 or 4. In some other embodiments, the method may further comprise infecting the cell or a patient in need thereof with HSV1 virus, wherein the infecting the cell is performed before administering the nucleic acid to the cell, which results in increased protein production in the cell, which may be useful in treating or ameliorating the targeted medical condition, cellular defect, or disease. Alternatively, as previously described, live viral vectors or oncolytic viral vectors can be used to enhance increased protein production without the need for pre-infection of cells or patients.

[0175]

[0235] In some embodiments, the method can further include inserting the nucleic acid into a gene delivery vehicle, where the inserting step is performed before infecting the cell with the HSV1 virus and before administering the nucleic acid to the cell, and the nucleic acid is administered to the cell by infecting the cell with a gene delivery vehicle containing the nucleic acid. The gene delivery vehicle can be selected from any of the non-limiting examples previously presented herein. As discussed above, administration of a nucleic acid containing SEQ ID NO: 1 or 4 results in a several-fold increase in protein production compared to its production in the absence of SEQ ID NO: 1 or 4.

[0176]

[0236] The method may include using any of the nucleic acids, vectors, gene delivery vehicles, compositions or kits previously detailed herein, or may be used to target any of the cell lines previously detailed herein.

[0177]

[0237] In the embodiments detailed above, the promoter can be located upstream or 5' of SEQ ID NO:1 (or SEQ ID NO:4), and the sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO:1 (or SEQ ID NO:4). The nucleic acid can be inserted into HSV1, and as described above, the desired effect of enhanced protein expression is observed when cells are infected with the HSV1 virus. In some embodiments, the method can be carried out using nucleic acid in the form of a plasmid or vector. The vector can be selected from, but is not limited to, a viral vector, a live viral vector, an oncolytic viral vector, an attenuated viral vector, a recombinant vector, or an amplicon vector.

[0178]

[0238] For all of the above production method embodiments detailing SEQ ID NO: 1 or 4, alternative embodiments including the UL27 sequence, i.e., either SEQ ID NO: 7 or 10, and alternative embodiments including the UL19 sequence, i.e., either SEQ ID NO: 13 or 16, are also contemplated in the present invention.

[0179]

[0239] Methods of Treating Medical Conditions, Cellular Defects or Diseases

[0240] In one embodiment of the present invention, a method for ameliorating or treating a medical condition, cellular defect, or disease in a subject is provided. The method includes administering a nucleic acid to cells of a subject exhibiting the medical condition, cellular defect, or disease, the nucleic acid comprising a promoter, SEQ ID NO: 1, and a sequence encoding a protein of interest that is expressed from the nucleic acid in the cells. The selected protein of interest can ameliorate or treat the medical condition, cellular defect, or disease in the subject, and thus, expression, synthesis, or production of the protein of interest in the subject's cells ameliorate or treat the medical condition, cellular defect, or disease in the subject. Another method is also contemplated, in which the nucleic acid comprises SEQ ID NO: 4.

[0180]

[0241] In the nucleic acid, the promoter is located upstream or 5' of SEQ ID NO:1 (or SEQ ID NO:4), and the sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO:1 (or SEQ ID NO:4). The nucleic acid can be inserted into HSV1, and to achieve the desired result, the subject or the subject's cells are infected with HSV1 to allow delivery of the nucleic acid. As previously suggested, the nucleic acid can be inserted into HSV1, which is a live viral vector, an oncolytic viral vector, or an attenuated viral vector. An alternative embodiment is possible in which the method uses the RNA counterpart of SEQ ID NO:1 (i.e., SEQ ID NO:4).

[0181]

[0242] In one embodiment of the present invention, a method for treating a medical condition, cellular defect, or disease in a patient is provided, comprising administering a nucleic acid to cells of a patient in need thereof, the nucleic acid comprising a promoter, SEQ ID NO: 1 or 4, and a gene encoding a protein of interest expressed in the cells from the nucleic acid, the protein of interest being capable of treating / ameliorating the medical condition, and the expression, synthesis, or production of the protein of interest in the patient's cells ameliorates the medical condition, cellular defect, or disease in the patient. More specifically, transcription of SEQ ID NO: 1 or 4 increases translation of the gene encoding the protein of interest several-fold compared to its translation in the absence of SEQ ID NO: 1 or 4, and the increased amount of the protein of interest provides the necessary treatment. The method may further comprise infecting the cells or patient with HSV1 virus, where the infecting the cells or patient is performed before administering the nucleic acid to the cells. Additionally, the method may comprise inserting the nucleic acid into any of the vectors, gene delivery vehicles, constructs, compositions, or kits previously described herein, where the inserting of the nucleic acid is performed before infecting the cells or patient with HSV1 virus and before administering the nucleic acid to the cells or patient in need thereof. In the presence of HSV1 infection, the sequences of SEQ ID NO: 1 or 4 increase protein expression several fold (eg, 8 fold).

[0182]

[0243] In an alternative embodiment, a method of treating cancer in a subject is also provided. The method includes administering a nucleic acid to the patient's / subject's cells, the nucleic acid comprising a promoter, SEQ ID NO: 1, and a sequence encoding a protein of interest that is expressed in the cells from the nucleic acid. The protein of interest is carefully selected to be capable of ameliorating or treating cancer in the subject. Thus, enhancing the expression, synthesis, or production of the protein of interest in the patient's cells treats the cancer or carcinoma condition. In an alternative embodiment, the cancer can be melanoma. An alternative embodiment is also contemplated in which the method uses the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4).

[0183]

[0244] In an alternative embodiment, a method of treating melanoma in a subject is also provided. The method includes administering to the patient's / subject's cells a nucleic acid comprising a promoter, SEQ ID NO: 1, and a sequence encoding GM-CSF that is expressed from the nucleic acid within the cells. Thus, enhancing the expression, synthesis, or production of GM-CSF in the patient's cells treats the melanoma condition. An alternative embodiment is also contemplated in which the method uses the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4).

[0184]

[0245] The above methods can be used to treat a variety of medical conditions, cellular defects or diseases. The following is a non-limiting list of examples: carcinoma, melanoma, immune deficiency, celiac disease, liver or kidney disorders, or any protein deficiency disorder.

[0185]

[0246] For all of the above embodiments of the treatment methods detailing SEQ ID NO: 1 or 4, alternative embodiments including the UL27 sequence, i.e., either SEQ ID NO: 7 or 10, and alternative embodiments including the UL19 sequence, i.e., either SEQ ID NO: 13 or 16, are also contemplated in the present invention.

[0186]

[0247] How to improve existing gene therapies

[0248] In an alternative embodiment, a method for improving the efficacy of an existing gene therapy is provided, comprising modifying a gene delivery vehicle used in the existing gene therapy by inserting the sequence of SEQ ID NO: 1, wherein the gene delivery vehicle comprises a sequence encoding a protein of interest. The modified gene delivery vehicle can be administered to a patient in need of gene therapy. Transcription of SEQ ID NO: 1 increases translation of the sequence encoding the protein of interest, thereby causing increased expression, production, or synthesis of the protein of interest compared to its expression, production, or synthesis in the absence of SEQ ID NO: 1, which improves the efficacy of the existing gene therapy. Thus, the present method can be used to improve the efficiency of any existing viral or non-viral-based gene therapy. As shown in the experiments discussed above, the present method can increase the expression, production, or synthesis of the protein of interest several-fold (e.g., 8-fold) compared to its expression, production, or synthesis in the absence of SEQ ID NO: 1 or 4, thereby enhancing the efficiency of the existing gene therapy. An alternative method is also envisioned in which the nucleic acid comprises the RNA counterpart of SEQ ID NO: 1 (i.e., SEQ ID NO: 4). In some embodiments, the increase in expression, production, or synthesis of the protein of interest is 0.5-fold, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, or more compared to its expression, production, or synthesis in the absence of SEQ ID NO:1 (or SEQ ID NO:4). The following is a non-limiting list of gene therapies whose efficiency can be increased using the present methods: Zolgensma, Yescarta, Luxturna, Kymriah, Zynteglo, MB-107, Strimvelis, Tecartus, or any of the existing gene therapies undergoing advanced phase trials. Some examples of commercially available vectors that can be modified include those from T-vec (Amgen), HSV-1716 (Virttu Therapeutics - acquired by Sorrento), Immvira, Virogin, Replimune, Treovir, J&J, BeneVir, and Oncorus. To enhance increased protein expression in non-HSV1-based gene therapy, co-infection with HSV1 virus or a live HSV1 virus vector may be required.In one embodiment of the present invention, the existing gene therapy can be an oncolytic virus therapy or a gene-based immunotherapy or any other existing gene therapy.

[0187]

[0249] For all of the above method embodiments detailing SEQ ID NO: 1 or 4, alternative embodiments including any of the UL27 sequences (i.e., SEQ ID NO: 7 or 10), and alternative embodiments including any of the UL19 sequences (i.e., SEQ ID NO: 13 or 16) are also contemplated herein.

[0188]

[0250] Methods for increasing transgene expression

[0251] Provided is a method for increasing transgene expression in a cell, comprising administering to the cell a nucleic acid, the nucleic acid comprising a promoter, SEQ ID NO: 1, and a transgene expressed in the cell from the nucleic acid. The transgene encodes a protein of interest, and the increase in expression of the transgene is compared to a similar step of administering the nucleic acid in the absence of SEQ ID NO: 1. The method can also be performed using the RNA counterpart of SEQ ID NO: 1, i.e., SEQ ID NO: 4.

[0189]

[0252] For the above embodiments detailing SEQ ID NO: 1 or 4, alternative embodiments including the UL27 sequence, i.e., either SEQ ID NO: 7 or 10, and alternative embodiments including the UL19 sequence, i.e., either SEQ ID NO: 13 or 16, are also contemplated in the present invention.

[0190]

[0253] Methods for identifying transcription start sites

[0254] In one embodiment of the present invention, a method for identifying transcription start sites (TSSs) (or 5'UTR sequences or leader sequences) in a viral genome that can increase protein expression, synthesis, or production is provided, comprising the steps of: sequencing copies of the viral genome to obtain sequencing data; aligning short reads and mapping the sequencing data to existing / annotated sequencing data of the viral genome to identify splice junctions of mRNA transcripts of the viral genome; identifying multiple TSSs by locating each stacked short read of the mRNA transcript; using the identified TSSs to perform a reporter assay using a reporter protein; and identifying TSSs that increase reporter protein expression, synthesis, or production compared to a control assay in the absence of the TSS. Multiple copies of the identified TSSs for performing the reporter assay can be obtained by amplification from a cDNA library, and copies of the viral genome can be obtained from virus-infected cells. The mapping step can be performed using RNA sequencing or any of the available or currently used advanced sequencing techniques. The reporter protein can be selected from any of the following non-limiting examples: GFP, RFP, lacZ, LUC, CAT, or any other reporter protein known in the art. The reporter assay can be performed using a reporter construct comprising the reporter protein and one of the identified TSSs, and the reporter construct can be in the form of a plasmid, vector, any gene delivery vehicle, or nanoparticle. In some embodiments, the TSS can be identified by locating the 5' and 3' ends of existing / annotated sequencing data of the viral genome. For clarity, the reporter assay can be performed in multiple cell lines or using a specific cell line selected from the non-limiting examples presented earlier herein.

[0191]

[0255] In some embodiments described above, the present disclosure provides theories and speculations regarding the mechanisms of biological processes. The present invention is not intended to be bound by any theory or speculation regarding the mechanisms involved in biological processes, and it should not be used to limit the present invention in any way.

[0192]

[0256] For all of the above embodiments detailing US11, alternative embodiments having a UL27 or UL19 5' leader are also envisioned. [Example]

[0193] [Discussion, Experimental Results, and Examples]

[0257] Determination of HSV1 mRNA sequence or 5' leader sequence

[0258] HSV1 is an enveloped dsDNA virus with a 153-kb genome composed of covalently linked long (L) and short (S) segments that together encode approximately 80 genes. Several single-gene studies have identified and characterized the 5' leader and 3' untranslated region (3'UTR) for a limited number of HSV1 genes (Table 1). However, most transcripts lack such annotations in public NCBI databases (e.g., NCBI accession numbers JQ780693 for the KOS strain and JN555585 for 17 strains). Therefore, we generated RNA-Seq data from 4T1 mouse mammary carcinoma cells infected with HSV1. By mapping HSV1 reads from this dataset to the KOS strain reference (JQ780693.1), we distinguished RNA transcripts derived from the plus and minus gDNA strands (as shown in Figures 2-1A and 2-2E). Figure 2-1A shows the full RNA-seq coverage of the HSV1 genome from 4T1-infected cells. It is important to note that strand-specific RNA reads were mapped to the HSV1 genome and separated by strand orientation to avoid ambiguity in the mapping of overlapping genes. By mapping HSV1 reads from this dataset to the KOS strain reference genome (JQ780693.1), RNA transcripts derived from the plus and minus gDNA strands could be distinguished (Figure 2-1B). Furthermore, splice junctions for four known spliced transcripts of HSV1 (i.e., UL15, US1, US12, and RL2) were also identified, with intron retention, a process previously reported for RL2 (Figure 7). As shown in Figure 7, individual transcripts (RL2, UL15, US1, and US12) are identified by RNA-seq coverage on the plus (blue) and minus (red) strands.

[0194]

[0259] It could be argued that identifying transcription start sites (TSSs) from long-read sequencing methods (e.g., PacBio) or whole-transcript sequencing (e.g., Oxford Nanopore MinION platform) is more straightforward than RNA-Seq, which relies on the alignment of short reads, especially when overlapping ORFs are present. However, we observed that standard RNA-Seq read mapping can sufficiently identify TSSs of non-overlapping HSV1 genes. This is possible due to the high depth and coverage achieved in infected cells, despite a low multiplicity of infection (MOI) of 0.1. TSS locations were identified by monitoring the "wall" of stacked short reads, which were interpreted as the start of the transcript (as shown in Figure 2-1B and Figure 2-1C). Figure 2-1B shows RNA-Seq coverage of the US1 gene from the HSV1 genome. Intron-spanning reads were also detected and illustrated using a Sashimi plot. Figure 2-1C shows RNA-seq coverage in the 5' region of the US1 gene, and the plot below shows the region of predicted TSSs at nucleotide resolution. A similar approach was recently used by Whisnant et al. to enumerate HSV1 TSSs, although their method used a more specialized RNA-seq method.

[0195]

[0260] Through this experiment, we detected reads flanking the 5' and 3' ends of most annotated ORFs, confirming that all annotated HSV1 transcripts possess both 5' leaders and 3' UTRs, as shown in Figures 2-1C and 2-1D. RNA-seq coverage in the 3' region of the US1 gene can be clearly seen in Figure 2-1D. While the 3' UTRs of most viral genes overlap with downstream ORFs, a spike in read density at a single nucleotide position upstream of the start codon that coincides with the TSS is clearly distinguishable from the low read density throughout the 3' UTR (Figures 2-1B, 2-1C, inset, and Table 1). A schematic diagram of the workflow for identifying HSV1 5' leaders from RNA-seq reads, screening for specifically 5' leader-enhancing translation in HSV1-infected cells, and incorporating the 5' leaders into transgene expression in oncolytic HSV1 genomes for in vivo testing in tumor models can be seen in Figure 2-2E. Using these TSS coordinates, we identified 61 5' leader sequences of HSV1 genes (Table 2). Importantly, when comparing the identified TSSs with several annotated TSSs in NCBI more recently identified by long-read sequencing performed by Tombacz et al. or by RNA-Seq on enriched 5'-end reads by Whisnant et al., we found that the TSS coordinates were accurate or differed by only a few nucleotides (Table 1). The read density coverage at each identified TSS is more clearly shown in Figures 8A-8D. The full RNA-Seq coverage of the HSV1 genome is shown in Figures 8A-8D, and RNA-Seq data from HSV1-infected 4T1 genomes was previously published in Hoang et al., 2019. To avoid ambiguity in the mapping of overlapping genes, strand-specific RNA reads were mapped to HSV1 (JQ780693.1) and separated by orientation. The graphs shown in Figures 8A-8D show insets for all identified TSSs of all HSV1 genes.

[0196]

[0261] Using these TSS coordinates, we were able to identify 61 5' leader sequences of HSV1 genes (see Table 2). Importantly, when we compared the identified TSSs with several annotated in NCBI that were more recently identified by long-read sequencing performed by Tombacz et al. or by RNA-Seq on enriched 5' end reads by Whisnant et al., we found that the TSS coordinates were accurate or differed by only a few nucleotides (Table 1). These studies confirm that this approach is robust for detecting and reliably annotating the 5' leader of each HSV1 transcript.

[0262] Table 1: Comparison of HSV1 TSSs identified in this study (Hoang et al.) with those of Tombacz et al., 2017 and Whisnant et al., 2020 [Table 1] JPEG2025525503000003.jpg205149 JPEG2025525503000004.jpg205149

[0197]

[0263] Table 2: HSV1 leader sequences identified in this study (Hoang et al.) [Table 2] JPEG2025525503000006.jpg205149 JPEG2025525503000007.jpg196149 JPEG2025525503000008.jpg196149 JPEG2025525503000009.jpg201149 JPEG2025525503000010.jpg201149

[0198]

[0264] The US11 leader enhances translation of downstream ORFs in HSV1-infected cells

[0265] After identifying the 5' leader sequences of most HSV1 genes in silico, it was important to determine their ability to modify the translational output of downstream cistrons. We speculated that the leaders of HSV1 late genes, which are expressed during established infection, should be most compatible with the altered translational control induced by HSV1 infection and therefore more likely to possess motifs that favorably modify translation in HSV1-infected cells. To confirm this hypothesis, we selected 10 late genes and tested the post-translational modification effects of their 5' leaders in HSV1-infected cells (as shown in Figure 9). The relative mRNA expression levels of the 10 candidate late genes are shown in the heatmap on the left, and the relative mRNA expression levels of the four immediate-early genes are shown in the heatmap on the right. mRNA expression was obtained from a study previously reported by Rutkowski et al. (2015). To normalize the levels as percentages, expression levels were normalized as a percentage of the highest expression level across all time points.

[0199]

[0266] HSV1 5' leaders of selected late genes were amplified from a cDNA library generated from HSV1-infected 4T1 cells and inserted upstream of a chloramphenicol acetyltransferase (CAT) reporter construct (Figure 3A and Figure 10A). Figures 3A-3H show the HSV1 US11 5' leader sequence enhancing protein reporter expression in mammalian cells infected with HSV1. Specifically, Figure 3A presents a schematic diagram of mRNA expressed from the CAT reporter construct with or without the HSV1 5' UTR sequence. Furthermore, Figure 10 presents a translation reporter screen for 5' UTRs that enhance translation upon HSV1 infection, and Figure 10(A) presents an agarose gel visualization of other HSV1 5' leaders (including the remainder of the 5' leader shown in Figures 3A-3H) amplified from total RNA of HSV1-infected cells.

[0200]

[0267] Negative controls (i.e., RNA isolated from uninfected cells) confirmed the specificity of the PCR products for HSV1 transcripts alone. Translation reporter assays were also performed under uninfected and HSV1-infected conditions by cotransfecting 4T1 cells with monocistronic plasmids expressing CAT and β-galactosidase after infection; the latter construct was included to normalize for differences in transfection efficiency. In uninfected cells, the viral 5' leader had both positive and negative effects on reporter expression, but no significant trends were observed (as shown in Figure 3B). Figure 3B shows the results of a translation reporter assay to screen for HSV1 5' leader sequences that enhance translation upon HSV1 infection. Specifically, 4T1 cells were infected with HSV-1716-GFP at an MOI of 5 and subsequently transfected with a CAT plasmid and a β-GAL expression plasmid, which served as a transfection control. 24 h after infection, cells were lysed, and CAT expression was quantified by ELISA, and β-GAL activity was quantified by a colorimetric assay using ONPG substrate. Two-way ANOVA with Tukey's post-hoc test was also performed. Only significant tests are shown in the figure, where n is at least three biological replicates, and error bars indicate standard deviation (sd). *p<0.05, **p<0.01.

[0201]

[0268] The US11 5' leader most strongly enhanced translation of the CAT mRNA reporter. In contrast, the UL1 and US8 5' leaders were found to have no inhibitory effect upon HSV1 infection (Figure 10B). Figure 10B shows a translation reporter assay to screen for HSV-1 leader sequences that enhance translation upon HSV-1 infection. 4T1 cells were transfected with a CAT plasmid and a β-GAL expression plasmid, which served as a transfection control. Eight hours after transfection, the cells were infected with HSV-1716-GFP at an MOI of 5. Eighteen hours after infection, the cells were lysed, and CAT expression was quantified by ELISA, and β-GAL activity was quantified by a colorimetric assay using an ONPG substrate.

[0202]

[0269] However, after HSV1 infection, we found that the US11 and UL27 5' leaders significantly enhanced CAT protein expression compared with a leaderless reporter (Fig. 3B). Importantly, these observations were not due to 5' leader-mediated upregulation of CAT mRNA transcription (Fig. 3C).

[0203]

[0270] After HSV1 infection, we observed that 5' UTR genes, specifically the US11 and UL27 5' leaders, significantly enhanced CAT expression compared to leaderless reporter constructs (Figure 3B). Furthermore, the UL19 5' leader enhanced CAT protein expression under HSV1 infection but inhibited it under non-infection conditions. It is important to note that these observations are not due to 5' leader-mediated upregulation of CAT mRNA transcription (as shown in Figure 3C). Figure 3C shows relative CAT mRNA expression by a CAT translation reporter assay, in which 4T1 cells were treated as in 2(C) and subsequently lysed using Trizol. RT-qPCR was then used to quantify CAT mRNA expression and normalize it to the expression of Rps20. Additionally, a two-way ANOVA with Sidak's post-hoc test was also performed. Only significant tests are shown in the figure, where n is 3 biological replicates, and error bars indicate standard deviation (sd). *p<0.05, **p<0.01, ****p<0.0001.

[0204]

[0271] We also predicted the folding free energies and potential secondary structures of the US11 and UL27 leaders (Figure 10C), as well as the folding free energies of other screened HSV1 leaders (Figure 10D). Figure 10B shows the predicted secondary structures and folding free energies of the US11 (left panel) and UL27 (right panel) leaders using Vienna RNAfold, with the color scale bar representing base-pairing probability. Figure 10C shows a heatmap representing the folding free energies of candidate HSV1 leaders calculated using Vienna RNAfold.

[0205]

[0272] The 5' leaders of US11 and UL27 were observed to have lower predicted folding free energies compared to other HSV1 leaders, despite having the strongest translational enhancement for CAT expression. Collectively, these results suggest that the 5' leader sequences from US11 or UL27 mRNAs can mediate HSV1 infection-dependent increases in protein expression when inserted upstream of a transgene in cells.

[0206]

[0273] Lytic infection by HSV1 has been reported to induce significant reprogramming of cellular transcription, splicing, and nuclear export. Therefore, plasmid-based overexpression reporter assays may be impaired by HSV1 infection and may not faithfully reflect the gene expression process (including mRNA translation) of HSV1-encoded transgenes. Therefore, we investigated the effect of the US11 5' leader on directly regulating transgene expression from an expression cassette designed to be inserted into the tk locus of the HSV1 genome. While not limiting the scope of this application, it should be noted that transcription from the pTK plasmid expression cassette is driven by a CMV promoter and contains an SV40 polyadenylation signal (as shown in Figure 3D). However, any other upstream promoter, enhancer, or regulatory element could also be used with the 5' leader sequence. Figure 3D presents a schematic diagram of the pTK-Green plasmid carrying the HSV1 5' leader-reporter construct for insertion into the HSV1 TK gene and the resulting transcripts. As can be seen in the figure, a ribosome skipping sequence, P2A, was inserted between the luciferase and GFP CDSs, allowing the synthesis of two proteins from a single cistron. This bicistronic transgene cassette was created to allow coexpression of a therapeutic protein with a reporter protein to facilitate selection and monitoring of recombinant viruses, all under the control of a putative enhancer element inserted at the 5' end of the expression cassette (as seen in Figure 3D). The ORF consisted of luciferase (LUC; however, any protein of interest can be used, and a desired therapeutic ORF can be engineered in place of LUC). In addition, green fluorescent protein (GFP) separated by the self-cleaving peptide, porcine teschovirus-1 2A (P2A), was inserted into the ORF. The inclusion of P2A is known to cause the intercistronic translating ribosome to skip peptide bond formation between glycine and proline residues, resulting in the production of separate LUC and GFP proteins from a single luc-gfp mRNA transcript.In parallel, GFP fluorescence was quantified in 4T1 cells transfected with leaderless plasmids or plasmids carrying the US11 leader and subsequently infected with or without HSV1, and GFP expression was monitored by fluorescence microscopy. As shown in Figure 3E, weak fluorescence was observed in leaderless and uninfected cells.

[0207]

[0274] Figure 3E shows quantification of GFP fluorescence in cells transfected with the LUC-GFP reporter plasmid and subsequently infected with HSV1 (KOS strain, referenced above) at an MOI of 2.5 4 hours posttransfection and imaged 24 hours postinfection. As expected, the construct with the US11 leader showed significant GFP expression, but this spike in expression was observed only in HSV1-infected cells. Further Western blot analysis of transfected cell lysates confirmed that inclusion of the US11 5' leader conferred increased GFP protein levels in HSV1-infected cells (as shown in Figures 3F and 3G). Figure 3F shows Western blots of lysates from 293T cells treated with antibodies against GFP, anti-HSV1, or anti-β-actin, as described in Figure 2-1(B). Figure 3G shows quantification of GFP expression from the Western blot shown in Figure 2(F).

[0208]

[0275] Consistent with previously obtained results, incorporation of the US11 5' leader did not affect the level of GFP transcript in uninfected cells compared to HSV1-infected cells (as shown in Figure 3H). Figure 3H shows RT-qPCR quantification of LUC-GFP mRNA from the experiment detailed above. Two-way ANOVA with Sidak's post-hoc test was performed in the figure, where n is three biological replicates, and error bars represent the standard deviation (sd). *p<0.05, **p<0.01, ****p<0.0001; ns, not significant.

[0209]

[0276] The US11 5' leader enhances transgene protein expression from engineered HSV1 virions

[0277] To verify the potential of the US11 5' leader as a transgene enhancer, recombinant HSV1 strains were constructed based on the bicistronic pTK transgene expression plasmid described above. Linearized pTK plasmids were used to generate recombinant viruses after cotransfection with purified HSV1 genomic DNA. Homologous recombination of the expression cassette into the tk locus generated Δtk virus progeny that constitutively expressed the transgene under the CMV promoter (as shown in Figure 4A). As previously mentioned, different promoters, translational enhancers, and regulatory elements can also be used in conjunction with or instead of the CMV promoter.

[0210]

[0278] Figures 4A-4F show that recombinant HSV1 viruses exhibit US11 5' leader-dependent enhancement of GM-CSF expression. Specifically, Figure 5A shows a schematic diagram of the expression cassette insertion scheme from the pTK-CSF2-GFP plasmid into the HSV1 genome (note that the TK gene is on the minus strand) and the resulting transcripts expressed from the inserted cassette. Consistent with the enhanced GFP expression conferred by the US11 5' leader in the plasmid-based system, Vero cell plaques of HSV1 US11-Csf2 showed increased GFP fluorescence compared to leaderless HSV1 Csf2 plaques (as shown in Figure 4C). Figure 4C shows the results of fluorescence imaging of individual plaques of wild-type HSV1, the HSV1 Csf2 construct, and the HSV1 US11-Csf2 construct.

[0211]

[0279] To more fully demonstrate clinical potential, the LUC ORF in the LUC-GFP expression cassette was replaced with the GM-CSF (Csf2) ORF, a gene expressed virally in the FDA-approved oncolytic HSV1. Leaderless (HSV1 Csf2) viruses were constructed along with two viral clones incorporating the US11 5' leader (HSV1 US11-Csf2). Figure 4B shows the results of viral genotyping to confirm expression cassette insertion. PCR was performed using HSV1 gDNA extracted from purified virus to confirm the insertion of the leaderless CSF2-GFP cassette (approximately 400 bp) and the US11 5' leader-CSF2-GFP cassette (approximately 600 bp) into the TK region of the HSV1 genome.

[0212]

[0280] Cells infected with either of the HSV1 US11-Csf2 viral clones produced several-fold more GM-CSF than cells infected with HSV1 Csf2 (Fig. 4D, Fig. S15). Fig. 4D shows quantification of GM-CSF production in the culture supernatant of Vero cells infected with HSV1 expressing leaderless CSF2-GFP or US11 5' leader-CSF2-GFP. Vero cell monolayers were infected with the indicated viruses at an MOI of 5, and culture supernatants were collected 24 h postinfection. GM-CSF concentrations were quantified by ELISA. One-way ANOVA with Dunnett's post-hoc test was performed. n = 3 biological replicates. Error bars: ± s.d. ****p < 0.0001.

[0213]

[0281] Figure 15 characterizes the enhanced expression by the US11 5' leader in oncolytic HSV1. Specifically, Figure 15A shows that Vero cell monolayers were infected with the indicated viruses at an MOI of 5, and culture supernatants were collected 24 hours postinfection. GM-CSF concentrations were quantified by ELISA. One-way ANOVA with Dunnett's post-hoc test was performed. n = 3 biological replicates. Error bars: +s.d. ****p<0.0001. Figure 15B shows representative GFP fluorescence of HSV1 expressing leaderless CSF2-GFP or US11 5' leader-CSF2-GFP. CT26 monolayers were infected with the indicated viruses at an MOI of 5, and subsequent fluorescence microscopy images were taken 24 hours postinfection. Figure 15C shows the time course of GFP fluorescence of HSV1 expressing leaderless CSF2-GFP or US11 5' leader-CSF2-GFP. CT26 monolayers were infected with the indicated viruses at an MOI of 0.2, 1, or 5, and GFP fluorescence was monitored for 2 days post-infection using an Incucyte live-cell imaging system. Figure 15D shows a dose-dependent analysis of secreted GM-CSF. CT26 cells were infected with the indicated viruses at an MOI of 0.2, 1, or 5, and culture supernatants were collected 24 hours post-infection. GM-CSF concentrations were quantified using ELISA. A two-way ANOVA with Sidak post-hoc test was performed. n = 3 biological replicates. Error bars: +sd. ****p<0.0001.

[0214]

[0282] In some cases, the increase in production was approximately 8-fold. Although the high increase in protein expression was very promising, it was important to assess whether the enhanced GM-CSF production was the result of higher viral replication. To confirm this, replication kinetics was measured by one-step growth curves, and it was observed that all viral clones exhibited comparable replication kinetics (Figure 4E). Figure 4E shows the results of one-step growth curves of HSV1 Csf2 and HSV1 US11-Csf2. Vero cell monolayers were infected at an MOI of 5, followed by collection and titration of intracellular and extracellular viruses at the indicated time points.

[0215]

[0283] RT-qPCR of mRNA extracted from infected cells at various time points revealed that the presence of the 5' leader did not affect the expression kinetics of the HSV1 transcript US6 (shown in Figure 4F, left panel) or the cis-expressed transgene transcripts (Csf2 and GFP, Figure 4F, center and right panels) throughout the course of infection. Figure 4F shows the transcription levels of the HSV1 endogenous gene (US6) and transgene. More specifically, Vero cell monolayers were infected at an MOI of 5, followed by cell lysis using Trizol at the indicated time points. Finally, mRNA abundance was quantified by RT-qPCR and normalized to Rps20. ANOVA, analysis of variance. MOI, multiplicity of infection.

[0216]

[0284] To understand whether transgene-enhanced protein production is a cell type- or species-dependent effect, we infected the human prostate cancer line DU145 and the human renal cell carcinoma line 786-O with wild-type, leader, and leaderless viruses. Monitoring GFP fluorescence intensity in these cells over the course of infection revealed strong US11 5' leader-mediated enhancement of transgene protein expression in all cell lines tested (Figure 11). US11 leader-mediated enhancement was observed to be robust across a variety of cell types and species. Figure 11 shows the results of experiments with monolayers of the African green monkey kidney cell line Vero, the mouse breast cancer cell line 4T1, the human pancreatic cancer cell line DU145, and the human renal carcinoma cell line 786-O. The cell lines were infected with either the HSV1 KOS leaderless or the HSV1 US11 5' leader at an MOI of 0.1. GFP fluorescence intensity was monitored for 48 hours using an Incucyte live-cell imaging system. These results demonstrate the ability of the US11 5' leader to enhance production of clinically important therapeutic transgenes in mammalian cells infected with HSV 1. Those skilled in the art will appreciate that the above examples are in no way limiting and that similar results will be observed when using other cell lines or strains.

[0217]

[0285] We therefore conclude that the 5' leader of the HSV1 late gene US11 can increase translation of downstream cistrons in heterologous reporter constructs, and notably, this effect was only observed with co-HSV1 infection. As previously described, HSV1 viruses engineered to express a cassette containing the US11 5' leader upstream of the GM-CSF ORF conferred superior GM-CSF expression compared to their leaderless counterparts in several mammalian cell lines, most importantly in mouse models of cancer, resulting in improved antitumor efficacy and prolonged survival. This confirms that incorporating a viral 5' leader into an expression transgene cassette can enhance therapeutic payload expression from the oncolytic HSV1 platform.

[0218]

[0286] The HSV1 US11 5' leader increases the translation efficiency of associated transcripts in an HSV1-dependent manner

[0287] Without wishing to be bound by theory, we sought to identify the mechanism underlying increased protein expression in cells infected with HSV1 US11-Csf2. To assess the effect of the US11 5' leader on transgene mRNA translation, we used polysome profiling techniques. Briefly, ribosome-bound mRNA was separated by ultracentrifugation on a sucrose gradient, which sediments mRNA based on the number of bound ribosomes. Therefore, mRNAs that migrated toward a heavier sucrose gradient had more bound ribosomes and higher translation efficiency. Vero cells were infected with HSV1 Csf2 or HSV1 US11-Csf2 at an MOI of 5 (Figure 5A), and then lysates containing ribosome-bound mRNA were separated on a 10–50% sucrose gradient (Figure 5B). Figure 5A shows fluorescence and phase-contrast images of HSV1-infected Vero cells used for polysome fractionation experiments in 5B and 5C (scale bar 400 μm). Figure 5B shows polysome trajectories in Vero cells infected with HSV1 Csf2 or HSV1 US11-Csf2 at an MOI of 5, where cells were lysed 24 h postinfection for polysome fractionation.

[0219]

[0288] We observed that the presence of the US11 5' leader caused a shift in Csf2-gfp transcript distribution to heavier polysome fractions, demonstrating enhanced translation efficiency compared to leaderless Csf2-gfp transcripts (as seen in Figures 5C and 5D). Figure 5C shows the mRNA distribution in polysome fractions of Csf2 (shown in the upper panel) and the endogenous HSV1 transcripts US6 (shown in the middle panel) and US11 (shown in the lower panel) as quantified by RT-qPCR. Two-tailed t-tests were performed, where n is three biological replicates, and error bars indicate standard deviation. **: p<0.01, *: p<0.05. Figure 5D shows the mRNA distribution of Csf2 (shown in the top panel), US6 (shown in the middle panel), and US11 (shown in the bottom panel) transcripts in the non-translating fraction (subpolysomes), poorly translated fraction (2-4 ribosomes), and highly translated fraction (>4 ribosomes). Multiple unpaired t-tests were performed, where n is three biological replicates, and error bars indicate the standard deviation (s.d.). ***: p<0.00.

[0220]

[0289] Interestingly, both US6 and US11 viral mRNAs were observed to be predominantly distributed in the heavier polysome fractions (as shown in Figures 5C and 5D), suggesting that HSV1 transcripts are generally highly translated despite the global blockade of protein synthesis caused by HSV1 infection. Notably, without the US11 5' leader, the transgene Csf2-gfp mRNA was translated suboptimally compared to the US6 and US11 viral mRNAs (as shown in Figures 12A and 12B). Figures 12A and 12B show that the leaderless transgene mRNA is poorly translated compared to the viral mRNA. In the same polysome profiling experiments described in Figures 5A–5E, the distribution of US6 and US11 mRNAs was compared with that of leaderless Csf2 (shown in Figure 12A) or US11-Csf2 (shown in Figure 12B) mRNAs. This data suggests that conventional transgene cassettes lacking cis-acting translation-enhancing elements are poorly translated when compared to the HSV1 endogenous transcript. This experiment also demonstrates that integration of the HSV1 US11 5' leader significantly improves transgene translation in HSV1-infected cells.

[0221]

[0290] To clarify whether the translational enhancement mediated by the US11 5' leader is specific to HSV1-infected cells or the result of a general antiviral state, we investigated GFP expression from the plasmid pTK-Csf2-gfp in Vero cells by transfection with the dsRNA mimetic poly(I:C) or infection with another virus (e.g., VSV). We observed that neither poly(I:C) transfection nor VSV infection could induce GFP expression (shown in Figure 5E). Figure 5E shows quantification of GFP fluorescence in Vero cells transfected with the pTK-CSF2-GFP plasmid with or without the US11 leader sequence, cotransfected with poly(I:C), or immediately infected with VSV or wild-type HSV1 at an MOI of 5. Thus, the enhancement of gene expression by the US11 5' leader appears to be specific to HSV1-infected cells. These data suggest that conventional transgene cassettes lacking cis-acting translation-enhancing elements are translated suboptimally compared to the HSV1 endogenous transcript. The data also demonstrate that integration of the HSV1 US11 5' leader can significantly and specifically improve translation of HSV1-encoding transgenes.

[0222]

[0291] The US11 5' leader improves the antitumor effect of GM-CSF in HSV1-expressing cells in vivo.

[0292] We further investigated whether cancer outcomes could be improved by enhancing transgene expression beyond that achieved by current oncolytic HSV1 platforms. To assess this, we used the CT26 syngeneic tumor model of colon cancer, which is routinely used to evaluate the efficacy of oncolytic HSV1. Mice were developed with tumors in both flanks, and one tumor was injected with HSV1 Csf2 or HSV1 US11-Csf2 viral particles. The other tumor was injected with virus resuspension buffer (as shown in Figure 6A). Mice were developed with tumors in both flanks, and one tumor was injected with 5 x 10 virions of either resuspension buffer or HSV1 leaderless-Csf2 or HSV1 US11-Csf2.5 Virus particles were injected. Figures 6A-6F show that the US11 leader sequence enhances the antitumor effect of GM-CSF expressing oncolytic HSV1. Figure 6A shows that 10 5 Schematic diagram of the in vivo study design is shown. BALB / c mice were injected with 5×10 CT26 cells into both flanks. When tumors reached approximately 5×5 mm, 5×10 5 Two injections of the indicated PFU of virus were given intratumorally, 2 days apart (days 0 and 2), and tumor size was measured every 2 days.

[0223]

[0293] Analysis of injected tumors confirmed that integration of the US11 5' leader enhanced intratumoral GM-CSF expression in tumors treated with HSV1 US11-Csf2 (shown in Figure 6B), while both viruses had similar replication kinetics in vivo, as indicated by comparable transcription levels of the viral genes US6 and UL30 (shown in Figure 6C). This observation suggested that both viruses infect tumor cells similarly, but increased GM-CSF production was observed only in HSV1 US11-Csf2-infected cells. Figure 6B shows intratumoral GM-CSF levels in tumors treated with leaderless or HSV1 US11-Csf2. Tumors generated in 6A were excised 1 day after the second injection and homogenized in PBS, after which GM-CSF levels were quantified by ELISA. Two-tailed t-tests were also performed, where n is three biological replicates and error bars indicate standard deviation (sd).

[0224]

[0294] Figure 6C shows the results of HSV1 replication in tumors, as measured by viral transcript expression levels. More specifically, RNA from tumors in 5B was extracted with Trizol, and the mRNA abundance of the indicated transcripts was then quantified by RT-qPCR and normalized to Actb. Unpaired two-tailed t-tests were also performed, where n is three biological replicates, and error bars indicate standard deviation (sd).

[0225]

[0295] GM-CSF is known to be a pro-inflammatory cytokine, but may exert anti-inflammatory properties in certain circumstances. We investigated the tumor microenvironment of infected tumors by analyzing the mRNA levels of representative inflammatory genes and observed elevated levels of Il1b, Il6, and Tnfa mRNA in tumors treated with HSV1 US11-Csf2 (Figure 6D). Figure 6D shows the expression of representative inflammatory genes in injected tumors. RNA from tumors in 6B was extracted with Trizol, and the mRNA abundance of the indicated transcripts was then quantified by RT-qPCR and normalized to Actb. Systemic antitumor responses were also analyzed 8 days after the first injection by IFNγ ELISPOT assay on splenocytes cocultured with UV-irradiated CT26 cells. Although CT26-specific immune cell responses were not found in the spleens of vehicle-treated mice, leaderless HSV1 was able to induce specific levels of CT26-specific immune cells. However, HSV1 US11-Csf2 induced significantly higher CT26-specific T cell responses compared to the leaderless virus (Fig. 6D, Fig. S14).

[0226]

[0296] Finally, we directly compared the antitumor effects of both viruses (Figure 6E, Figure 13). As expected, regardless of the viral clone, HSV1-injected tumors showed reduced tumor growth compared to vehicle-injected tumors (Figure 6F), a result consistent with the oncolytic and immunomodulatory properties of this viral platform. Importantly, tumors injected with the US11 5' leader virus grew significantly less than tumors injected with the leaderless virus (Figure 6F, left panel). More interestingly, while administration of the leaderless virus had no significant effect on the contralateral tumors, administration of the US11 5' leader virus significantly slowed tumor growth on the contralateral side, comparable to that observed in the treated tumors (Figure 6F, right panel), suggesting an abscopal effect consistent with the enhanced antitumor immune response observed by ELISPOT. Finally, we found that the US11 5' leader virus significantly improved mouse survival (Figures 6A-6F). Taken together, these data demonstrate that increasing GM-CSF expression through incorporation of the translation-enhancing US11 5' leader enhances intratumoral cytokine production and potentiates anticancer efficacy in a preclinical colon cancer model.

[0227]

[0297] This observation suggests that HSV1 US11-Csf2 may induce a more inflammatory tumor microenvironment, even at the same dose and growth rate as leaderless viruses. Finally, we directly compared the antitumor effects of both viruses. As expected, HSV1-injected tumors, regardless of viral clone, showed reduced tumor growth compared to vehicle-injected tumors (as shown in Figure 6E). This observation is consistent with the oncolytic and immunomodulatory properties of this viral platform. Figure 6E shows the effect of leaderless or HSV1 US11-Csf2 administration on tumor growth; the number of mice is indicated in parentheses. ANOVA with Sidak's post hoc test was also performed, with error bars representing ±sd (standard deviation). Figure 13 shows the size of individual tumors shown in Figure 6E.

[0228]

[0298] Tumors injected with the US11 5' leader virus grew significantly less than tumors injected with the leaderless virus (Figure 5E, left panel). More interestingly, while administration of the leaderless virus failed to show a significant effect on contralateral tumors compared with vehicle, administration of the US11 5' leader virus showed a much slower tumor growth profile comparable to that observed in ipsilateral tumors (Figure 6E, right panel), suggesting an abscopal effect. Finally, we found that the presence of the US11 5' leader significantly improved mouse survival with the US11 leader virus, consistent with its superior expression of GM-CSF (Figure 6F). Figure 6F shows the Kaplan-Meier survival curves for mice administered leaderless or US11-Csf2 HSV1; the number of mice is indicated in parentheses.

[0229]

[0299] Taken together, the above experimental data demonstrated that increasing the dose of GM-CSF through incorporation of the translation-enhancing US11 5' leader improved intratumoral cytokine production and enhanced anticancer efficacy in a preclinical colon cancer model.

[0230]

[0300] Considering the discussion and experimental data discussed previously herein, it is clear that incorporating an HSV1 5' leader sequence enhances downstream transgene protein expression from recombinant HSV1 viruses. It is hypothesized that the increased expression is mediated in infected cancer cells through increased mRNA translation of the modified transgene transcript. It has also been observed that oncolytic HSV1 carrying a 5' leader upstream of a therapeutic transgene has superior antitumor activity compared to leaderless HSV1. This approach is a simple yet highly effective way to improve the current generation of oncolytic HSV1 platforms currently undergoing clinical trials. This strategy can also be used as a complementary technique to techniques that use either a strong heterologous promoter to drive transgene expression or an approach that inserts a transgene into a highly transcriptionally active region of the HSV1 genome. As an example of the former strategy, Toda et al. demonstrated that a GM-CSF expression cassette inserted into the TK region and driven by a CMV promoter was expressed in 10 5 In this study, we also used a CMV-driven GM-CSF expression cassette inserted into the TK region of the HSV1 genome. 5 We found 41.75 ± 2.35 pg of GM-CSF per Vero cell, which is in line with previously reported values (Figure 3D, as shown in Figure 15; this is typically achieved by 4 × 10 cells in 1 ml of medium). 5 The results were very close to the GM-CSF production (containing 167 ± 9.4 pg / ml of cells) observed in 12-well plate confluence (Figure 3D, as shown in Figure 15; this was calculated based on 167 ± 9.4 pg / ml of GM-CSF observed at confluence in a 12-well plate format). However, introduction of the US11 5' leader resulted in a nearly 8-fold increase in GM-CSF production, indicating a significant improvement in transgene protein expression. Transgene production can be further improved by combining a strong HSV1 promoter (e.g., one driving HSV1 RL2 expression) with a translational enhancer such as the US11 5' leader.

[0231]

[0301] Enhanced translation of Csf2 transcripts expressed from the HSV1 backbone was observed to improve antitumor efficacy in a double-implanted flank tumor mouse cancer model. As expected, tumors administered with leaderless HSV1 progressed more slowly, and corresponding mice had better survival rates compared to mock-treated counterparts (as shown in Figures 6E and 6F). However, the HSV1 US11-csf2 virus not only inhibited tumor growth to a greater extent in the injected tumors, but also induced significant inhibition of tumor growth in the contralateral tumors, resulting in improved survival. Consistently, higher intratumoral GM-CSF concentrations in tumors from mice administered with the US11 5' leader HSV1 were observed to correlate with upregulation of inflammatory gene markers (shown in Figures 6B and 6D) and increased levels of tumor-specific immune cells in the spleens of administered mice (Figure 6D), suggesting a desirable inflammatory modification of the tumor microenvironment resulting from the enhanced antitumor immune response. Because GM-CSF has been shown to enhance systemic antitumor immune responses, these results indicate that increased GM-CSF production is sufficient to induce a more inflammatory tumor microenvironment in the administered tumor, potentially leading to improved systemic antitumor immune responses against distant tumors. Taken together, these results demonstrate that despite the use of a strong promoter (CMV promoter), it alone does not maximize transgene protein expression. For example, incorporating a translation enhancer can further enhance payload levels, leading to increased oncolytic viral efficacy.

[0232]

[0302] The following sections provide further information about materials and how to prepare or obtain them.

[0233]

[0303] Cell culture and viruses: Mouse breast cancer cell line 4T1, mouse colon carcinoma CT26, human prostate cancer DU145, human kidney cancer 786-O, HEK293T, and Vero cells were obtained from the American Tissue Culture Collection. 4T1 cells were maintained in Roswell Park Memorial Institute (RPMI) 1640 (Fisher) supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich) and 1x penicillin / streptomycin (Fisher). HEK293T and Vero cells were maintained in Dulbecco's modified Eagle's medium (DMEM) (Fisher) supplemented with 10% FBS and 1x penicillin / streptomycin (Fisher). Cells were incubated at 37°C in 5% CO2 (v / v). All HSV1 strains were propagated on Vero cells. Vero cell monolayers were inoculated with HSV1 at an MOI of 0.1 and subsequently cultured for approximately 24–48 h until near-100% cytopathic effect was observed. The supernatants were then collected separately, and the infected cells were freeze-thawed three times to release intracellular virus. Both the culture supernatant and the freeze-thaw lysate were clarified by centrifugation at 1,000 g for 5 min to remove cellular debris. The supernatants were combined and filtered through a 0.45 μm filter. Viral particles were further purified using a sucrose cushion by layering the supernatant on top of a 36% sucrose cushion in PBS and centrifuging at 18,000 g for 2 h at 4°C. The virus in the pellet was resuspended in HNE buffer (10 mM HEPES, 150 mM NaCl, 0.1 mM EDTA, pH 7.2) and stored at -80°C.

[0234]

[0304] RNA-Seq Mapping and TSS Identification: RNA-Seq data from HSV1-infected 4T1 cells have been previously published. For RNA-Seq mapping, RNA reads were mapped to the HSV1 reference genome JQ780693.1 using HISAT262. Only one copy of two adjacent inverted repeat regions was used: TRL region 1–8870 and TRS region 144602–151023. Transcription start sites (TSSs) were manually identified from RNA read coverage, defined by abrupt increases in read coverage at base positions (shown in Figures 2-1–2-2). Leader sequences were defined as the sequence from the TSS to the annotated start codon of the relevant HSV1 gene, excluding spliced introns where applicable. To convert leader sequence coverage between the different HSV1 reference genomes (JQ780693.1 to JN555585.1), the leader sequences identified from JQ780693.1 were aligned to JN555585.1 using NCBI-BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to find the corresponding coordinates on JN555585.1. Raw data were deposited and analyzed on the Galaxy server (https: / / galaxyproject.org). Gene expression levels from mapped RNA-seq and Ribo-seq reads were calculated using Cuffdiff.

[0235]

[0305] Plasmid Construction: For leader translation activity screening using the CAT reporter assay, viral leader sequences were amplified by PCR from cDNA reverse-transcribed from mRNA of HSV1-infected 4T1 cells. Briefly, total RNA was extracted from cells using TRIzol Reagent (Fisher), treated with the Turbo DNA-free kit (Thermo Fisher) to remove potential viral genomic DNA contaminants, and then reverse-transcribed using the iScript Advanced cDNA Synthesis Kit (BioRad). The forward and reverse primers for each leader (NotI_5'UTR-F and XhoI_5'UTR-R) also contained NotI and XhoI restriction sites, respectively, for subsequent cloning. Amplification specificity was confirmed for each primer pair by including a negative control cDNA from uninfected 4T1 mRNA. The PCR amplicon was cloned into the CAT reporter plasmid pMCpA using the NotI-XhoI restriction sites. A leaderless CAT reporter construct, in which only a short residual sequence from the plasmid MCS was transcribed by the CAT CDS, was used as a control (this residual sequence is also present directly 5' upstream of the leader sequence in all viral 5' leader constructs). To insert the transgene expression cassette into the HSV1 genome, the cassette was cloned into the pTK-Green plasmid and flanked by two regions of the HSV1 TK gene to allow homologous recombination. The expression cassette consisted of a leader followed by the transgene (firefly luciferase or mouse GM-CSF), the self-cleaving peptide porcine teschovirus-1 2A (P2A), and GFP. Inserts were generated by fusion PCR. The viral leader was amplified as described above using a forward primer containing an AgeI cleavage site (AgeI_5'UTR-F) and a reverse primer with an overlapping section of the 5' end of the transgene (5'UTR_LUC-R or 5'UTR_CSF2-R).The second fragment, containing the transgene CDS, was amplified using a forward primer (5'UTR_LUC-F or 5'UTR_CSF2-F) and a reverse primer (LUC-GSG-P2A-R) consisting of the CDS 3' end, a GSG linker, and part of the P2A sequence. The third fragment, containing GFP, was amplified using a forward primer (GSG-P2A-GFP-F) and a reverse primer (GFP-KpnI-R) containing a KpnI cleavage site. All three fragments were purified using a QIAquick PCR Purification Kit (Qiagen) and subsequently used as templates for fusion PCR using the 5'-end primer (AgeI_5'UTR-F) and the 3'-end primer (GFP-KpnI-R). The resulting PCR product was cloned into pTK-Green using the AgeI and XhoI sites. All plasmids were verified by Sanger sequencing. Leaderless LUC-GFP or CSF2-GFP constructs, in which only a short residual sequence from the plasmid MCS was transcribed with the transgene CDS, were used as controls (this residual sequence was also present directly 5' upstream of the leader sequence in all viral 5' leader constructs). All primer sequences are presented in Table S1.

[0236]

[0306] Table S1 [Table 3]

[0237]

[0307] CAT reporter assay: CAT reporter assays were performed as previously described. Cells were seeded at approximately 75% confluence in 6-well plates and incubated for 1 day before transfection. For HSV1 infection, cells were infected with HSV1 at an MOI of 5 1 h before transfection. The CAT reporter plasmid was cotransfected with the β-galactosidase plasmid at 1 μg per plasmid using Lipofectamine 2000 (Thermofisher) according to the manufacturer's protocol. 24 h after transfection, cells were lysed and assayed for CAT expression using a CAT ELISA kit (Roche). β-galactosidase activity was also measured from lysates using an ortho-nitrophenyl-β-galactoside (ONPG) colorimetric assay. CAT expression was normalized to β-galactosidase activity to control for transfection efficiency.

[0238]

[0308] Quantitative RT-PCR: DNase-treated RNA and cDNA were prepared as described above. For RT-qPCR, SsoAdvanced Universal SYBR Green supermix (BioRad) was used with a CFX96 Touch Real-Time PCR Detection System (BioRad). PCR conditions were 95°C for 3 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds, and terminated with a standard melting curve cycle. Gene expression was calculated using the ΔΔCt method against the indicated reference genes. A list of primers for the genes or sequences of interest is provided in Table S1.

[0239]

[0309] Western blot: Cells were washed once with 1x PBS and then lysed on ice using RIPA buffer (150 mM NaCl, 1.0% IGEPAL® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, 50 mM NaF, 15 mM NaVO3, pH 8.0) supplemented with Complete protease inhibitor cocktail (Roche). Lysates were centrifuged at 10,000g for 10 minutes at 4°C to remove cell debris. Protein concentrations were determined using a DC Protein assay kit (BioRad). The indicated amounts of total protein were used for SDS-polyacrylamide gel electrophoresis (PAGE) using a 10% SDS-polyacrylamide gel. The separated proteins were transferred to a PVDF membrane, which was blocked with 5% w / v nonfat milk in TBS-T buffer (10 mM Tris, 50 mM NaCl, 0.1% Tween-20, pH 7.5) and subsequently blotted with the indicated antibodies. The following antibodies and corresponding dilutions were used: anti-GFP (Abclonal, Cat. No. AE011) at 1:2000, anti-β-actin (Sigma, #A5441) at 1:10,000, IRDye® 800CW goat anti-mouse IgG secondary antibody (LICOR, Cat. No. 926-32210) at 1:20,000, and IRDye® 680RD goat anti-rabbit IgG secondary antibody (LICOR, Cat. No. 926-68071) at 1:20,000.

[0240]

[0310] Live-cell monitoring of GFP expression: Live-cell monitoring of GFP expression was performed using the IncuCyte Live-Cell. Sartorius was used as the monitoring system. Transfection and / or infection were performed as indicated, and then the cell plates were placed in the IncuCyte system and cultured and monitored at 37°C and 5% CO2, with phase-contrast and fluorescence images taken every 2 hours. Images were analyzed with the IncuCyte ZOOM software using the following parameters: background subtraction using the Top-Hat method (disk-shaped structural elements with a radius of 10 μm, threshold at 1.0 green calibration units), edge splitting: off, hole filling: none, size adjustment: none, and filter: none.

[0241]

[0311] Generation of recombinant HSV1 virus: To insert the expression cassette into the HSV1 genome, the TK gene was targeted for insertion as previously described. HSV1 genomic DNA was extracted from purified virus stocks using a QIAamp DNA Mini Kit (Qiagen). HEK293T cells were seeded into 6-well plates at 75% confluency one day prior to transfection and subsequently co-transfected with HSV1 gDNA:pTK-Green plasmid at a 1:40 ratio using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer's protocol, for a total volume of 1 tg DNA / well. Cells were then cultured for 3–5 days until cytopathic effects were observed. Cells were then freeze-thawed three times and centrifuged at 1000 g for 5 minutes to remove cellular debris, and the supernatant was collected. Subsequently, individual plaques were isolated by overlaying DMEM supplemented with 10% FBS and 1% carboxymethylcellulose (CMC), and various dilutions of the supernatant were inoculated onto a monolayer of Vero cells to allow for the development of individual plaques. GFP-positive plaques were selected and subjected to multiple rounds of plaque purification until a pure GFP-expressing HSV1 population was obtained. Insertion of the cassette into the HSV1 genome was first confirmed by PCR genotyping using a forward primer for the TK gene (pTK-seq) and a reverse primer for the transgene (CSF2.eR), followed by Sanger sequencing.

[0242]

[0312] Plaque titration: Virus stocks or solutions were serially diluted and then inoculated onto monolayers of Vero cells and incubated for 1 hour at 37°C, 5% CO2 with frequent shaking. The virus-containing medium was then removed and an overlay of DMEM + 10% FBS + 1% agar was added. The cells were then cultured at 37°C, 5% CO2 until visible plaques could be observed using a bright-field microscope. Plaques were visualized using crystal violet staining and counted.

[0243]

[0313] Polysome fractionation: Polysome fractionation was performed as previously described. Briefly, cells were treated with 100 μg / ml cycloheximide (CHX) (Bioshop, catalog no. 66-81-9) for 5 min to halt ribosomes, washed three times with ice-cold PBS supplemented with CHX (100 μg / ml), and lysed using polysome lysis buffer (5 mM Tris pH 7.5, 2.5 mM MgCl, 1.5 mM KCl, 100 μg / ml CHX, 2 mM DTT, 0.5% Triton X-100, 0.5% sodium deoxycholate) supplemented with 100 units of RNAsin ribonuclease inhibitor (Promega). Cell debris was removed by centrifugation at 14,000 g for 10 min at 4°C. The supernatant was then loaded onto a 10%–50% continuous sucrose gradient and centrifuged at 36,000 rpm for 90 min at 4°C in an SW41Ti rotor. Fractions were then collected and their OD260 absorbance was monitored using a Brandel Fraction Collector System (Brandel). RNA was extracted from each fraction using TRIzol Reagent (Thermo Fisher) according to the manufacturer's protocol.

[0244]

[0314] GM-CSF quantification: To measure GM-CSF production from engineered HSV1 infections, cells were seeded at 80–90% confluency and subsequently infected with the indicated HSV1 at an MOI of 5. Culture supernatants were collected 24 hours post-infection, and GM-CSF production was measured using a mouse GM-CSF ELISA kit (CSF2) (Abcam, catalog no. ab100685) according to the manufacturer's protocol.

[0245]

[0315] One-step growth curves and monitoring of HSV1 gene expression: To monitor viral replication and viral gene transcription during one-step growth curves, cells were seeded at 80-90% confluency and infected the next day at an MOI of 5. Both cells and culture supernatants were harvested at the indicated time points and used for viral titer determination by plaque assay or RNA extraction for quantification of viral transcript expression as described above.

[0246]

[0316] CT26 subcutaneous tumor model: Female BALB / c mice were ordered from Charles River (Kingston, NY, USA). Animals were received at 5-6 weeks of age, housed 5 per cage, fed ad libitum, and allowed to acclimate to the facility for 2 weeks before experimental manipulation. For tumor implantation, 10 5 Mice were injected subcutaneously into both flanks with CT26 cells. When tumors became palpable (approximately 5 x 5 mm), the tumors on one flank were injected with 50 μl of DMEM or 5 x 10 5 The indicated PFU of virus was injected intratumorally twice, one day apart, while the tumor on the other flank was left untreated (contralateral). Tumor size was measured every 2 days using calipers. Tumor size was measured when the humane endpoint was reached or when individual tumors reached 2000 mm 3 Animals were euthanized upon reaching a mean age of 18.5 or another humane endpoint. In vivo studies were performed in a single-blind manner; animal handlers were unaware of the treatments administered to each mouse group. To assess intratumoral GM-CSF levels and HSV1 transcript abundance, tumors were excised, finely minced, and homogenized in PBS buffer using 2.0 mm zirconia beads (Thomas Scientific, catalog no. 1197P96) in a TissueLyzer II (QIAGEN) at 20 Hz / sec. Half of the homogenate was used to measure mouse GM-CSF using the Mouse GM-CSF ELISA Kit (CSF2) (Abcam, catalog no. ab100685) according to the manufacturer's protocol. The other half of the homogenate was used for RNA extraction using Trizol reagent (Thermo Fisher), and transcript mRNA was subsequently quantified by RT-qPCR as described above.

[0247]

[0317] IFNγ ELISPOT assay: Splenocytes were freshly isolated from mouse spleens 8 days after the initial injection and cultured in RPMI (Fisher) supplemented with 10% FBS (Sigma-Aldrich) and 1x penicillin / streptomycin (Fisher). IFNγ ELISPOT was performed using a mouse interferon-γ ELISPOT kit (Abcam, catalog no. ab64029) according to the manufacturer's protocol. Briefly, 100,000 splenocytes were co-cultured in ELISPOT wells for 24 hours with or without 50,000 UV-irradiated CT26. Subsequently, cells were thoroughly washed from the wells, and IFNγ spots from stimulated T cells were developed. Individual wells were imaged using a LEICA EZ4 W stereomicroscope, and spots were manually counted.

[0248]

[0318] Data and code availability: RNA-seq data have been previously published and are available in the NCBI Gene Expression Omnibus (GEO: GSE137757), sample IDs GSM4086602 and GSM4086610 (HSV1-infected mRNA replicates).

[0249]

[0319] Statistical analysis: All experiments were performed with at least three biological replicates. Statistical analysis was performed using GraphPad Prism 8 using the methods indicated in the figure legends. Error bars indicate the standard error of the mean (SEM). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001; ns, not significant.

[0250]

[0320] Observations and Analysis

[0321] The findings presented previously herein led to the identification of cis-acting sequences in virus-based therapeutics that can be utilized to enhance transgene expression. This method was initially conceptualized through comprehensive annotation of viral 5' leader sequences via TSS identification by RNA-Seq and mapping of translation efficiency across the viral genome by ribosome profiling. In this manner, TSSs for 61 of 73 HSV1 genes were identified. During the lytic cycle, HSV1 regularly expresses its genes, classified as immediate-early (IE), early (E), and late (L) genes. We primarily focused on several selected 5' leaders that are highly expressed at the late stage of HSV1 infection, as they may be better tuned to enhance translation at the final stage of infection (as shown in Figures 2-1 to 2-2). While this application focuses primarily on the US11 5' leader, those skilled in the art will understand that there may be other specific viral sequences that may have superior translation-enhancing activity at different time points of infection, which can be revealed using a more comprehensive screening of all HSV1 5' leaders.

[0251]

[0322] Possible mechanisms of US11 5' leader-mediated translation enhancement during infection

[0323] The most extensively studied translational enhancer element of viral origin is the IRES, which supports cap-independent translation of viral transcripts. Viral proteins can also act in trans with 5' leader sequences to modify the translation efficiency of viral mRNAs. In this regard, the HSV1 protein VHS has been shown to regulate the translation activity of specific host 5' UTRs as well as HSV1 viral sequences in a cap-independent manner. VHS is a major translational modifier protein of HSV1, possessing RNase activity for ssRNA and interacting with the translation initiation complex, thus mediating the degradation of actively translating mRNAs in infected cells. During the late stages of HSV1 infection, VHS activity is attenuated by the viral proteins VP16 and VP22, allowing productive translation of viral transcripts in a cap-dependent manner. The cap-independent mode of translation used by the above-mentioned 5' leader may confer an advantage to related transcripts during the early stages of HSV1 infection.

[0252]

[0324] Another HSV1 translation modifier is ICP27, which is important for viral mRNA translation by facilitating its nuclear export. ICP27 contains an RGG motif at its N-terminus that binds to viral transcripts through a GC-rich region and links transcripts to the host nuclear export complex through its interaction with the nuclear export factors REF and NXF1. While this study was limited to the HSV1 5' leader, the same strategy may work for other viral vectors and OV backbones as well. In poxviruses, for example, nontemplated poly(A) sequences are added to the 5' leaders of late viral transcripts due to viral polymerase slippage, which promotes viral RNA translation. This activity is attributed to the phosphorylation of the small ribosomal protein RACK1 by viral kinase B160. Recently, SARS-CoV-2 sgRNAs as well as the 5' leaders of gRNAs have been shown to protect viral transcripts from translational blockade by the viral NS1 protein. Thus, viral leaders are likely enriched in cis-regulatory sequences that have co-evolved with viral trans-acting protein factors to post-transcriptionally control viral gene expression, but current virus-based therapeutic applications do not effectively use them.

[0253]

[0325] Thus, we demonstrated that incorporating the HSV1 5' leader sequence enhanced downstream transgene protein expression from recombinant HSV1 viruses. Experiments tested intracellular (CAT, LUC, GFP) or secreted (GM-CSF) transgenes, and expression levels were consistently induced by incorporation of the US11 5' leader during HSV1 infection. The increased expression was mediated by increased mRNA translation of the modified transgene transcript in infected cancer cells. Importantly, oncolytic HSV1 with a 5' leader upstream of the therapeutic transgene was found to have superior antitumor activity compared to leaderless HSV1. This approach represents a simple yet highly effective way to improve the current generation of oncolytic HSV1 platforms currently undergoing clinical trials. This strategy may be complementary to approaches that use either strong heterologous promoters to drive transgene expression or approaches that insert transgenes into highly transcriptionally active regions of the HSV1 genome. While secreted cytokines were used in this study, membrane-bound transgenes may also benefit from the expression-enhancing effects of a 5' leader. The 5' leader can also be incorporated into multiple transgene expression cassettes and inserted into multiple locations in the HSV1 genome, simultaneously enhancing the expression and therapeutic effect of each transgene. As an example of the former strategy, Toda et al. reported that a GM-CSF expression cassette driven by a CMV promoter and inserted into the TK region was able to express 10 5 In this study, which also used a CMV-driven GM-CSF expression cassette inserted into the TK region of the HSV1 genome, the results observed were comparable to those observed in 10 5 The concentration of GM-CSF was 41.75±2.35 pg per Vero cell, a value very close to that previously reported (Figure 15A; typically, 4×10 cells in 1 ml of medium were used). 5(Calculations based on 167 ± 9.4 pg / ml of GM-CSF observed in a confluent 12-well plate format containing 100 cells.) However, introduction of the US11 5' leader resulted in a nearly 8-fold increase in GM-CSF production, indicating a significant improvement in transgene protein expression. Transgene production can be further improved by combining a strong HSV1 promoter (e.g., one driving HSV1 RL2 expression) with a translation enhancer found in the viral 5' leader and potentially also in the viral 3' UTR. Additionally, minimal translation-enhancing motif(s) specific to HSV1 infection may pose a lower risk of recombination than a full-length 5' leader, especially when applied to new-generation oncolytic HSV1s encoding multiple therapeutic transgenes.

[0254]

[0326] While the present invention has been described with respect to one or more embodiments, it will be apparent to those skilled in the art that certain variations and modifications can be made without departing from the scope of the invention as defined by the claims.

[0255]

[0327] All citations and / or references recited herein are incorporated herein by reference in their entirety.

[0256] References 1. Rauch, S., Jasny, E., Schmidt, KE & Petsch, B. New vaccinetechnologies to combat outbreak situations. Front. Immunol. 9, 1963 (2018). 2. Macedo, N., Miller, DM, Haq, R. & Kaufman, HL Clinicallandscape of oncolytic virus research in 2020. Journal for ImmunoTherapy ofCancer 8, 1486 (2020). 3. Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L. & Gao, G.Viral vector platforms within the gene therapy landscape. Signal Transduct.Target. Ther. 2021 61 6, 1-24 (2021). 4. Serafini, P. et al. High-dose granulocyte-macrophagecolony-stimulating factor-producing vaccines impair the immune response throughthe recruitment of myeloid suppressor cells. Cancer Res. 64, 6337-6343 (2004). 5. Conner, J. & Braidwood, L. Expression of inhibitor of growth4 by HSV1716 improves oncolytic potency and enhances efficacy. Cancer GeneTher. 19, 499-507 (2012). 6. Pearl, T. M., Markert, J. M., Cassady, K. A. & Ghonime, M. G.Oncolytic Virus-Based Cytokine Expression to Improve Immune Activity in Brainand Solid Tumors. Molecular Therapy - Oncolytics 13, 14-21 (2019). 7. Zhang, Q. & Liu, F. Advances and potential pitfalls ofoncolytic viruses expressing immunomodulatory transgene therapy for malignantgliomas. Cell Death and Disease 11, 1-11 (2020). 8. Zheng, M., Huang, J., Tong, A. & Yang, H. Oncolytic Virusesfor Cancer Therapy: Barriers and Recent Advances. Molecular Therapy -Oncolytics 15, 234-247 (2019). 9. Cripe, T. P. et al. Pediatric cancer goneviral. Part I: Strategies for utilizing oncolytic herpes simplex virus-1 inchildren. Molecular Therapy - Oncolytics 2, 15015 (2015). 10. Walsh, D. & Mohr, I. Viral subversion of the host proteinsynthesis machinery. Nat Rev Microbiol 9, 860-875 (2011). 11. Hoang, H.-D., Graber, T. E. & Alain, T. Battling forRibosomes: Translational Control at the Forefront of the Antiviral Response. J. Mol. Biol. (2018). doi:10.1016 / j.jmb.2018.04.040 12. Hu, J. C. C. et al. A phase I study ofOncoVEXGM-CSF, a second-generation oncolytic herpes simplex virus expressinggranulocyte macrophage colony-stimulating factor. Clin. Cancer Res. 12, 6737-6747(2006). 13. Breitbach, C. J. et al. Intravenous delivery of amulti-mechanistic cancer-targeted oncolytic poxvirus in humans. Nat. 20114777362 477, 99-102 (2011). 14. Dhungel, P., Cao, S. & Yang, Z. The 5’-poly(A) leader ofpoxvirus mRNA confers a translational advantage that can be achieved in cellswith impaired cap-dependent translation. PLoS Pathog. 13, e1006602 (2017). 15. Jha, S. et al. Trans-kingdom mimicry underlies ribosomecustomization by a poxvirus kinase. Nature 546, 651-655 (2017). 16. Mears, W. E. & Rice, S. A. The RGG box motif of the herpessimplex virus ICP27 protein mediates an RNA-binding activity and determines invivo methylation. J. Virol. 70, (1996). 17. Sandri-Goldin, R. M. ICP27 mediates HSV RNA export by shuttlingthrough a leucine-rich nuclear export signal and binding viral intronless RNAsthrough an RGG motif. Genes Dev. 12, 868-79 (1998). 18. Rivera, A. A. et al. Mode of transgeneexpression after fusion to early or late viral genes of a conditionallyreplicating adenovirus via an optimized internal ribosome entry site in vitroand in vivo. Virology 320, 121-134 (2004). 19. Bommareddy, P. K., Peters, C., Saha, D., Rabkin, S. D. &Kaufman, H. L. Oncolytic Herpes Simplex Viruses as a Paradigm for the Treatmentof Cancer. Annu. Rev. Cancer Biol 2, 155-173 (2018). 20. Huang, C. J. & Wagner, E. K. The herpes simplex virus type 1major capsid protein (VP5- UL19) promoter contains two cis-acting elementsinfluencing late expression. J. Virol. 68, 5738-5747 (1994). 21. Steffy, K. R. & Weir, J. P. Upstream promoter elements ofthe herpes simplex virus type 1 glycoprotein H gene. J. Virol. 65, 972-975(1991). 22. Pederson, N. E., Person, S. & Homa, F. L. Analysis of the gBpromoter of herpes simplex virus type 1: high-level expression requires both an89-base-pair promoter fragment and a nontranslated leader sequence. J. Virol.66, (1992). 23. Goodart, S. A., Guzowski, J. F., Rice, M. K. & Wagner, E. K.Effect of genomic location on expression of beta-galactosidase mRNA controlledby the herpes simplex virus type 1 UL38 promoter. J. Virol. 66, 2973-2981(1992). 24. Mavromara-Nazos, P. & Roizman, B. Delineation of regulatorydomains of early (β) and late (γ2) genes by construction of chimeric genesexpressed in herpes simplex virus 1 genomes. Proc. Natl. Acad. Sci. U. S. A.86, 4071-4075 (1989). 25. Rixon, F. J. & Clements, J. B. Detailed structural analysisof two spliced HSV-1 immediate- early mRNAs. Nucleic Acids Res. 10, 2241-2256(1982). 26. Greco, A. et al. The DNA sequence coding for the 5’ untranslatedregion of herpes simplex virus type 1 ICP22 mRNA mediates a high level of geneexpression. J. Gen. Virol. 75, 1693-1702 (1994). 27. Hoang, H. D. et al. Induction of anAlternative mRNA 5′ Leader Enhances Translation of the Ciliopathy Gene Inpp5eand Resistance to Oncolytic Virus Infection. Cell Rep. 29, 4010-4023.e5 (2019). 28. Tang, S., Patel, A. & Krause, P. R. Hidden regulation ofherpes simplex virus 1 pre-mRNA splicing and polyadenylation by virally encodedimmediate early gene ICP27. PLOS Pathog. 15, e1007884 (2019). 29. Tombacz, D. et al. Long-Read Isoform Sequencing Reveals a HiddenComplexity of the Transcriptional Landscape of Herpes Simplex Virus Type 1.Front. Microbiol. 8, 1079 (2017). 30. Tombacz, D. et al. Multiple Long-Read Sequencing Survey ofHerpes Simplex Virus Dynamic Transcriptome. Front. Genet. 10, 834 (2019). 31. Whisnant, A. W. et al. Integrativefunctional genomics decodes herpes simplex virus 1. Nat. Commun. 11, 1-14(2020). 32. Rutkowski, A. J. et al. Widespreaddisruption of host transcription termination in HSV-1 infection. Nat. Commun.6, 7126 (2015). 33. Zhao, T. T. et al. hnRNP A1 regulates UV-induced NF-κBsignalling through destabilization of cIAP1 mRNA. Cell Death Differ. 16, 244-252(2009). 34. Tang, S., Patel, A. & Krause, P. R. Herpes simplex virusICP27 regulates alternative pre- mRNA polyadenylation and splicing in asequence-dependent manner. Proc. Natl. Acad. Sci. U. S. A. 113, 12256-12561(2016). 35. Minaker, R. L., Mossman, K. L. & Smiley, J. R. Functionalinaccessibility of quiescent herpes simplex virus genomes. Virol. J. 2, (2005). 36. Donnelly, M. L. L. et al. Analysis ofthe aphthovirus 2A / 2B polyprotein ‘cleavage’ mechanism indicates not aproteolytic reaction, but a novel translational effect: A putative ribosomal‘skip’. J. Gen. Virol. 82, 1013-1025 (2001). 37. Kim, J. H. et al. High cleavage efficiency of a 2A peptidederived from porcine teschovirus- 1 in human cell lines, zebrafish and mice.PLoS One 6, (2011). 38. Pol, J., Kroemer, G. & Galluzzi, L. First oncolytic virusapproved for melanoma immunotherapy. Oncoimmunology 5, (2016). 39. Malhotra, S. et al. Use of an oncolytic virus secreting GM-CSFas combined oncolytic and immunotherapy for treatment of colorectal and hepaticadenocarcinomas. Surgery 141, 520-529 (2007). 40. Moesta, A. K. et al. Local delivery ofOncoVEXmGM-CSF generates systemic antitumor immune responses enhanced bycytotoxic T-lymphocyte-associated protein blockade. Clin. Cancer Res. 23, 6190-6202(2017). 41. Bhattacharya, P. et al. Dual Role of GM-CSF as aPro-Inflammatory and a Regulatory Cytokine: Implications for Immune Therapy. J.Interf. Cytokine Res. 35, 585 (2015). 42. Kim, K. J. et al. Antitumor effects of IL-12 and GM-CSFco-expressed in an engineered oncolytic HSV-1. Gene Ther. 1-13 (2020). doi:10.1038 / s41434-020-00205-x 43. Toda, M., Martuza, R. L. & Rabkin, S. D. Tumor growthinhibition by intratumoral inoculation of defective herpes simplex virusvectors expressing granulocyte - Macrophage colony-stimulating factor. Mol.Ther. 2, 324-329 (2000). 44. Thomas, S. et al. Development of a new fusion-enhanced oncolyticimmunotherapy platform based on herpes simplex virus type 1. J. Immunother.Cancer 7, 214 (2019). 45. Yan, W. L., Shen, K. Y., Tien, C. Y., Chen, Y. A. & Liu, S.J. Recent progress in GM-CSF-based cancer immunotherapy. Immunotherapy 9, 347-360(2017). 46. Honess, R. W. & Roizman, B. Regulation of HerpesvirusMacromolecular Synthesis I. Cascade Regulation of the Synthesis of Three Groupsof Viral Proteins 1. J. Virol. 14, 8-19 (1974). 47. Lee, K. M., Chen, C. J. & Shih, S. R. Regulation Mechanismsof Viral IRES-Driven Translation. Trends in Microbiology 25, 546-561 (2017). 48. Mailliot, J. & Martin, F. Viral internal ribosomal entrysites: four classes for one goal. Wiley Interdiscip. Rev. RNA 9, e1458 (2018). 49. Dauber, B., Saffran, H. A. & Smiley, J. R. The HerpesSimplex Virus 1 Virion Host Shutoff Protein Enhances Translation of Viral LatemRNAs by Preventing mRNA Overload. J. Virol. 88, 9624-9632 (2014). 50. Saffran, H. A., Read, G. S. & Smiley, J. R. Evidence forTranslational Regulation by the Herpes Simplex Virus Virion Host ShutoffProtein. J. Virol. 84, 6041-6049 (2010). 51. Doepker, R. C., Hsu, W.-L., Saffran, H. A. & Smiley, J. R.Herpes Simplex Virus Virion Host Shutoff Protein Is Stimulated by TranslationInitiation Factors eIF4B and eIF4H. J. Virol. 78, 4684-4699 (2004). 52. Feng, P., Everly, D. N. & Read, G. S. mRNA Decay duringHerpes Simplex Virus (HSV) Infections: Protein-Protein Interactions Involvingthe HSV Virion Host Shutoff Protein and Translation Factors eIF4H and eIF4A. J.Virol. 79, 9651-9664 (2005). 53. Taddeo, B., Zhang, W. & Roizman, B. The virion-packagedendoribonuclease of herpes simplex virus 1 cleaves mRNA in polyribosomes. Proc.Natl. Acad. Sci. U. S. A. 106, 12139-12144 (2009). 54. Taddeo, B., Sciortino, M. T., Zhang, W. & Roizman, B.Interaction of herpes simplex virus RNase with VP16 and VP22 is required forthe accumulation of the protein but not for accumulation of mRNA. Proc. Natl.Acad. Sci. U. S. A. 104, 12163-12168 (2007). 55. Corbin-Lickfett, K. A., Chen, I. H. B., Cocco, M. J. &Sandri-Goldin, R. M. The HSV-1 ICP27 RGG box specifically binds flexible,GC-rich sequences but not G-quartet structures. Nucleic Acids Res. 37, 7290-7301(2009). 56. Chen, I.-H. B., Li, L., Silva, L. & Sandri-Goldin, R. M.ICP27 Recruits Aly / REF but Not TAP / NXF1 to Herpes Simplex Virus Type 1Transcription Sites although TAP / NXF1 Is Required for ICP27 Export. J. Virol.79, 3949-3961 (2005). 57. Koffa, M. D. et al. Herpes simplex virusICP27 protein provides viral mRNAs with access to the cellular mRNA exportpathway. EMBO J. 20, 5769-5778 (2001). 58. Schwer, B., Visca, P., Vos, J. C. & Stunnenberg, H. G.Discontinuous transcription or RNA processing of vaccinia virus late messengersresults in a 5′ poly(A) leader. Cell 50, 163-169 (1987). 59. Shirokikh, N. E. & Spirin, A. S. Poly(A) leader ofeukaryotic mRNA bypasses the dependence of translation on initiation factors. Proc. Natl. Acad. Sci. U. S. A. 105, 10738- 10743 (2008). 60. Jha, S. et al. Trans-kingdom mimicryunderlies ribosome customization by a poxvirus kinase. Nature 546, 651-655(2017). 61. Finkel, Y. et al. SARS-CoV-2 utilizes a multipronged strategy tosuppress host 2 protein synthesis Introduction. bioRxiv 2020.11.25.398578(2020). doi:10.1101 / 2020.11.25.398578 62. Kim, D., Langmead, B. & Salzberg, S. L. HISAT: A fastspliced aligner with low memory requirements. Nat. Methods 12, 357-360 (2015). 63. Afgan, E. et al. The Galaxy platform for accessible, reproducibleand collaborative biomedical analyses: 2018 update. Nucleic Acids Res. 46, W537-W544(2018). 64. Trapnell, C. et al. Transcript assembly and quantification byRNA-Seq reveals unannotated transcripts and isoform switching during celldifferentiation. Nat. Biotechnol. 28, 511-515 (2010). 65. Graber, T. E., Baird, S. D., Kao, P. N., Mathews, M. B. &Holcik, M. NF45 functions as an IRES trans-acting factor that is required fortranslation of cIAP1 during the unfolded protein response. Cell Death Differ.17, 719-29 (2010). 66. Gandin, V. et al. Polysome fractionation and analysis ofmammalian translatomes on a genome-wide scale. J. Vis. Exp. 1-9 (2014).doi:10.3791 / 51455y.

Claims

1. a) a nucleic acid comprising SEQ ID NO: 1, or a fragment thereof comprising at least 180 nucleotides, or a sequence that is at least 90% identical to SEQ ID NO: 1, a nucleic acid that does not comprise SEQ ID NO:2, SEQ ID NO:3, or both, and the nucleotide sequence does not comprise a fragment of SEQ ID NO:2, SEQ ID NO:3, or both, that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO:1; or b) a nucleic acid comprising SEQ ID NO: 7, or a fragment thereof comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 7, the nucleic acid does not comprise SEQ ID NO:8, SEQ ID NO:9, or both, and the nucleotide sequence does not comprise a fragment of SEQ ID NO:8, SEQ ID NO:9, or both, that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases directly contiguous with the 5' or 3' end of SEQ ID NO:7; or c) a nucleic acid comprising SEQ ID NO: 13, or a fragment thereof comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 13, a nucleic acid that does not comprise SEQ ID NO: 14, SEQ ID NO: 15, or both, and the nucleotide sequence does not comprise a fragment of SEQ ID NO: 14, 15, or both that is at least 1, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotide bases immediately contiguous with the 5' or 3' end of SEQ ID NO: 13; or d) a nucleic acid comprising the RNA counterpart of a); or e) a nucleic acid comprising the RNA counterpart of b); or f) Nucleic acids that include the RNA counterparts of c).

2. 2. The nucleotide sequence of claim 1, wherein the nucleic acid does not contain at least 250, 500, 1000 or more contiguous nucleotides of the entire genome of Human Herpesvirus Type 1, Strain KOS, as defined by NCBI Accession No. JQ673480.1 GI:380776962 or Accession No. JQ780693.1 GI:384597744, or a sequence 95% identical thereto.

3. A second nucleic acid comprising the nucleic acid of claim 1.

4. The nucleic acid of claim 1, which is a synthetic or recombinant nucleic acid.

5. The nucleic acid of claim 1 , which is an expression vector or a plasmid.

6. The nucleic acid of claim 5 , wherein the expression vector or plasmid drives the production of a protein of interest that is heterologous to HSV1.

7. 2. The nucleic acid of claim 1, further comprising a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonuclease or cloning sites, one or more polyadenylation sites, or any combination thereof, wherein at least one or more of the promoter, the nucleotide sequence encoding a protein of interest, the one or more restriction endonuclease or cloning sites, the one or more polyadenylation sites, or any combination thereof, is heterologous to HSV1.

8. 8. The nucleic acid of claim 7, wherein the promoter is located upstream or 5' of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13, or its RNA counterpart.

9. 8. The nucleic acid of claim 7, wherein the nucleotide sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13, or their RNA counterparts.

10. 8. The nucleic acid of claim 7, wherein the promoter is located immediately upstream of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or its RNA counterpart, and the nucleotide sequence encoding the protein of interest is located immediately downstream of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or its RNA counterpart.

11. The nucleic acid according to any one of claims 1 to 10, the nucleotide sequence of which is circular or linear.

12. An RNA nucleic acid defined by the counterpart of the nucleic acid of claim 1.

13. 8. The nucleic acid of claim 7, wherein SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or its RNA counterpart increases translation of a nucleotide sequence encoding a protein of interest in a cell compared to its translation in the absence of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or its RNA counterpart, and wherein the increased translation occurs only if the cell has previously been infected with the HSV1 virus.

14. The nucleic acid of claim 7 , wherein the protein of interest is a reporter protein, a cell regulatory protein, or a cytotoxic protein.

15. a) SEQ ID NO: 1, or a fragment thereof comprising at least 180 nucleotides, or a sequence that is at least 90% identical to SEQ ID NO: 1, or b) SEQ ID NO: 7, or a fragment thereof comprising at least 180 nucleotides, or a sequence that is at least 90% identical to SEQ ID NO: 7, or c) SEQ ID NO: 13, or a fragment thereof comprising at least 180 nucleotides, or a sequence that is at least 90% identical to SEQ ID NO: 13, or d) the RNA counterpart of a); or e) the RNA counterpart of b), or f) the RNA counterpart of c); and A vector comprising a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonuclease or cloning sites, and one or more polyadenylation sites, or any combination thereof.

16. a) SEQ ID NO: 1, or a fragment thereof comprising at least 180 nucleotides, or a sequence that is at least 90% identical to SEQ ID NO: 1; b) SEQ ID NO: 7, or a fragment thereof comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 7; c) SEQ ID NO: 13 or a fragment thereof comprising at least 180 nucleotides, or a sequence at least 90% identical to SEQ ID NO: 13; d) the RNA counterpart of a); e) the RNA counterpart of b), or f) the RNA counterpart of c); and a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonuclease or cloning sites, and one or more polyadenylation sites, or any combination thereof 16. The vector of claim 15, which is a viral vector recombinantly transformed with a heterologous nucleic acid comprising:

17. 17. The viral vector of claim 16, wherein at least one of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, a fragment thereof or an RNA counterpart thereof, a sequence at least 90% identical to SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13 or a fragment thereof comprising at least 180 nucleotides, a promoter, a nucleotide sequence encoding a protein of interest, one or more regulatory sequences, one or more restriction endonuclease or cloning sites, one or more polyadenylation sites, or any combination thereof, is heterologous to the viral vector.

18. 17. The viral vector of claim 16, wherein the vector is a live vector, an attenuated vector, an oncolytic vector, or any combination thereof.

19. The viral vector of claim 16, which is an HSV1 viral vector.

20. The viral vector of claim 19, wherein the HSV1 viral vector is HSV1.

21. A cell comprising the nucleic acid according to any one of claims 1 to 14 or the vector according to any one of claims 15 to 20.

22. 22. The cell of claim 21, which is a mammalian cell infected with the HSV1 virus.

23. The cell of claim 22, wherein the mammalian cell is a cancer cell infected with the HSV1 virus.

24. 22. The cell of claim 21, which, when infected with HSV1 virus, exhibits about a 0.5-fold, about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold or more increase in protein expression, synthesis or production compared to identical control cells lacking the nucleic acid.

25. The nucleic acid of any one of claims 1 to 14, or the vector of any one of claims 15 to 20, or the cell of any one of claims 21 to 24, wherein the nucleic acid is inserted anywhere in HSV1.

26. 25. The nucleic acid of any one of claims 1 to 14, or the vector of any one of claims 15 to 20, or the cell of any one of claims 21 to 24, wherein the nucleic acid is inserted into any restriction site or into the tk locus of HSV1.

27. A nucleic acid according to any one of claims 1 to 14, a vector according to any one of claims 15 to 20, or a cell according to any one of claims 21 to 24, alone or in combination, The composition optionally comprises one or more pharmaceutically acceptable carriers, excipients, or diluents.

28. a) a nucleic acid according to any one of claims 1 to 14, b) a vector according to any one of claims 15 to 20; c) a cell according to any one of claims 21 to 24, d) one or more pharmaceutically acceptable carriers, excipients, or diluents; e) one or more buffers, wash or cell culture media; f) one or more containers for containing a) to e); g) instructions for expressing or enhancing the expression of a protein of interest; h) instructions for using any components of the kit; or Any combination of a) to h) Includes a kit.

29. 1. A method for producing a protein of interest in a cell, comprising: A method comprising the step of administering a nucleic acid to a cell that has been previously infected with HSV1 virus, wherein the nucleic acid comprises: a) a promoter; b) SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or an RNA counterpart thereof; and c) a sequence encoding a protein of interest that is expressed from the nucleic acid in the cell.

30. 1. A method for increasing expression, synthesis, or production of a protein of interest in a cell, comprising: administering a nucleic acid to a cell previously infected with the HSV1 virus, said nucleic acid comprising: a) a promoter; b) SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13, or an RNA counterpart thereof; and c) a sequence encoding a protein of interest to be expressed from said nucleic acid in said cell; The method wherein the increase in expression, synthesis or production of the protein of interest is compared to a similar step of administering the nucleic acid in the absence of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or its RNA counterpart.

31. 31. The method of claim 30, wherein the promoter is located upstream or 5' of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or their RNA counterparts, and the sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or their RNA counterparts.

32. 31. The method of claim 30, wherein the promoter is located immediately upstream of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or an RNA counterpart thereof, and the sequence encoding the protein of interest is located immediately downstream of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or an RNA counterpart thereof.

33. 31. The method of claim 30, wherein the nucleic acid is present in HSV1 and the cell is infected with an HSV1 virus.

34. 31. The method of claim 30, wherein the nucleic acid is in a plasmid or vector.

35. 35. The method of claim 34, wherein the vector is selected from a viral vector, a live viral vector, an oncolytic viral vector, an attenuated viral vector, a recombinant vector, or an amplicon vector.

36. 1. A method of ameliorating or treating a medical condition, cellular defect, or disease in a subject, comprising: administering a nucleic acid to a cell of a subject in need thereof, said cell having been previously infected with the HSV1 virus, said nucleic acid comprising: a) a promoter; b) SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or an RNA counterpart thereof; and c) a sequence encoding a protein of interest that is expressed from said nucleic acid in said cell, said protein of interest ameliorating or treating a medical condition, cellular defect, or disease in the subject; wherein expression, synthesis, or production of said protein of interest in cells of said subject ameliorates or treats a medical condition, cellular defect, or disease in said subject.

37. 37. The method of claim 36, wherein the promoter is located upstream or 5' of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or their RNA counterparts, and the sequence encoding the protein of interest is located downstream or 3' of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or their RNA counterparts.

38. 37. The method of claim 36, wherein the promoter is located immediately upstream of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or an RNA counterpart thereof, and the sequence encoding the protein of interest is located immediately downstream of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or an RNA counterpart thereof.

39. 37. The method of claim 36, wherein the nucleic acid is in HSV1.

40. 40. The method of claim 39, wherein the HSV1 is a live viral vector, an oncolytic viral vector, or an attenuated viral vector.

41. 1. A method of treating cancer in a subject, comprising: administering a nucleic acid to cells of a patient in need thereof, wherein the cells have been previously infected with the HSV1 virus, the nucleic acid comprising: a) a promoter; b) SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or an RNA counterpart thereof, and a sequence encoding a protein of interest that is expressed from the nucleic acid in the cells, wherein the protein of interest is capable of treating cancer in the subject; wherein expression, synthesis, or production of said protein of interest in said patient's cells treats said cancerous condition.

42. 42. The method of claim 41, wherein the cancer is melanoma.

43. 1. A method for improving the efficacy of an existing gene therapy, comprising: modifying a gene delivery vehicle used in said existing gene therapy by inserting a sequence of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or an RNA counterpart thereof, wherein said gene delivery vehicle comprises a sequence encoding a protein of interest; administering the modified gene delivery vehicle to a patient in need thereof, wherein the patient is pre-infected with the HSV1 virus; Including, A method in which transcription of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or its RNA counterpart, increases translation of a sequence encoding a protein of interest, resulting in increased expression, production, or synthesis of the protein of interest compared to its expression, production, or synthesis in the absence of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or its RNA counterpart, thereby improving the effectiveness of gene therapy.

44. 44. The method of claim 43, wherein the increase in expression, production or synthesis of the protein of interest is several fold compared to its expression, production or synthesis in the absence of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or their RNA counterparts.

45. 45. The method of claim 44, wherein the increase in expression, production or synthesis of the protein of interest is 0.5-fold, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold or more.

46. 44. The method of claim 43, wherein the existing gene therapy is oncolytic virus therapy.

47. 44. The method of claim 43, wherein the existing gene therapy is a gene-based immunotherapy.

48. 1. A method for increasing transgene expression in a cell, comprising: administering to the cell a nucleic acid, the cell having been previously infected with HSV1 virus, the nucleic acid comprising: a) a promoter; b) SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or an RNA counterpart thereof; and c) a transgene expressed in the cell from the nucleic acid, the transgene encoding a protein of interest; The method, wherein the increase in expression of the transgene is compared to a similar step of administering the nucleic acid in the absence of SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:13, or an RNA counterpart thereof.