Replication-incompetent herpes simplex virus type 1 vaccine
A modified HSV-1 vaccine addresses the challenge of emerging SARS-CoV-2 variants by incorporating SARS-CoV-2 antigens, inducing broad immune responses and effective neutralizing antibodies.
Patent Information
- Application Number
- JP2025505614
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-08-05
- Filing Date
- 2023-08-04
- Publication Date
- 2025-08-07
AI Technical Summary
Existing vaccines against SARS-CoV-2 and its variants may be less effective due to the emergence of new variants, necessitating a broader immune response against sarbecoviruses.
A replication-incompetent HSV-1 vaccine is developed, modified with deletions and mutations in key genes and incorporating antigens from SARS-CoV-2 and its variants, driven by HSV-1 immediate-early genes, to induce a robust immune response.
The HSV-1 vaccine effectively induces neutralizing antibodies against multiple SARS-CoV-2 variants, providing long-lasting immunity up to six months.
Smart Images

Figure 2025525844000005 
Figure 2025525844000006 
Figure 2025525844000007
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to replication-incompetent herpes simplex virus type 1 (HSV-1) vaccines that deliver at least one antigen from a non-HSV-1 microorganism (e.g., a virus, bacterium, or parasite), particularly replication-incompetent HSV-1 viral vaccines that express a domain of the spike glycoprotein from SARS-Cov, SARS-Cov-2, and their variants. The present disclosure further relates to vaccine compositions comprising the viral vaccine and a pharmaceutically acceptable carrier. The present disclosure further relates to methods for inducing an immune response against a sarbecovirus in a subject. [Background technology]
[0002] Coronavirus disease 2019 (COVID-19) is caused by severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2) or its variants, and its infection in humans leads to mild or severe clinical symptoms primarily affecting the respiratory system. SARS-Cov-2 contains the spike (S) glycoprotein on its surface, which is the primary target of current vaccine research and development, because antibodies against this protein can neutralize infection. Vaccines based on the S glycoprotein and its antigenic domains and epitopes have already been developed by various companies and academic institutions, and these vaccines have proven effective in generating neutralizing antibodies. However, the emergence of new SARS-Cov-2 variants may affect vaccine efficacy. Given the ongoing evolution of the virus, a sarbecovirus vaccine is desirable. Summary of the Invention
[0003] A first aspect of the present disclosure relates to a replication-incompetent herpes simplex virus type 1 (HSV-1) viral vaccine comprising a modified HSV-1 genome and at least one antigen, wherein the modification includes a deletion of an internal inverted repeat region leading to deletion of each copy of a double copy gene including ICP0, ICP34.5, ICP4, and latency-associated transcript (LAT), an inactivating mutation in ICP47, and an inactivating mutation in another copy of ICP4 in the long terminal repeat, and wherein the first of the at least one antigen is driven by a promoter of a wild-type HSV-1 immediate-early gene.
[0004] In some embodiments, the immediate early gene of wild-type HSV-1 is ICP0, ICP27, ICP4, ICP22, or ICP47. In some embodiments, the immediate early gene of wild-type HSV-1 is ICP4.
[0005] In some embodiments, the inactivating mutation in the other copy of ICP4 in the long terminal repeat is a deletion in the coding sequence of ICP4. In some embodiments in which the deletion occurs in the ICP4 coding sequence, a first antigen of the at least one antigen is operably linked to a promoter of ICP4 in the long terminal repeat.
[0006] In some embodiments, a first of the at least one antigen is inserted with a driving promoter at a position corresponding to the deleted internal inverted repeat region.
[0007] In any of the above embodiments, the replication-incompetent HSV-1 virus vaccine further comprises a second antigen fused to the first HSV-1 glycoprotein.
[0008] In any of the above embodiments, the replication-incompetent HSV-1 virus vaccine further comprises a third antigen fused to the second HSV-1 glycoprotein.
[0009] In some embodiments, the first HSV-1 glycoprotein or the second HSV-1 glycoprotein is glycoprotein gC or gE.
[0010] In some embodiments, glycoprotein gC is altered to inactivate C3 binding and glycoprotein gE is altered to inactivate FcR binding, hi some embodiments, glycoprotein gC comprises a deletion in the C3 binding domain and glycoprotein gE comprises a deletion in the FcR binding domain.
[0011] In some embodiments, the first antigen is linked at its N-terminus to the glycoprotein gB or gD signal peptide and at its C-terminus to the transmembrane domain of glycoprotein gB or gD within the viral particle.
[0012] In some embodiments, the first antigen, the second antigen, or the third antigen is derived from a virus, bacterium, or parasite. In some embodiments, the first antigen, the second antigen, and the third antigen are derived from a sarbecovirus. In some embodiments, the first antigen, the second antigen, and the third antigen are derived from SARS-Cov, SARS-Cov-2, and variants thereof. In some embodiments, the first antigen is derived from a delta or omicron variant of SARS-Cov-2, and the second antigen and the third antigen are derived from SARS-Cov, SARS-Cov-2, and variants thereof. In some embodiments, the first antigen is derived from a delta variant of SARS-Cov-2, the second antigen is derived from the SARS-Cov Tor2 strain, and the third antigen is derived from the SARS-Cov-2 Wuhan-Hu-1 strain.
[0013] In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of the delta variant of SARS-CoV-2, or an immunogenically equivalent variant thereof. In some embodiments, the extracellular domain or an immunogenically equivalent variant thereof is linked at the N-terminus to the glycoprotein gB signal peptide and at the C-terminus to the transmembrane-intramembrane domain of glycoprotein gB. In some embodiments, the immunogenically equivalent variant of the extracellular domain has the K986P / V987P mutation and / or the 682-GSAS-685 mutation.
[0014] In some embodiments, one of the second antigen and the third antigen is the receptor-binding domain of the spike glycoprotein of the SARS-Cov Tor2 strain, and the other is the N-terminal domain of the spike glycoprotein of the SARS-Cov-2 Wuhan-Hu-1 strain, or an immunogenic equivalent variant thereof.
[0015] In some embodiments, the second antigen is the receptor-binding domain of the spike glycoprotein of the SARS-CoV Tor2 strain or an immunogenically equivalent variant thereof, and the first HSV-1 glycoprotein is glycoprotein gC. In some embodiments, the receptor-binding domain or an immunogenically equivalent variant thereof is fused to glycoprotein gC to replace its C3-binding domain.
[0016] In some embodiments, the second antigen is the N-terminal domain of the spike glycoprotein of the SARS-Cov-2 Wuhan-Hu-1 strain or an immunogenic equivalent variant thereof, and the first HSV-1 glycoprotein is glycoprotein gE. In some embodiments, the N-terminal domain of the spike glycoprotein of the SARS-Cov-2 Wuhan-Hu-1 strain or an immunogenic equivalent variant thereof is fused to glycoprotein gE to replace the FcR binding domain.
[0017] In some embodiments, the inactivating mutation in ICP47 is a deletion in the coding sequence of ICP47.
[0018] In some embodiments, the inverted internal repeat region is replaced with three repeats of a promoter (eg, a CMV, EF1α, CAG, or UbC promoter) followed by a stop codon.
[0019] In some embodiments, the modified genome comprises one copy of ICP0, LAT and ICP34.5, UL1-UL56 and US1-US11.
[0020] Another aspect of the present disclosure relates to a vaccine composition comprising a replication-incompetent HSV-1 virus vaccine disclosed herein and a pharmaceutically acceptable carrier.
[0021] Another aspect of the present disclosure relates to a method of inducing an immune response in a subject, comprising administering to the subject a pharmaceutically effective amount of a viral vaccine disclosed herein. [Brief explanation of the drawings]
[0022] [Figure 1] Schematic diagrams of the HSV-1(F), MVR-ΔIR4, and MVR-ΔIR47 genomes are shown.
[0023] [Figure 2] This shows that MVR-ΔIR4 and MVR-ΔIR47 viruses can only replicate in the ICP4-complementing cell line E5.
[0024] [Figure 3] 1 shows a model for constructing a non-replicating HSV-1-based sarbecovirus spike protein vaccine virus.
[0025] [Figure 4] Schematic diagrams of the MVR-ΔIR47, MVR-S-gB, or MVR-S-gD genomes are shown.
[0026] [Figure 5] The structure of the gC-SRBD chimera in which amino acids 275 to 367 in the gC protein are replaced with the RBD domain of the SARS coronavirus Tor2 (SARS Tor2) spike is shown.
[0027] [Figure 6] Figure 1 shows the structure of the gE-SNTD chimera in which amino acids 237–382 in the gE protein were replaced with the NTD domain of SARS-Cov-2 WT Wuhan-Hu-1 spike.
[0028] [Figure 7] 1 shows the structure of a gB-SECTO chimera in which SECTO is linked to the transmembrane domain and cytoplasmic tail region (TM / CT) of the gB protein.
[0029] [Figure 8] 1 shows the structure of a gD-SECTO chimera in which SECTO is linked to the transmembrane domain and cytoplasmic tail region (TM / CT) of the gD protein.
[0030] [Figure 9] 1 shows the accumulation of gC, gC-SRBD, gE-SNTD, gB-SECTO, or gD-SECTO proteins in E5 cells infected with MVR-S-gB and MVR-S-gD.
[0031] [Figure 10] 1 shows the accumulation of representative viral proteins of HSV-1 in E5 and Vero cells infected with MVR-S-gB virus.
[0032] [Figure 11] 1 shows the animal immunization design.
[0033] [Figure 12-1]Microneutralization assays using HIV-based pseudotyped viruses are shown. ACE2-Fc represents a positive control, a fusion protein consisting of the ACE2 functional domain and a human Fc fragment. All groups immunized with MVR-S-gB induced neutralizing antibodies against the Wuhan-Hu-1 strain (Figure 12A) and the Delta strain (Figure 12B) in a dose-dependent manner. Groups immunized with 4x106 or 2x107 PFU of MVR-S-gB induced neutralizing antibodies against the Omicron BA1 strain (Figure 12C). [Figure 12-2] Same as above
[0034] [Figure 13] This shows that the MVR-S-gB vaccine can induce neutralizing antibodies that last for at least 6 months. Serum samples for pseudotype virus neutralization assays are collected 3 months (Figure 13A) and 6 months (Figure 13B) after the third immunization. DETAILED DESCRIPTION OF THE INVENTION
[0035] definition
[0036] As used herein, the term "antigen" refers to a molecule that induces an immune response and elicits the production of antibodies. Typical antigens are proteins, extracellular domains, or portions thereof present on the surface of pathogens such as bacteria, fungi, viruses, and other foreign particles. When these harmful substances enter the body, they induce an immune response in the body and produce antibodies. The "antigen" included in the viral vaccine of the present disclosure is not intended to include HSV-1 antigens. That is, the antigen of the present disclosure is a non-HSV-1 protein, extracellular domain, or fragment thereof.
[0037] "Inactivating mutation" refers to any mutation in the genomic DNA sequence of a target gene that results in the inactivation, non-functionality, or absence of the target gene, including, but not limited to, the insertion, deletion, or substitution of one or more nucleic acids into the genomic DNA sequence of the target gene, particularly into the coding sequence of the gene of interest. In some embodiments, the inactivating mutation reduces or eliminates mRNA transcription, thereby reducing or eliminating the expression level of the encoded mRNA transcript and protein. In some embodiments, the inactivating mutation reduces or inhibits mRNA translation, thereby reducing the expression level of the encoded protein. In some embodiments, the inactivating mutation encodes a modified protein that has reduced or altered function compared to the unmodified (i.e., wild-type) form of the protein. For example, an inactivating mutation in ICP47 can include a deletion of the coding sequence (CDS) of the ICP47 gene or a substitution of one or more nucleic acids in the CDS of the ICP47 gene, resulting in the production of a non-functional ICP47 protein. For example, an inactivating mutation in ICP4 can include a deletion in the coding sequence (CDS) of the ICP4 gene or a substitution of one or more nucleic acids in the CDS of the ICP4 gene, which leads to the production of a non-functional ICP4 protein.
[0038] The term "deletion in a coding sequence" refers to the deletion of a fragment of a coding sequence or the deletion of the entire coding sequence. In some embodiments, the deletion in a coding sequence results in the deletion of the coding sequence. In some embodiments, the deletion in a coding sequence does not result in the deletion of regulatory elements of the corresponding gene (e.g., promoter sequences, enhancer sequences, ribosome binding sites, or transcription terminators).
[0039] The term "fused" means that components (e.g., NTD domain, RBD domain, and signal peptide) are linked directly by a peptide bond or via one or more peptide linkers. The term "fused to" means that a smaller component (e.g., NTD domain) is linked by a peptide bond to a larger component (e.g., the extracellular domain of an HSV-1 glycoprotein such as gC or gE) at one terminus (N-terminus or C-terminus) or anywhere between the latter. In some embodiments, an intermediate fragment of the larger component is substituted for the smaller component.
[0040] By "signal peptide" of a glycoprotein (e.g., gB or gD) is meant the signal peptide of the corresponding HSV-1 glycoprotein, either naturally occurring or having one or more conservative mutations compared to the parent sequence.
[0041] "Transmembrane-intracyloid domain" means that the transmembrane and intracranial domains (the intracranial domains are also referred to herein as cytoplasmic tail regions) are directly linked to each other, as occurs in nature, or indirectly linked by a suitable peptide linker.
[0042] As used herein, "HSV-1 glycoprotein" refers to the 12 to 13 virally encoded glycoproteins on the HSV-1 viral envelope that aid in the interaction of the virus with target cells. Of the 12 or more glycoproteins present on the HSV-1 viral envelope, the synergistic action of five glycoproteins (gC, gD, gB, and the heterodimer gH and gL) is required for viral entry into target cells. gC and gB independently interact with heparan sulfate proteoglycans on the cell surface to mediate initial viral binding. In the absence of both gB and gC, viral binding to the cell surface is greatly reduced.
[0043] Glycoprotein gB is the most conserved entry glycoprotein among herpesviruses, with approximately 50% amino acid sequence identity within each subfamily. gB is a type I transmembrane protein consisting of a signal peptide, a large extracellular domain, a single-span TM, a membrane-proximal region (MPR), and a long CTD containing over 90 residues. gB is a bona fide herpesvirus fusion protein. The initial evidence that gB is involved in membrane fusion came from the observation that syncytial HSV-1 strains harbor mutations in the gB gene. The first crystal structure of gB from HSV-1 provided the most direct evidence that it is a bona fide herpesvirus fusion protein. Despite a lack of sequence conservation and significant size differences (approximately 700 aa and 400 aa), the HSV-1 gB extracellular domain was shown to share conserved secondary, tertiary, and quaternary structures with the fusion protein G of another unrelated vesicular stomatitis virus (VSV). The structures of the gB extracellular domains from the alpha-herpesviruses HSV-1 and PrV, the beta-herpesvirus human cytomegalovirus (HCMV), and the gamma-herpesvirus EBV have been determined, revealing a highly conserved fold. The full-length gB amino acid sequences are available from UniProtKB / Swiss-Prot:P06437.2 (KOS strain), UniProtKB / Swiss-Prot:P06436.1 (F strain), UniProtKB / Swiss-Prot:P10211.1 (17 strain), and others.
[0044] Exemplary sequences of the signal peptide of gB are aa1 to aa30 of UniProtKB / Swiss-Prot:P06437.2, aa1 to aa29 of UniProtKB / Swiss-Prot:P06436.1 or aa1 to aa30 of UniProtKB / Swiss-Prot:P10211.1.
[0045] Exemplary transmembrane domains of gB within the virion are aa775 to aa904 of UniProtKB / Swiss-Prot:P06437.2, aa774 to aa903 of UniProtKB / Swiss-Prot:P06436.1 or aa775 to aa904 of UniProtKB / Swiss-Prot:P10211.1.
[0046] Glycoprotein gD is the major receptor-binding glycoprotein and binds to three classes of cellular receptors: (1) herpesvirus entry mediator (HVEM), a member of the TNF receptor family; (2) nectin-1 and nectin-2, members of the immunoglobulin superfamily; and (3) 3-O-sulfated heparan sulfate. Binding of gD to one of these receptors initiates conformational changes mediated by gB, gD, gH, and gL, triggering fusion between the virion envelope and the cellular membrane. The full-length gD amino acid sequence can be obtained from UniProtKB / Swiss-Prot:P57083.1 (strain Patton), UniProtKB / Swiss-Prot:Q05059.1 (strain F), UniProtKB / Swiss-Prot:A1Z0Q5.2 (strain KOS), and UniProtKB / Swiss-Prot:Q69091.1 (strain 17).
[0047] Exemplary sequences of the signal peptide of gD are aa1 to aa25 of UniProtKB / Swiss-Prot:P57083.1, aa1 to aa25 of UniProtKB / Swiss-Prot:Q05059.1, aa1 to aa25 of UniProtKB / Swiss-Prot:A1Z0Q5.2 or aa1 to aa25 of UniProtKB / Swiss-Prot:Q69091.1.
[0048] Exemplary transmembrane domains of gD within the virion are aa340 to aa394 of UniProtKB / Swiss-Prot:P57083.1, aa341 to aa394 of UniProtKB / Swiss-Prot:Q05059.1, aa341 to aa394 of UniProtKB / Swiss-Prot:A1Z0Q5.2 or aa341 to aa394 of UniProtKB / Swiss-Prot:Q69091.1.
[0049] The glycoprotein gE functions as a receptor (FcγR) for the Fc portion of immunoglobulin G (IgG) and plays a role in cell-to-cell spread of the virus. gE interacts with glycoprotein gI to form a noncovalent heterodimeric complex, enhancing Fc-binding affinity, such that the gE-gI complex binds to IgG monomers, whereas gE alone binds to IgG aggregates but not to monomers. Functions assigned to the IgG Fc domain include activation of the classical complement pathway and binding to FcγR-expressing immune effector cells. In vitro studies elucidating the function of HSV-1 FcγR demonstrated that FcγR protects the virus from the effects of antibody-dependent complement neutralization, antibody-dependent cellular cytotoxicity (ADCC), and Fc-mediated granulocyte attachment to HSV-1-infected cells. HSV-1 gE is required for effective spread of the virus from one epithelial cell to another and from epithelial cells to neurons. HSV-1 gE also mediates targeting of the capsid, tegument, and viral glycoproteins from the neuronal cell body to axons. Partially overlapping gE domains mediate FcγR activity and spreading, making it challenging to separate these functions. The complete amino acid sequences of gE from different HSV-1 strains are available from GenBank ADD60055.1 (F strain), UniProtKB / Swiss-Prot:P04488.1 (17 strains), GenBank:AFE62896.1 (KOS strain), etc.
[0050] Residues 235 to 380 of wild-type gE form a continuous IgG aggregate-binding domain and are essential for FcR activity. The "FcR-binding domain" of gE refers to the region between amino acids 235 and 380 in the case of HSV-1 F strain (GenBank ADD60055.1), or to the region plus adjacent sequences (e.g., one or more residues at the N-terminus or C-terminus, e.g., 1 to 10 residues). A "deletion in the FcR-binding domain" refers to the deletion of a fragment or the entire FcR-binding domain. For example, a fragment from aa 280 to aa 286 or a fragment from aa 299 to aa 306 located within the FcR-binding domain is deleted. Correspondingly, the term "inactivating FcR binding" refers to the loss of the FcR-binding function of the gE glycoprotein. This can be achieved by deletion of the FcR-binding domain or by insertion or substitution of one or more nucleotides in the coding sequence for the FcR-binding domain.
[0051] HSV-1 glycoprotein C binds to complement component C3b and inhibits the interaction of C3b with C5 and properdin (P), thereby blocking activation of the classical and alternative complement pathways. HSV-1 gC prevents complement-mediated neutralization of cell-free virus, inhibits complement-mediated lysis of infected cells, and contributes to the production of virulence in vivo, because viruses defective in binding to C3b or that block the interaction of C5 and P with C3b are more attenuated than wild-type virus in a mouse flank infection model. The complete amino acid sequences of gC of different HSV-1 strains can be obtained from GenBank ADD60042.1 (F strain), GenBank: AKM76368.1 (17+ strain), GenBank: AAA45779.1 (macroplaque strain), GenBank: CAB40083.1 (HSZP strain), GenBank: AFH78104.1 (McKrae strain), etc.
[0052] Wild-type gC has four C3-binding regions: binding region I (aa 124-137), II (aa 276-292), III (aa 339-366), and IV (aa 223-246), each of which is essential for C3 binding. The term "C3-binding domain" refers to any one of the four binding regions or a combination thereof. That is, a C3-binding domain can be binding region I, binding region II, binding region III, binding region IV, binding region II / III, binding region IV / II, binding region II / III / IV, binding region I / IV, binding region I / IV / II, or binding region I / II / III / IV. When two or more binding regions are designated, this is meant to include the amino acids between the two or more binding regions. For example, binding region II / III is intended to include binding regions II and III and amino acids 293-338 between the two regions. Thus, a deletion in the C3-binding domain or a grammatical variant thereof refers to a deletion of any one of regions I to IV or a combination thereof. For example, a deletion in the C3-binding domain can be a deletion of binding region I, II, III, or IV. Alternatively, a deletion in the C3-binding domain can be a deletion of binding region II / III, IV / II, I / IV, IV / II / III, or I / IV / II / III. The deletion occurs in the region from aa 124 to aa 366 of wild-type gC. In a preferred embodiment, the deletion in the C3-binding domain is a deletion of binding region II / III (i.e., aa 276 to aa 366). Correspondingly, the term "inactivating C3 binding" refers to a genome manipulation to inactivate any one of binding regions I to IV or a combination thereof. The manipulation can be an insertion, deletion, or substitution of one or more nucleotides in the coding sequence of binding regions I to IV.
[0053] The term "sarbecovirus" refers to a subgenus of viruses that includes SARS-CoV, SARS-CoV-2, and various variants. See Schoch CL et al., NCBI Taxonomy: A Comprehensive Update on Curation, Resources, and Tools, Database (Oxford), 2020:baaa062, PubMed:32761142, PMC:PMC7408187 (also see https: / / www.ncbi.nlm.nih.gov / Taxonomy / Browser / wwwtax.cgi?mode=Undef&id=2509511&lvl=3&lin=f, last accessed July 20, 2022). The sarbecoviruses SARS and SARS-CoV-2 can cause severe pulmonary disease, characterized by diarrhea and fecal shedding, respectively. In both cases, comorbid conditions and age increase the risk of severe disease. SARS-CoV-2 also infects the upper respiratory tract and has an overall lower mortality rate than SARS-CoV (though in severe cases, mortality is comparable to SARS). SARS-CoV-2 infection is associated with COVID-19 sequelae. Vaccination goals should include severe disease and COVID-19 sequelae. As more coronaviruses are identified, the large amount of genetic diversity among these viruses increases the difficulty of developing vaccines that provide broad immunity against these viruses. Climate change may alter the diversity and potential spread of additional sarbecoviruses to humans, most of which are host-resident in bats. Entirely novel coronaviruses may emerge in humans as a result of mutations or changes in contact between humans and infected vectors or hosts (potentially influenced by changes in weather or animal exposure). Animal reservoirs present both a challenge and an opportunity for control.
[0054] A "pan-sarbecovirus vaccine" is a vaccine that induces an immune response against one or more sarbecoviruses or their variants in a subject administered the vaccine. It is an object of the present disclosure to provide a pan-sarbecovirus vaccine that delivers antigens from one or more sarbecoviruses using a single, replication-incompetent HSV-1 vector. It is contemplated that the HSV-1 vector can also be used as a vaccine platform to deliver a single antigen or antigens from viruses other than sarbecoviruses.
[0055] Severe acute respiratory syndrome (SARS) is a novel infectious disease first discovered in the 21st century. A global effort coordinated by the WHO identified a novel coronavirus, SARS-coronavirus (SARS-CoV, also known as SARS-CoV-1 or SARS coronavirus), in April 2003, which is responsible for causing a major epidemic. SARS-CoV is an enveloped, single-stranded, and positive-sense RNA virus. Its genomic RNA encodes nonstructural replicase polyproteins and structural proteins, including spike (S), envelope (E), membrane (M), and nucleocapsid (N) proteins. While neutralizing antibodies and / or T cell immune responses can be generated directly against several SARS-CoV proteins, they primarily target the S protein, indicating that S-protein-induced specific immune responses play an important role in combating SARS-CoV infection. The SARS-CoV spike consists of a trimer of S protein. The SARS-CoV S protein encodes a surface glycoprotein precursor, predicted to be 1,255 amino acids long, with the amino terminus and majority of the protein located on the cell surface or exterior of the virus particle. The predicted S protein consists of an N-terminal signal peptide (amino acids 1-12), an extracellular domain (amino acids 13-1,195), a transmembrane domain (amino acids 1,196-1,215), and an intracellular domain (amino acids 1,216-1,255). Similar to other coronaviruses, the SARS-CoV S protein can be cleaved into S1 and S2 subunits by proteases (e.g., trypsin, factor Xa, and cathepsin L). Angiotensin-converting enzyme 2 (ACE2) has been identified as the receptor for SARS-CoV. The fragment located in the S1 subunit and spanning amino acids 318-510 is the minimal receptor-binding domain (RBD). Crystallographic studies have already shown the structure of the RBD in complex with its receptor, ACE2.
[0056] The SARS-CoV S protein plays an important role in viral infection and pathogenesis. S1 recognizes and binds to host receptors, and then a conformational change in S2 promotes fusion of the viral envelope with the host cell membrane. The RBD in S1 is responsible for binding between the virus and the host cell receptor. K341 of ACE2 and R453 of the RBD are important for complex formation. N479 and T487 of the RBD are important for high-affinity binding of the S protein to ACE2. An exemplary amino acid sequence of the SARS-CoV RBD domain can be obtained from the NCBI reference sequence: YP_009825051.1, aa306 to aa527.
[0057] Coronavirus disease 2019 (COVID-19) is caused by severe acute respiratory syndrome coronavirus type 2 (SARS-Cov-2), infection of which in humans results in mild or severe clinical symptoms primarily affecting the respiratory system. SARS-Cov-2 contains a spike (herein also referred to as spike glycoprotein, "S," S glycoprotein, or spike) glycoprotein on its surface, which is a primary target of current vaccine research and development because antibodies against this protein can neutralize infection. This protein is responsible for anchoring to the host receptor angiotensin-converting enzyme 2 (ACE2).
[0058] The S glycoprotein is responsible for virus entry into host cells and initiates their spread within them. It can also be recognized by the immune system and induce a protective response, which is the primary goal of vaccines. The viral S glycoprotein enters a metastable prefusion state through the noncovalent association of subunits 1 and 2 (S1 and S2). The S1 subunit of S consists of 672 amino acids (residues 14–685) and contains four domains: the N-terminal domain (NTD), the receptor-binding domain (RBD), and subdomains 1 and 2 (SD1 and SD2). The RBD has attracted more attention because it is recognized as an intermediate factor in virus-host cell interactions through the interaction of its receptor-binding motif (RBM) with angiotensin-converting enzyme 2 (ACE2) on host cells. Binding of the RBM to the ACE2 receptor is crucial for the viral infection process, and this interaction has been shown to transform S from a metastable prefusion state to a more stable postfusion state, which is required for virus-host cell membrane fusion. The S2 subunit consists of 588 amino acids (residues 686-1273) and contains an N-terminal fusion peptide (FP) and two heptad repeats (HR1 and HR2) that mediate the association of the S2 subunit with the host membrane. The S2 subunit also contains a transmembrane domain (TM) and a tail region within the virus particle that attaches the S glycoprotein to the viral membrane.
[0059] An exemplary NTD amino acid sequence of the S glycoprotein of SARS-Cov-2 can be obtained from UniProtKB / Swiss-Prot:P0DTC2.1, aa 13 to aa 304. An exemplary RBD amino acid sequence of the S glycoprotein of SARS-Cov-2 can be obtained from UniProtKB / Swiss-Prot:P0DTC2.1, aa 319 to aa 541.
[0060] As used herein, the terms "replication-incompetent," "replication-defective," or "non-replicating" have a general meaning, such as a virus whose genome has been modified to render it incapable of propagation. Thus, once such a recombinant virus infects a cell, the only process it can follow is to express any viral and heterologous proteins contained within its genome. In specific embodiments, the replication-defective viruses provided herein may contain genes encoding nonstructural proteins and be self-sufficient for RNA transcription and gene expression. However, because these vectors lack genes encoding structural proteins, they require a helper genome to enable their packaging into infectious particles. In the present disclosure, replication-incompetent viruses lack two copies of ICP4. This can be achieved, for example, by deleting the coding sequence for one copy of ICP4 in the internal inverted repeat and terminal repeat sequences where one copy of ICP4 resides.
[0061] As used herein, the term "immunogenically equivalent variant" refers to a variant that has one or more conservative mutations compared to a reference antigen but retains the immunogenicity of the reference antigen. Immunogenically equivalent variants retain one or more or all epitopes of the reference antigen. In some embodiments, immunogenically equivalent variants retain all epitopes of the reference antigen.
[0062] A "conservative mutation" refers to one or more changes from an amino acid residue to a homologous residue (e.g., an isoleucine to leucine change, an asparagine to glutamic acid change, or a cysteine to serine change) that are not expected to significantly interfere with the protein. Additionally, nucleotide or amino acid substitutions, deletions, or insertions that result in conservative mutations or changes in "non-essential" amino acid regions can be made. For example, a polypeptide or amino acid sequence derived from a designated protein can be identical to the starting sequence except for one or more individual amino acid substitutions, insertions, or deletions, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more individual amino acid substitutions, insertions, or deletions. In certain embodiments, a polypeptide or amino acid sequence derived from a designated protein has 1 to 5, 1 to 10, 1 to 15, or 1 to 20 individual amino acid substitutions, insertions, or deletions relative to the starting sequence.
[0063] As used herein, "adjuvant" refers to a component used in vaccine compositions that helps generate a stronger immune response in vaccinated humans. Adjuvants help the body generate an immune response strong enough to protect humans from the effects of the disease for which the vaccine was administered. Adjuvanted vaccines may cause more local reactions (e.g., redness, swelling, and pain at the injection site) and more systemic reactions (e.g., fever, chills, and body aches) than non-adjuvanted vaccines. Aluminum salts, such as aluminum hydroxide, aluminum phosphate, and aluminum potassium sulfate, have been safely used in vaccines for over 70 years. Aluminum-containing adjuvants are vaccine components that have been used in vaccines since the 1930s. Small amounts of aluminum are added to help develop stronger immunity against bacteria in vaccines. Aluminum is one of the most common metals found in nature and is present in air, food, and water. Scientific studies have shown that humans who follow recommended vaccine protocols are exposed to low amounts of aluminum and are poorly absorbed by the body. Monophosphoryl lipid A (MPL) has been used in the US vaccine (Cervarix®) since 2009, but due to low demand, this vaccine is no longer used in the United States. This immune-enhancing substance is isolated from the surface of bacteria. MF59 is the adjuvant included in Fluad (an influenza vaccine licensed for use in adults 65 years of age and older). MF59 is an oil-in-water emulsion composed of squalene, a naturally occurring oil found in many plant and animal cells and in humans. MF59 has been used in influenza vaccines in Europe since 1997 and in the United States since 2016, with millions of vaccinations and an excellent safety record. AS01B is an adjuvant suspension used with the antigen component of the Shingrix vaccine. Shingrix is a recombinant varicella-zoster vaccine recommended for use in people 50 years of age and older.AS01B is composed of monophosphoryl lipid A (MPL), an immune-enhancing substance isolated from the surface of bacteria, and QS-21, a natural compound extracted from the Chilean soap tree (Quillaja saponaria Molina). In pre-approved clinical trials, AS01B has been associated with local and systemic reactions, but its overall safety profile is encouraging. AS01B is also a component of vaccines being tested in clinical trials, including malaria and HIV vaccines. To date, these trials have involved more than 15,000 participants. CpG1018 is the adjuvant used in the recently developed Heplisav-B vaccine. It is a synthetic form of DNA consisting of cytosinephosphoguanine (CpG) motifs, mimicking the genetic material of bacteria and viruses. The inclusion of CpG1018 in a vaccine enhances the body's immune response. In pre-approved clinical trials, adverse events following vaccination with Heplisav-B were comparable to those observed following vaccination with another non-adjuvanted hepatitis B vaccine approved in the United States.
[0064] As used herein, the term "antigen" refers to a substance, usually a protein, that is capable of inducing an immune response in a subject. The term also refers to a protein that is immunoreactive in the sense that it is capable of eliciting a humoral and / or cellular immune response against the protein once administered to a subject (either directly or by administering to the subject a nucleotide sequence or vector encoding the protein).
[0065] "Subject" or "individual" or "animal" or "patient" or "mammal" refers to any subject, particularly a mammalian subject, in need of diagnosis, prognosis, or treatment. Mammalian subjects include humans, livestock, farm animals, and zoo, sport, or pet animals, such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, and dairy cows.
[0066] HSV-1 virus vaccine
[0067] The HSV-1 genome consists of two covalently linked components, designated L and S. Each component consists of a unique sequence whose lateral fins are inverted repeats (UL for the L component and US for the S component). The inverted repeats of the L component are designated ab and b'a'. The inverted repeats of the S component are designated a'c' and ca. The inverted repeat region contains duplicated transcription units. At least five open reading frames with duplicated copies are known in the art, and the proteins are designated ICP0, ICP4, ICP34.5, ORF P, and ORF O, respectively. The inverted repeat b'a' is linked to a'c' (b'a'-a'c') to form an internal inverted repeat region or internal inverted repeat. Conversely, the inverted repeats ab and ca are referred to herein as terminal repeat regions or terminal repeats.
[0068] One aspect of the present disclosure relates to a replication-incompetent herpes simplex virus type 1 (HSV-1) viral vaccine, the replication-incompetent HSV-1 viral vaccine comprising a modified HSV-1 genome and at least one antigen, the modification including a deletion of an internal inverted repeat region, resulting in a deletion of each copy of a dual copy gene including ICP0, ICP34.5, ICP4, and latency-associated transcript (LAT), an inactivating mutation in ICP47, and an inactivating mutation in another copy of ICP4 in the long terminal repeat, and a first antigen of the at least one antigen is driven by a promoter of a wild-type HSV-1 immediate-early gene.
[0069] In some embodiments, deletion of the internal inverted repeat region results in excision of nucleotides 117005-132096 in the genome of HSV-1 strain F, which is available under GenBank accession number GU734771.1. Those skilled in the art will appreciate that the exact start and end positions of the nucleotides deleted according to the present disclosure will depend on the strain and genome isoform of the HSV-1 virus and can be readily determined using techniques known in the art. It should be understood that the present disclosure is not intended to be limited to any particular genome isoform or strain of the HSV-1 virus. Those skilled in the art will also appreciate that other strains are possible, so long as the genomic DNA is sequenced. Sequencing techniques are readily available in the literature and commercially available. For example, in another embodiment, deletions can be made in HSV-1 strain 17, whose genome is available under GenBank accession number NC_001806.2. In another embodiment, deletions can be made on strain KOS 1.1, whose genome can be obtained under GenBank accession number KT899744. Note that the majority of the deleted sequence does not encode proteins, but rather repetitive non-coding sequences located in the intervals between the deleted regions, such as the ICP0 intron, the LAT domain, the "a" sequence, etc. Deletion of the internal inverted repeat region results in the deletion of one copy each of ICP0, LAT, ICP4, ICP34.5, ORF P, and ORF O.
[0070] In some embodiments, the inactivating mutation in ICP47 (also referred to as US12) is a deletion of the coding sequence of ICP47. For example, in one embodiment, the deletion of the coding sequence of ICP47 is a deletion of nucleotides 145152 to 145418 in the genome of HSV-1 strain F (GenBank: GU734771.1). In some embodiments, the inactivating mutation in ICP47 is a deletion of the gene ICP47. For example, in one embodiment, the deletion of the coding sequence of ICP47 is a deletion of nucleotides 143988 to 146011 in the genome of HSV-1 strain F (GenBank: GU734771.1). In some embodiments, the inactivating mutation in ICP47 overlaps with the nucleotide sequence 145152-145418 in the genome of HSV-1 strain F (GenBank: GU734771.1), but is a deletion of a nucleotide fragment within nucleotides 143988-146011. For example, the deleted sequence begins at any nucleotide after 143988 and ends within 145152-145418 of HSV-1 strain F (GenBank: GU734771.1), or begins at any nucleotide within 145152-145418 and ends before 146011. One skilled in the art will understand that the specific start and end positions of the deletion may vary when using different strains (e.g., KOS, 17, etc.) or different isomers and can be determined depending on the sequence information available from the GenBank database.
[0071] In some embodiments, an inactivating mutation in ICP47 is an insertion, deletion, or substitution of a nucleotide in the coding sequence of ICP47 that results in a missense mutation, thereby producing a non-functional ICP47 protein. In some embodiments, an inactivating mutation in ICP47 is an insertion, deletion, or substitution of a nucleotide in the regulatory sequence of ICP47 that inactivates one of the regulatory elements (e.g., the promoter) so as to terminate, attenuate, or inactivate the transcription or translation process of ICP47.
[0072] In the present disclosure, inactivating mutations in ICP47 lead to reduced or complete elimination of ICP47 protein levels, which promotes antigen presentation and favors immune responses to the vaccines of the present disclosure. ICP47 inhibits the transporter involved in antigen presentation, thereby inhibiting CD8+ T cell recognition of infected cells. HSV-1 ICP47 - The mutant is less neurovirulent than wild-type HSV-1 in mice. - The reduced neurovirulence of the mutant is due to a protective CD8+ T cell response. Compared to the wild-type virus, ICP47 - The mutants exhibit reduced neurovirulence in immunologically normal mice and in T cell-deficient nude mice after reconstitution with CD8+ T cells. However, ICP47 - The mutant exhibits normal neurovirulence in mice acutely depleted of CD8+ T cells and in nude mice either unreconstituted or reconstituted with CD4+ T cells. In contrast, depletion of CD8+ T cells inhibits the neurovirulence of an unrelated attenuated HSV-1 gE - Does not increase neurovirulence of mutants. ICP47 is the first viral protein shown to affect neurovirulence by inhibiting CD8+ T cell protection.
[0073] In the present disclosure, an inactivating mutation in another copy of ICP4 in the terminal repeat sequence leads to reduced or complete elimination of ICP4 protein levels. This can be achieved by techniques known in the art. For example, in some embodiments, the inactivating mutation is an insertion, deletion, or substitution of nucleotides in the coding sequence of ICP4 that results in a missense mutation, thereby producing a non-functional ICP4 protein. In some embodiments, the inactivating mutation in ICP4 is an insertion, deletion, or substitution of nucleotides in the regulatory sequence of ICP4 that inactivates one of the regulatory elements (e.g., a promoter) to terminate, weaken, or inactivate the transcription or translation process of ICP4. In some embodiments, the inactivating mutation in ICP4 is a deletion in the coding sequence of ICP4.
[0074] In the present disclosure, a deletion in the coding sequence for ICP4 is made in the HSV-1 genome, thereby inactivating other copies of ICP4 and resulting in a viral vaccine that does not express any ICP4 protein. In some embodiments, the deletion in the coding sequence for ICP4 is a deletion of the entire coding sequence for ICP4. For example, the deletion in the coding sequence for ICP4 is a deletion of nucleotides 146978 to 150886 in the genome of HSV-1 strain F (GenBank: GU734771.1). In some embodiments, the deletion in the coding sequence for ICP4 is a deletion of a fragment of the coding sequence between nucleotides 146978 to 150886. In some embodiments, the deletion in the coding sequence for ICP4 is a deletion of a nucleotide fragment overlapping the fragment of nucleotides 146978 and 150886. For example, a deletion in the coding sequence of ICP4 is a deletion of a nucleotide fragment beginning before 146978 and ending between 146978 and 150886. For example, a deletion in the coding sequence of ICP4 is a deletion of a nucleotide fragment beginning between 146978 and 150886 and ending after 150886. In some embodiments, when a deletion occurs in a nucleotide fragment overlapping the fragment of nucleotides 146978 and 150886, the deletion occurs within 146651 to 150948, but the ICP4 promoter is retained, and preferably the ICP4 polyA sequence and / or TATA box are also retained. An exemplary promoter sequence for ICP4 can be obtained from GenBank: EF667506.1. Note that the specific nucleotide start and end positions described in this paragraph refer only to the F strain prototype. If a different strain or isomer is used, the start and end positions of the deleted nucleotides will be changed accordingly, which is within the ability of one skilled in the art.
[0075] In some embodiments, the first of the at least one antigen is driven by the promoter of ICP4, and the inactivating mutation in the other copy of ICP4 in the long terminal repeat is a deletion in the coding sequence of ICP4 and leaves the promoter of ICP4 intact, thereby operably linking the first of the at least one antigen to the promoter of ICP4 in the long terminal repeat.
[0076] In some embodiments, a first of the at least one antigen is driven by a promoter of a wild-type HSV-1 immediate-early gene (e.g., ICP0, ICP27, ICP4, ICP22, or ICP47), and the first of the at least one antigen, along with the driving promoter, is inserted at a position corresponding to the deleted internal inverted repeat region.
[0077] In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises one copy of ICP34.5, one copy of ICP0, one copy of LAT, and one copy of the "a" sequence. In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises UL1-UL56 and US1-US11. In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises an engineered gC (UL44) and / or an engineered gE (US8). In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises only one copy of ICP34.5, only one copy of ICP0, only one copy of LAT, only one copy of the "a" sequence, UL1-UL56, and US1-US11. In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises only one copy of ICP34.5, only one copy of ICP0, only one copy of LAT, only one copy of the "a" sequence, native UL1-UL43, engineered UL44, native UL45-UL56, and native US1-US11. In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises only one copy of ICP34.5, only one copy of ICP0, only one copy of LAT, only one copy of the "a" sequence, native UL1-UL43, engineered UL44, native UL45-UL56, and native US1-US7, engineered US8, and native US9-US11.
[0078] In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises an engineered UL44. In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises an engineered US8. In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises an engineered UL44 and / or an engineered US8. In some embodiments, the engineered UL44 inactivates C3 binding. In some embodiments, the engineered UL44 has a deletion in the C3-binding domain. In some embodiments, the engineered US8 inactivates FcR binding. In some embodiments, the engineered US8 has a deletion in the FcR-binding domain. In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises an engineered UL44 with a deletion in the C3-binding domain. In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises an engineered US8 with a deletion in the FcR-binding domain. In some embodiments, the HSV-1 viral vaccine of the present disclosure comprises an engineered UL44 with a deletion in the C3-binding domain and an engineered US8 with a deletion in the FcR-binding domain.
[0079] The HSV-1 virus vaccines of the present disclosure comprise at least one antigen. In some embodiments, the HSV-1 virus vaccines of the present disclosure comprise an antigen (i.e., a first antigen), wherein the first antigen is driven by an immediate-early gene promoter, such as the ICP4 promoter. In some embodiments, the first antigen is derived from a virus, bacterium, or parasite. In some embodiments, the first antigen is derived from a non-HSV-1 virus. In some embodiments, the first antigen is derived from a sarbecovirus. In some embodiments, the first antigen is derived from SARS-Cov, SARS-Cov-2, or a variant thereof. In some embodiments, the first antigen is derived from SARS-Cov, SARS-Cov-2, or a variant thereof. In some embodiments, the first antigen is derived from SARS-Cov-2 or a variant thereof. In some embodiments, the first antigen is derived from the delta or omicron variant of SARS-Cov-2. In some embodiments, the first antigen is derived from the omicron variant of SARS-Cov-2. In some embodiments, the first antigen is derived from the delta variant of SARS-Cov-2. In some embodiments, the first antigen is derived from the spike glycoprotein of a sarbecovirus. In some embodiments, the first antigen is derived from the spike glycoprotein of SARS-Cov, SARS-Cov-2, or variants thereof. In some embodiments, the first antigen is derived from the spike glycoprotein of SARS-Cov-2 or variants thereof. In some embodiments, the first antigen is derived from the extracellular domain of the spike glycoprotein of a sarbecovirus. In some embodiments, the first antigen is derived from the extracellular domain of the spike glycoprotein of SARS-Cov, SARS-Cov-2, or variants thereof. In some embodiments, the first antigen is derived from the extracellular domain of the spike glycoprotein of SARS-Cov-2 or variants thereof. In some embodiments, the first antigen is derived from the NTD domain of the spike glycoprotein of a sarbecovirus.In some embodiments, the first antigen is derived from the NTD domain of the spike glycoprotein of SARS-Cov, SARS-Cov-2, or variants thereof. In some embodiments, the first antigen is derived from the NTD domain of the spike glycoprotein of SARS-Cov-2 or variants thereof. In some embodiments, the first antigen is derived from the RBD domain of the spike glycoprotein of a sarbecovirus. In some embodiments, the first antigen is derived from the RBD domain of the spike glycoprotein of SARS-Cov, SARS-Cov-2, or variants thereof. In some embodiments, the first antigen is derived from the RBD domain of the spike glycoprotein of SARS-Cov-2 or variants thereof. In some embodiments, the first antigen is derived from the extracellular domain of the spike glycoprotein of a delta or omicron variant of SARS-Cov-2. In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of a delta variant of SARS-Cov-2.
[0080] In some embodiments, the HSV-1 virus vaccine of the present disclosure comprises the SARS-CoV-2 spike glycoprotein extracellular domain driven by the ICP4 promoter. The SARS-CoV-2 spike glycoprotein extracellular domain does not include the spike glycoprotein signal sequence, transmembrane domain, or intraviral domain. For example, in the case of the Delta strain, the extracellular domain is aa 14 to aa 1213 of UniProtKB / Swiss-Prot:P0DTC2.1. In some embodiments, the spike glycoprotein extracellular domain is linked at the N-terminus (i.e., the NTD domain) to the signal peptide of gB (UL27) or gD (US6). In some embodiments, the spike glycoprotein extracellular domain is linked at the C-terminus (i.e., the HR2 domain) to the transmembrane intraviral domain of gB (UL27) or gD (US6). In some embodiments, the extracellular domain of the spike glycoprotein is linked at the N-terminus (i.e., the NTD domain) to the signal peptide of gB(UL27) or gD(US6) and at the C-terminus (i.e., the HR2 domain) to the transmembrane intracellular domain of gB(UL27) or gD(US6). In some embodiments, the extracellular domain of the spike glycoprotein is linked at the N-terminus (i.e., the NTD domain) to the signal peptide of gB(UL27) and at the C-terminus (i.e., the HR2 domain) to the transmembrane intracellular domain of gB(UL27). In some embodiments, the extracellular domain of the spike glycoprotein is linked at the N-terminus (i.e., the NTD domain) to the signal peptide of gD(US6) and at the C-terminus (i.e., the HR2 domain) to the transmembrane intracellular domain of gD(US6).
[0081] In some embodiments, the HSV-1 viral vaccines of the present disclosure comprise an ectodomain of the spike glycoprotein of a delta variant of SARS-Cov-2 driven by the ICP4 promoter. In some embodiments, the HSV-1 viral vaccines of the present disclosure comprise an ectodomain of the spike glycoprotein of a delta variant of SARS-Cov-2 with the K986P and V987P mutation sites. In some embodiments, the HSV-1 viral vaccines of the present disclosure comprise an ectodomain of the spike glycoprotein of a delta variant of SARS-Cov-2 with the K986P and V987P mutation sites and the 682-GSAS-685 mutation at the furin cleavage site.
[0082] In some embodiments, the HSV-1 viral vaccines of the present disclosure comprise the extracellular domain of the spike glycoprotein of a delta variant of SARS-Cov-2 driven by the promoter of ICP4, where the extracellular domain is linked at its N-terminus (i.e., NTD domain) to the signal peptide of gB (UL27), with or without the mutations described above. In some embodiments, the HSV-1 viral vaccines of the present disclosure comprise the extracellular domain of the spike glycoprotein of a delta variant of SARS-Cov-2 driven by the promoter of ICP4, where the extracellular domain is linked at its C-terminus (i.e., HR2 domain) to the transmembrane domain of gB (UL27), with or without the mutations described above. In some embodiments, the HSV-1 virus vaccines of the present disclosure comprise the extracellular domain of the spike glycoprotein of the delta variant of SARS-Cov-2 driven by the promoter of ICP4, with or without the above-described mutations, linked at its N-terminus (i.e., NTD domain) to the signal peptide of gB(UL27) and at its C-terminus (i.e., HR2 domain) to the transmembrane domain of gB(UL27) within the viral particle.
[0083] In some embodiments, the inverted internal repeat region of the HSV-1 viral vaccine of the present disclosure is replaced with a triple repeat of a promoter followed by a stop codon. In some embodiments, the inverted internal repeat region of the HSV-1 viral vaccine of the present disclosure is replaced with a triple repeat of a CMV promoter followed by a stop codon. In some embodiments, the inverted internal repeat region of the HSV-1 viral vaccine of the present disclosure is replaced with a promoter of an immediate early gene (e.g., ICP4) followed by nucleotides encoding the first antigen.
[0084] Another aspect of the present disclosure relates to a replication-incompetent herpes simplex virus type 1 (HSV-1) virus vaccine, the replication-incompetent HSV-1 virus vaccine comprising a modified HSV-1 genome and at least one antigen, wherein the modification includes a deletion of an internal inverted repeat region, resulting in a deletion of each copy of a dual copy gene including ICP0, ICP34.5 and ICP4, and a latency-associated transcript (LAT), an inactivating mutation in ICP47, and an inactivating mutation in another copy of ICP4 in the long terminal repeat; and wherein a first antigen of the at least one antigen is driven by a promoter of a wild-type HSV-1 immediate-early gene, and a second antigen of the at least one antigen is fused to a first HSV-1 glycoprotein.
[0085] The terms "deletion of the internal inverted repeat region," "inactivating mutation in ICP47," "inactivating mutation in another copy of ICP4," "promoter of the immediate early gene," and "first antigen" have the same definitions and extensions as above.
[0086] The second antigen is derived from a different source than the first antigen, for example, a different variant or a different species. In a preferred embodiment, the second antigen is derived from a virus, bacterium, or parasite belonging to the same family, genus, subgenus, or species as the virus, bacterium, or parasite from which the first antigen is derived. For example, in some embodiments, the first and second antigens are derived from the same genus or subgenus as the virus. In some embodiments, the first and second antigens are derived from a sarbecovirus. In some embodiments, the first and second antigens are derived from SARS-CoV, SARS-CoV-2, or variants thereof. In some embodiments, the first and second antigens are derived from SARS-CoV, SARS-CoV-2, or variants thereof. In some embodiments, the first and second antigens are derived from SARS-CoV-2 or variants thereof. In some embodiments, the first and second antigens are derived from different SARS-CoV-2 variants. In some embodiments, the first antigen and the second antigen are derived from the delta or omicron variant of SARS-Cov-2.
[0087] In some embodiments, the first antigen is derived from SARS-Cov-2 (e.g., the Wuhan-Hu-1 strain) or a variant thereof, and the second antigen is derived from SARS-Cov or a variant thereof. In some embodiments, the first antigen is derived from SARS-Cov-2 and the second antigen is derived from SARS-Cov or a variant thereof. In some embodiments, the first antigen is derived from the delta or omicron variant of SARS-Cov-2, and the second antigen is derived from SARS-Cov or a variant thereof. In some embodiments, the first antigen is derived from the delta variant of SARS-Cov-2, and the second antigen is derived from SARS-Cov or a variant thereof. In some embodiments, the first antigen is derived from the omicron variant of SARS-Cov-2, and the second antigen is derived from SARS-Cov or a variant thereof. In some embodiments, the first antigen is derived from the spike glycoprotein of SARS-Cov-2 or a variant thereof, and the second antigen is derived from SARS-Cov or a variant thereof. In some embodiments, the first antigen is derived from the spike glycoprotein of SARS-Cov-2 and the second antigen is derived from SARS-Cov or a variant thereof. In some embodiments, the first antigen is derived from the spike glycoprotein of a variant of SARS-Cov-2 and the second antigen is derived from SARS-Cov or a variant thereof. In some embodiments, the first antigen is derived from the spike glycoprotein of a delta or omicron variant of SARS-Cov-2 and the second antigen is derived from SARS-Cov or a variant thereof. In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of SARS-Cov-2 or a variant thereof, and the second antigen is derived from SARS-Cov or a variant thereof.
[0088] In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of SARS-Cov-2 or a variant thereof, and the second antigen is the RBD domain of the spike glycoprotein of SARS-Cov or a variant thereof. In some embodiments, the first antigen is derived from the extracellular domain of the spike glycoprotein of a delta or omicron variant of SARS-Cov-2, and the second antigen is derived from the spike glycoprotein of SARS-Cov-2. In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of a delta or omicron variant of SARS-Cov-2, and the second antigen is the NTD domain of the spike glycoprotein of SARS-Cov-2. In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of a delta or omicron variant of SARS-Cov-2, and the second antigen is derived from the spike glycoprotein of SARS-Cov or a variant thereof. In some embodiments, the first antigen is derived from the extracellular domain of the spike glycoprotein of a delta or omicron variant of SARS-Cov-2, and the second antigen is the RBD domain of the spike glycoprotein of SARS-Cov. In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of a delta or omicron variant of SARS-Cov-2, and the second antigen is the NTD or RBD domain of the spike glycoprotein of a delta variant of SARS-Cov-2. In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of an omicron variant of SARS-Cov-2, and the second antigen is the NTD domain of the spike glycoprotein of a delta variant of SARS-Cov-2.
[0089] In some embodiments, the first HSV-1 glycoprotein is gC or gE. In some embodiments, the first HSV-1 glycoprotein is gC or gE, and the second antigen is the NTD domain of the spike glycoprotein of SARS-Cov-2 or a variant thereof, or the RBD domain of the spike glycoprotein of SARS-Cov or a variant thereof. In some embodiments, the first HSV-1 glycoprotein is gE, and the second antigen is the NTD domain of the spike glycoprotein of SARS-Cov-2. In some embodiments, the first HSV-1 glycoprotein is gC, and the second antigen is the RBD domain of the spike glycoprotein of SARS-Cov.
[0090] In some embodiments, HSV-1 gC is altered to inactivate C3 binding. In some embodiments, inactivation of C3 binding is achieved by a deletion in the C3 binding domain. In some embodiments, inactivation of C3 binding is achieved by a deletion of binding region II / III, i.e., aa 276 to aa 366. In some embodiments, the RBD domain of the spike glycoprotein of SARS-CoV (e.g., Tor2 strain) is inserted in place of binding region II / III.
[0091] In some embodiments, HSV-1 gE is altered to inactivate FcR binding. In some embodiments, inactivation of FcR binding is achieved by a deletion in the FcR-binding domain. In some embodiments, in the case of HSV-1 F strain gE, inactivation of FcR binding is achieved by a deletion of aa 235-380. In some embodiments, the NTD domain of the spike glycoprotein of SARS-CoV-2 (e.g., Wuhan-Hu-1 strain) is inserted in place of the FcR-binding domain.
[0092] Another aspect of the present disclosure relates to a replication-incompetent herpes simplex virus type 1 (HSV-1) virus vaccine, the replication-incompetent HSV-1 virus vaccine comprising a modified HSV-1 genome and at least one antigen, wherein the modification includes a deletion of an internal inverted repeat region, which leads to a deletion of each copy of a dual copy gene including ICP0, ICP34.5 and ICP4, and latency-associated transcript (LAT), an inactivating mutation in ICP47, and an inactivating mutation in another copy of ICP4 in the long terminal repeat; and wherein a first of the at least one antigen is driven by a promoter of a wild-type HSV-1 immediate-early gene, a second of the at least one antigen is fused to a first HSV-1 glycoprotein, and a third of the at least one antigen is fused to a second HSV-1 glycoprotein.
[0093] The terms "deletion of the internal inverted repeat region," "inactivating mutation in ICP47," "inactivating mutation in another copy of ICP4," "promoter of the immediate early gene," "first antigen," and "second antigen" have the same definitions and extensions as above.
[0094] The first, second, and third antigens are derived from different sources, such as different variants or different species. In preferred embodiments, the first, second, and third antigens are derived from viruses, bacteria, or parasites belonging to the same family, genus, subgenus, or species. For example, in some embodiments, the first, second, and third antigens are derived from the same genus or subgenus of virus. In some embodiments, the first, second, and third antigens are derived from a sarbecovirus. In some embodiments, the first, second, and third antigens are derived from SARS-CoV, SARS-CoV-2, or variants thereof. In some embodiments, the first, second, and third antigens are derived from SARS-CoV-2 or variants thereof. In some embodiments, the first, second, and third antigens are derived from different SARS-CoV-2 variants. In some embodiments, at least two of the first antigen, second antigen, and third antigen are derived from the delta or omicron variants of SARS-Cov-2. In some embodiments, at least two of the first antigen, second antigen, and third antigen are derived from the delta or omicron variants of SARS-Cov-2, and the others are derived from SARS-Cov or a variant thereof.
[0095] In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of SARS-Cov-2 or a variant thereof, the second antigen is the NTD domain of the spike glycoprotein of SARS-Cov-2 or a variant thereof that is different from the SARS-Cov-2 or variant thereof from which the first antigen is derived, and the third antigen is the RBD domain of the spike glycoprotein of SARS-Cov or a variant thereof.
[0096] In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of a delta variant of SARS-Cov-2, the second antigen is the NTD domain of the spike glycoprotein of SARS-Cov-2, and the third antigen is the RBD domain of the spike glycoprotein of SARS-Cov or a variant thereof. In some embodiments, the first antigen is the extracellular domain of the spike glycoprotein of a delta variant of SARS-Cov-2, the second antigen is the RBD domain of the spike glycoprotein of SARS-Cov or a variant thereof, and the third antigen is the NTD domain of the spike glycoprotein of SARS-Cov-2.
[0097] In some embodiments, the first HSV-1 glycoprotein and the second HSV-1 glycoprotein are gC and gE. In some embodiments, the first HSV-1 glycoprotein is gC and the second HSV-1 glycoprotein is gE. In some embodiments, the first HSV-1 glycoprotein is gE and the second HSV-1 glycoprotein is gC.
[0098] In some embodiments, the first HSV-1 glycoprotein is gE, the second antigen is the NTD domain of the spike glycoprotein of SARS-Cov-2 or a variant thereof, the second HSV-1 glycoprotein is gC, and the third antigen is the RBD domain of the spike glycoprotein of SARS-Cov or a variant thereof.
[0099] In some embodiments, HSV-1 gC is altered to inactivate C3 binding. In some embodiments, inactivation of C3 binding is achieved by a deletion in the C3 binding domain. In some embodiments, inactivation of C3 binding is achieved by a deletion of binding region II / III, i.e., aa 276 to aa 366. In some embodiments, the RBD domain of the spike glycoprotein of SARS-CoV (e.g., Tor2 strain) is inserted in place of binding region II / III.
[0100] In some embodiments, HSV-1 gE is altered to inactivate FcR binding. In some embodiments, inactivation of FcR binding is achieved by a deletion in the FcR-binding domain. In some embodiments, in the case of HSV-1 F strain gE, inactivation of FcR binding is achieved by a deletion of aa 235-380. In some embodiments, the NTD domain of the spike glycoprotein of SARS-CoV-2 (e.g., Wuhan-Hu-1 strain) is inserted in place of the FcR-binding domain.
[0101] In some embodiments, the first HSV-1 glycoprotein is gE and the second antigen is the NTD domain of the spike glycoprotein of SARS-Cov-2 (e.g., Wuhan-Hu-1 strain) inserted in place of the FcR binding domain, and the second HSV-1 glycoprotein is gC and the second antigen is the RBD domain of the spike glycoprotein of SARS-Cov (e.g., Tor2 strain) at binding region II / III inserted in place of the C3 binding domain.
[0102] Vaccine Composition
[0103] Another aspect of the present disclosure relates to a vaccine composition comprising the HSV-1 virus vaccine described herein and a pharmaceutically acceptable carrier. Potential carriers include, but are not limited to, physiologically balanced media, phosphate-buffered saline solution, water, emulsions (e.g., oil / water or water / oil emulsions), various types of wetting agents, cryoprotective additives or stabilizers, such as proteins, peptides, or hydrolysates (e.g., albumin, gelatin), sugars (e.g., sucrose, lactose, sorbitol), amino acids (e.g., monosodium glutamate), or other protective agents. The resulting aqueous solution may be packaged for ready use or lyophilized. Lyophilized formulations are combined with a sterile solution prior to administration and used for single or multiple doses. Formulated compositions, particularly liquid formulations, may contain bacteriostatic agents, including, but not limited to, benzyl alcohol, phenol, m-cresol, chlorobutanol, methylparaben, and / or propylparaben, at effective concentrations (usually 1% w / v) to prevent or minimize degradation during storage. Bacteriostatic agents may be contraindicated in some patients, therefore the lyophilized formulation can be reconstituted in a solution that either contains or does not contain such ingredients.
[0104] The vaccine composition of the present disclosure may contain pharmaceutically acceptable vehicle substances necessary to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents, etc., such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate. The vaccine composition may optionally contain an adjuvant to enhance the host's immune response. Suitable adjuvants include, for example, Toll-like receptor (TLR) agonists, alum, AlPO4, alhydrogel, lipid-A and derivatives or variants thereof, oil emulsions, saponins, neutral liposomes, liposomes containing vaccines and cytokines, nonionic block polymers, and chemokines. POE-POP-POE block copolymers, MPL, etc. 商標Nonionic block polymers containing polyoxyethylene (POE) and polyxylpropylene (POP), such as 3-O-deacylated monophosphoryl lipid A (Corixa, Hamilton, Ind.) and IL-12 (Genetics Institute, Cambridge, Mass.), and many other suitable adjuvants known in the art, can be used as adjuvants (Newman et al., 1998, Critical Reviews in Therapeutic Drug Carrier Systems, Vol. 15:89-142). The advantage of these adjuvants is that they help stimulate the immune system in a nonspecific manner, enhancing the immune response to pharmaceuticals. In some embodiments, the immunogenic compositions of the present disclosure can include one or more adjuvants or can be administered with one or more adjuvants. In some embodiments, the immunogenic compositions of the present disclosure can include two adjuvants or can be administered with two adjuvants. In some embodiments, the immunogenic compositions of the present disclosure may include or be administered with multiple adjuvants.
[0105] For vaccine compositions, examples of suitable adjuvants include, for example, aluminum hydroxide, lecithin, Freund's adjuvant, MPL, etc. 商標 and IL-12. In some embodiments, the vaccine compositions disclosed herein (e.g., SARS-Cov-2 vaccine compositions) can be formulated into controlled or sustained release formulations. This can be achieved in compositions that include slow-release polymers, or via microencapsulated delivery systems or bioadhesive gels. The various vaccine compositions can be prepared according to standard procedures well known in the art.
[0106] In some embodiments, the vaccine compositions of the present disclosure may include an adjuvant formulation that may include a metabolizable oil (e.g., squalene) and α-tocopherol in the form of an oil-in-water emulsion, and polyoxyethylene sorbitan monooleate (Tween-80). In some embodiments, the adjuvant formulation may include about 2% to about 10% squalene, about 2% to about 10% α-tocopherol (e.g., D-α-tocopherol), and about 0.3% to about 3% polyoxyethylene sorbitan monooleate. In some embodiments, the adjuvant formulation may include about 5% squalene, about 5% tocopherol, and about 0.4% polyoxyethylene sorbitan monooleate. In some embodiments, immunogenic compositions of the present disclosure may comprise 3 de-O-acylated monophosphoryl lipid A (3D-MPL) and an adjuvant in the form of an oil-in-water emulsion, wherein the adjuvant comprises a metabolizable oil, α-tocopherol, and polyoxyethylene sorbitan monooleate. In some embodiments, vaccine compositions of the present disclosure may comprise QS21 (soap tree extract: fraction 21), 3D-MPL, and an oil-in-water emulsion, wherein the oil-in-water emulsion comprises a metabolizable oil, α-tocopherol, and polyoxyethylene sorbitan monooleate. In some embodiments, vaccine compositions of the present disclosure may comprise QS21, 3D-MPL, and an oil-in-water emulsion, wherein the oil-in-water emulsion has a composition of a metabolizable oil, such as squalene, α-tocopherol, or Tween-80. In some embodiments, vaccine compositions of the present disclosure may comprise an adjuvant in the form of a liposomal composition.
[0107] In some embodiments, the vaccine compositions of the present disclosure may include an adjuvant formulation comprising a metabolizable oil (e.g., squalene), polyoxyethylene sorbitan monooleate (Tween-80), and Span 85. In some embodiments, the adjuvant formulation may comprise about 5% (w / v) squalene, about 0.5% (w / v) polyoxyethylene sorbitan monooleate, and about 0.5% (w / v) Span 85.
[0108] In some embodiments, the vaccine compositions of the present disclosure may include an adjuvant formulation comprising Quillaja saponins, cholesterol, and phospholipids in the form of a nanoparticle composition. In some embodiments, the vaccine compositions of the present disclosure may include a mixture of separately purified fractions of Quillaja saponins, which are then combined with cholesterol and phospholipids. In some embodiments, the vaccine compositions of the present disclosure may include MF59 商標 , Matrix-A 商標 , Matrix-C 商標 , Matrix-M 商標 , AS01, AS02, AS03 and AS04 adjuvants.
[0109] One or more adjuvants may be used in combination, and include, but are not limited to, alum (aluminum salts), oil-in-water emulsions, water-in-oil emulsions, liposomes, and microparticles such as poly(lactide-co-glycolide) microparticles. In some embodiments, the vaccine composition further comprises an aluminum salt adjuvant. In some embodiments, the aluminum salt adjuvant comprises one or more of the group consisting of amorphous aluminum sulfate hydroxyphosphate, aluminum hydroxide, aluminum phosphate, and aluminum potassium sulfate. In some embodiments, the aluminum salt adjuvant comprises one or both of aluminum hydroxide and aluminum phosphate. In some embodiments, the aluminum salt adjuvant comprises aluminum hydroxide. In some embodiments, a unit dose of the vaccine composition comprises about 0.25 mg to about 0.50 mg of Al. 3+ , or about 0.35 mg of Al 3+ In some embodiments, the vaccine composition further comprises another adjuvant.
[0110] Methods and Uses
[0111] In some embodiments, the description provides a method for generating an immune response in a subject, comprising administering to the subject an effective amount of an HSV-1 virus vaccine or vaccine composition described herein.
[0112] In some embodiments, the description provides a method for generating an immune response in a subject to a surface antigen of a coronavirus, wherein the surface antigen comprises an S protein or an antigenic fragment thereof, and the method comprises administering to the subject an effective amount of an HSV-1 virus vaccine or vaccine composition described herein.
[0113] For example, subjects who have been exposed to or may be exposed to coronavirus and therefore are infected with or at risk of becoming infected with coronavirus can be selected for treatment. After administration of the disclosed vaccines, subjects can be monitored for infection or symptoms associated with coronavirus, or both.
[0114] Typical subjects intended for treatment with the vaccines and methods of the present disclosure include humans, non-human primates, and other animals. To identify subjects for prevention or treatment with the methods of the present disclosure, generally accepted screening methods are used to determine risk factors associated with the target or suspected disease or condition, or to determine the subject's existing disease or condition status. These screening methods include, for example, routine efforts to determine environmental, familial, occupational, and other risk factors of this type associated with the target or suspected disease or condition, as well as diagnostic methods, such as various ELISA and other immunoassay methods for detecting and / or characterizing coronavirus infection. These and other conventional methods enable clinicians to select patients who need to be treated using the methods and pharmaceutical compositions of the present disclosure. In accordance with these methods and principles, the compositions can be administered as a stand-alone preventative or treatment program or as a follow-up, adjunctive, or coordinated treatment program for other treatments, according to the teachings herein or other conventional methods.
[0115] Administration of the disclosed vaccines can be used for prophylactic or therapeutic purposes. When provided prophylactically, the disclosed vaccines are provided before any symptoms, e.g., before infection. Prophylactic administration of the disclosed vaccines is used to prevent or ameliorate any subsequent infection. When provided therapeutically, the disclosed vaccines are provided at or after the onset of disease or infection symptoms, e.g., after the development of symptoms of coronavirus infection or after diagnosis of coronavirus infection. Thus, the vaccines can be provided before exposure to the coronavirus, after exposure or suspected exposure to the virus, or after the actual onset of infection, to attenuate the expected severity, duration, or extent of infection and / or associated disease symptoms.
[0116] The vaccines described herein are provided to a subject (preferably a human) in an amount effective to induce or enhance an immune response, e.g., to a coronavirus, in the subject. The actual dose of the vaccine will vary depending on factors such as the disease indication and the particular condition of the subject (e.g., the subject's age, size, level of health, severity of symptoms, susceptibility factors, etc.), the time and route of administration, other drugs or treatments administered concomitantly, and the particular pharmacology of the composition to elicit the desired activity or biological response in the subject. Dosage regimens can be adjusted to provide an optimal prophylactic or therapeutic response.
[0117] The booster may be administered multiple times. The priming and booster may be administered as a single dose or multiple doses, e.g., two, three, four, five, six, or more doses, over the course of several days, weeks, or months. The booster may be administered multiple times, e.g., one to five times (e.g., one, two, three, four, or five boosters), or more. Different doses may be used in a series of successive immunizations, e.g., a relatively large dose in the priming, followed by boosts with smaller doses.
[0118] In some embodiments, the booster can be administered about 2 weeks, about 3 to 8 weeks, or about 4 weeks after the primary immunization, or for about several months after the primary immunization. In some embodiments, the booster can be administered about 5 months, about 6 months, about 7 months, about 8 months, about 10 months, about 12 months, about 18 months, about 24 months, or for more or less time after the primary immunization. Periodic boosters can also be used at appropriate times to enhance the subject's "immunological memory." The appropriateness of selected vaccination parameters (e.g., formulation, dose, regimen, etc.) can be determined by collecting aliquots of serum from the subject and assaying antibody titers during the immunization program. Clinical monitoring of the subject can also be performed to achieve the desired effect, such as prevention of infection or improvement in disease status (e.g., reduction in viral load). If such monitoring indicates a suboptimal vaccination, the subject can be boosted with additional doses of vaccine, and vaccination parameters can be modified in a manner that is expected to enhance the immune response.
[0119] The amount used in the vaccine composition is selected based on the subject population (e.g., infants or the elderly). The optimal amount of a particular composition can be determined by standard studies involving observation of antibody titers and other responses in subjects. It is understood that a therapeutically effective amount of the disclosed vaccine in the vaccine composition includes an amount that is not effective in eliciting an immune response in a single administration, but is effective when administered multiple times, for example, in a prime-boost administration regimen.
[0120] After administration of a vaccine disclosed in the present disclosure, the subject's immune system typically responds to the vaccine by producing antibodies specific to, for example, the coronavirus S protein peptides included in the vaccine. Such a response represents an immunologically effective dose delivered to the subject. In some embodiments, the subject's antibody response is determined based on the context of assessing an effective dose / immunization regimen. In most cases, assessing antibody titers in serum or plasma obtained from the subject is sufficient. Decisions about whether to administer a booster vaccination and / or modify the amount of therapeutic agent administered to the individual can be based, at least in part, on the antibody titer level. The antibody titer level can be based, for example, on an immunobinding assay that measures the concentration of antigen-binding antibodies in serum.
[0121] In some embodiments, the method need not completely eliminate, reduce, or prevent coronavirus infection for it to be effective. For example, an immune response to coronavirus by one or more of the disclosed vaccines can reduce or inhibit coronavirus infection by a desired amount, e.g., at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100% (elimination or prevention of detectable infected cells) compared to coronavirus infection in the absence of the immunogen. In another example, coronavirus replication can be reduced or inhibited by the disclosed methods. Complete elimination of coronavirus replication is not required for the method to be effective. For example, an immune response initiated using one or more of the disclosed immunogens can reduce replication of the corresponding coronavirus by a desired amount, such as at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100% (eliminating or preventing detectable coronavirus replication) compared to coronavirus replication in the absence of the immune response.
[0122] In some embodiments, a subject is administered a therapeutically effective amount of one or more of the disclosed vaccines to induce a neutralizing immune response in the subject. To assess neutralizing activity, serum can be collected from the subject at appropriate time points after immunization, frozen, and stored for use in neutralization tests. Methods for assaying neutralizing activity are known to those skilled in the art and are further described herein, including, but not limited to, plaque reduction neutralization (PRNT) assays, microneutralization assays, flow cytometry-based assays, and single-cycle infection assays. In some embodiments, serum neutralizing activity can be assayed using a set of coronavirus pseudoviruses.
[0123] In some embodiments, the neutralizing immune response induced by the vaccines disclosed herein results in the production of neutralizing antibodies against a coronavirus, such as SARS-Cov-2. In some embodiments, the neutralizing antibodies herein bind to a cellular receptor or coreceptor or a component thereof for a coronavirus, such as SARS-Cov-2. In some embodiments, the viral receptor or coreceptor is a coronavirus receptor or coreceptor, preferably a pneumovirus receptor or coreceptor, more preferably a human coronavirus receptor, e.g., a SARS-Cov-2 receptor or coreceptor. In some embodiments, the neutralizing antibodies herein modulate, reduce, antagonize, attenuate, block, inhibit, eliminate, and / or interfere with at least one coronavirus, e.g., SARS-Cov-2 activity or binding, or coronavirus, e.g., SARS-Cov-2 receptor activity or binding, such as SARS-Cov-2 release, SARS-Cov-2 receptor signaling, membrane SARS-Cov-2 cleavage, SARS-Cov-2 activity, SARS-Cov-2 production and / or synthesis, in vitro, in situ, and / or in vivo. In some embodiments, the vaccines disclosed herein induce neutralizing antibodies against SARS-Cov-2 that modulate, reduce, antagonize, mitigate, block, inhibit, eliminate, and / or interfere with the binding of SARS-Cov-2 to a SARS-Cov-2 receptor or co-receptor, such as angiotensin-converting enzyme 2 (ACE2), dipeptidyl peptidase 4 (DPP4), dendritic cell-specific intercellular adhesion molecule-3-grabbing nonintegrin (DC-SIGN), and / or liver / lymph node-SIGN (L-SIGN).
[0124] In some embodiments, the neutralizing immune response induced by the vaccines disclosed herein produces neutralizing antibodies against sarbecoviruses, including SARS-Cov, SARS-Cov-2, and their variants. In this sense, the vaccines provided herein are pan-sarbecovirus vaccines.
[0125] Such vaccine compositions can be administered to a subject by a variety of modes of administration known to those skilled in the art, such as intramuscular, intradermal, subcutaneous, intravenous, intraarterial, intraarticular, intraperitoneal, intranasal, sublingual, tonsillar, oropharyngeal, or other parenteral and mucosal routes.
[0126] array
[0127] gD-S ECTO Amino acid sequence (SEQ ID NO: 1) JPEG2025525844000001.jpg155167
[0128] NOTE: The gD signal peptide is underlined, the extracellular domain of the delta mutant of SARS-Cov-2 is shaded, the gD transmembrane-domain within the viral particle is boxed, and * indicates the stop codon.
[0129] gB-S ECTO Amino acid sequence (SEQ ID NO: 2) JPEG2025525844000002.jpg167167
[0130] NOTE: The gB signal peptide is underlined, the extracellular domain of the delta mutant of SARS-Cov-2 is shaded, the gB transmembrane-domain within the viral particle is boxed, and * indicates the stop codon.
[0131] gC-S RBD Amino acid sequence (SEQ ID NO: 3) JPEG2025525844000003.jpg83165
[0132] Note: The SARS-Cov Tor2 RBD domain is shaded and * indicates the stop codon.
[0133] gE-S NTD Amino acid sequence (SEQ ID NO: 4) JPEG2025525844000004.jpg88165
[0134] Note: The SARS-Cov-2 Wuhan-Hu-1 NTD domain is shaded and * indicates the stop codon. [Example]
[0135] Example
[0136] Construction of non-replicating HSV-1 viral vectors MVR-ΔIR4 and MVR-ΔIR47.
[0137] Figure 1 shows a schematic diagram of the HSV-1(F), MVR-ΔIR4, and MVR-ΔIR47 genomes. The non-replicating HSV-1 viral vector MVR-ΔIR4 contains a deletion of the ICP4 gene in the terminal repeat (TR) region and a modified internal repeat (IR) region. This modified IR region contains a single copy of the genes encoding ICP0, ICP4, ICP34.5, LAT, ORF P, and ORF O, replaced by three repeats of a CMV promoter followed by a stop codon. The non-replicating HSV-1 viral vector MVR-ΔIR47 contains an additional deletion of the ICP47 gene based on the MVR-ΔIR4 vector. Recombinant viruses are constructed in several steps with the aid of a bacterial artificial chromosome (BAC) system.
[0138] Details of virus construction are as follows: The prototype (P) sequence of HSV-1(F) was used. In the background of the wild-type genome, a CMV cassette flanked by nucleotides 117005 upstream and 132096 downstream was PCR-amplified from the HSV-1 viral genome using two pairs of primers (GAAGATCTAATATTTTTATTGCAACTCCCTG (SEQ ID NO: 5), CTAGCTAGCTTATAAAAGGCGCGTCCCGTGG (SEQ ID NO: 6)) and (GCTCTAGATTGCGACGCCCCGGCTC (SEQ ID NO: 7), CCTTAATTAAGGTTACCACCCTGTAGCCCCGATGT (SEQ ID NO: 8)). The primers were inserted into the gene replacement plasmid pKO5 to generate pKO-CMV-STOP. pKO-CMV-STOP was then transfected into Escherichia coli harboring BAC-HSV-1(F) by electroporation to generate BAC-CMV-STOP. Then, in the case of the wild-type genome, the pKO-ΔICP4 plasmid containing the 5'-flanking sequence from nucleotides 145867 to 146977 and the 3'-flanking sequence from nucleotides 150887 to 151868 was PCR-amplified from the HSV-1 viral genome using two pairs of primers (ATCCCGAGCCGGGGCGTCGCGATGCCGA (SEQ ID NO: 9), CGCCGATGCGGGGCGATCCTCCGGGGATACGGCTGC (SEQ ID NO: 10)) and (CGGGCCGGGACGGGGCGGGGCGCTTGCGAAAC (SEQ ID NO: 11), AACGCCCGCCGCGCGCGCGCACGCCGCCCGGACC (SEQ ID NO: 12)), and transfected into E. coli harboring BAC-CMV-STOP by electroporation to produce BAC-ΔIR4. The MVR-ΔIR4 virus was obtained by transfecting the BAC-ΔIR4 plasmid followed by amplification in E5 cells (a Vero-derived, ICP4-complementing cell line).
[0139] MVR-ΔIR47 is an ICP47 gene-addition deletion based on the MVR-ΔIR4 vector. For the wild-type genome, the pKO-ΔICP47 plasmid containing the 5'-flanking sequence from nucleotides 146977 to 145867 and the 3'-flanking sequence from nucleotides 145088 to 143761 was PCR-amplified from the HSV-1 viral genome using two pairs of primers: CGCCGATGCGGGGCGATCCTCCGGGGATACGG (SEQ ID NO: 13), TCCCGAGCCGGGGCGTCGCGATGCCGACGCCG (SEQ ID NO: 14), and ATGAGCCAGACCCAACCCCCGGCCCCAGTTGG (SEQ ID NO: 15), CAGAAAATGTAACCATACCCAAACCGACTCT (SEQ ID NO: 16). Then, the plasmid was transfected into E. coli carrying BAC-ΔIR4 by electroporation to generate BAC-ΔIR47. The MVR-ΔIR47 virus was obtained by transfecting the BAC-ΔIR47 plasmid followed by amplification in E5 cells (a Vero-derived, ICP4-complementing cell line).
[0140] Construction of non-replicating HSV-1-based sarbecovirus spike protein vaccine viruses MVR-S-gB and MVR-S-gD.
[0141] MVR-S-gB is an MVR-ΔIR47-based virus consisting of the extracellular domain of the SARS-Cov-2 delta strain B.1.617.2 spike, the transmembrane domain (TM) and cytoplasmic tail region (CT) of the gB protein. MVR-S-gD is an MVR-ΔIR47-based virus consisting of the extracellular domain of the SARS-Cov-2 delta strain B.1.617.2 spike, the transmembrane domain (TM) and cytoplasmic tail region (CT) of the gD protein.
[0142] For the wild-type genome, S RBD pKO-gC-S, where the cassette is flanked by a 5'-flanking sequence from nucleotides 95401 to 97031 and a 3'-flanking sequence from nucleotides 97311 to 98692. RBDThe plasmid was PCR-amplified from the HSV-1 viral genome using two pairs of primers (GGGCCACCGTCCCCCCCGACACCCCAACGA (SEQ ID NO: 17), GTGGGCTGGAGGGTCAGAGACGGGGGGCGG (SEQ ID NO: 18)) and (CTGGTGCTGCCGCGGCCAACCATCACCATG (SEQ ID NO: 19), ACGCCTCCACCCGTGCTGCCGTCGCTAGAC (SEQ ID NO: 20)), and transfected into E. coli harboring BAC-ΔIR47 by electroporation to produce BAC-ΔIR47-SgC.
[0143] For the wild-type genome, S NTD pKO-gE-S, where the cassette is flanked by a 5'-flanking sequence from nucleotides 140341 to 141812 and a 3'-flanking sequence from nucleotides 142251 to 143580. NTD The plasmid was PCR-amplified from the HSV-1 viral genome using two pairs of primers (AAGCATCGACCACACCCTTCCCCACGGGA (SEQ ID NO: 21), AAACAGGATAGCTTCCGGAGTCTCCATACGCA (SEQ ID NO: 22)) and (TACCGGAACGCGGTGGTGGAACAGCCCCTC (SEQ ID NO: 23), AAAAATCAACCGGGAGACAACATTGCCAAT (SEQ ID NO: 24)), and transfected into E. coli harboring BAC-ΔIR47-SgC by electroporation to produce BAC-ΔIR47-SgC-SgE.
[0144] For the wild-type genome, S ECTO pKO-gB-S, where the cassette is flanked by a 5'-flanking sequence from nucleotides 145867 to 146977 and a 3'-flanking sequence from nucleotides 150887 to 151868 ECTO or pKO-gD-S ECTOPlasmids were PCR-amplified from the HSV-1 viral genome using two pairs of primers: ATCCCGAGCCGGGGCGTCGCGATGCCGA (SEQ ID NO: 25), CGCCGATGCGGGGCGATCCTCCGGGGATACGGCTGC (SEQ ID NO: 26), and CGGGCCGGGACGGGGCGGGGCGCTTGCGAAAC (SEQ ID NO: 27), AACGCCCGCCGCGCGCGCGCACGCCGCCCGGACC (SEQ ID NO: 28). These plasmids were transfected into E. coli harboring BAC-ΔIR47-SgC-SgE by electroporation to produce BAC-S-gB or BAC-S-gD. MVR-S-gB and MVR-S-gD viruses were obtained by transfecting the BAC-S-gB or BAC-S-gD plasmids into E5 cells (a Vero-derived, ICP4-complementing cell line) followed by amplification.
[0145] Materials and Methods
[0146] Microscopic analysis
[0147] The morphological phenotype of infected cells was recorded using an EVOS XL Core Imaging System. To analyze the phenotype of infected cells, Vero or E5 cells were cultured at 150 cm 2 The cells were cultured in flasks and infected with MVR-ΔIR4 or MVR-ΔIR47 viruses. 48 hours after infection, the morphology of each cell was observed using an EVOS XL core microscope, and raw digital images were recorded.
[0148] Immunoblot assay
[0149] 75cm 2 6 x 10 E5 or Vero cells in a flask 6After overnight incubation at 37°C, cells were either mock-infected or infected with 10 PFU of HSV-1(F), MVR-S-gB, or MVR-S-gD per cell. 24 h postinfection, cells were harvested and lysed in RIPA buffer (Beyotime). Cell lysates were heated at 100°C for 10 min and then loaded onto an 8% SDS-PAGE gel. Proteins were transferred to polyvinylidene difluoride (PVDF) membranes (Minipore). The membranes were blocked with 5% milk in PBST at room temperature (RT) for 1 hour and then incubated overnight at 4°C with primary antibodies against SARS-CoV-2 spike protein (Cat. No. 42172, CST), gE (Cat. No. ab6510, Abcam), gC (Cat. No. ab6509, Abcam), ICP4 (Cat. No. ab6514, Abcam), ICP27 (Cat. No. ab53480, Abcam), ICP8 (Cat. No. ab20194, Abcam), ICP0 (Cat. No. ab6513, Abcam), gD (Cat. No. sc-21719, Santa Cruz), or GAPDH (Cat. No. 2118S, CST). The membranes were then washed three times with PBST on a shaker and incubated with HRP-conjugated goat anti-mouse IgG (Cat. No. 31430, Invitrogen) or HRP-conjugated goat anti-rabbit IgG (Cat. No. 31460, Invitrogen) for 1 hour at room temperature, then washed three times with PBST on a shaker, ECL Western blot substrate (Cat. No. WBKLS0500, Minipore) was added, and the blots were imaged with a ChemiDoc XRS+ (Bio-Rad).
[0150] This study involved mouse immunization studies. Female BalB / c mice were used in this study. For intramuscular vaccination with MVR-S-gB or a negative control, d120 virus was prepared in a total volume of 200 μL, with or without aluminum adjuvant. All mice received three immunizations at 14-day intervals. Blood was collected from the orbital sinus on days 0, 8, 14, 22, 28, 36, 43, and 50 of the study. Serum was separated by low-speed centrifugation and stored at -80°C until use.
[0151] Pseudovirus neutralization assays were performed by Genscript using lentiviruses encoding luciferase and displaying the spike protein of the Wuhan-Hu-1, Delta, or Omicron BA1 strains. To measure neutralizing antibody activity in serum, mouse serum was diluted 1:50 in opti-MEM buffer. Then, 25 μL aliquots of diluted serum, positive control ACE2 protein, or negative control assay buffer were incubated with 25 μL aliquots of HIV-based SARS-CoV-2 pseudovirus containing 500 TCID50 in a 96-well plate at RT for 1 h. At the end of the incubation period, 50 μL of the mixture was added to Opti-HEK293 / ACE2 target cells and incubated at 37°C for 24 h. The cells were then analyzed by luciferase assay. Data were analyzed using GraphPad Prism 6.0. The luminescence intensity of the negative group was used as a cutoff value to identify positive neutralizing antibodies.
[0152] Non-replicating HSV-1 viral vectors replicate only in viral ICP4 complementing cells
[0153] 1.2 × 10 Vero or E5 cells 7 individual cells / cm 2 At a density of 150cm 2 After overnight incubation, the cells were infected with 1 PFU of MVR-ΔIR4 and MVR-ΔIR47 per cell. Forty-eight hours after infection, the morphology of each cell was observed using an EVOS XL Core microscope, and raw digital images were recorded.
[0154] As shown in Figure 2 , the replication-defective MVR-ΔIR4 and MVR-ΔIR47 viruses replicated only in E5 cells (a Vero-derived, ICP4-complementing cell line) but not in Vero cells, causing cytopathic effectors (CPE).
[0155] Figure 3 shows a model for constructing a non-replicating HSV-1-based sarbecovirus spike protein vaccine virus.
[0156] The green sphere represents the extracellular domain (S) of the SARS-Cov-2 delta strain B.1.617.2 spike. ECTO ) Glycoprotein-S ECTO is S ECTO The light green trapezoid represents the NTD domain (S) of the SARS-CoV-2 wild-type Wuhan-Hu-1 spike. NTD ) gE-S NTD is a chimera in which amino acids 237–382 in the gE protein are replaced with the NTD domain of the SARS-Cov-2 WT Wuhan-Hu-1 spike. The red box indicates the RBD domain (S) of the SARS coronavirus Tor2 (SARS Tor2) spike. RBD ) gC-S RBD is a chimera in which amino acids 275–367 in the gC protein are replaced with the RBD domain of the SARS coronavirus Tor2 (SARS Tor2) spike. The red cross indicates a modification that results in defective viral genome replication.
[0157] FIG. 4 shows a schematic diagram of the MVR-ΔIR47, MVR-S-gB, or MVR-S-gD genome.
[0158] Figure 5 shows gC-S, in which amino acids 275 to 367 in the gC protein were replaced with the RBD domain of the SARS coronavirus Tor2 (SARS Tor2) spike. RBD The structure of the chimera is shown.
[0159] Figure 6 shows the gE-S protein in which amino acids 237–382 in the gE protein were replaced with the NTD domain of SARS-Cov-2 WT Wuhan-Hu-1 spike. NTD The structure of the chimera is shown.
[0160] Figure 7 shows the S ECTO gB-S is linked to the transmembrane domain and cytoplasmic tail region (TM / CT) of the gB protein. ECTO The structure of the chimera is shown.
[0161] Figure 8 shows the S ECTO gD-S is linked to the transmembrane domain and cytoplasmic tail region (TM / CT) of the gD protein. ECTO The structure of the chimera is shown.
[0162] Protein expression of non-replicating HSV-1-based spike protein vaccine viruses in E5 cells
[0163] Figure 9 shows the expression of gC and gC-S in E5 cells infected with MVR-S-gB and MVR-S-gD. RBD , gE-S NTD , gB-S ECTO or gD-S ECTO Shows protein accumulation. 75cm 2 6 x 10 E5 or Vero cells in a flask 6 After overnight incubation at 37°C, cells were either mock-infected or infected with 10 PFU of HSV-1(F), MVR-S-gB, or MVR-S-gD per cell. 24 hours after infection, cells were harvested. Immunoblot assays revealed that gC, gC-S, and RBD , gE-S NTD , gB-S ECTO or gD-S ECTO Protein expression was detected.
[0164] As shown in Figure 9, the MVR-S-gB virus expresses the spike fusion protein more efficiently than the MVR-S-gD virus in infected E5 cells.
[0165] Accumulation of HSV viral proteins in E5 and Vero cells infected with MVR-S-gB virus
[0166] Figure 10 shows the accumulation of HSV-1 representative viral proteins in E5 and Vero cells infected with MVR-S-gB virus. 2 6 x 10 E5 or Vero cells in a flask 6After overnight incubation at 37°C, cells were mock infected and infected with 10 PFU of HSV-1(F) and MVR-S-gB per cell. 24 hours after infection, cells were harvested. Immunoblot assays revealed the presence of representative viral proteins ICP4, ICP27, ICP0, ICP8, gD, and the MVR-S-gB viral fusion protein gB-S. ECTO The expression of was detected.
[0167] As shown in Figure 10, MVR-S-gB efficiently expressed all detected viral proteins, namely, ICP4(α), ICP27(α), ICP0(α), ICP8(β), and gD(γ) (representing the viral immediate-early (α), early (β), and late (γ) genes), in ICP4-complementing E5 cells (a Vero-derived ICP4-complementing cell line), but only expressed the immediate-early (α) gene products ICP27 and ICP0 in Vero cells. These results suggest that the MVR-S-gB virus, in which both copies of the ICP4 gene have been disrupted by deletion of the IR and TR regions, is defective in vector replication and is a promising sarbecovirus vaccine candidate.
[0168] Animal Vaccination
[0169] Figure 11 shows the animal immunization design. Female BalB / c mice aged 6 to 8 weeks were used. Group 1 (n = 7) was inoculated with the negative control d120 virus lacking the ICP4 gene in the presence of aluminum (Alum). Groups 2 to 9 (n = 7) were inoculated with MVR-S-gB in the presence or absence of alum. d120 or MVR-S-gB was administered intramuscularly (IM) on D1, D15, and D29. Serum samples were collected on D0, D8, D14, D22, D28, D36, D43, and D50.
[0170] Six- to eight-week-old female BALB / c mice were inoculated with MVR-S-gB (n = 7) or negative control d120 virus in the presence or absence of alum. They were immunized three times via the intramuscular route on D1, D15, and D29. Serum samples collected on D36 were used for pseudotyped virus neutralization assays. In the neutralization assays, three of the seven mouse serum samples were tested in technical replicates with HIV-based Wuhan-Hu-1 or B.1.617.2 delta strain pseudoviruses. Pooled sera from each group were also tested in technical replicates with Omicron BA1 strain pseudoviruses.
[0171] Figure 12 shows the microneutralization assay using HIV-based pseudotyped viruses. As shown in Figure 12, neutralizing antibodies against the Wuhan-Hu-1 strain (A) and the Delta strain (B) were induced in a dose-dependent manner in all MVR-S-gB-vaccinated groups. Furthermore, 4 x 10 6 PFU or 2 × 10 7 In the group inoculated with PFU of MVR-S-gB, neutralizing antibodies against Omicron BA1 strain (C) were induced, and this was induced in a dose-dependent manner, indicating that MVR-S-gB induces cross-neutralizing antibodies against pansarbecoviruses.
[0172] The MVR-S-gB vaccine can induce long-lasting neutralizing antibodies that can last for at least 6 months.
[0173] Six- to eight-week-old female BALB / c mice were inoculated with MVR-S-gB (n = 7) or negative control d120 virus in the presence or absence of alum. They were immunized three times via the intramuscular route on D1, D15, and D29. Serum samples were collected 3 months (Figure 13A) and 6 months (Figure 13B) after the third vaccination and used in pseudovirus neutralization assays. Pooled mouse sera from each group were tested in technical replicates in pseudovirus neutralization assays against the Delta strain.
[0174] As shown in Figure 13, the group vaccinated with MVR-S-gB was able to induce durable neutralizing antibodies against the Delta strain for at least 6 months.
Claims
1. 1. A replication-incompetent herpes simplex virus type 1 (HSV-1) virus vaccine comprising a modified HSV-1 genome and at least one antigen, said modification comprising: deletion of internal inverted repeat regions leading to the deletion of each copy of duplicated genes including ICP0, ICP34.5, ICP4 and latency-associated transcript (LAT); an inactivating mutation in ICP47; an inactivating mutation in another copy of ICP4 in the long terminal repeat; and A replication-incompetent herpes simplex virus type 1 (HSV-1) virus vaccine, wherein a first antigen of said at least one antigen is driven by a promoter of an immediate early gene of wild-type HSV-1.
2. 2. The replication-incompetent HSV-1 virus vaccine of claim 1, wherein the immediate early gene of wild-type HSV-1 is ICP0, ICP27, ICP4, ICP22, or ICP47.
3. 2. The replication-incompetent HSV-1 virus vaccine of claim 1, wherein the immediate early gene of wild-type HSV-1 is ICP4.
4. 4. The replication-incompetent HSV-1 virus vaccine of claim 3, wherein the inactivating mutation in the other copy of ICP4 in the terminal repeat is a deletion in the coding sequence of ICP4.
5. 5. The replication-incompetent HSV-1 virus vaccine of claim 4, wherein the first antigen of the at least one antigen is operably linked to a promoter of ICP4 in the long terminal repeat sequence.
6. 2. The replication-incompetent HSV-1 virus vaccine of claim 1, wherein the first antigen of the at least one antigen is inserted with a driving promoter at a position corresponding to the deleted internal inverted repeat region.
7. The replication-incompetent HSV-1 virus vaccine of any one of claims 1 to 6, wherein a second antigen of said at least one antigen is fused to a first HSV-1 glycoprotein.
8. 8. The replication-incompetent HSV-1 virus vaccine of claim 7, wherein a third antigen of said at least one antigen is fused to a second HSV-1 glycoprotein.
9. 9. The replication-incompetent HSV-1 virus vaccine of claim 8, wherein the first HSV-1 glycoprotein or the second HSV-1 glycoprotein is glycoprotein gC or gE.
10. 10. The replication-incompetent HSV-1 virus vaccine of claim 9, wherein the glycoprotein gC is altered to inactivate C3 binding and the glycoprotein gE is altered to inactivate FcR binding.
11. 11. The replication-incompetent HSV-1 virus vaccine of claim 10, wherein the glycoprotein gC comprises a deletion in the C3 binding domain and the glycoprotein gE comprises a deletion in the FcR binding domain.
12. The replication-incompetent HSV-1 virus vaccine according to any one of claims 1 to 11, wherein the first antigen is linked at its N-terminus to a glycoprotein gB or gD signal peptide and at its C-terminus to a transmembrane domain of glycoprotein gB or gD within the viral particle.
13. 9. The replication-incompetent HSV-1 virus vaccine of claim 8, wherein the first antigen, the second antigen, or the third antigen is derived from a virus, a bacterium, or a parasite.
14. 9. The replication-incompetent HSV-1 virus vaccine of claim 8, wherein the first antigen, the second antigen, or the third antigen is derived from a sarbecovirus.
15. 15. The replication-incompetent HSV-1 virus vaccine of claim 14, wherein the first antigen, the second antigen or the third antigen is derived from SARS-Cov, SARS-Cov-2 and variants thereof.
16. 16. The replication-incompetent HSV-1 virus vaccine of claim 15, wherein the first antigen is derived from a delta or omicron variant of SARS-Cov-2, and the second and third antigens are derived from SARS-Cov, SARS-Cov-2 and variants thereof.
17. 17. The replication-incompetent HSV-1 virus vaccine of claim 16, wherein the first antigen is derived from the delta variant of SARS-Cov-2, the second antigen is derived from SARS-Cov Tor2 strain, and the third antigen is derived from SARS-Cov-2 Wuhan-Hu-1 strain.
18. The replication-incompetent HSV-1 virus vaccine of any one of claims 1 to 11, wherein the first antigen is the extracellular domain of the spike glycoprotein of the delta variant of SARS-Cov-2 or an immunogenic equivalent variant thereof.
19. 19. The replication-incompetent HSV-1 virus vaccine of claim 18, wherein the extracellular domain or the immunogenically equivalent variant thereof is linked at the N-terminus to the glycoprotein gB signal peptide and at the C-terminus to the transmembrane-intramycin domain of glycoprotein gB.
20. 20. The replication-incompetent HSV-1 virus vaccine of claim 19, wherein the immunogenically equivalent variant of the extracellular domain has the K986P / V987P mutation and / or the 682-GSAS-685 mutation.
21. 19. The replication-incompetent HSV-1 virus vaccine of claim 15 or 18, wherein one of the second antigen and the third antigen is the receptor-binding domain of spike glycoprotein of SARS-Cov Tor2 strain, and the other is the N-terminal domain of spike glycoprotein of SARS-Cov-2 Wuhan-Hu-1 strain, or an immunogenic equivalent variant thereof.
22. 22. The replication-incompetent HSV-1 virus vaccine of claim 21, wherein the second antigen is the receptor-binding domain of the spike glycoprotein of SARS-Cov Tor2 strain or an immunogenic equivalent variant thereof, and the first HSV-1 glycoprotein is glycoprotein gC.
23. 23. The replication-incompetent HSV-1 virus vaccine of claim 22, wherein the receptor-binding domain or an immunogenically equivalent variant thereof is fused to glycoprotein gC to replace its C3-binding domain.
24. 22. The replication-incompetent HSV-1 virus vaccine of claim 21, wherein the second antigen is the N-terminal domain of the spike glycoprotein of SARS-Cov-2 Wuhan-Hu-1 strain or an immunogenic equivalent variant thereof, and the first HSV-1 glycoprotein is glycoprotein gE.
25. 25. The replication-incompetent HSV-1 virus vaccine of claim 24, wherein the N-terminal domain of the spike glycoprotein of SARS-Cov-2 Wuhan-Hu-1 strain or an immunogenic equivalent variant thereof is fused to glycoprotein gE to replace the FcR binding domain.
26. 2. The replication-incompetent HSV-1 virus vaccine of claim 1, wherein the inactivating mutation in ICP47 is a deletion in the coding sequence of ICP47.
27. 6. The replication-incompetent HSV-1 virus vaccine of claim 5, wherein the inverted internal repeat region is replaced with three repeats of a CMV promoter followed by a stop codon.
28. 2. The replication-incompetent HSV-1 virus vaccine of claim 1, wherein the modified genome comprises one copy of ICP0, LAT and ICP34.5, UL1 to UL56, and US1 to US11.
29. A vaccine composition comprising the replication-incompetent HSV-1 virus vaccine of any one of claims 1 to 28 and a pharmaceutically acceptable carrier.
30. 30. The vaccine composition of claim 29, wherein the pharmaceutically acceptable carrier comprises an adjuvant.
Citation Information
Patent Citations
herpes simplex virus complex
JP2005532039A
Virus strain
JP2015221813A
Non-Toxic Hsv Vectors and Complementing Cells for Their Production for Efficient Gene Delivery Applications
JP2016525349A