Recombinant fusion proteins for antigen delivery and uses thereof
A fusion protein with N- and C-terminus carrier proteins addresses antigen delivery challenges, enhancing expression and immunogenicity for robust immune responses.
Patent Information
- Application Number
- JP2025504802
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-07-29
- Filing Date
- 2023-07-31
- Publication Date
- 2025-08-13
AI Technical Summary
Existing antigen delivery systems face challenges in achieving consistent antigen expression, stability, and immunogenicity, with peptide delivery facing solubility and half-life issues, mRNA delivery requiring dosage forms and instability, DNA delivery needing nuclear targeting and low efficiency, and viral vectors facing antibody interference.
A fusion protein comprising a peptide antigen with carrier proteins at the N- and C-terminus, linked by a nucleic acid molecule, expressed via an expression vector, and administered to induce immune responses.
The system enhances antigen delivery and immunogenicity, allowing for diverse antigen expression and improved immune response induction.
Smart Images

Figure 2025526447000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to a fusion protein comprising a peptide antigen containing a T cell epitope and a carrier protein linked to the N-terminus, C-terminus, or both, of the peptide antigen; a nucleic acid molecule encoding the fusion protein; an expression vector comprising the nucleic acid molecule; a cell transformed with the expression vector; and an immunogenic composition comprising the fusion protein, nucleic acid molecule, expression vector, or cell. [Background technology]
[0002] Various technologies have been developed to deliver antigens in various forms to induce T cell immunity, but each form has its own advantages and disadvantages. Delivering antigens in peptide form has the disadvantages of difficult synthesis and purification due to diverse antigen sequences, and low exposure due to solubility and a short half-life. Delivering antigens in mRNA form has the advantage of consistent manufacturing, but the disadvantages are the need for a dosage form due to instability in the body and uncertainty regarding the delivery of a consistent amount of antigen (consistent expression of diverse sequences in the body). Delivering antigens in DNA form has better in vivo stability than mRNA, but the disadvantages are that it must be delivered to the nucleus, low antigen expression efficiency, and the possibility of DNA being integrated into the genome. Viral vectors have the advantages of in vivo delivery and high immunogenicity, but the disadvantage is that strong antibodies are generated against the viral surface, resulting in reduced drug efficacy due to anti-drug antibodies during booster vaccinations.
[0003] Therefore, there is a need to develop vaccines that can more effectively deliver antigens to the body while inducing stronger immune responses. [Prior art documents] [Patent documents]
[0004] [Patent Document 1] U.S. Patent Registration No. 10,023,657 (July 17, 2018) Summary of the Invention [Problem to be solved by the invention]
[0005] The present invention provides an antigen delivery system that improves antigen expression, physical properties, stability, and / or immunogenicity, and improves antigen delivery to immune response cells. The present invention also provides an antigen delivery system that can produce, express, purify, and deliver a diverse array of antigens, thereby inducing a stronger immune response in the body.
[0006] One example provides a fusion protein comprising a peptide antigen and a carrier protein linked to the N-terminus, C-terminus, or both of the peptide antigen. In a preferred embodiment, the fusion protein comprises a peptide antigen, a first carrier protein linked to the N-terminus of the peptide antigen, and a second carrier protein linked to the C-terminus of the peptide antigen.
[0007] Another example provides a nucleic acid molecule encoding the fusion protein.
[0008] Another example provides an expression vector comprising the nucleic acid molecule.
[0009] Another example provides a cell transformed with the expression vector.
[0010] Another example provides a vaccine or immunogenic composition comprising the fusion protein, nucleic acid molecule, expression vector, or cell.
[0011] Another example provides a composition for preventing or treating a disease, comprising the fusion protein, nucleic acid molecule, expression vector, or cell. [Means for solving the problem]
[0012] One aspect of the present invention provides a fusion protein comprising a peptide antigen and a carrier protein linked to the N-terminus, C-terminus, or both, of the peptide antigen.
[0013] In one embodiment, a fusion protein is provided, comprising a peptide antigen, a first carrier protein linked to the N-terminus of the peptide antigen, and a second carrier protein linked to the C-terminus of the peptide antigen.
[0014] In one embodiment, the fusion protein can have an affinity tag linked to its N-terminus, C-terminus, or both.
[0015] In one embodiment, there may be a linker between the peptide antigen and the first carrier protein, or a linker between the peptide antigen and the second carrier protein, or both.
[0016] In one embodiment, the peptide antigen may comprise a T cell epitope.
[0017] In one embodiment, the peptide antigen may comprise a T cell epitope derived from a tumor antigen, an infectious antigen, an autoantigen, or an allergy-inducing antigen.
[0018] In one embodiment, the carrier protein may be a protein that improves the recombinant expression of the peptide antigen or improves the purification of the peptide antigen.
[0019] In one embodiment, the first carrier protein may be a protein that improves recombinant expression of the peptide antigen, and the second carrier protein may be a protein that improves expression of the peptide antigen.
[0020] In one embodiment, the tumor antigen may include a tumor-associated antigen (TAA), a tumor-specific antigen (TSA), or a tumor-derived neoantigen.
[0021] In one embodiment, tumor-derived neoantigens may contain mutations that are specifically expressed in cancer cells.
[0022] In one embodiment, the tumor-associated antigen (TAA) is a cancer-associated antigen (CT), EGFR, M12, M20, M21, M30, M44, Ova, Melan-A, Prostate Specific Membrane Antigen (PSMA), Survivin, MAGE-A, adenosine deaminase-binding protein (ADAbp), cyclophilin b, gp100, Colorectal associated antigen (CRC)-C017-1 A / GA733, carcinoembryonic antigen (CEA), CAP-1, CAP-2, etv6, AML1, or Prostate Specific Antigen (PSA). Antigen), PSA-1, PSA-2, PSA-3, MAGE (melanoma antigen E), GAGE (G antigen), BAGE (melanoma B antigen), RAGE (renal tumor antigen), LAGE (L antigen), NAG, GnT-V, MUM-1, CDK4, p53, tyrosinase, Muc1 (mucin 1), HER2 / neu, p21ras, N-RAS, K-RAS, RCAS1, α-fetoprotein, E-cadherin, α-catenin, β-catenin, γ-catenin, p120ctn, PRAME, NY-ESO-1, TRP2, mammaglobin-A, metallopanstimulin-1 (MPS-1), The protein may be cytochrome P450 isoform 1B1, 90K / Mac-2 binding protein, Ep-CAM (MK-1), HSP-70, hTERT (TRT), LEA, TAGE-1, 5T4, gp70, SCP-1, c-myc, cyclin B1, MDM2, p62, Koc, IMP1, TA90, OA1, CT-7, HOM-MEL-40 / SSX-2, SSX-1, SSX-4, HOM-TES-14 / SCP-1, HOM-TES-85, HDAC5, MBD2, TRIP4, NY-CO-45, KNSL6, HIP1R, Seb4D, KIAA1416, IMP1, 90K / Mac-2 binding protein, MDM2, or LMNA.
[0023] In one embodiment, the infectious antigen may be derived from a virus, bacteria, parasite, or fungus.
[0024] In one embodiment, the first carrier protein and the second carrier protein may be the same or different, and may each be NDPK (nucleoside diphosphate kinase B), CSTA (cystatin-A), Trx (thioredoxin), RPL7Am (50S ribosomal protein L7Ae), Samp2a (small archaeal modifier protein 2), TE (tenascin), TM1112 (Thermotoga maritima Cupin_3 domain-containing protein), TrxA (thioredoxin1), TTrx (Thermosipho africanus thioredoxin), or PSBD (peripheral subunit-binding domain), a fragment thereof, or two or more thereof.
[0025] In one embodiment, the affinity tag may be His or streptavidin.
[0026] In one embodiment, the linker may be (GS)n, (GS)n, (GS)n, (GS), Gn, LE, SSGG, or GGGGSGGGGG (where G is Gly, S is Ser, L is Leu, E is Glu, and n is an integer of at least 1).
[0027] In one embodiment, the fusion protein may be 30 kDa or less in size.
[0028] Another aspect of the present invention provides a nucleic acid molecule encoding the fusion protein.
[0029] Another aspect of the invention provides an expression vector comprising the nucleic acid molecule.
[0030] Another aspect of the invention provides a cell transformed with the expression vector.
[0031] Another aspect of the present invention provides a vaccine composition comprising the fusion protein, nucleic acid molecule, expression vector, or cell.
[0032] Another aspect of the present invention provides an immunogenic composition comprising the fusion protein, nucleic acid molecule, expression vector, or cell.
[0033] In one embodiment, the composition may additionally comprise an immunoadjuvant.
[0034] Another aspect of the present invention provides a method for generating, inducing, and / or enhancing an immune response to an antigen, comprising administering to a patient an effective amount of the fusion protein, vaccine composition, and / or immunogenic composition.
[0035] Another aspect of the present invention provides a method for preventing, ameliorating, and / or treating cancer, an infectious disease, an autoimmune disease, or an allergic disease, comprising administering to a patient an effective amount of the fusion protein, vaccine composition, and / or immunogenic composition.
[0036] Another aspect of the present invention provides a use of the fusion protein for inducing, inducing, or enhancing an immune response to an antigen, or for preparing a composition for inducing, inducing, or enhancing an immune response.
[0037] Another aspect of the present invention provides a use of the fusion protein for preventing, ameliorating, and / or treating cancer, infectious diseases, autoimmune diseases, or allergic diseases, or for producing a composition for preventing, ameliorating, and / or treating cancer, infectious diseases, autoimmune diseases, or allergic diseases.
[0038] The present invention will now be described in more detail.
[0039] When the terms "comprise", "comprises", "comprised" or "comprising" are used in this specification (including the claims), they should be interpreted as specifying the presence of stated features, integers, steps or components, but not as excluding the presence of one or more other features, integers, steps, components or groups thereof.
[0040] Discussions of documents, statutes, materials, devices, articles and the like are included in this specification solely for the purpose of providing a context for the present invention, and are not intended, in whole or in part, to form part of the prior art base or to represent or indicate the common general knowledge in the field to which the present invention pertains prior to the priority date of each claim of this application.
[0041] One example of the present application relates to a fusion protein comprising a peptide antigen and a carrier protein linked to the N-terminus, C-terminus, or both of the peptide antigen. In a preferred embodiment, the fusion protein comprises a peptide antigen, a first carrier protein linked to the N-terminus of the peptide antigen, and a second carrier protein linked to the C-terminus of the peptide antigen.
[0042] The term "antigen" refers to any molecule that induces an immune response in a subject. By way of example, an antigen can refer to any molecule that contains an epitope that can be recognized by a T cell receptor and / or a B cell receptor and that can stimulate an immune response, particularly a T cell response and / or a B cell response, in a subject.
[0043] The term "epitope" thus refers to the region of an antigen that interacts with a T-cell receptor and / or a B-cell receptor.
[0044] In a preferred example, the peptide antigen of the present application may contain a T cell epitope. For example, the peptide antigen of the present application may contain an MHC class I and / or II binding motif. As a specific example, the peptide antigen of the present application may contain a CD4+ T cell epitope, which is a peptide sequence that contains an MHC class II binding motif and can be presented on the surface of an antigen-presenting cell by an MHC class II molecule. The peptide antigen of the present application may also contain a CD8+ T cell epitope, which is a peptide sequence that contains an MHC class I binding motif and can be presented on the cell surface by an MHC class I molecule. The peptide antigen of the present application may further contain both a CD4+ T cell epitope and a CD8+ T cell epitope.
[0045] The term "MHC (major histocompatibility complex)" refers to proteins that provide antigen fragments to immune cells so they can distinguish between self and non-self molecules. There are two types of MHC: MHC class I and MHC class II. MHC class I is found in all cells with a nucleus, while MHC class II is found in antigen-presenting cells. MHC class I molecules interact with CD8+ cytotoxic T cells, which play an important role in organ transplant rejection and the destruction of infected cells. MHC class II molecules interact with CD4+ accessory T cells, which play an important role in recognizing non-self antigens and inducing cell-mediated immunity.
[0046] Generally, in adaptive immune responses, when an antigen enters the body, antigen-presenting cells ingest it and break it down into short peptide fragments, which can then bind to MHC class I or MHC class II molecules within the cell and be transported to the cell surface. When antigen peptides bind to MHC class I or MHC class II molecules and are presented on the cell surface of antigen-presenting cells, T cells recognize and activate them via T cell receptors (TCRs), initiating an immune response. In this respect, the peptide antigens of the present application can correspond to T cell epitopes.
[0047] In other preferred embodiments, the peptide antigen may be, but is not limited to, a peptide derived from a tumor antigen, such as a tumor-associated antigen (TAA), tumor-specific antigen (TSA), or tumor-derived neoantigen; an antigen of an infectious source, such as an antigen derived from a virus, bacteria, parasite, or fungus; an autoantigen known or suspected to induce autoimmunity; or an allergy-inducing antigen (allergen) known or suspected to induce allergy.
[0048] For example, peptide antigens can include portions of tumor antigens, infectious antigens, autoantigens, or allergy-inducing antigens that are in silico predicted or known to bind to MHC class I or MHC class II molecules, including, but not limited to, CD8+ or CD4+ T cell epitopes.
[0049] Peptide antigens can include natural or non-natural amino acid sequences, amino acids with post-translational modifications, or peptidomimetics that can induce an immune response, e.g., a T cell or B cell response, in a subject. For example, peptide antigens can be about 5 to about 100 amino acids, or about 5 to about 50 amino acids. For example, peptide antigens can be about 7 to 35 amino acids, such as, but not limited to, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 amino acids.
[0050] The term "tumor antigen" can be used interchangeably with "cancer antigen" and refers to a molecule expressed on a tumor (cancer) that elicits an immune response. Such an immune response can involve antibody production, activation of specific immunologically competent cells, or both.
[0051] Tumor antigens can be derived from tumor-bearing organisms, dead or inactivated whole tumor cells, or lysates, and include any antigen derived from a tumor. Lysates are substances resulting from the application of processes that cause the division of normal structures in cells. Tumor antigens also include any protein or other substance with antigenic properties that is contained in tumor cells and expressed differently from normal cells.
[0052] For example, tumor antigens can include tumor-associated antigens (TAA), tumor-specific antigens (TSA), or tumor-derived neoantigens.
[0053] Tumor-associated antigens (TAAs) are antigens that are expressed more in cancer cells than in normal cells, or at a different differentiation stage than normal cells, and are also present in trace amounts in normal cells. Therefore, immune responses using these TAAs are likely to be neutralized by self-tolerance, an immunosuppressive mechanism that prevents damage to self-cells, or conversely, they may lead to autoimmunity and attack of unwanted organs.
[0054] Examples of tumor-associated antigens (TAA) include cancer-testis (CT) antigen, EGFR, M12, M20, M21, M30, M44, Ova, Melan-A, prostate specific membrane antigen (PSMA), survivin, MAGE-A, adenosine deaminase-binding protein (ADAbp), cyclophilin b, gp100, colorectal associated antigen (CRC)-C017-1 A / GA733, carcinoembryonic antigen (CEA), CAP-1, CAP-2, etv6, AML1, prostate specific antigen (PSA), and the like.Antigen), PSA-1, PSA-2, PSA-3, MAGE (melanoma antigen E) [e.g., MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, MAGE-A12, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), MAGE-C1, MAGE-C2, MAGE -C3, MAGE-C4, MAGE-C5, etc.], GAGE (G antigen) [e.g., GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, GAGE-9, etc.], BAGE (B melanoma antigen), RAGE (kidney tumor antigen), LAGE (L antigen), NAG, GnT-V, MUM-1, CDK4, p53, tyrosinase, Muc1 (mucin 1), HER2 / neu, p21ras, N-RAS, K-RAS, RCAS1, α- Fetoprotein, E-cadherin, α-catenin, β-catenin, γ-catenin, p120ctn, PRAME, NY-ESO-1, TRP2, mammaglobin-A, metallopanstimulin-1 (MPS-1), cytochrome P450 isoform 1B1, 90K / Mac-2 binding protein, Ep-CAM (MK-1), HSP-70, hTERT (TRT), LEA, TAGE-1, 5T 4, gp70, SCP-1, c-myc, cyclin B1, MDM2, p62, Koc, IMP1, TA90, OA1, CT-7, HOM-MEL-40 / SSX-2, SSX-1, SSX-4, HOM-TES-14 / SCP-1, HOM-TES-85, HDAC5, MBD2, TRIP4, NY-CO-45, KNSL6, HIP1R, Seb4D, KIAA1416, IMP1, 90K / Mac-2 binding protein, MDM2, or LMNA.
[0055] Tumor-specific antigens (TSAs) are antigens that are present specifically in cancer cells. In particular, as tumors grow in cancer patients, cancer cell-specific genetic mutations occur, generating new antigen epitopes that can stimulate T cells; these are called neoantigens. In other words, neoantigens contain cancer cell-specific genetic mutations and, unlike tumor-shared antigens that are expressed in trace amounts in normal cells, are selectively expressed only in cancer cells. Therefore, they are recognized by the immune system as non-self foreign epitopes, eliciting strong anti-cancer immune activity.
[0056] When peptides generated by mutated DNA are presented on the MHC of cells, they are recognized by T cell receptors (TCRs). However, because mutations do not occur in normal cells or tissues, neoantigen-specific T cells are free from the problems of self-tolerance and autoimmunity. Because of these advantages, neoantigens are considered ideal targets for T cell-based cancer immunotherapy.
[0057] The causes of neoantigens include, but are not limited to, frame-shift deletions or insertions, which result in the disruption of the genetic code due to the addition or deletion of one or more nucleotides in DNA; point mutations, which result in the substitution of one nucleotide for another; missense mutations, splice-site mutations, read-through mutations, and gene-fusion mutations.
[0058] Neoantigens are predicted by analyzing specific cancer cell genomes from individual cancer patients. For example, cancer cells are extracted from the patient's tumor, their DNA is sequenced, and then compared with the sequence of normal cells to identify mutated regions. From these mutated regions, neoantigens that stimulate T cells can be identified. This can be done using, but is not limited to, next-generation sequencing (NGS), whole-exome sequencing (WES), or RNA sequencing, big data processing techniques such as MHC binding prediction computer programs, or artificial intelligence (AI) for neoantigen prediction. Because mutations are not shared between patients, neoantigens can be developed into personalized cancer vaccines.
[0059] As a specific example, the tumor antigen may be one represented by any one of the amino acid sequences of SEQ ID NOs: 1 to 44, but is not limited thereto.
[0060] The infectious antigen may be derived from a virus, bacteria, parasite, or fungus.
[0061] For example, antigens derived from viruses include chickenpox virus, smallpox virus, Ebola virus, Marburg virus, dengue virus, influenza virus, parainfluenza virus, respiratory cytoplasmic virus, measles virus, human immunodeficiency virus, human papillomavirus, varicella-zoster virus, and the like. virus, herpes simplex virus, cytomegalovirus, Epstein-Barr virus, JC virus, rhabdovirus, rotavirus, rhinovirus, adenovirus, papillomavirus, parvovirus, picornavirus, poliovirus, mumps-causing virus, rabies-causing virus, reovirus, rubella virus, togavirus, orthomyxovirus, retrovirus, hepadnavirus, coxsackievirus, equine encephalitis virus, Japanese encephalitis virus, yellow fever virus The antigen may be, but is not limited to, an antigen derived from Hepatitis virus, Rift Valley fever virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus, or Hepatitis E virus.
[0062] Antigens derived from bacteria include Borrelia species, Bacillus anthracis, burgdorferi, Bordetella pertussis, Campylobacter jejuni, Chlamydia species, Chlamydial psittaci, Chlamydial trachomatis, Clostridium species, Clostridium tetani, Clostridium botulinum, Clostridium perfringens, Corynebacterium diphtheriae, Coxiella species, and species, Enterococcus species, Ehrlichia species, Escherichia coli, Francisella tularensis, Haemophilus species, Haemophilus influenzae, Haemophilus parainfluenzae, Lactobacillus species, Legionella species, Legionella pneumophila, Leptospirosis interrogans, Listeria species, Listeria monocytogenes, Mycobacterium species, Mycobacterium tuberculosis, Mycobacterium leprae), Mycoplasma speciesspecies, Mycoplasma pneumoniae, Neisseria species, Neisseria meningitidis, Neisseria gonorrhoeae, Pneumococcus species, Pseudomonas species, Pseudomonas aeruginosa, Salmonella species, Salmonella typhi, Salmonella enterica, Rickettsia species, Rickettsia rickettsii, Rickettsia typhi, Shigella species, Staphylococcus species, Staphylococcus aureus The antigen may be, but is not limited to, an antigen derived from S. aureus, Streptococcus species, Streptococcus pneumoniae, Streptococcus pyrogenes, Streptococcus mutans, Treponema species, Treponema pallidum, Vibrio species, Vibrio cholerae, or Yersinia pestis.
[0063] The fungal-derived antigen may be, but is not limited to, an antigen derived from a fungus selected from Candida species, Cryptococcus species, Coccidioides species, Histoplasma species, and Aspergillus species.
[0064] The parasite-derived antigen may be, but is not limited to, an antigen from Plasmodium, Trypanosome, Schistosome or Leishmania.
[0065] The term "carrier protein" refers to a protein that is linked to a peptide antigen to improve the recombinant expression of the peptide antigen (e.g., high expression rate, consistent expression rate, etc.), improve purification, enhance physical properties, stabilize, increase immunogenicity, and / or improve delivery to immune response cells. In this application, carrier proteins can be linked to the N-terminus and C-terminus of the peptide antigen, respectively, and for the sake of distinction, they are referred to as the first carrier and the second carrier, respectively.
[0066] One or more carrier proteins can be linked to the N-terminus, C-terminus, or both. For example, one, two, three, or more carrier proteins can be linked to the N-terminus, C-terminus, or both.
[0067] The first and second carrier proteins may be the same or different, and may be nucleoside diphosphate kinase B (NDPK), cystatin-A (CSTA) [e.g., human CSTA (hCSTA) or mouse CSTA (mCSTA)], thioredoxin (Trx) [e.g., human Trx (hTRx) or mouse TRx (mTRx)], 50S ribosomal protein L7Ae (RPL7Am), small archaeal modifier protein 2 (Samp2a), tenascin (TE) [e.g., TE1, TE2, TE3.1, TE3.2, TE4], Thermotoga maritima Cupin_3 domain-containing protein (TM1112), thioredoxin1 (TrxA), Thermosipho africanus thioredoxin (TTrx), or peripheral subunit-binding domain (PSBD), respectively. The polypeptide may be, but is not limited to, one or more of the polypeptides of the present invention, including the polypeptides of the present invention, ...
[0068] In a preferred embodiment, the first carrier protein located at the N-terminus can be selected to improve antigen expression, taking into account the difficulty of recombinantly expressing the antigen depending on the sequence of the tumor antigen. For example, the first carrier protein can be selected for the purpose of expressing the antigen at a certain level or higher, consistently expressing it, and / or stabilizing it in a host expression system. For example, the first carrier protein may be one or more selected from TrxA, Trx (e.g., tTrx, mTrx, etc.), CSTA (e.g., tCSTA, mCSTA), TT-CSTA, TE, RPL7Am, Samp2a, TM1112, TT-TM1112, and TT-Trx, but is not limited thereto.
[0069] In a preferred embodiment, the second carrier protein located at the C-terminus can be selected to improve antigen purification, taking into consideration the difficulty of antigen purification (or impurity removal) depending on the tumor antigen sequence. For example, the second carrier protein can be selected to stabilize the C-terminal structure of the fusion protein in a conventional purification system, thereby improving purification. For example, the second carrier protein may be one or more selected from NDPK, TrxA, CSTA (e.g., tCSTA, mCSTA), PSBD, and PSBD-TT, but is not limited thereto.
[0070] Carrier proteins can also include, but are not limited to, pan HLA DR binding epitopes (PADRE), tetanus toxin epitope (TT) or diphtheria toxoid or recombinantly produced, genetically detoxified variants thereof, staphylococcal exotoxin or toxoid, or Pseudomonas aeruginosa exotoxin A or derivatives thereof.
[0071] As a specific example, the tumor antigen may be one represented by any one of the amino acid sequences of SEQ ID NOs: 45 to 69, but is not limited thereto.
[0072] The proteins (e.g., carrier proteins and / or fusion proteins) and / or polypeptides provided herein may be isolated and / or purified from nature, or may be recombinantly or chemically synthesized. When the amino acid sequence of a protein (e.g., carrier proteins and / or fusion proteins) or polypeptide provided herein contains a methionine (Met, M) as the first amino acid residue from the N-terminus, the protein or polypeptide may be recombinantly produced, and the methionine at the first amino acid position from the N-terminus may be encoded by an initiation codon. Therefore, when the amino acid sequence of a protein (e.g., carrier proteins and / or fusion proteins) or polypeptide provided herein contains a recombinantly produced methionine at the N-terminus, it can be interpreted as including the amino acid sequence starting from the second amino acid residue excluding the methionine at the first amino acid position from the recombinantly produced N-terminus, if the protein or polypeptide is obtained by other methods (e.g., chemical synthesis or isolation from nature) or is not located at the N-terminus within a fusion protein.
[0073] An example of a fusion protein of the present application may be one in which an affinity tag is linked to its N-terminus, C-terminus, or both.
[0074] The term "affinity tag" refers to a substance that provides a site for attachment of the fusion protein to a specific substrate in vitro, i.e., when the fusion protein is experimentally purified. As part of the fusion protein, the affinity tag should not induce immunogenicity or affect the activity of the fusion protein.
[0075] The fusion protein of the present invention can be purified regardless of the characteristics of the antigen sequence by including an affinity tag, and the fusion protein can be easily purified by affinity purification, allowing for ultra-high speed protein production.
[0076] The affinity tag may be, but is not limited to, polyhistidine (His), polyphenylalanine, polyalanine, streptavidin, maltose-binding protein (MBP), intein, thioredoxin (Trx), protein A, NusA (N utilization substance A), beta-galactosidase, or glutathione-S-transferase (GST). For example, in the case of a polyhistidine tag, a peptide with a sequence of 5 to 8 consecutive histidines (e.g., His-His-His-His-His-His) is used. Because histidine tags have affinity for divalent metal ions, fusion proteins can be purified by affinity chromatography using nickel-immobilized beads, cobalt-immobilized beads, etc.
[0077] Affinity tags may or may not be cleaved under extracellular or intracellular conditions, and even if they are not cleaved, they are not only safe in vivo but also do not induce structural changes in the fusion protein and do not substantially affect the function of the fusion protein in cells.
[0078] An example of a fusion protein of the present application may have a linker between the peptide antigen and the first carrier protein, a linker between the peptide antigen and the second carrier protein, or both.
[0079] The term "linker" refers to a molecule or atomic group that links, couples, or binds two or more components together. In the present application, each component of a fusion protein, for example, a peptide antigen and a carrier protein, or a carrier protein and an affinity tag, can be linked or bound together via any suitable means. The linker can have additional functions, such as increasing or decreasing aqueous solubility, increasing the distance between the two components to be linked to provide flexibility, or increasing stability, but preferably does not induce immunogenicity or affect the activity of the fusion protein.
[0080] The linker may be a peptide linker and may be, but is not limited to, 1 to 10 or 2 to 10 amino acids in length, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more (e.g., 20 or less) amino acids in length, for example, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. As an example, the peptide linker may be composed of neutral amino acids (more specifically, Gly, Ser, Ala, Thr, or a combination of these four amino acids). For example, it may be (GS)n, (GS)n, (GS)n, (GS), Gn, LE, SSGG, or GGGGSGGGGG (wherein G is Gly, S is Ser, L is Leu, E is Glu, and n is an integer of at least 1), such as, but not limited to, GS, GGGGS, LE, SSGG, GG, GGGGG, or GGGGSGGGGG.
[0081] In one embodiment, the linker can comprise a degradable peptide sequence that is cleavable by an intracellular enzyme, e.g., a protease, and cleavage of the linker can result in release of any moiety attached to the linker, e.g., an affinity tag or a carrier protein.
[0082] The term "linked" means that components are directly or indirectly linked together. Each component can be covalently or non-covalently linked. "Linked" can also mean that each component maintains a chemical or physical bond after contact with cells, such as antigen-presenting cells or immune cells, and immunization. For example, the components can be linked so that they do not freely disperse from each other until they are contacted with antigen-presenting cells and immune cells. For example, two components can be covalently linked to each other to prevent the two components from dispersing or diffusing separately.
[0083] For example, the size of the fusion protein of the present application is not particularly limited, but a small size may be advantageous, for example, to facilitate the removal of impurities during the purification process. In this aspect, the overall size of the fusion protein may be, but is not limited to, 500 kDa or less, 400 kDa or less, 300 kDa or less, 200 kDa or less, 100 kDa or less, 90 kDa or less, 80 kDa or less, 70 kDa or less, 60 kDa or less, or 50 kDa or less, for example, 10 kDa to 100 kDa, 10 kDa to 90 kDa, 10 kDa to 80 kDa, 10 kDa to 70 kDa, 10 kDa to 60 kDa, 10 kDa to 50 kDa, 10 kDa to 40 kDa, or 10 kDa to 30 kDa. Another example of the present application relates to a nucleic acid molecule encoding the fusion protein.
[0084] The terms "nucleic acid molecule," "nucleic acid," or "nucleic acid sequence" refer to a polymer of deoxyribonucleotides or ribonucleotides that exists in single- or double-stranded form. The nucleic acid molecule encompasses RNA genomic sequences, cDNA, and RNA sequences transcribed therefrom, and includes analogs of naturally occurring nucleic acids, unless otherwise specified.
[0085] The nucleic acid molecule includes not only a nucleic acid sequence encoding the amino acid sequence of the fusion protein but also a complementary sequence to that sequence. The complementary sequence includes not only a completely complementary sequence but also a substantially complementary sequence, which means a sequence that can hybridize to, for example, a nucleic acid sequence encoding the amino acid sequence of the fusion protein under stringent conditions known in the art.
[0086] The fusion protein of the present application can be preferably, but not limited to, expressed and purified by recombinant methods. Therefore, the present invention further provides an expression vector containing a nucleic acid molecule encoding the fusion protein, and a cell transformed therewith, for expression and purification of the fusion protein.
[0087] Another example of the present application relates to an expression vector comprising said nucleic acid molecule.
[0088] The term "expression vector" refers to a nucleic acid construct in which a gene insert encoding a protein of interest is operably linked for expression. In one embodiment, the expression vector may be linear or circular, single- or double-stranded DNA, cDNA, RNA, etc., encoding two or more proteins of interest. An expression vector can be part of, but is not limited to, a vector that can be used to transform, transfect, or transfect a host, and may itself be transcribed and / or translated in vitro.
[0089] The term "operably linked" refers to a bond between nucleic acid sequences that is functionally related. For example, a coding sequence (e.g., a sequence encoding a protein of interest) can be operably linked to appropriate regulatory elements to enable its replication, transcription, and / or translation. For example, a coding sequence is operably linked to a promoter if the promoter is capable of driving the transcription of the coding sequence. Regulatory elements need not be contiguous with the coding sequence, so long as they function properly. For example, intervening sequences that are not translated, but are transcribed, can be present between the promoter sequence and the coding sequence, and the promoter sequence would still be considered "operably linked" to the coding sequence.
[0090] The components within the expression vector must be operably linked to each other, and linking of these component sequences may be accomplished by ligation at convenient restriction enzyme sites or, if such sites do not exist, by the use of synthetic oligonucleotide adapters or linkers by conventional methods.
[0091] An expression vector can contain transcriptional and coding expression control sequences that allow the gene to be expressed in a selected host. Expression control sequences can include a promoter for transcription, an optional operator sequence for regulating the transcription, and / or a sequence for regulating the termination of transcription and coding. Initiation and termination codons are generally considered part of the nucleic acid sequence encoding the protein of interest, and must be functional in an individual when the gene construct is administered, and must be in frame with the coding sequence.
[0092] For example, a promoter refers to a DNA base sequence site to which a transcriptional regulatory factor binds, and for the purposes of the present invention, a promoter capable of inducing strong and stable gene expression can be used to increase the gene expression rate.
[0093] The promoter may be constitutive or inducible. Examples of promoters include, but are not limited to, the early and late promoters of adenovirus, simian virus 40 (SV40), mouse mammary tumor virus (MMTV) promoter, the long terminal repeat (LTR) promoter of HIV, Moloney virus, cytomegalovirus (CMV) promoter, Epstein-Barr virus (EBV) promoter, Rous sarcoma virus (RSV) promoter, RNA polymerase ± promoter, T3 and T7 promoters, and the major operator and promoter regions of phage lambda.
[0094] Additionally, expression vectors can include adaptors or linkers, enhancers, selection markers (e.g., antibiotic resistance markers), replicative units, polyA sequences, purification tags, or other constitutive and inducible sequences known to regulate gene expression in prokaryotic or eukaryotic cells or viruses, as well as various combinations thereof, as appropriate.
[0095] The expression vector may be in various forms such as a plasmid, a virus vector, a bacteriophage vector, or a cosmid vector.
[0096] Another example of the present application relates to cells transformed with said expression vectors.
[0097] In the present invention, the transformed cells can be any host cells known in the art that can stably and continuously clone or express the expression vector. Prokaryotic cells include E. coli, e.g., E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X1776, E. coli W3110, Bacillus strains such as Bacillus subtilis and Bacillus thuringiensis, and enterobacteriaceae and strains such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species. When transforming eukaryotic cells, host cells include yeast (Saccharomyce cerevisiae), insect cells, plant cells, and animal cells, e.g., CHO cell lines (Chinese hamster ovary (CHO) cell lines). ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines can be used, but are not limited to these.
[0098] As is known in the art, expression vectors can be introduced into cells using suitable standard techniques, including, but not limited to, electroporation, electroinjection, microinjection, calcium phosphate co-precipitation, calcium chloride / rubidium chloride, retroviral infection, DEAE-dextran, cationic liposomes, polyethylene glycol-mediated uptake, and gene guns. In this case, circular constructs can be cleaved with appropriate restriction enzymes to introduce them in a linear form.
[0099] The transformed cells can be easily selected by a method well known in the art using the phenotype expressed by the selection marker. For example, when the selection marker is a specific antibiotic resistance gene, the transformants can be easily selected by culturing them in a medium containing the antibiotic.
[0100] The transformed cells can be cultured by various methods known in the art. For example, the transformed cells can be inoculated into a culture medium and cultured. When the cell density reaches a certain level, IPTG is added to the medium to induce protein expression, and the cells can be cultured to obtain the protein secreted into the cells or the medium.
[0101] Proteins secreted into cells or the medium can be purified by various purification methods known in the art, preferably by affinity chromatography using an affinity tag. For example, if the fusion protein is fused to GST, the desired protein can be easily purified using a glutathione-bound resin column, and if it is fused to His, the desired protein can be easily purified using IMAC (immobilized metal affinity chromatography).
[0102] Another example of the present application relates to a vaccine or immunogenic composition comprising said fusion protein, nucleic acid molecule, expression vector, or cell.
[0103] Yet another example of the present application relates to a composition for preventing or treating cancer, an infectious disease, an autoimmune disease, or an allergic disease, comprising the fusion protein, the nucleic acid molecule, the expression vector, or the cell.
[0104] The term "immunogenic composition" refers to any composition capable of inducing an immune response. The term "vaccine" refers to an immunogenic composition that induces an immune response to reduce or prevent the risk of disease or infection, or to ameliorate or treat an existing disease or infection.
[0105] These compositions may contain the fusion protein of the present application and be in a dosage form that can be administered to a subject to induce an immune response. Therefore, the compositions of the present invention can be conveniently used to prevent, ameliorate, or treat diseases. After being introduced into a subject or host, the compositions can induce an immune response, preferably a T-cell-mediated immune response.
[0106] The vaccine of the present invention may be an anti-cancer vaccine containing tumor antigens, e.g., tumor antigen sequences obtained from patient tumor analysis, particularly neoantigen sequences, which can maximize the stimulation of proliferation and activation of anti-cancer T cells tailored to the patient, thereby enhancing the anti-cancer immune effect.
[0107] The vaccine compositions of the present application may also include additional adjuvants that enhance the effectiveness of the vaccine.Suitable immunopotentiators include: (1) aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, and the like; (2) oil-in-water emulsion formulations (with or without specific immunostimulants such as muramyl peptides or bacterial cell wall components), such as (a) 5% squalene, 0.5% Tween 80, and 0.5% Span 85 formulated into submicron particles (optionally, but not necessarily, containing various amounts of N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1',2')-2-methyl-N ... (b) MF59 (WO 90 / 14837) containing N-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE), (c) SAF containing 10% squalene, 0.4% Tween 80, 5% Pluronic-blocked polymer and N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP) microfluidized to submicron particles or shaken to produce a large particle size emulsion, and (d) monophosphoryl lipid A (MPL), (3) Ribi™ Immunoadjuvant System (RAS) containing trehalose dimycolate (TDM) and one or more bacterial cell wall components selected from the group consisting of cell wall skeleton (CWS), 2% squalene, and 0.2% Tween 80; (4) saponin immunoadjuvant; (5) Freund's complete immunoadjuvant (CFA) and incomplete immunoadjuvant (IFA); (6) cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g., gamma (6) bacterial ADP-ribosylating toxins, such as cholera toxin (CT), pertussis toxin (PT), or heat-labile toxin (LT) of Escherichia coli (E. coli), particularly detoxified mutants of LT-R72, CT-S109, and PT-K9 / G129 (WO93 / 13302 and WO92 / 19265); and (7) other substances that act as immunostimulants to enhance vaccine efficacy.
[0108] The compositions of the present application may, if necessary, additionally contain pharmaceutically acceptable carriers, diluents and / or excipients in amounts normally used.
[0109] The pharmaceutically acceptable carriers are those commonly used in formulations, and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. In addition to the above ingredients, the composition may additionally contain lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.
[0110] The fusion protein or a composition containing it as an active ingredient may be produced in unit dose form or in multi-dose containers by formulating it with pharmaceutically acceptable carriers and / or excipients by a method that can be easily carried out by a person skilled in the art.
[0111] For example, vaccine compositions can contain a conventional saline or buffered aqueous medium in which the vaccine is suspended or dissolved. For example, conventional diluents, such as water, saline, glycerol, ethanol, etc., can be included, and auxiliary substances, such as wetting agents, emulsifying agents, pH buffering agents, and the like, can be present in the composition.
[0112] Suitable forms for injection include sterile aqueous solutions (water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. These must be stable under the conditions of manufacture and preserved against the contamination of microorganisms such as bacteria and fungi. Microbial contamination can be prevented using various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it is preferable to include an isotonic agent, for example, sugar or sodium chloride. Prolonged absorption of injectable compositions can be achieved by using agents that delay absorption, for example, aluminum monostearate or gelatin, in the composition.
[0113] Sterile injectable solutions are prepared by combining the required amount of fusion protein and various other ingredients listed above in the aforementioned solvent, and sterilizing the remaining ingredients, excluding the fusion protein and / or heat-sensitive immunoadjuvant cytokines, if necessary, using a buffer solution such as PBS, through filtration. Generally, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle containing a basic dispersion medium and the other required ingredients listed above. For sterile powders for the preparation of sterile injectable solutions, preferred methods are vacuum drying and freeze-drying. These methods yield powders of the active ingredient and any desired ingredients from the sterile-filtered solution described above.
[0114] The patient to whom the fusion protein or a composition containing the same as an active ingredient is administered may be a mammal, such as a human, a primate including a monkey, or a rodent including a rat or a mouse, but is not limited thereto.
[0115] Yet another aspect of the present invention provides a method for generating, inducing, or enhancing an immune response to an antigen, comprising administering to a patient an effective amount of the fusion protein, vaccine composition, and / or immunogenic composition.
[0116] The method of generating, inducing, or enhancing an immune response to an antigen may relate to a method of generating, inducing, or enhancing an immune response to an antigen in a cancer patient, for example, comprising administering to the cancer patient.
[0117] The term "immune response" refers to a change in the activity of cells of the immune system, e.g., B cells, T cells, or monocytes, as a result of direct or indirect cellular or cytokine-mediated stimulation. The immune response may be a specific (T cell and / or B cell) and / or non-specific immune response.
[0118] Without limiting the operation of the present invention in any way, delivery of fusion proteins according to the present invention is particularly useful for inducing immune responses, particularly T cell responses, e.g., CD4+ T cell responses or CD8+ T cell responses to antigens. CD4+ and CD8+ T cell responses can occur together with or independently of humoral responses or other specific or nonspecific immune responses.
[0119] Yet another aspect of the present invention relates to the use of the fusion proteins of the present invention in connection with the treatment and / or prevention of disease states. Examples of diseases that can be treated by the methods of the present invention include various cancers, infectious diseases, autoimmune diseases, and allergic diseases.
[0120] For example, the cancer may be a solid cancer or a blood cancer, and non-limiting examples include breast cancer, lung cancer, prostate cancer, ovarian cancer, brain cancer, liver cancer, cervical cancer, endometrial cancer, uterine cancer, colon cancer, colorectal cancer, rectal cancer, kidney cancer, nephroblastoma, skin cancer, oral squamous cell carcinoma, epidermal cancer, nasopharyngeal cancer, head and neck cancer, bone cancer, esophageal cancer, bladder cancer, lymphatic cancer (e.g., Hodgkin's lymphoma or non-Hodgkin's lymphoma), stomach cancer, pancreatic cancer, and the like. The cancer may be cancer, testicular cancer, thyroid cancer, thyroid follicular cancer, melanoma, myeloma, multiple myeloma, mesothelioma, osteosarcoma, myelodysplastic syndrome, tumor of mesenchymal origin, soft tissue sarcoma, liposarcoma, gastrointestinal stromal sarcoma, malignant peripheral nerve sheath tumor (MPNST), Ewing's sarcoma, leiomyosarcoma, mesenchymal chondrosarcoma, lymphosarcoma, fibrosarcoma, rhabdomyosarcoma, teratocarcinoma, neuroblastoma, medulloblastoma, neuroglioma, benign tumor of the skin, or leukemia. The lung cancer may be, for example, small cell lung carcinoma (SCLC) or non-small cell lung carcinoma (NSCLC). The leukemia may be, for example, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL), or chronic lymphocytic leukemia (CLL). The treated subject may be undergoing secondary anti-hyperproliferative therapy. For example, the secondary anti-hyperproliferative therapy can be chemotherapy, radiation therapy, immunotherapy, phototherapy, cryotherapy, toxin therapy, hormone therapy, or surgery.
[0121] Thus, yet another aspect of the present invention provides a method for preventing, ameliorating, and / or treating cancer, an infectious disease, an autoimmune disease, or an allergic disease, comprising administering to a patient an effective amount of a fusion protein, vaccine composition, and / or immunogenic composition. The method for preventing, ameliorating, and / or treating may be a method for preventing, ameliorating, and / or treating a disease, such as cancer, an infectious disease, an autoimmune disease, or an allergic disease, by enhancing an immune response, wherein administering to a patient an effective amount of the fusion protein, vaccine composition, and / or immunogenic composition generates, induces, or promotes an immune response that inhibits, halts, delays, or prevents the onset or progression of a disease state.
[0122] The direct delivery of the composition can generally be systemic, subcutaneous, intradermal, intraperitoneal, intravascular (intravenous), intramuscular, or local delivery, or delivered to tissue gaps. The composition can also be administered to a lesion. The administration regimen can be a single dose or a multiple dose schedule.
[0123] The term "effective amount" means an amount sufficient to achieve a desired result when administered to an individual, including a human, e.g., an amount effective to treat or prevent cancer. The effective amount can vary depending on factors such as the disease state, age, sex, and weight of the individual. Dosage or treatment regimen can be adjusted to provide the optimal therapeutic response, as will be appreciated by those skilled in the art.
[0124] A therapeutic regimen for an individual using a therapeutically effective amount may consist of a single administration or, as another example, may include a series of applications. The duration of the treatment period will depend on various factors, such as the severity of the disease, the individual's age, the concentration of the vaccine, the patient's responsiveness to the vaccine, or a combination thereof. It will also be understood that the effective dosage of the vaccine used for treatment may increase or decrease over the course of an individual treatment regimen. Dosage variations may occur and may be determined by standard diagnostic assays known in the art. The vaccines of the present invention, e.g., cancer vaccines, can be administered before, during, or after treatment using conventional anticancer drugs, radiation therapy, hormone therapy, biotherapy, and / or surgical tumor resection. [Effects of the Invention]
[0125] The present invention relates to a fusion protein comprising a peptide antigen containing a T cell epitope and a carrier protein linked to the N-terminus, C-terminus, or both, of the peptide antigen; a nucleic acid molecule encoding the fusion protein; an expression vector containing the nucleic acid molecule; a cell transformed with the expression vector; and an immunogenic composition comprising the fusion protein, nucleic acid molecule, expression vector, or cell, which has the effect of improving antigen expression, physical properties, stability, and / or immunogenicity, and improving antigen delivery to immune response cells. [Brief explanation of the drawings]
[0126] [Figure 1] 1 shows the results of SDS-PAGE confirming the production of a fusion protein prepared according to one example of the present application. [Figure 2] 1 shows the results of a purity test (SE-HPLC) of a fusion protein prepared according to an embodiment. [Figure 3] 1 shows the results of endotoxin content by size exclusion chromatography fractionation of a fusion protein prepared according to an example of the present application. [Figure 4] 1 shows the results of tumor suppression effect when an anti-cancer vaccine prepared according to an example of the present application is administered to an MC38 mouse model. [Figure 5] 1 shows the results of tumor suppression effect when an anti-cancer vaccine prepared according to an example of the present application is administered to a CT26 mouse model. [Figure 6] 1 shows the results of TIL analysis after administration of an anti-cancer vaccine prepared according to an example of the present application to an MC38 mouse model. [Figure 7] 1 shows the results of TIL analysis after administration of an anti-cancer vaccine prepared according to an example of the present application to a CT26 mouse model. [Figure 8] 1 shows the results of TIL analysis after administration of an anti-cancer vaccine prepared according to an example of the present application to a B16-F10 mouse model. [Figure 9] 1 shows the structure of a fusion protein according to one embodiment of the present application. DETAILED DESCRIPTION OF THE INVENTION
[0127] The present invention will be described in more detail below with reference to the following examples, which are merely for illustrative purposes and are not intended to limit the scope of the present invention.
[0128] Example 1. Epitope Selection To identify the mouse mutations and select the MHC binding epitopes, we performed whole exome sequencing (WES) of cancer and normal cells, and mRNA sequencing to identify the presence or absence of mutant gene expression. Analysis of the WES results identified mutations that altered the protein sequence (missense mutations, frameshift mutations, and insertion-deletions) and the mouse MHC type.
[0129] Specifically, we used mouse tail tissue as normal cells and mouse melanoma cell line B16-F10 and mouse colon carcinoma cell lines MC38 and CT26 for next-generation sequencing (NGS). NGS was performed using Macrogen, and WES was performed using the Mutect2 algorithm to analyze missense single-nucleotide polymorphism (SNP) mutations. Using SNPs as a reference, we identified 27-mer amino acids by adding 13-mer sequences before and after.
[0130] In mRNA sequencing, only genes with expression levels, i.e., RPKM (Reads Per Kilobase Million) values of 10 or higher, were selected from the WES sequencing results.
[0131] The resulting epitope sequences were entered into the publicly available NetMHCCons and NetMHCPanII programs. The MHC type was entered based on the phenotype appropriate for mouse, and the Strong Binding (SB) and Weak Binding (WB) criteria were set to default. NetMHCCons analyzed 9-mer sequences, and NetMHCPanII analyzed 13-mer sequences. The sequences were then entered into the IEBD Immunogenicity program, where they were analyzed 9-mer sequences and scores were entered.
[0132] Predicted Score = 10 × NetMHCCons Number of Binders +Number of NetMHCPanII Binders +IEDB Immunogenicity Score Assuming that the higher the prediction score, the greater the probability of efficacy, the top 20 were selected and all were confirmed to elicit immune responses. From these, substances that elicited immune responses or were easy to manufacture were selected and evaluated for anti-cancer efficacy. Furthermore, fusion proteins for anti-cancer vaccines were produced using these selected epitopes.
[0133] [Table 1] Epitopes (In the table below, "CT + number" is an arbitrarily named neoantigen number for the CT26 colon cancer cell line, "M + number" is an arbitrarily named neoantigen number for the melanoma cell line (B16-F10), "OVA" means an ovalbumin antigen, and Cpne1, Irgq, and Aatf represent neoantigens for the MC38 colon cancer cell line) [Table 1]
[0134] Example 2. Selection of Carrier Protein 2-1. Carrier protein design Neoantigens induce T-cell immunity by binding to MHC-I (Major Histocompatibility Complex-I) or MHC-II proteins, but synthetic long peptides (SLPs) containing neoantigens are generally known to have a short half-life in the body and low solubility depending on the sequence. To overcome these shortcomings of SLPs, we attempted to produce fusion proteins of neoantigens and carrier proteins, which were expressed in Escherichia coli and purified.
[0135] The neoantigen was expressed in an ORF (Open Reading Frame) composed of (CP1)-(Linker 1)-(Neoantigen)-(Linker 2)-(CP2)-(Linker 3)-(His-tag). Because neoantigens vary from patient to patient, CP1, which is well expressed in E. coli, was placed at the N-terminus of the ORF to ensure consistent expression at a certain level in E. coli. Furthermore, to address the potential for purification difficulties depending on the neoantigen sequence, the structurally stable CP2 was placed at the C-terminus of the ORF. Furthermore, because the physicochemical properties of the expressed antigen sequences vary, a His-tag affinity tag was placed at the C-terminus of the ORF to enable antigen purification regardless of the antigen sequence characteristics. CP2 was placed between the antigen and His-tag to ensure that any antigen sequence would not interfere with affinity tag purification, and the main components of the ORF were linked by a linker composed of glycine and serine. The types of carrier proteins used in this invention are as follows:
[0136] [Table 2] Carrier proteins [Table 2-1] [Table 2-2]
[0137] 2-2. Production results of neoantigen fusion proteins by carrier protein Because the protein sequences of neoantigens used in anticancer vaccines are different, even when fused to a carrier protein, their pI and hydrophobicity vary depending on the protein sequence, making it difficult to purify all antigens using ion exchange chromatography or hydrophobic interaction chromatography. For this reason, we attempted to purify antigen proteins using affinity. We selected a His-tag, which has a small tag size of six histidine amino acids and a high protein binding capacity of 20 mg per mL of resin, as an affinity tag. We also created and compared a neoantigen-specific structure at the N-terminus. We introduced an MBP tag to the N-terminus, expressed and purified it, and then cleaved it with TEV protease to produce the antigen. The antigen purified using the affinity tag was then polished using size-exclusion chromatography (SEC). The cloning, culture, and purification methods were the same as in Example 3. The results of producing neoantigen fusion proteins bound to each carrier protein are as follows.
[0138] [Table 3] Production results of neoantigen fusion proteins by carrier protein [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7]
[0139] Example 3. Production of therapeutic recombinant anti-cancer vaccines 3-1. Vector construction When synthesizing fusion proteins, if the insert length was short (up to 400 mer), approximately six 60-90 mer oligos were obtained and then overlap PCR was performed. If the insert length was long, restriction enzyme sites were attached to both ends of the sequence by gene synthesis. The primer and backbone sequences required for each construct are summarized in Tables 5 and 6. The sequence and backbone vector were treated with restriction enzymes for 1 hour, followed by gel extraction. The resulting gene fragment was treated with ligase for 1 hour and then transformed into E. coli.
[0140] The fusion protein sequence consists of a carrier protein, an epitope, and a tag sequence for purification. The desired sequence was generated by overlap PCR or gene synthesis and then inserted into a vector. To allow for the continual modification of epitope sequences selected through tumor sequencing, the sequence and order of the fusion protein were determined. Separate restriction enzyme sites were inserted before and after the epitope insertion site, allowing for convenient insertion of the desired epitope sequence via oligo synthesis. To insert additional sequences, such as epitopes, two single base sequences (5'>3' and 3'>5' oligos) were added via annealing, followed by insert cloning. If the additional sequence was longer, the number of inserts was increased.
[0141] For PCR, primer, template, polymerase premix, and DW were added and denatured at 95°C for 1 minute, followed by 25 cycles of 95°C for 10 seconds, 60°C for 10 seconds, and 72°C for 30 seconds. Extension was performed at 72°C for 2 minutes, and finally at 12°C for 5 minutes in a PCR machine. The sequence and backbone vector were treated with restriction enzymes for 1 hour, followed by gel extraction. The resulting gene fragment was treated with ligase for 1 hour and then transformed into E. coli. For insert construction by oligo annealing, two complementary oligonucleotide sequences were mixed at equal concentrations of 1 μM and incubated at 95°C for 5 minutes with a ramp rate of 0.1°C / sec, cooled to 50°C, and then incubated for 10 minutes. The primers, backbone sequences, and restriction enzyme sites required for each construct are summarized in Table 5.
[0142] First, all the constructed vector backbones were derived from pMAL-c2x, pRK793, pET-Duet, and pET28a(+). In the case of pET28a(+), to change the restriction enzyme site, PCR was performed using the pET-Duet vector as a template and backbone F1 and backbone R1 primers. The fragment was then cut using the restriction enzymes XbaI and XhoI sites and inserted into pET-28a(+), creating a pET-Backbone vector that can be used as a different enzyme site from the existing one.
[0143] To express epitopes via ubiquitin fusion, we performed PCR using the pTr-Ub-E1 fragment (gene synthesised by Cosmogenetech) as a template with UB_NdeI F and UB_SalI R. The resulting vector was then digested with NdeI-SalI along with the previously prepared pET-Backbone vector to create the pUB-E1 vector. The NdeI-SacI site in this vector was available, and this enzyme site was used to construct other vectors.
[0144] The process for constructing vectors to express the two fusion proteins (hTrx-epitope-PSBD, TM1112-epitope-PSBD) used in the efficacy evaluation of anti-cancer vaccines is as follows. First, for the hTrx fusion vector (all hTrx used in the efficacy evaluation was the same as hTrx.v3 in Table 2), a backbone vector designed to allow epitope insertion was constructed using two BsaI sites located between two carrier proteins in the order hTrx-BsaI enzyme site-PSBD-His, and various epitopes were then inserted. Overlap PCR was performed to construct the vectors.PCR was performed using the nucleotide sequence of hTrx.v1 synthesized by Cosmogenetech as a template and hT NdeI F (GCGCATATGGTTAAACAAATTGAGTCGAAAAC: SEQ ID NO: 108) and hTrx.v3 R (TATCATTTTAGATGGACCAGACCAAGTGGCTGAGAAGTCAACTACGAC: SEQ ID NO: 109) as primers to produce a first template. PCR was performed using the hTrx.v1 sequence as a template and hTrx.v3 F (CACTTGGTCTGGTCCATCTAAAATGATAAAGCCTTTTTTCCACTCGTTGAG: SEQ ID NO: 110) and hT BsaI R1 (TGAGACCCAGCGTTGCGGGTCTCTTCCTCCACCACCACCGACCAGTT: SEQ ID NO: 111) as primers to produce a second template. Overlap PCR was then performed using the hT NdeI F and hT BsaI R as a second template and hTrx.v3F and hT BsaI R as primers. The product was used again as the first template. Using the PSBD sequence synthesized by Cosmogenetech as a template, PCR was performed with BsaI F (agagaccCGCAACGCTGggtctcaGGTGGTGGTGgaGgaGTTATCGCT: SEQ ID NO: 100) and PSBD R (CGACGAGCTCTCAATGGTGGTGATGGTGATGTCCGCCAGCCAGCCACGCGTCGATGTCTTCTTTCAGAACACGG: SEQ ID NO: 101) to form the second template. Overlap PCR was performed using the forward primer for the PCR product, hT NdeI F, and the reverse primer for the PCR product, PSBD R, as primers. This was then cut with NdeI and SacI and ligated into backbone vectors constructed based on pET-28 and pET-Duet, respectively, to generate the hTrx-BsaI enzyme site-PSBD-His vector.
[0145] Subsequently, an epitope expression vector constructed based on the hTrx-BsaI enzyme site-PSBD-His vector showed better physical properties than other carrier proteins in expressing several epitopes. However, MASS analysis revealed that cleavage of the 27th glutamine of PSBD was observed. Based on this paper, which showed that this phenomenon was reduced when this sequence was substituted with A / S / T / G, we confirmed the stability of each substitution after expression of MBP-TEV-PSBD by TEV cleavage. However, no significant effect was observed when expressed alone, so we constructed the N27G substitution, which was predicted to be the most efficient, and named it PSBD_G. This vector was prepared by PCR using the original hTrx-BsaI enzyme site-PSBD-His vector as a template and G (TCAGGGTACCGGTAAAGGTGGCCGTGTTCTGAAAGAAGACATCG: SEQ ID NO: 142) and T7 R 63 (TTCGCCAATCCGGATATAGTTCCTCCTTTC: SEQ ID NO: 120) as primers. This vector was then cleaved with KpnI and BlpI along with the original hTrx-BsaI enzyme site-PSBD-His vector to be ligated, and the hTrx.v3-BsaI-PSBD_G-His vector was prepared by ligation.
[0146] A vector constructed based on hTrx.v3-BsaI-PSBD_G-His, in which PSBD_G was substituted, showed reduced cleavage. To further complement the physical properties, a form was constructed in which the linker length between the epitope and carrier protein was extended with a GS linker of 10 amino acids in total, GGGGS. PCR was performed using the hTrx.v3-BsaI-PSBD_G-His vector as a template and T7 F 63 (GTCCGGCGTAGAGGATCGAGATCTC: SEQ ID NO: 131) and G10R (tgagaccCAGCGTTGCGggtctctgcCgcCaCCgCCaCCgcttcCACCACCACCGACCAGTTCATTAATCGTAGCTTCTAAT: SEQ ID NO: 143) as primers as the first template. Similarly, PCR was performed using the hTrx.v3-BsaI-PSBD_G-His vector as a template and G10F (agagaccCGCAACGCTGggtctcaGGcGGTGGcGgtGgtagcGGTGGTGgaGgaGTTATCGCTATGCCGTCCGTACGCAAAT: SEQ ID NO: 144) and T7 R 63 (TTCGCCAATCCGGATATAGTTCCTCCTTTC: SEQ ID NO: 120) as primers as the second template. Overlap PCR was performed using primers T7 R 63 and T7 R 63 to insert the fragments, which were then cleaved with BglII and SacI and ligated into the hTrx.v3-BsaI-PSBD_G-His vector to prepare the hTrx.v3-G10_BsaI-PSBD_G-His vector.
[0147] Next, in the case of the TM1112 fusion vector, the first platform created was TM1112-BsaI-PSBD-His, a vector designed to allow the insertion of an epitope using two BsaI sites located between the two carrier proteins. This vector, in the form of carrier protein 1-epitope-carrier protein 2-His, was created by screening various forward carrier proteins in addition to TM1112. Overlap PCR was performed to create the vector. Using the TM1112 nucleotide sequence synthesized by Cosmo Genetech as a template, PCR was performed using TMF (TAGCGCATATGGAAGTTAAAATCGAGAAACCGACTCCGGAAAA; SEQ ID NO: 98) and TM1R (TGAGACCCAGCGTTGCGGGTCTCTTCCTCCACCACCACCGAACAGGTT; SEQ ID NO: 99) as primers to produce the first template. The PSBD sequence synthesized by Cosmo Genetech was used as a template, and PCR was performed using BsaI F and PSBD R as primers to produce the second template. This template was inserted by overlap PCR using TMF and PSBD R as primers, and this was then cut with NdeI and SacI and ligated into backbone vectors constructed based on pET-28 and pET-Duet, respectively, to produce the TM1112-BsaI-PSBD-His vector.
[0148] Furthermore, an epitope expression vector constructed based on TM1112-BsaI-PSBD-His showed better physicochemical properties for expressing several epitopes than other carrier proteins. However, similar to the hTrx vector, MASS analysis revealed that cleavage of the glutamine 27 of PSBD was observed. Substitution of this sequence with A / S / T / G reduced this phenomenon. Based on this paper, we confirmed the stability of each substitution by TEV cleavage after MBP-TEV-PSBD expression. However, expression alone did not show a significant effect. Therefore, we constructed the N27G substitution, which we named PSBD_G, as predicted to be the most efficient. To construct this vector, we first used TM1112-BsaI-PSBD-His as the vector, and then digested hTrx.v3-BsaI-PSBD_G-His, in which PSBD was substituted with G, with KpnI-BlpI inserts. Following ligation, the TM1112-BsaI-PSBD_G-His vector was generated.
[0149] The PSBD_G-substituted vector constructed based on TM1112-BsaI-PSBD_G-His showed reduced cleavage, but to further complement the physical properties, we constructed a form in which the linker length between the epitope and carrier protein was extended with a GS linker of 10 amino acids in total, GGGGS. PCR was performed using the TM1112-BsaI-PSBD_G-His vector as a template and T7 F 63 (GTCCGGCGTAGAGGATCGAGATCTC: SEQ ID NO: 131) and TM_G10_R (TGAGACCCAGCGTTGCGGGTCTCTTCCTCCACCACCACCGCTTCCACCACCACCGAACAGGTTGTAGTGCATACGAACAGG: SEQ ID NO: 145) as primers as the first template. Similarly, PCR was performed using the pc1068 vector as a template and TM_G10_F (AGAGACCCGCAACGCTGGGTCTCAGGTGGCGGCGGTGGTAGCGGTGGTGGAGGAGTTATCGCTATGCCGTCCGTACGCAAAT: SEQ ID NO: 146) and T7 R 63 (TTCGCCAATCCGGATATAGTTCCTCCTTTC: SEQ ID NO: 120) as primers as the second template. This was used as an overlapping primer with T7 F 63 and T7 R 63. The PCR fragment was inserted into the TM1112-BsaI-PSBD_G-His vector, which was then digested with BglII and SacI and ligated to prepare the TM1112-G10_BsaI-PSBD_G-His vector.
[0150] The 10 anti-cancer vaccines and other epitope expression vectors used in the purification examples were produced by ligating two annealed oligos to the BsaI site.
[0151] In the case of TM-M30-PS, TM1112-BsaI-PSBD-His was cleaved with BsaI, and two nucleotide oligomers, M30 F (aGgaCCGAGCAAACCGTCGTTTCAGGAATTTGTGGACTGGGAAAACGTGTCGCCGGAACTGAaCAGCACCGATCAGCCGTTTCTG: SEQ ID NO: 102) and M30 R (CACCCAGAAACGGCTGATCGGTGCTGtTCAGTTCCGGCGACACGTTTTCCCAGTCCACAAATTCCTGAAACGACGGTTTGCTCGG: SEQ ID NO: 103), were added by an annealing process, followed by ligation with the cleaved vector to complete the construction.
[0152] TM-CT5-PS was prepared by overlap PCR of three fragments. The first fragment was prepared by PCR using the TM sequence synthesized by Cosmo Genetech as a template and TMF and TM R5 (GCTCACCATAAACAGCTGCGGCATAATCGCCACGCTTTCCAGATAAATTCCTCCACCACCACCGAACAGGTTGT; SEQ ID NO: 104) as primers. The second fragment was prepared by PCR using the PSBD sequence synthesized by Cosmo Genetech as a template and CT5 F2 (GCGATTATGCCGCAGCTGTTTATGGTGAGCAAAGGCGGTGGTGGAGGAGTTATCGCTATGCCGTCCGTACGCAAATATGCACGTGAAA; SEQ ID NO: 105) and PSBD R as primers. Overlap PCR was then performed using these two fragments as templates and TMF and PSBD R as primers. This and the pET-backbone vector were treated with restriction enzymes NdeI-SacI, and then ligated to prepare a vector.
[0153] hT-M12-PS was constructed by cleaving the hTrx-BsaI-PSBD-His vector with BsaI, and then annealing two nucleotide oligomers, M12 F (aGgaACCCCGCCGCCGGAAGAAGCGATGCCGTTTGAATTTAATGGTCCGGCGCAGGGTGATCATAGCCAGCCGCCGCTGCAGGTG: SEQ ID NO: 115) and M12 R (CACCCACCTGCAGCGGCGGCTGGCTATGATCACCCTGCGCCGGACCATTAAATTCAAACGGCATCGCTTCTTCCGGCGGCGGGGT: SEQ ID NO: 116), followed by ligation with the cleaved vector.
[0154] hT-CT25-PS was constructed by cleaving the hTrx-BsaI-PSBD-His vector with BsaI, and then adding two nucleotide oligomers, CT25 F (aGgaCTGCATCTGGAAGAAACCCTGGCGGGCTTTTGGGCGCGCCTGCTGGAAcgc: SEQ ID NO: 117) and CT25 R (CACCgcgTTCCAGCAGGCGCGCCCAAAAGCCCGCCAGGGTTTCTTCCAGATGCAG: SEQ ID NO: 118), through an annealing process, followed by ligation with the cleaved vector.
[0155] TT-hT-M30-PS was prepared by first cleaving the hTrx-BsaI-PSBD-His vector prepared above with BsaI, and then adding two nucleotide oligomers, M30 F (aGgaCCGAGCAAACCGTCGTTTCAGGAATTTGTGGACTGGGAAAACGTGTCGCCGGAACTGAaCAGCACCGATCAGCCGTTTCTG; SEQ ID NO: 102) and M30 R (CACCCAGAAACGGCTGATCGGTGCTGtTCAGTTCCGGCGACACGTTTTCCCAGTCCACAAATTCCTGAAACGACGGTTTGCTCGG; SEQ ID NO: 103), through an annealing process. The resulting oligomer was then ligated with the cleaved vector. To add a TT sequence at the front, htrx TT F (GCAAATTTATTGGCATTACCGAACTGGGCGGCGGCGGGTCTATGGTTAAACAAATTGAGTCGAAAACCG; SEQ ID NO: 119) and T7 R 63 After performing PCR once with the primer, PCR was performed again with TTF (GCGGCATATGCAGTATATTAAAGCGAACAGCAAATTTATTGGCATTACCGAACTG: SEQ ID NO: 121) and T7 R 63 primer, and then a vector was prepared via the NdeI-SacI site with the pET-Backbone vector.
[0156] TT-hT-CT5-PS was prepared by first cleaving the previously prepared hT-BsaI-PS with BsaI, and then annealing two nucleotide oligomers, CT5 F (aGgaATTTATCTGGAAAGCGTGGCGATTATGCCGCAGCTGTTTATGGTGAGCAAA; SEQ ID NO: 122) and CT5 R (CACCTTTGCTCACCATAAACAGCTGCGGCATAATCGCCACGCTTTCCAGATAAAT; SEQ ID NO: 123), to the resulting fragment. The resulting fragment was then ligated with the cleaved vector. To add the TT sequence at the front, PCR was performed once with htrx TT F and T7 R primers, followed by another PCR with TTF and T7 R primers. The vector was then prepared via the NdeI-SacI site with the pET-Backbone vector.
[0157] TT-CS-M21-PS was prepared by first performing PCR using CSTA as a template with CSTA F (gcgaCTAGtAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGATCCCAGGAGGTCTGTCTGAAGCTAAGcc: SEQ ID NO: 124) and CS_OVA R (CTGTTCCAGACCGCTAACTTCATCGGATCCACCACCACCAAAACCCGTCAGCTCATCATCTTT: SEQ ID NO: 125) to obtain the first fragment, and then performing PCR using the OVA sequence as a template with CS_OVA F (GGTGGATCCGATGAAGTTAGCGGTCTGGAACAG: SEQ ID NO: 126) and OVA R (GACGAGCTCTCAGTGATGATGGTGGTGATGACCTCCACTAGACATAACATTGCTGCTGGTCCATTCGGT: SEQ ID NO: 127) to obtain the second fragment, followed by overlap PCR using CSTA F and OVA R as primers. The product was digested with SpeI-SacI and used as an insert, and pET-backbone was digested with XbaI-SacI and ligated with the vector to produce CSTA-OVA.Subsequently, a PCR was performed using the sequence created by annealing M21 F (AGGAAGCAGCCCGGATGAAGTGGCGCTGGTTGAAGGTGTGCAGAGCCTGGGTTTTACCTATCTGCGTCTGAAAGATAATTATATG; SEQ ID NO: 147) and M21 R (CACCCATATAATTATCTTTCAGACGCAGATAGGTAAAACCCAGGCTCTGCACACCTTCAACCAGCGCCACTTCATCCGGGCTGCT; SEQ ID NO: 148) as a template and M21 BamHI F (GCGGGATCCAGCAGCCCGGATGAAGTGGC; SEQ ID NO: 128) and M21 SacI R (CGCGAGCTCTCAGTGATGATGGTGGTGATGACCTCCCATATAATTATCTTTCAGACGCAGATAGGTAAAACCC; SEQ ID NO: 129) as primers. The PCR product was then cleaved at the BamHI-SacI site together with CSTA-OVA to produce CSTA-M21. Then, using the CSTA-M21 vector as a template, PCR was performed once with hCS TT F2 (GCGCATATGGGCGGCGGCGGGTCTATGATCCCAGGAGGTCTGTCTGAAG: SEQ ID NO: 149) and T7 R 63 primer. Then, using the PCR product as a template, PCR was performed again with TT F (GCGCATATGCAGTATATTAAAGCGAACAGCAAATTTATTGGCATTACCGAACTGGGCGGCGGCGGGTCTATGAT: SEQ ID NO: 121) and T7 R 63 primer. The TT-CS-M21 vector was then constructed using the pET-Backbone vector via the NdeI-SacI site.Using the TT-CS-M21 vector as a template, PCR was performed with T7 F 63 and CS-M21 R primer (GCGTACGGACGGCATAGCGATAACTCCTCCACCACCACCCATATAATTATCTTTCAGACGCAGATAGGTA; SEQ ID NO: 132) to obtain the first fragment. PCR was performed with PSBD F2 (GGTGGTGGTGGAGGAGTTATCGCTAT; SEQ ID NO: 133) and T7 R 63 primer to obtain the second fragment. Overlap PCR was performed with T7 F and T7 R as primers, and the resulting fragment was digested with pET-Backbone and NdeI-SacI to obtain the TT-CS-M21-PS vector.
[0158] TT-CS-CT5-PS was prepared by cleaving the CSTA-OVA prepared above at the BamHI-SacI site, and ligating the resulting insert to CT5 BamHI F (GATCCATTTATCTGGAAAGCGTGGCGATTATGCCGCAGCTGTTTATGGTGAGCAAAGGCGGACATCACCATCACCACCATTGAGAGCT; SEQ ID NO: 134) and CT5 SacI R (CTCAATGGTGGTGATGGTGATGTCCGCCTTTGCTCACCATAAACAGCTGCGGCATAATCGCCACGCTTTCCAGATAAATG; SEQ ID NO: 135). PCR was then performed once using the CSTA-CT5 vector as a template with hCS TT F and T7 R primers. The PCR product was then used as a template for a second PCR with T F and T7 R primers. The TT-CS-CT5 vector was then synthesized via the NdeI-SacI site with pET-Backbone vector. Then, using the TT-CS-CT5 vector as a template, PCR was performed with T7 F and CS-CT5 R primers to obtain the first fragment. PCR was performed with the PSBD sequence as a template, PSBD F2 and T7 R primers to obtain the second fragment. Overlap PCR was performed with T7 F and T7 R primers, and the resulting fragment was digested with pET-Backbone and NdeI-SacI to obtain the TT-CS-CT5-PS vector.
[0159] TT-TM-M44-PS was prepared by cleaving TM1112-BsaI-PSBD-His with BsaI, and then adding two nucleotide oligomers, M44 F (aGgaGAATTTAAACATATTAAAGCGTTTGATCGTACCTTTGCGAATAACCCGGGTCCGATGGTGGTGTTTGCGACCCCGGGTATG; SEQ ID NO: 137) and M44 R (CACCCATACCCGGGGTCGCAAACACCACCATCGGACCCGGGTTATTCGCAAAGGTACGATCAAACGCTTTAATATGTTTAAATTC; SEQ ID NO: 138), via an annealing process. The resulting vector was then ligated with the cleaved vector. To add the TT sequence at the front, PCR was performed once with htrx TT F and T7 R primers, followed by a second PCR with TTF and T7 R 63 primers. The resulting vector was then combined with pET-Backbone vector via the NdeI-SacI site to generate a vector.
[0160] TT-TM-CT25-PS was prepared by cleaving TM1112-BsaI-PSBD-His with BsaI, adding two nucleotide oligomers, CT25 F (aGgaCTGCATCTGGAAGAAACCCTGGCGGGCTTTTGGGCGCGCCTGCTGGAAcgc; SEQ ID NO: 140) and CT25 R (CACCgcgTTCCAGCAGGCGCGCCCAAAAGCCCGCCAGGGTTTCTTCCAGATGCAG; SEQ ID NO: 141), through an annealing process, followed by ligation with the cleaved vector. To add the TT sequence at the front, PCR was performed once with htrx TT F and T7 R primers using the prepared vector as a template, followed by a second PCR with TTF and T7 R primers. The vector was then combined with pET-Backbone vector via the NdeI-SacI site to create a vector.
[0161] The 10 types of anti-cancer vaccines used to evaluate the efficacy of anti-cancer vaccines were prepared by ligating two oligos annealed at the BsaI site, just like the vectors used in the purification examples.
[0162] Among hTrx.v3-CT4-PSBD-His, hTrx.v3-CT5-PSBD-His, and hTrx.v3-CT24-PSBD-His, hT-CT5-PS is the same as hTrx.v3-CT5-PSBD-His. hTrx.v3-CT4-PSBD-His and hTrx.v3-CT24-PSBD-His were prepared by cleaving the prepared hT-BsaI-PS with BsaI, and then pairing CT4 F (aGgaGGCGGCATTAGCGTGAAAGAACATATTGAAGTGAACGTGGTGCCGCTgACC: SEQ ID NO: 156) with CT4 R (CACCGGTcAGCGGCACCACGTTCACTTCAATATGTTCTTTCACGCTAATGCCGCC: SEQ ID NO: 157). Two nucleotide oligomers that paired F (aGgaCCGCTGGAAGCGATGTATATGCAGTGGCCGGTGATTGCGGTGAACAACgGC: SEQ ID NO: 158) and CT24 R (CACCGCcGTTGTTCACCGCAATCACCGGCCACTGCATATACATCGCTTCCAGCGG: SEQ ID NO: 159) were added by an annealing process, and then ligated with the cleaved vector to create the construct.
[0163] hTrx.v3-Cpne1-PSBD-His, hTrx.v3-Irgq-PSBD-His, and hTrx.v3-Aatf-PSBD-His were prepared by cleaving the hTrx.v3-G10_BsaI-PSBD_G-His vector with BsaI, and constructing the Cpne1-PSBD-His vector using a pair of Aatf F (CGGCCATGTGCTGAGCAAACTGCTGAGCTTTATGGCGCCGATTGATCATACCACCATGAGCGATGATGCGCGCACCGAACTGTTT: SEQ ID NO: 150) and Aatf R (CaCCAAACAGTTCGGTGCGCGCATCATCGCTCATGGTGGTATGATCAATCGGCGCCATAAAGCTCAGCAGTTTGCTCAGCACATG: SEQ ID NO: 151). Another pair was F (CGGCGGCAGCAACGGCGATCCGAGCAGCCCGTATAGCCTGCATTATCTGAGCCCGACCGGCGTGAACGAATATCTGACCGCGCTG: SEQ ID NO: 152) and Cpne R (CaCCCAGCGCGGTCAGATATTCGTTCACGCCGGTCGGGCTCAGATAATGCAGGCTATACGGGCTGCTCGGATCGCCGTTGCTGCC: SEQ ID NO: 153), and Irgq F (CGGCCCGGGCGATAGCCAGAACGCGGCGAAAGCGCGCGATGAAACCGCGGCGCTGCTGAACAGCGCGGTGCTGGGCGCGGCGCCG: SEQ ID NO: 154) and Irgq Two other nucleotide oligomers that pair with R (CaCCCGGCGCCGCGCCCAGCACCGCGCTGTTCAGCAGCGCCGCGGTTTCATCGCGCGCTTTCGCCGCGTTCTGGCTATCGCCCGG: SEQ ID NO: 155) were added by an annealing process, and then ligated with the cleaved vector to prepare the vector.
[0164] Of TM1112-M44-PSBD-His, TM1112-M30-PSBD-His, TM1112-M12-PSBD-His, and TM1112-M21-PSBD-His, TM1112-M30-PSBD-His is the same as TM-M30-PS, and the remaining TM1112-BsaI-PSBD-His was digested with BsaI, and M44 F and M44 R were paired, followed by M12 F (aGgaACCCCGCCGCCGGAAGAAGCGATGCCGTTTGAATTTAATGGTCCGGCGCAGGGTGATCATAGCCAGCCGCCGCTGCAGGTG: SEQ ID NO: 115) and M12 Two nucleotide oligomers were attached by an annealing process using M21 R (CACCCACCTGCAGCGGCGGCTGGCTATGATCACCCTGCGCCGGACCATTAAATTCAAACGGCATCGCTTCTTCCGGCGGCGGGGT: SEQ ID NO: 116) as a pair, and M21 F (aGgaAGCAGCCCGGATGAAGTGGCGCTGGTTGAAGGTGTGCAGAGCCTGGGTTTTACCTATCTGCGTCTGAAAGATAATTATATG: SEQ ID NO: 147) and M21 R (CACCCATATAATTATCTTTCAGACGCAGATAGGTAAAACCCAGGCTCTGCACACCTTCAACCAGCGCCACTTCATCCGGGCTGCT: SEQ ID NO: 148) as a pair, followed by ligation with the cleaved vector to complete the synthesis.
[0165] Each construct had a His tag at the end to facilitate purification, and two glycine linkers were inserted between the element and the His tag to reduce the effect of the tag on the physical properties of the protein. For the same purpose, a linker consisting of GGGGG, GGGGS, or a combination of the two was inserted between the fusion protein and the epitope.
[0166] DH5alpha (Engynomics) cells were used for transformation. After heat shock for 1 minute 30 seconds, the cells were stabilized in LB media for 1 hour and then spread onto solid medium containing antibiotic marker for selection. One or two colonies were grown in 2 ml of LB media overnight (12-16 hours) at 37°C. After 6-8 hours of growth, mini-preps were performed to obtain vectors, and an aliquot was used for sequencing analysis.
[0167] [Table 4] Linker [Table 4]
[0168] [Table 5] Backbone sequence [Table 5-1] [Table 5-2] [Table 5-3]
[0169] [Table 6] Primer sequences [Table 6-1] [Table 6-2] [Table 6-3]
[0170] 3-2.Culture The sequence-confirmed vector was transformed into Clear coli BL21(DE3) for cultivation. Since the strain's comp. cells were electroporated, the DNA was transferred to a separate cuvette and subjected to electric shock. After stabilization in LB media for 1 hour, the cells were spread on solid medium containing antibiotic marker for selection. One colony grown overnight (16-20 h) at 37°C was inoculated into 3 ml of LB media containing antibiotics and grown overnight. The following morning, a secondary inoculation was performed on 1.2 L of medium. When the OD reached approximately 0.7-1.2, IPTG 0.2 mM induction was performed, and the culture temperature was lowered from 37°C to 25°C for overnight cultivation. The cells were then harvested the following day.
[0171] 3-3. Collection and disruption of bacterial cells The culture medium expressing the therapeutic recombinant anti-cancer vaccine was placed in a 1L centrifuge bottle and centrifuged at 7000 rpm at 5±3°C for 5 minutes. The supernatant was discarded and the precipitated bacterial cells were collected. The recovered bacterial cells were suspended in a lysis solution (20mM sodium phosphate, 0.3M NaCl, 10mM imidazole, 1mM PMSF, pH 8.0) and then disrupted using an ultrasonic homogenizer. After disruption, the cell lysate was placed in a 50mL centrifuge bottle and centrifuged at 40,000xg at 5±3°C for 30 minutes. The supernatant was purified using an Äkta pure system.
[0172] 3-4. Purification Purification of the therapeutic recombinant anti-cancer vaccine was carried out using filtration and two steps of column chromatography.
[0173] Step 1: Metal ion affinity chromatography (IMAC) A metal ion affinity column (Cobalt immobilized column) was equilibrated with 20 mM sodium phosphate / 0.3 M sodium chloride / 10 mM imidazole buffer. After disruption, the centrifuged supernatant was filtered through a 0.22 μm filter and loaded onto the column. The column was washed with 20 mM sodium phosphate / 0.3 M sodium chloride / 10 mM imidazole buffer (pH 8.0). The recombinant anti-cancer vaccine was then eluted with 20 mM sodium phosphate / 0.3 M sodium chloride / 150 mM imidazole buffer (pH 8.0).
[0174] Step 2: Size Exclusion Chromatography (SEC) A size-exclusion chromatography column (Hiload Superdex G75) was equilibrated with phosphate-buffered saline. After loading the metal ion affinity column eluate onto the column, UV absorbance (280 nm) was monitored, and fractions at approximately 20 kD elution were collected.
[0175] Step 3: Sterile filtration The resulting fractions were adjusted during the manufacturing process (protein concentration of the anti-cancer vaccine). It was determined whether further concentration was necessary to meet the protein concentration target. If necessary, the fractions were concentrated to a final protein concentration of 2.0 mg / mL or higher.
[0176] Finally, the anti-cancer vaccine protein was filtered (0.22 μm) and dispensed into sterile 1.5 mL polyethylene (Cryotube) containers. At this stage, in-process controls (IPC) were performed to determine the identity (SDS-PAGE), protein content (UV method), endotoxin content (kinetic method), and purity (SE-HPLC). The results are shown in Figures 1 and 2 and Table 7 (Figure 1 shows the results for hT-CT25-PSBD, and Figure 2 shows the results for TM-CT5-PSBD). The sterilized final anti-cancer vaccine active substance was stored at -70±10°C.
[0177] [Table 7]
[0178] (In the table, TM indicates TM1112, hT indicates human Trx, TT-hT indicates Tetanus Toxoid-human Trx, TT-CS indicates Tetanus Toxoid-CSTA, and TT-TM indicates Tetanus Toxoid-TM1112.) 3-5. Formulation of therapeutic recombinant anti-cancer vaccine proteins All formulations of therapeutic recombinant anti-cancer vaccine proteins were carried out in a biosafety cabinet (BSC). The required volume of each anti-cancer vaccine active substance was calculated based on the batch volume and the protein concentration of the anti-cancer vaccine. The combined anti-cancer vaccine proteins were diluted to the target concentration by adding additional buffer containing sodium chloride, phosphate (pH 7.4), and polysorbate 80. After thorough mixing, the formulated therapeutic anti-cancer vaccine was mixed with Poly IC and administered to animals.
[0179] Table 8 below shows the final composition of the adjuvanted therapeutic recombinant anti-cancer vaccine.
[0180] [Table 8]
[0181] Example 4. Endotoxin removal using size exclusion chromatography The host cell used in this invention, E. coli, is a Gram-negative bacterium that secretes endotoxin, a substance that can cause stability problems when injected into the body. Therefore, protein pharmaceuticals using E. coli as a host cell must undergo strict quality control for endotoxins, and an endotoxin removal process must be verified. Therefore, in this invention, a size exclusion chromatography process was used to control the quality of trace amounts of endotoxin.
[0182] Gram-negative bacterial endotoxins are lipopolysaccharides (LPS) that possess both hydrophilic and hydrophobic properties and form micelles under certain concentrations and conditions. The formation of endotoxin micelles increases the size of the endotoxin. In this invention, a substance with as small a molecular weight as possible was designed to separate the endotoxin micelles from the target protein in a size exclusion chromatography process. Fractions were collected based on retention time and analyzed for endotoxin content. The endotoxin content decreased from fractions with short retention times (large size) to fractions with long retention times (small size). This process confirmed that fractions corresponding to the size of the anti-cancer vaccine protein contained trace amounts of endotoxin.
[0183] The endotoxin content determined by size exclusion chromatography fractionation is shown in Figure 3 and Table 9 (Figure 3 shows the results for TrxA-M30-His, and is an arrangement for observing the difference in endotoxin by SEC fraction, which corresponds to the arrangement of Lot No: pc0735 listed in Table 3).
[0184] [Table 9]
[0185] Example 5. Immunogenicity evaluation of anti-cancer vaccines A study was conducted to evaluate whether the anti-cancer vaccine composition prepared in the above example induces an immune response in mice, and such an immune response was confirmed by measuring the concentration of interferon gamma (IFN-γ) by ELISPOT.
[0186] Additionally, anti-cancer vaccine proteins were mixed in amounts of 1-10 nmol each, with a minimum of one and a maximum of four, and then injected subcutaneously. The anti-cancer vaccine proteins were mixed with poly IC (Invivogen) at 50 μg per mouse and administered twice a week for two weeks. Immunogenicity was confirmed from the spleens of the mice 4-5 days after the final injection. This is described in detail below.
[0187] 5-1. Mouse allogeneic anti-cancer model Six-week-old female C57BL / 6 and Balb / c mice were purchased from Koatech and allowed to adapt for one week before the start of the study. The mouse melanoma cell line B16-F10 (5 × 10 4 ) or mouse colon carcinoma cell line CT26 (1 × 10 6 ) were subcutaneously implanted in the right flank of mice at a volume of 100 μl. Prior to inoculation, cells were subcultured no more than five times in DMEM or RPMI medium supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine. Cells were cultured in an incubator at 37°C with 5% CO2. When the cells were 80–90% filled, they were harvested and resuspended in a 1:1 mixture of serum-free medium and Matrigel.
[0188] After cell transplantation, the mice were monitored three times weekly. For tumor measurement, the length and width of each tumor were measured using calipers, and the volume was calculated using the formula: tumor volume (mm 3 )=(Width (mm) 2 × length (mm) / 2). All tumors were measured and separated into groups (8-10 animals / group) between 5 and 10 days after inoculation. The mean tumor volume of all animals was 50-100 mm. 3 Anticancer vaccine substance (10 nmol) and polyIC (50 μg) were administered subcutaneously in an amount of 300 μl twice a week for 2 weeks. 3 Tumors were continuously measured until they reached .
[0189] As shown in Figures 4 and 5, in the MC38 model, TCV001 and the peptide mixture showed comparable tumor regression results, which were statistically significant compared to the vehicle control. In the CT26 model, TCV001 showed potent anticancer efficacy, resulting in statistically significant tumor reduction compared to the peptide mixture.
[0190] The TCV001 sample used in the mouse allogeneic anticancer model was a mixture of neoantigens and recombinant antigen delivery proteins with the structures listed in Table 3. For the CT26 model, a mixture of pc0885 (CT4), pc0886 (CT5), and pc0888 (CT24) was used, while for the MC38 model, a mixture of pc1304 (Cpne1), pc1307 (Irgq), and pc1308 (Aatf) was used. For peptide mixtures, a mixture of synthetic peptide antigens with the amino acid sequences listed in Table 1 was used. For the CT26 model, a mixture of CT4, CT5, and CT24 was used, while for the MC38 model, a mixture of Cpne1, Irgq, and Aatf was used.
[0191] 5-2.TIL analysis FACS analysis was performed to measure lymphocyte activity in the tumors (4 mice per group). When the tumors in the mice reached an appropriate size, they were excised and chopped with scissors. Collagenase was added and shaken at 200 rpm at 37°C for 1 hour. After centrifugation and washing with HBSS, lymphocytes were isolated using fercoll. The isolated lymphocytes were treated with PMA, ionomycin, and a transport inhibitor and then cultured in a 5% CO2 incubator for 4 hours at 37°C. After permeabilization and fixation, the cells were stained with CD45, CD4, CD8, and IFN-r antibodies for 15 minutes. After one wash, FACS analysis was performed.
[0192] As shown in Figures 6, 7, and 8, hTrx-epitope-PSBD and TM1112-epitope-PSBD increased T cell activation by TIL compared to the peptide mixture. Although this result was not observed in all animal models, it generally increased T cell activation.
[0193] The hTrx-epitope-PSBD samples used in TIL analysis were a mixture of recombinant antigen delivery proteins with the neoantigens and structures listed in Table 3. For the CT26 model, a mixture of pc0885 (CT4), pc0886 (CT5), and pc0888 (CT24) was used; for the MC38 model, a mixture of pc1304 (Cpne1), pc1307 (Irgq), and pc1308 (Aatf) was used; and for the B16F10 model, a mixture of pc924 (M44), pc923 (M30), pc903 (M12), and pc933 (M21) was used. For peptide mixtures, a mixture of synthetic peptide antigens with the amino acid sequences listed in Table 1 was used. The CT26 model used a mixture of CT4, CT5, and CT24 antigens, the MC38 model used a mixture of Cpne1, Irgq, and Aatf antigens, and the B16F10 model used a mixture of M44, M30, M12, and M21 antigens. The TM1112-epitope-PSBD sample used a mixture of pc0924 (M44), pc0923 (M30), pc0903 (M12), and pc0933 (M21) antigens.
[0194] From the above description, those skilled in the art will understand that the present invention can be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. Therefore, it should be understood that the above-described embodiments are illustrative in all respects and not limiting. The scope of the present invention should be interpreted as including all modifications and variations derived from the meaning and scope of the claims below, rather than the above detailed description, and equivalent concepts thereof.
Claims
1. peptide antigens, and A carrier protein linked to the N-terminus, C-terminus, or both of the peptide antigen. A fusion protein comprising:
2. The fusion protein of claim 1, comprising a peptide antigen, a first carrier protein linked to the N-terminus of the peptide antigen, and a second carrier protein linked to the C-terminus of the peptide antigen.
3. The fusion protein according to claim 2, wherein an affinity tag is linked to the N-terminus, the C-terminus, or both of the N-terminus and the C-terminus of the fusion protein.
4. The fusion protein of claim 2 , wherein a linker is present between the peptide antigen and a first carrier protein, a linker is present between the peptide antigen and a second carrier protein, or both.
5. The fusion protein of claim 1 , wherein the peptide antigen comprises a T cell epitope.
6. The fusion protein of claim 1 , wherein the peptide antigen comprises a T cell epitope derived from a tumor antigen, an infectious antigen, an autoantigen, or an allergy-inducing antigen.
7. The fusion protein of claim 6, wherein the tumor antigen comprises a tumor-associated antigen (TAA), a tumor-specific antigen (TSA), or a tumor-derived neoantigen.
8. The fusion protein of claim 7, wherein the tumor-derived neoantigen contains a mutation that is specifically expressed in cancer cells.
9. The tumor-associated antigen (TAA) may be a CT (Cancer-testis) antigen, EGFR, M12, M20, M21, M30, M44, Ova, Melan-A, PSMA (Prostate Specific Membrane Antigen), survivin, MAGE-A, ADAbp (adenosine deaminase-binding protein), cyclophilin b, gp100, CRC (Colorectal Associated Antigen)-C017-1A / GA733, CEA (Carcinoembryonic Antigen), or the like. antigen), CAP-1, CAP-2, etv6, AML1, PSA (Prostate Specific Antigen), PSA-1, PSA-2, PSA-3, MAGE (melanoma antigen E), GAGE (G antigen), BAGE (melanoma B antigen), RAGE (kidney tumor antigen), LAGE (L antigen), NAG, GnT-V, MUM-1, CDK4, p53, tyrosinase, Muc1 (mucin 1), HER2 / neu, p21ras, N-RAS, K-RAS, RCAS1, α-fetoprotein, E-cadherin, α-catenin, β-catenin, γ-catenin, p120ctn, PRAME, NY-ESO-1, TRP2, mammaglobin-A, metallopanstimulin-1 (MPS-1), cytochrome P 450 isoform 1B1, 90K / Mac-2 binding protein, Ep-CAM (MK-1), HSP-70, hTERT (TRT), LEA, TAGE-1, 5T4, gp70, SCP-1, c-myc, cyclin B1, MDM2, p62, Koc, IMP1, TA90, OA1, CT-7, HOM-MEL-40 / S 8. The fusion protein of claim 7, which is SX-2, SSX-1, SSX-4, HOM-TES-14 / SCP-1, HOM-TES-85, HDAC5, MBD2, TRIP4, NY-CO-45, KNSL6, HIP1R, Seb4D, KIAA1416, IMP1, 90K / Mac-2 binding protein, MDM2, or LMNA.
10. The fusion protein of claim 6 , wherein the infectious antigen is an antigen derived from a virus, bacterium, parasite, or fungus.
11. The fusion protein of claim 1 , wherein the carrier protein is a protein that improves recombinant expression of the peptide antigen or improves purification of the peptide antigen.
12. The fusion protein of claim 2 , wherein the first carrier protein improves recombinant expression of a peptide antigen and the second carrier protein improves expression of the peptide antigen.
13. The first carrier protein and the second carrier protein may be the same or different, and may be selected from the group consisting of NDPK (nucleoside diphosphate kinase B), CSTA (cystatin-A), Trx (thioredoxin), RPL7Am (50S ribosomal protein L7Ae), Samp2a (small archaeal modifier protein 2), TE (tenascin), TM1112 (Thermotoga maritima Cupin_3 domain-containing protein), TrxA (thioredoxin 1), and TTrx (Thermosiphos africanus 3. The fusion protein of claim 2, which is one or more of thioredoxin, PSBD (peripheral subunit-binding domain), or fragments thereof.
14. The fusion protein of claim 3 , wherein the affinity tag is His or streptavidin.
15. The linker may be (GS)n, (G 2 S)n, (G 3 S)n, (G 4 5. The fusion protein of claim 4, wherein G is Gly, S is Ser, L is Leu, E is Glu, and n is an integer of at least 1.
16. The fusion protein of claim 1 , wherein the fusion protein is 30 kDa or less in size.
17. A nucleic acid molecule encoding the fusion protein according to any one of claims 1 to 16.
18. 18. An expression vector comprising the nucleic acid molecule of claim 17.
19. A cell transformed with the expression vector of claim 18.
20. A fusion protein according to any one of claims 1 to 16; a nucleic acid molecule encoding the fusion protein; an expression vector comprising the nucleic acid molecule; or a cell transformed with the expression vector, Immunogenic composition.
21. 21. The immunogenic composition of claim 20, additionally comprising an adjuvant.
Citation Information
Patent Citations
Reversible protein multimers, methods for their production and use
US10023657B2