Aminoacyl-tRNA synthetase mutants and uses thereof

Abstract

The present invention relates to an aminoacyl-tRNA synthetase mutant and its use. The aminoacyl-tRNA synthetase mutant has a mutation in the amino acid sequence shown in SEQ ID NO:19, and the mutation includes at least a mutation site where I at position 159 is mutated to a hydroxyl-containing amino acid, a basic amino acid, or a nonpolar amino acid. This mutant has been mutated by site-directed mutagenesis to alter the amino acid sequence and the protein structure and function. The mutant has high activity and specificity and can be used to achieve efficient site-specific introduction of unnatural amino acids into proteins.

Description

[Technical Field]

[0001] The present invention relates to the technical field of enzyme engineering, and more particularly to aminoacyl-tRNA synthetase mutants and uses thereof. [Background technology]

[0002] All living proteins are composed of 20 naturally occurring amino acids arranged according to genetic code and perform a range of functions. However, the number of functional groups available in existing natural amino acids is limited, making them unable to meet the structural and functional needs of proteins in biological research and applications. Unnatural amino acids, with their diverse functional groups, are ideal for protein modification. These unnatural amino acids contain ketone, aldehyde, azide, alkynyl, amide, nitro, phosphate, and sulfonate groups, enabling a variety of modification reactions. They are widely used in basic research, drug discovery, biotechnology, and other fields, including protein conformational change detection, antibody-conjugated drug ADCs, DNA-peptide coupling, biosensors, peptide cyclization, fluorescent dye labeling, and molecular surface immobilization.

[0003] The technology for encoding unnatural amino acids involves adding additional components, such as a pair of orthogonal tRNAs, aminoacyl-tRNA synthetases (aaRSs), and amber codons (TAGs), to the protein translation machinery. The orthogonality of the aaRS / tRNA requires that the aaRS cannot recognize endogenous tRNAs or amino acids in the host, but can only aminoacylate its ligand tRNA, and that the tRNA and target unnatural amino acid cannot be aminoacylated by the endogenous aaRS. The tyrosyl-tRNA synthetase / tRNA pair (MjTyrRS / TyrT) from the archaebacterium Methanocaldococcus jannaschii has been engineered and used to site-specifically introduce over 60 unnatural amino acids. The alkynyl groups of unnatural amino acids containing alkynyl groups can undergo click chemistry with other molecules containing azide groups, making them useful for the preparation of ADC drugs and protein labeling studies. However, this method requires multiple rounds of screening based on antibiotics and the nuclease barnase, making the procedure cumbersome, and no high-performance mutants have been obtained. Summary of the Invention [Problem to be solved by the invention]

[0004] The present invention provides aminoacyl-tRNA synthetase mutants and uses thereof to increase the efficiency of introducing unnatural amino acids. [Means for solving the problem]

[0005] To achieve the above object, one aspect of the present invention provides an aminoacyl-tRNA synthetase mutant, which has a mutation in the amino acid sequence shown in SEQ ID NO: 19, at least at a mutation site where I at position 159 is mutated to a hydroxyl-containing amino acid, a basic amino acid, or a nonpolar amino acid.

[0006] Furthermore, the mutations may include at least one of the following: A at position 31 is mutated to a non-polar amino acid; Y at position 32 is mutated to an aromatic amino acid or a hydroxy-containing amino acid; E at position 107 is mutated to a negatively charged amino acid or a hydroxy-containing amino acid; F at position 108 is mutated to a basic amino acid; Q at position 109 is mutated to a basic amino acid; L at position 110 is mutated to a methionine; D at position 158 is mutated to an acidic amino acid, a hydroxy-containing amino acid or a histidine; H at position 160 is mutated to a basic amino acid, a hydroxy-containing amino acid or an aromatic amino acid; Y at position 161 is mutated to an aromatic amino acid or a hydroxy-containing amino acid; ,At least, L69I+E107D+F108R+Q109R+D158H+I159T+H160Q+Y161G+L162T, A31G+Y32S+E107S+D158T+I159S+H160N+Y161S+L162T, Y32S+L69I+E107S+L110M+I159S, A31V+Y32T+L65C+F108R+Q109R+L110M+D158H+I159Y+H160S+Y161G+Ll62M, A31C+Y32T+E107S+D The mutation site combinations include one of 158S+I159Q+H160F+Y161S+L162T, Y32S+L65I+E107D+F108K+Q109R+L110M+D158S+I159Q+H160F+Y161G+L162M, A31L+Y32F+L65I+F108R+L110M+D158T+I159L+H160S+Y161S+L162T, or A31V+E107S+Q109R+D158E+I159L+Y161W+L162T.

[0007] Another aspect of the present invention provides a DNA molecule encoding any of the above-described aminoacyl-tRNA synthetase mutants, preferably a DNA molecule comprising a gene mutation based on the nucleotide sequence shown in SEQ ID NO:7.

[0008] According to yet another aspect of the present invention, there is provided a recombinant plasmid, which contains any of the DNA molecules described above.

[0009] Furthermore, the recombinant plasmids are pET-22a(+), pET-22b(+), pET-3a(+), pET-3d(+), pET-11a(+), pET-12a(+), pET-14b(+), pET-15b(+), pET-16b(+), pET-17b(+), pET-19b(+), pET-20b(+) ), pET-2la(+), pET-23a(+), pET-23b(+), pET-24a(+), pET-25b(+), pET-26b(+), pET -27b(+), pET-28a(+), pET-29a(+), pET-30a(+), pET-31b(+), pET-32a(+), pET-35b( +), pET-38b(+), pET-39b(+), pET-40b(+), pET-41a(+), pET-4lb(10), pET-42a(+), pE T-43a(+), pET-43b(+), pET-44a(+), pET-49b(+), pQE2, pQE9, pQE30, pQE31, pQE32, p QE40, pQE70, pQE80, pRSET-A, pRSET-B, pRSET-C, pGEX-5X-1, pGEX-6p-1, pGEX-6p-2, pBV220, pBV221, pBV222, pTrc99A, pTwin1, pEZZ18, pKK232-18, pUC-18, or pUC-19.

[0010] According to a further aspect of the present invention, there is provided a host cell, which contains any of the recombinant plasmids described above.

[0011] Additionally, the host cell includes a prokaryotic cell, preferably the prokaryotic cell is an E. coli BL21-DE3 cell or an E. coli Rosetta-DE3 cell.

[0012] A further aspect of the present invention provides a method for introducing propargyl-L-tyrosine, which comprises the steps of introducing propargyl-L-tyrosine using any of the aminoacyl-tRNA synthetase mutants or recombinant plasmids described above, preferably constructing a recombinant plasmid containing any of the aminoacyl-tRNA synthetase mutants and a TyrT gene, as well as a recombinant plasmid containing a TAG codon at a specific site, and co-transforming the two recombinant plasmids into a host cell and culturing the host cell while adding propargyl-L-tyrosine; more preferably, the host cell is Escherichia coli, and the E. coli is cultured at a culture medium pH of 6.8 to 7.4, a culture temperature of 16 to 37°C, and a propargyl-L-tyrosine concentration of 1 to 10 mM. [Effects of the Invention]

[0013] In the technical solution of the present invention, the above aminoacyl-tRNA synthetase mutant is based on the aminoacyl-tRNA synthetase shown in SEQ ID NO:19, and is mutated by site-directed mutagenesis to change the amino acid sequence and protein structure and function. The mutant has high activity and specificity, which can improve the efficiency of introducing unnatural amino acids when used in combination. [Brief explanation of the drawings]

[0014] The drawings that form a part of this application are intended to provide a further understanding of the invention, and the illustrative embodiments of the invention and their descriptions are intended to illustrate the invention and are not intended to unduly limit the invention. [Figure 1]Construction of the tyrosyl-tRNA synthetase mutant library and the corresponding amino acid mutation sites are shown. [Figure 2] Fluorescence values per unit bacterial concentration are shown. DETAILED DESCRIPTION OF THE INVENTION

[0015] The embodiments and features of the present invention may be combined with each other as long as they are not contradictory. The present invention will be described in detail below in combination with the embodiments with reference to the drawings.

[0016] The present invention improves upon the screening scheme based on green fluorescent protein and resistance genes described in the literature (An efficient system for the evolution of aminoacyl-tRNA synthetase specificity, Nature Biotechnology, volume 20, pages 1044-1048 (2002)). This improves upon the conventional screening scheme, which relied on expensive flow cytometers. By replacing the previously undetectable green fluorescent protein with a red fluorescent protein, a screening scheme that can be discerned with the naked eye was realized. To address the issue of low incorporation efficiency of propargyl-L-tyrosine OpY* (structural formula shown below), this improved screening platform employed rationally designed multi-point saturation mutagenesis and screening. As a result, mutants with improved specificity and a fourfold or greater increase in incorporation efficiency were obtained.

[0017] [ka]

[0018] According to one exemplary embodiment of the present invention, there is provided an aminoacyl-tRNA synthetase mutant, which has a mutation in the amino acid sequence shown in SEQ ID NO: 19, at least at a mutation site where I at position 159 is mutated to a hydroxyl-containing amino acid, a basic amino acid, or a nonpolar amino acid.

[0019] The above-described aminoacyl-tRNA synthetase mutants of the present invention are based on the aminoacyl-tRNA synthetase shown in SEQ ID NO:19, and are mutated by site-directed mutagenesis to alter the amino acid sequence and protein structure and function. These mutants have high activity and specificity, and can therefore improve the efficiency of introducing unnatural amino acids.

[0020] In order to further improve the activity and specificity of the enzyme, the mutations may further include at least one of the following: A at position 31 is mutated to a non-polar amino acid; Y at position 32 is mutated to an aromatic amino acid or a hydroxy-containing amino acid; E at position 107 is mutated to a negatively charged amino acid or a hydroxy-containing amino acid; F at position 108 is mutated to a basic amino acid; Q at position 109 is mutated to a basic amino acid; L at position 110 is mutated to methionine; D at position 158 is mutated to an acidic amino acid, a hydroxy-containing amino acid, or histidine; H at position 160 is mutated to a basic amino acid, a hydroxy-containing amino acid, or an aromatic amino acid; Y at position 161 is mutated to an aromatic amino acid or a hydroxy-containing amino acid; and L at position 162 is mutated to a hydroxy-containing amino acid or a non-polar amino acid; More preferably, the mutations are at least L69I+E107D+F108R+Q109R+D158H+I159T+H160Q+Y161G+L162T, A31G+Y32S+E107S+D158T+I159S+H160N+Y161S+L162T, Y32S+L69I+E107S+L110M+I159S, A31V+Y32T+L65C+F108R+Q109R+L110M+D158H+I159Y+H160S+Y161G+L162M, A31C+Y32T+ The mutation site combinations include one of E107S+D158S+I159Q+H160F+Y161S+L162T, Y32S+L65I+E107D+F108K+Q109R+L110M+D158S+I159Q+H160F+Y161G+L162M, A31L+Y32F+L65I+F108R+L110M+D158T+I159L+H160S+Y161S+L162T, or A31V+E107S+Q109R+D158E+I159L+Y161W+L162T.

[0021] According to one exemplary embodiment of the present invention, a DNA molecule is provided, preferably a DNA molecule based on the nucleotide sequence shown in SEQ ID NO:7, which is genetically mutated. The DNA molecule encodes the above-described aminoacyl-tRNA synthetase mutant. The above-described aminoacyl-tRNA synthetase mutant encoded by the DNA molecule has excellent specificity and activity.

[0022] The above-mentioned DNA molecules of the present invention can also exist in the form of an "expression cassette." An "expression cassette" refers to a linear or circular nucleic acid molecule containing DNA and RNA sequences capable of directing the expression of a specific nucleotide sequence in an appropriate host cell. Generally, it includes a promoter operatively linked to a target nucleotide and, optionally, to a termination signal and / or other regulatory elements. An expression cassette may also contain sequences necessary for accurate translation of the nucleotide sequence. The coding region typically encodes a target protein, but may also encode a target functional RNA, such as an antisense RNA or a non-translated RNA, in either the sense or antisense orientation. An expression cassette containing a target polynucleotide sequence may be chimeric, meaning that at least one of its components is heterologous to at least one of its other components. Expression cassettes may be naturally occurring or obtained by efficient recombination for heterologous expression.

[0023] According to one exemplary embodiment of the present invention, there is provided a recombinant plasmid containing any one of the above DNA molecules, wherein the DNA molecule in the recombinant plasmid is positioned at an appropriate position in the recombinant plasmid so that the replication, transcription, or expression of the DNA molecule is carried out accurately and smoothly.

[0024] In the present invention, the modifier "containing" is used to define the above DNA molecule, but this does not mean that other sequences unrelated to its function can be arbitrarily added to both ends of the DNA sequence. Those skilled in the art will know that to meet the requirements of recombinant manipulation, it is necessary to add appropriate restriction enzyme cleavage sites to both ends of the DNA sequence, or to add additional initiation codons, termination codons, etc. Therefore, a definition using the term "closed-end" cannot fully cover these situations.

[0025] The term "plasmid" as used herein includes any plasmid, cosmid, phage, or Agrobacterium binary nucleic acid molecule in double-stranded or single-stranded, linear or circular form, preferably a recombinant expression plasmid, which may be a prokaryotic or eukaryotic expression plasmid, but is preferably a prokaryotic expression plasmid. In some embodiments, the recombinant plasmid is selected from the group consisting of pET-22a(+), pET-22b(+), pET-3a(+), pET-3d(+), pET-11a(+), pET-12a(+), pET-14b(+), pET-15b(+), pET-16b(+), pET-17b(+), pET-19b(+), pET- 20b(+), pET-21a(+), pET-23a(+), pET-23b(+), pET-24a(+), pET-25b(+), pET-26b(+) , pET-27b(+), pET-28a(+), pET-29a(+), pET-30a(+), pET-31b(+), pET-32a(+), pET-35 b(+), pET-38b(+), pET-39b(+), pET-40b(+), pET-41a(+), pET-41b(+), pET-42a(+), p ET-43a(+), pET-43b(+), pET-44a(+), pET-49b(+), pQE2, pQE9, pQE30, pQE31, pQE32, pQ E40, pQE70, pQE80, pRSET-A, pRSET-B, pRSET-C, pGEX-5X-1, pGEX-6p-1, pGEX-6p-2, pBV220, pBV221, pBV222, pTrc99A, pTwin1, pEZZ18, pKK232-18, pUC-18, or pUC-19.

[0026] To facilitate subsequent screening, a red fluorescent protein reporter gene is operably linked to the recombinant plasmid, preferably the red fluorescent protein reporter gene has the nucleotide sequence shown in SEQ ID NO: 1. Additionally, a chloramphenicol screening gene is operably linked to the recombinant plasmid, preferably the recombinant plasmid is operably linked to the promoter and terminator sequences shown in SEQ ID NO: 6.

[0027] According to one exemplary embodiment of the present invention, there is provided a host cell containing any of the above-described recombinant plasmids. Host cells applicable to the present invention include, but are not limited to, prokaryotic cells. Preferably, the prokaryotic cells are E. coli BL21-DE3 cells or E. coli Rosetta-DE3 cells.

[0028] One exemplary embodiment of the present invention provides a method for introducing propargyl-L-tyrosine. The method comprises the steps of introducing propargyl-L-tyrosine using an aminoacyl-tRNA synthetase mutant or the above-mentioned recombinant plasmid of the present invention, preferably by constructing a recombinant plasmid containing any of the above-mentioned aminoacyl-tRNA synthetase mutants and a TyrT gene, as well as a recombinant plasmid containing a TAG codon at a specific site, co-transforming the two recombinant plasmids into host cells, and adding propargyl-L-tyrosine while culturing the host cells. More preferably, the host cells are Escherichia coli, and the E. coli is cultured at a culture medium pH of 6.8 to 7.4, a culture temperature of 16 to 37°C, and a propargyl-L-tyrosine concentration of 1 to 10 mM.

[0029] More specifically, in one preferred embodiment of the present invention, the method for introducing propargyl-L-tyrosine comprises the following steps: 1) constructing a plasmid containing the MjTyrRS mutant of the present invention and TyrT. In this example, a constitutive promoter is used, but of course, inducible promoters such as promoters derived from T7 or Sp6 phages can also be used. 2) constructing a plasmid expressing the target gene sfGFP (the fluorescent protein used in the test; this method can also be applied to other target proteins). The T7 inducible promoter used can also be replaced with other inducible promoters, including Sp6, xylose-inducible promoters, and arabinose-inducible promoters. 3) co-transforming the two plasmids into Escherichia coli. The host currently used is BL21(DE3), but any other E. coli cell line can also be used. 4) culturing the E. coli. Simultaneously with induction, an unnatural amino acid is added at a concentration of 1 to 10 mM, and fluorescence is detected after culturing. Preferably, for a plasmid containing an MjTyrRS mutant and TyrT, and a plasmid containing a target gene containing one or more TAG mutation sites used to introduce the corresponding unnatural amino acid, the two plasmids must contain different replication origins to ensure stable coexistence. E. coli is cultured at pH 6.8-7.4 and a culture temperature of 16-37°C, and the unnatural amino acid propargyl-L-tyrosine is added. This is dissolved in water, the pH is adjusted to approximately 10.0 with NaOH, and the bacteria are removed by filtration after complete dissolution. When used, this E. coli is added to the medium to a final concentration of 1-10 mM.

[0030] The beneficial effects of the present invention will be further illustrated below with reference to examples.

[0031] Example 1 Establishment of a screening scheme based on red fluorescent protein and chloramphenicol resistance A screening scheme based on red fluorescent protein and chloramphenicol resistance was established. Specifically, the green fluorescent protein gene GFPuV in the screening plasmid described in An efficient system for the evolution of aminoacyl-tRNA synthetase specificity, Nature Biotechnology, volume 20, pages 1044-1048 (2002) was replaced with the gene encoding the red fluorescent protein mcherry. Genewiz performed full gene synthesis of the codon-optimized mcherry sequence, introducing an NcoI enzyme cleavage site at the 5' end and an XhoI enzyme cleavage site at the 3' end, and constructing it in the pET-28a vector. The sequence is as follows (SEQ ID NO: 1):

[0032] TIFF2025526992000003.tif77164

[0033] BL21(DE3) competent cells were transformed with the expression plasmid and coated onto a solid LB medium plate containing LB + 50 μg / mL kanamycin. The cells were grown overnight to obtain a single clone. The single clone was then inoculated into 5 ml of LB medium and cultured at 37°C with shaking at 200 rpm for 2-3 hours. When the OD600 reached 0.6-0.8, IPTG was added to a final concentration of 0.5 mM and induced at 30°C for 20 hours. The culture medium turned purple-red, indicating that the red fluorescent protein was available. Using RFP-HR-Bone-F (SEQ ID NO: 2, GAGTCGTATTAATTTCGCGGGATCGAGTGAGCGCAACGCAATTAATG) and RFP-HR-Bone-R (SEQ ID NO: 3, GCATTAAGCGCGGCGGGTGTGGTGTTTTCACCGTCATCACCG) as primers, sequences other than the green fluorescent protein coding sequence based on the green fluorescent and antibiotic screening plasmid (Nat Biotechnol. 2002 Oct; 20(10):1044-1048.) were amplified by PCR to give RFP-HR-F: (SEQ ID NO: 4, CATTAATTGCGTTGCGCTCACTCGATCCCGCGAAATTAATACGACTC) and RFP-HR-R: (SEQ ID NO: The mcherry coding frame sequence, including the T7 promoter and T7 terminator, was amplified by PCR using primers 5 and CGGTGATGACGGTGAAAACACCACACCCGCCGCGCTTAATGC. The resulting plasmid was then constructed by homologous recombination, completing the fluorescent protein replacement. The constructed screening plasmid was transformed into competent DH10B bacteria, and after sequencing, a DH10B strain containing the screening plasmid was obtained. This strain was designated DH10B-REP (screening plasmid) and made electroporation competent for use.

[0034] Example 2 Construction of pET-Gln constitutive expression plasmid To achieve constitutive expression of aminoacyl-tRNA synthetase, the promoter and terminator of pET-28a were replaced with the Gln promoter and GlnTT terminator. The promoter and terminator were synthesized into a single DNA sequence by GENEWIZ. A BglII (AGATCT) enzyme cleavage site was introduced at the 5' end of the promoter, an NdeI (CATATG) and an EcoRI (GAATTC) site were introduced at the 3' end of the promoter, and an XhoI (CTCGAG) site was introduced at the 3' end of the GlnTT terminator. The synthesized sequence was ligated into the pET28a vector by BglII and XhoI enzyme cleavage. After sequencing, pET-Gln was obtained and prepared for use.

[0035] Synthetic promoter and terminator sequence (SEQ ID NO:6):

[0036] TIFF2025526992000004.tif38164

[0037] Example 3 Construction of wild-type expression plasmid for tyrosyl-tRNA synthetase Codon-optimized MjTyrRS was synthesized by GENEWIZ, Inc. Its sequence is as follows (SEQ ID NO:7):

[0038] TIFF2025526992000005.tif93164

[0039] After digestion with NdeI and EcoRI enzymes, the fragment was constructed into a pET-Gln vector to obtain a pET-Gln-MjTyrRS synthetase expression plasmid.

[0040] Sequence of the protein encoded by MjTyrRS (SEQ ID NO:19):

[0041] TIFF2025526992000006.tif31164

[0042] Example 4 Construction of a tyrosyl-tRNA synthetase mutant library Molecular docking identified amino acids within 5 Å of the para-hydroxy group of tyrosine on MjTyrRS (31, 32, 65, 67, 69, 107, 108, 109, 110, 158, 159, 160, 161, and 162), and performed multi-site saturation mutagenesis. Primers used:

[0043] TIFF2025526992000007.tif91163

[0044] As shown in Figure 1, the above primers were used to amplify three segments, 31-69, 65-110, and 107-162, respectively, and then overlap PCR was performed to obtain the NNK-containing fragment of MjTyrRS (31-162 aa). The vector portion was obtained by PCR amplification using primers 31-bone-R (SEQ ID NO: 14): TGACTTCTCGTCCTTCTTCAGCACTTCG and 162-bone-F (SEQ ID NO: 15): GGATGTGGCGGTGGGCGGCATG. The NNK fragment and the vector portion pET-Gln-MjTyrRS were ligated by circular polymerase extension cloning (CPEC). The recombinant vector was transformed into DH10B electroporation-competent cells by electroporation, cultured overnight with kanamycin, and the mutant mixture plasmid was extracted using a plasmid extraction kit and stored at -20°C for further use.

[0045] Example 5 Screening for tyrosyl-tRNA synthetase mutants The tyrosyl-tRNA synthetase mutants obtained in Example 4 were electrotransformed into DH10B-REP, recovered at 37°C for 1 h, and then plated and cultured on LB solid screening plates containing 10 μg / mL tetracycline, 50 μg / mL kanamycin, 50 μg / mL chloramphenicol, 0.1% arabinose, and 1 mM OpY (hereafter referred to as plate B). The plates were cultured for 48–72 h until red clones grew. These clones were then cultured on both plates B and C (with the 1 mM OpY removed from plate B). Clones that grew on plate B but not on plate C and exhibited red fluorescence were selected and streaked onto plate B. Once red clones grew, two or three rounds of screening were performed on plates B and C. Finally, tyrosyl-tRNA synthetase mutants capable of efficiently introducing OpY were obtained. The mutants were sequenced to obtain the coding sequences and mutation sites. The information is shown in Table 1.

[0046] [Table 1]

[0047] Example 6 Construction of fluorescent protein recombinant plasmids The codon-optimized green fluorescent protein sfGFP gene (for testing) was synthesized by GENEWIZ and constructed into the NcoI and XhoI sites of pACYCduetl. The sfGFP gene sequence is as follows (SEQ ID NO: 16):

[0048] TIFF2025526992000009.tif73163

[0049] To introduce an unnatural amino acid into a specific site of sfGFP, the triplet codon encoding I39 was mutated from ATT to TAG, and the pACYCduet-sfGFP(I39) plasmid was obtained by DNA sequencing.

[0050] Example 7 Construction of MjTyrRS mutants and plasmids containing TyrT The coding sequence of TyrT, including the promoter and terminator, was amplified from the screening plasmid REP using tRNA-XhoI-F (SEQ ID NO: 17, gggCTCGAGCCCATCAAAAAAATATTCTCAAC) and tRNA-HR-XhoI-R (SEQ ID NO: 18, gggCTCGAGtaaaaaaaatccttagctttcg). The product was digested with XhoI enzyme and then ligated into pET-Gln-MjTyrRS (obtained by sequencing). DNA sequencing revealed that: P The ET-Gln-MyTyrRS(mut)-tRNA plasmid was obtained.

[0051] Example 8 Evaluation of propargyl-L-tyrosine incorporation pET-Gln-MyTyrRS(2#)-tRNA, pET-Gln-MyTyrRS(5#)-tRNA, pET-Gln-MyTyrRS(16#)-tRNA, pET-Gln-MyTyrRS(32#)-tRNA, pET-Gln-MyTyrRS(55#)-tRNA, pET-Gln-MyTyrRS(62#)-tRNA, pET-Gln-MyTyrRS(75#)-tRNA, and pET-Gln-MyTyrRS(88#)-tRNA were cotransformed with pACYCduet-sfGFP(I39TAG) and BL21(DE3) competent cells, respectively, and plated onto LB plates containing kanamycin and chloramphenicol. Cultures were incubated at 37°C until single clones emerged. A single clone was selected and inoculated into 30 ml of LB (kan + Cm + 1 mM OpY). LB without OpY (kan + Cm) served as a negative control. The cells were induced with 1 mM IPTG overnight at 30°C. The sample and positive control cells were emerald green, demonstrating strong expression. No fluorescence was visible in the negative control. The fluorescence intensity of the green fluorescent protein was measured using an excitation light of 485 nm and an emission light of 525 nm. OD600 was also measured, and the fluorescence value per unit bacterial concentration was calculated. Figure 2 shows the results compared with the mutant OpYRS synthases reported in the literature (32A, 107P, 158A, and 162A).

[0052] Compared with the OpYRS described in the literature (In vivo incorporation of an alkyne into proteins in Escherichia coli Bioorganic & Medicinal Chemistry Letters 15 (2005) 1521-1524), the activity of the mutants OpYRS-2#, OpYRS-5#, OpYRS-16#, OpYRS-32#, OpYRS-55#, OpYRS-62#, OpYRS-75#, and OpYRS-88# obtained in the present invention was improved by 4.97, 4.57, 4.10, 5.0, 3.85, 5.83, 4.07, and 5.42 times, respectively, and the specificity (OpYRS-2#, OpYRS-55#, OpYRS-62#, OpYRS-75#, and OpYRS-88#) was also improved by 4.97, 4.57, 4.10, 5.0, 3.85, 5.83, 4.07, and 5.42 times, respectively. The fluorescence / OD600 values (fluorescence / OD600 values without OpY) significantly improved with OpY addition: OpYRS-2# = 20.46, OpYRS-5# = 16.9, OpYRS-16# = 15.8, OpYRS-32# = 9.1, OpYRS-55# = 13.2, OpYRS-62# = 13.5, OpYRS-75# = 16.2, and OpYRS-88# = 10.8, whereas the values for the control were only 5.72.

[0053] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects.

[0054] This invention optimizes the screening scheme based on red fluorescence and antibiotic resistance, enabling clone screening that can be distinguished by the naked eye. Based on the results of structure and molecular docking, we constructed a tyrosyl-tRNA synthetase mutant library covering 14 sites. Furthermore, using the improved screening scheme, we screened eight synthetase mutants that could efficiently introduce OpY. Compared to literature results, the resulting new synthetase mutants showed significantly improved activity and specificity.

[0055] The above description is merely a preferred embodiment of the present invention, and is not intended to limit the present invention. Those skilled in the art can make various modifications and variations to the present invention. Any modifications, equivalent replacements, improvements, etc. made without departing from the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An aminoacyl-tRNA synthetase mutant, The aminoacyl-tRNA synthetase mutant is characterized in that a mutation has occurred in the amino acid sequence represented by SEQ ID NO: 19, and the mutation at least includes a mutation site where I at position 159 is mutated to a hydroxyl-containing amino acid, a basic amino acid, or a nonpolar amino acid.

2. The mutation comprises at least a mutation site where A at position 31 is mutated to a non-polar amino acid, a mutation site where Y at position 32 is mutated to an aromatic amino acid or a hydroxy-containing amino acid, a mutation site where E at position 107 is mutated to a negatively charged amino acid or a hydroxy-containing amino acid, a mutation site where F at position 108 is mutated to a basic amino acid, a mutation site where Q at position 109 is mutated to a basic amino acid, a mutation site where L at position 110 is mutated to a methionine, a mutation site where D at position 158 is mutated to an acidic amino acid, a hydroxy-containing amino acid or a histidine, a mutation site where H at position 160 is mutated to a basic amino acid, a hydroxy-containing amino acid or an aromatic amino acid, a mutation site where Y at position 161 is mutated to an aromatic amino acid or a hydroxy-containing amino acid, or a mutation site where L at position 162 is mutated to a hydroxy-containing amino acid or a non-polar amino acid, Preferably, the mutations are at least: L69I + E107D + F108R + Q109R + D158H + I159T + H160Q + Y161G + L162T, A31G + Y32S + E107S + D158T + I159S + H160N + Y161S + L162T, Y32S + L69I + E107S + L110M + 1159S, A31V + Y32T + L65C + F108R + Q109R + L110M + D158H + T159Y + H160S + Y161G + L162M, A31C + Y32T + E107S + D158S + 1159Q + 2. The aminoacyl-tRNA synthetase mutant of claim 1, comprising one of the following mutation site combinations: H160F + Y161S + L162T, Y32S + L65I + E107D + F108K + Q109R + L110M + D158S + I159Q + H160F + Y161G + L162M, A31L + Y32F + L65I + F108R + L110M + D158T + I159L + H160S + Y161S + L162T, or A31V + E107S + Q109R + D158E + I159L + Y161W + L162T.

3. A DNA molecule encoding the aminoacyl-tRNA synthetase mutant according to any one of claims 1 to 2, comprising: Preferably, the DNA molecule is characterized in that a gene mutation has occurred based on the nucleotide sequence shown in SEQ ID NO:

7.

4. A recombinant plasmid comprising the DNA molecule of claim 3.

5. The recombinant plasmids are pET-22a(+), pET-22b(+), pET-3a(+), pET-3d(+), pET-11a(+), pET-12a(+), pET-14b(+), pET-15b(+), pET-16b(+), pET-17b(+), pET-19b(+), pET-20b(+), pET-21 a(+), pET-23a(+), pET-23b(+), pET-24a(+), pET-25b(+), pET-26b(+), pET-27b(+), pET -28a (+), pET-29a (+), pET-30a (+), pET-31b (+), pET-32a (+), pET-35b (+), pET-38b (+), pET-39b(+), pET-40b(+), pET-41a(+), pET-41b(+), pET-42a(+), pET-43a(+), pET-43b( +), pET-44a (+), pET-49b (+), pQE2, pQE9, pQE30, pQE31, pQE32, pQE40, pQE70, pQE80, pRS 5. The recombinant plasmid of claim 4, which is ET-A, pRSET-B, pRSET-C, pGEX-5X-1, pGEX-6p-1, pGEX-6p-2, pBV220, pBV221, pBV222, pTrc99A, pTwin1, pEZZ18, pKK232-18, pUC-18, or pUC-19.

6. A host cell comprising the recombinant plasmid of claim 4 or 5.

7. 7. The host cell of claim 6, comprising a prokaryotic cell, preferably said prokaryotic cell being an E. coli BL21-DE3 cell or an E. coli Rosetta-DE3 cell.

8. A method for introducing propargyl-L-tyrosine, comprising introducing propargyl-L-tyrosine using the aminoacyl-tRNA synthetase mutant of claim 1 or 2, or the recombinant plasmid of claim 4 or 5.

9. Constructing a recombinant plasmid containing the recombinant plasmid of claim 4 or 5 and a TyrT gene; 9. The method for introducing propargyl-L-tyrosine according to claim 8, further comprising the steps of: co-transforming a host cell with the two recombinant plasmids; and adding propargyl-L-tyrosine to the host cell while culturing the host cell.

10. 10. The method for introducing propargyl-L-tyrosine according to claim 9, wherein the host cell is Escherichia coli, and the Escherichia coli is cultured at a culture solution pH of 6.8 to 7.4, a culture temperature of 16 to 37°C, and a propargyl-L-tyrosine concentration of 1 to 10 mM.

Images