Multisegmented PolyA polynucleotides stably present in host cells and uses thereof

Abstract

A multisegmented PolyA polynucleotide that can exist stably in a host cell and uses thereof. The present invention provides a multisegmented PolyA polynucleotide comprising two or more PolyA sequence segments, with adjacent PolyA sequence segments connected via a linker, wherein each PolyA sequence segment consists of multiple consecutive A's, and each linker is 1-24 nt long and consists of nucleotide residues that are not all A's. The multisegmented PolyA polynucleotide can exist stably during subculture in a host cell, such as Escherichia coli, and can improve mRNA stability and protein export. Furthermore, compared with conventional polyA sequences as units, the rate of fermentation recombination in E. coli can be significantly reduced, making it easier to optimize the amplification process. This makes the multisegmented PolyA polynucleotide more suitable for use in plasmid fermentation, which is used to prepare transcription templates for mRNA vaccines and pharmaceutical production.

Description

[Technical Field]

[0001] The present invention relates to a polynucleotide having PolyA and its use, in particular to a polynucleotide having a multisegmented PolyA sequence that can stably exist in a host cell such as E. coli, and its use, which belongs to the technical field of molecular biology. [Background technology]

[0002] Among the various approaches to combating the spread and infection of the novel coronavirus, vaccines are a very effective measure for preventing the further spread of the novel coronavirus on a wide scale. In particular, mRNA vaccines have developed rapidly due to their short research, development, and production cycles, and have great potential for future development in the pharmaceutical field. Currently, mRNA production is mainly by in vitro transcription, and the mRNA obtained by in vitro transcription needs to be capped and tailed to exert its physiological function in vivo.

[0003] Currently, there are two main methods for mRNA tailing: enzymatic and template-based methods. The enzymatic method involves tailing in vitro transcripts using PolyA polymerase, a mechanism that exists in natural cells. However, it has certain limitations in research and production. The additional tailing reaction makes the production process more complicated, and the number of tails added is not precise and can only be controlled within a certain range. Another limitation is that the tail length of the produced mRNA varies. On the other hand, the template-based method involves constructing a predetermined number of PolyA sequences on a transcription template, allowing tailing during the transcription process. This simplifies the process and avoids the problem of not being able to specify the specific number of PolyA sequences.

[0004] In the prior art, there are two common methods for adding a desired number of PolyA tails to a transcription template: PCR and plasmid methods, which are used at different scales. The PCR method involves adding PolyA to a transcription template by PCR using primers, with the final transcription template being the PCR product. This method is suitable for small-scale mRNA production due to the limitations of PCR systems. The plasmid method involves constructing a designed PolyA sequence directly into a plasmid, which contains a T7 promoter, 5' UTR, a gene of interest sequence, a 3' UTR, and the constructed PolyA sequence. The plasmid rapidly replicates in host cells such as E. coli, allowing for the rapid production of large amounts of transcription template in a short period of time, thereby enabling mRNA production to reach industrial scale. However, constructing a PolyA sequence into a plasmid is prone to recombination during replication in host cells, which can alter the PolyA sequence and result in uncontrollable PolyA tail sequences added to the produced mRNA, which directly affects the efficacy of mRNA medicines or vaccines.

[0005] To improve the stability of PolyA sequences in host cells, the current approach is to cultivate plasmids in strains that can reduce recombination or to modify the PolyA sequences to stabilize them during replication. Summary of the Invention

[0006] One object of the present invention is to provide a polynucleotide having a PolyA sequence that can stably replicate in a host cell.

[0007] Another object of the present invention is to provide related uses of said polynucleotides.

[0008] The present invention primarily involves multisegmenting a PolyA sequence by inserting non-PolyA sequences (linkers) of different lengths into different positions within the PolyA sequence, thereby obtaining a polynucleotide having a multisegmented PolyA sequence (abbreviated as a multisegmented PolyA polynucleotide in the present invention). The present invention maintains a high level of stability even after introducing a plasmid containing a multisegmented PolyA polynucleotide into a host cell, such as E. coli, and expanding the fermentation process. This prevents recombination during host cell subculture, improving the stability of the PolyA sequence in host cells, such as E. coli. Stable multisegmented PolyA polynucleotides with different effective lengths can meet the different expression requirements of different target genes. The multisegmented PolyA polynucleotides provided by the present invention significantly reduce the difficulty of plasmid construction and are more suitable for use in plasmid fermentation, which involves preparing transcription templates for the production of mRNA vaccines and pharmaceuticals. Stable multisegmented PolyA polynucleotides significantly reduce the loss of PolyA sequences during plasmid fermentation, thereby ensuring the efficacy of mRNA vaccines and pharmaceuticals.

[0009] Specifically, in one aspect, the present invention provides a multisegmented PolyA polynucleotide comprising two or more PolyA sequence segments, with adjacent PolyA sequence segments connected via linkers, wherein each PolyA sequence segment consists of multiple consecutive As, and each linker is 1-24 nt long and consists of nucleotide residues that are not all As.

[0010] According to a specific embodiment of the invention, the multisegmented PolyA polynucleotide of the invention comprises two, three, four or five PolyA sequence segments.

[0011] According to a specific embodiment of the invention, the multisegmented PolyA polynucleotide of the invention is one or more selected from polynucleotides having the following structure: PolyA sequence segment 1-linker 1-PolyA sequence segment 2; PolyA sequence segment 1-linker 1-PolyA sequence segment 2-linker 2-PolyA sequence segment 3; PolyA sequence segment 1-linker 1-PolyA sequence segment 2-linker 2-PolyA sequence segment 3-linker 3-PolyA sequence segment 4.

[0012] According to a specific embodiment of the present invention, in the multisegmented PolyA polynucleotide of the present invention, each PolyA sequence segment independently consists of 10-100 consecutive A's.

[0013] According to a specific embodiment of the invention, in the multisegmented PolyA polynucleotide of the invention, each PolyA sequence segment independently consists of 30-100, such as 30, 40, 50, 60, 70, 80, 90 or 100 consecutive As.

[0014] Unless otherwise specified, those skilled in the art will understand that when the number of A bases in a PolyA sequence segment described in the present invention is a submultiple, particularly when the number of A bases in the PolyA sequence segment is a multiple of 10, an error of approximately ±5, preferably ±3, and more preferably ±2 or ±1 A base is allowed based on the stated numerical value. For example, a PolyA sequence segment consisting of 30 consecutive A's means that the PolyA sequence segment actually contains 25, 26, 27, 28, 29, 30, 31, 32, 33, and / or 34 consecutive A's. For example, a PolyA sequence segment consisting of 70 consecutive A's means that the PolyA sequence segment actually contains 65, 66, 67, 68, 69, 70, 71, 72, 73, and / or 74 consecutive A's.

[0015] According to a specific embodiment of the present invention, in the multisegmented PolyA polynucleotide of the present invention, PolyA sequence segment 1 consists of 30-60 consecutive A's.

[0016] According to a specific embodiment of the present invention, in the multisegmented PolyA polynucleotide of the present invention, the total number of As in all PolyA sequence segments is 30-300, preferably 60-240, more preferably 100-200.

[0017] According to a specific embodiment of the present invention, in the multisegmented PolyA polynucleotide of the present invention, each linker is independently 1-18 nt, preferably 1-12 nt, and consists of nucleotide residues that are not all A.

[0018] According to a specific embodiment of the present invention, in the multisegmented PolyA polynucleotide of the present invention, each linker independently consists of G or has a G content of 20%-33% of all bases in the linker sequence.

[0019] According to a specific embodiment of the present invention, in the multisegmented PolyA polynucleotide of the present invention, each linker is independently selected from the nucleotides shown in the following sequence:

[0020] G; C; GGGGGG; ATGCAT; GCATATGACT(SEQ ID No.53); CAGTAATGAC (SEQ ID No. 54); AGTCATATGC (SEQ ID No. 55); GTCATTACTG (SEQ ID No. 56); TGTCAGATAC (SEQ ID No. 57); GCTCATATGC (SEQ ID No. 58); GCATATATGC (SEQ ID No. 59); CGCCATTAGAGG (SEQ ID No. 60); ATGCATGATATC (SEQ ID No. 61); TGCAACATCGAT (SEQ ID No. 62); CCTCTAATGGCG (SEQ ID No. 63); CAACCCCTGATTGTGTCCGCATCT(SEQ ID No.64).

[0021] According to a specific embodiment of the present invention, in the multisegmented PolyA polynucleotide of the present invention, the total length of all linkers is 1-48 nt, more preferably 2-24 nt.

[0022] According to a specific embodiment of the invention, in the multisegmented PolyA polynucleotide of the invention, the combined length of all linkers accounts for no more than 20%, preferably no more than 15%, more preferably no more than 10%, and even more preferably no more than 5% of the total length of the polynucleotide.

[0023] According to a specific embodiment of the present invention, the multisegmented PolyA polynucleotide of the present invention has the sequence SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO. The present invention also includes one or more polynucleotides having any of the sequences set forth in SEQ ID NO. 30, SEQ ID NO. 31, SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID NO. 39, SEQ ID NO. 40, SEQ ID NO. 41, SEQ ID NO. 42, SEQ ID NO. 43, SEQ ID NO. 44, SEQ ID NO. 45, SEQ ID NO. 46, SEQ ID NO. 47, SEQ ID NO. 48, SEQ ID NO. 49, SEQ ID NO. 50, SEQ ID NO. 51, SEQ ID NO. 52, SEQ ID NO. 77, SEQ ID NO. 78, SEQ ID NO. 79, SEQ ID NO. 80, and SEQ ID NO. 81.

[0024] In another aspect, the present invention also provides a vector comprising the multisegmented PolyA polynucleotide of the present invention. The multisegmented PolyA polynucleotide of the present invention can be incorporated into a plasmid vector by any method available in the art, thereby constructing the vector of the present invention incorporating the multisegmented PolyA polynucleotide. Specifically, when constructing the vector, restriction enzyme cleavage sites can be added to the termini of the multisegmented PolyA polynucleotide, if necessary.

[0025] In another aspect, the present invention also provides a host cell comprising the multisegmented PolyA polynucleotide of the present invention or the vector of the present invention (a vector incorporating the multisegmented PolyA polynucleotide).

[0026] In another aspect, the present invention also provides use of the multisegmented PolyA polynucleotide, the vector, and the host cell for in vitro transcription and production of a target mRNA, the target mRNA having a polyA tail formed by in vitro transcription from the multisegmented PolyA polynucleotide of the present invention.

[0027] Accordingly, the present invention further provides an mRNA comprising a polyA tail formed by in vitro transcription from a multisegmented PolyA polynucleotide of the present invention, said polyA tail corresponding to the mRNA sequence of the multisegmented PolyA polynucleotide of the present invention.

[0028] According to a specific embodiment of the present invention, the target mRNA is used in the production of mRNA vaccines and medicines. The multisegmented PolyA polynucleotides provided by the present invention are more suitable for use in plasmid fermentation for preparing transcription templates in the production of mRNA vaccines and medicines. The stable multisegmented PolyA polynucleotides significantly improve the loss of PolyA sequences during plasmid fermentation, ensuring the efficacy of mRNA vaccines and medicines.

[0029] In another aspect, the present invention also provides a method for determining the stability of a multisegmented PolyA polynucleotide in a host cell, the method comprising: 1) cloning the multisegmented PolyA polynucleotide of the present invention into a general-purpose plasmid vector to obtain a plasmid vector incorporating the multisegmented PolyA polynucleotide; 2) introducing a plasmid vector incorporating the multisegmented PolyA polynucleotide into a host cell, such as E. coli, to obtain recombinant cells, seeding the recombinant cells on a solid plate to obtain single colonies, picking the single colonies and performing preliminary PCR identification (preferably, the PCR product is identified by 2%-3% agarose gel electrophoresis), and selecting stable colonies in which recombination has not occurred; 3) The stable bacteria selected in the preliminary identification, in which no recombination has occurred, are subjected to expanded fermentation culture, and the culture solution is serially diluted, and then applied to a solid plate, and colony PCR is performed to identify the subculture stability.

[0030] In some specific embodiments of the present invention, methods for identifying the stability of a multisegmented PolyA polynucleotide of the present invention in a host cell comprise: 1) Producing a gene fragment having the above sequence by gene synthesis, constructing it into the general-purpose plasmid pUC-GW-kana, and synthesizing the corresponding general-purpose primers; 2) To identify the optimal annealing temperature by gradient annealing PCR using the plasmid as a template; 3) The plasmid is introduced into E. coli by standard E. coli transformation (including, but not limited to, DH5α, stbl2, stbl3, and stable), and after transformation, the plasmids are spread onto LB plates with different kanamycin resistance (final concentration 50 μg / ml; all kanamycin resistances described below are at this concentration, so explanation will be omitted), and cultured at 30-37°C for 12-20 hours; 4) A single colony on each plate was collected into 20 μl of kanamycin-resistant liquid medium and mixed thoroughly to prepare a colony suspension. 5) preparing a colony PCR reaction system for identifying the sequence stability (20 μL, containing as components 7 μL of RNA-free water, 0.5 μL each of Primer 1 and Primer 2, 10 μL of Enzyme Mix, and 2 μL of colony solution); 6) Identifying the PCR products obtained in 5) by 2-3% agarose gel electrophoresis and analyzing the electrophoresis results to determine the stability of the corresponding PolyA sequence in E. coli; 7) If the recombination rate is lower than 15%, select the bacterial suspension in which recombination has not occurred, take 5 μl of the suspension, inoculate it into 100 ml of kanamycin-resistant medium, and place it in a shaker at 30°C and 220 rpm for 12-16 hours. 4 Dilution and spreading onto a kanamycin-resistant solid plate, inverting the plate in an incubator at 30°C for 20 hours, and repeating steps 4)-6) to further verify the stability of the PolyA sequence during expansion; 8) Further validation will involve inoculating 3 ml of kanamycin-resistant medium from the monoclonal colonies on the plate and culturing them on a shaker at 30-37°C for 12-20 hours, followed by small-scale extraction of the plasmid. The extracted plasmid will be sent to a reputable biotech company for sequencing, and the sequencing results will be subjected to sequence alignment analysis, which will provide further evidence of sequence stability.

[0031] Specific experiments demonstrated that the multisegmented PolyA polynucleotides provided by the present invention significantly reduce the occurrence of alterations or deletions of PolyA sequences due to homologous recombination during E. coli subculture, significantly improving the quality of the mRNA produced. PolyA sequences of different effective lengths can meet the expression requirements of different target genes, and stable subculture in E. coli also enables the fermentation of expanded plasmid production, greatly simplifying the production process and improving production yields. The multisegmented PolyA polynucleotides provided by the present invention are particularly well suited for use in plasmid fermentation, which involves the preparation of transcription templates for mRNA vaccines and pharmaceutical production. [Brief explanation of the drawings]

[0032] [Figure 1] FIG. 1 is a schematic diagram of the designed structure of a multisegmented PolyA polynucleotide of the present invention. [Figure 2] 1 is a plasmid map of pUC-GW-kana. [Figure 3] The results of investigating the optimal annealing temperature for primers cgacggccagtgaattgac (SEQ ID No. 65) and cagctatgaccatgctcgag (SEQ ID No. 66) using the general-purpose plasmid pUC-GW-kana having the sequence shown in SEQ ID No. 1 as a template are shown. [Figure 4] 1 shows the results of a comparison of the stability of some multisegmented PolyA polynucleotides of the present invention in E. coli stbl3. [Figure 5] 1 shows the results of a comparison of the stability of some multisegmented PolyA polynucleotides of the present invention in E. coli stbl2. [Figure 6] The figure shows the results of sequencing and alignment after small-scale extraction of plasmids from strains in which some multisegmented PolyA polynucleotides of the present invention were fermented and expanded in Escherichia coli stbl2. [Figure 7]Based on the data shown in Figures 4 and 5, the sequence characteristics were divided into the number of linkers, their position, length, and G, C, and T content, and the correlation with the stability of the multisegmented PolyA polynucleotides was analyzed. [Figure 8]

[0039] Figure 1 shows the results of fluorescence microscopy of 293T / 17 cells transfected with some of the multisegmented PolyA polynucleotides of the present invention, which were added to a DNA template expressing GFP by the plasmid method or PCR method, and the corresponding mRNA was obtained by IVT. [Figure 9] The cell samples shown in FIG. 8 were treated and then detected by a flow cytometer (specific detection data are shown in the table of the figure). [Figure 10] 1 shows the results of detecting the expression levels of mRNA for the multisegmented polyA sequences shown in SEQ ID No. 77-SEQ ID No. 81. [Figure 11] 1 shows stability detection data for A30G70 and A30L70 after limit expansion culture. DETAILED DESCRIPTION OF THE INVENTION

[0033] In order to more clearly understand the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will be described in detail below, but it is not intended to limit the scope of the present invention. The starting reagent materials used in the following experiments are all commercially available, and the experimental methods without specific conditions are in accordance with conventional methods and conditions well known in the art or conditions recommended by the instrument manufacturers.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0035] The present invention provides multisegmented PolyA polynucleotides, the structural design of which is shown in Figure 1. Specifically, the present invention provides multisegmented PolyA polynucleotides represented by SEQ ID No. 1-SEQ ID No. 52 and SEQ ID No. 77-SEQ ID No. 81 in Table 1 (note that the number of A bases in the PolyA sequence segments represented by SEQ ID No. 1-SEQ ID No. 52 has an error of ±1 A base, while the number of A bases in the PolyA sequence segments represented by SEQ ID No. 77-SEQ ID No. 81 is the exact value).

[0036] [Table 1] JPEG2025527792000002.jpg249160JPEG2025527792000003.jpg249160JPEG2025527792000004.jpg249160

[0037] In the present invention, the multisegmented PolyA polynucleotide must be constructed in a general-purpose vector, followed by transformation and identification. In the present invention, the general-purpose vector is not particularly limited, but it is preferable to use the kanamycin-resistant general-purpose plasmid pUC-WG-kana. The plasmid map of pUC-GW-kana is shown in Figure 2. In the present invention, the multisegmented PolyA polynucleotide must be constructed in the EcoRVI insertion site of the general-purpose vector. Synthetic plasmids are typically stored and transported in a dry powder state and are preferably dissolved in ultrapure water for use. The concentration of the plasmid dissolved in water is preferably 10 ng / μl, more preferably 1 ng / μl. In the present invention, the ultrapure water is not particularly limited, and conventional laboratory ultrapure water can be used.

[0038] In the present invention, after obtaining the synthetic plasmid, the synthetic plasmid is introduced into different host cells to obtain recombinant cells, and colony PCR is performed on each of the different recombinant cells to identify the stability of the corresponding sequence in the synthetic plasmid. In the present invention, the different host cells are preferably E. coli competent cells (including, but not limited to, DH5α, stbl2, stbl3, and stable). In the present invention, the introduction method is not particularly limited, and any conventional introduction method in the art may be used. In the present invention, after obtaining recombinant cells, it is preferable to identify the stabilizing sequence of positive recombinant cells. In the present invention, the screening of the positive recombinant cells is preferably performed on a kanamycin-resistant solid medium. In the present invention, a single colony on the kanamycin-resistant solid medium is collected and thoroughly dissolved in a predetermined volume of medium to obtain a dilution of the single colony. In the present invention, the method for dissolving the single colony is not particularly limited, and any conventional bacterial collection and inoculation procedure in the art may be used. After obtaining the colony dilution, a small amount of the bacterial liquid is aspirated and subjected to colony PCR. If the number of bands corresponding to the target band exceeds 75%, the bacterial liquid containing the amplified band is collected and inoculated into 100 ml of kanamycin-resistant liquid medium for further subculture. In the present invention, the sequence of primer F for the colony PCR is cgacggccagt gaattgac (SEQ ID No. 65), and the sequence of primer R for the colony PCR is cagctatgaccatgctcgag (SEQ ID No. 66). In the present invention, the amplification program for the colony PCR preferably includes 30 cycles of pre-denaturation at 98°C for 10 minutes, denaturation at 98°C for 300 seconds, annealing at 66.5°C for 15 seconds, and extension at 72°C for 30 seconds, followed by a final extension at 72°C for 5 minutes. In the present invention, the colony PCR system preferably uses 2x Hieff (R) The contents were 10 μl of HotStart PCR Genotyping Master Mix (containing dye), 0.5 μl of primer F, 0.5 μl of primer R, 2 μl of bacterial solution, and 7 μl of water.

[0039] In the present invention, the initial concentrations of the primers F and R are preferably 10 μmol / L. (R) HotStart PCR Genotyping Master Mix (with dye) contains DNA polymerase, dNTPs, Mg 2+ and a nucleic acid dye. After the PCR amplification is completed, the present invention preferably identifies and analyzes single colonies matching the size of the target band by agarose gel electrophoresis. In the present invention, the agarose gel electrophoresis is not particularly limited, and conventional gel preparation and electrophoresis methods in the art can be used. It is preferable to use a 3% agarose gel and perform the electrophoresis at 130 V for 30 minutes. When the proportion of bands matching the size of the target band exceeds 50%, a strain matching the size of the target band is selected and inoculated into 100 ml of kanamycin-resistant liquid medium for strain culture. In the present invention, the kanamycin-resistant liquid medium is not particularly limited, and conventional kanamycin-resistant liquid medium in the art can be used. In the present invention, the method for inoculating and culturing the strain is not particularly limited, and conventional strain inoculation and culturing methods in the art can be used. Preferably, the culture is performed in a shaker at 30°C and 220 rpm for 16 hours. After the culture is completed, 5 μl of the bacterial suspension is serially diluted to 100 ml. 4 , 10 5 , 10 6After diluting the bacterial suspension 1:1, the suspension is spread onto a kanamycin-resistant solid medium and cultured overnight in an incubator at 30°C. In the present invention, the method for diluting the bacterial suspension is not particularly limited; a serial dilution method for bacterial suspensions commonly used in the art can be used. After overnight culture, plates with 100-300 single colonies are selected for subsequent colony PCR identification. The identification procedure is the same as above, including bacterial collection, bacterial suspension dilution, PCR system preparation, reaction using a specific program, and identification by agarose gel electrophoresis. The primers, program, and electrophoresis method used are all the same as above. Furthermore, monoclonal colonies collected from appropriate plates are cultured in 3 ml of kanamycin-resistant medium, followed by small-scale extraction and sequencing of the plasmid. The sequencing results can be aligned to provide additional evidence for stability analysis. From the identification results, the recombination rate of the plasmid containing the stabilizing sequence during expansion in E. coli can be calculated. The recombination rate is calculated as follows: recombination rate = 1 - number of bands matching the size of the target band / total number of samples.

[0040] In this study, after obtaining all the results from the above assay experiments, we selected several multisegmented polyA sequences with extremely low recombination rates, i.e., extremely stable, and incorporated them into eGFP-expressing vectors. Alternatively, we synthesized primers containing the corresponding stable multisegmented polyA sequences and added the polyA sequences to the eGFP coding sequence by PCR. We then prepared the corresponding mRNA by in vitro transcription and transfected it into 293T / 17 cells to verify translation at the cellular level. Qualitative analysis was performed using an inverted fluorescence microscope and quantitative fluorescence intensity was measured using a flow cytometer to analyze the effects of different polyA sequences on translational activity. [Example]

[0041] The technical solutions according to the present invention will be described in detail below with reference to examples, which should not be construed as limiting the scope of the claims of the present invention.

[0042] Example 1 Design and synthesis of multisegmented PolyA polynucleotides 1) The target DNA fragments represented by the genes SEQ ID Nos. 1-52 and 77-81 were synthesized and inserted into the EcoRV I site of the general-purpose vector pUC-GW-kana. The structural design of the above sequences is shown in Figure 1, and the map of the general-purpose vector is shown in Figure 2. 2) The optimal annealing temperature of universal primers for colony PCR was identified. 3) The target gene was transformed into Escherichia coli competent cells stbl2 or stbl3 and cultured in a kanamycin-resistant liquid medium. 4) Preliminary identification was performed by colony PCR. 5) The bacterial solution identified as meeting the requirements was inoculated, serially diluted, and spread for identification and analysis. 6) After expansion, the target plasmid in the strain was subjected to sequencing analysis. 7) The stability data of all sequences were statistically analyzed.

[0043] The procedure for identifying the optimal annealing temperature is as follows. The enzyme, primers, and plasmid template were removed from -20°C and placed in an ice-water mixture until these materials had completely melted and no solid ice was evident. A PCR reaction system was prepared, the specific system being as follows:

[0044] 2×Hieff (R) HotStart PCR Genotyping Master Mix (contains dye) 200μl Primer F 10 μl Primer R 10 μl Plasmid 10 μl 170 μl water

[0045] In the present invention, the initial concentrations of Primer F and Primer R were 10 μmol / L, and the concentration of the DNA template (a plasmid having the sequence shown in SEQ ID No. 1) was 1 ng / μL. In the present invention, the sequence of Primer F was cgacggccagtgaattgac (SEQ ID No. 65), and the sequence of Primer R was cagctatgaccatgctcgag (SEQ ID No. 66). After the reaction system was prepared, 20 μL aliquots were dispensed into 19 different PCR tubes. Each tube was placed sequentially in the same horizontal row of a PCR device, and a gradient annealing PCR program was set up to examine and identify the optimal annealing temperature.

[0046] In the present invention, the amplification program for the gradient annealing PCR preferably includes 30 cycles of pre-denaturation at 98°C for 10 minutes, denaturation at 98°C for 30 seconds, annealing at 55.7-66.5°C for 15 seconds, and extension at 72°C for 30 seconds, followed by a final extension at 72°C for 5 minutes. This program allows each well in a horizontal row of the PCR instrument to correspond to a different annealing temperature, while the other temperature change programs remain completely identical. Therefore, by varying only the annealing temperature in the same system, differences in product quality can be quickly obtained, and the optimal annealing temperature of the primers can be analyzed and determined.

[0047] After completing the program, a 3% agarose gel was prepared (3 g of agarose was weighed out and added to 100 ml of TAE solution). After the PCR reaction was completed, 0.5 μl of bromophenol blue was added to the PCR tubes, which were then shaken to mix evenly. The samples were then loaded sequentially at different temperatures. The electrophoresis program was set to 130 V and run for 30 minutes, after which the color was developed. The detection results are shown in Figure 3. To reduce the impact of nonspecific bands on the detection results, an annealing temperature of 66.5°C, which minimized the number of nonspecific bands, was selected for subsequent experimental assays.

[0048] The plasmid transformation procedure is as follows. A corresponding number of clean 1.5ml EP tubes were placed in the EP tube holder, and the corresponding transformation plasmid markings were written on them. The tubes containing the dried synthetic gene powders (synthetic gene plasmids containing any of SEQ ID Nos. 1-52 and SEQ ID Nos. 77-81, respectively) were centrifuged at 10,000xg for 1 minute, diluted to 10ng / μl with enzyme-free water on the bench, and pre-cooled on ice for 5 minutes. At the same time, competent cells stbl2 and stbl3 were thawed on ice. Once no significant ice fragments remained in the competent cells, 50μl aliquots were placed in the removed 1.5ml EP tubes, and 1ng of the correspondingly pre-cooled synthetic plasmids was added to the competent cells. After gently pipetting with a pipette tip to mix evenly, the mixture was incubated on ice for 30 min. The EP tube was then placed in a preheated water bath at 42°C. The cells were heat-shocked by submerging them below the liquid surface and heating thoroughly. After 45 s of heat shock, the tube was removed and gently placed under the ice surface. After 2 min of incubation, 950 μl of LB liquid medium was added and the tube was placed in a shaker at 30°C and resuscitated at 220 rpm for 1 hour. 50 μl, 100 μl, and 150 μl of each strain were plated onto kanamycin-resistant solid plates. After 20-24 h of incubation in a 30°C incubator, plates with approximately 100-300 visible single colonies were selected for identification.

[0049] The procedure for colony PCR is as follows. Picking single colonies: Arrange the corresponding number of 8-tube tubes in a PCR tube holder, pour LB medium into the reservoir of a multichannel pipette, and then add 50 μl of LB medium to each 8-tube using the multichannel pipette. Using a sterile white tip of the pipette with tweezers, pick a single colony from the plate and place it into the 8-tube. Gently shake the PCR tube holder to thoroughly mix the bacteria on the tip into the medium, then remove the white tip. At the same time, close the lids of the 8-tube tubes, mark them with an alcohol-resistant marker, and place them on a shaker at 30°C for 2 hours. Record relevant information (date, number, etc.) in a notebook. After removing from the shaker, briefly spin the tubes in a mini centrifuge, tap lightly with your finger to remove bubbles, and then briefly spin for another 15 seconds before storing at 4°C for further use.

[0050] Colony PCR reaction: The PCR reaction system shown below was prepared, and the prepared reaction mixture was added to a 96-well plate. 1 μl of bacterial suspension was then added using a multichannel pipette. A positive control reaction using the original gene plasmid as a template and a negative control reaction using water as a template were also included. Amplification was performed according to the PCR program.

[0051] 2×Hieff (R) HotStart PCR Genotyping Master Mix (contains dye) 10μl Primer F 0.5 μl Primer R 0.5 μl Bacterial solution 2μl 7μl water

[0052] In the present invention, the initial concentrations of Primer F and Primer R are 10 μmol / L, and the concentration of the DNA template is 1 ng / μL. In the present invention, the sequence of Primer F is cgacggccagtgaattgac (SEQ ID No. 65), and the sequence of Primer R is cagctatgaccatgctcgag (SEQ ID No. 66). In the present invention, the PCR amplification program preferably comprises 30 cycles of pre-denaturation at 98°C for 10 minutes, denaturation at 98°C for 30 seconds, annealing at 66.5°C for 15 seconds, and extension at 72°C for 30 seconds, followed by a final extension at 72°C for 5 minutes.

[0053] Agarose gel electrophoresis: First, a 3% agarose gel was prepared (3 g of agarose was weighed and added to 100 ml of TAE solution). After the PCR reaction was completed, 0.5 μl of bromophenol blue was added to each of the 8 tubes, which were then shaken to mix evenly. The samples were then loaded onto the gel, and the electrophoresed agarose gel was photographed and stored.

[0054] Definition and analysis of recombination rate: The recombination rate of the stabilizing sequence was determined based on the band diagram of agarose gel electrophoresis. If the colony PCR band size matched that of the positive control (using the corresponding plasmid as a PCR template) and there were no contaminating bands, the strain was counted as non-recombinant; otherwise, it was counted as recombinant. Recombination rate = number of counted recombinant strains / total number of tested strains.

[0055] Stability test after expansion culture for plasmids with favorable sequences after recombination rate analysis: For some sequences (including SEQ ID No. 44, SEQ ID No. 45, SEQ ID No. 46, SEQ ID No. 47, and SEQ ID No. 51) with recombination rates of less than 15% initially screened by the above screening, further expansion culture tests were conducted. Stable strains identified by colony PCR were selected, and 10 μl of the bacterial solution was inoculated into 100 ml of kanamycin-resistant LB liquid medium and cultured at 30°C, 220 rpm for 16 hours. 4 , 10 5 , 106 After 2x dilution, the mixture was plated on a kanamycin-resistant solid medium and cultured in a 30°C incubator for 20 hours. Plates with relatively uniform colonies were selected, and several single colonies were picked for stability assays. The assay method was the same as above.

[0056] Figure 4 shows the recombination rate assay results after transforming some of the plasmids into the stbl3 strain, while Figure 5 shows the assay results after transforming some of the plasmids into the stbl2 strain and after expanded fermentation of the stabilized strain. To more accurately determine sequence stability, we sent the expanded strains to an external laboratory for sequencing, and the sequence alignment results are shown in Figure 6. To more intuitively analyze the relationship between the stability of multisegmented polyA and sequence properties based on the extensive assay results shown in Figures 4 and 5, we processed the data using matplotlib.pyplot and separated sequence characteristics into linker number, position, length, and G, C, and T content. We then analyzed the correlation between each of these features and the stability of the multisegmented PolyA polynucleotide. The results are shown in Figure 7.

[0057] Example 2 Translation verification of some multi-segmented polyA sequences: 1) A linearized vector backbone and a multi-segmented polyA sequence with the same termini as the backbone were obtained by PCR. 2) The linearized backbone was ligated to the polyA sequence by homologous recombination. 3) The ligation product was transformed into Escherichia coli stbl2, spread on kanamycin-resistant LB solid screening medium, and cultured overnight in an incubator at 30°C for preliminary screening of recombinants. 4) The correct recombinants were finally confirmed by sequencing. 5) The corresponding transcription templates were obtained by linearization recombinants and PCR tailing. 6) The corresponding mRNA was prepared by in vitro transcription. 7) Translation was verified in cells.

[0058] The procedure for backbone linearization and obtaining a polyA sequence by PCR is as follows. PCR reaction: A kanamycin-resistant plasmid containing a T7 promoter, 5'UTR, eGFP coding region, and 3'UTR sequence was obtained by gene synthesis and used as the backbone for constructing the target vector. The plasmid was linearized by PCR and the reaction system was run using PrimeSTAR (R) Max DNA polymerase 10 μl, primer F 0.5 μl, primer R 0.5 μl, plasmid template 0.5 μl, water 8.5 μl.

[0059] In the present invention, the initial concentrations of Primer F and Primer R are 10 μmol / L, the concentration of the DNA template is 1 ng / μL, the sequence of Primer F in the linearized vector backbone is TGAGGGTCTAGAACTAGTGTCG (SEQ ID No. 67), the sequence of Primer R is CTTCCTACTCAGGCTTTATTCAAAG (SEQ ID No. 68), and the plasmid template used is a synthetic gene having the above backbone sequence.

[0060] The PCR system used to amplify a polyA segment with a backbone homology sequence was the same as described above. The sequence of primer F used was CTTTGAATAAAGCCTGAGTAGGAAG (SEQ ID No. 69), the sequence of primer R used was CGACACTAGTTCTAGACCCTCA (SEQ ID No. 70), and the plasmid template used was a synthetic gene with a multisegmented stable polyA sequence, containing backbone homology sequences at both ends of the gene. The flanking sequences at the 5' end were CTTTGAATAAAGCCTGAGTAGGAAG (SEQ ID No. 71) and CGACACTAGTTCTAGACCCTCA (SEQ ID No. 72). The multisegmented polyA sequences selected for construction included A30L70, A30L170, A30L270, A30G70, and A40L80.

[0061] In the present invention, the PCR amplification program preferably comprises 30 cycles of pre-denaturation at 98°C for 10 minutes, denaturation at 98°C for 30 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds, followed by a final extension at 72°C for 5 minutes.

[0062] Agarose gel electrophoresis: First, a 1% agarose gel was prepared (1 g of agarose was weighed and added to 100 ml of TAE solution). After the PCR reaction was completed, 0.5 μl of bromophenol blue was added to the PCR tube, which was then shaken to mix evenly. The sample was then loaded, and a DNA marker was loaded in the lane adjacent to the sample. The electrophoresed agarose gel was photographed and saved.

[0063] Analysis of target bands: The gel was developed and the target bands were compared with the marker bands of the corresponding size to confirm that the target bands were clear and of the correct size. If the band size was incorrect or no band was detected, the above procedure was repeated.

[0064] The procedure for in vitro recombination of the target band is as follows. Preparation of Recombination System: An in vitro recombination system was prepared using the PCR product described above, containing 2 μl of backbone PCR product, 2 μl of polyA PCR product, 0.1 μl of T5 exonuclease, 0.5 μl of 4 buffer, and 0.4 μl of ddH2O. All preparations were performed on ice. After completion of the preparation, the mixture was gently mixed uniformly with a Pipetman and incubated on ice for 5 min. After incubation, 50 μl of E. coli competent cells, preferably Stbl2 competent cells, was added, gently pipetted, and incubated on ice for 30 min. After heat shock in a 42°C water bath for 45 s, the mixture was returned to ice and incubated for 2 min. The mixture was then removed, 950 μl of liquid LB medium was added, and the mixture was resuscitated on a shaker at 30°C for 1 h. It was then plated onto kanamycin-resistant solid LB medium and cultured in a 30°C incubator for 20 h.

[0065] Finally, screening for accurate recombinants was performed: After culturing the above-mentioned culture medium for 20 hours, several single colonies were picked and inoculated into 3 ml of kanamycin-resistant liquid LB medium, which were then cultured at 30°C for 16 hours to extract the plasmids, which were then sequenced. The sequencing results were aligned with the designed sequence, and the plasmids with no errors in the alignment results were numbered, aliquoted, and stored.

[0066] The procedure for preparing the transcription template by the plasmid method is as follows. Linearization of recombinant plasmid: The constructed recombinant plasmid was linearized using the designed restriction enzyme cleavage site of the IIS type restriction endonuclease. In the present invention, the enzyme cleavage was preferably performed using BspQI. The enzyme cleavage system was as follows: 100 μg of recombinant plasmid (1 μg / μl), NEBuffer TM 500 μl of r3.1, 30 μl of BspQI (10,000 units / ml), and 4.37 ml of sterile water were mixed uniformly and then incubated in a metal bath at 50°C for 1 hour. After the incubation was completed, the mixture was purified using the Cycle Pure kit according to the operating instructions in the kit manual.

[0067] Assay of linearized product: After purifying the linearized product, 2 μl was taken and the concentration was measured using a nanodrop microvolume spectrophotometer to record the product concentration. 400 ng was taken and mixed with 10× DNA loading buffer and assayed by agarose gel electrophoresis. The band was single, clear, and of the correct size. The product was either marked and stored at -20°C or used for subsequent in vitro transcription.

[0068] The procedure for preparing a transcription template by PCR is as follows. Preparation of PCR system: A kanamycin-resistant plasmid containing a T7 promoter, 5'UTR, eGFP coding region, and 3'UTR sequence was obtained by gene synthesis, and a polyA tail was added to the above sequence by PCR. The reaction system was as follows:

[0069] PrimeSTAR (R) Max DNA polymerase 200 μl Primer F 4 μl Primer R 4 μl Plasmid template 4 μl 188μl water

[0070] In the present invention, the initial concentrations of the primer F and the primer R are 10 μmol / L, and the concentration of the DNA template is 1 ng / μl. In the present invention, the sequence of the primer F is GTACAGAAGCTAATACGACTCAC (SEQ ID No. 73), and the sequence of the primer R is TT ... The plasmid template used is a synthetic gene having the T7 promoter, 5'UTR, eGFP coding region and 3'UTR sequence described above.

[0071] In the present invention, the PCR amplification program preferably comprises 30 cycles of pre-denaturation at 98°C for 10 minutes, denaturation at 98°C for 30 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds, followed by a final extension at 72°C for 5 minutes.

[0072] Purification of PCR products: Weigh out 0.5 g of agarose and place it in 50 ml of 1x TAE. Heat in a microwave oven until no visible solids are visible. Add 5 μl of nucleic acid dye and mix thoroughly to homogenize. Place in a pre-prepared gel caster to create a collection gel with 400 μl wells. Let the gel stand at room temperature for 30 minutes until completely solidified. Remove the comb and place in an electrophoresis apparatus. Load all of the PCR products mixed with DNA loading buffer onto the gel. Run at 130 V for 30 minutes. After that, transfer the gel to a blue-light gel imager to analyze the target bands. After confirming that the bands are clear and of the correct size, excise the target bands with an alcohol-sterilized knife and place them in an EP tube. Then, EZNA (R) The purified product was extracted using a Gel Extraction Kit, following the specific procedures described in the kit's manual.

[0073] Assay of purified products: After purifying the PCR products, 2 μl of each were measured using a nanodrop microvolume spectrophotometer and recorded. 400 ng of each was mixed with 10× DNA loading buffer and assayed by agarose gel electrophoresis. A single, clear band was obtained, and the size was accurate. The product was then marked and stored at -20°C or used for subsequent in vitro transcription.

[0074] Preparation of mRNA by in vitro transcription: Preparation of transcription system: In vitro transcription systems for preparing the corresponding mRNAs were prepared using different templates as follows.

[0075] NTP 2 μl CAP 2μl 10x buffer 2 μl T7 RNA polymerase mix 2 μl Transcription template 400ng Add water up to 20 μl

[0076] After preparing the above system, set it in a PCR machine and set the program to react at 37°C for 4 hours. Then, add 2 μl of DNAse I to the reaction system, react at 37°C for 45 minutes, then remove it and wash it with MEGAclean. TM Purification was carried out using the kit, with reference to the specific purification procedure described in the kit manual.

[0077] mRNA assay: 2 μl of the purified mRNA was measured using a nanodrop microvolume spectrophotometer to record the product concentration. 400 ng was then mixed with 10x RNA loading buffer and assayed by agarose gel electrophoresis. The band was single and clear, and the size was accurate. The sample was marked and stored at -20°C or used in the next assay experiment.

[0078] Cellular translation verification of GFP expression by mRNAs with different multi-segmented polyA sequences: Cell and transfection reagent preparation: The host cells used for transfection were 293T cells, which were pre-seeded in 24-well plates to be 70-90% confluent at the time of transfection. 0.5-4 h before transfection, the medium was replaced with opti-MEM™ medium containing 5% serum. Subsequent transfections were performed using the Lipofectamine transfection kit. TM 3000 and following the specific procedure below.

[0079] mRNA and Lipofectamine transfection reagent in opti-MEM™ medium TM Dilute both Lipofectamine 3000 at the specified ratio. TMThe dilution solution was prepared by mixing 3000 and mRNA at a ratio of 1:1. The dilution solution was prepared as follows: 1) 25 μl of opti-MEM™ medium and Lipofectamine TM 1) 1.5 μl of 3000 μL of 1 ...

[0080] Examination using an inverted fluorescence microscope: After 24 hours of culture, the cell culture plate was removed from the CO2 incubator and placed under the lens of an inverted fluorescence microscope. The corresponding channel and detection parameters were set, and the fluorescence within the field of view was first observed using a low-magnification lens. When the field of view was uniform and the fluorescence was strong, the lens was switched to a high-magnification lens to observe and photograph the image. The image was saved, named, memorized, and recorded, and the detection results are shown in Figure 8.

[0081] Flow cytometry assay: The cells identified by microscopy were digested with trypsin at room temperature for 1 minute, then the digestion reaction was stopped with complete medium. The cells were then transferred to a 1.5 ml tube with a sharp bottom using a Pipetman and centrifuged at 1000 g. The supernatant was discarded and the cells were washed twice with PBS. The samples were then assayed using a flow cytometer. The mean fluorescence intensity was measured in the FITC channel. Blank cells (without mRNA transfection) served as a negative control. The results of the assay, comparing the fluorescence intensity of different mRNAs expressed in the cells, are shown in Figure 9. The results of the assay for the expression levels of mRNAs corresponding to the multisegmented polyA fragments shown in SEQ ID Nos. 77-81, are shown in Figure 10.

[0082] As can be seen from the above examples, the multisegmented PolyA polynucleotides provided by the present invention can remain stable during subculture of E. coli.

[0083] Comparison of stability between A30G70 and A30L70 after limit expansion culture (1) Transformation of a plasmid containing the target gene The plasmids containing A30G70 and A30L70 were then transformed into competent E. coli cells. The specific procedure was as follows: The synthetic gene was diluted to 1 ng / μl in enzyme-free water, and the competent E. coli stbl2 cells were removed from the -80°C refrigerator and placed in an ice-water mixture. After 5 minutes, the competent cells were completely thawed. 1.5 ml sterile EP tubes were marked with corresponding labels. 50 μl of competent cells were added to each tube, followed by 1 μl of plasmid, which was added sequentially according to the labeling on the tube. The competent cells and plasmid were mixed by gently pipetting five times. During the procedure, the temperature was maintained at a low temperature without leaving the ice-water mixture, and the handling was as gentle as possible to minimize the impact on the efficiency of the competent cells. After thoroughly mixing the competent cells and plasmid, the tubes were placed in an ice-water mixture for 30 minutes and then heat-shocked by incubating in a 42°C water bath for 45 seconds. They were then immediately removed and placed in an ice-water mixture for 2 minutes. Then, 950 μl of LB liquid medium was added to each tube in a clean bench, and the tubes were placed in a shaking incubator at 30°C for 1 hour. After incubation, the tubes were removed from the shaking incubator, and 100 μl of the medium was aspirated from each tube using a pipette and plated onto a kanamycin-resistant solid plate. After uniformly spreading, the plates were inverted and incubated for 20 hours in a 30°C incubator. Approximately 100-300 visible single colonies were considered acceptable for subsequent identification.

[0084] (2) Fermentation stability verification The corresponding number of 8-tube tubes were arranged in a PCR tube holder, LB medium was placed in the reservoir of a multichannel pipette, and 120 μl of LB medium was added to each 8-tube using the multichannel pipette. A single colony was picked from the plate using a sterile white tip held with tweezers and placed in the 8-tube. The PCR tube holder was gently shaken to thoroughly mix the bacteria on the tip with the medium, and the white tip was then removed. The 8-tube tubes were then capped, marked with an alcohol-resistant marker, and incubated on a shaker at 30°C for 2 h. Relevant information (date, number, etc.) was recorded in a notebook. After removal from the shaker, the tubes were briefly spun in a minicentrifuge, tapped lightly with a finger to remove bubbles, and then spun again for 15 s. They were then stored at 4°C until further use.

[0085] Colony PCR reaction: The PCR reaction system shown below was prepared, and the prepared reaction mixture was added to a 96-well plate. 1 μl of bacterial suspension was then added using a multichannel pipette. A positive control reaction using the original gene plasmid as a template and a negative control reaction using water as a template were also included. Amplification was performed according to the PCR program.

[0086] 2×Hieff (R) HotStart PCR Genotyping Master Mix (contains dye) 10μl Primer F 0.5 μl Primer R 0.5 μl Bacterial solution 2μl 7μl water

[0087] In the present invention, the initial concentrations of Primer F and Primer R are 10 μmol / L, and the concentration of the DNA template is 1 ng / μL. In the present invention, the sequence of Primer F is 5'-gtaaaacgacggccagt-3' (SEQ ID No. 82), and the sequence of Primer R is 5'-caggaaacagctatgac-3' (SEQ ID No. 83). In the present invention, the PCR amplification program preferably comprises 30 cycles of pre-denaturation at 98°C for 10 minutes, denaturation at 98°C for 30 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 30 seconds, followed by a final extension at 72°C for 5 minutes.

[0088] Agarose gel electrophoresis: First, a 3% agarose gel was prepared (3 g of agarose was weighed and added to 100 ml of TAE solution). After the PCR reaction, 0.5 μl of bromophenol blue was added to each of the 8 tubes. After the PCR reaction, the tubes were mixed uniformly by shaking, and the samples were loaded. The electrophoresed agarose gel was photographed and stored. The recombination rate of the stabilizing sequence was determined based on the band pattern obtained from the agarose gel electrophoresis. A colony PCR band whose size matched that of the positive control and lacked any contaminating bands was defined as a non-recombinant strain; otherwise, a recombinant strain was defined as a recombinant strain. A non-recombinant strain was selected and expanded at a volume ratio of 1:1000. A 24-hour incubation at 30°C was defined as one generation. After incubation, an additional 100 μl was aspirated and inoculated into 100 ml of fresh medium for continuous cultivation. The culture was continued for 20 generations, and stability assays of the intermediate and final generations were performed using the same assay method as described above.

[0089] See Figure 11 for the assay results. As can be seen from the analysis, after limit-expansion culture, A30G70 showed obvious superiority. Even after 20 generations of limit-expansion fermentation, the recombination rate of A30G70 was less than 10, which was only about one-third of that of A30L70. This indicates that even after undergoing a certain expansion process, A30G70 still has better quality mRNA products.

[0090] It should be understood that the above-described contents are merely preferred embodiments of the present invention, and that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these should also be considered to be included within the scope of the present invention.

Claims

1. A multisegmented PolyA polynucleotide comprising two or more PolyA sequence segments, with adjacent PolyA sequence segments connected via linkers, wherein each PolyA sequence segment consists of multiple consecutive A's, and each linker is 1-24 nt long and consists of nucleotide residues that are not all A's.

2. 2. The multisegmented PolyA polynucleotide of claim 1, which is one or more selected from polynucleotides having the following structure: PolyA sequence segment 1-linker 1-PolyA sequence segment 2; PolyA sequence segment 1-linker 1-PolyA sequence segment 2-linker 2-PolyA sequence segment 3; PolyA sequence segment 1-linker 1-PolyA sequence segment 2-linker 2-PolyA sequence segment 3-linker 3-PolyA sequence segment 4.

3. Each PolyA sequence segment independently consists of 10-100 consecutive A's, Preferably, PolyA sequence segment 1 consists of 30-60 consecutive A's, Preferably, each PolyA sequence segment independently consists of 30, 40, 50, 60, 70, 80, 90 or 100 consecutive A's; Preferably, in the multisegmented PolyA polynucleotide, the total number of A's in all PolyA sequence segments is 30-300, preferably 60-240, more preferably 100-200.

3. A multisegmented PolyA polynucleotide according to claim 1 or 2.

4. each linker is 1-12 nt and consists of nucleotide residues that are not all A; Preferably, each linker consists of G or has a G content of 20%-33% of all bases in the linker sequence.

2. The multisegmented PolyA polynucleotide of claim 1.

5. Each linker is independently selected from the nucleotides set forth in the following sequences: G； C； GGGGGG; ATGCAT; GCATATGACT; CAGTAATGAC; AGTCATATGC; GTCATTACTG; TGTCAGATAC; GCTCATATGC; GCATATATGC; CGCCATTAGAGG; ATGCATGATATC; TGCAACATCGAT; CCTCTAATGGCG; CAACCCCTGATTGTGTCCGCATCT; Preferably, in each multisegmented PolyA polynucleotide, the total length of all linkers is 1-48 nt, more preferably 2-24 nt.

4. A multisegmented PolyA polynucleotide according to any one of claims 1 to 3.

6. SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID 6. The multisegmented PolyA polynucleotide of any one of claims 1 to 5, comprising one or more of the polynucleotides having any of the sequences set forth in SEQ ID NO. 32, SEQ ID NO. 33, SEQ ID NO. 34, SEQ ID NO. 35, SEQ ID NO. 36, SEQ ID NO. 37, SEQ ID NO. 38, SEQ ID NO. 39, SEQ ID NO. 40, SEQ ID NO. 41, SEQ ID NO. 42, SEQ ID NO. 43, SEQ ID NO. 44, SEQ ID NO. 45, SEQ ID NO. 46, SEQ ID NO. 47, SEQ ID NO. 48, SEQ ID NO. 49, SEQ ID NO. 50, SEQ ID NO. 51, SEQ ID NO. 52, SEQ ID NO. 77, SEQ ID NO. 78, SEQ ID NO. 79, SEQ ID NO. 80, SEQ ID NO.

81.

7. A vector comprising the multisegmented PolyA polynucleotide of any one of claims 1 to 6.

8. A host cell comprising a multisegmented PolyA polynucleotide according to any one of claims 1 to 6 or a vector according to claim 7.

9. Use of a multisegmented PolyA polynucleotide according to any one of claims 1 to 6, a vector according to claim 7, or a host cell according to claim 8 for in vitro transcription and production of a target mRNA, which is preferably used for the production of an mRNA vaccine or a pharmaceutical.

10. 7. An mRNA comprising a polyA tail formed by in vitro transcription from the multisegmented PolyA polynucleotide of any one of claims 1-6.

11. 1) cloning the multisegmented PolyA polynucleotide according to any one of claims 1 to 6 into a general-purpose plasmid vector to obtain a plasmid vector incorporating the multisegmented PolyA polynucleotide; 2) introducing a plasmid vector incorporating the multisegmented PolyA polynucleotide into a host cell, such as E. coli, to obtain recombinant cells, seeding the recombinant cells on a solid plate to obtain single colonies, picking the single colonies and performing preliminary identification by PCR (preferably, the PCR product is identified by 2%-3% agarose gel electrophoresis), and selecting stable colonies in which recombination has not occurred; 3) The stable bacteria selected in the preliminary identification, in which no recombination has occurred, are subjected to expanded fermentation culture, and the culture solution is serially diluted, and then applied to a solid plate, and colony PCR is performed to identify the subculture stability. Including, A method for determining the stability of a multisegmented PolyA polynucleotide in a host cell.

Images