Bacillus species strains expressing superoxide dismutase, Bacillus species strain spores and / or superoxide dismutase, and use thereof for the prevention or treatment of fibrotic diseases

Abstract

The present invention relates to the use of a Bacillus species strain expressing superoxide dismutase, a Bacillus species strain spore, and / or a composition containing superoxide dismutase for the prevention, amelioration, or treatment of fibrotic diseases. When the composition is orally administered, the polypeptide having superoxide dismutase activity scavenges reactive oxygen species in the body, thereby helping to prevent, ameliorate, or treat fibrotic diseases such as pulmonary fibrosis or liver fibrosis.

Description

[Technical Field]

[0001] This application claims priority to Korean Patent Application No. 2022-0111060, filed September 1, 2022, the disclosure of which is incorporated herein by reference in its entirety.

[0002] This invention relates to a study (No. 2020R1A2C1008431, "Exploring new treatment strategies for COPD, an intractable fatal disease, using microbial symbiosis") conducted with support from the Korea Research Foundation's Individual Basic Research Project, funded by the Government of the Republic of Korea (Ministry of Science and ICT) in fiscal year 2022.

[0003] [Array List] This application contains a Sequence Listing, which has been submitted electronically in XML format and is incorporated herein by reference in its entirety. A copy of this Sequence Listing, created on September 1, 2023, is titled KC23094SEQ.xml and is 64.0 kilobytes in size.

[0004] The present invention relates to a Bacillus species strain expressing superoxide dismutase, a Bacillus species strain spore and / or a composition containing superoxide dismutase (SOD), and its use for the prevention, amelioration, or treatment of fibrotic diseases. [Background technology]

[0005] Fibrosis is a disease characterized by the accumulation of extracellular matrix (ECM), such as collagen, in tissues, resulting in structural and functional problems. It can be idiopathic or result from a variety of causes. For example, pulmonary fibrosis can be caused by a variety of conditions, including chronic inflammation (e.g., sarcoidosis, Wegener's granulomatosis), infection, environmental factors (e.g., exposure to asbestos or certain gases), exposure to ionizing radiation (e.g., radiation therapy for treating chest tumors), chronic diseases, and side effects of certain drugs (e.g., bleomycin, amiodarone, busulfan, methotrexate, nitrofurantoin). Idiopathic pulmonary fibrosis, a disease of unknown etiology, is a typical pulmonary fibrosis, and oxidative stress is known to play an important role in the development of idiopathic pulmonary fibrosis. Patients with idiopathic pulmonary fibrosis have been shown to have higher reactive oxygen species (ROS) levels and reduced antioxidant activity compared to normal controls, which can lead to irreversible lung damage and fibrosis. However, the exact etiology of idiopathic pulmonary fibrosis is unknown, and although drugs such as IFN-γ are under development, no effective treatments have been developed yet. As another example, liver fibrosis can be caused by nonalcoholic fatty liver disease (NAFLD) such as nonalcoholic steatohepatitis (NASH), viral hepatitis (e.g., HBV, HCV), alcohol, hepatotoxic substances (e.g., acetaminophen overdose, chemicals such as arsenic), or genetic causes. NASH, in particular, is a condition characterized by hepatocyte damage and inflammation along with fatty deposits, and is one of the most common liver fibrosis-causing diseases. If liver fibrosis worsens, it can progress to cirrhosis, and if further progression occurs, it can develop into liver cancer. There is a need for drugs to treat nonalcoholic steatohepatitis and prevent its progression, but to date, no drugs effectively improve fibrosis and steatohepatitis.

[0006] Therefore, there is a need to develop drugs that can treat fibrotic diseases, including pulmonary fibrosis, NASH, and liver fibrosis. Summary of the Invention [Problem to be solved by the invention]

[0007] An object of the present invention is to solve all of the problems of the prior art described above.

[0008] An object of the present invention is to provide a Bacillus species strain, a Bacillus species strain spore and / or a superoxide dismutase (SOD) for the prevention or treatment of fibrotic diseases.

[0009] Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of fibrotic diseases, comprising a Bacillus sp., a Bacillus sp. spore and / or SOD.

[0010] Another object of the present invention is to provide a food composition for preventing or ameliorating fibrotic diseases, comprising a Bacillus sp. strain, a Bacillus sp. strain spore and / or SOD.

[0011] Another object of the present invention is to provide a method for preventing, ameliorating or treating a fibrotic disease, comprising the step of administering Bacillus sp., Bacillus sp. spores and / or SOD to a subject.

[0012] Another object of the present invention is to provide uses of Bacillus sp., Bacillus sp. spores and / or superoxide dismutase for the prevention, amelioration or treatment of fibrotic diseases.

[0013] The object of the present invention is not limited to the above-mentioned object, but will become clearer from the following description and can be realized by the means and combinations thereof described in the claims. [Means for solving the problem]

[0014] A typical configuration of the present invention to achieve the above object is as follows.

[0015] According to one aspect of the present invention, there is provided a composition for treating, ameliorating, or preventing a fibrotic disease, comprising, as an active ingredient, one or more selected from the group consisting of a Bacillus sp. strain, a Bacillus sp. strain spore, and a polypeptide having superoxide dismutase (SOD) activity.

[0016] In one embodiment of the above, the Bacillus species strain may be a strain that expresses SOD or a strain that has been mutated or engineered to overexpress SOD.

[0017] In other embodiments, the Bacillus species strain spores may include spores derived from strains that express SOD or that have been mutated or engineered to overexpress SOD.

[0018] In another embodiment, the Bacillus species strain may be a Bacillus veresensis species strain.

[0019] In another aspect, the Bacillus species strain may be one or more strains selected from the Bacillus veresensis strain deposited under accession number KCTC 13222 BP, the Bacillus veresensis strain deposited under accession number KCTC 13227 BP, and the Bacillus veresensis strain deposited under accession number KCTC 15552 BP.

[0020] In one embodiment described above, the polypeptide having SOD activity may be manganese-containing SOD (Mn-SOD).

[0021] In another embodiment, the polypeptide having SOD activity may be deamidated Mn-SOD.

[0022] In another embodiment, the polypeptide having SOD activity may be derived from a Bacillus sp. strain.

[0023] In another embodiment, the strain from which the polypeptide having SOD activity is derived may be a Bacillus veresensis species strain.

[0024] In another embodiment, the Bacillus species strain from which the polypeptide having SOD activity is derived may be one or more strains selected from the Bacillus veresensis strain deposited under accession number KCTC 13222 BP, the Bacillus veresensis strain deposited under accession number KCTC 13227 BP, and the Bacillus veresensis strain deposited under accession number KCTC 15552 BP.

[0025] In other embodiments, the polypeptide having SOD activity may comprise the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0026] In the above-mentioned embodiment, the polypeptide having SOD activity may be coated with a coating agent.

[0027] In another embodiment, the coating agent for the polypeptide having SOD activity may comprise shellac.

[0028] In the above-mentioned aspect, the fibrotic disease may be a pulmonary fibrotic disease or a liver fibrotic disease.

[0029] In other aspects, the pulmonary fibrotic disease may be selected from the group consisting of interstitial lung disease, pulmonary fibrosis, and idiopathic pulmonary fibrosis.

[0030] In other aspects, the liver fibrotic disease may be selected from the group consisting of non-alcoholic steatohepatitis, liver fibrosis, idiopathic liver fibrosis, cirrhosis, alcoholic steatohepatitis, chronic liver disease, and viral hepatitis.

[0031] In one aspect of the above, the active ingredient of the composition may be administered orally.

[0032] In another embodiment, the composition comprises two or more components selected from the group consisting of a Bacillus species strain, a Bacillus species strain spore, and a polypeptide having SOD activity, and the two or more components may be administered simultaneously, sequentially, or in reverse order.

[0033] In one of the above aspects, the composition may be a pharmaceutical composition.

[0034] In one aspect above, the composition may be a food composition.

[0035] In one aspect of the above, the composition may be a veterinary composition.

[0036] In one aspect of the above, the composition may be a feed composition.

[0037] According to another aspect of the present invention, there is provided a method for preventing, ameliorating, or treating a fibrotic disease, the method comprising administering to a subject a composition comprising one or more selected from the group consisting of a Bacillus sp. strain, a Bacillus sp. strain spore, and a polypeptide having superoxide dismutase activity.

[0038] According to another aspect of the present invention, there is provided use of a composition comprising one or more selected from the group consisting of a Bacillus sp. strain, a Bacillus sp. strain spore, and a polypeptide having superoxide dismutase activity for the prevention, amelioration, or treatment of a fibrotic disease. [Effects of the Invention]

[0039] The present inventors have confirmed that a composition comprising one or more selected from the group consisting of the Bacillus species strain of the present invention, Bacillus species strain spores, and superoxide dismutase has a preventive or therapeutic effect on fibrotic diseases. In one embodiment of the present invention, the Bacillus species strain spores of the present invention showed an effect of improving fibrosis when administered before or after the induction of pulmonary fibrosis, and it was confirmed that Bacillus species strain spores with increased SOD expression levels showed a more excellent preventive or therapeutic effect. Furthermore, the active oxygen scavenging effect of SOD in the body was superior when administered in the form of species strain spores compared to when administered as free SOD, indicating that the spore form is more stable in the body. Meanwhile, oral SOD with improved stability in gastric acid showed an effect of improving pulmonary fibrosis even when administered alone, and showed an enhanced effect when administered in combination with spores of a normal SOD strain. In another embodiment of the present invention, the Bacillus species strain of the present invention showed excellent therapeutic effects on liver fibrosis in an animal model of non-alcoholic steatohepatitis, and it was confirmed that this effect was greater when a strain mutant overexpressing SOD was administered. Furthermore, administration of the composition of the present invention not only improved liver fibrosis, but also improved indicators of non-alcoholic steatohepatitis (total blood glucose level, plasma ALT level, plasma CK-18 level, liver triglyceride content, etc.) and significantly reduced NAFLD activity score (NAS). Thus, it was confirmed that the composition disclosed in the present invention is highly effective in preventing, ameliorating, or treating fibrotic diseases. [Brief explanation of the drawings]

[0040] [Figure 1] The overall procedure for preparing a recombinant production strain (BSBA310) expressing SodA2 is shown. [Figure 2]The expression vector for overexpression of the sodA2 gene is shown below. Here, rrnBT1T2 represents a transcription terminator, rep(pBR322) represents a replicon from pBR322 that functions in E. coli, rep(pUB110) represents a replicon from pUB110 that functions in B. subtilis, KanR represents the kanamycin resistance gene (aminoglycoside O-nucleotidyltransferase), and the BJ27 promoter represents a strong promoter for B. subtilis. [Figure 3a] Figure 3a shows the cloning process of the GF427 strain, in which the SOD activity was increased by replacing the promoter of the GF423 strain. Figure 3a shows the process of constructing pUori-cm-amp-10sod using PCR products obtained using GF423 genomic DNA as a template. [Figure 3b] Figure 3b shows the cloning process of the GF427 strain, in which the SOD activity was increased by replacing the promoter of the GF423 strain. Figure 3b shows the process of constructing pUori-cm-amp-P3-SOD using a PCR product obtained using pUori-cm-amp-10sod as a template. [Figure 4] 1 shows the administration schedule of a test substance and bleomycin to confirm the preventive effect on fibrosis in a mouse model of pulmonary fibrosis. [Figure 5] FIG. 1 shows the results of measuring the hydroxyproline content when GF424 spores were administered at different concentrations. [Figure 6a] The results of measuring the number of immune-related cells in lung lavage fluid after administration of GF424 spores at different concentrations are shown in Figure 6. Figure 6a shows the number of total immune cells (Total BAL cells). [Figure 6b] The results of measuring the number of immune-related cells in lung lavage fluid after administration of different concentrations of GF424 spores are shown in Figure 6. Figure 6b shows the number of neutrophils. [Figure 6c] The results of measuring the number of immune-related cells in lung lavage fluid after administration of GF424 spores at different concentrations are shown in Figure 6. Figure 6c shows the number of lymphocytes. [Figure 6d]The results of measuring the number of immune-related cells in lung lavage fluid after administration of GF424 spores at different concentrations are shown in Figure 6. Figure 6d shows the number of macrophages. [Figure 7] 1 shows the results of measuring TGF-β1 concentrations following administration of GF424 spores at different concentrations. [Figure 8] 1 shows the results of staining (H&E and Masson's trichrome staining) of lung tissue sections following administration of GF424 spores at different concentrations. The scale bar indicates 500 μm. [Figure 9a] The expression levels of pulmonary fibrosis-related gene markers (FIG. 9a, Col1a1) following administration of GF424 spores at different concentrations were confirmed by real-time polymerase chain reaction. [Figure 9b] The expression levels of pulmonary fibrosis-related gene markers (FIG. 9b, TGF-β) following administration of GF424 spores at different concentrations were confirmed by real-time polymerase chain reaction. [Figure 9c] The results of confirming the expression level of a pulmonary fibrosis-related gene marker (FIG. 9c, CTGF) following administration of GF424 spores at different concentrations by real-time polymerase chain reaction are shown. [Figure 9d] The expression levels of pulmonary fibrosis-related gene markers (FIG. 9d, IL-6) following administration of GF424 spores at different concentrations were confirmed by real-time polymerase chain reaction. [Figure 10a] The results of measuring reactive oxygen by-products (Fig. 10a, MDA) following administration of GF424 spores at different concentrations are shown. [Figure 10b] The results of measuring reactive oxygen by-products (FIG. 10b, 4-HNE) following administration of GF424 spores at different concentrations are shown. [Figure 11] The figure shows the results of measuring the hydroxyproline content after administration of spores of strains that exhibit different SOD expression levels (SOD knockout, normal expression, and overexpression). [Figure 12a] The results of measuring the number of immune-related cells in lung lavage fluid after administration of spores of bacterial strains with different SOD expression levels (SOD knockout, normal expression, and overexpression) are shown in Figure 12. Figure 12a shows the number of total immune cells (total BAL cells). [Figure 12b] The results of measuring the number of immune-related cells in lung lavage fluid after administration of spores of bacterial strains that exhibit different levels of SOD expression (SOD knockout, normal expression, and overexpression) are shown in Figure 12. Figure 12b shows the number of neutrophils. [Figure 12c] The results of measuring the number of immune-related cells in lung lavage fluid after administration of spores of bacterial strains that exhibit different levels of SOD expression (SOD knockout, normal expression, and overexpression) are shown in Figure 12. Figure 12c shows the number of lymphocytes. [Figure 12d] Figure 12d shows the results of measuring the number of immune-related cells in lung lavage fluid following administration of spores of bacterial strains that exhibit different levels of SOD expression (SOD knockout, normal expression, and overexpression), and shows the number of macrophages. [Figure 13] The figure shows the results of measuring TGF-β1 concentrations after administration of spores of strains that exhibit different SOD expression levels (SOD knockout, normal expression, and overexpression). [Figure 14] The results of staining (H&E and Masson's trichrome staining) of lung tissue sections after administration of spores of strains that exhibit different levels of SOD expression (SOD knockout, normal expression, and overexpression) are shown. The scale bar indicates 500 μm. [Figure 15a] The results of real-time polymerase chain reaction were shown, in which the expression levels of pulmonary fibrosis-related gene markers (Figure 15a, Col1a1) were confirmed by administration of spores of bacterial strains that exhibit different SOD expression levels (SOD knockout, normal expression, and overexpression). [Figure 15b] The results of real-time polymerase chain reaction were shown, in which the expression levels of pulmonary fibrosis-related gene markers (α-SMA, Figure 15b) were confirmed by administration of spores of bacterial strains that exhibit different SOD expression levels (SOD knockout, normal expression, and overexpression). [Figure 15c] The results of real-time polymerase chain reaction were shown, in which the expression levels of pulmonary fibrosis-related gene markers (Figure 15c, TGF-β) were confirmed by administering spores of bacterial strains that exhibit different SOD expression levels (SOD knockout, normal expression, and overexpression). [Figure 15d]The results of real-time polymerase chain reaction were shown, in which the expression levels of pulmonary fibrosis-related gene markers (Fig. 15d, CTGF) were confirmed by administration of spores of bacterial strains that exhibit different SOD expression levels (SOD knockout, normal expression, and overexpression). [Figure 15e] The results of the real-time polymerase chain reaction (PCR) were used to confirm the expression levels of pulmonary fibrosis-related gene markers (Figure 15e) and TNF-α after administration of spores from strains that exhibited different levels of SOD expression (SOD knockout, normal expression, and overexpression). [Figure 15f] The results of real-time polymerase chain reaction were shown, in which the expression levels of pulmonary fibrosis-related gene markers (Figure 15f, IL-6) were confirmed by administering spores of bacterial strains that exhibit different SOD expression levels (SOD knockout, normal expression, and overexpression). [Figure 16] 1 shows the results of Western blot analysis of pulmonary fibrosis-related markers following administration of spores of bacterial strains that exhibit different levels of SOD expression (SOD knockout, normal expression, and overexpression). [Figure 17] The figure shows the results of estimating the survival rate of a mouse model of pulmonary fibrosis after administration of spores of bacterial strains that exhibit different levels of SOD expression (SOD knockout, normal expression, and overexpression). [Figure 18a] The results of measuring reactive oxygen by-products (Fig. 18a, MDA) following administration of spores of strains exhibiting different levels of SOD expression (SOD knockout, normal expression, and overexpression) are shown. [Figure 18b] The results of measuring reactive oxygen by-products (FIG. 18b, 4-HNE) following administration of spores of strains exhibiting different levels of SOD expression (SOD knockout, normal expression, and overexpression) are shown. [Figure 19] 1 shows the results of measuring the hydroxyproline content after administration of free SOD and spores of the strain. [Figure 20] 1 shows the results of measuring TGF-β1 concentrations following administration of free SOD and spores of the bacterial strain. [Figure 21] The results of staining (H&E and Masson's trichrome staining) of lung tissue sections after administration of free SOD and spores of the strain are shown. The scale bar indicates 500 μm. [Figure 22a]The expression levels of pulmonary fibrosis-related gene markers (Figure 22a, Col1a1) following administration of free SOD and spores of the strain were confirmed by real-time polymerase chain reaction. [Figure 22b] The expression levels of pulmonary fibrosis-related gene markers (FIG. 22b, α-SMA) following administration of free SOD and spores of the strain were confirmed by real-time polymerase chain reaction. [Figure 22c] The expression levels of pulmonary fibrosis-related gene markers (FIG. 22c, TGF-β) following administration of free SOD and spores of the bacterial strain were confirmed by real-time polymerase chain reaction. [Figure 22d] The expression levels of pulmonary fibrosis-related gene markers (Fig. 22d, CTGF) following administration of free SOD and spores of the strain were confirmed by real-time polymerase chain reaction. [Figure 22e] The expression levels of pulmonary fibrosis-related gene markers (Figure 22e, TNF-α) following administration of free SOD and spores of the strain were confirmed by real-time polymerase chain reaction. [Figure 22f] The expression levels of pulmonary fibrosis-related gene markers (FIG. 22f, IL-6) following administration of free SOD and spores of the strain were confirmed by real-time polymerase chain reaction. [Figure 23] 1 shows the results of Western blot analysis of pulmonary fibrosis-related markers following administration of free SOD and spores of the strain. [Figure 24a] The results of measuring free SOD and reactive oxygen by-products (Fig. 24a, MDA) upon administration of spores of the strain are shown. [Figure 24b] The results of measuring free SOD and reactive oxygen by-products (FIG. 24b, 4-HNE) upon administration of spores of the strain are shown. [Figure 25] Immunofluorescence staining of primary lung fibroblasts isolated from a mouse model of pulmonary fibrosis. Each lung fibroblast was stained with α-smooth muscle actin (α-SMA), Collagen 1 (Col1a1), and DAPI antibodies. The scale bar indicates 50 μm. [Figure 26a]The expression levels of pulmonary fibrosis-related gene markers (FIG. 26a, TGF-β) in primary lung fibroblasts isolated from a mouse model of pulmonary fibrosis were confirmed by real-time polymerase chain reaction. [Figure 26b] The expression levels of pulmonary fibrosis-related gene markers (FIG. 26b, Col1a1) in primary lung fibroblasts isolated from a mouse model of pulmonary fibrosis were confirmed by real-time polymerase chain reaction. [Figure 26c] The expression levels of pulmonary fibrosis-related gene markers (FIG. 26c, TNF-α) in primary lung fibroblasts isolated from a mouse model of pulmonary fibrosis were confirmed by real-time polymerase chain reaction. [Figure 26d] The expression levels of pulmonary fibrosis-related gene markers (FIG. 26d, IL-6) in primary lung fibroblasts isolated from a mouse model of pulmonary fibrosis were confirmed by real-time polymerase chain reaction. [Figure 27] 1 shows the results of measuring the hydroxyproline content in a mouse model of pulmonary fibrosis after oral SOD (GF103), bacterial spores, and a combination of oral SOD and bacterial spores. [Figure 28] FIG. 1 shows the results of measuring TGF-β1 concentrations in a mouse model of pulmonary fibrosis following administration of oral SOD (GF103), strain spores, and a combination of oral SOD and strain spores. [Figure 29] This shows the results of staining (H&E and Masson's trichrome staining) of lung tissue sections following administration of oral SOD (GF103), bacterial spores, and a combination of oral SOD and bacterial spores in a pulmonary fibrosis mouse model. The scale bar indicates 500 μm. [Figure 30a] The expression levels of pulmonary fibrosis-related gene markers (Figure 30a, Col1a1) were confirmed by real-time polymerase chain reaction in a mouse model of pulmonary fibrosis after oral SOD (GF103), bacterial spores, and a combination of oral SOD and bacterial spores. [Figure 30b]The results of real-time polymerase chain reaction were shown to confirm the expression levels of pulmonary fibrosis-related gene markers (Figure 30b, α-SMA) following administration of oral SOD (GF103), strain spores, and a combination of oral SOD and strain spores in a mouse model of pulmonary fibrosis. [Figure 30c] The results of real-time polymerase chain reaction were shown to confirm the expression levels of pulmonary fibrosis-related gene markers (Figure 30c, TGF-β) following administration of oral SOD (GF103), strain spores, and a combination of oral SOD and strain spores in a mouse model of pulmonary fibrosis. [Figure 30d] The results of real-time polymerase chain reaction were shown to confirm the expression levels of pulmonary fibrosis-related gene markers (Figure 30d, IL-6) following administration of oral SOD (GF103), strain spores, and a combination of oral SOD and strain spores in a mouse model of pulmonary fibrosis. [Figure 30e] The results of real-time polymerase chain reaction were shown to confirm the expression levels of pulmonary fibrosis-related gene markers (Figure 30e, IL-1β) following administration of oral SOD (GF103), strain spores, and a combination of oral SOD and strain spores in a mouse model of pulmonary fibrosis. [Figure 30f] The results of real-time polymerase chain reaction were shown to confirm the expression levels of pulmonary fibrosis-related gene markers (Figure 30f, TNF-α) following administration of oral SOD (GF103), strain spores, and a combination of oral SOD and strain spores in a mouse model of pulmonary fibrosis. [Figure 31a] The results of measuring reactive oxygen by-products (Fig. 31a, MDA) in a pulmonary fibrosis mouse model are shown, following administration of oral SOD (GF103), strain spores, and a combination of oral SOD and strain spores. [Figure 31b] The results of measuring reactive oxygen by-products (FIG. 31b, 4-HNE) in a mouse model of pulmonary fibrosis following administration of oral SOD (GF103), strain spores, and a combination of oral SOD and strain spores are shown. [Figure 31c] The results of measuring reactive oxygen by-products (FIG. 31c, 8-OHdG) in a pulmonary fibrosis mouse model are shown, following administration of oral SOD (GF103), bacterial spores, and a combination of oral SOD and bacterial spores. [Figure 32] 1 shows the administration schedule of a test substance and bleomycin to confirm the therapeutic effect on fibrosis in a mouse model of pulmonary fibrosis. [Figure 33] FIG. 1 shows the results of measuring the hydroxyproline content in a mouse model of pulmonary fibrosis after administration of spores of GF424, an SOD-overexpressing strain, and GF427, a strain that expresses more SOD than GF424. [Figure 34] 1 shows the results of measuring TGF-β1 concentrations in a mouse model of pulmonary fibrosis after administration of spores of SOD-overexpressing bacterial strains (GF424 and GF427). [Figure 35] 1 shows the results of staining (H&E and Masson's trichrome staining) of lung tissue sections following spore administration of SOD-overexpressing strains (GF424 and GF427) in a mouse model of pulmonary fibrosis. The scale bar indicates 500 μm. [Figure 36a] The expression levels of pulmonary fibrosis-related gene markers (FIG. 36a, Col1a1) following administration of spores of SOD-overexpressing strains (GF424 and GF427) in a pulmonary fibrosis mouse model were confirmed by real-time polymerase chain reaction. [Figure 36b] The expression levels of pulmonary fibrosis-related gene markers (FIG. 36b, TGF-β) following administration of spores of SOD-overexpressing strains (GF424 and GF427) in a pulmonary fibrosis mouse model were confirmed by real-time polymerase chain reaction. [Figure 36c] The expression levels of pulmonary fibrosis-related gene markers (FIG. 36c, CTGF) following administration of spores of SOD-overexpressing strains (GF424 and GF427) in a pulmonary fibrosis mouse model were confirmed by real-time polymerase chain reaction. [Figure 36d] The expression levels of pulmonary fibrosis-related gene markers (FIG. 36d, TNF-α) following administration of spores of SOD-overexpressing strains (GF424 and GF427) in a pulmonary fibrosis mouse model were confirmed by real-time polymerase chain reaction. [Figure 36e]The results of confirming the expression levels of pulmonary fibrosis-related gene markers (FIG. 36e, IL-6) by real-time polymerase chain reaction after administration of spores of SOD-overexpressing strains (GF424 and GF427) to a pulmonary fibrosis mouse model are shown. [Figure 36f] The results of confirming the expression levels of pulmonary fibrosis-related gene markers (FIG. 36f, IL-1β) by real-time polymerase chain reaction after administration of spores of SOD-overexpressing strains (GF424 and GF427) to a pulmonary fibrosis mouse model are shown. [Figure 37] 1 shows the results of Western blot analysis of pulmonary fibrosis-related markers in a mouse model of pulmonary fibrosis after administration of spores of SOD-overexpressing bacterial strains (GF424 and GF427). [Figure 38a] FIG. 38 shows the results of measuring reactive oxygen by-products (FIG. 38a, MDA) following administration of spores of SOD-overexpressing strains (GF424 and GF427) in a pulmonary fibrosis mouse model. [Figure 38b] FIG. 38b shows the results of measuring reactive oxygen by-products (4-HNE) produced by administration of spores of SOD-overexpressing strains (GF424 and GF427) in a mouse model of pulmonary fibrosis. [Figure 38c] FIG. 38c shows the results of measuring reactive oxygen by-products (8-OHdG) produced by administration of spores of SOD-overexpressing strains (GF424 and GF427) in a mouse model of pulmonary fibrosis. [Figure 38d] FIG. 38d shows the results of measuring thiols (FIG. 38d), an important marker of oxidative stress, in a mouse model of pulmonary fibrosis following administration of spores of SOD-overexpressing strains (GF424 and GF427). [Figure 39a] 39A and 39B are graphs showing the expression levels of biomarkers for pulmonary fibrosis induced by administration of spores of SOD-overexpressing strains (GF424 and GF427) in a mouse model of pulmonary fibrosis, including the expression level of an epithelial damage marker (FIG. 39A, SP-D). [Figure 39b]39B is a graph showing the expression levels of biomarkers for pulmonary fibrosis induced by administration of spores of SOD-overexpressing strains (GF424 and GF427) in a mouse model of pulmonary fibrosis. The expression levels of fibrosis markers (FIG. 39B, MMP-7) are shown. [Figure 39c] 39c shows graphs confirming the expression levels of biomarkers for pulmonary fibrosis induction by administration of spores of SOD-overexpressing strains (GF424 and GF427) in a mouse model of pulmonary fibrosis. The expression levels of fibrosis markers (Fig. 39c, Tenascin-C) are shown. [Figure 39d] 39 is a graph showing the expression levels of biomarkers for pulmonary fibrosis induction by administration of spores of SOD-overexpressing strains (GF424 and GF427) in a mouse model of pulmonary fibrosis. The expression levels of fibrosis markers (Fig. 39d, Periostin) are shown. [Figure 39e] 39e shows graphs confirming the expression levels of biomarkers for pulmonary fibrosis induction by administration of spores of SOD-overexpressing strains (GF424 and GF427) in a mouse model of pulmonary fibrosis. The expression levels of inflammatory markers (CXCL13, FIG. 39e) are shown. [Figure 39f] 39 is a graph showing the expression levels of biomarkers for pulmonary fibrosis induced by administration of spores of SOD-overexpressing strains (GF424 and GF427) in a mouse model of pulmonary fibrosis, including the expression level of a thrombosis marker (FIG. 39f, PAI-1). [Figure 40] 1 shows the results of estimating the survival rate of a mouse model of pulmonary fibrosis by administering spores of SOD-overexpressing strains (GF424 and GF427) to the mouse model of pulmonary fibrosis. [Figure 41] This is a diagram showing the parts of the left outer lobe of a liver sample that were separated and dissected in an experiment to confirm the therapeutic effect of Bacillus veresensis strain on liver fibrosis in a non-alcoholic steatohepatitis STAM™ model. [Figure 42] 1 is a graph showing changes in body weight of mice belonging to 10 groups over 21 days of treatment after induction of non-alcoholic steatohepatitis (NASH, STAM™ model). [Figure 43a]Figure 43a is a graph showing changes in organ weights in mice belonging to 10 groups after inducing nonalcoholic steatohepatitis (NASH, STAM™ model) and completing all treatments on day 21. Figure 43b is a table summarizing the results of body weight, liver weight, and liver-to-body weight ratio. [Figure 43b] Figure 43b is a graph showing changes in organ weights in mice belonging to 10 groups after inducing nonalcoholic steatohepatitis (NASH, STAM™ model) and completing all treatments on day 21. Figure 43b is a graph showing body weight. [Figure 43c] Figure 43c is a graph showing changes in organ weights in mice belonging to 10 groups after inducing nonalcoholic steatohepatitis (NASH, STAM™ model) and completing all treatments on day 21. Figure 43d is a graph showing liver weight. [Figure 43d] Figure 43d is a graph showing the liver-to-body weight ratio of mice in 10 groups after inducing nonalcoholic steatohepatitis (NASH, STAM™ model) and examining changes in organ weight on day 21, when all treatments were completed. [Figure 44a] The results of biochemical analysis using plasma and liver samples from a mouse model in which nonalcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed are shown in Figure 44a, which is a table summarizing the results of total blood glucose level, plasma ALT level, plasma CK-18 level, and liver triglyceride content. [Figure 44b] Figure 44b shows the results of biochemical analysis using plasma and liver samples from a mouse model of induced non-alcoholic steatohepatitis (NASH, STAM™ model) after all treatments were completed. Figure 44b is a graph showing total blood glucose levels. [Figure 44c] Figure 44c shows the results of biochemical analysis of plasma and liver samples from a mouse model of induced non-alcoholic steatohepatitis (NASH, STAM™ model) after all treatments were completed. Figure 44c is a graph showing plasma ALT levels. [Figure 44d]Figure 44d shows the results of biochemical analysis using plasma and liver samples from a mouse model of induced non-alcoholic steatohepatitis (NASH, STAM™ model) after all treatments were completed. Figure 44d is a graph showing plasma CK-18 levels. [Figure 44e] Figure 44e shows the results of biochemical analysis using plasma and liver samples from a mouse model in which non-alcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. Figure 44e is a graph showing the liver triglyceride content. [Figure 45a] Figures 45a to 45c show the results of H&E staining and NAFLD activity score evaluation using liver samples from mice in 10 groups after nonalcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. [Figure 45b] Figures 45a to 45c show the results of H&E staining and NAFLD activity score evaluation using liver samples from mice in 10 groups after nonalcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. [Figure 45c] Figures 45a to 45c show the results of H&E staining and NAFLD activity score evaluation using liver samples from mice in 10 groups after nonalcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. [Figure 45d] Figure 45d shows the results of H&E staining and NAFLD activity score evaluation using liver samples from a mouse model in which nonalcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. Figure 45d shows the results of H&E staining of liver sections from a disease control group. [Figure 45e] Figure 45e shows the results of H&E staining and NAFLD activity score evaluation using liver samples from a mouse model in which nonalcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. Figure 45e is a table showing the numerical NAFLD activity score (NAS) calculated based on the Kleiner criteria. [Figure 45f] Figure 45f shows the results of H&E staining and NAFLD activity score evaluation using liver samples from a mouse model in which nonalcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. Figure 45f is a graph showing the NAS of each group. [Figure 45g] Figure 45 shows the results of H&E staining and NAFLD activity score evaluation using liver samples from a mouse model in which nonalcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. Figure 45g shows the steatosis score, which is a detailed breakdown of NASH. [Figure 45h] Figure 45 shows the results of H&E staining and NAFLD activity score evaluation using liver samples from a mouse model in which non-alcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. The inflammation score (Figure 45h) is also shown. [Figure 45i] Figure 45 shows the results of H&E staining and NAFLD activity score evaluation using liver samples from a mouse model in which non-alcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. Ballooning score (Figure 45i) is also shown. [Figure 46a] Figure 46a shows the results of Sirius red staining using liver samples from a mouse model in which non-alcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. Figure 46a shows a photomicrograph of a Sirius red stained liver section. [Figure 46b] Figure 46b shows the results of Sirius red staining using liver samples from a mouse model in which nonalcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. Figure 46b is a table showing the numerical values ​​of the degree of fibrosis. [Figure 46c] Figure 46c shows the results of Sirius red staining using liver samples from a mouse model in which nonalcoholic steatohepatitis (NASH, STAM™ model) was induced and all treatments were completed. Figure 46c is a graph showing the degree of fibrosis (Sirius red positive) in each group. DETAILED DESCRIPTION OF THE INVENTION

[0041] The following detailed description of the present invention will be described with reference to certain drawings and with reference to specific embodiments in which the present invention may be practiced; however, the present invention is not limited thereto, but is limited only by the appended claims, if properly defined, and to the full extent of equivalents thereto. It should be understood that various embodiments of the present invention differ from one another but are not necessarily mutually exclusive. For example, specific shapes, structures, and characteristics described herein may be modified from one embodiment / example to another, or may be combined with other embodiments / examples, without departing from the spirit and scope of the present invention. Terms presented in describing the present invention should generally be understood to have their ordinary meaning unless otherwise specified, and apply to all aspects or embodiments of the invention in which the term is defined, as well as to all uses of the same term herein. For purposes of interpreting this specification, the following definitions apply, and terms used in the singular include the plural where appropriate, and vice versa.

[0042] [Definition] The term "subject" is used interchangeably with "subject" or "patient" and may be a mammal in need of prevention, amelioration, or treatment of a fibrotic disease, such as a primate (e.g., human, monkey, chimpanzee, etc.), pet (e.g., dog, cat, etc.), livestock animal (e.g., cow, pig, horse, sheep, goat, etc.), and laboratory animal (e.g., rat, mouse, guinea pig, etc.). In one embodiment of the present invention, the subject is a human.

[0043] The term "treatment" generally refers to obtaining a desired pharmacological and / or physiological effect. Such an effect has a therapeutic effect in that it partially or completely cures a disease and / or an undesired or unwanted condition (e.g., a fibrotic disease such as pulmonary fibrosis or liver fibrosis). Preferred therapeutic effects include, but are not limited to, preventing the onset or recurrence of a disease, ameliorating symptoms, reducing any direct or indirect pathological consequences of a disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the disease state, and achieving remission or improving prognosis. Preferably, "treatment" refers to medical intervention for an already occurring disease or disorder.

[0044] The term "prevention" refers to obtaining a desired prophylactic pharmacological and / or physiological effect in terms of partially or completely preventing a disease or its symptoms.

[0045] The term "administering" means providing an active ingredient to a subject to achieve a prophylactic or therapeutic objective (e.g., prevention or treatment of a fibrotic disease such as pulmonary fibrosis or liver fibrosis).

[0046] [Use of Bacillus species strains, Bacillus species strain spores and / or SOD for the prevention or treatment of fibrotic diseases] The present invention is based, at least in part, on the surprising discovery that administration of a composition comprising one or more selected from the group consisting of Bacillus sp., Bacillus sp. spores, and superoxide dismutase (SOD) is effective in preventing, ameliorating, or treating fibrotic diseases, such as pulmonary fibrotic diseases (e.g., interstitial lung disease, pulmonary fibrosis, idiopathic pulmonary fibrosis) or liver fibrotic diseases (e.g., nonalcoholic steatohepatitis, liver fibrosis, idiopathic liver fibrosis, cirrhosis, alcoholic steatohepatitis, chronic liver disease, viral hepatitis, etc.). Thus, one aspect of the present invention provides the use of Bacillus sp., Bacillus sp. spores, and superoxide dismutase for preventing, ameliorating, or treating fibrotic diseases. In some embodiments, the use of Bacillus sp., Bacillus sp. spores, or SOD alone for preventing, ameliorating, or treating fibrotic diseases is provided. In some embodiments, there is provided a use of a combination of two or more selected from Bacillus sp. strains, Bacillus sp. strain spores, and SOD for the prevention, amelioration, or treatment of a fibrotic disease.

[0047] Fibrotic diseases, or fibrosis, are characterized by the abnormal accumulation of collagen matrix due to injury or inflammation, which alters the structure and function of various tissues. Fibrotic diseases or fibrosis can occur in tissues of various organs, such as the kidney, liver, lung, heart, bone marrow, and skin. Examples of fibrotic diseases or fibrosis include, but are not limited to, liver fibrosis, liver cirrhosis, vocal cord scarring, vocal cord mucosal fibrosis, laryngeal fibrosis, pulmonary fibrosis, pancreatic fibrosis, bone marrow fibrosis, myocardial infarction, post-myocardial fibrosis, myocardial fibrosis, endomyocardial fibrosis, splenic fibrosis, mediastinal fibrosis, tongue submucosal fibrosis, intestinal fibrosis (e.g., associated with inflammatory bowel disease), retroperitoneal fibrosis, uterine fibrosis, scleroderma, and breast fibrosis.

[0048] In some embodiments, the fibrotic disease may be pulmonary fibrosis, which includes not only pulmonary fibrosis (PF) in the strict sense, but also interstitial lung disease (ILD) (pulmonary fibrosis or lung injury caused by autoimmune conditions, viral infection, bacterial infection, anticancer drugs such as bleomycin, drug administration such as antibiotics, toxic substances, etc.) or idiopathic pulmonary fibrosis (IPF).

[0049] In some embodiments, the fibrotic disease may be pulmonary fibrosis (PF) or idiopathic pulmonary fibrosis (IPF).

[0050] In other embodiments, the fibrotic disease may be an interstitial lung disease (ILD).

[0051] In some embodiments, the fibrotic disease may be liver fibrosis. Liver fibrosis includes not only liver fibrosis in the strict sense, but also non-alcoholic steatohepatitis, (progressive) liver fibrosis, idiopathic liver fibrosis, liver cirrhosis, alcoholic steatohepatitis, chronic liver disease, or viral hepatitis.

[0052] In some embodiments, the fibrotic disease may be non-alcoholic steatohepatitis (NASH).

[0053] In one embodiment of the present invention, oral administration of Bacillus veresensis spores before and after the induction of pulmonary fibrosis (bleomycin treatment) significantly improved the severity of pulmonary fibrosis, and this effect was confirmed to be greater when spores of an SOD-overexpressing mutant strain with a high SOD expression level were administered.

[0054] In another embodiment of the present invention, it was confirmed that the 21-day survival rate of a mouse model with bleomycin-induced pulmonary fibrosis after administration of spores of an SOD-overexpressing strain was almost as good as that of normal mice without pulmonary fibrosis (prophylactic effect). Furthermore, when spores of an SOD-overexpressing strain were administered to a mouse model in which pulmonary fibrosis had been induced by treatment with bleomycin, the survival rate was not as high as that of normal mice, but was significantly higher than that of the bleomycin-treated group (therapeutic effect).

[0055] In another embodiment of the present invention, oral SOD with increased stability in gastric acid was effective in improving pulmonary fibrosis in a mouse model of bleomycin-induced pulmonary fibrosis when administered alone, and the effect of inhibiting pulmonary fibrosis was also confirmed when oral SOD was administered in combination with spores of a normal SOD strain.

[0056] In another embodiment of the present invention, oral administration of Bacillus veresensis (Bacillus amyloliquefaciens) strains to an animal model of NASH induced with streptozotocin solution and a high-fat diet significantly improved the degree of liver fibrosis, and this effect was more pronounced with strains that showed greater improvements in SOD expression levels. Furthermore, improvements in indicators of nonalcoholic steatohepatitis (e.g., total blood glucose level, plasma ALT level, plasma CK-18 level, liver triglyceride content) and a significant reduction in NAFLD activity score (NAS) were also observed.

[0057] [Compositions containing Bacillus species strains, Bacillus species strain spores and / or SOD] According to another aspect of the present invention, there is provided a composition for preventing, ameliorating, or treating a fibrotic disease, comprising one or more active ingredients selected from the group consisting of a Bacillus species strain, a Bacillus species strain spore, and SOD. Specifically, the composition may comprise (i) a Bacillus species strain, (ii) a Bacillus species strain spore, (iii) SOD, (iv) a Bacillus species strain and a Bacillus species strain spore, (v) a Bacillus species strain and SOD, (vi) a Bacillus species strain spore and SOD, or (vii) a Bacillus species strain, a Bacillus species strain spore, and SOD.

[0058] As used herein, the term "spore" can be used interchangeably with "spore," and Bacillus species spores can be obtained by culturing a Bacillus species strain in an appropriate medium, inducing sporulation, and then isolating the spores produced.

[0059] In some embodiments, the Bacillus species can be sourced from GRAS bacteria, which are generally regarded as safe for use in drugs or food. Bacillus species spores are known to be resistant to proteases and low pH (see Cutting SM. Bacillus probiotics. Food Microbiol. 2011;28:214-220. doi: 10.1016 / j.fm.2010.03.007; and Wang Y, et al., In vitro assessment of probiotic properties of Bacillus isolated from naturally fermented congee from inner Mongolia of China. World J. Microb. Biot. 2010;26:1369-1377. doi: 10.1007 / s11274-010-0309-7).

[0060] Bacillus species are also recognized as GRAS probiotics in many countries. Specifically, Bacillus species may be, but are not limited to, B. velezensis, B. amyloliquesfaciens, B. methylotrophicus, B. siamensis, B. subtilis, B. tequilensis, B. atrophaeus, B. mojavensis, or B. vallismortis. Bacillus species spores may be derived from, but are not limited to, the above strains. Preferably, the Bacillus species strain may be a Bacillus veresensis (Bacillus amyloliquefaciens) strain (e.g., GF423, GF424, or GF427 strain). The Bacillus species spores may be derived from a Bacillus veresensis (Bacillus amyloliquefaciens) strain (e.g., GF423, GF424, or GF427 strain). The GF423, GF424, and GF427 strains were deposited at the Korea Institute of Bioscience and Biotechnology on March 6, 2017, March 13, 2017, and August 14, 2023, respectively (accession numbers KCTC 13222 BP, KCTC 13227 BP, and KCTC 15552 BP). In addition, the characteristics and culture method of the GF423 strain are described in Korean Patent Registration No. 1762199, the entire disclosure of which is incorporated herein by reference.The deposited Bacillus species strain was previously classified and described as Bacillus amyloliquefaciens. However, comparison using the genome-based classification methods DDH and ANI revealed that it did not meet the species-level criteria and should be classified as Bacillus velezensis. It was also listed as "Bacillus velezensis" in the LPSN (List of Prokaryotic names with Standing in Nomenclature; https: / / lpsn.dsmz.de / species / bacillus-velezensis) (see reference [Fan, Ben, et al. "Bacillus amyloliquefaciens, Bacillus velezensis, and Bacillus siamensis form an 'operational group B. amyloliquefaciens' within the B. subtilis species complex." Frontiers in microbiology 8 (2017): 22.]). Considering that Bacillus berezensis and Bacillus amyloliquefaciens are heterotypic synonyms, the two names can be used interchangeably.

[0061] In some embodiments, Bacillus amyloliquefaciens strains can be used interchangeably with Bacillus veresensis strains, and thus Bacillus amyloliquefaciens strains GF423, GF424, and GF427 can be understood to be the same strain as Bacillus veresensis strains GF423, GF424, and GF427.

[0062] The deposited Bacillus species strain was classified as Bacillus veresensis as follows: The deposited Bacillus species strain was isolated and its 16S rRNA gene and whole genome were compared with those of three highly homologous reference strains by DDH, ANI, and AAI analyses (gene-based classification methods) (see Table 1).

[0063] [Table 1]

[0064] Referring to Table 1, the DDH and ANI results indicate that the deposited Bacillus species strain is more similar to Bacillus amyloliquefaciens subspecies plantarum than to Bacillus amyloliquefaciens subspecies amyloliquefaciens (DDH species differentiation criteria are 70% or more, and ANI species differentiation criteria are 94% or more). However, when B. amyloliquefaciens subsp. plantarum was compared with B. amyloliquefaciens DSM7, the type strain of B. amyloliquefaciens subsp. amyloliquefaciens, using the genome-based classification methods DDH and ANI, it did not meet the species-based distinction criteria and was therefore classified as a microorganism belonging to B. veresensis, not the same species as B. amyloliquefaciens subsp. amyloliquefaciens. In some embodiments, the Bacillus species strain may be a strain that expresses or produces SOD, or a mutant strain that has been mutated or engineered to overexpress or overproduce SOD. In some embodiments, the Bacillus species strain spores may be spores of a strain that expresses or produces SOD. Furthermore, the Bacillus species strain spores may be derived from a strain that has been mutated or engineered to overexpress or overproduce SOD. For example, the Bacillus species strain may be a strain isolated from nature (e.g., the GF423 strain) or a mutant strain that has been mutated to overexpress or overproduce SOD (e.g., the GF424 strain or the GF427 strain).

[0065] In other embodiments, the Bacillus species spores can be derived from another Bacillus species strain that has been engineered to express the SOD of a B. verezensis strain, and these recombinant strains are further described below.

[0066] Sporulation of Bacillus species strains can be induced using conventional techniques known in the art. For example, spores can be obtained by inducing sporulation in a medium such as Difco Sporulation Medium (DSM), Nutrient Broth (NB), Starch Yeast Extract Peptone Medium (SYP), or Luria-Bertani 2 (LB2) during the main culture after pre-culturing the strain. Various sources, including natural, mutant, or recombinant hosts, can be cultured, and vegetative cells can be removed and then separated by filtration, concentration, centrifugation, or the like.

[0067] Superoxide dismutase (SOD) is an enzyme that alternately catalyzes the dismutation of superoxide (O2·-) radicals into general molecular oxygen (O2) and hydrogen peroxide (HO2). SOD plays an important role in scavenging reactive oxygen species and reducing oxidative stress. SODs are widely distributed in prokaryotic and eukaryotic cells and are classified into four types based on the type of metal center (copper / zinc, nickel, manganese, and iron). Manganese-containing SOD (Mn-SOD) is widely present in the chloroplasts, mitochondria, and cytoplasm of many bacteria and eukaryotic cells. In this specification, the term "SOD" can be used interchangeably with a (poly)peptide having superoxide dismutase activity. SOD may also include a polypeptide having superoxide dismutase activity, a fragment thereof, or a fusion containing the same.

[0068] In some embodiments, the SOD may be manganese-binding (Mn-SOD). Preferably, the SOD may be deamidated Mn-SOD. Alternatively, the SOD may comprise or consist of the amino acid sequence shown in SEQ ID NO: 2 (SodA). Preferably, the SOD may be SOD in which the 74th and 137th amino acid residues of SEQ ID NO: 2 are substituted with Asp. More preferably, the SOD may comprise or consist of the amino acid sequence shown in SEQ ID NO: 4 (SodA2). In some embodiments, the SOD may be in a form in which the initiation codon, methionine (Met), has been removed during the protein translation process. Preferably, the SOD may be in a form in which the methionine (Met) has been removed from deamidated Mn-SOD. The SOD may be SOD in which the first amino acid residue, Met, has been deleted from SEQ ID NO: 2. Preferably, the SOD may comprise or consist of the amino acid sequence shown in SEQ ID NO: 5 (Met-deleted SodA). Alternatively, the SOD may be one in which the first amino acid residue, Met, is deleted based on SEQ ID NO: 4. More preferably, the SOD may comprise or consist of the amino acid sequence shown in SEQ ID NO: 6 (Met-deleted SodA2).

[0069] The SOD or polypeptide having SOD activity of the present invention is understood to include amino acid sequences that are substantially identical to the above amino acid sequences. "Substantial identity" as used herein means an amino acid sequence that is 80% or more, preferably 90% or more, more preferably 95% or more, and most preferably 98% or more identical when the aligned sequences are analyzed using an algorithm commonly used in the art.

[0070] In some embodiments, the SOD is a modified or engineered polypeptide having SOD enzymatic activity and may contain one or more mutations, e.g., deletion, insertion, or substitution of one or more amino acids, that may or may not affect various aspects (e.g., in vivo, in vitro, or in vivo stability, homogeneity, and / or morphological changes). Additionally, the polypeptide may further contain a heterologous substance (e.g., a tag known in the art, including a HIS tag, HA tag, myc tag, GFC, and / or an Fc domain of an antibody) for purification, detection, in vivo delivery, or increased stability.

[0071] In some embodiments, the SOD of the present invention may be derived from various sources, including natural, mutant, or recombinant microorganisms. For example, the SOD may be derived from bacteria. Preferably, the SOD may be derived from bacteria generally regarded as safe (GRAS) for use in drugs or foods, such as Bacillus sp. strains or their mutants or recombinant forms. Specific examples of Bacillus sp. strains are described above. More preferably, the SOD may be obtained from Bacillus velezensis strains (e.g., GF423, GF424, or GF427 strains) or their culture supernatants. The Bacillus velezensis GF424 strain was obtained by mutating the Bacillus velezensis GF423 strain by UV irradiation to improve sod gene expression. The Bacillus veresensis GF427 strain was obtained by replacing the promoter sequence of the Bacillus veresensis GF423 strain with a nucleotide sequence with stronger promoter activity to improve sod gene expression. The SOD enzyme (SodA) derived from the Bacillus veresensis GF423, GF424, or GF427 strain is Mn-SOD and may comprise or consist of the amino acid sequence of SEQ ID NO: 2 (its nucleotide sequence is shown in SEQ ID NO: 1). SOD may also be a recombinant polypeptide. For example, it may be a deamidated SOD (SodA2) in which the amino acid residues 74 and 137 of SEQ ID NO: 2 are substituted with Asp, which may comprise or consist of the amino acid sequence of SEQ ID NO: 4 (its nucleotide sequence is shown in SEQ ID NO: 3). SOD may also be a polypeptide in which methionine (Met) is removed from the start codon. For example, the SOD may be one in which the first amino acid residue is deleted based on SEQ ID NO: 2 or SEQ ID NO: 4, and may contain or consist of the amino acid sequence of SEQ ID NO: 5 or 6. The sequences of SEQ ID NOs: 1 to 6 are as shown in Table 2.

[0072] [Table 2] TIFF2025529259000004.tif87170

[0073] Alternatively, SOD may be derived from another recombinant strain (e.g., a Bacillus subtilis species strain) containing the SOD expression gene of the Bacillus veresensis strain. The recombinant strain can be produced by recombinant technology using conventional protein-producing strains known in the art. For example, the Bacillus subtilis strain (the parent strain of the recombinant strain) may be KCTC 3135, which is available from the Korea Institute of Bioscience and Biotechnology (KCTC) Biological Resource Center. Furthermore, the recombinant strain may have one or more of the genes listed in Table 3 deleted to facilitate downstream processing.

[0074] [Table 3]

[0075] For example, a recombinant strain can be produced through the process shown in Figure 1. The recombinant strain can also contain the expression vector shown in Figure 2. In the diagram, sodA and sodA2 represent genes encoding SOD. Since SOD derived from a strain is an enzyme secreted extracellularly, when SOD is produced using the strain, SOD can be mass-produced without an expensive purification process (e.g., column purification), ensuring safety for individuals, and thus enabling efficient production.

[0076] In some embodiments, SOD can be obtained by culturing natural or recombinant microorganisms in various culture media. For example, SOD can be isolated from the culture supernatant of Bacillus veresensis strains GF423, GF424, or GF427. Specifically, Bacillus veresensis strains can be cultured in various media to obtain a culture medium. For example, the strains are grown in complex medium (pH 6.0-7.0) at about 25°C to about 42°C for about 1 to about 4 days. Other suitable media for culturing Bacillus veresensis strains include Luria-Bertani (LB) medium, International Streptomyces Project (ISP) medium, nutrient agar (NA) medium, brain heart infusion agar (BHI) medium, sabouraud dextrose agar (SDA) medium, potato dextrose agar (PDA) medium, and nutrient broth (NB) medium. In preferred embodiments, LB medium, ISP medium, BHI medium, SDA medium, or NB medium may be used. Additionally, SOD can be sourced from other natural, mutant, or recombinant hosts using information provided in databases such as PubMed or BRENDA (brenda-enzymes.org on the World Wide Web).

[0077] In some embodiments, SOD may be isolated or purified from culture of a native, mutant, or recombinant strain. In this case, the isolated or purified SOD or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which it was derived. For example, the purified product may be purified from a strain culture by ultrafiltration, ammonium sulfate treatment, column purification, concentration, etc., or a culture retentate obtained by ultrafiltration, concentration, etc. The phrase "substantially free of cellular material" includes protein preparations in which such protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. In some embodiments, the phrase "substantially free of cellular material" includes protein preparations having less than about 30%, preferably less than about 20%, more preferably less than about 10%, and most preferably less than about 5% undesired protein by dry weight.

[0078] SOD can be purified by, but not limited to, the following purification methods. For example, a culture medium obtained by culturing Bacillus veresensis strains is centrifuged and the culture supernatant is collected. The supernatant fraction is pretreated by solid-phase extraction, followed by isolation and purification by chromatography. SOD can be purified using various types of chromatography. Preferably, hydrophobic interaction chromatography is used.

[0079] In some embodiments, SOD may be contained in the form of a strain lysate, strain culture, strain culture concentrate, strain culture extract, or a dried form thereof. Here, "strain lysate" refers to a product obtained by culturing a strain and mechanically or chemically disrupting it, and may also include any product that has subsequently undergone further processes such as extraction, dilution, concentration, or purification. "Strain culture" refers to the culture broth itself obtained by culturing a strain or its supernatant. "Strain culture concentrate" refers to a product separated from a strain culture by ultrafiltration, ammonium sulfate treatment, column purification, concentration, or the like, or a culture concentrate obtained by ultrafiltration, concentration, or the like. "Strain culture extract" refers to a product extracted from a culture broth or its concentrate, and may include an extract, a diluted or concentrated extract, a dried product obtained by drying an extract, a crude or purified product thereof, or a fraction thereof. The dried form may also include a freeze-dried form.

[0080] In some embodiments, SOD may include cellular material, e.g., extracellular vesicles, from the cell or tissue source from which it was derived. In this case, the cellular material, including SOD, can be isolated by filtration, concentration, or the like from culture media from various sources, including natural, mutant, or recombinant hosts, using conventional techniques known in the art, as described above.

[0081] [Method for preventing or treating fibrotic diseases] According to another aspect of the present invention, there is provided a method for preventing, ameliorating, or treating a fibrotic disease, comprising the step of administering to a subject a composition comprising one or more selected from the group consisting of a Bacillus sp. strain, a Bacillus sp. strain spore, and an SOD as disclosed herein. For example, the method comprises administering to a subject suffering from or at risk of developing a fibrotic disease a therapeutically or dietarily effective amount of a composition comprising one or more selected from the group consisting of a Bacillus sp. strain, a Bacillus sp. strain spore, and an SOD as disclosed herein. The fibrotic disease is as described herein.

[0082] In some embodiments, the method may comprise administering to a subject a Bacillus species strain, Bacillus species spores, or SOD as disclosed herein alone. In other embodiments, the method may comprise administering to a subject a combination of one or more selected from the group consisting of a Bacillus species strain, Bacillus species spores, and SOD as disclosed herein. The administration may be oral or parenteral, preferably oral. In one embodiment of the present invention, it has been confirmed that fibrotic diseases can be effectively prevented or treated when a Bacillus species strain, Bacillus species spores, or SOD is orally administered to a subject.

[0083] An effective or non-toxic amount of the compositions of the present invention can be determined by routine experimentation. For example, a therapeutically active amount of a composition comprising a Bacillus species strain, Bacillus species spores, and / or SOD of the present invention may vary depending on factors such as the stage of the disease, the severity of the disease, the age, sex, medical complications, and weight of the subject, and the ability of the species spores to express SOD to elicit the desired response in the subject. The dosage and administration regimen of the compositions of the present invention may be adjusted to provide the optimal therapeutic response. For example, several divided doses may be administered daily, weekly, every two weeks, every three weeks, every four weeks, etc., and / or the dose may be proportionally reduced or increased depending on the exigencies of the therapeutic situation.

[0084] As an example, Bacillus species or Bacillus species spores may be 4 ~10 12 , 10 4 ~10 10 , 10 4 ~10 9 , 10 5 ~10 12 , 10 5 ~10 11 , 10 5 ~10 10 , or 10 5 ~10 9 It may be included in the composition at the cfu level.

[0085] The compositions of the present invention may be administered together with one or more other agents that induce or may induce fibrotic diseases for the prevention, amelioration, or treatment of fibrotic diseases. Examples of other agents include, but are not limited to, any agents that are administered to reverse or ameliorate other diseases, such as antibiotics, immunosuppressants, drugs for heart disease, and cancer chemotherapy drugs, but that may unintentionally cause fibrotic diseases. When a composition comprising one or more selected from the group consisting of Bacillus sp. strains, Bacillus sp. strain spores, and / or SOD of the present invention is administered together with other agents, they may be administered simultaneously, sequentially, or in reverse order, or may be administered before the other agents. Each component may be administered to a subject at a time different from that of the other components. In certain embodiments, each component may be administered non-concurrently (e.g., separately or sequentially) at multiple intervals over a given period of time. Furthermore, individual components may be administered to a subject via the same or different routes. Possible routes of administration are described in detail in the section on pharmaceutical compositions.

[0086] In one embodiment, the Bacillus species strain, Bacillus species strain spores, and / or polypeptide having SOD activity of the present invention may be administered simultaneously, sequentially, or in the reverse order. That is, compositions comprising the following components (i) to (vii) can be administered simultaneously, sequentially, or in the reverse order to exhibit a preventive or therapeutic effect on fibrotic diseases: (i) a Bacillus species strain and a Bacillus species strain spore, (ii) a Bacillus species strain and an SOD, (iii) a Bacillus species strain spore and an SOD, or (iv) a Bacillus species strain, a Bacillus species strain spore, and an SOD. Preferably, the Bacillus species strain spores and an SOD can be administered simultaneously, sequentially, or in the reverse order to exhibit a preventive or therapeutic effect on fibrotic diseases.

[0087] [Pharmaceutical composition] According to another aspect of the present invention, there is provided a pharmaceutical or veterinary composition comprising the above-described composition. That is, a pharmaceutical or veterinary composition comprising one or more active ingredients selected from the group consisting of Bacillus sp. strains, Bacillus sp. strain spores, and SOD is provided. When the pharmaceutical composition of the present invention is applied to animals other than humans, the term "veterinary composition" may be used interchangeably.

[0088] In some embodiments, the pharmaceutical composition can be used to prevent or treat a fibrotic disease, as described above.

[0089] The pharmaceutical or veterinary compositions of the present invention may further comprise one or more selected from the group consisting of pharmaceutically acceptable carriers, excipients, and diluents. The pharmaceutically acceptable carriers, excipients, and / or diluents may be those commonly used in the art. Examples of carriers, excipients, or diluents include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, hydroxypropylmethylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil such as silicon dioxide.

[0090] When formulating, additives such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. Appropriate additives for formulation may be selected from those commonly used in the pharmaceutical field.

[0091] The pharmaceutical or veterinary compositions of the present invention can be formulated in a preferred form depending on the method of use, and can be formulated using methods known in the art to provide rapid, sustained, or delayed release of the active ingredient after administration to a mammal, in particular. Specific examples of such dosage forms include tablets, pills, acids, granules, syrups, liquids, capsules, suspensions, emulsions, injections, plasters, lotions, liniments, lemonades, aerosols, extracts, elixirs, ointments, fluid extracts, infusions, creams, soft or hard gelatin capsules, patches, etc.

[0092] Furthermore, the pharmaceutical or veterinary compositions of the present invention may be suitably formulated using any suitable method known in the art or using the methods disclosed in Remington's Pharmaceutical Sciences (latest edition), Mack Publishing Company, Easton PA.

[0093] The pharmaceutical or veterinary compositions of the present invention may be administered orally or parenterally, depending on the desired method, which may include, but is not limited to, intravenous, subcutaneous, intraperitoneal, intrapulmonary, intraarterial, intramuscular, intrarectal, intravaginal, intraarticular, intraprostatic, intranasal, intraocular, intravesical, intraspinal, or intraventricular (e.g., intracerebroventricular) administration.

[0094] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations may be prepared by mixing the composite composition with at least one or more excipients, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc., and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavorings, preservatives, etc. may be used.

[0095] For oral administration, SOD may be coated with shellac to protect it from gastric acid, but the coating agent is not limited thereto. Examples of coating agents suitable for use in the present invention include shellac, ethyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, zein, Eudragit, and combinations thereof. When SOD is coated, it may be coated in solution. Specifically, the purified solution is mixed with a shellac-containing solution and then lyophilized. This lyophilized sample becomes a powder and can be stored at about 4°C until use. In some embodiments, the SOD may be an oral SOD with enhanced stability in gastric acid through a shellac coating. Preferably, the SOD may be a shellac-coated SOD in which the first amino acid residue, Met, is deleted based on SEQ ID NO:4. More preferably, the SOD may be a shellac-coated SOD comprising or consisting of the amino acid sequence set forth in SEQ ID NO:6.

[0096] The pharmaceutical or veterinary compositions of the present invention are administered in a pharmaceutically or veterinarily effective amount. The term "pharmaceutically effective amount" or "veterinarily effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to any medical or veterinary treatment, and effective dose levels can be determined based on factors including the patient's or animal's weight, sex, age, health, severity, drug activity, drug sensitivity, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical arts.

[0097] The pharmaceutical or veterinary compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents, either sequentially or simultaneously. The pharmaceutical compositions may be administered in single or multiple doses as needed. Taking all of the above factors into consideration, it is important to administer an amount that will provide maximum efficacy with the minimum amount without adverse effects, and such an amount can be readily determined by one skilled in the art.

[0098] In some embodiments, the compositions may have various forms suitable for human administration known in the art, such as liquid, solid, gel, powder, or paste form.

[0099] [Food or feed composition] According to another aspect of the present invention, there is provided a food composition comprising one or more selected from the group consisting of the above-mentioned Bacillus species strain, Bacillus species strain spores, and SOD. Such a food composition includes a medical or nutraceutical food composition. Therefore, the food composition provided is a food composition for preventing or ameliorating fibrotic diseases.

[0100] The terms "medical food" or "nutraceutical food" are defined by the Ministry of Food and Drug Safety as foods made with ingredients or materials that may have beneficial functions for the human body and that maintain or improve health by maintaining normal functions or activating physiological functions of the human body, but are not limited to these and do not exclude any ordinary health foods from their meaning.

[0101] The food products include, but are not limited to, various foods, food additives, beverages (e.g., functional beverages, natural fruit and vegetable juices), gums, teas, vitamin complexes, health functional foods, and other functional foods.

[0102] The above-mentioned foods can be prepared by conventional methods known in the art. For example, medical foods, nutraceutical foods, or health functional foods may contain, in addition to SOD, one or more of carriers, diluents, excipients, and additives, and be formulated into one selected from the group consisting of tablets, pills, acid preparations, granules, powders, capsules, and liquid dosage forms, for the purpose of preventing or improving fibrotic diseases. Specific examples of carriers, excipients, diluents, and additives are well known in the art, and a skilled artisan can prepare them by combining appropriate ingredients according to the dosage form.

[0103] The content of the Bacillus species strain, spores and / or SOD according to the present invention as an active ingredient in the dosage form may be appropriately adjusted depending on the form and purpose of use, the condition of the patient, the type and severity of symptoms, etc., and may be, but is not limited to, 0.001 to 99.9 wt % based on the solid content, and preferably 0.01 to 50 wt %.

[0104] The dosage of the food of the present invention varies depending on the patient's age, weight, sex, dosage form, health condition, and severity of the disease. It may be administered once or several times daily at regular intervals, as determined by a physician or pharmacist. For example, the daily dosage may be 10 to 1,000 mg / kg based on the content of the active ingredient. The dosages are given as examples of average cases, and may be higher or lower depending on individual differences. A daily dosage of the functional health food of the present invention below the above dosage may not provide meaningful benefits, while a dosage higher than the above dosage is not only uneconomical but may also exceed the normal dosage range and cause undesirable side effects.

[0105] Another aspect of the present invention provides a feed composition comprising one or more selected from the group consisting of the above-described Bacillus species strain, Bacillus species strain spores, and SOD. The feed composition of the present invention can be prepared in any dosage form commonly used in the art. For example, the feed composition of the present invention may further comprise supplementary ingredients such as amino acids, inorganic salts, vitamins, antibiotics, antibacterial substances, antioxidants, antifungal enzymes, and other probiotic microbial preparations; grains such as crushed or shredded wheat, oats, barley, corn, and rice; vegetable protein feeds such as those based on rapeseed, soybeans, and sunflower; animal protein feeds such as blood meal, meat meal, bone meal, and fish meal; dry ingredients consisting of sugars and dairy products, such as various milk powders and whey powders; lipids, such as animal fats and vegetable fats optionally liquefied by heating; and additives such as nutritional supplements, digestion and absorption improvers, growth promoters, and disease preventatives.

[0106] The feed composition of the present invention may be in the form of a powder or liquid formulation, and may contain a feed additive excipient (such as calcium carbonate, powdered flour, zeolite, rice flour, or rice bran).

[0107] The present invention will now be described in more detail by way of the following examples, which are presented to aid in the understanding of the present invention and are not intended to, and should not be construed as, limiting its scope in any way.

[0108] [Example] [Production Example 1. Production of SOD-expressing Bacillus veresensis spores] Spores of the SOD-expressing Bacillus veresensis (B. amyloliquefaciens) strain used in this example were prepared from the Bacillus veresensis strain deposited at the Korea Bioresource Center (KCTC) (accession number: KCTC 13227BP, date of deposit: March 13, 2017) (hereinafter referred to as "strain GF424"), the Bacillus veresensis strain deposited at the Korea Bioresource Center (KCTC) (accession number: KCTC 13222BP, date of deposit: March 6, 2017) (hereinafter referred to as "strain GF423"), and the Bacillus veresensis strain deposited at the Korea Bioresource Center (KCTC) (accession number: KCTC 15552BP, date of deposit: August 14, 2023) (hereinafter referred to as "strain GF427") by the following method.

[0109] A single colony of Bacillus veresensis was inoculated into 1 mL of LB medium in a 14 mL tube and cultured at 37°C and 200 rpm for 12 hours. 1 mL of the culture was transferred to 50 mL of LB medium in a 500 mL flask and cultured at 37°C and 200 rpm for 12 hours. 20 mL of the culture medium was then transferred to 1 L of SYP or DSM in a 2.5 L baffled flask. The inoculated culture was cultured at 37°C and 200 rpm for 24 to 120 hours.

[0110] SYP medium contains 1.5% soy tone, 0.5% yeast extract, 0.5% K2HPO4, 0.1% MnSO4, 0.1% MgSO4, 10 mM FeSO4, 0.04% (NH4)2SO4, 0.04% (NH4)2PO4, 0.1% CaCl2, and 2% glucose. DSM medium contains 8 g / L Bacto-nutrient broth, 1 g / L KCl, 0.25 g / L MgSO4, 0.16415 g / L Ca(NO3)2, 0.9521 mg / L MnCl2, and 0.152 mg FeSO4. MnSO4, MgSO4, FeSO4, (NH4)2SO4, (NH4)2PO4, and CaCl2 were dissolved in ddH2O before use.

[0111] After incubation, lysozyme (0.5 g / L) was added to the culture broth, which was then incubated at 37°C and 200 rpm for 1 hour to remove remaining vegetative cells. The spores were collected by centrifugation at 6000 rpm for 10 minutes. The collected spores were washed twice with water, washed with 0.02% SDS, and then washed twice with water. The spore suspension was then purified by suspending in PBS. The spore suspension was stored at -20°C. The diluted spore solution was spread on an LB agar plate, and the spore number was determined by counting the colonies.

[0112] The spores were dissolved in phosphate-buffered saline (PBS) according to the experimental conditions and prepared in a volume of 100 μl.

[0113] [Production Example 2. Production of GF427 strain] The Bacillus veresensis GF427 strain expressing SOD was constructed from the GF423 strain by substituting the promoter sequence of the GF423 sodA gene with a base sequence having stronger promoter activity to increase SOD activity as follows.

[0114] The promoter sequence of the existing GF423 strain and the promoter sequence of the mutant GF427 strain are as follows: GF423 promoter sequence (5'-TTGATTACCACGCTTTCTTTTGTTACATT-3') (SEQ ID NO: 7) and GF427 promoter sequence (5'-TTGACTTTACGCTTTCTTATAGGTTATAAT-3') (SEQ ID NO: 8).

[0115] The nucleotide sequence on the genome was replaced by double crossover recombination (Figure 3). PCR was performed using GF423 genomic DNA as a template with the SOD up F and Psodmut R primers to generate two PCR products: one using GF423 genomic DNA as a template with the Psodmut F and SOD dw R primers to generate two PCR products. Next, the PCR products were cloned into BamHI-cleaved pUori-cm-amp-tsrepA using the LIC method to generate pUori-cm-amp-10sod (Figure 3a).

[0116] Next, PCR was performed using pUori-cm-amp-10sod as a template with the SOD PF and SOD P3R primers. PCR products were also prepared using the same template with the SOD P3F and SOD PR primers. The PCR products were cloned into pUori-cm-amp-10sod digested with HindIII and ClaI using the LIC method to generate pUori-cm-amp-P3-SOD, which was used for replacement (Figure 3b). The vector was constructed using E. coli C2984H. The primer sequences, PCR conditions, and LIC reaction mixture composition used are listed in Tables 4, 5, and 6, respectively.

[0117] [Table 4]

[0118] [Table 5]

[0119] [Table 6]

[0120] pUori-cm-amp-10sod was transformed into the GF423 strain by electroporation. GF423 was inoculated into LB-Sor medium (1xLB, 0.5M sorbitol) and grown at 37°C and 200 rpm. Glycine was added to a final concentration of 10mg / ml at an OD of 0.8 and further grown for 1.5 hours. After incubation, the cells were cooled on ice for 15 minutes and then centrifuged at 4000 rpm at 4°C for 10 minutes. The recovered cells were washed three times with electrotransformation buffer (containing 0.5M sorbitol, 0.5M mannitol, and 10% glycerol) and resuspended in the same buffer at 1 / 50 of the culture volume for electroporation. 0.5µg of pUori-cm-amp-10sod DNA was mixed with the prepared cells, placed in a chilled 1mm-gap electroporation cuvette, and incubated on ice for 3 minutes. Next, a single electric pulse (time constant = 4.8-5.8) was applied using a MicroPulser Electroporation System (purchased from Bio-Rad) at a field strength of 2.5 V, 25 μF, and 200 Ω. Immediately after the pulse, 1 mL of LB-Sor medium was added and allowed to recover for 2 hours at 37°C and 200 rpm. The cells were then plated on antibiotic solid medium (1xLB, cm 2.5 μg / ml, 1.5% agar) and cultured in an incubator at 37°C for 48 hours. The resulting colonies were confirmed for transformation by PCR using cm conf F and cm conf R primers. Double-crossover recombination was induced and confirmed as follows: The confirmed colonies were added to LB medium and cultured at 37°C and 200 rpm for 24 hours, after which they were diluted to 1 / 10 of the original volume. 5 The resulting solution was diluted to 100 μl and smeared on antibiotic solid medium (1xLB, agar 1.5%) and cultured in an incubator at 37°C for 20 hours. From the colonies obtained during the culture, PCR was performed using primers Cm CF and SOD mid R to select colonies in which single crossover recombination had occurred. The selected colonies were inoculated into LB broth again and cultured at 28°C for 20 hours, after which 1 / 10 5The resulting strain was diluted to 1000 kJ / ml and smeared on LB solid medium. The colonies were then plated on both antibiotic and standard solid media to identify colonies that had undergone plasmid elimination. Among the colonies from which the plasmid had been eliminated, PCR conditions were set to detect bands only in successfully engineered colonies using primers containing the mutation site, and colonies with successful mutations were selected. The primers used were SOD DC F2, -10 SOD R pair, and SOD DC F2, SOD P2 R pair. The selected colonies were subjected to PCR using 424 conf F and 424 conf R primers. The PCR products were gel-purified and sequenced to confirm the correct substitution. The strain was then named "GF427." This strain was deposited at the Korea Institute of Bioscience and Biotechnology (KCTC) on August 14, 2023 (KCTC 15552 BP). To confirm the increased SOD expression level in the GF427 strain, we compared it with that of the GF424 strain, which has improved SOD activity. The SOD activity of the culture supernatant was measured as follows. Colonies of both GF424 and GF427 strains were inoculated into 1x SYPG (1.5% soytone, 1% yeast extract, 0.5% potassium phosphate dibasic, 1% glucose) containing 50 μg / mL MnSO4 and cultured for 20 hours. The culture was centrifuged at 12,000 rpm for 10 minutes, and the culture supernatant was collected and used to measure SOD activity. The SOD activity of GF424 was measured to be 22.2 U / mL, while that of GF427 was measured to be 67.8 U / mL, approximately three times higher than that of GF424.

[0121] Spores of the GF427 strain were prepared in the same manner as in Production Example 1.

[0122] Example 1: Confirmation of the fibrosis-preventing effect of SOD-overexpressing bacterial spores in an animal model of pulmonary fibrosis Example 1.1. Establishment and testing of an animal model of pulmonary fibrosis To confirm whether spores of an SOD-overexpressing bacterial strain (GF424 spores) exhibit a preventive effect in a pulmonary fibrosis animal model, a pulmonary fibrosis animal model was established and experiments were conducted as follows. Seven-week-old C57BL / 6 male mice were subjected to a one-week purification period, and then their general symptoms were observed to confirm their health. Healthy animals were used for the experiment. The mice were divided into three groups: a control group (CTL), a bleomycin-treated group (Bleo), and a test group (GF424 spore-administered group; B+Spore SOD). The test group mice were again divided into three groups, and GF424 spores prepared in Preparation Example 1 were administered at three concentrations (1 x 10 6 CFU, 1x10 7 CFU and 1x10 8 Mice in each test group were orally administered 1000 mg of spores (CFU) once daily (a total of five times per week) for three weeks. On Day 7 (D0) after the start of spore administration (-D7), bleomycin (Bleomycin sulfate, purchased from Millipore) was administered intratracheally once at a dose of 3 U / kg to induce pulmonary fibrosis. The administration schedule for spores and bleomycin, which was performed over a total of 21 days, is shown in Figure 4. The control group (CTL) did not undergo pulmonary fibrosis induction and was not administered spores. The bleomycin-treated group (Bleo) received no spores but received a single intratracheal administration of bleomycin at a dose of 3 U / kg on Day 0 to induce pulmonary fibrosis (see Figure 4).

[0123] The experiment was terminated on the 21st day after the first spore administration, and the mice in each group were sacrificed.

[0124] [Example 1.2. Measurement of collagen concentration by measuring hydroxyproline concentration] Hydroxyproline, an amino acid found almost exclusively in collagen in mammals, is a representative indicator for directly measuring collagen levels. Hydroxyproline levels were measured using the following procedure. The left lung of a mouse model of pulmonary fibrosis was removed, and 100 μl of sterile water was added per 10 mg of lung tissue. The tissue was then thoroughly pulverized. An equal volume of hydrochloric acid (HCl, ~12 N) was added to the pulverized tissue suspension, which was then sealed and boiled at 120°C for 3 hours. After the reaction, the cell suspension was centrifuged (4°C, 10,000 x g, 3 minutes). The clear supernatant was transferred to a new tube and measured at 560 nm using a Hydroxyproline Colorimetric Assay Kit (purchased from Biovison) and a multiplate spectrometer.

[0125] As a result, referring to Figure 5, in the bleomycin-treated group, where pulmonary fibrosis progressed and the amount of collagen increased due to bleomycin, the measured amount of hydroxyproline was higher than that of the control group. On the other hand, in the GF424 spore-administered group, the amount of hydroxyproline (i.e., the amount of collagen) was confirmed to be reduced at all concentrations compared to the bleomycin-treated group. In particular, at 1x10 7 The decrease was most significant in the CFU concentration administered group.

[0126] [Example 1.3. Measurement of immune cell count in lung lavage fluid] The laryngobronchus of a mouse model of pulmonary fibrosis was partially incised, and 1 ml of sterile PBS was added and collected twice. Approximately 2 ml of the collected bronchoalveolar lavage fluid (BALF) was quickly centrifuged at 2,200 rpm for 10 minutes at 4°C. The supernatant was placed in a new 2 ml tube, and 0.5 ml of fresh PBS was added to the cell pellet to resuspend the cells. The total cell number of the cell suspension was measured using a hemocytometer, and 1 × 10 cells per sample were counted. 5The cells were diluted in PBS at a concentration of 100 cells / 0.5 ml. The cells were then attached to a microscope slide using a cytocentrifuge at 600 rpm for 5 minutes. The cells on the slide were stained with Diff-Quik reagent (supplied from Sysmex), and the numbers of macrophages, lymphocytes, and neutrophils in the total lung lavage fluid were measured.

[0127] As a result, referring to Figures 6a to 6d, in the bleomycin-treated group, the total number of BAL cells (combined total of the above three types of cells) and the number of each cell type increased compared to the control group, while in the GF424 spore group, the total number of cells and the number of each cell type decreased compared to the bleomycin-treated group. In particular, most of the immune cells found in pulmonary fibrosis were macrophages, with a concentration of 1 x 10 7 It was confirmed that the number of macrophages and lymphocytes was most significantly reduced in the CFU concentration administration group.

[0128] Example 1.4. Measurement of transforming growth factor beta 1 (TGF-β1) concentrations in lung lavage fluid Transforming growth factor beta 1 (TGF-β1) plays a crucial role in the development of pulmonary fibrosis. When cells are stimulated by reactive oxygen species or various factors, TGF-β1 is activated, which then promotes pulmonary fibrosis through a downstream mechanism. To measure TGF-β1, the lung lavage fluid in Example 1.3 was centrifuged, and the supernatant collected separately was concentrated four-fold. The concentrated lung lavage fluid was measured at 450 nm using a TGF-β1 ELISA kit (purchased from R&D systems) and a multiplate spectrometer to determine the TGF-β1 concentration in the lung lavage fluid.

[0129] As a result, referring to Figure 7, the amount of TGF-β1 due to pulmonary fibrosis was significantly increased in the bleomycin-treated group compared to the control group. On the other hand, the amount of TGF-β1 in the GF424 spore-administered group was reduced at all concentrations compared to the bleomycin-treated group, especially at 1 x 10 7 The CFU concentration was significantly reduced in the treated group.

[0130] [Example 1.5. Confirmation of pulmonary fibrosis using pathological tissue staining] Lung tissues excised from the mice sacrificed in Example 1.1 were pretreated by immersion in 4% paraformaldehyde (PFA) solution for at least one day. The lung tissues were then prepared as paraffin blocks, cut into 5 μm-thick sections, and attached to slides. The tissue sections were stained with hematoxylin and eosin (H&E) and Masson's trichrome stain and observed under a microscope to compare histopathological changes.

[0131] As a result, as shown in FIG. 8, it was confirmed that the pulmonary fibrosis increased by bleomycin was effectively reduced at all concentrations of GF424 spores administered to the group, especially at 1×10 7 The CFU concentration group showed the best effect.

[0132] [Example 1.6. Measurement of expression levels of pulmonary fibrosis gene markers] The expression levels of Col1a1 (a factor that increases collagen synthesis), TGF-β1 (a factor that activates myofibroblasts and promotes fibrosis), CTGF (connective tissue growth factor), and IL-6 (an inflammatory cytokine), which are representative gene markers known to be activated as pulmonary fibrosis progresses, were confirmed using real-time polymerase chain reaction (qRT-PCR).

[0133] A portion of the right lung lobe removed from the mouse sacrificed in Example 1.1 was pulverized using TRIzol reagent (purchased from Thermo Fisher Scientific), and total RNA was extracted. The extracted RNA was used to synthesize cDNA using M-MLV RT reagent (purchased from Promega), and real-time polymerase chain reaction (qRT-PCR) was performed using the synthesized cDNA according to the Go Taq qPCR master mix (purchased from Promega) protocol. Relative mRNA expression levels were normalized using 18S rRNA as an internal control and calculated using the 2-ΔΔCq method. The primers used in this experiment and the following qRT-PCR experiments are summarized in Table 7 below.

[0134] [Table 7]

[0135] As a result, referring to Figures 9a to 9d, the expression of all four genes tended to decrease overall in the GF424 spore-administered group compared to the bleomycin-treated group.

[0136] Example 1.7. Measurement of reactive oxygen by-product concentrations Lipid peroxidation is a major mechanism of cell damage in vivo, occurring in both animals and plants. The concentrations of malondialdehyde (MDA) and 4-hydroxynonenal (4-HNE), the most common by-products of lipid peroxidase, were measured in lung tissue as follows.

[0137] A portion of lung tissue excised from the mouse sacrificed in Example 1.1 was placed in 1X RIPA buffer (containing a protease inhibitor cocktail, purchased from Abcam) and finely ground. The tissue suspension was centrifuged at 4°C, 12,000 rpm, and 10 minutes, and the clear supernatant was separated and transferred to a new 1.5 ml tube. Protein quantification was performed using a BCA assay kit (purchased from Thermo Fisher Scientific) and measured at 562 nm using a multiplate spectrometer. By-product quantification was performed using the same amount of sample using an MDA ELISA kit (purchased from Cell Biolabs, cat# STA-832) and an HNE ELISA kit (purchased from Cell Biolabs, cat# STA-838) according to the manufacturer's instructions, and the concentration was measured at 450 nm using a multiplate spectrometer.

[0138] As a result, referring to Figures 10a and 10b, it was confirmed that the amount of reactive oxygen by-products (MDA and 4-HNE) present in the lung tissue was statistically significantly reduced in both the GF424 spore-administered group and the bleomycin-treated group. Overall, 1 x 10 7 The CFU concentration was reduced more effectively.

[0139] Example 2: Confirmation of the preventive effect of spores from bacterial strains with different SOD expression levels in an animal model of pulmonary fibrosis Example 2.1. Production and testing of spores of strains with different SOD expression levels To determine whether superoxide dismutase (SOD) expression directly influences the preventive effect against pulmonary fibrosis, we prepared spores from three Bacillus veresensis strains with different SOD expression levels: a strain with the SOD gene deleted (knockout, indicated by "-", GF423Δ), a wild-type strain with normal SOD expression (wild, indicated by "+", GF423), and a genetically engineered strain with overexpression of SOD (overexpression, indicated by "++", GF424).

[0140] The knockout strain, Bacillus veresensis ΔsodA, lacking sodA function, was constructed by double-crossover recombination as follows: First, a pair of DNA fragments flanking the sodA gene were amplified by PCR from the chromosome using primers for the upstream fragment (5'aaacagctgggatgaacacaagtgagag 3' (SEQ ID NO: 42) and 5'cacactctcttaagtttgcttccaattctggaagtttgtaag 3' (SEQ ID NO: 43)) and the downstream fragment (5'ctactgacagcttccaaggatacctgaactaccaaaaccg 3' (SEQ ID NO: 44) and 5'aaacagctgaagctcatgaccacagcaag 3' (SEQ ID NO: 45)). The erythromycin resistance (EmR) gene was amplified by PCR from pDG1664 (see Guerout-Fleury, A. M. et al., Gene 180:57-61 (1996)) using primers 5' gaagcaaacttaagagagtgtg 3' (SEQ ID NO:46) and 5' tccttggaagctgtcagtag 3' (SEQ ID NO:47). The upstream fragment, EmR gene, and downstream fragment were assembled in order and cloned into the PvuII locus of the pUori-ts plasmid, which contains a temperature-sensitive origin of replication functional in Bacillus subtilis (see J Bacteriol 176, no. 6; 1761-1763). The resulting plasmid was transformed into Bacillus veresensis GF423 by electroporation (see Zhang GQ et al., Anal Biochem. 409:130-137 (2011)). The sodA knockout mutant was selected from transformants resistant to erythromycin (5 μg / ml) at 42°C, followed by plasmid curing at 30°C. The genomic status around the sodA region was confirmed by PCR and DNA sequencing of the PCR product.

[0141] The normal strain was Bacillus veresensis GF423 (accession number: KCTC 13222BP, date of accession: March 6, 2017), and the overexpression strain was Bacillus veresensis GF424 (accession number: KCTC 13227BP, date of accession: March 13, 2017). Bacillus veresensis GF424 was obtained by UV irradiation of Bacillus veresensis GF423 to induce mutations and improve the expression of the sodA gene.

[0142] Spores prepared from the above strains by the method described in Preparation Example 1 were injected into mice in which lung fibrosis had been induced with bleomycin at 1x10 7 The mice were orally administered at a concentration of 100 CFU. Spore administration and bleomycin treatment were performed in the same manner as described in Example 1.1, and a control group and a bleomycin-treated group were prepared in the same manner. The experiment was terminated on day 21 after the initial spore administration, and the mice in each group were sacrificed (see Figure 4). Information on the Bacillus seed strain and seed spores is provided in Table 8.

[0143] [Table 8]

[0144] Example 2.2. Measurement of collagen concentration by measuring hydroxyproline concentration Hydroxyproline, a representative index that can directly measure the amount of collagen, was measured in the same manner as in Example 1.2.

[0145] As shown in Figure 11, the group administered with spores of the SOD knockout strain (B+Spore SOD(-)) had higher hydroxyproline levels than the bleomycin-treated group. Meanwhile, the groups administered with spores of the SOD-normal strain (B+Spore SOD(+)) and the SOD-overexpressing strain (B+Spore SOD(++)) showed a decrease in hydroxyproline. The group administered with spores of the SOD-overexpressing strain showed the greatest decrease.

[0146] [Example 2.3. Measurement of immune cell count in lung lavage fluid] The number of macrophages, lymphocytes, and neutrophils in the total lung lavage fluid cells was measured in the same manner as in Example 1.3.

[0147] 12a to 12d, the measurement results showed that the number of immune cells in the lung lavage fluid was reduced in all groups administered with spores of the SOD knockout strain, SOD normal strain, and SOD overexpressing strain compared to the bleomycin-treated group. The reduction in immune cell count was greater in the group administered with spores of the SOD normal strain than in the group administered with SOD knockout spores, with the most significant reduction being seen in the group administered with spores of the SOD overexpressing strain.

[0148] [Example 2.4. Measurement of growth factor β1 concentration in lung lavage fluid] Measurement of TGF-β1 concentration using lung lavage fluid was carried out in the same manner as in Example 1.4.

[0149] As shown in Figure 13, the amount of TGF-β1, which increased due to pulmonary fibrosis in the bleomycin-treated group, decreased significantly in the SOD knockout strain spore administration group, the SOD normal strain spore administration group, and the SOD overexpression strain spore administration group.

[0150] [Example 2.5. Confirmation of pulmonary fibrosis by pathological tissue staining] The pathological tissue staining method using the excised lung tissue was carried out in the same manner as in Example 1.5.

[0151] 14 shows the tissue staining results for the control group, bleomycin-treated group, and groups treated with spores of strains with different SOD expression levels (knockout, normal, and overexpressing strains), confirming that bleomycin-induced pulmonary fibrosis was improved by spore SOD. In particular, the group treated with spores of the SOD-overexpressing strain showed the most significant improvement in pulmonary fibrosis.

[0152] [Example 2.6. Measurement of expression levels of pulmonary fibrosis gene markers] Representative gene markers known to be activated as pulmonary fibrosis progresses, Col1a1, α-SMA, TGF-β1, CTGF, TNF-α, and IL-6, were analyzed for gene expression by real-time polymerase chain reaction using the primers in Table 7 (same method as in Example 1.6).

[0153] The measurement results (Figures 15a-15f) confirmed that the expression of gene markers increased by bleomycin significantly decreased depending on the SOD expression level of the administered spores. In the SOD knockout strain spore-administered group, the expression levels of Col1a1 (Figure 15a), α-SMA (Figure 15b), and TGF-β1 (Figure 15c) were similar to or higher than those of the bleomycin-treated group. Meanwhile, in the SOD-normal strain spore-administered group and the SOD overexpressing strain spore-administered group, the expression of these six markers was significantly reduced compared to the bleomycin-treated group and the SOD knockout strain spore-administered group. In particular, the SOD overexpressing strain spore-administered group showed statistically significant decreases in the expression levels of TGF-β1 (Figure 15c), CTGF (Figure 15a), and IL-6 (Figure 15f).

[0154] Example 2.7. Measurement of protein expression levels of pulmonary fibrosis markers A portion of the right lung lobe from the pulmonary fibrosis model mouse sacrificed in Example 2.1 was placed in 1X RIPA buffer (containing a protease and phosphatase inhibitor cocktail, purchased from Abcam) and finely ground. The tissue suspension was centrifuged (4°C, 12,000 rpm, 10 minutes), and the clear supernatant was separated and transferred to a new 1.5 ml tube. For Western blotting, protein quantification was performed using a BCA assay kit (purchased from Thermo Fisher Scientific) and measured at 562 nm using a multiplate spectrometer. Equal amounts of sample, determined by protein quantification, were dispensed into each gel line and subjected to electrophoresis. The gel was transferred to a PVDF membrane and incubated overnight at 4°C with primary antibodies (TGF-β (1:1000, purchased from Abcam), phospho-Smad2 / 3 (1:1000, purchased from Abcam), Smad2 / 3 (1:1000, purchased from Abcam), α-SMA (1:1000, purchased from CST), Col1a1 (1:1000, purchased from CST), and GAPDH (1:2000, purchased from CST). The next day, the membrane was thoroughly washed with 1X PBST buffer and incubated with secondary anti-rabbit antibodies for 1 hour at room temperature. Band patterns were measured using an imaging system (ChemiDoc Imaging System, purchased from Bio-Rad).

[0155] As shown in Figure 16, the bleomycin-treated group showed activation of TGF-β1-Smad2 / 3 signaling, a pulmonary fibrosis-related signaling pathway, resulting in increased expression of TGF-β1 and phospho-Smad2 / 3 proteins. Furthermore, the production of α-SMA and Col1a1, which are signaling products, also increased (lane 2). In contrast, the SOD knockout strain spore-treated group and the SOD-normal strain spore-treated group showed slightly decreased expression of phospho-Smad2 / 3 proteins, as well as slightly decreased expression of α-SMA and Col1a, compared to the bleomycin-treated group (lanes 3 and 4). In the SOD-overexpressing strain spore-treated group, the expression of the upper TGF-β1 protein was suppressed, and phosphorylation of the lower Smad2 / 3 protein was reduced, resulting in a significant decrease in the production of α-SMA and Col1a1, which are signaling products (lane 5).

[0156] Example 2.8. Measurement of survival rate To confirm the survival rate of a mouse model of pulmonary fibrosis when pulmonary fibrosis was induced after administration of spores from bacterial strains with different SOD expression levels, the survival rate was estimated using the Kaplan-Meier method, and the log-rank test was used to calculate statistical differences.

[0157] As shown in Figure 17, the survival rate of the control group (CTL, N = 13 / 13) was 100%, while that of the bleomycin-treated group (Bleo, N = 10 / 19) decreased to 52.6%. Meanwhile, the survival rate of the SOD knockout strain spore-administered group (B + Spore SOD(-), N = 5 / 7) was 71.4%, and the survival rate of the SOD normal strain spore-administered group (B + Spore SOD(+), N = 5 / 7) was also 71.4%, which was no different from the SOD knockout strain spore-administered group. Meanwhile, the survival rate of the SOD overexpression strain spore-administered group (B + Spore SOD(++), N = 19 / 20) significantly increased to 95%. The survival rate results for the experimental groups are shown in Table 9 below.

[0158] [Table 9]

[0159] This confirmed that SOD has a preventive effect on pulmonary fibrosis, which in turn is effective in increasing survival rates.

[0160] Example 2.9. Measurement of reactive oxygen by-product concentrations The concentrations of reactive oxygen by-products (MDA and 4-HNE) in the excised lung tissue were measured in the same manner as in Example 1.7.

[0161] The results confirmed that the concentrations of by-products increased by bleomycin significantly decreased depending on the SOD expression level of the administered spores. The concentrations of MDA and 4-HNE significantly decreased in the SOD knockout strain spore-administered group, followed by the SOD normal strain spore-administered group and the SOD overexpressing strain spore-administered group (Figures 18a and 18b).

[0162] Example 3: Comparison of the preventive effects of SOD-overexpressing bacterial spores and SOD in an animal model of pulmonary fibrosis Example 3.1. Sample Preparation and Testing When SOD is orally administered alone, it is difficult to maintain the activity and stability of the protein, and it may be decomposed by stomach acid before it can be effective in the body. On the other hand, spores produced by bacteria are resistant to harsh environments (e.g., extreme temperatures, acidity, alkalinity, dryness, toxic chemicals, etc.), and are predicted to be effective even when administered orally. To compare the effects of both, SOD was administered as free SOD (B+Free SOD, 2 units / mouse) and as GF424 spores (B+Spore SOD, 1x10 7 The preventive effects on pulmonary fibrosis in pulmonary fibrosis model mice were compared.

[0163] Free SOD was prepared by extracting and purifying the culture medium of Bacillus veresensis GF424 strain (KCTC 13227BP, date of accession: March 13, 2017) using the following method.

[0164] First, a single colony formed on LB agar medium (LB (Luria-Bertani) agar; tryptophan 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L) was inoculated into 30 mL of LB medium and cultured at 37°C for 12 hours. This seed culture was then inoculated into 3 L of LB medium containing 1 mM manganese sulfate (MnSO4) and cultured at 37°C for 20 hours.

[0165] The cell culture medium was then centrifuged at 3,578 × g for 20 minutes at 4°C. The supernatant was collected and concentrated 10-fold using ultrafiltration (UF, MWCO 10,000). The concentrate was filtered through a sterilizing filter and then lyophilized. SOD activity was analyzed using an SOD assay kit (purchased from Cayman Chemical, Michigan, USA). One unit of SOD activity is defined as the amount of enzyme that inhibits 50% of superoxide radicals. Dried SOD enzyme was dissolved in PBS to prepare a volume of 100 μl, which exhibits an activity of 2 units.

[0166] Administration of GF424 spores or free SOD and bleomycin treatment of both test groups were performed in the same manner as described in Example 1.1. The control group and bleomycin-treated group were also prepared in the same manner. The experiment was terminated on the 21st day after the initial spore administration, and the mice in each group were sacrificed (see Figure 4).

[0167] Example 3.2. Measurement of collagen concentration by measuring hydroxyproline concentration Hydroxyproline, which can confirm collagen levels, was measured in the same manner as in Example 1.2.

[0168] 19, the hydroxyproline concentrations in the free SOD-administered group and the GF424 spore-administered group were measured. The free SOD-administered group showed almost no difference in hydroxyproline concentration compared to the bleomycin-treated group, whereas the GF424 spore-administered group showed a statistically significant decrease in hydroxyproline levels. This confirms that administration of GF424 spores is effective in preventing pulmonary fibrosis.

[0169] Example 3.3. Measurement of growth factor β1 concentration in lung lavage fluid The TGF-β1 concentration was measured using lung lavage fluid in the same manner as in Example 1.4.

[0170] As shown in FIG. 20, the amount of TGF-β1, which increased due to pulmonary fibrosis in the bleomycin-treated group, was very effectively reduced in the GF424 spore-administered group, while free SOD had only a slight effect.

[0171] [Example 3.4. Confirmation of pulmonary fibrosis by pathological tissue staining] The pathological tissue staining method using the excised lung tissue was carried out in the same manner as in Example 1.5.

[0172] Referring to Figure 21, which shows the tissue staining results for the control group, bleomycin-treated group, free SOD-administered group, and GF424 spore-administered group, free SOD showed a slight improvement effect on bleomycin-induced pulmonary fibrosis, but showed a greater effect than GF424 spore administration.

[0173] [Example 3.5. Measurement of expression levels of pulmonary fibrosis gene markers] Representative gene markers known to be activated as pulmonary fibrosis progresses, Col1a1, α-SMA, TGF-β1, CTGF, TNF-α, and IL-6, were analyzed for gene expression by real-time polymerase chain reaction using the primers in Table 7 (same method as in Example 1.6).

[0174] As shown in Figures 22a to 22f, the pro-fibrotic markers (Col1a1, α-SMA, TGF-β1, and CTGF) and pro-inflammatory cytokines (TNF-α and IL-6), which were increased by bleomycin, showed little change in the free SOD-administered group, but were significantly reduced in the GF424 spore-administered group.

[0175] Example 3.6. Measurement of protein expression levels of pulmonary fibrosis markers Western blotting to measure the protein expression levels of pulmonary fibrosis markers in pulmonary fibrosis model mice was performed in the same manner as in Example 2.7.

[0176] As shown in Figure 23, the expression of TGF-β1 and phospho-Smad2 / 3 protein was reduced in both the free SOD and GF424 spore-treated groups by inhibiting TGF-β1-Smad2 / 3 signaling, a major mechanism of pulmonary fibrosis. Meanwhile, the fibrosis markers α-SMA and Col1a1 tended to decrease in both groups, but Col1a1 was more effectively reduced in the GF424 spore-treated group (lane 4).

[0177] Example 3.7. Measurement of reactive oxygen by-product concentrations The concentrations of reactive oxygen by-products (MDA and 4-HNE) in the excised lung tissue were measured in the same manner as in Example 1.7.

[0178] As a result, the concentrations of MDA and 4-HNE, reactive oxygen by-products increased by bleomycin, showed little change in the free SOD-treated group, but significantly decreased in the GF424 spore-treated group (Figures 24a and 24b).

[0179] Example 4: Confirmation of the preventive effect of SOD-overexpressing bacterial spores on primary lung fibroblasts isolated from an animal model of pulmonary fibrosis Example 4.1. Isolation and culture of primary mouse lung fibroblasts The GF424 spore administration group (B+Spore SOD) received 1 x 10 spores prepared by the method described in Preparation Example 1. 7 After oral administration of spores at a concentration of 1000 CFU, lung fibrosis was induced with bleomycin. Spore administration and bleomycin treatment were performed in the same manner as described in Example 1.1, and a control group and a bleomycin-treated group were also prepared in the same manner. The experiment was terminated on the 21st day after the initial spore administration, and the mice in each group were sacrificed (see Figure 4).

[0180] After laparotomy of pulmonary fibrosis model mice, the lungs were thoroughly perfused with PBS (3% penicillin / streptomycin). After the lungs were removed, they were washed with fresh PBS containing 3% antibiotics (penicillin / streptomycin). The washed lung tissue was transferred to a 6-well plate and fragmented with sterile scissors. The fragmented tissue was transferred to a new 15 ml tube and added to 5 ml of RPMI-1640 (2% penicillin / streptomycin, glutamine-free) medium containing 600 units / ml DNase I (purchased from Sigma, product number: DN25) and 0.14 units / ml liberase (purchased from Roche, product number: 05401119001). The tissue was then incubated at 37°C for 1 hour. After the reaction, the tube containing the tissue was filtered through a 40μm filter, a 70μm filter, and a 100μm filter, and the final tube was centrifuged at 520xg for 10 minutes. Finally, the supernatant was removed, and the remaining cells were suspended in an appropriate amount of DMEM (15% FBS, 2% penicillin / streptomycin) medium to prepare a cell suspension.

[0181] [Example 4.2. Confirmation of pulmonary fibrosis by immunofluorescence staining] When lung fibroblasts are exposed to external stimuli and the TGF-β pathway is activated, morphological changes (elongated shape) and functional changes (increased ECM products such as α-SMA and collagen) occur, leading to the progression of lung fibrosis. To confirm these changes, primary lung fibroblasts isolated from the lungs of mice with pulmonary fibrosis were stained for α-SMA and Col1a1, which are representative indicators of lung fibrosis, using the following immunofluorescent staining method.

[0182] After measuring the cell number using the mouse cell suspension of Example 4.1, 2 × 10 cells were cultured in a 60 mm culture dish. 6 Cells were added to the wells and cultured for one day. The next day, the medium was replaced with fresh DMEM (15% FBS, 2% penicillin / streptomycin). This medium was replaced every two to three days until the cells filled 85% to 90% of the 60 mm culture dish. After removing the cells from the dish, 40,000 cells were added per well to an 8-channel slide. Once the cells filled more than 80% of the dish, the medium was removed and washed three times with fresh PBS. The cells were fixed with 4% PFA for one hour at room temperature, then washed with PBS. Blocking buffer (purchased from Invitrogen, product number 00-4952-54) was added and incubated at room temperature for one hour. After washing with PBS three times, the primary antibodies α-SMA (1:200, Mouse mAb, CST, Product No. 48938) and Col1a1 (1:200, Rabbit mAb, CST, Product No. 72026) were diluted in blocking buffer and added to each well for overnight incubation at 4°C. The next day, after washing with PBS three times, the secondary antibodies anti-Rabbit-Alexa 555 and anti-Mouse-Alexa 488 were diluted 1:500 in PBS and added to each well for 1 hour at room temperature in the dark. After washing with PBS three times, the PBS was completely removed from the stained cells. Then, a drop of DAPI-containing mounting solution was added to each well, and a cover glass was placed on top. The cells were then observed under a confocal microscope (Zeiss).

[0183] As shown in Figure 25, the bleomycin-treated group showed elongated cell shape and increased expression of α-SMA and Col1a. On the other hand, the GF424 spore-administered group showed similar morphological changes (shortened cell shape) and functional changes (decreased expression of α-SMA and Col1a1) to the control group, confirming the preventive effect on pulmonary fibrosis.

[0184] [Example 4.3. Measurement of expression levels of pulmonary fibrosis gene markers] To verify whether the expression levels of lung fibrosis genes were altered in primary lung fibroblasts, as in the lung tissue of mice with pulmonary fibrosis induction, real-time polymerase chain reaction was performed using the primers in Table 7 (same method as in Example 1.6).

[0185] The expression levels of TGF-β1 (a factor that activates muscle fibroblasts and promotes fibrosis), Col1a1 (a factor that increases collagen synthesis), TNF-α, and IL-6 (an inflammatory cytokine), which are representative gene markers known to be activated as pulmonary fibrosis progresses, were measured. As shown in Figures 26a to 26d, the pro-fibrotic markers (TGF-β and Col1a1) and pro-inflammatory cytokines (TNF-α and IL-6), which were increased by bleomycin, were all significantly reduced in the GF424 spore-administered group.

[0186] Example 5: Confirmation of the effect of combined administration of oral SOD and bacterial spores in a pulmonary fibrosis animal model Example 5.1. Sample Preparation and Testing An experiment was prepared to confirm the preventive effect of combined administration of oral SOD and bacterial spores on pulmonary fibrosis. First, GF103, an oral SOD with enhanced stability in gastric acid, was prepared at three concentrations (1, 10, 20 units / mouse). GF423 spores (B+Spore SOD(+)) prepared in Preparation Example 1 were administered at 1 x 10 7 The concentration of GF424 spores (B+Spore SOD(++), 1x10 CFU / mouse) was used as a comparison group for the combined treatment effect. 7 CFU / mouse) were prepared.

[0187] GF103 (SEQ ID NO: 6; Met-deleted SodA2) was prepared by shellac-coating methionine-deleted SodA2 as follows: Shellac (EXCELACS Co., Ltd., Bangkok) was dissolved in 100% ethanol to a concentration of 3% and filtered through a 0.2 μm sterile filter. The shellac solution was prepared by diluting the ethanol-dissolved shellac solution 1 / 20 with sterilized 1x PBS. Freeze-dried SodA2 tablets were dissolved at 20 mg / ml and filtered through a 0.2 μm filter to sterilize. The prepared shellac solution and the dissolved SOD were mixed in a 1:1 ratio with stirring. Stirring was continued for 10 minutes. The well-mixed mixture was freeze-dried. This resulted in the final freeze-dried shellac-coated SodA. Lyophilized shellac-coated SodA was mixed with dextrin at a ratio of 1:9 to 12 (shellac-coated SodA 2:dextrin), and the final activity was measured to be 90 to 110 u / mg.

[0188] Free SOD used was purified, freeze-dried SodA without shellac coating.

[0189] Spore administration and bleomycin treatment were performed in the same manner as described in Example 1.1, and a control group and a bleomycin-treated group were prepared in the same manner. The experiment was terminated on the 21st day after the initial spore administration, and the mice in each group were sacrificed (see Figure 4).

[0190] Example 5.2. Measurement of collagen concentration by measuring hydroxyproline concentration Hydroxyproline, which can confirm collagen levels, was measured in the same manner as in Example 1.2.

[0191] Hydroxyproline concentrations were reduced in all experimental groups compared with the bleomycin-treated group. This indicates that the oral SOD (GF103) alone also reduced hydroxyproline concentrations in a dose-dependent manner. Meanwhile, the oral SOD and GF423 spore co-administration groups demonstrated a significant effect at oral SOD concentrations of 1 unit / mouse and 10 units / mouse. The group co-administered with oral SOD and GF423 spores at 10 units / mouse was particularly effective, with lower hydroxyproline concentrations measured than the group co-administered with GF424 spores, an SOD-overexpressing strain (Figure 27).

[0192] Example 5.3. Measurement of growth factor β1 concentration in lung lavage fluid The TGF-β1 concentration was measured using lung lavage fluid in the same manner as in Example 1.4.

[0193] As shown in Figure 28, the amount of TGF-β1 increased due to pulmonary fibrosis in the bleomycin-treated group showed almost no change when oral SOD (GF103) was administered alone, but was effectively reduced in the group administered oral SOD and GF423 spores in combination. In particular, the group administered oral SOD at a concentration of 20 units / mouse in combination with GF423 spores showed the greatest effect, with TGF-β1 levels measured lower than in the group administered spores of the overexpressing SOD strain GF424. On the other hand, there was almost no change in the group administered oral SOD alone.

[0194] [Example 5.4. Confirmation of pulmonary fibrosis by pathological tissue staining] The pathological tissue staining method using the excised lung tissue was carried out in the same manner as in Example 1.5.

[0195] Referring to Figure 29, which shows the tissue staining results for the control group, bleomycin-treated group, GF103-treated group at various concentrations, GF423 spore-treated group, GF103 and GF423 spore-treated group at various concentrations, and GF424 spore-treated group, it was confirmed that bleomycin-induced pulmonary fibrosis was improved in a concentration-dependent manner in the group administered oral SOD alone, and also in the group administered oral SOD and GF423 spores in combination, confirming the synergistic effect of the combined administration.

[0196] [Example 5.5. Measurement of expression levels of pulmonary fibrosis gene markers] The gene expression of representative gene markers known to be activated as pulmonary fibrosis progresses, Col1a1, α-SMA, TGF-β1, IL-6, TNF-α, and IL-1β, was confirmed by real-time polymerase chain reaction using the primers in Table 7 (same method as in Example 1.6).

[0197] As shown in Figures 30a to 30f, the pro-fibrotic markers (Col1a1, α-SMA, and TGF-β) and pro-inflammatory cytokine markers (IL-6, TNF-α, and IL-1β) increased by bleomycin were effectively reduced by oral SOD, but there was no synergistic effect from the combined administration of oral SOD and GF423 spores.

[0198] Example 5.6. Measurement of reactive oxygen by-product concentrations Not only MDA and 4-HNE, which are by-products of reactive oxygen species produced by lipid peroxidase in response to reactive oxygen species, but also 8-hydroxydeoxyguanosine (8-OHdG), which is produced when reactive oxygen species induce oxidative DNA damage, are important markers of oxidative stress. Therefore, the concentrations of reactive oxygen species by-products (MDA and 4-HNE) in the excised lung tissue were measured as in Example 1.7, and the concentration of 8-OHdG was measured using the following method, and the values ​​in each experimental group were compared.

[0199] For 8-OHdG, lung tissue was cut into small pieces and total DNA was extracted using a DNeasy Blood & Tissue Kit (purchased from Qiagen, cat# 69504). An equal amount of DNA was then analyzed using an Oxidative DNA damage ELISA kit (purchased from Cell Biolabs, cat# STA-320) according to the manufacturer's instructions, and the concentration was measured at 450 nm using a multiplate spectrophotometer.

[0200] As a result, the MDA, 4-HNE, and 8-OHdG present in the lung tissue all tended to decrease in a concentration-dependent manner when treated with oral SOD, and these levels were further reduced by the combined administration of oral SOD and GF423 spores (Figures 31a to 31c).

[0201] Example 6: Confirmation of the therapeutic effect of spores of SOD-overexpressing bacterial strains on fibrosis in an animal model of pulmonary fibrosis Example 6.1. Establishment and testing of an animal model of pulmonary fibrosis GF424 spores were administered to an animal model of pulmonary fibrosis, and pulmonary fibrosis was then induced. The results confirmed that administration of the spores had a preventive effect on pulmonary fibrosis (see Example 1, etc.). Therefore, pulmonary fibrosis was first induced, and then spores of the GF424 strain and spores of the GF427 strain, which was developed to produce approximately four times more SOD than GF424, were administered to confirm the relevant indicators. The preparation of the GF427 strain is described in Preparation Example 2.

[0202] Seven-week-old C57BL / 6 male mice were used in the study after a one-week purification period. After general observation, healthy mice were used in the study. The mice were divided into four groups: a control group (CTL), a bleomycin-treated group (Bleo), and a test group (i.e., a GF424 spore-administered group or a GF427 spore-administered group).

[0203] First, bleomycin sulfate (purchased from Millipore) was administered intratracheally once at a dose of 3 U / kg to induce pulmonary fibrosis (D0). Five days later, the test group mice received 1 x 10 GF424 spores prepared in Preparation Example 1. 7 CFU concentration and three concentrations of spores (1 x 10 5 CFU concentration, 1x10 6 CFU concentration and 1x10 7 Mice in each test group were orally administered spores (CFU concentration) once daily (5 times a week) for 12 days. The experiment was terminated on the 16th day after the first bleomycin administration, and the mice in each group were sacrificed. The control group (CTL) did not undergo pulmonary fibrosis induction and was not administered spores. See Figure 32 for the administration schedule of spores and bleomycin over a total of 16 days.

[0204] Example 6.2. Measurement of collagen concentration by measuring hydroxyproline concentration Hydroxyproline, which can confirm collagen levels, was measured in the same manner as in Example 1.2.

[0205] Measurement of hydroxyproline concentration showed that the hydroxyproline concentration was decreased in all experimental groups compared with the bleomycin-treated group, and GF427 spores reduced collagen production even at a small dose. In particular, at 1 x 10 7 In the groups administered with CFU concentration, the GF427 spore-administered group showed a more significant decrease than the GF424 spore-administered group (FIG. 33).

[0206] Example 6.3. Measurement of growth factor β1 concentration in lung lavage fluid The TGF-β1 concentration was measured using lung lavage fluid in the same manner as in Example 1.4.

[0207] As a result of the measurement, referring to FIG. 34, the amount of TGF-β1 increased due to pulmonary fibrosis in the bleomycin-treated group was significantly higher than that in the group administered with a small amount of GF427 spores (1x10 5 The GF427 spore-administered group was found to have a decrease in the number of spores (CFU concentration).6 CFU concentration and 1x10 7 The group administered with CFU concentration showed a more significant reduction than the group administered with GF424 spores.

[0208] [Example 6.4. Confirmation of pulmonary fibrosis by pathological tissue staining] The pathological tissue staining method using the excised lung tissue was carried out in the same manner as in Example 1.5.

[0209] Referring to FIG. 35, which shows the tissue staining results for the control group, bleomycin-treated group, GF424 spore group, and GF427 spore-administered groups at various concentrations, it was confirmed that bleomycin-induced pulmonary fibrosis was effectively reduced at all concentrations of GF427 spores, especially at 1x10 7 The most significant improvement was seen in CFU concentration.

[0210] [Example 6.5. Measurement of expression levels of pulmonary fibrosis gene markers] Representative gene markers known to be activated as pulmonary fibrosis progresses, Col1a1, TGF-β1, CTGF, IL-6, TNF-α, and IL-1β, were analyzed for gene expression by real-time polymerase chain reaction using the primers in Table 7 (same method as in Example 1.6).

[0211] As shown in Figures 36a to 36f, the pro-fibrotic markers (Col1a1, TGF-β, and CTGF) and pro-inflammatory cytokines (IL-6, TNF-α, and IL-1β) increased by bleomycin were reduced by administration of spores from all SOD-overexpressing strains (GF424 and GF427), with a particularly significant reduction observed in the GF427 spore-administered group.

[0212] Example 6.6. Measurement of protein expression levels of pulmonary fibrosis markers Western blotting to measure the protein expression levels of pulmonary fibrosis markers in pulmonary fibrosis model mice was performed in the same manner as in Example 2.7.

[0213] As shown in Figure 37, in both groups administered with spores of the SOD-overexpressing strains (GF424 and GF427), TGF-β1 expression was reduced and phospho-Smad2 / 3 phosphorylation was decreased due to the suppression of TGF-β1-Smad2 / 3 signaling, which is the main mechanism of pulmonary fibrosis. Furthermore, the fibrosis markers α-SMA and Col1a1 were also reduced in both groups administered with spores of the SOD-overexpressing strains (GF424 and GF427). In particular, the protein expression levels were significantly higher at 1x10 of GF427 spores. 7 There was a significant decrease in CFU concentration.

[0214] Example 6.7. Measurement of reactive oxygen by-product concentrations The concentrations of MDA and 4-HNE, which are by-products of lipid peroxidase produced by reactive oxygen species, were measured using the same method as in Example 1.7, and the concentration of 8-hydroxydeoxyguanosine (8-OHdG), which is produced when oxidative DNA damage is induced by reactive oxygen species, was measured using the same method as in Example 5.6. In addition, the degree of thiol loss in the human body due to ROS was measured, and the degree of oxidative stress was compared.

[0215] The concentrations of MDA, 4-HNE, and 8-OHdG in lung tissues tended to decrease depending on the concentration of SOD-overexpressing spores (GF424 and GF427). On the other hand, the free thiols lost by ROS were restored by the SOD-overexpressing spores. The recovery of lost thiols became more effective as the concentration of SOD-overexpressing spores increased (Figures 38a-38d).

[0216] Example 6.8. Biomarker analysis A piece of lung tissue excised from the mouse sacrificed in Example 6.1 was placed in 1X RIPA buffer (containing a protease inhibitor cocktail, purchased from Abcam) and finely ground. The tissue suspension was centrifuged at 12,000 rpm at 4°C for 10 minutes, and the clear supernatant was separated and transferred to a new 1.5 ml tube. Protein quantification was performed using a BCA assay kit (purchased from Thermo Fisher Scientific) and measured at 562 nm on a multiplate spectrometer. SP-D, MMP-7, tenascin-C, periostin, CXCL13, and PAI-1 were analyzed by real-time polymerase chain reaction using RNA obtained from a portion of the right lung lobe. Relative mRNA expression levels were normalized using 18S rRNA as an internal control and calculated using the 2-ΔΔCq method. The primers used in this experiment are summarized in Table 10 below.

[0217] [Table 10]

[0218] A comparison of the gene expression levels of six major markers that can identify pulmonary fibrosis revealed that, as shown in Figures 39a to 39f, the epithelial damage marker (SP-D), fibrosis markers (MMP-7, Tenascin-C, and Periostin), inflammation marker (CXCL13), and thrombosis marker (PAI-1) were all reduced by spores of the SOD-overexpressing strains (GF424 and GF427), and the reductions were more effective as the concentration of SOD-overexpressing strain spores increased.

[0219] Example 6.9. Measurement of Viability In a pulmonary fibrosis treatment model, we investigated the effect of spore administration of SOD-overexpressing strains (GF424 and GF427) on the survival of a mouse model of pulmonary fibrosis. Survival rates were estimated using the Kaplan-Meier method as in Example 2.8, and the log-rank test was used to calculate statistical differences.

[0220] As a result, referring to Figure 40, the survival rate of the control group (CTL, N=6 / 6) was 100%, while the survival rate of the bleomycin-treated group (Bleo, N=7 / 12) decreased to 58.3%. On the other hand, the survival rate of the GF424 strain spore-administered group (B+GF424 spore 1x10 7 The CFU concentration (N=7 / 12) was 58.3%, which was not different from the bleomycin-treated group. 5 Spore administration group (B+GF427 spore 1x10 5 CFU concentration, N=9 / 12) was 75% viability, and GF427 10 6 Spore administration group (B+GF427 spore 1x10 6 CFU concentration, N=6 / 12) was used to determine 50% viability. 7 Spore administration group (B+GF427 spore 1x10 7 CFU concentration (N=9 / 12) showed a survival rate of 75%. GF427 10 7 The spore-administered group had the slowest mortality rate and the highest number of survivors, but this was not statistically significant. These results suggest that administering SOD to a model with pulmonary fibrosis can have a therapeutic effect on pulmonary fibrosis and improve survival rates.

[0221] [Statistical analysis] All numerical data were statistically analyzed using the GraphPad Prism statistical program (Version 9.0). All data were calculated as the mean ± SEM within each group. Data were analyzed by t-test (two-way analysis of variance). * denotes p<0.05, ** denotes p<0.01, *** denotes p<0.001, and **** denotes p<0.0001.

[0222] [Conclusion] In this example, we used Bacillus veresensis spores and oral SOD to verify the effectiveness of oral administration of spores in preventing or treating pulmonary fibrosis. Specifically, we demonstrated the effectiveness of oral administration of GF424 spores in preventing and treating pulmonary fibrosis in both a mouse model in which pulmonary fibrosis was induced after oral administration of GF424 spores for a total of 3 weeks (a preventive efficacy confirmation model) and a mouse model in which pulmonary fibrosis was induced and then orally administered GF424 spores for a total of 12 days (a therapeutic efficacy confirmation model).

[0223] It is known that the induction of idiopathic pulmonary fibrosis by bleomycin is closely related to reactive oxygen species (ROS). Therefore, when the concentrations of representative by-products generated by reactive oxygen species were measured in lung tissue, it was confirmed that SOD reduces the reactive oxygen species by-products, which proves that SOD plays an effective role in reducing reactive oxygen species in the body.

[0224] The SOD-overexpressing or SOD-normal strain spore-administered groups demonstrated greater efficacy in preventing and treating pulmonary fibrosis than the SOD-knockout strain spore-administered group, with the SOD-overexpressing strain spore-administered group showing particularly significant effects. This confirms the preventive and therapeutic effects of SOD on pulmonary fibrosis through the scavenging of reactive oxygen species in the body, and also confirms the increased survival rate of mice due to these preventive and therapeutic effects. Meanwhile, spore-form SOD overcomes the drawback of oral administration of SOD in glass form (degradation before absorption in the body) and further increases its bioavailability, demonstrating significant therapeutic efficacy. Furthermore, oral SOD (GF103), which has enhanced stability in gastric acid, was also effective in improving pulmonary fibrosis when administered alone. The combined effect with SOD-normal strain spores (Spore SOD(+)) was not significant, but a slight increase was observed. These results confirm the potential of oral SOD (GF103) administered alone and in combination as a pulmonary fibrosis treatment. Furthermore, spores of the GF427 strain, which was developed to produce approximately four times more SOD than GF424, showed an improvement in pulmonary fibrosis even when administered in a smaller dose than GF424 strain spores.

[0225] In conclusion, we have confirmed that the single and combined administration of Bacillus veresensis SOD-overexpressing strain spores (GF424 spores and GF427 spores), SOD-normal strain spores, and oral SOD (GF103) is a useful material for the suppression and treatment of pulmonary fibrosis.

[0226] Example 7: Confirmation of the therapeutic effect of Bacillus veresensis spores on liver fibrosis in the STAM™ model of nonalcoholic steatohepatitis Example 7.1. Construction of a non-alcoholic steatohepatitis model To confirm whether spores of the overexpressing SOD strain GF427 have a therapeutic effect on liver fibrosis in a non-alcoholic steatohepatitis (NASH) STAM™ animal model, an animal model of non-alcoholic steatohepatitis was established, and the results were compared and analyzed with those of spores of the normal SOD strain GF423 and oral SOD (GF103).

[0227] C57BL / 6J mice (14-day-pregnant females and 6-week-old males) (purchased from SLC, Japan) were maintained in a SPF facility with controlled temperature (23±3°C), humidity (50±20%), lighting (12-hour artificial light-dark cycle; light cycle from 08:00 to 20:00), and air exchange.

[0228] NASH was induced in all groups except for the eight normal mice as follows: newborn male mice were injected subcutaneously with 200 μg of streptozotocin (STZ, purchased from Sigma-Aldrich) solution on day 2 of life. After 4 weeks of age, NASH was induced by placing a solid high-fat diet (HFD) (57 kcal% fat, purchased from CLEA Japan, Inc., Cat# HFD32) on a metal lid on top of the cage and feeding ad libitum.

[0229] Ten-week-old mice with induced NASH were randomly assigned to nine groups of eight mice each based on their body weight the day before treatment began. Random assignment was performed using weight-stratified random sampling using Excel software. NASH model mice were stratified by body weight to calculate SD and minimize the difference in mean body weight between groups. Mice were identified by ear punch, and each cage was labeled with a specific identification code.

[0230] The animal model for confirming the therapeutic effect on liver fibrosis was divided into a total of 10 groups as shown in Table 11, with 8 animals assigned randomly to each group.

[0231] [Table 11]

[0232] Here, PO means oral administration and QD means once daily.

[0233] The GF427-treated group had 0.05 × 10 7 CFU (lowest dose), 0.1x10 7 CFU (low dose), 0.5x107 CFU (intermediate dose), 1x10 7 CFU (high dose), 5x10 7 The GF423-treated group received 1x10 CFU (highest dose) per mouse once daily at five dose levels. 7 CFU once daily. GF103 was administered at a dose of 10 U per mouse once daily. Telmisartan was administered at a dose of 10 mg / kg once daily. The GF427, GF423, and GF103 groups were orally administered vehicle at a volume of 100 μL, while telmisartan was orally administered at a volume of 10 mL / kg supplemented with reverse osmosis water (RO water). The normal and disease control groups received no treatment prior to sacrifice. They were sacrificed at 13 weeks of age by direct cardiac puncture under isoflurane (Pfizer Inc.) anesthesia. Animals were monitored daily for viability, clinical signs (lethargy, convulsions, respiratory distress), and behavior, and observed for significant clinical signs, such as toxicity, coma, and death, before and after test substance administration. If an animal lost less than 25% of its body weight within one week or showed signs of coma, such as a prone position, it was euthanized before the end of the study and no samples were collected. All animal care and experiments were conducted in accordance with the Act on Animal Welfare and Care.

[0234] Example 7.2. Sample Preparation The GF427 and GF423 spores used in Example 7.1 were prepared as in Preparation Example 1, and GF103 was prepared as in Example 5.1. Telmisartan (Micardis) was purchased from Boehringer Ingelheim GmbH (Germany). The SOD-expressing Bacillus veresensis GF427 strain used in this example was derived from the Bacillus veresensis strain deposited at the Korea Central Biological Resource Center (KCTC) (accession number: KCTC 13222BP, date of deposit: March 6, 2017) ("GF423 strain") by substituting the promoter sequence of the GF423 sodA gene with a more potent promoter sequence to increase SOD activity (see Preparation Example 2). The GF427 and GF423 test substances were vortexed for at least 30 seconds before use. When aliquoting, a well-mixed solution was used, and an appropriate amount of CFU / mL was used for aliquots to obtain the desired stock volume. Before daily administration of the GF103 test substance, 10 mg of GF103 powder was diluted with an appropriate amount of distilled water. The GF427, GF423, and GF103 test substances were stored and maintained at 4°C before administration. The telmisartan test substance was prepared fresh before administration by transferring one telmisartan tablet to a mortar and grinding it with a pestle while gradually adding RO water to obtain a 1 mg / mL homogeneous suspension.

[0235] Example 7.3. Sample Preparation After sacrificing 13-week-old mice, frozen plasma samples, frozen liver samples, OCT-embedded liver blocks, and paraffin-embedded liver blocks were collected and stored.

[0236] [Plasma sample preparation] At the end of the study, non-fasting blood samples were collected by direct cardiac puncture using a pre-chilled syringe. The collected blood was transferred to pre-chilled polypropylene tubes with an anticoagulant (Novoheparin, purchased from Mochida Pharmaceutical Co. Ltd.) and stored on ice until centrifugation. Blood samples were centrifuged at 1,000 x g for 15 minutes at 4°C. After centrifugation, the supernatant was collected and stored at -80°C for biochemical experiments and transportation.

[0237] [Liver sample preparation] At sacrifice, whole livers were harvested from mice and washed with cold saline. Photographs of each individual whole liver (parietal and visceral sides) were taken. Liver weights were then measured, and liver-to-body weight ratios were calculated. The left lateral lobe of the liver was isolated, dissected, and stored as shown in Figure 41. The liver specimen labeled "a" in Figure 41 was stored at -80°C embedded in optimal cutting temperature (OCT, purchased from Sakura Finetek Japan) compound (OCT, purchased from Sakura Finetek Japan) for further analysis or transportation. The liver specimen labeled "b" was fixed in Bouin's solution (purchased from Sigma-Aldrich Japan) for 24 hours. After fixation, these specimens were embedded in paraffin for H&E and Sirius Red staining. The liver specimen labeled "c" was flash-frozen in liquid nitrogen and stored at -80°C for gene expression analysis.

[0238] Additionally, the left and right medial lobes were flash-frozen in liquid nitrogen and stored at −80°C for transport. The right lobe was flash-frozen in liquid nitrogen and stored at −80°C for biochemical experiments. The caudal lobe was flash-frozen in liquid nitrogen and stored at −80°C for transport.

[0239] Example 7.4. Checking the mouse status during the experiment NASH was induced, and weight changes in mice belonging to the 10 groups were monitored over the 21 days of treatment. As a result, as shown in Figure 42, the mean weight of the disease control group was significantly lower than that of the normal group on days 13, 15, 16, and 17. The mean weight of the telmisartan-treated group was significantly lower than that of the disease control group from days 17 to 21. However, there was no significant difference in mean weight changes between the disease control group and the other treatment groups (Groups 3 to 9) on any day during the treatment period.

[0240] During the treatment period, the following mice died by day 21: In the disease control group, one of eight mice was euthanized; in the GF427 medium-dose and high-dose groups, one of eight mice died; in the GF423-administered group, two of eight mice died; and in the telmisartan-administered group, two of eight mice were euthanized.

[0241] Example 7.5. Confirmation of long-term weight change On the 21st day, when all treatments were completed, the average body weight, liver weight, and liver-to-body weight ratio for each of the 10 groups were measured (FIG. 43a).

[0242] 43a and 43b, the mean body weight of the disease control group on the day of sacrifice tended to be lower than that of the normal group. The mean body weight of the telmisartan group on the day of sacrifice was significantly lower than that of the disease control group. The mean body weight of all treatment groups on the day of sacrifice tended to be lower than that of the disease control group.

[0243] Referring to Figures 43a and 43c, the disease control group showed a significant increase in mean liver weight compared to the normal group. Meanwhile, the GF427 high dose group and the telmisartan administration group showed a significant decrease in mean liver weight compared to the disease control group. The mean liver weights of the lowest dose, low dose, and GF427 administration groups tended to decrease compared to the disease control group. No significant difference in mean liver weight was observed between the remaining groups and the disease control group.

[0244] 43a and 43d, the mean liver-to-body weight ratio of the disease control group was significantly increased compared to the normal group. Meanwhile, the mean liver-to-body weight ratios of the high-dose GF427 group and the telmisartan group tended to decrease compared to the disease control group. No significant difference in the mean liver-to-body weight ratio was observed between the disease control group and the remaining groups.

[0245] Example 7.6. Biochemical analysis of plasma and liver tissue Plasma or liver samples were collected from each mouse according to the plasma sample preparation method and liver sample preparation method in Example 7.3, and then the total blood glucose level, plasma ALT level, plasma CK-18 level, and liver triglyceride content were measured and compared (Figure 44a).

[0246] [Measurement of total blood glucose levels] Non-fasting blood glucose of whole blood was measured using a Stat Strip blood glucose meter (purchased from NIPRO CORPORATION). As shown in Figure 44b, the total blood glucose level of the disease control group was significantly increased compared to the normal group. The total blood glucose levels of the lowest dose, highest dose, and GF427 administration groups and the GF423 administration group tended to decrease compared to the disease control group. No significant difference in total blood glucose levels was observed between the disease control group and the remaining groups.

[0247] [Measurement of plasma ALT levels] Plasma ALT levels were measured using a FUJI DRI-CHEM 7000 (purchased from Fujifilm Corporation). As shown in Figure 44c, the disease control group showed a significant increase in plasma ALT levels compared to the normal group. The high-dose GF427 group showed a significant decrease in plasma ALT levels compared to the disease control group. The plasma ALT levels of the lowest dose, highest dose, and telmisartan-administered groups tended to decrease compared to the disease control group. No significant difference in plasma ALT levels was observed between the disease control group and the remaining groups.

[0248] [Measurement of plasma CK-18 levels] Plasma CK-18 levels were quantified using a mouse cytokeratin 18-M30 ELISA kit (purchased from Cusabio Biotech Co., Ltd.). The measurement results, shown in Figure 44d, showed that the disease control group had significantly increased plasma CK-18 levels compared to the normal group. All groups showed significantly decreased plasma CK-18 levels compared to the disease control group.

[0249] [Confirmation of liver triglyceride content] Total liver lipid extracts were obtained by the method of Folch (see reference [Folch J. et al., J. Biol. Chem. 1957;226:497]). Liver samples were homogenized in chloroform-methanol (2:1, v / v) and incubated overnight at room temperature. After washing with chloroform-methanol-water (8:4:3, v / v / v), the extract was evaporated to dryness and dissolved in isopropanol. Liver triglyceride content was measured using the Triglyceride E-Test (purchased from FUJIFILM Wako Pure Chemical Corporation).

[0250] As shown in Figure 44e, the measurement results show that the disease control group had a significantly increased liver triglyceride content compared to the normal group. On the other hand, all groups except the lowest dose GF427 group had a significantly decreased liver triglyceride content compared to the disease control group. The liver triglyceride content of the lowest dose GF427 group tended to decrease compared to the disease control group.

[0251] Example 7.7. Confirmation of liver fibrosis through H&E staining of liver tissue and NAFLD activity score assessment Sections were cut from the paraffin blocks of liver tissue prepared in Example 7.3 using a rotary microtome (purchased from Leica Microsystems). After sectioning, each slide was coded with a number for blind evaluation. Numbers were generated using the RAND function in Excel software, sorted in ascending order, and assigned to slides. Tissue slides were used for H&E staining and evaluated by the experimenter.

[0252] For H&E staining, sections were cut from paraffin blocks of liver tissue prefixed in Bouin's solution and stained with Lilly-Meyer hematoxylin (purchased from Muto Pure Chemicals Co., Ltd.) and eosin solution (purchased from FUJIFILM Wako Pure Chemical Corporation). The NAFLD activity score (NAS) was calculated according to the Kleiner criteria as shown in Table 12 (see reference [Kleiner DE. Et al., Hepatology, 2005;41:1313]). For NAS scoring, bright-field images of H&E-stained sections were taken at 50x and 200x magnification using a digital camera (purchased from Leica, product number: DFC295). The steatosis score of one section per mouse (one representative field at 50x magnification), the inflammation score of one section per mouse (one representative field around the central vein at 200x magnification), and the ballooning score of one section per mouse (one representative field around the central vein at 200x magnification) were assessed.

[0253] [Table 12]

[0254] Representative micrographs of H&E-stained liver sections were taken (Figures 45a-45c), and the scores and NAS values ​​for each section were presented in a table (Figure 45e) and graphs (Figures 45f-45i) to confirm the degree of steatosis, inflammatory cells, and hepatocyte ballooning in each group. Detailed examination of liver sections from the disease control group revealed microvesicular and macrovesicular fat deposition, hepatocyte ballooning, and inflammatory cell infiltration compared to the normal group (Figure 45d). Meanwhile, the remaining treatment groups showed a tendency toward decreased steatosis, inflammatory cells, and hepatocyte ballooning compared to the disease control group. As shown in Figures 45e-45i, the disease control group showed a significant increase in NAS compared to the normal group. Meanwhile, the low, medium, high, and maximum doses of GF427, GF423, and telmisartan treatment groups showed a significant decrease in NAS compared to the disease control group. The NAS of the GF103 group tended to decrease compared to the disease control group. There was no significant difference in NAS between the disease control group and the lowest dose GF427 group.

[0255] [Example 7.8. Confirmation of liver fibrosis by Sirius Red staining of liver tissue] To visualize collagen deposition, Bouin-fixed liver sections were stained with picro-sirius red solution (purchased from FUJIFILM Wako Pure Chemical Corporation). The sections were deparaffinized and hydrophilized sequentially with xylene, a 100-70% alcohol series, and RO water. They were then treated with 0.03% picro-sirius red solution (product number: Cat No. 194-16202) for 60 minutes. After washing with 0.5% acetic acid and RO water, the stained sections were dehydrated, washed with a 70-100% alcohol series, and xylene, and then sealed with Entellan new (purchased from Merck) for observation.

[0256] For quantitative analysis of fibrotic area, bright-field images of Sirius Red-stained sections were captured around the central vein at 200x magnification using a digital camera (purchased from Leica, product number: DFC295), and the positive areas in five fields per section were measured using ImageJ software (National Institutes of Health). Representative photomicrographs of Sirius Red-stained sections for assessment of fibrotic area are shown in Figure 46a.

[0257] Referring to Figures 46a to 46c, liver sections from the disease control group showed increased collagen deposition (Sirius Red positive) in the central periphery of the hepatic lobule compared to the normal group. The disease control group also showed a significant increase in fibrotic area (Sirius Red positive area) compared to the normal group. Meanwhile, the fibrotic area in the highest dose GF427, GF423, GF103, and telmisartan-treated groups tended to decrease compared to the disease control group. No significant difference in fibrotic area was observed between the disease control group and the remaining groups.

[0258] [Statistical analysis] Statistical analysis was performed using Prism software 6 (GraphPad Software, USA) with the Bonferroni Multiple Comparison Test.

[0259] A P value <0.05 was considered statistically significant. Results are expressed as mean ± SD.

[0260] If the one-sided t-test yielded a P value of less than 0.1, a tendency or trend was assumed. All results were compared between groups as follows: 1) Group 2 (disease control group) vs. Group 1 (normal group) 2) Group 2 (disease control group) vs. Group 3 (GF427 lowest dose group) 3) Group 2 (disease control group) vs. Group 4 (low-dose GF427 group) 4) Group 2 (disease control group) vs. Group 5 (GF427 intermediate dose group) 5) Group 2 (disease control group) vs. Group 6 (high-dose GF427 group) 6) Group 2 (disease control group) vs. Group 7 (GF427 highest dose group) 7) Group 2 (disease control group) vs. Group 8 (GF423 treatment group) 8) Group 2 (disease control group) vs. Group 9 (GF103 treatment group) 9) Group 2 (disease control group) vs. Group 10 (telmisartan administration group) [Conclusion] In this example, we used Bacillus verrezensis GF427, GF423, and oral SOD (GF103) to confirm that administration of spores or oral SOD is effective in treating liver fibrosis in an animal model of nonalcoholic steatohepatitis. Specifically, in an animal model in which NASH was induced with streptozotocin solution and a high-fat diet, GF427 spores, GF423 spores, or GF103 were orally administered in the form of a vehicle at a volume of 100 μL once daily for 21 days. This demonstrated the suppression and improvement of the progression of liver fibrosis in a mouse model.

[0261] The GF427-treated group showed a tendency for a decrease in total blood glucose level and fibrosis area compared with the disease control group, and plasma ALT level, plasma CK-18 level, hepatic triglyceride content, and NAS showed significant decreases compared with the disease control group. The GF423-treated group showed a significant decrease in plasma CK-18 level, hepatic triglyceride content, and NAS compared with the disease control group. The total blood glucose level and fibrosis area also tended to decrease compared with the disease control group. The GF103-treated group showed a significant decrease in plasma CK-18 level and hepatic triglyceride content compared with the disease control group. The NAS and fibrosis area also tended to decrease compared with the disease control group.

[0262] In conclusion, we have confirmed that spores of the GF427 strain, which was engineered to overexpress SOD, spores of the GF423 strain, which expresses wild-type SOD, and the oral SOD GF103, can all be useful materials for the suppression and treatment of liver fibrosis when administered alone. [Accession number]

[0263] (1) Bacillus verrezensis (Bacillus amyloliquefaciens) strain (GF427 strain) Deposited at the Korea Institute of Bioscience and Biotechnology on August 14, 2023 Accession number: KCTC 15552 BP

[0264] (2) Bacillus verrezensis (Bacillus amyloliquefaciens) strain (GF424 strain) Deposited at the Korea Institute of Bioscience and Biotechnology on March 13, 2017 Accession number: KCTC 133227BP

[0265] (3) Bacillus veresensis (Bacillus amyloliquefaciens) strain (GF423 strain) Deposited at the Korea Institute of Bioscience and Biotechnology on March 6, 2017 Accession number: KCTC 13222BP

Claims

1. A pharmaceutical composition for treating or preventing a fibrotic disease, comprising as an active ingredient one or more selected from the group consisting of Bacillus species strains, Bacillus species strain spores, and polypeptides having superoxide dismutase (SOD) activity.

2. 2. The pharmaceutical composition according to claim 1, wherein the Bacillus species strain is a strain that expresses SOD or a strain that has been mutated or engineered to overexpress SOD.

3. 2. The pharmaceutical composition of claim 1, wherein the Bacillus species strain spores comprise spores derived from a strain that expresses SOD or a strain that has been mutated or engineered to overexpress SOD.

4. 2. The pharmaceutical composition of claim 1, wherein the Bacillus species is a Bacillus veresensis species.

5. 2. The pharmaceutical composition according to claim 1, wherein the Bacillus species strain is one or more selected from the group consisting of the Bacillus veresensis strain deposited under accession number KCTC 13222 BP, the Bacillus veresensis strain deposited under accession number KCTC 13227 BP, and the Bacillus veresensis strain deposited under accession number KCTC 15552 BP.

6. The pharmaceutical composition of claim 1 , wherein the polypeptide is a manganese-containing SOD (Mn-SOD).

7. The pharmaceutical composition according to claim 1, wherein the polypeptide is a deamidated Mn-SOD.

8. 10. The pharmaceutical composition of claim 1, wherein the polypeptide is derived from a Bacillus species strain.

9. 9. The pharmaceutical composition of claim 8, wherein the Bacillus species is a Bacillus veresensis species.

10. 9. The pharmaceutical composition according to claim 8, wherein the Bacillus species strain is one or more selected from the group consisting of the Bacillus veresensis strain deposited under accession number KCTC 13222 BP, the Bacillus veresensis strain deposited under accession number KCTC 13227 BP, and the Bacillus veresensis strain deposited under accession number KCTC 15552 BP.

11. The pharmaceutical composition of claim 1, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:

6.

12. The pharmaceutical composition according to claim 1, wherein the polypeptide is coated with a coating agent.

13. 13. The pharmaceutical composition of claim 12, wherein the coating agent comprises shellac.

14. The pharmaceutical composition according to claim 1, wherein the fibrotic disease is a pulmonary fibrotic disease or a liver fibrotic disease.

15. 15. The pharmaceutical composition of claim 14, wherein the pulmonary fibrotic disease is selected from the group consisting of interstitial lung disease, pulmonary fibrosis, and idiopathic pulmonary fibrosis.

16. 15. The pharmaceutical composition of claim 14, wherein the liver fibrosis disease is selected from the group consisting of non-alcoholic steatohepatitis, liver fibrosis, idiopathic liver fibrosis, liver cirrhosis, alcoholic steatohepatitis, chronic liver disease, and viral hepatitis.

17. The pharmaceutical composition of claim 1, wherein the active ingredient is administered orally.

18. 2. The pharmaceutical composition of claim 1, comprising two or more components selected from the group consisting of the Bacillus species strain, Bacillus species strain spores, and the polypeptide having SOD activity, wherein the two or more components are administered simultaneously, sequentially, or in reverse order.

19. A method for preventing, ameliorating, or treating a fibrotic disease, comprising administering to a subject a composition comprising one or more selected from the group consisting of a Bacillus species strain, a Bacillus species strain spore, and a polypeptide having superoxide dismutase activity.

20. A food composition for preventing or ameliorating a fibrotic disease, comprising one or more selected from the group consisting of a Bacillus species strain, a Bacillus species strain spore, and a polypeptide having superoxide dismutase activity.

Images