Humanized immunodeficient mouse model

By expressing human-specific cytokines in immunodeficient mouse models and directly transplanting human cells, the risk of GvHD and the complexity of treatment in humanized mouse models are resolved, and the long-term functional maintenance of human T cells and innate immune cells is achieved, supporting various aspects of human immune cell biology research.

JP2025530216APending Publication Date: 2025-09-11JACKSON LAB THE +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025514329
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-09-08
Filing Date
2023-09-07
Publication Date
2025-09-11

AI Technical Summary

Technical Problem

Existing technologies for generating humanized mouse models carry the risk of graft-versus-host disease (GvHD) when transplanting the human immune system, making it difficult to achieve the mature functions of human T cells and innate immunity. Furthermore, the processing is complex and costly, limiting research on human cell therapy.

Method used

An immunodeficient mouse model is used, which is genetically engineered to express human-specific cytokines, such as huIL7, huIL15, huIL3, and huGM-CSF. Combined with non-irradiated NOD mice, human hematopoietic stem cells or peripheral blood mononuclear cells are directly transplanted to establish a long-term human immune cell engraftment model, avoiding traditional immunosuppressive treatment.

Benefits of technology

This enables long-term engraftment and functional maintenance of human T cells, natural killer cells, and innate immune cells in humanized mouse models, reducing processing steps and costs and supporting diverse human immune cell biology research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025530216000001_ABST
    Figure 2025530216000001_ABST
Patent Text Reader

Abstract

In some aspects, the present disclosure provides humanized immunodeficient mouse models that support long-term engraftment and function of human T cells, natural killer (NK) cells, and innate immune cells (e.g., basophils, dendritic cells, eosinophils, Langerhans cells, mast cells, myeloid cells such as monocytes and macrophages, and neutrophils) without the need for conditioning (e.g., myeloablative therapy).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related Applications This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Patent Application No. 63 / 404,597, filed September 8, 2022, which is incorporated by reference herein in its entirety.

[0002] Use of electronic sequence listing The contents of the electronic sequence listing (J022770130WO00-SEQ-EMB.xml; size: 2,991 bytes; and creation date: September 5, 2023) are incorporated herein by reference in their entirety.

[0003] Government licensing rights This invention was made with government support under AI132963 awarded by the National Institutes of Health. The government has certain rights in this invention. [Background technology]

[0004] background Humanized mouse models are valuable preclinical tools that enable researchers to conduct more translationally relevant studies. These models are mice that contain functioning human genes, cells, tissues, or microbiota. There are three general methods for humanizing mice: transplanting a human immune system into an immunodeficient host, replacing mouse genes with their human homologs, or transferring fecal microbiota from a human donor into germ-free mice.

[0005] Human immune system transplantation typically involves the transplantation of human hematopoietic stem cells (HSCs) or human peripheral blood mononuclear cells (PMBCs). To facilitate the engraftment of human HSCs, immunodeficient mice are first conditioned (e.g., irradiated or subjected to some other form of myeloablative treatment) to weaken their immune systems. Furthermore, human HSCs often contain human CD34 +and CD3 to enrich for HSCs + These procedures are engineered to deplete T cells. These procedures prevent or at least reduce the likelihood of mice developing acute xenograft-versus-host disease (GvHD), a condition resulting from human immune cells attacking host mouse tissues, which is primarily mediated by the presence of human leukocyte antigen (HLA)-restricted T cells. For mouse models aiming to replicate human T cells and innate immunity, human PBMC transplantation is typically used; however, avoiding GvHD in these model systems remains a challenge. Conditioning procedures used to suppress the mouse immune system simultaneously eradicate mature HLA-restricted T cells, so these procedures cannot be used with PBMC transplantation. Recipient mice transplanted with human PBMCs develop GvHD shortly after transplantation.

[0006] Thus, there are many limitations to the generation of a human immune system in humanized mice that would enable their use for the study of human stem cell therapy. These limitations include difficulties in generating primary and recall human adaptive and innate cellular immune responses, including T cell priming and memory T cell generation, as well as low human NK cell activity. These observations illustrate the critical need for a more mature, fully functional human (adaptive and innate) immune system. Summary of the Invention [Means for solving the problem]

[0007] Abstract Immunocompromised mice engrafted with human immune cells are essential for evaluating the efficacy and safety of, for example, human cell therapy products engineered to circumvent host immune rejection. Typically, individual mouse models are used to evaluate the specific immune biology of specific cell types. However, this à la carte approach results in greater overall direct mouse costs and longer project timelines. Furthermore, manipulation of human cell samples and myeloablative conditioning of immunocompromised mice often impairs the survival, proliferation capacity, and function of the engrafted human immune cells. Therefore, new humanization methods and mouse models are needed. In some aspects, the present disclosure fulfills this need and advances the field by providing new humanized mouse models and methods that can be used to evaluate multiple complex aspects of human immune cell biology (e.g., human cell therapy products) in a single mouse strain. The methods provided herein also aim to minimize the processing of human xenograft samples and the manipulation of immunocompromised mice.

[0008] Accordingly, some aspects of the present disclosure provide humanized immunodeficient mouse models that support the long-term engraftment and function of human T cells, natural killer (NK) cells, and innate immune cells (e.g., basophils, dendritic cells, eosinophils, Langerhans cells, mast cells, myeloid cells such as monocytes and macrophages, and neutrophils) without the need for conditioning (e.g., myeloablative therapy). The humanized immunodeficient mouse models provided herein possess robust human (adaptive and innate) immune systems, in part because they have little or no residual innate immunity and because they transgenically express human-specific cytokines required for the development and function of human T cells, NK cells, and innate immune cells (e.g., myeloid cells).

[0009] In some aspects, the present disclosure provides immunodeficient non-obese diabetic (NOD) mice comprising an endogenous Il2rg allele comprising a null mutation; an endogenous H2-K allele comprising a null mutation; an endogenous H2-D allele comprising a null mutation; an endogenous H2-A allele comprising a null mutation; an endogenous Kit allele comprising a null mutation; an exogenous nucleic acid encoding human interleukin 7 (huIL7); an exogenous nucleic acid encoding human interleukin 15 (huIL15); an exogenous nucleic acid encoding human interleukin 3 (huIL3); an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF); and an exogenous nucleic acid encoding human Steel factor (also referred to as human stem cell factor or human KIT ligand) (huSCF).

[0010] In some embodiments, the endogenous H2-K1 allele comprising a null mutation is H2-K1 tm1Bpe In some embodiments, the endogenous H2-D allele comprising a null mutation is H2-D1 tm1Bpe In some embodiments, the endogenous H2-A allele comprising a null mutation is H2-Ab1 em1Mvw It is an allele.

[0011] In some embodiments, the endogenous interleukin-2 receptor gamma (Il2rg) allele is Il2rg tm1Wjl In some embodiments, the endogenous Il2rg allele comprising a null mutation is Il2rg tm1Sug It is an allele.

[0012] In some embodiments, the immunodeficient mouse further comprises an endogenous protein kinase, DNA-activated catalytic subunit (Prkdc) allele comprising a null mutation. In some embodiments, the mutation is a severe combined immunodeficiency (scid) mutation. In some embodiments, the endogenous Prkdc allele comprising a null mutation is Prkdc scid It is an allele.

[0013] In some embodiments, the immunodeficient mouse further comprises an endogenous recombination activating gene 1 (Rag1) allele comprising a null mutation. In some embodiments, the endogenous Rag1 allele comprising a null mutation is Rag1 tm1Mom It is an allele.

[0014] In some embodiments, the immunodeficient mouse further comprises an endogenous recombination activating gene 2 (Rag2) allele that comprises a null mutation. In some embodiments, the endogenous Rag2 allele that comprises a null mutation is Rag2 tm1Fwa It is an allele.

[0015] In some embodiments, the immunodeficient mice have a NOD scid γ background. In some embodiments, the immunodeficient mice are NSG-(K b D b ) null (IA null ) genetic background.

[0016] In some embodiments, the endogenous Kit allele comprising a null mutation is Kit W-41J is.

[0017] In some embodiments, the mouse further comprises (or is transplanted with) human cells.

[0018] In some embodiments, the immunodeficient mice further comprise (or are transplanted with) unfractionated human umbilical cord blood comprising human cells.

[0019] In some embodiments, the human cells comprise human hematopoietic stem cells. In some embodiments, the human cells comprise human peripheral blood mononuclear cells.

[0020] In some embodiments, the human cells are CD34 + Not enriched for human hematopoietic stem cells. In some embodiments, CD3 + Human T cells have not been depleted from human cells.

[0021] In some embodiments, the mouse has not been subjected to myeloablative treatment, e.g., irradiation or chemical myeloablative treatment. In other embodiments, the mouse has been subjected to myeloablative treatment.

[0022] In another aspect, the present disclosure provides a method for generating a humanized mouse, the method comprising administering human cells to any one of the immunodeficient mice described herein.

[0023] In some embodiments, the method comprises administering unfractionated human umbilical cord blood comprising human cells. In some embodiments, the human cells comprise human hematopoietic stem cells. In some embodiments, the human cells comprise human hematopoietic peripheral blood mononuclear cells.

[0024] In still another aspect, the present disclosure provides a method of generating an immunodeficient mouse according to any one of the preceding claims, comprising mating (i) a mouse comprising an endogenous Kit allele comprising a null mutation, an exogenous nucleic acid encoding human interleukin 3 (huIL3), an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF), and an exogenous nucleic acid encoding human Steel factor (huSCF); and (ii) a mouse comprising an endogenous H2-K allele comprising a null mutation, an endogenous H2-D allele comprising a null mutation, an endogenous H2-A allele comprising a null mutation, an exogenous nucleic acid encoding human interleukin 7 (huIL7), and an exogenous nucleic acid encoding human interleukin 15 (huIL15).

[0025] In some embodiments, the immunodeficient mouse is homozygous for an endogenous Kit allele comprising a null mutation. In some embodiments, the immunodeficient mouse is homozygous for an endogenous H2-K allele comprising a null mutation, homozygous for an endogenous H2-D allele comprising a null mutation, and / or homozygous for an endogenous H2-A allele comprising a null mutation.

[0026] Some aspects provide a method that includes administering human cells to an immunodeficient mouse of any one of the paragraphs.

[0027] In some embodiments, the method further comprises administering unfractionated human umbilical cord blood comprising human cells.

[0028] In some embodiments, the human cells comprise human hematopoietic stem cells.

[0029] In some embodiments, the human cells comprise human peripheral blood mononuclear cells.

[0030] In some embodiments, the human cells are CD34 + Not enriched for human hematopoietic stem cells.

[0031] In some embodiments, CD3 + Human T cells have not been depleted from human cells.

[0032] In some embodiments, the methods exclude subjecting the immunodeficient mice to myeloablation, optionally irradiation or chemical myeloablation.

[0033] Some aspects relate to immunodeficient non-obese diabetic (NOD) mice comprising: (a) an endogenous Il2rg allele comprising a null mutation, an endogenous Prkdc allele comprising a null mutation, and an endogenous Kit allele comprising a null mutation; and (b) a transgene encoding human interleukin 3 (huIL3), a transgene encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF), and a transgene encoding human Steel factor (huSCF).

[0034] In some embodiments, the immunodeficient mouse has been transplanted with human hematopoietic stem cells, hi other embodiments, the immunodeficient mouse has been transplanted with human peripheral blood mononuclear cells.

[0035] In some embodiments, the immunodeficient mice are transplanted with pathological human cells.

[0036] In some embodiments, the diseased human cells are obtained from a subject with a genetic disorder.

[0037] In some embodiments, the genetic disorder is facioscapulohumeral muscular dystrophy (FSHD).

[0038] In some embodiments, the diseased human cells are human muscle cells.

[0039] In some embodiments, the human muscle cells are CD56+ muscle stem cells.

[0040] Another aspect relates to a method comprising administering human hematopoietic stem cells to the non-irradiated immunodeficient mouse of claim 1, wherein the human HSCs develop into innate immune cells; and administering human diseased cells to the non-irradiated immunodeficient mouse.

[0041] In some embodiments, about 10 4 ~about 10 6 Human HSCs are administered.

[0042] In some embodiments, the human pathological cells are administered about 4 to about 10 weeks after administration of the human HSCs.

[0043] In some embodiments, about 10 4 ~about 10 6 Human diseased cells, optionally muscle cells, and optionally CD56+ muscle stem cells are administered.

[0044] In some embodiments, the human diseased cells are obtained from a subject with facioscapulohumeral muscular dystrophy (FSHD).

[0045] In some embodiments, the method further comprises administering a therapeutic modality to the immunodeficient mouse.

[0046] In some embodiments, the method further comprises assaying for the response of the innate immune cells to the human diseased cells.

[0047] In some embodiments, the response is an inflammatory response.

[0048] Some aspects include (a) an endogenous Il2rg allele containing a null mutation, an endogenous Prkdc allele containing a null mutation, an endogenous H2-K allele containing a null mutation (H2-K null ); endogenous H2-D alleles containing null mutations (H2-D null ); endogenous H2-A allele containing a null mutation (H2-A null and (b) an immunodeficient non-obese diabetic (NOD) mouse comprising a transgene encoding human interleukin-15 (huIL15). In some embodiments, the methods herein include administering human hematopoietic stem cells (HSCs) or human peripheral blood mononuclear cells (PBMCs) to the immunodeficient mouse, wherein the human HSCs develop into innate immune cells, optionally wherein the mouse is not irradiated; and administering human diseased cells to the immunodeficient mouse. In some embodiments, about 10 4 ~about 10 6 Human HSCs or human PBMCs are administered. In some embodiments, the human pathological cells are administered about 4 to about 10 weeks after the administration of the human HSCs or human PBMCs. In some embodiments, the human pathological cells are administered about 10 to about 10 weeks after the administration of the human HSCs or human PBMCs. 4 ~about 10 6 Human pathological cells are administered. In some embodiments, the method further comprises administering a therapeutic modality to the immunodeficient mouse. In some embodiments, the method further comprises assaying for a response of the innate immune cells to the human pathological cells. In some embodiments, the response is an inflammatory response.

[0049] Another aspect relates to an immunodeficient non-obese diabetic (NOD) mouse comprising (a) an endogenous Il2rg allele containing a null mutation and an endogenous Prkdc allele containing a null mutation; and (b) a transgene encoding huIL15 and a transgene encoding human interleukin 7 (huIL7). In some embodiments, the method herein comprises administering human HSCs or human PBMCs to the immunodeficient mouse, wherein the human HSCs develop into innate immune cells, optionally wherein the mouse is not irradiated; and administering human diseased cells to the immunodeficient mouse. In some embodiments, about 10 4 ~about 10 6 Human HSCs or human PBMCs are administered. In some embodiments, the human pathological cells are administered about 4 to about 10 weeks after the administration of the human HSCs or human PBMCs. In some embodiments, the human pathological cells are administered about 10 to about 10 weeks after the administration of the human HSCs or human PBMCs. 4 ~about 10 6 Human pathological cells are administered. In some embodiments, the method comprises administering a therapeutic modality to the immunodeficient mouse. In some embodiments, the method further comprises assaying for a response of the innate immune cells to the human pathological cells. In some embodiments, the response is an inflammatory response. [Brief explanation of the drawings]

[0050] [Figure 1-1]Figures 1A-1E. NSG-SMG3-W41 mice support human hematopoietic stem cell (HSC) engraftment and selective expansion of innate immune cells, but not T cells. Figure 1A is a schematic diagram showing the experimental design comparing innate immune engraftment in NSG-SGM3 mice with or without 100 cGy irradiation to NSG-SGM3-W41 mice. Figure 1B shows flow sorting assays of human CD45+ cells in the blood at the indicated time points after HSC injection. Figures 1C-1E show flow cytometry analysis of the % of CD45+ cells co-expressing CD33+ myeloid cell markers, CD20+ B cell markers, and CD3+ T cell markers in the blood at 4 weeks (Figure 1C), 8 weeks (Figure 1D), or 12 weeks (Figure 1E) after HSC injection. [Figure 1-2] Same as above.

[0051] [Figure 2-1] Figures 2A-2G. Co-xenografting of human innate immune cells and skeletal muscle in NSG-SGM3-W41 mice. Figure 2A is a schematic diagram illustrating the co-transplantation protocol for human donor HSCs and FSHD and control muscle stem cells (myoblasts), as well as processing of tibialis anterior (TA) muscle xenografts for flow cytometry, qPCR, and NanoString analysis to identify cell lineage, RNA isolation, and sectioning for immunohistology. Figure 2B is a table listing the myoblast cell lines used. DUX4 expression levels have been previously described. Figure 2C is a schematic diagram listing the HSC and muscle experimental groups for six HSC donors and three FSHD family cohorts. Figures 2D-2G show the percent hCD45+ cells (Figure 2D), hCD45 / CD20+ B cells (Figure 2E), hCD45 / CD33+ myeloid cells (Figure 2F), or hCD45 / CD3+ T cells (Figure 2G) in the spleen from the indicated transplant conditions using flow cytometry assays. Each dot represents data from one mouse, with bars indicating the mean ± SEM per condition. Schematics in A and C were generated using biorender.com. [Figure 2-2] Same as above. [Figure 2-3] Same as above. [Figure 2-4] Same as above.

[0052] [Figure 3-1] Figures 3A-3C. Enhanced accumulation of human CD45+ innate immune cells in FSHD muscle xenografts. Figure 3A shows cryosectioned humanized TA muscles immunostained with human-specific anti-CD45 to identify HSCs and Hoechst to identify nuclei. Representative images of FSHD and control transplanted TA muscles are shown. Scale bar = 50 μm. Figure 3B shows quantification of CD45+ cells per TA muscle section for the indicated transplant conditions. Each dot represents the number of human CD45+ cells in one muscle section, with bars indicating the mean ± SEM per condition. By Welch's t-test, * = p < 0.05, ** = p < 0.01, *** = p < 0.001, **** = p < 0.0001. Figure 3C shows serial sections immunostained with human-specific anti-CD45 to identify immune cells or spectrin β1 to identify human fibers and Hoechst to identify nuclei. Humanized muscle regions are outlined with dotted lines based on spectrin β1 myofiber localization and transposed onto the CD45 immunostained image. Scale bar = 100 μm. [Figure 3-2] Same as above.

[0053] [Figure 4-1]Figures 4A-4D. Enhanced accumulation of human B cells and macrophages in FSHD muscle xenografts. Humanized TA muscles were cryosectioned and co-immunostained with human-specific antibodies against CD19 (Figure 4A) to identify early B cells or CD68 (Figure 4C) to identify macrophages, and Hoechst to show nuclei in FSHD- or control-transplanted TAs from mice transplanted with muscle cohorts 12, 15, or 17. Scale bar = 50 µm. Figure 4B shows quantification of B cells as demonstrated by human CD19 immunostaining. Each dot represents one muscle section, with the bar indicating the mean ± SEM per condition. Figure 4D shows quantification of macrophages as demonstrated by human CD68 immunostaining. Each dot represents one muscle section and is shown as the mean ± SEM per condition. By Welch's t-test, *=p<0.05, **=p<0.01, ***=p<0.001, ****=p<0.0001. [Figure 4-2] Same as above.

[0054] [Figure 5-1]Figures 5A-5D. FSHD and unaffected control muscle stem cells were transplanted into and differentiated in HSC-transplanted NSG-SGM3-W41 mice. Figure 5A shows humanized TA muscle that was cryosectioned and co-stained with lamin A / C to identify human nuclei, a human-specific antibody against spectrin β1 to identify differentiated myofibers, and Hoechst to identify all nuclei. Representative images of FSHD and control xenografts from cohorts 12, 15D1, 15D2, 17D3, and 17D4 are shown. Scale bar = 100 μm. Figure 5B shows quantification of spectrin β1 fibers for the indicated transplant conditions. Each dot represents the number of fibers in one muscle section, with bars indicating the mean ± SEM per condition. * = p < 0.05, ** = p < 0.01 by Welch's t-test. Figure 5C shows representative images of FSHD and control xenografts from cohorts 12 and 15, with or without immunoengraftment, stained with spectrin β1 to identify differentiated myofibers. Scale bar = 100 μm. Figure 5D shows quantification of spectrin β1 fibers for the indicated transplant conditions. Each dot represents the number of fibers in one muscle section, with bars indicating the mean ± SEM per condition. *** = p < 0.001, **** = p < 0.0001 by Welch's t-test. [Figure 5-2] Same as above.

[0055] [Figure 6]Figures 6A-6D. The inflammatory response to FSHD muscle is immune donor dependent. Normalized NanoString counts for muscle genes (Figure 6A), DUX4 target genes (Figure 6B), and complement genes (Figure 6C) as assayed in RNA isolated from immune / muscle-transplanted TA muscles from the indicated cohorts. NanoString counts were log2-transformed, and fold changes in FSHD relative to control gene expression were calculated. Significant gene expression changes are indicated with an asterisk and calculated using Welch's t-test. Figure 6D shows NanoString log2-transformed counts showing C3 RNA expression from individual TA muscles. Each dot represents expression data from one TA muscle, with bars indicating the mean ± SEM per condition. *=p<0.05, **=p<0.01, ****=p<0.0001 by Welch's t-test.

[0056] [Figure 7-1] Figures 7A-7B. Human C3 localizes to FSHD and control human xenograft myofibers. Figure 7A shows cryosectioned humanized TA muscle co-stained with a human-specific antibody against spectrin β1 to identify C3 and differentiated myofibers and Hoechst to identify nuclei. Representative images of FSHD and control xenografts at low (top) and high (bottom) magnifications are shown. Scale bars = (top) 100 μm, (bottom) 50 μm. Figure 7B shows quantification of C3 puncta in spectrin β1+ fibers for FSHD and control transplanted TA muscle sections from cohorts 12, 15D1, 15D2, 17D3, and 17D4. Each dot represents the percent of fibers with more than 10 C3 puncta, with bars indicating the mean ± SEM per condition. *** = p<0.001, **** = p<0.0001 by Welch's t-test. [Figure 7-2] Same as above.

[0057] [Figure 8-1]Figures 8A-8C. Human CD45+ cells in the spleen and xenograft muscle of mice transplanted with donor HSC cells. Figure 8A shows representative flow data from mice co-transplanted with HSCs and muscle, including a gating strategy for identifying human immune cell subtypes. Figure 8B shows flow cytometry assays from the spleen for percent human CD45+ cells. Animals that did not develop human immune cell populations are included (no IM). Each dot represents data from one mouse, with bars indicating the mean ± SEM per condition. Figure 8C shows quantification of CD45+ cells per section for the indicated transplant conditions. Each dot represents the number of CD45+ cells in one muscle section, with bars indicating the mean ± SEM per condition. [Figure 8-2] Same as above.

[0058] [Figure 9] Figure 9 shows cell engraftment (percent of total) 6 weeks after administration of unfractionated umbilical cord blood (UCB) to irradiated NSG-MHC DKO Tg(Hu-IL15) mice (n=10), irradiated NSG-MHC-class I / II KO mice (n=8), and irradiated NSG-Tg(Hu-IL7)(Hu-IL15) mice (n=10).

[0059] [Figure 10-1]Figure 10A shows results from flow cytometry analysis of cells collected from blood 3 weeks after administration of unfractionated UCB to irradiated NSG-MHC DKO Tg(Hu-IL15) mice (n = 13) and irradiated NSG-Tg(Hu-IL7)(Hu-IL15) mice (n = 14). Figure 10B shows cell engraftment (percent of total) 3 weeks after administration of UCB. Figure 10C shows results from flow cytometry analysis of CD4 T cells and CD8 T cells 3 weeks after administration of UCB. Figure 10D shows CD4 T cell and CD8 T cell engraftment 3 weeks after administration of unfractionated UCB. Figure 10E shows the percentage of human CD45 cells 3, 6, and 9 weeks after administration of UCB. FIG. 10F shows the percentage of human CD3 T cells (as a percentage of human CD45 cells) 3, 6, and 9 weeks after administration of UCB. [Figure 10-2] Same as above. [Figure 10-3] Same as above. [Figure 10-4] Same as above. [Figure 10-5] Same as above. [Figure 10-6] Same as above.

[0060] [Figure 11-1] Figures 11A-11B show cell engraftment (percent of total) 9 weeks after split cell injection into NSG-MHC DKO Tg(Hu-IL15) mice. Figure 11C shows human CD45 cell engraftment at 6 and 9 weeks after split cell injection into NSG-MHC DKO Tg(Hu-IL15) mice. [Figure 11-2] Same as above. [Figure 11-3] Same as above. DETAILED DESCRIPTION OF THE INVENTION

[0061] Detailed Description Humanized immunodeficient mouse models engrafted with human immune cells enable in vivo evaluation of the efficacy and safety of human cell therapy products and other therapeutic products. However, the use of humanized mice is hindered by model-specific limitations, some of which include the occurrence of graft-versus-host disease (GvHD), the technical difficulties and costs associated with each humanized animal, and poor engraftment of some human immune cells. Despite the many mouse models currently available, there remains a great need in the field for clinically relevant humanized models—for example, humanized models that can inform the clinical application of cancer immunotherapeutics (see, e.g., Lee et al., Dev Reprod., 2019, 2(2): 79-92; Morillon et al., Anticancer Research, 2020, 40(10): 5329-5341, each of which is incorporated herein by reference). The present disclosure provides such models.

[0062] Mouse model For brevity, reference will be made herein to "mouse" and "mouse models (e.g., surrogates for the human condition)." It should be understood that these terms can be used interchangeably throughout this specification to encompass "rodents" and "rodent models," including mice, rats, and other rodent species, unless otherwise stated.

[0063] It should also be understood that the standard genetic nomenclature used herein provides unique identification for different rodent strains, and that the strain symbol conveys basic information about the type of strain or breed used and the genetic content of the strain. The rules for strain and breed symbolization are published by the International Committee on Standardized Genetic Nomenclature for Mice. These rules are available online at the Mouse Genome Database (MGD; informatics.jax.org) and have been published in print (Lyon et al. 1996). Strain symbols typically include a Laboratory Registration Code (Lab Code). The initial Lab Code appended to the strain symbol identifies and credits the creator of the strain. The Lab Code at the end of the strain symbol indicates the current source for obtaining mice of that strain. Different Lab Codes assigned to the same strain symbol distinguish sublines and alert users to possible genetic differences between different sublines. Lab Codes are assigned by a central registry to ensure uniqueness. The above authorities are maintained at the Institute for Laboratory Animal Research (ILAR) at the National Academy of Sciences, Washington, D.C. The Lab Code can be obtained electronically at the ILAR website (nas.edu / cls / ilarhome.nsf).See also Davisson MT, Genetic and Phenotypic Definition of Laboratory Mice and Rats / What Constitutes an Acceptable Genetic-Phenotypic Definition, National Research Council (US) International Committee of the Institute for Laboratory Animal Research. Washington (DC): National Academies Press (US); 1999.

[0064] When applied to a mutant mouse strain, "genetic background" or "background" refers to its genetic makeup (all its alleles at all loci), excluding the mutated gene of interest and small amounts of other genetic material that typically come from one or two other strains. The precise strain nomenclature indicates what the background of the mutant strain is. For example, the targeted mutant strain NOD.129S7(B6)-Rag1 tm1Mom / J (The Jackson Laboratory (JAX) Strain # 003729) and NOD.Cg-Rag1 tm1Mom Prf1 tm1Sdz The genetic background of / SzJ (JAX Strain # 004848) is primarily non-obese diabetic (NOD). However, the first strain carries targeted mutations in the Rag1 gene, possibly some Rag1-linked alleles from 129S7-derived embryonic stem (ES) cells, and possibly some B6 alleles from crosses in its breeding history. In contrast, the second strain is congenic (Cg) with more than one donor strain in its breeding history. It carries targeted mutations in the Rag1 and Prf1 genes and possibly some background alleles from those other strains.

[0065] The mouse model can be modified to allow for disease evaluation. Any system (e.g., immune system, respiratory system, nervous system, or circulatory system), organ (e.g., blood, heart, blood vessels, spleen, thymus, lymph nodes, or lungs), tissue (e.g., epithelium, connective, muscle, and nerve), or cell type (e.g., lymphocytes or macrophages) can be modified independently or in combination to allow for disease study in the models provided herein.

[0066] Three conventional methods used for the generation of genomically modified mice (e.g., knockout mice, transgenic mice) include DNA microinjection (Gordon and Ruddle, Science 1981: 214: 1244-124, incorporated herein by reference), embryonic stem cell-mediated gene transfer (Gossler et al., Proc. Natl. Acad. Sci. 1986, 83: 9065-9069, incorporated herein by reference), and retrovirus-mediated gene transfer (Jaenisch, Proc. Natl. Acad. Sci. 1976, 73: 1260-1264, incorporated herein by reference), any of which may be used as provided herein. For example, genome editing methods using clustered regularly interspace palindromic repeats (CRISPR / Cas) nucleases, transcription activator-like effector nucleases (TALENs), or zinc finger nucleases (ZFNs) may also be used and are described elsewhere herein.

[0067] After delivery of the nucleic acid into a fertilized embryo (e.g., a single-cell embryo (e.g., a zygote) or a multicellular embryo (e.g., a developmental stage after the zygote, such as a blastocyst)), the fertilized embryo is transferred to a pseudopregnant female, which subsequently gives birth to offspring. The presence or absence of a transgene of interest or a null mutation in an endogenous gene of interest can be confirmed, for example, using any number of genotyping methods (e.g., sequencing and / or genomic PCR).

[0068] New mouse models can also be created by crossing parental lines. With the availability of various mutants, knockouts, knock-ins, transgenics, Cre-lox, Tet-inducible systems, and other mouse strains, multiple mutations and transgenes can be combined to generate new mouse models. Multiple mouse strains can be crossed together to generate double, triple, or even quadruple and higher multiple mutant / transgenic mice.

[0069] In some embodiments, parent mice can be bred to generate F1 mice. The parent mice can be, for example, homozygous, heterozygous, hemizygous, or homozygous null at a particular allele. Homozygous describes a genotype with two identical alleles at a given locus, heterozygous describes two different alleles at a given locus, hemizygous describes a genotype consisting of only a single copy of a particular gene in an otherwise diploid organism, and homozygous null refers to an otherwise diploid organism in which both copies of the gene are missing.

[0070] As is known in the art, immunodeficient mice have impaired or destroyed immune systems, such as specific deficiencies in MHC class I, II, or both, B cell or T cell deficiencies, natural killer (NK) cell deficiencies, myeloid deficiencies (e.g., granulocyte and / or monocyte deficiencies), macrophage deficiencies, dendritic cell deficiencies, and immunodeficiencies resulting from knockdown of genes related to cytokines, cytokine receptors, Toll-like receptors (TLRs), and various transducers and transcription factors of signal transduction pathways. Immunodeficient mouse models include single gene mutation models (e.g., nude mouse (nu) strains and severe combined immunodeficiency (scid) strains, non-obese diabetic (NOD) strains, RAG (recombination activating gene) strains with targeted gene deletions), as well as various hybrids generated by crossing double and triple mutant mouse strains with additional deficiencies in innate and adaptive immunity.

[0071] An impaired immune system can be measured by any method known in the art, including, but not limited to, the production of mature immune cells (e.g., B cells, T cells, dendritic cells, macrophages, natural killer cells), defective endogenous cytokine signaling, limited resistance to infection, and reduced survival. In some embodiments, the immunodeficient mice lack mature mouse T cells, mature mouse B cells, functional mouse natural killer cells, and are deficient in endogenous (e.g., mouse) cytokine signaling. Mature T cells develop in the thymus and are released into other tissues, including the blood, spleen, and lymphatic system. Mature B cells express pathogen-specific antibodies on their surface. Functional natural killer cells recognize and kill malignant and virally transformed cells without previous exposure. Endogenous (e.g., mouse) cytokine signaling is important in maintaining homeostasis, and the immune, nervous, and endocrine systems rely on cytokines to regulate function. Defective endogenous (eg, murine) cytokine signaling means that the level of cytokine signaling is not sufficient to maintain immune system homeostasis compared to a non-deficient endogenous immune system.

[0072] The "lack of" a particular cell type or signal (e.g., cytokine) in an immunodeficient mouse can be the complete absence of that cell type or signal, or a substantial reduction of that cell type or signal relative to a mouse that is not immunodeficient (e.g., not genetically modified to reduce innate immunity). For example, the lack of a particular cell type (e.g., cell number) or signal (e.g., cytokine protein level) can be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reduced relative to a mouse that is not immunodeficient.

[0073] The absence of specific cell types may be assessed by any method known in the art, including, but not limited to, flow cytometry; quantitative PCR (qPCR) of T cell markers (e.g., CD3, CD8, CD4, CD25, CD127, CD152), B cell markers (e.g., CD19, IgM, BCAP), and NK cells (e.g., CD224, CD122, NK1, NKp46, Ly49, CD11b, CD49b); immunofluorescence, and / or enzyme-linked immunosorbent assay (ELISA). Defective cytokine signaling (e.g., murine cytokine signaling) can be assessed by any method known in the art, including, but not limited to, flow cytometry, qPCR of cytokines (e.g., IL2, IL7, IL15, IFNγ, IL4, IL5, IL9, IL13, IL25, IL17A, IL17F, IL22, TNFα, IL12, CCL3, GM-CSF, IL6, IL10, TGFβ, IL18, IL21), immunofluorescence, and / or ELISA.

[0074] Non-limiting examples of immunodeficient mouse model backgrounds that can be used herein include the following mouse strains: Nude (nu) [Flanagan SP. Genet Res 1966; 8: 295-309; and Nehls M et al. Nature 1994; 372: 103-7] Scid (scid) [Bosma GC et al. Nature 1983; 301:527-30; Mosier DE et al. Nature 1988; 335: 256-9; and Greiner DL et al. Stem Cells 1998; 16: 166-77]; NOD [Kikutani H et al. Adv Immunol 1992; 51: 285-322; and Anderson MS et al. Ann Rev Immunol 2005; 23: 447-85]; RAG1 and RAG2 (rag) [Mombaerts P et al. Cell 1992; 68: 869-77; Shinkai U et al. Cell 1992; 68: 855-67] NOD-scid [Greiner DL et al. 1998; Shultz LD et al. J Immunol 1995;154:180-91; Melkus MW et al. Nature Med 2006;12:1316-22; and Denton PW et al. PLoS Med 2008;4(12):e357]; ·IL2rg null [DiSanto JP et al. Proc Natl Acad Sci USA 1995; 92: 377-81]; · B2m null [Christianson SW et al. J Immunol 1997; 158: 3578-86]; NOD-scid IL2rγ null [Shultz LD et al. Nat Rev Immunol 2007;7:118-30; Ito M et al. Blood 2002;100:3175-82; Ishikawa I et al. Blood 2005;106:1565-73; and Macchiarini F et al. J Exp Med 2005;202:1307-11]; NOD-scid B2m null [Shultz et al. 2007; Shultz LD et al. Transplantation 2003; 76: 1036-42; Islas-Ohlmayer MA et al. J Virol 2004; 78: 13891-900; and Macchiarini et al. 2005]; HLA transgenic mice [Grusby MJ et al. Proc Natl Acad Sci USA 1993; 90(9): 3913-7; and Roy CJ et al. Infect Immun 2005; 73(4): 2452-60]. See also, e.g., Belizario JE The Open Immunology Journal, 2009; 2:79-85; NOG mice (NOD.cg-Prkdc scid Il2rgtm1Sug ) [Shultz LD et al. Nat Rev Immunol 2007;7:118-30]; and BRG mice (BALB / c; 129S4- Rag2 tm1.1Flv ) [Traggiai E et al., Science 2004; 304(5667): 104-107].

[0075] Non-obese diabetic (NOD) background In some embodiments, provided herein is an immunodeficient mouse model with a non-obese diabetic (NOD) background. The NOD mouse (e.g., JAX strain #001976, NOD-Shi LtJ NOD mice are a polygenic mouse model of autoimmune (e.g., type 1) diabetes characterized by hyperglycemia, insulitis, and leukocyte infiltration of pancreatic islet cells. These mice are hypoinsulinemic and hyperglucagonemic and exhibit selective destruction of pancreatic islet β cells. A key component of diabetes susceptibility in NOD mice is a unique MHC haplotype. NOD mice also exhibit multiple abnormal immune phenotypes, including defective antigen-presenting cell immunoregulatory function, defects in regulating the T lymphocyte repertoire, defective NK cell function, defective cytokine production from macrophages (Fan et al., 2004), and impaired wound healing. They also lack the hemolytic complement, C5. NOD mice are also severely deaf. Various mutations causing immune deficiencies, targeted mutations in cytokine genes, and transgenes affecting immune function have been backcrossed onto the NOD inbred background.

[0076] In some aspects of the present disclosure, the immunodeficient mice provided herein based on a NOD background are NOD-Cg.-Prkdc scid IL2rg tm1wJl / SzJ (NSG®), NOD.Cg-Rag1 tm1Mom Il2rg tm1Wjl / SzJ(NRG), NOD.Cg-Prkdc scid Il2rg tm1Sug / ShiJic(NOG), NOD-Prkdc em26Cd52 Il2rg em26Cd22 / NjuCrl(NCG), and BALB / c-Rag2 tm1Fwa Ilr2g tm1Sug / JicTac(BRG). Other immunodeficient mouse strains are contemplated herein.

[0077] In some embodiments, the immunodeficient mouse model based on a NOD background is NOD-Cg.-Prkdc scid IL2rg tm1wJl / SzJ (NSG®) genetic background. The NSG® mice (e.g., JAX strain #005557) are immunodeficient mice lacking mature T cells, B cells, and NK cells, lacking multiple cytokine signaling pathways, and having numerous defects in innate immunity (see, e.g., Shultz, Ishikawa, & Greiner, 2007; Shultz et al., 2005; and Shultz et al., 1995, each of which is incorporated herein by reference). The NSG® mice are derived from the NOD mouse strain NOD / ShiLtJ (see, e.g., Makino et al., 1980, which is incorporated herein by reference) and express the Prkdc gene. scid mutation (also known as the "severe combined immunodeficiency" or "scid" mutation) and Il2rg tm1Wjl Contains targeted mutations. Il2rg tm1Wjl The mutation is a null mutation in the gene encoding the interleukin-2 receptor gamma chain (IL2rg, homologous to IL2RG in humans), which blocks NK cell differentiation, thereby removing a roadblock that prevents efficient engraftment of primary human cells (Cao et al., 1995; Greiner et al., 1998; and Shultz et al., 2005, each of which is incorporated herein by reference).

[0078] In some embodiments, the immunodeficient mouse model has an NRG background. The NRG mouse (e.g., JAX strain #007799) is severely immunodeficient. This mouse harbors two mutations on a NOD / ShiLtJ genetic background: a targeted knockout mutation in recombination activating gene 1 (Rag1) and a complete null allele of the IL2 receptor common gamma chain (IL2rg null The severe immunodeficiency of NRG mice is due to the fact that these mice contain human CD34 + These immunodeficient NRG mice allow for highly efficient humanization through transplantation of hematopoietic stem cells (HSCs) and patient-derived xenografts (PDXs). These mice are more resistant to irradiation and genotoxic drugs than mice with a scid mutation in the DNA repair enzyme Prkdc.

[0079] In some embodiments, the immunodeficient mouse model is a NOG mouse. The NOG mouse (Ito M et al., Blood 2002) is a severe combined immunodeficient (scid) mouse established by combining a NOD / scid mouse and an IL2 receptor-γ chain knockout (IL2rγKO) mouse (Ohbo K. et al., Blood 1996). The NOG mouse lacks T cells and B cells, lacks natural killer (NK) cells, exhibits reduced dendritic cell function and reduced macrophage function, and lacks complement activity.

[0080] In some embodiments, the immunodeficient mouse model has an NCG background. The NCG mouse (e.g., Charles River Stock #572) was generated by sequential CRISPR / Cas9 editing of the Prkdc and Il2rg loci in NOD / Nju mice, generating coisogenic mice to NOD / Nju. The NOD / Nju mice have a mutation in the Sirpa (SIRPα) gene, which allows transplantation of foreign hematopoietic stem cells. The Prkdc knockout generates a SCID-like phenotype lacking proper T cell and B cell formation. The Il2rg gene knockout further results in a decrease in NK cell generation and further exacerbates the SCID-like phenotype.

[0081] In some embodiments, the immunodeficient mouse model has a BRG background. tm1Fwa Ilr2g tm1Sug / JicTac) (e.g., Taconic #11503) is used to express BALB / cA-Rag2 knockout (Rag2 tm1Fwa ) mice were cultured in BALB / cA-Il2rg (Ilr2g tm1Sug ) mice (Traggiai E. et al., Science 2004). The BRG mice lack mature T, B, and NK cells, do not produce immunoglobulins, and exhibit reduced dendritic cell function (relative to wild-type BALB / c mice).

[0082] Interleukin 2 receptor gamma (Il2rg) allele This gene encodes a transmembrane protein that is a common subunit of several interleukin receptor complexes. These receptors are composed of α and β subunits in addition to this common subunit. Signaling through this pathway is important in immune cell differentiation and function. In some embodiments, the endogenous interleukin 2 receptor, a gamma chain (Il2rg) allele containing a null mutation (Il2rg nullAn immunodeficient mouse model comprising Il2rg is provided herein. null An example of an allele is Il2rg tm1Wjl Allele (Cao X, et al., Immunity. 1995 Mar;2(3):223-38) and Il2rg tm1Sug In some embodiments, the immunodeficient mouse is an allele of the Il2rg allele (Ohbo K, et al., Blood. 1996 Feb 1;87(3):956-67). tm1Wjl In some embodiments, the immunodeficient mouse comprises the Il2rg allele. tm1Sug In some embodiments, the immunodeficient mouse comprises the Il2rgem26Cd22 allele. Mouse IL2Rγ is encoded by the mouse Il2rg gene (Gene ID: 16186). The human ortholog of mouse IL2Rγ is interleukin-2 receptor subunit gamma (IL2RG).

[0083] Protein kinase, DNA-activated catalytic subunit (Prkdc) allele This gene is capable of DNA-dependent protein kinase activity, double-stranded DNA binding activity, and enzyme-binding activity. It is involved in several processes, including the regulation of cellular protein metabolic processes, the regulation of hematopoietic stem cell differentiation, and the regulation of hematopoiesis. It acts upstream of or within several processes, including DNA metabolic processes, programmed cell death of ectopic germ cells, and immune system development. In some embodiments, an endogenous protein kinase, DNA-activated catalytic polypeptide (Prkdc) allele containing a null mutation (Prkdc) is used. null Provided herein are immunodeficient mouse models comprising: a Prkdc allele that encodes a Prkdc gene; a Prkdc gene encoding a Prkdc gene that encodes a Prkdc gene; and a Prkdc gene encoding a Prkdc gene that encodes a Prkdc gene. In some embodiments, the Prkdc allele is a null mutation in an endogenous Prkdc allele that encodes a Prkdc gene. null An example of an allele is Prkdc scid allele (commonly referred to as scid) (Bosma GC, et al., Nature. 1983 Feb 10;301(5900):527-30) and Prkdc em26Cd52In some embodiments, the immunodeficient mouse is scid In some embodiments, the immunodeficient mouse comprises a Prkdc allele. em26Cd52 Alleles included. Mouse PRKDC is encoded by the mouse Prkdc gene (Gene ID: 19090). The human orthologue of mouse PRKDC is protein kinase, DNA-activated catalytic subunit (PRKDC).

[0084] In some embodiments, the immunodeficient mouse model is a NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ Background (NSG (登録商標) ;NOD-scid IL2Rgamma null ; NOD-scid IL2Rg null ; and NOD scid gamma) (JAX Strain # 005557). These mice are severely immunodeficient. These mice carry two mutations on the NOD / ShiLtJ genetic background: severe combined immunodeficiency (scid) and a complete null allele of the IL2 receptor common gamma chain (IL2rg). null The scid mutation is in the DNA repair complex protein PRKDC, rendering mouse B and T cells defective. null The mutations disrupt cytokine signaling through multiple receptors, resulting in a defect in functional NK cells. Severe immunodeficiency occurs when these mice express human CD34 + Allows for humanization by engraftment of HSCs, PBMCs, patient-derived xenografts (PDX), or adult stem cells and tissues.

[0085] Recombination activating gene 1 (Rag1) allele This gene enables several functions, including protein homodimerization activity, ubiquitin protein ligase activity, and zinc ion binding activity. It is involved in immune system development, positive regulation of T cell differentiation, and protein ubiquitination. It acts upstream of or within several processes, including T cell homeostasis, hematopoietic or lymphoid organogenesis, and negative regulation of apoptotic processes. In some embodiments, an endogenous recombination activating gene 1 (Rag1) allele containing a null mutation (Rag1) is used. null An immunodeficient mouse model comprising Rag1 is provided herein. null Examples of alleles include: Rag1 tm1Mom (Mombaerts P, et al., Cell. 1992 Mar 6;68(5):869-77), Rag1 em1Gpt , Rag1 em1Ldn , Rag1 em2Gpt , Rag1 em28Gpt , Rag1 m1Btlr , Rag1 tm1(cre)Thr , Rag1 tm1(GFP)Imku , Rag1 tm1Fwa , Rag1 tm1Jsek , Rag1 m1Anu , Rag1 tm1.1Sadu , Rag1 tm1Mnz , Rag1 coln , Rag1 em1Dgs , Rag1 em2Dgs , Rag1 em2Ldn , Rag1 em2Tutzy , Rag1 em3Ldn , Rag1 em4Ldn , Rag1 em5Lutzy , Rag1 em8Lutzy , Rag1 em10Lutzy , Rag1 m2Btlr , Rag1 m3Btlr , Rag1 m4Btlr , Rag1 tm1Bal , Rag1 tm1Jmj , Rag1 tm1Nju , Rag1 tm1Smoc , Rag1 tm1a(KOMP)Wtsi , and Rag1 tm1e(KOMP)Wtsi In some embodiments, the immunodeficient mouse is Rag1 tm1MomAlleles included. Mouse RAG1 is encoded by the mouse Rag1 gene (Gene ID: 19373). The human orthologue of mouse RAG1 is recombination activating 1 (RAG1).

[0086] Recombination activating gene 2 (Rag2) allele This gene enables several functions, including phosphatidylinositol phosphate-binding activity, phosphatidylinositol-3,4-bisphosphate-binding activity, and zinc ion-binding activity. It is involved in V(D)J recombination and pre-B cell allele exclusion. It acts upstream of or within several processes, including positive regulation of B cell homeostatic proliferation, lymphocyte differentiation, and organ growth. In some embodiments, an endogenous recombination activating gene 2 (Rag2) allele containing a null mutation (Rag2) is expressed. null An immunodeficient mouse model comprising Rag2 is provided herein. null Examples of alleles include: Rag2 tm1Fwa (Shinkai Y, et al., Cell. 1992 Mar 6;68(5):855-67), Rag2 tm1Mnz , Rag2 m1Btlr , Rag2 tm1.1Cgn , Rag2 tm1.1Desi , Rag2 tm1Avla , Rag2 tm1Cgn , Rag2 tm1Mao , Rag1 tm1Libo , and Rag2 tm1Tgi In some embodiments, the immunodeficient mouse is Rag2 tm1Fwa Alleles included. Mouse RAG2 is encoded by the mouse Rag2 gene (Gene ID: 5897). The human orthologue of mouse RAG2 is recombination activating 2 (RAG2).

[0087] MHC class I / class II alleles The major histocompatibility complex (MHC) genomic region contains overlapping genes that express protein molecules responsible for the rejection of transplanted tissues, restricted antigen presentation, and self- and non-self-recognition. The MHC genomic region in mice, located on chromosome 17, is designated H2, and genes within this region are typically classified into three distinct classes (I-III) based on their structure and function. Class I molecules generally elicit immune responses by presenting peptide antigens derived from intracellular proteins to T lymphocytes. Class II molecules play a central role in the selection of the T cell repertoire, the establishment and regulation of adaptive immune responses, and autoimmune deviation.

[0088] In some embodiments, an endogenous histocompatibility 2, K region (H2-K) allele (H2-K) comprising a null mutation is null An immunodeficient mouse model comprising H2-K is provided herein. null Examples of alleles include: H2-K1 tm1Bpe (Perarnau B, et al., Eur J Immunol. 1999 Apr;29(4):1243-52), H2-K bm1 , H2-K bm3 , H2-K bm4 , H2-K bm5 , H2-K bm8 , H2-K bm10 , H2-K bm11 , H2-K bm16 , H2-K bm23 , H2-K bm29 , H2-K dm4 , H2-K dm5 , H2-K em1(HLA-A*0201)Gpt , Tg(GFAP-B2m, GFAP-H2-K b )1Gjh, Tg(H2-K)1Alm, Tg(H2-K b )1Rms, Tg(HLA-A2 / H2-K)1Scr, Tg(HLA-A / H2-K)1Chmb, and Tg(HLA-B / H2-K)1Chmb. In some embodiments, the immunodeficient mouse model comprises an endogenous histocompatibility 2, K1, K region (H2-K1) allele containing a null mutation (H2-K1null In some embodiments, the immunodeficient mouse model comprises H2-K1 tm1Bpe The human orthologue of mouse H2-K1 is major histocompatibility complex, class I, A (HLA-A).

[0089] In some embodiments, an endogenous H2-D allele (H2-D) comprising a null mutation is null An immunodeficient mouse model comprising H2-D is provided herein. null Examples of alleles include: H2-D1 tm1Bpe (Pascolo S, et al., J Exp Med. 1997 Jun 16;185(12):2043-51), H2-D dm1 , Tg(H2-D b )2Bujf, Tg(H2-D d )28Bee, Tg(H2-D d )D8Gja, Tg(H2-D d / H2-L d ) DL1Ul, and Tg(HLA-A24 / H2-D / B2M)3DVs. In some embodiments, the immunodeficient mouse model comprises an endogenous histocompatibility 2, D1, locus 1 (H2-D1) allele containing a null mutation (H2-D1 null In some embodiments, the immunodeficient mouse model comprises H2-D1 tm1Bpe Alleles included. The human orthologue of mouse H2-D1 is major histocompatibility complex, class I, A (HLA-A).

[0090] In some embodiments, an endogenous H2-A allele (H2-A) containing a null mutation is null An immunodeficient mouse model comprising H2-A is provided herein. null Examples of alleles include: H2-Ab1 em1Mvw (Brehm MA, et al., FASEB J. 2019 Mar;33(3):3137-3151), H2-Ab1 bm12 H2-Ab1 em1(HLA-DPB1)Smoc H2-Ab1 em1Dys H2-Ab1 em1GptH2-Ab1 em1Ygch H2-Ab1 em2Gpt H2-Ab1 em2Smoc H2-Ab1 em2Ygch H2-Ab1 em3Smoc H2-Ab1 em4Smoc H2-Ab1 em22Gp; H2-Ab1 tm1,Jssh H2-Ab1 tm1,Koni H2-Ab1 Tm1,1Sish H2-Ab1 tm1Doi H2-Ab1 Tm1Gru H2-Ab1 tmJpl H2-Ab1 Tm1Hpl H2-Ab1 tm1Koni H2-Ab1 tm1Wug H2-Ab1 tm2Hpl ; H2 em1Gpt ; H2 em1Smoc Tg(Ab1TL)1Gru; Tg(CD2-CD4,HLA-DQA1,HLA-DQB1)1Ell; Tg(CD4,HLA-DQA1,HLA-1DQB1)N8Ell; Tg(68-H2-Ab o )#Rhd; Tg(H2-Ab1)62Dim; Tg(H2-Ab1)GBQRhd; Tg(H2-Ea-H2-Ab1)1Pmr; Tg(HLA-DQA1,HLA-DQB1)70Myl; Tg(HLA-DQA1,HLA-DQB1_73Myl, Tg(KRT14-H2-Ab1)1Glm; H2-Ab1 tm1a(EUCOMM)Hmgu H2-Ab1 tm1e(EUCOMM)Hmgu and H2-Ab1 tm2e(EUCOMM)Hmgu In some embodiments, the immunodeficient mouse model is an endogenous H2-Ab1 allele containing a null mutation (H2-Ab1 null In some embodiments, the immunodeficient mouse model comprises H2-Ab1 em1Mvw The human orthologue of mouse H2-Ab1 is major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1).

[0091] In some embodiments, provided herein are immunodeficient mouse models comprising an endogenous mouse H2-K allele comprising a null mutation, an endogenous mouse H2-D allele comprising a null mutation, and an endogenous mouse H2-A allele comprising a null mutation. In some embodiments, the endogenous H2-K1 allele comprising a null mutation is H2-K1 tm1Bpe allele, and endogenous H2-D alleles containing null mutations are H2-D1 tm1Bpe allele, and the endogenous H2-A allele containing a null mutation is H2-Ab1 em1Mvw It is an allele.

[0092] In some embodiments, the immunodeficient mouse model is a NOD.Cg-Prkdc scid H2-K1 tm1Bpe H2-Ab1 em1Mvw H2-D1 tm1Bpe Il2rg tm1Wjl / SzJ background (NSG-MHC I / II DKO; NSG-(K b D b ) null (IA) null ; and NSG-(K b D b ) null (IA null NSG-MHC I / II DKO mutant mice (also known as scid) have a severe combined immunodeficiency mutation, IL2 receptor γ chain deficiency, MHC class I molecule deficiency (H2-K and D), and MHC class II molecule deficiency (IA), and show a significant delay in the onset of GvHD.

[0093] Kit allele This gene (c-Kit proto-oncogene) is the cellular homolog of the transforming gene of feline retrovirus (v-Kit). This protein contains characteristics of a protein kinase transmembrane receptor. In some embodiments, an endogenous KIT proto-oncogene receptor tyrosine kinase (Kit) allele containing a null mutation (Kit nullProvided herein is an immunodeficient mouse model comprising a Kit allele. In some embodiments, the mutation in the Kit allele is a spontaneous mutation. null Examples of alleles include: Kit W-41J (Cosgun et al., Cell Stem Cell, 2014, 15(2): 227-238); Del(5Kit-Cep135)1Utr; In(5)9Rk; In(5)30Rk; In(5)33Rk; Kit W-19H ; Kit W-57J , Kit W-18J , Kit W-sh , Kit W-43J , Kit W-34J , Kit W-55J , Kit W-35J , and Kit W-39J In some embodiments, the immunodeficient mouse is Kit W-41J Alleles included. Mouse KIT is encoded by the mouse Kit gene (Gene ID: 16590). The human orthologue of mouse KIT is the KIT proto-oncogene, receptor tyrosine kinase (KIT).

[0094] Human cytokines The immunodeficient mouse models provided herein, in some embodiments, express several exogenous nucleic acids (e.g., transgenes), each encoding a human cytokine. In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding human interleukin 7 (huIL7). In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding human interleukin 15 (huIL15). In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding human interleukin 3 (huIL3). In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF). In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding human Steel (huSCF). In some embodiments, the immunodeficient mouse model comprises an exogenous nucleic acid encoding huIL1, an exogenous nucleic acid encoding huIL15, an exogenous nucleic acid encoding huIL3, an exogenous nucleic acid encoding huGM-CSF, and an exogenous nucleic acid encoding huSCF. Thus, in some embodiments, cells of the immunodeficient mouse model express huIL1, express huIL15, express huIL3, express huGM-CSF, and express huSCF.

[0095] Human IL-7 In some embodiments, the immunodeficient mice provided herein express human interleukin 7 (huIL7). Interleukin 7 is an important cytokine in B and T cell development. IL7 binds to hepatocyte growth factor to promote B cell precursor growth and stimulate V(D)J rearrangement of the T cell receptor. IL7 also plays a role in lymphoid cell survival and in the maintenance and development of naive and memory T cells.

[0096] The human IL7 sequence can be any human IL7 sequence known in the art (see, e.g., Gene ID: 3574). In some embodiments, the human IL7 sequence is codon-optimized for expression in a non-human host (e.g., an immunodeficient mouse). The human IL7 sequence can be expressed (e.g., in mouse cells) by any of the methods provided herein.

[0097] Human IL15 In some embodiments, the immunodeficient mice provided herein express human interleukin-15 (huIL15). Interleukin-15 binds to the hematopoietin receptor and promotes cell differentiation and CD8 + It is a cytokine that regulates T cell and natural killer cell activation and proliferation by stimulating regulation of T cell numbers.

[0098] The human IL15 sequence can be any human IL15 sequence known in the art (see, e.g., Gene ID: 3600). In some embodiments, the human IL15 sequence is codon-optimized for expression in a non-human host (e.g., an immunodeficient mouse). The human IL15 sequence can be expressed (e.g., in mouse cells) by any of the methods provided herein.

[0099] Human IL3 In some embodiments, the immunodeficient mice provided herein express human interleukin 3 (huIL3). Interleukin 3 is a cytokine that promotes the growth and proliferation of a wide range of hematopoietic cell types, including granulocytes, monocytes, and dendritic cells. IL3 is produced by activated T cells and stimulates the differentiation of immature bone marrow mononuclear cells into macrophage and granulocyte cell populations.

[0100] The human IL3 sequence can be any human IL3 sequence known in the art (see, e.g., Gene ID: 3562). In some embodiments, the human IL3 sequence is codon-optimized for expression in a non-human host (e.g., an immunodeficient mouse). The human IL3 sequence can be expressed (e.g., in mouse cells) by any of the methods provided herein.

[0101] Human GM-CSF In some embodiments, the immunodeficient mice provided herein express human granulocyte-macrophage colony-stimulating factor (huGM-CSF), a cytokine that regulates macrophage and granulocyte differentiation, dendritic cell development, and the maintenance of homeostasis.

[0102] The human GM-CSF sequence can be any human GM-CSF sequence known in the art (see, e.g., Gene ID: 1437). In some embodiments, the human GM-CSF sequence is codon-optimized for expression in a non-human host (e.g., an immunodeficient mouse). The human GM-CSF sequence can be expressed (e.g., in mouse cells) by any of the methods provided herein.

[0103] Human SCF In some embodiments, the immunodeficient mice provided herein express human Steel factor (SCF, SF, or KITLG). SCF, also known as KIT ligand (KITLG), is a ligand for the tyrosine kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, as well as hematopoiesis, all thought to reflect a role in cell migration. In the adult, it functions in multiple ways, but is mostly noted for its continued requirement in hematopoiesis.

[0104] The human SCF sequence can be any human SCF sequence known in the art (see, e.g., Gene ID: 4254). In some embodiments, the human SCF sequence is codon-optimized for expression in a non-human host (e.g., an immunodeficient mouse). The human SCF sequence can be expressed (e.g., in mouse cells) by any of the methods provided herein.

[0105] Exemplary Humanized Immunodeficiency Mouse Models Immunodeficient mice expressing a human IL7 transgene In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises an exogenous nucleic acid encoding human interleukin-7 (huIL7) (e.g., a human IL7 transgene). In some embodiments, the genome of the mouse comprises an endogenous Il2rg allele containing a null mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele comprising a null mutation (Prkdc null In some embodiments, the genetic background of the mouse further comprises NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ. In some embodiments, the immunodeficient mouse model is transplanted with human cells selected from peripheral blood mononuclear cells (PBMCs), hematopoietic stem cells (HSCs), and umbilical cord blood (UCB) cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse is irradiated. In some embodiments, the method of the present disclosure comprises administering human cells to the mouse. In some embodiments, the method further comprises irradiating the mouse prior to transplanting the human cells.

[0106] Immunodeficient mice expressing human IL7 and human IL15 transgenes In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises an exogenous nucleic acid encoding human interleukin-7 (huIL7) (e.g., a huIL7 transgene); and an exogenous nucleic acid encoding human interleukin-15 (huIL15) (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse comprises an endogenous Il2rg allele containing a null mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele comprising a null mutation (Prkdc null In some embodiments, the genetic background of the mouse further comprises NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0107] In some embodiments, the immunodeficient mouse model is transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse is irradiated. In some embodiments, the method of the present disclosure comprises administering human cells to the mouse. In some embodiments, the method further comprises irradiating the mouse prior to transplanting the human cells.

[0108] Immunodeficient mice lacking MHC and expressing a human IL-15 transgene In some embodiments, the genome of the immunodeficient mouse model of the present disclosure contains an endogenous H2-K allele (H2-K) containing a null mutation. null ); endogenous H2-D alleles containing null mutations (H2-D null ); endogenous H2-A allele containing a null mutation (H2-A null and an exogenous nucleic acid encoding huIL15 (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse comprises an endogenous Il2rg allele containing a null mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele comprising a null mutation (Prkdcnull In some embodiments, the genetic background of the mouse further comprises NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0109] In some embodiments, the immunodeficient mouse model is transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse is irradiated. In some embodiments, the method of the present disclosure comprises administering human cells to the mouse. In some embodiments, the method further comprises irradiating the mouse prior to transplanting the human cells.

[0110] Immunodeficient mice lacking MHC and expressing human IL7 and human IL15 transgenes In some embodiments, the genome of the immunodeficient mouse model of the present disclosure contains an endogenous H2-K allele (H2-K) containing a null mutation. null ); endogenous H2-D alleles containing null mutations (H2-D null ); endogenous H2-A allele containing a null mutation (H2-A null an exogenous nucleic acid encoding huIL7 (e.g., a huIL7 transgene); and an exogenous nucleic acid encoding huIL15 (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse contains an endogenous Il2rg allele containing a null mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele comprising a null mutation (Prkdc null In some embodiments, the genetic background of the mouse further comprises NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0111] In some embodiments, the immunodeficient mouse model is transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse is irradiated. In some embodiments, the method of the present disclosure comprises administering human cells to the mouse. In some embodiments, the method further comprises irradiating the mouse prior to transplanting the human cells.

[0112] Immunodeficient mice lacking MHC and expressing human IL3, human GM-CSF, human SCF, and human IL15 transgenes In some embodiments, the genome of the immunodeficient mouse model of the present disclosure contains an endogenous H2-K allele (H2-K) containing a null mutation. null ); endogenous H2-D alleles containing null mutations (H2-D null ); endogenous H2-A allele containing a null mutation (H2-A null an exogenous nucleic acid encoding human interleukin-3 (huIL3); an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF); and an exogenous nucleic acid encoding huSCF; and an exogenous nucleic acid encoding huIL15 (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse contains an endogenous Il2rg allele containing a null mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele comprising a null mutation (Prkdc null In some embodiments, the genetic background of the mouse further comprises NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0113] In some embodiments, the immunodeficient mouse model is transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse is irradiated. In some embodiments, the method of the present disclosure comprises administering human cells to the mouse. In some embodiments, the method further comprises irradiating the mouse prior to transplanting the human cells.

[0114] Immunodeficient mice lacking MHC and expressing human IL3, human GM-CSF, human SCF, and human IL7 transgenes In some embodiments, the genome of the immunodeficient mouse model of the present disclosure contains an endogenous H2-K allele (H2-K) containing a null mutation. null ); endogenous H2-D alleles containing null mutations (H2-D null ); endogenous H2-A allele containing a null mutation (H2-A null an exogenous nucleic acid encoding huIL3; an exogenous nucleic acid encoding huGM-CSF; and an exogenous nucleic acid encoding huSCF; and an exogenous nucleic acid encoding huIL7 (e.g., a huIL7 transgene). In some embodiments, the genome of the mouse contains an endogenous Il2rg allele containing a null mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele comprising a null mutation (Prkdc null In some embodiments, the genetic background of the mouse further comprises NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0115] In some embodiments, the immunodeficient mouse model is transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse is irradiated. In some embodiments, the method of the present disclosure comprises administering human cells to the mouse. In some embodiments, the method further comprises irradiating the mouse prior to transplanting the human cells.

[0116] Immunodeficient mice lacking MHC and expressing human IL3, human GM-CSF, human SCF, human IL7, and human IL15 transgenes In some embodiments, the genome of the immunodeficient mouse model of the present disclosure contains an endogenous H2-K allele (H2-K) containing a null mutation. null ); endogenous H2-D alleles containing null mutations (H2-D null ); endogenous H2-A allele containing a null mutation (H2-A null an exogenous nucleic acid encoding huIL3; an exogenous nucleic acid encoding huGM-CS; and an exogenous nucleic acid encoding huSCF; an exogenous nucleic acid encoding huIL7 (e.g., a huIL7 transgene); and an exogenous nucleic acid encoding huIL15 (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse contains an endogenous Il2rg allele containing a null mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele comprising a null mutation (Prkdc null In some embodiments, the genetic background of the mouse further comprises NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0117] In some embodiments, the immunodeficient mouse model is transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse is irradiated. In some embodiments, the method of the present disclosure comprises administering human cells to the mouse. In some embodiments, the method further comprises irradiating the mouse prior to transplanting the human cells.

[0118] Immunodeficient mice deficient in and expressing human IL3, human GM-CSF, human SCF, and human IL15 transgenes In some embodiments, the genome of the immunodeficient mouse model of the present disclosure comprises an exogenous nucleic acid encoding huIL3; an exogenous nucleic acid encoding huGM-CS; and an exogenous nucleic acid encoding huSCF; and an exogenous nucleic acid encoding huIL15 (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse comprises an endogenous Il2rg allele containing a null mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele comprising a null mutation (Prkdc null In some embodiments, the genetic background of the mouse further comprises NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0119] In some embodiments, the immunodeficient mouse model is transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse is irradiated. In some embodiments, the method of the present disclosure comprises administering human cells to the mouse. In some embodiments, the method further comprises irradiating the mouse prior to transplanting the human cells.

[0120] Immunodeficient mice lacking MHC and Kit and expressing human IL3, human GM-CSF, human SCF, human IL7, and human IL15 transgenes In some embodiments, the genome of the immunodeficient mouse model of the present disclosure contains an endogenous H2-K allele (H2-K) containing a null mutation. null ); endogenous H2-D alleles containing null mutations (H2-D null ); endogenous H2-A allele containing a null mutation (H2-A null ); endogenous H2-D alleles containing null mutations (H2-D null ); endogenous Kit alleles containing null mutations (Kit null an exogenous nucleic acid encoding huIL3; an exogenous nucleic acid encoding huGM-CS; an exogenous nucleic acid encoding huSCF; an exogenous nucleic acid encoding huIL7 (e.g., a huIL7 transgene); and an exogenous nucleic acid encoding huIL15 (e.g., a huIL15 transgene). In some embodiments, the genome of the mouse contains an endogenous Il2rg allele containing a null mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele comprising a null mutation (Prkdc null In some embodiments, the genetic background of the mouse further comprises NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0121] In some embodiments, the immunodeficient mouse model is transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse is irradiated. In some embodiments, the method of the present disclosure comprises administering human cells to the mouse. In some embodiments, the method further comprises irradiating the mouse prior to transplanting the human cells.

[0122] In some embodiments, the humanized immunodeficient mouse model of the present disclosure comprises an endogenous Il2rg allele containing a null mutation (Il2rg null); endogenous H2-K alleles containing null mutations (H2-K null ); endogenous H2-D alleles containing null mutations (H2-D null ); endogenous H2-A allele containing a null mutation (H2-A null ); endogenous Kit alleles containing null mutations (Kit null an exogenous nucleic acid encoding human interleukin-7 (huIL7); an exogenous nucleic acid encoding human interleukin-15 (huIL15); an exogenous nucleic acid encoding human interleukin-3 (huIL3); an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF); and an exogenous nucleic acid encoding human Steel factor (huSCF). In some embodiments, the humanized immunodeficiency mouse model comprises an endogenous Prkdc allele containing a null mutation (Prkdc null In some embodiments, the humanized immunodeficiency mouse model further comprises Il2rg null Homozygous for the allele, Prkdc null Homozygous for the allele and H2-K null Homozygous for the allele, H2-D null Homozygous for the allele, H2-A null Homozygous for the Kit allele null In some embodiments, the humanized immunodeficient mouse is homozygous for the allele. In some embodiments, the humanized immunodeficient mouse has been transplanted with HSCs. In some embodiments, the humanized immunodeficient mouse has been transplanted with PBMCs. In some embodiments, the humanized immunodeficient mouse has been transplanted with human umbilical cord blood cells (e.g., unfractionated human UCB cells).

[0123] In some embodiments, the humanized immunodeficient mouse model of the present disclosure is Il2rg tm1Wjl Allele;Prkdc scid Allele;H2-K1 tm1Bpe Allele;H2-D1 tm1Bpe Allele;H2-Ab1 em1Mvw Allele;Kit W-41JIn some embodiments, the humanized immunodeficiency mouse model comprises an exogenous nucleic acid encoding an Il2rg allele; an exogenous nucleic acid encoding huIL7; an exogenous nucleic acid encoding huIL15, an exogenous nucleic acid encoding huIL3, an exogenous nucleic acid encoding huGM-CSF; and an exogenous nucleic acid encoding huSCF. tm1Wjl Homozygous for the allele; Prkdc scid Homozygous for the allele; H2-K1 tm1Bpe Homozygous for the allele; H2-D1 tm1Bpe Homozygous for the allele; H2-Ab1 em1Mvw Homozygous for the Kit allele W-41J In some embodiments, the humanized immunodeficient mouse is homozygous for the allele. In some embodiments, the humanized immunodeficient mouse has been transplanted with HSCs. In some embodiments, the humanized immunodeficient mouse has been transplanted with PBMCs. In some embodiments, the humanized immunodeficient mouse has been transplanted with human umbilical cord blood cells (e.g., unfractionated human UCB cells).

[0124] In some embodiments, the humanized immunodeficient mouse model of the present disclosure is Il2rg tm1Sug Allele; Prkdc scid Allele; H2-K1 tm1Bpe Allele; H2-D1 tm1Bpe Allele; H2-Ab1 em1Mvw Allele; Kit W-41J allele; an exogenous nucleic acid encoding huIL7; an exogenous nucleic acid encoding huIL15, an exogenous nucleic acid encoding huIL3, an exogenous nucleic acid encoding huGM-CSF; and an exogenous nucleic acid encoding huSCF. In some embodiments, the humanized immunodeficiency mouse model comprises an Il2rg allele. tm1Sug Homozygous for the allele; Prkdc scid Homozygous for the allele; H2-K1 tm1Bpe Homozygous for the allele; H2-D1 tm1Bpe Homozygous for the allele; H2-Ab1 em1Mvw Homozygous for the Kit allele W-41JIn some embodiments, the humanized immunodeficient mouse is homozygous for the allele. In some embodiments, the humanized immunodeficient mouse has been transplanted with HSCs. In some embodiments, the humanized immunodeficient mouse has been transplanted with PBMCs. In some embodiments, the humanized immunodeficient mouse has been transplanted with human umbilical cord blood cells.

[0125] Immunodeficient mice lacking Kit and expressing human IL3, human GM-CSF, and human SCF transgenes In some embodiments, the genome of the immunodeficient mouse model of the present disclosure contains an endogenous Kit allele (Kit) containing a null mutation. null an exogenous nucleic acid encoding huIL3; an exogenous nucleic acid encoding huGM-CS; and an exogenous nucleic acid encoding huSCF. In some embodiments, the genome of the mouse contains an endogenous Il2rg allele containing a null mutation (Il2rg null In some embodiments, the genome of the mouse further comprises an endogenous Prkdc allele comprising a null mutation (Prkdc null In some embodiments, the genetic background of the mouse further comprises NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ.

[0126] In some embodiments, the immunodeficient mouse model is transplanted with human cells selected from PBMCs, HSCs, and UCB cells (e.g., unfractionated human UCB cells). In some embodiments, the mouse is irradiated. In some embodiments, the method of the present disclosure comprises administering the human cells to the mouse. In some embodiments, the method further comprises irradiating the mouse prior to transplanting the human cells.

[0127] human cells A "humanized" mouse is an immunodeficient mouse that has been transplanted with human cells. "Transplantation" refers to the process of migrating and incorporating the human cells into an existing tissue of interest in vivo. The transplanted human cells repopulate the immunodeficient mouse with a functional human immune system. Most frequently, the human cells (e.g., hematopoietic stem cells (HSCs) or peripheral blood mononuclear cells (PBMCs)) are "fractionated" or "isolated"—separated (e.g., by centrifugation)—from other cell types and intracellular components—before using them for humanization. Fractionation involves processing a human cell population to enrich for a population with one or more specific cell types. This process involves depleting the population of one or more specific cell types. The fractionated human HSC and PBMC populations develop into various human immune cell types. HSCs develop into dendritic cells, lymphoid cells (including T cells, natural killer cells, and B cells), and myeloid cells (including macrophages, granulocytes, platelets, and erythrocytes) through a process called hematopoiesis. PMBCs develop primarily into lymphocytes. In some embodiments, human HSCs are administered to the immunodeficient mouse models provided herein to humanize the mouse model. In some embodiments, human PBMCs are administered to the immunodeficient mouse models provided herein to humanize the mouse model.

[0128] Human HSCs and human PBMCs are often obtained from human umbilical cord blood. Typically, human umbilical cord blood is fractionated to separate HSCs and / or PBMCs from other cell types and intracellular components. Blood fractionation results in the removal of more mature immune cells (e.g., T cells) that contribute to graft-versus-host response. However, fractionation requires additional time, effort, and cost for preclinical evaluation, and may damage the cells. This may reduce the survival and proliferation rate of human immune cell populations, thereby impairing the successful transplantation of the immunodeficient mice.

[0129] Surprisingly, the inventors have found that fractionation of human umbilical cord blood is not necessary when using the immunodeficient mouse models provided herein. In some embodiments, unfractionated human umbilical cord blood can be administered to immunodeficient mice to promote engraftment of the human immune system. Due to the unique combination of alleles used to generate the immunodeficient mouse models provided herein, unfractionated human umbilical cord blood can be used without inducing a graft-versus-host reaction in the mice, and in some embodiments, without conditioning the mice. "Unfractionated human umbilical cord blood" refers to unfractionated human umbilical cord blood, and thus contains mature HLA-restricted T cells.

[0130] Thus, in some embodiments, the immunodeficient mouse is not "conditioned" prior to transplantation of the human cells, e.g., prior to administration (e.g., injection) of the human cells. Conditioning refers to a group of treatments used to suppress the immune system and eliminate the stem cell niche prior to human cell transplantation. Conditioning typically includes myeloablative techniques (e.g., radiation and myeloablative chemotherapy (e.g., busulfan (1,4-butanediol dimethanesulfonate))). Thus, in some embodiments, the humanized immunodeficient mouse model provided herein is not conditioned. In some embodiments, the method of generating the humanized immunodeficient mouse model does not include a conditioning step.

[0131] In some embodiments, the length of time that an immunodeficient mouse provided herein supports engraftment of human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) is extended by at least 25% relative to a control mouse. For example, the length of time that an immunodeficient mouse provided herein supports engraftment of human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) can be extended by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% relative to a control mouse. In some embodiments, the length of time that an immunodeficient mouse provided herein supports engraftment of human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) is extended by 25% to 100%, 25% to 75%, 25% to 50%, 50% to 100%, 50% to 75%, or 75% to 100% relative to a control mouse.

[0132] In some embodiments, the number of transplanted human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) is increased by at least 25% in the immunodeficient mice provided herein relative to control mice. For example, the number of transplanted human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) can be increased by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% in the immunodeficient mice provided herein relative to control mice. In some embodiments, the number of transplanted human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) is increased by 25% to 100%, 25% to 75%, 25% to 50%, 50% to 100%, 50% to 75%, or 75% to 100% in the immunodeficient mice provided herein relative to control mice.

[0133] In some embodiments, the rate of cell death of transplanted human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) in the immunodeficient mice provided herein is reduced by at least 25%. For example, the rate of cell death of transplanted human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) in the immunodeficient mice provided herein is reduced by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% relative to control mice. In some embodiments, the rate of cell death of transplanted human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) in the immunodeficient mice provided herein is reduced by 25% to 100%, 25% to 75%, 25% to 50%, 50% to 100%, 50% to 75%, or 75% to 100% relative to control mice.

[0134] In some embodiments, the rate of cell proliferation of transplanted human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) in an immunodeficient mouse provided herein is increased by at least 25%. For example, the rate of cell proliferation of transplanted human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) in an immunodeficient mouse provided herein is increased by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% relative to a control mouse. In some embodiments, the rate of cell proliferation of transplanted human immune cells (e.g., human T cells, human NK cells, and / or human myeloid cells) in the immunodeficient mice provided herein is increased by 25% to 100%, 25% to 75%, 25% to 50%, 50% to 100%, 50% to 75%, or 75% to 100% relative to control mice.

[0135] The control mouse can be, for example, a mouse that is not immunodeficient and / or is not humanized. In some embodiments, the control mouse is a NOD scid γ mouse (NSG (登録商標) mouse).

[0136] Methods for injecting human cells into immunodeficient mice to generate humanized mouse models include, but are not limited to, intraperitoneal or intravenous injection (Shultz et al., J Immunol, 2015, 174:6477-6489; Pearson et al., Curr Protoc Immunol. 2008; 15-21; Kim et al., AIDS Res Hum Retrovirus, 2016, 32(2): 194-2020; Yaguchi et al., Cell & Mol Immunol, 2018, 15:953-962). In some embodiments, the mice are injected into the facial vein, heart, or liver.

[0137] In some embodiments, the mice are about 1 x 10 4 ~approx. 1x10 10 For example, the mouse is injected with approximately 1 x 10 human cells. 4 ~approx. 1x10 9 , approximately 1x10 4 ~approx. 1x10 8 , approximately 1x10 4 ~approx. 1x10 7 , approximately 1x10 4 ~approx. 1x10 6 , approximately 1x10 4 ~approx. 1x10 5 , approximately 1x10 5 ~approx. 1x10 10 , approximately 1x10 5 ~approx. 1x10 9 , approximately 1x10 5 ~approx. 1x10 8 , approximately 1x10 5 ~approx. 1x10 7 , approximately 1x10 5 ~approx. 1x10 6 , approximately 1x10 6 ~approx. 1x10 10 , approximately 1x10 6 ~approx. 1x10 9 , approximately 1x10 6 ~approx. 1x10 8 , or about 1x10 6 ~approx. 1x10 7 In some embodiments, the mice are injected with approximately 1 x 10 human cells. 4 , approximately 1x10 5 , approximately 1x10 6 , approximately 1x10 7 , approximately 1x10 8 , approximately 1x10 9 , approximately 1x10 10 They are injected with human cells.

[0138] In some embodiments, the human cells are formulated in a solution (e.g., a buffered solution). In some embodiments, the solution has a volume of about 50 μl to about 250 μl. For example, the solution may have a volume of about 50 μl, 60 μl, 70 μl, 80 μl, 90 μl, 100 μl, 110 μl, 120 μl, 130 μl, 140 μl, 150 μl, 160 μl, 170 μl, 180 μl, 190 μl, 200 μl, 210 μl, 220 μl, 230 μl, 240 μl, or 250 μl.

[0139] In some embodiments, the mouse is injected with about 50 μl to about 250 μl of human cord blood. For example, the solution may have a volume of about 50 μl, 60 μl, 70 μl, 80 μl, 90 μl, 100 μl, 110 μl, 120 μl, 130 μl, 140 μl, 150 μl, 160 μl, 170 μl, 180 μl, 190 μl, 200 μl, 210 μl, 220 μl, 230 μl, 240 μl, or 250 μl of human cord blood.

[0140] Nucleic Acids: Manipulation and Delivery The nucleic acids provided herein are, in some embodiments, engineered (e.g., exogenous). Engineered nucleic acids are nucleic acids that do not occur in nature (e.g., at least two nucleotides covalently linked together and, in some cases, containing a phosphodiester bond, also referred to as a phosphodiester backbone). Engineered nucleic acids include recombinant nucleic acids and synthetic nucleic acids. Recombinant nucleic acids are molecules constructed by joining nucleic acids (e.g., isolated nucleic acids, synthetic nucleic acids, or a combination thereof) from two different organisms (e.g., human and mouse). Synthetic nucleic acids are molecules that are amplified or synthesized chemically or by other means. Synthetic nucleic acids include those that have been chemically or otherwise modified but are capable of base pairing (binding) with naturally occurring nucleic acid molecules. Recombinant and synthetic nucleic acids also include those molecules that result from replication of any of the foregoing.

[0141] Engineered nucleic acids can include DNA (e.g., genomic DNA, cDNA, or a combination of genomic DNA and cDNA), RNA, or hybrid molecules, for example, where the nucleic acid includes any combination of deoxyribonucleotides and ribonucleotides (e.g., artificial or natural), and any combination of two or more bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine.

[0142] In some embodiments, the nucleic acid is complementary DNA (cDNA), which is synthesized from a single-stranded RNA (e.g., messenger RNA (mRNA) or microRNA (miRNA)) template in a reaction catalyzed by reverse transcriptase.

[0143] The engineered (e.g., exogenous) nucleic acids of the present disclosure can be generated using standard molecular biology methods (see, e.g., Green and Sambrook, Molecular Cloning, A Laboratory Manual, 2012, Cold Spring Harbor Press). In some embodiments, the nucleic acids are generated using GIBSON ASSEMBLY® Cloning (see, e.g., Gibson, DG et al. Nature Methods, 343-345, 2009; and Gibson, DG et al. Nature Methods, 901-903, 2010, each of which is incorporated herein by reference). GIBSON ASSEMBLY® typically uses three enzyme activities in a single test-tube reaction: a 5' exonuclease, a 3' extension activity of a DNA polymerase, and a DNA ligase activity. The 5' exonuclease activity partially digests the 5' terminal sequence, exposing complementary sequences for annealing. Polymerase activity then fills in the gaps in the annealed domains. DNA ligase then seals the nicks and covalently links the DNA fragments together. The overlapping sequences of adjacent fragments are much longer than those used in Golden Gate Assembly, resulting in a higher percentage of accurate assembly. Other methods of generating engineered nucleic acids can be used in accordance with the present disclosure.

[0144] A gene is a distinct sequence of nucleotides, the order of which determines the order of monomers in a polynucleotide or polypeptide. Genes typically encode proteins. Genes can be endogenous (naturally occurring in a host organism) or exogenous (transferred into a host organism, naturally or via genetic engineering). An allele arises by mutation and is one of two or more alternative forms of a gene found at the same locus on a chromosome. In some embodiments, a gene comprises a promoter sequence, a coding region (e.g., exon), a non-coding region (e.g., intron), and a regulatory region (also referred to as a regulatory sequence).

[0145] A mouse containing a human gene is considered to contain a human transgene. A transgene is a gene that is exogenous to the host organism. That is, a transgene is a gene that has been transferred into the host organism, either naturally or through genetic engineering. The transgene does not naturally occur in the host organism (the organism containing the transgene, e.g., a mouse).

[0146] A promoter is a nucleotide sequence to which RNA polymerase binds to the initial transcript (e.g., ATG). A promoter is typically located immediately upstream (at the 5' end) of the transcription start site. In some embodiments, the promoter is an endogenous promoter. An endogenous promoter is a promoter that naturally occurs in the host animal.

[0147] An open reading frame is a contiguous stretch of codons that begins with a start codon (e.g., ATG) and ends with a stop codon (e.g., TAA, TAG, or TGA) and encodes a polypeptide, e.g., a protein. An open reading frame is operably linked to a promoter if the promoter controls transcription of the open reading frame.

[0148] Exons are regions of a gene that code for amino acids. Introns (and other non-coding DNA) are regions of a gene that do not code for amino acids.

[0149] In some embodiments, the nucleotide sequence encoding the product (e.g., a protein) has a length of 200 base pairs (bp) to 100 kilobases (kb). In some embodiments, the nucleotide sequence has a length of at least 10 kb. For example, the nucleotide sequence may have a length of at least 15 kb, at least 20 kb, at least 25 kb, at least 30 kb, or at least 35 kb. In some embodiments, the nucleotide sequence has a length of 10 to 100 kb, 10 to 75 kb, 10 to 50 kb, 10 to 30 kb, 20 to 100 kb, 20 to 75 kb, 20 to 50 kb, 20 to 30 kb, 30 to 100 kb, 30 to 75 kb, or 30 to 50 kb.

[0150] Any one of the nucleic acids provided herein can have a length of 200 bp to 500 kb, 200 bp to 250 kb, or 200 bp to 100 kb. In some embodiments, the nucleic acid has a length of at least 10 kb. For example, the nucleic acid can have a length of at least 15 kb, at least 20 kb, at least 25 kb, at least 30 kb, at least 35 kb, at least 50 kb, at least 100 kb, at least 200 kb, at least 300 kb, at least 400 kb, or at least 500 kb. In some embodiments, the nucleic acid has a length of 10 to 500 kb, 20 to 400 kb, 10 to 300 kb, 10 to 200 kb, or 10 to 100 kb. In some embodiments, the nucleic acid has a length of 10 to 100 kb, 10 to 75 kb, 10 to 50 kb, 10 to 30 kb, 20 to 100 kb, 20 to 75 kb, 20 to 50 kb, 20 to 30 kb, 30 to 100 kb, 30 to 75 kb, or 30 to 50 kb. The nucleic acid may be circular or linear.

[0151] The nucleic acids described herein include, in some embodiments, modifications. A modification, with respect to a nucleic acid, is any manipulation of the nucleic acid relative to its corresponding wild-type nucleic acid (e.g., a naturally occurring nucleic acid). A genomic modification, therefore, is any manipulation of a nucleic acid in a genome (e.g., in a coding region, non-coding region, and / or regulatory region) relative to its corresponding wild-type nucleic acid (e.g., a naturally occurring (unmodified) nucleic acid). Non-limiting examples of nucleic acid (e.g., genomic) modifications include deletions, insertions, "indels" (deletions and insertions), and substitutions (e.g., point mutations). In some embodiments, deletions, insertions, indels, or other modifications in a gene result in a frameshift mutation such that the gene no longer encodes a functional product (e.g., a protein). Modifications also include chemical modifications, such as chemical modifications of at least one nucleic acid base. Methods of nucleic acid modification, e.g., those that result in gene inactivation, are known and include, but are not limited to, RNA interference, chemical modification, and gene editing (e.g., using recombinases or other programmable nuclease systems, e.g., CRISPR / Cas, TALENs, and / or ZFNs).

[0152] Null mutations, as known in the art, result in a gene product that has little or no function. Null mutations result in a gene product that has no detectable / measurable function.

[0153] A nucleic acid (e.g., an allele or alleles of a gene) can be modified so that it does not produce detectable levels of a functional gene product (e.g., a functional protein). Thus, a null allele is an allele that does not produce detectable levels of a functional gene product (e.g., a functional protein). A detectable level of protein is any level of protein that is detected using a standard protein detection assay (e.g., flow cytometry and / or ELISA). In some embodiments, the null allele is not transcribed. In some embodiments, the null allele does not encode a functional protein.

[0154] Vectors used for nucleic acid delivery include minicircles, plasmids, bacterial artificial chromosomes (BACs), and yeast artificial chromosomes. However, it should be understood that a vector may not be required. For example, circularized or linearized nucleic acids can be delivered to embryos without their vector backbones. While vector backbones are small (approximately 4 kb), the donor DNA to be circularized can range, for example, from >100 bp to 50 kb.

[0155] Methods for delivering nucleic acids into mouse embryos (e.g., mice) for the generation of transgenic mice include electroporation (see, e.g., Wang W et al. J Genet Genomics 2016;43(5):319-27; WO 2016 / 054032; and WO 2017 / 124086, each of which is incorporated by reference herein), DNA microinjection (see, e.g., Gordon and Ruddle, Science 1981: 214: 1244-124, incorporated by reference herein), embryonic stem cell-mediated gene transfer (see, e.g., Gossler et al., Proc. Natl. Acad. Sci. 1986; 83: 9065-9069, incorporated by reference herein), and retrovirus-mediated gene transfer (see, e.g., Jaenisch, Proc. Natl. Acad. Sci. 1976; 73: 1260-1264 (hereby incorporated by reference), any of which may be used as provided herein.

[0156] Genome editing The present application contemplates the use of various gene editing techniques using engineered nucleic acids, for example, to knock out target endogenous genes (e.g., Il2rg, Prkdc, H2-K, H2-D, H2-A, and / or Kit) or to introduce nucleic acids into the genome of a mouse (e.g., to generate transgenic mice expressing human IL7, human IL15, human IL3, human GM-CSF, and / or human SCF). The immunodeficient mice described herein can be generated by any gene editing technique known in the art.

[0157] Genome editing The engineered nucleic acids (e.g., guide RNAs, donor polynucleotides, and other nucleic acid coding sequences) can be introduced into the genome of an embryo or cell (e.g., stem cells) using any suitable method, for example. The present application contemplates the use of various gene editing techniques, for example, to delete a nucleic acid sequence from the genome of an embryo or cell, or to introduce a nucleic acid into the genome of a cell or embryo to generate a knockout mouse, or to generate a transgenic mouse. Non-limiting examples include programmable nuclease-based systems, such as clustered regularly interspaced short palindromic repeats (CRISPR) systems, zinc finger nucleases (ZFNs), and transcription activator-like effector nucleases (TALENs). See, e.g., Carroll D Genetics. 2011; 188(4): 773-782; Joung JK et al. Nat Rev Mol Cell Biol. 2013; 14(1): 49-55; and Gaj T et al. Trends Biotechnol. 2013 Jul; 31(7): 397-405, each of which is incorporated herein by reference.

[0158] In some embodiments, CRISPR system is used to edit the genome of mouse (e.g., mouse) embryos provided herein.See, for example, Harms DW et al., Curr Protoc Hum Genet. 2014;83:15.7.1-15.7.27; and Inui M et al., Sci Rep. 2014;4:5396 (each of which is incorporated herein by reference).For example, Cas9 mRNA or protein, one or more guide RNAs (gRNAs) and / or donor nucleic acid can be directly delivered (e.g., injected or electroporated) into mouse embryos at one cell (zygote) stage or later stage to promote homology-directed repair (HDR), for example, to delete nucleic acid sequences from genome or to introduce engineered nucleic acid (e.g., donor nucleic acid) into genome.

[0159] The CRISPR / Cas system is a naturally occurring defense mechanism in prokaryotes that has been repurposed as an RNA-guided DNA targeting platform for gene editing. Engineered CRISPR systems contain two main components: a guide RNA (gRNA) and a CRISPR-associated endonuclease (e.g., a Cas protein). The gRNA is a short synthetic RNA composed of a scaffold sequence for nuclease binding and a user-defined nucleotide spacer (e.g., about 15-25 nucleotides, or about 20 nucleotides) that defines the genomic target (e.g., gene) to be modified. Thus, the genomic target of the Cas protein can be altered simply by changing the target sequence present in the gRNA. In some embodiments, the Cas9 endonuclease is derived from Streptococcus pyogenes (NGG PAM) or Staphylococcus aureus (NNGRRT or NNGRR(N) PAM), although other Cas9 homologs, orthologs, and / or variants (e.g., evolved versions of Cas9) may also be used, as provided herein. Further non-limiting examples of RNA-guided nucleases that can be used as provided herein include Cpf1 (TTN PAM); SpCas9 D1135E variant (NGG (reduced NAG binding) PAM); SpCas9 VRER variant (NGCG PAM); SpCas9 EQR variant (NGAG PAM); SpCas9 VQR variant (NGAN or NGNG PAM); Neisseria meningitidis (NM) Cas9 (NNNNGATT PAM); Streptococcus thermophilus (ST) Cas9 (NNAGAAW PAM); and Treponema denticola (TD) Cas9 (NAAAAC). In some embodiments, the CRISPR-associated endonuclease is selected from Cas9, Cpf1, C2c1, and C2c3. In some embodiments, the Cas nuclease is Cas9.

[0160] Guide RNA comprises at least the spacer sequence that hybridizes (binds) with target nucleic acid sequence and the CRISPR repeat sequence that binds endonuclease and guides this endonuclease to target nucleic acid sequence.As understood by those skilled in the art, each gRNA is designed to comprise the spacer sequence that is complementary to its genome target sequence.See, for example, Jinek et al., Science, 2012; 337: 816-821 and Deltcheva et al., Nature, 2011; 471: 602-607 (each of which is incorporated herein by reference).

[0161] In some embodiments, the RNA-guided nuclease and gRNA are complexed to form a ribonucleoprotein (RNP) prior to delivery to the embryo.

[0162] The concentration of the RNA-guided nuclease or the nucleic acid encoding the RNA-guided nuclease can vary. In some embodiments, the concentration is 100 ng / μl to 1000 ng / μl. For example, the concentration can be 100 ng / μl, 150 ng / μl, 200 ng / μl, 250 ng / μl, 300 ng / μl, 350 ng / μl, 400 ng / μl, 450 ng / μl, 500 ng / μl, 550 ng / μl, 600 ng / μl, 650 ng / μl, 700 ng / μl, 750 ng / μl, 800 ng / μl, 850 ng / μl, 900 ng / μl, 950 ng / μl, or 1000 ng / μl. In some embodiments, the concentration is between 100 ng / μl and 500 ng / μl, or between 200 ng / μl and 500 ng / μl.

[0163] The concentration of gRNA can also be varied. In some embodiments, the concentration is 200 ng / μl to 2000 ng / μl. For example, the concentration can be 200 ng / μl, 300 ng / μl, 400 ng / μl, 500 ng / μl, 600 ng / μl, 700 ng / μl, 800 ng / μl, 900 ng / μl, 1000 ng / μl, 1100 ng / μl, 1200 ng / μl, 1300 ng / μl, 1400 ng / μl, 1500 ng / μl, 1600 ng / μl, 1700 ng / μl, 1700 ng / μl, 1900 ng / μl, or 2000 ng / μl. In some embodiments, the concentration is 500 ng / μl to 1000 ng / μl. In some embodiments, the concentration is 100 ng / μl to 1000 ng / μl, for example, 100 ng / μl, 150 ng / μl, 200 ng / μl, 250 ng / μl, 300 ng / μl, 350 ng / μl, 400 ng / μl, 450 ng / μl, 500 ng / μl, 550 ng / μl, 600 ng / μl, 650 ng / μl, 700 ng / μl, 750 ng / μl, 800 ng / μl, 850 ng / μl, 900 ng / μl, 950 ng / μl, or 1000 ng / μl.

[0164] In some embodiments, the ratio of the concentration of the RNA-guided nuclease or nucleic acid encoding the RNA-guided nuclease to the concentration of the gRNA is 2: 1. In other embodiments, the ratio of the concentration of the RNA-guided nuclease or nucleic acid encoding the RNA-guided nuclease to the concentration of the gRNA is 1:1.

[0165] Donor nucleic acid typically comprises a sequence of interest flanked by homology arms. Homology arms are regions of ssDNA that are homologous to the region of genomic DNA located at a genomic locus. One homology arm (left homology arm) is located on the left (5') side of the genomic region of interest (into which the sequence of interest is introduced), and the other homology arm (right homology arm) is located on the right (3') side of the genomic region of interest. These homology arms allow homologous recombination between the ssDNA donor and the genomic locus, resulting in the insertion of the sequence of interest into the genomic locus of interest (for example, via CRISPR / Cas9-mediated homology-directed repair (HDR)).

[0166] The homology arms can vary in length. For example, each homology arm (left homology arm and right homology arm) can have a length of 20 to 1000 nucleotide bases. In some embodiments, each homology arm has a length of 20 to 200 nucleotide bases, 20 to 300 nucleotide bases, 20 to 400 nucleotide bases, 20 to 500 nucleotide bases, 20 to 600 nucleotide bases, 20 to 700 nucleotide bases, 20 to 800 nucleotide bases, or 20 to 900 nucleotide bases. In some embodiments, each homology arm has a length of 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotide bases. In some embodiments, the length of one homology arm is different from the length of the other homology arm. For example, one homology arm may have a length of 20 nucleotide bases, and the other homology arm may have a length of 50 nucleotide bases. In some embodiments, the donor DNA is single-stranded. In some embodiments, the donor DNA is double-stranded. In some embodiments, the donor DNA is modified, for example, via phosphorothioation. Other modifications may also be made.

[0167] How to use A significant barrier to translating human cell therapies into the clinic is the need for robust preclinical animal models to evaluate the efficacy, safety, and importantly, immunogenicity of human cell therapies (e.g., human stem cell- and immune cell-based therapies). Because cell therapy products are of human origin, it has been difficult to support these products in vivo using other species due to strong xenograft responses. One approach to evaluating cell therapy products without endangering patients is to use humanized mice—immunocompromised mice transplanted with functional human cells, tissues, and immune systems. Humanized mice may provide a critically needed preclinical bridge for evaluating the safety, efficacy, and immunogenicity of human stem cell-derived cell products.

[0168] Thus, in some embodiments, the humanized immunodeficient mouse model of the present disclosure can be used to evaluate the clinical efficacy of cell therapy products. Non-limiting examples of cell therapy products include cellular immunotherapeutics, cancer vaccines, and other types of both autologous and allogeneic cells for certain therapeutic indications, including hematopoietic stem cells and adult and embryonic stem cells. Cell therapy refers to the transfer of autologous or allogeneic cellular material into patients for medical purposes. The mouse model provided herein, which aims to reproduce the human immune system, can be used to evaluate such cell therapies.

[0169] Thus, in some embodiments, the methods provided herein include administering a cell therapy product to a humanized immunodeficient mouse described herein.

[0170] In some embodiments, the humanized immunodeficient mouse has been transplanted with HSCs, PBMCs, or human umbilical cord blood cells.

[0171] The method may further include evaluating one or more clinically relevant characteristics of the cell therapy product or one or more clinically relevant effects on the transplanted human immune system. Clinically relevant characteristics may include, for example, slowing tumor growth or resolution of infection.

[0172] In some embodiments, the cell therapy product is designed to treat cancer (e.g., alleviate one or more symptoms of cancer). Non-limiting examples of human cancers include: adenoid cystic carcinoma, adrenal tumor, amyloidosis, anal cancer, appendix cancer, astrocytoma, ataxia-telegiectasia, Beckwith-Wiedemann syndrome, cholangiocarcinoma, Birt-Hogg-Dubé syndrome, bladder cancer, bone cancer, brainstem glioma, brain cancer, breast cancer, Carney complex, cervical cancer, colorectal cancer, Cowden syndrome, craniopharyngioma, desmoid tumor, desmoplastic infantile ganglioglioma, ependymoma, esophageal cancer, uterine cancer, and thyroid cancer. Ing's sarcoma, eye cancer, eyelid cancer, familial adenomatous polyposis, familial GIST, familial malignant melanoma, familial pancreatic cancer, gallbladder cancer, gastrointestinal stromal tumor (GIST), germ cell tumors, gestational trophoblastic disease, head and neck cancer, hereditary breast cancer and ovarian cancer, hereditary diffuse gastric cancer, hereditary leiomyomatosis, renal cell carcinoma, hereditary mixed polyposis syndrome, hereditary pancreatitis, hereditary papillary renal cell carcinoma, HIV / AIDS-related cancer, juvenile polyposis syndrome, kidney cancer, tears Adenocarcinoma, laryngeal and hypopharyngeal cancer, leukemia, Li-Fraumeni syndrome, liver cancer, lung cancer, lymphoma, Lynch syndrome, mastocytosis, medullablastoma, melanoma, meningioma, mesothelioma, multiple endocrine neoplasia type 1, multiple endocrine neoplasia type 2, multiple myeloma, MUTYH-associated polyposis, myelodysplastic syndrome, cancer of the nasal cavity and paranasal sinuses, nasopharyngeal cancer, neuroblastoma, neuroendocrine tumors of the gastrointestinal tract, neuroendocrine tumors of the lung, neuroendocrine tumors of the pancreas Tumors, neurofibromatosis type 1, neurofibromatosis type 2, nevoid basal cell carcinoma syndrome, oral cavity and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, Peutz-Jeghers syndrome, pheochromocytoma and paraganglioma, pituitary tumors, pleuropulmonary blastoma, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, non-melanoma skin cancer, small intestine cancer, gastric cancer, testicular cancer, thymoma and thymic carcinoma, thyroid cancer, tuberous sclerosis complex, uterine cancer, vaginal cancer, von Hippel-Lindau syndrome, vulvar cancer, Waldenstrom macroglobulinemia, Werner syndrome, Wilms' tumor, and xeroderma pigmentosum.

[0173] In some embodiments, the cell therapy product is designed to treat an autoimmune disease.

[0174] In some embodiments, the cell therapy product is designed to treat a genetic disorder.

[0175] There are several types of cell therapy products that can be tested using the humanized immunodeficient mouse model of the present disclosure. In some embodiments, the cell therapy product is a stem cell-based cell therapy product. In some embodiments, the cell therapy product is a non-stem cell-based cell therapy product. In some embodiments, the cell therapy product is an adoptive cell therapy (ACT) product. In some embodiments, the cell therapy product is a scaffold-based or scaffold-free cell therapy product. In some embodiments, the cell therapy product is a bone marrow aspirate (BMA)-derived cell therapy product. The present disclosure also contemplates testing cell-free therapies, e.g., with multicellular components. See, e.g., El-Hakim El-Kadiry A et al., Front. Med., 22 November 2021 Sec. Gene and Cell Therapy (incorporated herein by reference).

[0176] In some embodiments, the humanized immunodeficient mouse model of the present disclosure can be used to study diseases associated with the human immune system. Diseases associated with the human immune system are diseases or disorders whose pathophysiology is attributable, at least in part, to or influenced by human immune cells. Non-limiting examples of diseases associated with the human immune system that can be studied with the humanized immunodeficient mouse model provided herein include muscle disorders (e.g., muscular dystrophy, myopathy, etc.), autoimmune disorders (e.g., rheumatoid arthritis, Crohn's disease, ulcerative colitis, lupus, or any other autoimmune disease or disorder provided herein), cancer (e.g., melanoma, leukemia, lymphoma, or any other cancer provided herein), and metabolic disorders (e.g., diabetes, obesity, etc.). In some embodiments, studying diseases associated with the human immune system can include administering potential treatments for the disease to the humanized immunodeficient mouse model and characterizing the effects of the potential treatments. The potential treatment can be a cell therapy product, a protein (e.g., an antibody, a peptide, etc.), a small molecule, or any other potential treatment known in the art. Characterization of the effect of the potential treatment can be, for example, measuring the level of a protein associated with the disease (e.g., an adult marker) in a sample from the mouse, imaging the mouse to study disease progression, measuring survival after the potential treatment, or any other method of characterizing a disease known in the art.

[0177] In some embodiments, the humanized immunodeficient mouse model of the present disclosure can be used to study muscular dystrophy. Muscular dystrophy is a genetic disease characterized by muscle weakness and wasting, with or without nerve involvement. Non-limiting examples of muscular dystrophies include Becker, congenital, Duchenne, distal, Emery-Dreifuss, facioscapulohumeral (FSHD), limb-girdle, myotonic, and oculopharyngeal. In some embodiments, the humanized immunodeficient mouse model of the present disclosure can be used to study FSHD muscular dystrophy.

[0178] Treatment Modalities Therapeutic modalities are different approaches and strategies used in the treatment of various diseases and health conditions in a subject. As used herein, the terms "subject," "patient," and "individual" are used interchangeably. In some embodiments, the subject is a human subject. Other animal subjects are also contemplated herein. Some of the most common therapeutic modalities include pharmacotherapy, which involves the use of drugs to treat disease and manage symptoms. Other therapeutic modalities include gene therapy and immunotherapy, which use genetic manipulation and the immune system, respectively, to treat diseases such as cancer and genetic disorders. There are many therapeutic modalities available, and the choice of treatment depends on the patient's condition, medical history, and the expertise of the healthcare provider.

[0179] In some embodiments, the therapeutic modality is a targeted therapeutic agent. Targeted therapy is a type of treatment that uses drugs or other substances to identify and attack cells more precisely than standard therapy. For example, unlike chemotherapy, which can affect both cancer cells and healthy cells, targeted therapy is designed to interfere with specific molecules or pathways involved in cancer cell growth and survival. Targeted therapy is based on the principle that diseased cells often have certain genetic or molecular abnormalities that distinguish them from normal cells. By targeting these specific abnormalities, targeted therapy can be more effective and less toxic than traditional treatments such as chemotherapy. Non-limiting examples of targeted therapy include drugs that block the activity of specific enzymes or growth factor receptors, and immunotherapy, which stimulates the immune system to recognize and attack diseased cells.

[0180] In some embodiments, the mouse models provided herein are used to test the efficacy of therapeutic modalities. Non-limiting examples of therapeutic modalities that can be used as provided herein include antibodies, small molecule drugs, gene therapy, cell therapy, vaccines, hormones, enzyme replacement therapy, and nucleic acid-based therapy.

[0181] Antibodies are proteins produced by the immune system that can specifically recognize and bind to foreign substances (e.g., viruses and bacteria), neutralizing and helping to eliminate them from the body. Antibodies can also be designed and generated in laboratories and used as therapeutic agents to target specific proteins or cells in the body. Therapeutic antibodies used herein can be full-length antibodies or antibody fragments. Antibody fragments are smaller fragments of full-length antibodies that retain antigen-binding ability. Some of the most commonly used antibody fragments include Fab (fragment antigen-binding) fragments, F(ab')2 (fragment antigen-binding dimer) fragments, single-chain variable fragments (scFv), nanobodies, bispecific antibodies, diabodies, triabodies, and domain antibodies (dAbs). Fab fragments are the variable regions of antibodies that contain the antigen-binding site. Fab fragments can be generated by enzymatic cleavage of antibody molecules and are often used, for example, in diagnostic applications. F(ab')2 fragments are Fab fragments linked together by disulfide bonds, resulting in fragments that can simultaneously bind two antigen molecules. Single-chain variable fragments are recombinant antibody fragments containing the variable regions of the antibody's heavy and light chains connected by a short linker peptide. They can be produced in bacteria or yeast and are often used, for example, to target tumor or other disease-related antigens. Nanobodies are single-domain antibody fragments derived from camel or shark antibodies that have small size and high stability. Nanobodies can be produced, for example, by genetic engineering. Bispecific antibodies are antibodies that can simultaneously bind to two different antigens. Bispecific antibodies can be produced by fusing two different Fab or scFv fragments together or by engineering a single antibody molecule to contain two different antigen-binding sites. Diabodies are artificially engineered antibodies consisting of two different single-chain variable fragments (scFvs) linked together. Diabodies are small and can simultaneously bind two different antigens.Triabodies are engineered antibodies consisting of three different single-chain variable fragments (scFv) linked together. Triabodies are small in size and can simultaneously bind three different antigens. Domain antibodies are antibody fragments consisting of a single variable domain of an antibody that can be produced in bacteria or yeast. dAbs are small in size and highly stable.

[0182] Small molecule drugs are low molecular weight (for example, less than 10 kDa) compounds that can bind to specific proteins in the body and modify their activity.Small molecule drugs are often used to treat diseases such as cancer, hypertension, and diabetes.

[0183] Gene therapy involves the delivery of genetic material (eg, DNA or RNA) to cells in the body to, for example, correct a genetic defect or alter cell function.

[0184] Cell therapy involves the transplantation or modification of cells in the body, for example, to replace damaged or diseased cells or tissues.Non-limiting examples of cell therapy include stem cell therapy, CAR T-cell therapy, gene editing using CRISPR / Cas9, mesenchymal stem cell therapy, retinal pigment epithelial cell therapy, natural killer cell therapy, tumor-infiltrating lymphocyte therapy, dendritic cell therapy, umbilical cord stem cell therapy, and tissue engineering.

[0185] A vaccine is a biological preparation that stimulates the immune system to generate a protective immune response against a specific infectious agent (e.g., virus or bacteria).There are several types of vaccines, each of which uses a different method to stimulate the immune response.Some of the most common types of vaccines include inactivated vaccines, live attenuated vaccines, subunit, recombinant and conjugate vaccines, mRNA vaccines, viral vector vaccines, and DNA vaccines.

[0186] Hormones are chemical messengers produced by the endocrine system that regulate various physiological functions in the body. Hormones can be used as therapeutic agents to treat a variety of conditions, such as diabetes, thyroid disorders, and growth hormone deficiency.

[0187] Enzyme replacement therapy involves the administration of enzymes to replace or supplement enzymes that are deficient or missing in the body.

[0188] Nucleic acid-based therapy involves delivering nucleic acids (e.g., DNA or RNA) to cells in the body to alter gene expression or cellular function. Nucleic acid-based therapy includes antisense oligonucleotide therapy and RNA interference therapy. RNA interference (RNAi) therapy is a type of gene therapy that involves the use of small RNA molecules to silence or "knock down" the expression of specific genes in the body. Examples of types of RNAi molecules include small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), ribozymes, aptamers, antisense RNA, and CRISPR RNA (crRNA). Small interfering RNA is a double-stranded RNA molecule typically 21-23 nucleotides in length. siRNA molecules are used to silence specific genes by targeting their mRNA for degradation. MicroRNA is a small single-stranded RNA molecule typically 20-24 nucleotides in length. miRNA molecules are involved in regulating the expression of multiple genes by targeting their mRNAs for degradation or translational inhibition. Short hairpin RNAs are single-stranded RNA molecules, typically 19–29 nucleotides in length, that fold back on themselves to form a hairpin structure. shRNA molecules are used to silence specific genes by targeting their mRNAs for degradation. Ribozymes are RNA molecules that have enzymatic activity and can cleave specific RNA molecules, including mRNAs. Aptamers are RNA molecules that can bind to specific targets (e.g., proteins or other molecules) with high affinity and specificity. Antisense RNA is a single-stranded RNA molecule that is complementary to a specific mRNA molecule. Antisense RNA molecules are used to inhibit the translation of target mRNAs by forming double-stranded RNA molecules that are degraded by the cell. CRISPR RNA is an RNA molecule that is part of the CRISPR-Cas9 system, a genome editing tool that can be used to target specific genes for deletion or modification.

[0189] Route of administration The cells (e.g., human cells) and / or therapeutic modalities (or other substances / agents) of the present disclosure can be administered to the immunodeficient mice, for example, via systemic administration or via local administration.

[0190] In some embodiments, cells or therapeutic modalities are administered via systemic administration. Systemic administration routes in mice involve the introduction of drugs or therapeutic modalities into the mouse's body to achieve systemic distribution and the desired effect. Intravenous (IV) injection is a commonly used route in mice, involving the direct delivery of drugs or therapeutic modalities into veins such as the tail vein, lateral tail vein, retro-orbital sinus, or jugular vein. IV injection provides rapid and direct access to the systemic circulation, ensuring immediate distribution throughout the body. This route is suitable for substances requiring a rapid systemic effect. Intraperitoneal (IP) injection involves the delivery of drugs or therapeutic modalities into the mouse's peritoneal cavity. The substance is absorbed through the peritoneal membrane and enters the systemic circulation. This route provides widespread distribution of the drug within the peritoneal cavity and systemic circulation, and is suitable for drugs requiring widespread contact with abdominal organs. Subcutaneous (SC) injection involves the delivery of a drug or therapeutic modality into subcutaneous tissue, typically the dorsal region or back of the neck of a mouse. The substance is absorbed into the systemic circulation via capillaries in the subcutaneous tissue. SC injection provides a slower but sustained release of the drug into the systemic circulation and is suitable for substances requiring a longer duration of action. Intramuscular (IM) injection involves the delivery of a drug or therapeutic modality directly into the muscle tissue of a mouse (e.g., quadriceps or gastrocnemius). The substance is absorbed through capillaries within the muscle and enters the systemic circulation. Compared to other routes, IM injection allows for sustained release and a longer duration of action, making it suitable for substances requiring a sustained effect. Oral gavage involves the administration of a drug or therapeutic modality directly into the stomach of a mouse using a feeding needle or gavage needle. This route is commonly used for orally available and stable substances in the gastrointestinal tract. Oral gavage allows for systemic distribution via absorption in the gastrointestinal tract and is suitable for substances that can be administered orally. Inhalation involves the administration of a drug or therapeutic modality via inhalation of an aerosolized substance. Inhalation chambers or specialized devices are used to deliver substances into the respiratory system of mice.Inhalation allows targeted delivery to the lungs and systemic distribution via absorption in the respiratory tract. This route is suitable for substances that require targeting to the respiratory system or direct delivery to the lungs.

[0191] In some embodiments, cells or therapeutic modalities are administered via local administration. Local administration routes in mice involve delivering drugs or therapeutic modalities directly to specific target tissues or regions of interest within the mouse body. These routes focus on localized delivery for localized effects, as opposed to systemic routes, which aim for widespread distribution. Various local administration routes are commonly used in mice for specific research purposes. Intradermal (ID) injection is a local route that delivers drugs or therapeutic modalities to the dermis (the skin layer immediately below the epidermis). This route is suitable for substances that target the skin or require localized effects in cutaneous tissue. Subcutaneous (SC) injection, traditionally associated with systemic administration, can be employed for local administration in mice. By targeting specific subcutaneous regions or anatomical sites, drugs or therapeutic modalities can be delivered directly to the desired local area. Intramuscular (IM) injection serves as both a systemic and local route of administration. In the context of local administration, the drug or therapeutic modality is injected directly into muscle tissue at a specific site of interest. Intraperitoneal (IP) injection is primarily considered a systemic route and can also be used for local administration within the peritoneal cavity. By delivering the drug or therapeutic modality to the peritoneal cavity, localized effects can be achieved in organs or tissues within the abdominal region. Intra-articular injection involves delivering a drug or therapeutic modality directly to the joint cavity. Intranasal administration involves delivering a drug or therapeutic modality via the nasal cavity. This local route allows for targeted effects via the nasal route or potentially targeting the central nervous system via the olfactory route. Local administration involves applying a drug or therapeutic modality directly to the skin or mucous membranes. This local route allows for localized effects on the skin or mucosal surfaces (e.g., the eye, ear, or genitals).

[0192] In some embodiments, cells and / or agents are administered orthotopically. Orthotopic administration refers to the direct delivery of a drug or therapeutic modality to an anatomically accurate or appropriate location within an organism, mimicking the natural or native site of the disease or condition being studied. In the context of animal research, particularly in mice, orthotopic administration aims to reproduce the physiological and anatomical characteristics of a specific organ or tissue to study disease progression, treatment response, or other relevant biological processes. Orthotopic administration in mice involves various techniques for targeting a specific organ or tissue. One commonly used approach is orthotopic tumor implantation, in which tumor cells or tissues are injected or surgically placed directly into the corresponding anatomical site of interest. This method allows researchers to study tumor growth, metastasis, and treatment response in a manner that closely resembles the tumor's natural environment. Another approach is organ-specific injection, in which a drug or therapeutic modality is delivered directly to a specific organ or tissue of interest. By injecting cells or other substances into organs such as the liver, lungs, brain, or other organs, researchers can investigate organ-specific effects, disease models, or therapeutic interventions. Orthotopic transplantation is another technique used in mice, involving the surgical transfer or transplantation of tissues or cells into their anatomically precise location within a recipient mouse. This method is commonly used in transplantation studies to evaluate graft survival, integration, and functionality. Orthotopic injection or instillation involves introducing a substance directly into an organ or cavity via a catheter or needle. For example, instilling a drug into the bladder or bronchi can mimic the physiological conditions of urinary or respiratory diseases, allowing researchers to study localized effects or treatment approaches.

[0193] In some embodiments, cells (e.g., human cells) of the present disclosure are administered into the mammary fat pad of an immunodeficient mouse. The mammary fat pad in the mouse model refers to a defined region of adipose (fat) tissue located within the mammary gland region of a female mouse. In female mice, mammary glands are located in pairs along the abdominal region. Each mammary gland is composed of multiple lobes and ductal structures embedded within the periphery of the mammary fat pad.

[0194] In some embodiments, cells (e.g., human cells) of the present disclosure are administered into the renal capsule of an immunodeficient mouse. The renal capsule of a mouse refers to the outer layer or covering that encapsulates the kidney. It is a fibrous layer composed of connective tissue that surrounds and protects the kidney, providing structural support. The renal capsule acts as a barrier, separating the kidney from surrounding tissues and organs. The renal capsule is often used for various procedures, including transplantation or implantation of cells, tissues, or therapeutic modalities into the kidney. This may involve making an incision in the renal capsule to access the kidney and perform the desired procedure.

[0195] Assay In some embodiments, the method further comprises assaying the effect of one or more of the therapeutic modalities on the human cells.

[0196] In some embodiments, the assaying includes assaying for cell death (e.g., necrosis and / or apoptosis), inflammation, oxidative stress, changes in cell morphology, changes in cell function, accumulation of toxic substances, and changes in enzyme activity.

[0197] In some embodiments, the method involves assaying for cell death, which can lead to tissue damage and dysfunction. Cell death assays are used to measure and quantify different forms of cell death, such as apoptosis, necrosis, and autophagy. These assays are useful for understanding the mechanism and extent of cell death in various biological processes. Some commonly used cell death assays include the annexin V / propidium iodide (PI) assay, TUNEL assay, caspase activity assay, LDH release assay, MTT assay, PI exclusion assay, and Caspase-Glo® assay. The annexin V / PI assay distinguishes between early apoptotic and late apoptotic or necrotic cells. Annexin V (labeled with a fluorescent marker) binds to phosphatidylserine (a marker of early apoptosis). Propidium iodide (PI) stains cells with compromised membranes, indicating late apoptosis or necrosis. Flow cytometry is typically used to analyze the distribution of stained cells. The TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) assay detects DNA fragmentation (a hallmark of apoptosis). It involves labeling DNA strand breaks with modified nucleotides, which can be visualized using fluorescence microscopy or flow cytometry. This assay allows for quantification of apoptotic cells within a population. Caspase activity assays measure the activity of specific caspases (enzymes involved in apoptosis). Using fluorescent or colorimetric substrates, these assays detect cleavage of the substrate by active caspases, generating a measurable signal. The activity of caspase-3, -8, or -9 can be measured, indicating activation of the apoptotic pathway. The LDH (lactate dehydrogenase) release assay measures the release of LDH (an enzyme) into the culture medium upon cell membrane damage or disruption, which is characteristic of necrotic cell death. This assay quantifies the amount of LDH in the culture supernatant using a colorimetric or fluorometric assay, indicating compromised membrane integrity and cell death.The MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay measures cell viability based on the ability of living cells to reduce MTT (a yellow tetrazolium salt) to a purple formazan product. Formazan can be measured spectrophotometrically, and a decrease in formazan production indicates a decrease in cell viability. The PI exclusion assay uses propidium iodide (PI), a DNA-intercalating fluorescent dye, to distinguish viable from nonviable cells. PI cannot penetrate intact cell membranes and therefore stains only cells with compromised membrane integrity (e.g., necrotic cells). Flow cytometry or fluorescence microscopy can be used to analyze stained cells. The Caspase-Glo® assay is a luminescent assay that utilizes a luminescent caspase substrate. Upon caspase cleavage, the substrate emits a light signal. These assays can be specific for different caspases (e.g., caspase-3 / 7 or caspase-8) and provide sensitive and quantitative measurements of caspase activity indicative of apoptotic cell death.

[0198] In some embodiments, the method involves assaying for inflammation, which can result in swelling, redness, and pain. Inflammation assays are widely used to study and measure the presence and extent of inflammation, a complex immune response that occurs in various tissues and organs. These assays help understand the mechanisms underlying inflammation, identify potential therapeutic targets, and evaluate the effectiveness of anti-inflammatory treatments. Some commonly used inflammation assays include cytokine analysis, cell migration assays, leukocyte adhesion assays, nitric oxide assays, myeloperoxidase assays, histological staining, reactive oxygen species assays, and inflammatory gene expression analysis. Cytokine analysis is an important approach for quantifying inflammation. This assay involves measuring the levels of specific cytokines (e.g., interleukin (IL), tumor necrosis factor-α (TNF-α), and interferon (IFN)) in biological samples using technologies such as ELISA, multiplex immunoassays, or protein arrays. By assaying cytokine profiles, insights into the inflammatory process occurring in different tissues can be gained. Cell migration assays are utilized to study the migratory capacity of immune cells (e.g., neutrophils or monocytes) in response to inflammatory stimuli. Transwell or scratch assays provide valuable information about immune cell migration and infiltration into inflamed tissues. Leukocyte adhesion assays focus on measuring leukocyte (white blood cell) adhesion to endothelial cells, which is a critical step in the inflammatory response. By employing flow chamber or static adhesion assays, the adhesive properties of leukocytes under inflammatory conditions can be evaluated, contributing to our understanding of leukocyte-endothelial interactions. Nitric oxide (NO) assays are employed to measure the production of nitric oxide, a signaling molecule involved in inflammation. Griess reagent-based assays or fluorescent probes allow for the evaluation of nitric oxide levels, which serve as an indicator of inflammatory activity.Myeloperoxidase (MPO) assays are used to quantify the presence of neutrophils or the degree of inflammation in tissues. MPO is an enzyme released by activated neutrophils and macrophages during inflammation, and measuring MPO activity provides insight into the level of neutrophil infiltration and inflammatory activity. Histological staining techniques (e.g., hematoxylin and eosin (H&E) staining) play an important role in visualizing and assessing inflammatory changes in tissue samples. By examining cellular and tissue changes, including immune cell infiltration, tissue damage, and edema, inflammatory responses can be identified and characterized. Reactive oxygen species (ROS) assays detect the presence of reactive oxygen species generated during inflammation. Fluorescent probes (e.g., dichlorofluorescein diacetate (DCFDA)) allow for the measurement of ROS generation in cells or tissues, which indicates the presence and degree of inflammation. Inflammatory gene expression analysis involves providing expression levels of specific inflammatory genes (including cytokines, chemokines, and adhesion molecules). Techniques such as quantitative real-time polymerase chain reaction (qPCR) or gene expression microarrays allow for the assessment of gene expression patterns, providing insight into the molecular aspects of the inflammatory response.

[0199] In some embodiments, the method involves assaying for oxidative stress, which can damage cellular components and cause tissue dysfunction. Oxidative stress assays are valuable tools used to measure and evaluate the levels of reactive oxygen species (ROS) and oxidative damage in cells and tissues. These assays provide insight into oxidative stress states, which have been implicated in various physiological and pathological conditions. Some commonly used oxidative stress assays include the DCFDA assay, NBT assay, total antioxidant capacity assay, lipid peroxidation assay, protein carbonyl assay, glutathione assay, DNA oxidation assay, and mitochondrial membrane potential assay. The DCFDA assay is a widely used fluorometric assay that measures intracellular ROS levels. DCFDA, a non-fluorescent probe, is oxidized by ROS to form the fluorescent compound dichlorofluorescein (DCF). The fluorescence intensity of DCF is proportional to the level of ROS in cells and can be quantified using fluorescence microscopy or flow cytometry. The NBT assay detects superoxide anions (a type of ROS) by their ability to reduce NBT to formazan crystals. The intensity of the resulting blue formazan precipitate is proportional to the level of superoxide anions produced. This assay is commonly used in histochemical analysis to visualize and quantify superoxide production in tissues. Total antioxidant capacity assays measure the overall antioxidant capacity of biological samples, including both enzymatic and nonenzymatic antioxidants. These assays evaluate the sample's ability to scavenge free radicals or prevent oxidative damage. Methods such as the Trolox equivalent antioxidant capacity (TEAC) assay and the ferric reducing antioxidant power (FRAP) assay are employed to determine total antioxidant capacity. Lipid peroxidation assays evaluate the levels of lipid peroxidation products (e.g., malondialdehyde (MDA)) as indicators of oxidative damage to lipids.Thiobarbituric acid reactive substances (TBARS) assays or MDA assays are commonly used to measure lipid peroxidation, a common consequence of oxidative stress. Protein carbonyl assays detect the presence of carbonylated proteins, which result from protein oxidation due to oxidative stress. These assays derivatize carbonyl groups with 2,4-dinitrophenylhydrazine (DNPH), quantify protein-bound DNPH, and provide a measure of protein oxidation using spectrophotometry. Glutathione assays evaluate the levels of reduced (GSH) and oxidized (GSSG) forms of glutathione, an important intracellular antioxidant. These assays (e.g., enzymatic recycling methods or Ellman's reagent-based assays) provide insight into cellular antioxidant capacity and redox balance. DNA oxidation assays detect and quantify DNA damage resulting from oxidative stress. The comet assay (single-cell gel electrophoresis) and 8-hydroxy-2'-deoxyguanosine (8-OHdG) assay are commonly used to assess DNA damage, including oxidized bases and DNA strand breaks, caused by oxidative stress. The mitochondrial membrane potential assay measures changes in mitochondrial function resulting from oxidative stress. Fluorescent dyes (e.g., JC-1 or TMRE (tetramethylrhodamine ethyl ester)) are employed to assess changes in mitochondrial membrane potential using fluorescence microscopy or flow cytometry.

[0200] In some embodiments, the method involves assaying for changes in cell morphology, such as changes in cell size, shape, and structure, which can lead to tissue dysfunction. Assaying for changes in cell morphology is an approach for studying cellular changes associated with various biological processes or pathological conditions. By examining cellular structural features and shape, insights into cellular function, differentiation, disease progression, and response to treatment can be gained. Several commonly used methods allow for the assessment of changes in cell morphology. Light microscopy is a fundamental technique for visualizing and assessing cell morphology. Bright-field microscopy provides high-resolution images that allow for examination of overall cell shape, size, and characteristics (e.g., organelles and cytoplasmic structures). Phase-contrast microscopy and differential interference contrast (DIC) microscopy enhance contrast and improve visualization of cellular details, especially for clear or unstained cells. Fluorescence microscopy utilizes fluorescent dyes or genetically encoded fluorescent proteins to label specific cellular components or structures. By targeting specific molecules, changes in cell morphology (e.g., changes in cytoskeletal organization, organelle distribution, or nuclear morphology) can be visualized and studied. Techniques such as immunofluorescence staining and live-cell imaging provide valuable information about cellular dynamics and structural changes. Electron microscopy (EM) provides high-resolution images of cellular structures at the ultrastructural level. Transmission electron microscopy (TEM) provides detailed views of cellular organelles, membranes, and cytoplasmic components. Scanning electron microscopy (SEM) allows three-dimensional visualization of the cell surface and can reveal changes in cell shape, surface morphology, or the presence of cellular processes. Cytospin and cell smear techniques involve spreading cells on a glass slide, followed by fixation and staining. These methods allow for the examination of cell morphology under a microscope and the evaluation of characteristics such as cell size, shape, nuclear features, and the presence of cellular inclusions or abnormalities. Staining techniques such as Giemsa, Wright-Giemsa, or Papanicolaou staining can be employed to highlight cellular details and facilitate the identification of specific cell types.High-content imaging combines automated microscopy with image analysis software to quantitatively assess changes in cell morphology and subcellular structure. This approach enables large-scale screening of cell phenotypes, measuring parameters such as cell shape, size, texture, or fluorescence intensity. High-content imaging is particularly useful for studying cellular responses to treatment, genetic perturbations, or disease-related processes. Advanced image analysis software tools are available to quantify changes in cell morphology from microscopy images. These tools allow for the measurement of parameters such as cell area, perimeter, circularity, aspect ratio, and intensity distribution. By comparing these morphological parameters between different experimental conditions or cell populations, changes in cell shape or structure can be identified and quantified.

[0201] In some embodiments, the method involves assaying for changes in cellular function, which can lead to tissue dysfunction and organ failure. Assays for changes in cellular function are important for understanding cellular processes, evaluating the effects of treatments or genetic modifications, and investigating disease mechanisms. Various techniques and assays are available for assessing changes in cellular function. These methods provide valuable insight into cellular behavior, signaling pathways, metabolism, and overall cellular health. Enzyme activity assays measure the activity levels of specific enzymes involved in various cellular processes. By employing specific substrates that undergo measurable changes during enzymatic reactions, changes in metabolic pathways, signaling, or other enzymatic processes can be assessed. Calcium imaging techniques allow for monitoring intracellular calcium levels, which play an important role in regulating cell signaling and various cellular functions. Fluorescence microscopy using calcium-sensitive dyes allows for the assessment of changes in calcium dynamics, providing insight into processes such as neuronal signaling, muscle contraction, or cellular communication. Electrophysiological techniques (e.g., patch clamp recording) measure cellular electrical activity. These techniques assess changes in cellular membrane potential, ion channel activity, action potential, synaptic transmission, or other electrical properties. Electrophysiology is widely used in neuroscience and cardiac research to study cellular excitability and function. Metabolic assays measure various aspects of cellular metabolism (e.g., glucose uptake, ATP production, or oxygen consumption). By utilizing specific substrates or indicators, these assays allow for the quantification of changes in cellular energy metabolism or metabolic pathways. Cell proliferation and viability assays evaluate changes in cell growth, division, or survival. Techniques such as the MTT assay, cell counting, or live / dead staining provide quantitative or qualitative measurements of changes in cell proliferation or viability in response to treatment, genetic modification, or environmental conditions. Analysis of cell signaling pathways reveals changes in cellular responses or signaling cascades.Techniques such as Western blotting, immunofluorescence staining, or ELISA can be used to analyze protein expression, phosphorylation levels, or activation status of specific signaling molecules. These methods reveal changes in signaling pathways involved in processes such as cell growth, differentiation, or immune response. Functional imaging techniques (e.g., fMRI or PET) are used to study changes in cellular function in living organisms or tissues. These non-invasive imaging methods provide insight into functional changes in organs, tissues, or specific cell types and are commonly used in neuroscience, cardiovascular research, or oncology. Flow cytometry allows for the simultaneous analysis of multiple cellular parameters. By using fluorescently labeled antibodies or dyes, flow cytometry evaluates changes in cell surface markers, intracellular protein expression, cell cycle distribution, or apoptosis. It provides quantitative information about changes in various cellular functions within complex cell populations.

[0202] In some embodiments, the method involves assaying for toxic substance accumulation, which can lead to tissue damage and dysfunction. Assays for toxic substance accumulation are essential for studying the effects of various chemicals, pollutants, or drugs on cells and organisms. These assays provide valuable insight into toxicological mechanisms, the potential harmful effects of substances, and the effectiveness of antitoxin or protective interventions. Several commonly used methods allow for the assessment of toxic substance accumulation. Analytical techniques such as HPLC (high-performance liquid chromatography) and GC-MS (gas chromatography-mass spectrometry) allow for the identification and quantification of toxic substances. HPLC separates and quantifies a wide range of compounds and provides information about their accumulation levels. GC-MS combines gas chromatography and mass spectrometry to detect and characterize toxic substances based on their mass-to-charge ratio, particularly for volatile or semivolatile compounds. Fluorescence spectroscopy measures the emission of fluorescence from a sample when excited at a specific wavelength. By using fluorescent probes or dyes, fluorescence spectroscopy can assess toxic substance accumulation by monitoring changes in fluorescence intensity or emission spectra. These probes selectively bind or react with specific toxic compounds, providing a direct readout of their accumulation. Enzyme activity assays evaluate changes in enzyme function caused by toxicants. These assays employ specific substrates and indicators to measure enzyme activity and provide insight into the effects of toxicants on cellular processes. Some toxic compounds can interfere with cellular enzymes, inhibiting their activity or resulting in aberrant enzymatic reactions. Immunohistochemistry and immunofluorescence techniques use specific antibodies to detect and visualize the accumulation of toxicants in tissues or cells. By targeting specific antigens or epitopes associated with toxic compounds, these techniques allow for spatial identification and localization of accumulated toxicants. Cell-based assays utilize specific fluorescent dyes or probes to assess the accumulation of toxicants in cultured cells.These assays employ fluorescence microscopy or flow cytometry to quantify the accumulation of toxic compounds, providing insight into their cellular uptake, distribution, and metabolism. Tissue analysis can be employed to study toxicant accumulation in vivo. Tissue analysis involves the extraction and quantification of toxic compounds from organs or biological fluids, allowing for the assessment of their accumulation levels and distribution patterns in different tissues or body compartments. Indirect assays target specific physiological or biochemical changes caused by toxicants. Assays measuring oxidative stress markers, DNA damage, or metabolic changes can indirectly infer the presence and accumulation of toxic compounds. These changes serve as indicators of the toxicant's effects on cells or organisms.

[0203] In some embodiments, the method involves assaying for changes in enzyme activity, which can lead to tissue dysfunction and organ failure. Assaying for changes in enzyme activity can be used to study enzymatic processes, evaluate the effects of various factors on enzyme function, and identify potential disease-related changes. Several commonly used methods quantitatively measure the catalytic activity of enzymes and enable detection of changes in their function. Spectrophotometric assays utilize measurements of absorbance or color change to quantify enzyme activity. These assays often involve enzymatic reactions that produce or consume a specific substrate, resulting in a change in light absorption. By monitoring absorbance or color intensity, the rate of enzyme activity can be determined. Examples include the use of substrates such as NADH or NADPH, which exhibit a change in absorbance during the enzymatic reaction. Fluorometric assays rely on the detection of fluorescence emitted by substrates or products of the enzymatic reaction. Fluorescent molecules can be designed to specifically interact with certain enzymes and generate a fluorescent signal upon enzymatic activity. Enzymatic activity can be quantified by measuring fluorescence intensity. Fluorometric assays are highly sensitive and are often used in high-throughput screening. Radiometric assays involve the use of radioactive isotopes to track enzymatic reactions. Radioactive substrates or cofactors are used in enzymatic reactions, and the radioactivity of the reaction products is measured using techniques such as liquid scintillation counting. These assays offer high sensitivity but require special precautions due to the use of radioactive materials. Enzyme-linked immunosorbent assays (ELISAs) utilize the specificity of antibodies to detect and quantify enzyme activity. In these assays, enzymes are conjugated to antibodies or antigens, and their activity is measured through the detection of enzymatic reaction products. ELISAs are widely used for the quantification of various enzymes or enzyme activities in biological samples. Gel electrophoresis techniques (e.g., zymography or native gel electrophoresis) are used to assess changes in enzyme activity based on their mobility in a gel matrix.Enzymes are separated based on their size, charge, or activity, and subsequent staining or activity-based detection methods reveal changes in enzyme activity. Kinetic assays measure the rate of an enzyme-catalyzed reaction under various substrate concentrations or reaction conditions. These assays determine important kinetic parameters, such as the Michaelis-Menten constant (Km) and maximum reaction velocity (Vmax), providing insight into the influence of factors on enzyme-substrate interactions and enzyme activity. Common kinetic assays include Lineweaver-Burk plots and steady-state kinetic analysis. Mass spectrometry can be used to quantify enzyme activity by measuring the consumption or production of metabolites involved in enzymatic reactions. Isotopically labeled substrates or reactants can be introduced, and changes in isotope ratios are detected using mass spectrometry. This approach allows for accurate measurement of enzyme activity and can be applied to complex enzyme pathways. Activity-based probes are small molecules that selectively react with active enzyme sites. These probes covalently modify active enzymes, allowing for their subsequent detection or isolation. Activity-based probes provide a powerful method for profiling enzyme activity in complex biological systems.

[0204] In some embodiments, the methods involve assaying for increased survival, hi some embodiments, the methods involve assaying for improvement in symptoms, hi some embodiments, the methods involve assaying for improvement in overall health.

[0205] Further Phases Further aspects of the present disclosure are provided in the following numbered paragraphs:

[0206] 1. An immunodeficient mouse, an exogenous nucleic acid selected from an endogenous H2-K allele comprising a null mutation, an endogenous H2-D allele comprising a null mutation, an endogenous H2-A allele comprising a null mutation, and a nucleic acid encoding human interleukin 7 (huIL7) and a nucleic acid encoding human interleukin 15 (huIL15); Immunodeficient mice containing.

[0207] 2. An immunodeficient mouse described in paragraph 1, comprising a nucleic acid encoding said huIL7 and a nucleic acid encoding said huIL15.

[0208] 3. The endogenous H2-K1 allele containing a null mutation is H2-K1 tm1Bpe 2. The immunodeficient mouse of paragraph 1, wherein the mouse is allelic.

[0209] 4. The endogenous H2-D allele containing a null mutation is H2-D1 tm1Bpe 2. The immunodeficient mouse of paragraph 1, wherein the mouse is allelic.

[0210] 5. The endogenous H2-A allele containing a null mutation is H2-Ab1 em1Mvw 2. The immunodeficient mouse of paragraph 1, wherein the mouse is allelic.

[0211] 6. The immunodeficient mouse of any one of the preceding paragraphs, further comprising an endogenous interleukin-2 receptor gamma (Il2rg) allele comprising a null mutation.

[0212] 7. The endogenous Il2rg allele containing a null mutation is Il2rg tm1Wjl 7. The immunodeficient mouse of paragraph 6, wherein the mouse is allelic.

[0213] 8. The endogenous Il2rg allele containing a null mutation is Il2rg tm1Sug 7. The immunodeficient mouse of paragraph 6, wherein the mouse is allelic.

[0214] 9. The immunodeficient mouse of any one of the preceding paragraphs, further comprising an endogenous protein kinase, DNA-activated catalytic subunit (Prkdc) allele that comprises a null mutation.

[0215] 10. The immunodeficient mouse of paragraph 9, wherein the mutation is a severe combined immunodeficiency (scid) mutation.

[0216] 11. The endogenous Prkdc allele containing a null mutation is Prkdc scid 11. The immunodeficient mouse of paragraph 10, wherein the mouse is allelic.

[0217] 12. The immunodeficient mouse of any one of the preceding paragraphs, further comprising an endogenous recombination activating gene 1 (Rag1) allele that comprises a null mutation.

[0218] 13. The endogenous Rag1 allele containing a null mutation is Rag1 tm1Mom 13. The immunodeficient mouse of paragraph 12, wherein the mouse is allelic.

[0219] 14. The immunodeficient mouse of any one of the preceding paragraphs, further comprising an endogenous recombination activating gene 2 (Rag2) allele that comprises a null mutation.

[0220] 15. The endogenous Rag2 allele containing a null mutation is Rag2 tm1Fwa 15. The immunodeficient mouse of paragraph 14, wherein the mouse is allelic.

[0221] 16. The immunodeficient mouse of any one of the preceding paragraphs, having a non-obese diabetic (NOD) background.

[0222] 17. The immunodeficient mouse of paragraph 16, having a NOD scid gamma background.

[0223] 18. NSG-(K b D b ) null (IA null 18. The immunodeficient mouse of paragraph 16 or 17, having a .) genetic background.

[0224] 19. The immunodeficient mouse of any one of the preceding paragraphs, further comprising an exogenous nucleic acid selected from a nucleic acid encoding human interleukin 3 (huIL3), a nucleic acid encoding human granulocyte / macrophage stimulating factor (huGM-CSF), and a nucleic acid encoding human Steel factor (huSCF).

[0225] 20. The immunodeficient mouse of paragraph 17, further comprising a nucleic acid encoding said huIL3, a nucleic acid encoding said huGM-CSF, and a nucleic acid encoding said huSCF.

[0226] 21. The immunodeficient mouse of any one of the preceding paragraphs, further comprising an endogenous Kit allele that comprises a null mutation.

[0227] 22. The endogenous Kit allele containing a null mutation is Kit W-41J 22. The immunodeficient mouse of paragraph 21, wherein the mouse is

[0228] 23. The immunodeficient mouse of any one of the preceding paragraphs, further comprising (or engrafted with) human cells.

[0229] 24. The immunodeficient mouse of paragraph 23, further comprising (or being transplanted with) unfractionated human umbilical cord blood comprising said human cells.

[0230] 25. The immunodeficient mouse of paragraph 23 or 24, wherein the human cells comprise human hematopoietic stem cells.

[0231] 26. The immunodeficient mouse of any one of paragraphs 23 to 25, wherein the human cells comprise human peripheral blood mononuclear cells.

[0232] 27. The human cells are CD34 + The immunodeficient mouse of the preceding paragraph, which is not enriched for human hematopoietic stem cells.

[0233] 28. CD3 + The immunodeficient mouse of the preceding paragraph, wherein human T cells have not been depleted from said human cells.

[0234] 29. An immunodeficient mouse according to any one of the preceding paragraphs that has not been subjected to myeloablation, optionally irradiation or chemical myeloablation.

[0235] 30. A method for producing a humanized mouse, comprising administering human cells to an immunodeficient mouse described in any one of paragraphs 1 to 22.

[0236] 31. The method of paragraph 30, comprising administering unfractionated human umbilical cord blood comprising the human cells.

[0237] 32. The method of paragraph 30 or 31, wherein the human cells comprise human hematopoietic stem cells.

[0238] 33. The method of any one of paragraphs 30 to 32, wherein the human cells comprise human hematopoietic peripheral blood mononuclear cells.

[0239] 34. A method of generating an immunodeficient mouse according to any one of the preceding paragraphs, comprising: (i) a mouse comprising an endogenous Kit allele containing a null mutation, an exogenous nucleic acid encoding human interleukin 3 (huIL3), an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF), and an exogenous nucleic acid encoding human Steel factor (huSCF); and (ii) a mouse comprising an endogenous H2-K allele comprising a null mutation, an endogenous H2-D allele comprising a null mutation, an endogenous H2-A allele comprising a null mutation, an exogenous nucleic acid encoding human interleukin 7 (huIL7), and an exogenous nucleic acid encoding human interleukin 15 (huIL15); The method comprises crossbreeding the

[0240] 35. The method of paragraph 34, wherein the immunodeficient mouse is homozygous for the endogenous Kit allele that contains a null mutation.

[0241] 36. The method of paragraph 35 or 36, wherein the immunodeficient mouse is homozygous for the endogenous H2-K allele containing a null mutation, homozygous for the endogenous H2-D allele containing a null mutation, and / or homozygous for the endogenous H2-A allele containing a null mutation.

[0242] 37. A method comprising administering human cells to an immunodeficient mouse described in any one of the preceding paragraphs.

[0243] 38. The method of paragraph 37, further comprising administering unfractionated human umbilical cord blood comprising the human cells.

[0244] 39. The method of paragraph 37 or 38, wherein the human cells comprise human hematopoietic stem cells.

[0245] 40. The method of any one of paragraphs 37 to 39, wherein the human cells comprise human peripheral blood mononuclear cells.

[0246] 41. The human cells are CD34 + 41. The method of any one of paragraphs 37 to 40, which is not enriched for human hematopoietic stem cells.

[0247] 42. CD3 + 42. The method of any one of paragraphs 37 to 41, wherein the human T cells are not depleted from said human cells.

[0248] 43. The method of any one of paragraphs 37 to 42, excluding subjecting the immunodeficient mouse to myeloablation, optionally irradiation or chemical myeloablation.

[0249] 44. Mouse models with genotypes / strains listed in Table 1.

[0250] 45. A progeny mouse of any one of the matings described in Examples 1-5.

[0251] 46. ​​The following: endogenous Il2rg allele containing a null mutation; endogenous H2-K allele containing a null mutation; endogenous H2-D allele containing a null mutation; endogenous H2-A allele containing a null mutation; endogenous Kit allele containing a null mutation; an exogenous nucleic acid encoding human interleukin 7 (huIL7); an exogenous nucleic acid encoding human interleukin 15 (huIL15); an exogenous nucleic acid encoding human interleukin 3 (huIL3); an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF); and an exogenous nucleic acid encoding human Steel factor (huSCF); immunodeficient non-obese diabetic (NOD) mice containing

[0252] 47. The endogenous H2-K1 allele containing a null mutation is H2-K1 tm1Bpe 47. The immunodeficient mouse of paragraph 46, wherein the mouse is allelic.

[0253] 48. The endogenous H2-D allele containing a null mutation is H2-D1 tm1Bpe 48. The immunodeficient mouse of paragraph 46 or 47, wherein the mouse is allelic.

[0254] 49. The endogenous H2-A allele containing a null mutation is H2-Ab1. em1Mvw The immunodeficient mouse of any one of the preceding paragraphs, wherein the mouse is allelic.

[0255] 50. The endogenous Il2rg allele containing a null mutation is Il2rg tm1Wjl The immunodeficient mouse of any one of the preceding paragraphs, wherein the mouse is allelic.

[0256] 51. The endogenous Il2rg allele containing a null mutation is Il2rg tm1Sug 50. The immunodeficient mouse of any one of paragraphs 46 to 49, wherein the mouse is allelic.

[0257] 52. The immunodeficient mouse of any one of the preceding paragraphs, further comprising an endogenous Prkdc allele comprising a null mutation.

[0258] 53. The immunodeficient mouse of paragraph 52, wherein the null mutation in the endogenous Prkdc allele is a severe combined immunodeficiency (scid) mutation.

[0259] 54. The endogenous Prkdc allele containing a null mutation is Prkdc scid 54. The immunodeficient mouse of paragraph 53, wherein the mouse is allelic.

[0260] 55. The immunodeficient mouse of any one of the preceding paragraphs, further comprising an endogenous recombination activating gene 1 (Rag1) allele comprising a null mutation.

[0261] 56. The endogenous Rag1 allele containing a null mutation is Rag1 tm1Mom 56. The immunodeficient mouse of paragraph 55, wherein the mouse is allelic.

[0262] 57. The immunodeficient mouse of any one of the preceding paragraphs, further comprising an endogenous recombination activating gene 2 (Rag2) allele comprising a null mutation.

[0263] 58. The endogenous Rag2 allele containing a null mutation is Rag2 tm1Fwa 13. The immunodeficient mouse of paragraph 12, wherein the mouse is allelic.

[0264] 59. An immunodeficient mouse according to any one of the preceding paragraphs, having a NOD scid gamma background.

[0265] 60. NSG-(K b D b ) null (IA null 60. The immunodeficient mouse of paragraph 59, having a .) genetic background.

[0266] 61. The endogenous Kit allele containing a null mutation is Kit W-41J The immunodeficient mouse of any one of the preceding paragraphs,

[0267] 62. The immunodeficient mouse of any one of the preceding paragraphs, further comprising (or being transplanted with) human cells.

[0268] 63. The immunodeficient mouse of paragraph 62, further comprising (or being transplanted with) unfractionated human umbilical cord blood comprising said human cells.

[0269] 64. The immunodeficient mouse of paragraph 62 or 63, wherein the human cells comprise human hematopoietic stem cells.

[0270] 65. The immunodeficient mouse of any one of paragraphs 62 to 64, wherein the human cells comprise human peripheral blood mononuclear cells.

[0271] 66. The human cells are CD34 + The immunodeficient mouse of any one of the preceding paragraphs, which is not enriched for human hematopoietic stem cells.

[0272] 67. CD3 + The immunodeficient mouse of any one of the preceding paragraphs, wherein the human T cells have not been depleted from said human cells.

[0273] 68. An immunodeficient mouse according to any one of the preceding paragraphs that has not been subjected to myeloablation, optionally irradiation or chemical myeloablation.

[0274] 69. A method for producing a humanized mouse, comprising administering human cells to an immunodeficient mouse described in any one of paragraphs 46 to 61.

[0275] 70. The method of paragraph 69, comprising administering unfractionated human umbilical cord blood containing the human cells.

[0276] 71. The method of paragraph 69 or 70, wherein the human cells comprise human hematopoietic stem cells.

[0277] 73. The method of any one of paragraphs 69 to 71, wherein the human cells comprise human hematopoietic peripheral blood mononuclear cells.

[0278] 73. A method of generating an immunodeficient mouse according to any one of the preceding paragraphs, comprising: (i) a mouse comprising an endogenous Kit allele containing a null mutation, an exogenous nucleic acid encoding human interleukin 3 (huIL3), an exogenous nucleic acid encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF), and an exogenous nucleic acid encoding human Steel factor (huSCF); and (ii) a mouse comprising an endogenous H2-K allele comprising a null mutation, an endogenous H2-D allele comprising a null mutation, an endogenous H2-A allele comprising a null mutation, an exogenous nucleic acid encoding human interleukin 7 (huIL7), and an exogenous nucleic acid encoding human interleukin 15 (huIL15); The method comprises crossbreeding the

[0279] 74. The method of paragraph 73, wherein the immunodeficient mouse is homozygous for the endogenous Kit allele that contains a null mutation.

[0280] 75. The method of paragraph 73 or 74, wherein the immunodeficient mouse is homozygous for the endogenous H2-K allele containing a null mutation, homozygous for the endogenous H2-D allele containing a null mutation, and / or homozygous for the endogenous H2-A allele containing a null mutation.

[0281] 76. A method comprising administering human cells to an immunodeficient mouse described in any one of the preceding paragraphs.

[0282] 77. The method of paragraph 76, further comprising administering unfractionated human umbilical cord blood comprising the human cells.

[0283] 78. The method of paragraph 76 or 77, wherein the human cells comprise human hematopoietic stem cells.

[0284] 79. The method of any one of paragraphs 76 to 78, wherein the human cells comprise human peripheral blood mononuclear cells.

[0285] 80. The human cells are CD34 + 80. The method of any one of paragraphs 76 to 79, which is not enriched for human hematopoietic stem cells.

[0286] 81. CD3 + 81. The method of any one of paragraphs 76 to 80, wherein the human T cells are not depleted from said human cells.

[0287] 82. The method of any one of paragraphs 76 to 81, excluding subjecting the immunodeficient mouse to myeloablation, optionally irradiation or chemical myeloablation. [Example]

[0288] [Table 1] Tg: transgene / transgenic SGM3: transgene encoding human interleukin 3 (huIL3); transgene encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF); transgene encoding human stem cell factor (huSCF) W41: Kit W-41J Mutant allele NSGs in Table 1 (登録商標) Mouse strain description: Lineage 1 (NSG (登録商標) ): Severe immunodeficiency platform strain for all models in this study - see RRID:IMSR_JAX:005557.

[0289] Line 2 (NSG-MHC DKO): Lacking expression of major histocompatibility class I and class II genes, it supports engraftment of human peripheral blood mononuclear cells (PBMC) or unfractionated human umbilical cord blood without the development of acute xenograft-versus-host disease (GVHD) - see RRID:IMSR_JAX:025216.

[0290] Line 3 (NSG-Tg(Hu-IL7)): Provides expression of the human IL7 transgene, which supports the development and survival of T cells, NK cells, and other lymphoid cells. This line was generated using clone RP11-19N15 from CHORI BACPAC. The only gene contained in the BAC was human IL7. The BAC is 164,110 bp long. It spans the contiguous region from 79630616 to 79794725 on chromosome 8q21.12. Accession end numbers are B85558 (plus strand) and AQ14183 (minus strand). It was grown in LB + chloramphenicol, and DNA was purified using the Qiagen Large Construct Kit. The product was sequenced before injection into NOD+ / scid embryos.

[0291] Of the 84 potential founders, 3 were classified as positive for the transgene. All were female. All were male NSG. (登録商標) These lines were crossed with mice to produce many litters, and one of the lines was fixed to homozygosity.

[0292] Line 4 (NSG-Tg(Hu-IL15)): Provides expression of human IL15, which supports human natural killer (NK) cell development and survival and also aids human T cell survival. This line was generated using a 200 Kbp BACPAC obtained from ChoriBACPAC. Pronuclear injection generated male transgenic founders, which transmitted the transgene to their offspring. NSG-Tg(Hu-IL15) mice produce physiological levels of human IL15 - see RRID:IMSR_JAX:030890.

[0293] Line 5 (NSG-Tg(Hu-IL7)(Hu-IL15)): This line dually expresses human IL7 and IL15.

[0294] Strain 6 (NSG-Tg(SGM3) W41): A G-to-A point mutation was created in NSG mice using CRISPR Cas9, creating the W41 mutation in the Kit gene. This strain supports human HSC transplantation but requires irradiation of recipients.

[0295] Line 7 (NSG-MHC DKO Tg(Hu-IL15)): This line expresses human IL15 in the absence of mouse MHC class I and II.

[0296] Line 8 (NSG-Tg(Hu-IL15) Tg(Hu-SGM3)): This line expresses human IL15, as well as human stem cell factor, human IL3 and human GM-CSF.

[0297] Line 9 (NSG-MHC DKO Tg(Hu-IL7)(Hu-IL15)): This line expresses human IL7 and human IL15 in the absence of mouse MHC class I and II.

[0298] Line 10 (NSG-MHC DKO Tg(Hu-IL15)(SGM3)): This line expresses human IL15, as well as human stem cell factor, human IL3 and human GM-CSF in the absence of mouse MHC class I and II.

[0299] Line 11 (NSG-MHC DKO Tg(Hu-IL7)(Hu-IL15)(SGM3) W41): This line expresses human IL7 and IL15, as well as human stem cell factor, IL3, and GM-CSF in the absence of mouse MHC class I and II, and also expresses the W41 mutation.

[0300] Line 12 (NSG-MHC DKO Tg(Hu-IL7)(Hu-IL15)(SGM3)): This line expresses human IL7 and IL15, as well as human stem cell factor, IL3, and GM-CSF, in the absence of mouse MHC class I and II.

[0301] Line 13 (NSG-MHC DKO Tg(Hu-IL7)(SGM3)): This line expresses human IL7 and human stem cell factor, human IL3 and human GM-CSF in the absence of mouse MHC class I and II.

[0302] Line 14 (NSG-SGM3): This triple transgenic line expresses human IL3, GM-CSF (CSF2) and SCF (KITLG), cytokines that support stable engraftment of myeloid lineages and regulatory T cell populations, allowing for excellent engraftment of diverse hematopoietic lineages - see RRID:IMSR_JAX:013062.

[0303] Lines 9 to 13 are NSG (登録商標) Mouse model strains 1-8 are being generated by the genetic crosses described below using the following methods: Mice generated in each mating for the crosses described below should be genotyped by PCR, RT-PCR, or melting curves as appropriate for each genotype.

[0304] Example 1: Generation of NSG-MHC DKO Tg(Hu-IL7)(Hu-IL15) mice (line 9) mating 1 NSG-Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(lineage 5) × NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15) (lineage 7) 100% of the offspring mice should be homozygous for the MHC class I / II double knockout (MHC DKO), hemizygous for the human IL7 (Hu-IL7) transgene, and homozygous for the human IL-15 (Hu-IL15) transgene: NSG-(+ / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (Mating 1 progeny)

[0305] mating 2 NSG-(+ / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (Mating 1 progeny) × NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15) (lineage 7) 25% of the offspring mice should be homozygous for the MHC DKO, hemizygous for the Hu-IL-7 transgene, and homozygous for the Hu-IL15 transgene: NSG-(MHC DKO / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (Mating 2 progeny)

[0306] mating 3 NSG-(MHC DKO / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (Mating 2 progeny) × NSG-(MHC DKO / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (Mating 2 progeny) 12.5% ​​of the offspring mice should be homozygous for the MHC DKO, hemizygous for the Hu-IL7 transgene, and homozygous for the Hu-IL15 transgene: NSG-(MHC DKO / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (crossing 3 progeny A) 12.5% ​​of the offspring mice should be homozygous for the MHC DKO, homozygous for the Hu-IL7 transgene, and homozygous for the Hu-IL15 transgene: NSG-(MHC DKO / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) (crossing 3 progeny B)

[0307] mating 4 NSG-(MHC DKO / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (crossing 3 progeny A) × NSG-(MHC DKO / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) (crossing 3 progeny B) 50% of the offspring mice should be homozygous for the MHC DKO, homozygous for the Hu-IL7 transgene, and homozygous for the Hu-IL15 transgene: NSG-(MHC DKO / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) (crossing 4 progeny) mating 5 NSG-(MHC DKO / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) (crossing 4 progeny) × NSG-(MHC DKO / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) (crossing 4 progeny)

[0308] The NSG-(MHC DKO / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) progeny line is maintained by brother-sister mating.

[0309] Example 2: Generation of NSG-MHC DKO Tg(Hu-IL15)(SGM3)(Line 10) mating 1 NSG-Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(lineage 8) × NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15) (lineage 7) 100% of the offspring mice should be heterozygous for the MHC DKO, homozygous for the Hu-IL15 transgene, and hemizygous for the human SGM3 (SMG3) transgene: NSG-(+ / MHC DKO) Tg (Hu-IL15 / Hu-IL15) (+ / SGM3) (Mating 1 progeny)

[0310] mating 2 NSG-(+ / MHC DKO) Tg (Hu-IL15 / Hu-IL15) (+ / SGM3) (Mating 1 progeny) × NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15) (lineage 7) 25% of the offspring mice should be homozygous for the MHC DKO, homozygous for the Hu-IL15 transgene, and hemizygous for the human SGM3 (SMG3) transgene: NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(+ / SGM3) (Mating 2 progeny)

[0311] mating 3 NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(+ / SGM3) (Mating 2 progeny) × NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(+ / SGM3) (Mating 2 progeny) 25% of the offspring mice should be homozygous for the MHC DKO, homozygous for the Hu-IL15 transgene, and homozygous for the human SGM3 (SMG3) transgene: NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(Cross 3 progeny A) 50% of the offspring mice should be heterozygous for the MHC DKO, homozygous for the Hu-IL15 transgene, and hemizygous for the human SGM3 (SMG3) transgene: NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(+ / SGM3)(Cross 3 progeny B)

[0312] mating 4 NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(Cross 3 progeny A) × NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(+ / SGM3) (crossing 3 progeny B) 50% of the offspring mice should be homozygous for the MHC DKO, homozygous for the Hu-IL15 transgene, and homozygous for the human SGM3 (SMG3) transgene: NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (crossing 4 progeny)

[0313] mating 5 NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (crossing 4 progeny) × NSG-(MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (crossing 4 progeny)

[0314] The NSG-MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) progeny line is maintained by brother-sister mating.

[0315] Example 3: Generation of NSG-MHC DKO W41 Tg(Hu-IL15)(Hu-IL7)(SGM3)(Line 11) mating 1 NSG-(+ / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (line 9 female cross 1 progeny) × NSG-(W41 / W41) Tg(SGM3 / SGM3) (line 6 male) 25% of the offspring mice were heterozygous for MHC DKO, Kit W-41J Should be heterozygous for the mutant (W41) allele, hemizygous for the Hu-IL7 transgene, hemizygous for the Hu-IL15 transgene, and hemizygous for the SGM3 transgene: NSG-(+ / MHC DKO)(+ / W41) Tg(+ / Hu-IL7)(+ / Hu-IL15)(+ / SGM3)(Mating 1 progeny)

[0316] mating 2 NSG-(+ / MHC DKO)(+ / W41) Tg(+ / Hu-IL7)(+ / Hu-IL15)(+ / SGM3)(Mating 1 progeny) × NSG-MHC DKO / MHC DKO) Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (strain 10) 3.125% of the offspring mice were homozygous for MHC DKO, Kit W-41J Should be heterozygous for the mutant (W41) allele, hemizygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and homozygous for the SGM3 transgene: NSG-(MHC DKO / MHC DKO)(+ / W41) Tg(+ / Hu-IL7) (Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (mating 2 progeny)

[0317] mating 3 NSG-(MHC DKO / MHC DKO)(+ / W41) Tg(+ / Hu-IL7) (Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (Mating 2 progeny) × NSG-(MHC DKO / MHC DKO)(+ / W41) Tg(+ / Hu-IL7) (Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (Mating 2 progeny) 12.5% ​​of the offspring were homozygous for MHC DKO, Kit W-41J Should be heterozygous for the mutant (W41) allele, homozygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and homozygous for the SGM3 transgene: NSG-(MHC DKO / MHC DKO)(+ / W41) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(Cross 3 progeny A) 12.5% ​​of the offspring mice NSG-(MHC DKO / MHC DKO)(W41 / W41) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(Cross 3 progeny B) It should be.

[0318] mating 4 NSG-(MHC DKO / MHC DKO)(+ / W41) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(Cross 3 progeny A) × NSG-(MHC DKO / MHC DKO)(W41 / W41) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (SGM3 / SGM3)(Mating 3 progeny B) 25% of the offspring mice were homozygous for MHC DKO, Kit W-41J Should be homozygous for the mutant (W41) allele, homozygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and homozygous for the SGM3 transgene: NSG-(MHC DKO / MHC DKO)(W41 / W41) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(Mating 4 progeny)

[0319] mating 5 NSG-(MHC DKO / MHC DKO)(W41 / W41) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(Mating 4 progeny) × NSG-(MHC DKO / MHC DKO)(W41 / W41) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (crossing 4 progeny)

[0320] The NSG-(MHC DKO / MHC DKO)(W41 / W41) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) progeny line will be maintained by brother-sister mating.

[0321] Example 4: Generation of NSG-MHC DKO Tg(Hu-IL7)(Hu-IL15)(SGM3)(Line 12) mating 1 NSG-Tg(Hu-IL15 / Hu-IL15)(SGM3 / SGM3)(lineage 8) × NSG-(+ / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15) (line 9 cross 1 progeny) 25% of the offspring mice should be heterozygous for the MHC DKO, hemizygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and hemizygous for the SGM3 transgene: NSG-(+ / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(+ / SGM3)(Mating 1 progeny)

[0322] mating 2 NSG-(+ / MHC DKO) Tg(+ / Hu-IL7)(Hu-IL15 / Hu-IL15)(+ / SGM3)(Mating 1 progeny) × NSG-Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15) (strain) 12.5% ​​of the offspring mice should be heterozygous for the MHC DKO, homozygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and hemizygous for the SGM3 transgene: NSG-(+ / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(+ / SGM3) (Mating 2 progeny)

[0323] mating 3 NSG-(+ / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(+ / SGM3) (Mating 2 progeny) × NSG-(+ / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(+ / SGM3) (Mating 2 progeny) 12.5% ​​of the offspring mice should be heterozygous for the MHC DKO, homozygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and homozygous for the SGM3 transgene: NSG-(+ / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (Mating 3 progeny)

[0324] mating 4 NSG-(+ / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (Mating 3 progeny) × NSG-(+ / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (Mating 3 progeny) 25% of the offspring mice should be homozygous for the MHC DKO, homozygous for the Hu-IL7 transgene, homozygous for the Hu-IL15 transgene, and homozygous for the SGM3 transgene: NSG-(MHC DKO / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (crossing 4 progeny)

[0325] mating 5 NSG-(MHC DKO / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (crossing 4 progeny) × NSG-(MHC DKO / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) (crossing 4 progeny)

[0326] the above NSG- The (MHC DKO / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(Hu-IL15 / Hu-IL15)(SGM3 / SGM3) progeny line is maintained by brother-sister mating.

[0327] Example 5: Generation of NSG-MHC DKO Tg(Hu-IL7)(SGM3)(Line 13) mating 1 NSG-(+ / MHC DKO)(+ / W41) Tg(+ / Hu-IL7)(+ / Hu-IL15)(+ / SGM3) (line 11 cross 1 progeny) × NSG-(SGM3 / SGM3)(line 14) 3.125% of the offspring mice should be heterozygous for the MHC DKO, hemizygous for the Hu-IL7 transgene, and homozygous for the SGM3 transgene: NSG-(+ / MHC DKO) Tg(+ / Hu-IL-7)(SGM3 / SGM3) (Mating 1 progeny)

[0328] mating 2 NSG-(+ / MHC DKO) Tg(+ / Hu-IL-7)(SGM3 / SGM3) (Mating 1 progeny) × NSG-(+ / MHC DKO) Tg(+ / Hu-IL-7)(SGM3 / SGM3) (Mating 1 progeny) 6.25% of the offspring mice should be homozygous for the MHC DKO, hemizygous for the Hu-IL7 transgene, and hemizygous for the SGM3 transgene: NSG-(MHC DKO / MHC DKO) Tg(+ / Hu-IL7)(+ / SGM3) (crossing 2 progeny A) 3.125% of the offspring mice should be heterozygous for the MHC DKO, homozygous for the Hu-IL7 transgene, and homozygous for the SGM3 transgene: NSG-(+ / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(SGM3 / SGM3) (crossing 2 progeny B)

[0329] mating 3 NSG-(MHC DKO / MHC DKO) Tg(+ / Hu-IL7)(+ / SGM3) (crossing 2 progeny A) × NSG-(+ / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(SGM3 / SGM3) (crossing 2 progeny B) 50% of the offspring mice should be homozygous for the MHC DKO, homozygous for the Hu-IL7 transgene, and homozygous for the SGM3 transgene: NSG-(MHC / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(SGM3 / SGM3) (Mating 3 progeny)

[0330] mating 4 NSG-(MHC / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(SGM3 / SGM3) (Mating 3 progeny) × NSG-(MHC / MHC DKO) Tg(Hu-IL7 / Hu-IL7)(SGM3 / SGM3) (Mating 3 progeny) The NSG-(MHC DKO / MHC DKO) Tg(Hu-IL7 / HuIL7)(SGM3 / SGM3) progeny line is maintained by brother-sister mating.

[0331] Example 6: Use of NSG-SGM3-W41 mice to investigate the role of innate immunity in FSHD muscle pathology Facioscapulohumeral muscular dystrophy (FSHD) disease progression is associated with muscle inflammation, but its role in FSHD muscle pathology is unknown. Facioscapulohumeral muscular dystrophy is a widespread epigenetic disease caused by gene disruption involving contractions of the D4Z4 repeat at the 4qA locus or loss-of-function mutations in chromatin modifier genes, resulting in hypomethylation of the D4Z4 locus and misexpression of the germline transcription factor gene DUX4 (FSHD disease gene). DUX4 is encoded by terminal D4Z4 repeats and normally functions during early germline development. DUX4 misexpression in muscle disrupts the muscle transcriptome through activation of a large set of germline-specific genes that are surrogate biomarkers of DUX4 expression, but their role in DUX4 muscle pathology is unknown.

[0332] DUX4 misexpression alone does not appear to be sufficient to explain FSHD muscle pathology. DUX4 misexpression causes muscle toxicity in patient muscle cells in vitro and in an inducible mouse model in vivo, but the onset of muscle pathology in FSHD patients is highly variable, including early onset and subclinical disease. Clinical disease begins sporadically in facial, scapular, and brachial muscles, which are often asymmetrically affected and, over time, involve most muscle groups. Finally, transient expression of DUX4 in transgenic zebrafish and mouse models produces delayed muscle pathology, and transient DUX4 induction in human myoblast culture models produces H3.X and H3.Y histones, which characterize DUX4 target genes involved in delayed muscle toxicity.

[0333] Our research focused on the role of innate immunity as a modifier and amplifier of FSHD muscle pathology and disease progression. FSHD disease progression involves immune cell infiltration, followed by muscle turnover and fatty and fibrotic replacement, as evidenced by muscle transcriptome and immunohistology assays from patient muscle biopsies and DUX4-inducible mouse models. DUX4 misexpression inhibits nonsense-mediated decay (NMD), leading to the generation of aberrantly spliced ​​RNA and abnormal proteins, which are presumed to induce damage-associated molecular patterns (DAMPs), which are known to stimulate the innate immune response. The role of innate immunity in FSHD muscle pathology is also supported by elevated expression levels of complement genes in muscle biopsies and increased levels of complement C3 in the blood of FSHD patients.

[0334] To investigate the role of innate immunity in FSHD muscle pathology, we developed a novel humanized HSC / muscle transplantation mouse model, NSG-SGM3-W41. This mouse strain was engineered to selectively expand human innate immune cell lineages after transplantation of umbilical cord blood (UCB)-derived hematopoietic stem cells (HSCs) in the absence of irradiation preconditioning. Co-transplantation of patient-derived FSHD (or unaffected control) muscle stem cells into mouse tibialis anterior (TA) muscles generates differentiated FSHD human muscle cells expressing the FSHD disease gene, DUX4. Our findings show that FSHD muscle xenografts in HSC-transplanted NSG-SGM3-W41 mice preferentially accumulate human macrophages and early B cells, express early complement RNAs encoding activators of both the classical and alternative pathways, and upregulate C3 RNA and protein, a mediator of the early complement response. FSHD muscle xenografts also undergo muscle turnover that is dependent on the specific HSC donor, supporting the idea that innate immunity directly contributes to FSHD pathology. A role for late complement in muscle turnover is ruled out by our finding that FSHD muscle xenografts do not express RNA encoding the complement membrane attack complex (MAC). Based on our findings, we hypothesize that C3 complement, activated by the early complement pathway, responds to FSHD muscle, generating DAMPs and promoting muscle turnover through opsonization of FSHD muscle for macrophage recognition and phagocytosis.

[0335] Development of the NSG-SGM3-W41 mouse model of human innate immunity To investigate the role of the human innate immune system in FSHD muscle pathology, we developed a mouse strain (NSG-SGM3-W41, strain 6 described above) that supports the co-transplantation and differentiation of human CD34+ hematopoietic stem cells (HSCs) and human muscle stem cells isolated from muscle biopsies of FSHD and control patients. The NSG-SGM3-W41 mouse strain was first generated by crossing immune-deficient NSG-SGM3 mice expressing the human interleukin-3 gene (IL-3), the human granulocyte / macrophage-stimulating factor gene (GM-SCF), and the human steel factor gene (KITL) with NSG mice expressing the CRISPR Cas9 W41J point mutation in the Kit locus, enabling efficient multilineage transplantation of HSCs without irradiation.

[0336] Immune cell development was compared in HSC-transplanted NSG-SGM3 mice with and without 100 cGy irradiation pretreatment, and in non-irradiated NSG-SGM3-W41 mice. 5 Blood samples from mice injected and transplanted with CD34+ HSCs were assayed for circulating human CD45+ immune cells by flow cytometry at 4, 6, 8, 10, and 12 weeks after HSC transplantation (Figures 1A, 8A-8C). Results were expressed as the percentage of human CD45+ blood cells (Figure 1B). Both irradiated and non-irradiated NSG-SGM3 mice exhibited 30-40% circulating human CD45+ hematopoietic cells by 4 weeks after HSC injection, and this percentage increased to 70-80% by 12 weeks (Figure 1B). In contrast, non-irradiated NSG-SGM3 mice injected with HSCs had only 6% human CD45+ cells 4 weeks after HSC transplantation, and these cell numbers increased to 48% by 12 weeks (Figure 1B), a significantly lower engraftment efficiency than either irradiated or non-irradiated NSG-SGM3-W41 mice at all time points.

[0337] The specific lineages of human immune cells generated in HSC-transplanted NSG-SGM3 mice with or without 100 cGy pretreatment and in non-irradiated NSG-SGM3-W41 mice were compared using flow cytometry to determine the percentage of CD45+ cells co-expressing CD33 (myeloid cell marker), CD20 (cell marker), and CD3 (T cell marker). Flow cytometry assays were performed at 4, 8, and 12 weeks after HSC transplantation (Figures 1C–1E). At 4 weeks, mice in all three groups were predominantly CD33+ myeloid cells, with non-irradiated NSG-SGM3 mice having the lowest engraftment levels (average 32%) compared to irradiated NSG-SGM3 mice (50%) and NSG-SGM3-W41 mice (59%) (Figure 1C). In contrast, CD20+ B cell counts were very low and CD3+ T cells were absent. At 8 weeks after HSC injection, all three groups had lower levels of CD33+ myeloid cells compared with 40% and 60% of CD20+ B cells, and several animals in the irradiated NSG-SGM3 group and one in the NSG-SGM3-W41 group had low numbers of CD3+ T cells (Figure 1D). At 12 weeks after HSC injection, the blood of irradiated NSG-SGM3 mice had robust engraftment of CD33+ myeloid cells, CD20+ B cells, and CD3+ T cells; nonirradiated NSG-SGM3 mice showed primarily CD20+ B cell engraftment; NSG-SGM3-W41 mice showed robust engraftment of CD20+ B cells, moderate levels of CD33+ myeloid cells, and low levels of CD3+ T cells (Figure 1E). These data indicate that NSG-SGM3-W41 mice 8 weeks after HSC transplantation support robust myeloid and B cell development and restricted T cell development, providing a model of HSC co-transplantation with muscle stem cells for investigating the innate immune response to FSHD muscle.

[0338] HSC Transplantation of FSHD and Control Muscle Stem Cells in NSG-SGM3-W41 Mice We next investigated whether HSC-transplanted NSG-SGM3-W41 mice could support the engraftment and differentiation of muscle stem cells from patients with FSHD and unaffected controls. NSG-SGM3-W41 mice were transplanted with 10 HSCs derived from healthy UCB donors for 4 weeks. 5 CD34+ HSCs were transplanted. Two to three weeks after HSC transplantation, the hind limbs of the HSC-transplanted mice were irradiated to block the growth of host mouse muscle stem cells. The tibialis anterior (TA) muscle was then injured by barium chloride injection to destroy mouse TA muscle fibers and create a niche for the transplantation and differentiation of human muscle biopsy-derived stem cells (Figure 2A). The barium chloride-injected TA muscle was then implanted with 10 cells isolated from muscle biopsies from three FSHD families (12, 15, and 17), including affected FSHD patients (12A, 15A, and 17A) and first-degree unaffected control relatives (12U, 15V, and 17U). 6 CD56+ muscle stem cells were transplanted (Figure 2B). High (17A), medium (12A), and low (15A) DUX4-expressing FSHD cell lines were selected for the experiment to characterize the immune response to FSHD muscle (Figure 2B). Muscle stem cells from family 12 (12A / 12U) were co-transplanted with one HSC donor into the TA muscle of mice. Muscle stem cells from family 15 (15A / 15V) were co-transplanted with two different HSC donors (15D1 and 15D2), and muscle stem cells from family 17 were transplanted into the TA muscle of mice transplanted with HSCs derived from four different donors (17D1, 17D2, 17D3, and 17D4) (Figure 2C). Three to four weeks after muscle stem cell transplantation, the mice were euthanized, their spleens isolated to assess the development of human B, myeloid, and T cells, and their TA muscles processed for immunohistology or RNA expression analysis (Figure 2A).

[0339] HSC engraftment was assessed by flow cytometry analysis of spleen cells assayed for CD45+ hematopoietic lineage cells, CD45+ / CD20+ B cells, CD45+ / CD33+ myeloid cells, and CD45+ / CD3+ T cells. Mice transplanted with all combinations of HSC and muscle stem cell donors generated comparable levels of hematopoietic CD45+ cells (Figure 2D), B cells (Figure 2E), and myeloid cells (Figure 2F). A representative flow cytometry gating strategy is shown in Figure 8A. None of the HSC-transplanted mice generated CD45+ / CD3+ T cells, confirming that NSG-SGM3-W41 mice are permissive for the expansion of innate immune lineages, but not T cell lineages, during the 8-week period following HSC transplantation (Figure 2G). A minority of mice did not engraft HSCs, based on undetectable CD45+ staining by flow cytometry of splenocytes (FIG. 8B) and by immunohistology of TA muscles (FIG. 8C).

[0340] Enhanced accumulation of CD45+ innate immune cells in FSHD xenografted muscles compared to control muscles To investigate whether human innate immune cells preferentially infiltrate FSHD muscle xenografts, TA muscle was immunostained for human-specific CD45 to identify HSC-derived innate immune cells and Hoechst to identify total nuclei (Figure 3A). CD45+ immune cells were identified in both FSHD and control TA xenografts (Figure 3A), but CD45+ cells were significantly more abundant in FSHD than in control muscle xenografts in six of seven immune donors (Figure 3B). This reflects either increased infiltration and / or expansion of human immune cells in FSHD xenografts. To determine whether human CD45+ cells localized to transplanted human muscle, serial sections of TA muscle were immunostained for human CD45 to indicate human leukocytes or human spectrin β1 to indicate human muscle fibers. CD45+ cells colocalized with spectrin β1+ muscle fibers in FSHD xenografts compared with control muscles (Fig. 4C), providing evidence that immune cells are trophic for FSHD muscle.

[0341] Human CD19+ B cells and CD68+ macrophages are more abundant in FSHD than in control muscle xenografts To characterize immune cell types in muscle xenografts, FSHD and control TA muscles were sectioned and immunostained for the B cell marker human CD19 (hCD19) (Figure 4A) and the macrophage marker human CD68 (hCD68) (Figure 4C). Significantly higher numbers of human B cells and macrophages were present in FSHD compared to control muscles in all immune donors analyzed (Figures 4B and D). TA muscles from 17D1 and 17D2 were processed for IHC, but these tissue samples were not suitable for immunofluorescence assays. These data indicate that FSHD muscle promotes the influx and / or expansion of macrophages and B cells.

[0342] Muscle turnover in FSHD xenografts is donor-dependent To investigate whether human innate immune cells promote FSHD muscle turnover, TA muscle sections from FSHD and control xenografts were co-immunostained with human-specific antibodies against lamin A / C to identify human nuclei and spectrin β1 to identify differentiated human myofibers in donors 12, 15D1, 15D2, 17D3, and 17D4. Xenografts from cohorts 17D1 and 17D2 were processed for IHC and not assayed for immunofluorescence. Lamin A / C+ nuclei and spectrin β1+ myofibers were detected in both FSHD and control TA muscle xenografts (Figure 5A). Notably, FSHD xenografts from cohorts 15D1, 15D2, and 17D4 had significantly fewer spectrin β1+ myofibers than control xenografts (Figure 5B). This indicates that FSHD muscle was undergoing turnover, whereas FSHD and control xenografts from cohorts 12 and 17D3 maintained similar levels of spectrin β1+ myofibers, although these FSHD muscles were infiltrated with immune cells (Figures 3 and 4). To investigate whether innate immune cell cotransplantation reduced proliferative capacity, the number of spectrin β1+ myofibers was compared in immune-transplanted mice and mice that did not develop immune systems in cohorts 12 and 15 (Figures 5C-5D). Significantly fewer spectrin β1+ myofibers were observed in immune-transplanted 12A and 15A muscle xenografts, whereas similar fiber numbers were observed in 12U and 15V with or without immune engraftment. This indicates that control muscles did not undergo turnover in response to their cotransplanted immune donors (Figure 5D).

[0343] The inflammatory response to FSHD muscle is donor-dependent To analyze the immune and muscle gene expression profiles of FSHD and control xenografts, we designed a custom NanoString RNA expression quantification panel containing human-specific probes for immune, muscle, and DUX4 target genes. This NanoString panel assayed the expression of 204 inflammatory genes, three muscle genes (MYH8, MYL2, and MEF2C), and two DUX4 transcriptional target genes (LEUTX and MBD3L2). NanoString assays were performed on FSHD and control xenografts from three different FSHD families (12, 15, and 17) in NSG-SGM3-W41 mice transplanted with seven different HSC donors, as described above (Figure 2C).

[0344] To identify genes differentially expressed in FSHD vs. control xenografts, NanoString counts for each mouse were log2-transformed and averaged within each muscle donor and immune donor combination before calculating the fold change in FSHD vs. control expression for all genes within all seven of the HSC donors. Muscle gene expression levels were significantly reduced by up to 200-fold (log2 fold change -8.37) in four of the seven HSC donor groups (15D1, 15D2, 17D2, and 17D4) (Figure 6A). This provides evidence for differential turnover of FSHD muscle in these cohorts, as also observed in immunohistological assays of spectrin β1+ myofibers in FSHD xenografts from cohorts 15D1, 15D2, and 17D4 (Figure 5). In contrast, cohorts 12 and 17D3 had increased expression of muscle genes in FSHD versus control, suggesting a regenerative response of FSHD muscle in these xenografts (Figure 6A). Differentially expressed human immune genes included C3, a key mediator of the complement response; C1R, C1S, C1QA, and C1QB, which constitute the C1 complex of the classical complement pathway, which initiates complement activation through interaction with pathogens or DAMPs; C2 serine proteinase; and early complement pathway genes in both the classical and alternative pathways, including CFB and CFD, which are unique to the alternative pathway and also responsive to DAMPs (Figure 6). Their expression levels varied based on muscle cohort and HSC donor. 17D2 FSHD xenografts had low expression of complement genes and high muscle turnover, but also accumulated macrophages and B cells. This suggests that 17D2 donor immune cells efficiently targeted FSHD muscle for turnover (Figure 4). Notably, C3 expression tended to be higher in FSHD xenograft muscles from the three FSHD cohorts responding to all seven immune donors. Expression of all human late complement RNAs, including C5-C9, which encode components of the membrane attack complex (MAC), was undetectable in both FSHD and control muscles.Furthermore, NSG-SGM3-W41 mice are deficient in the C5 complement component and therefore cannot induce a murine host MAC response. In addition to complement genes, several chemokines, including CXCL1, CXCL2, CXCL6, CXCL9, CXCL10, and CCL13, were more highly expressed in FSHD xenografts in several cohorts compared with controls.

[0345] Myofibers in FSHD xenografts show increased deposition of C3 Human immune-muscle transplanted TA muscle cryosections were immunostained with spectrin β1 to identify human muscle fibers and with a human-specific antibody against human-specific C3 to examine the localization of human C3 relative to the humanized muscle region. Immunohistochemistry of cohorts 12, 15D1, 15D2, 17D3, and 17D4 demonstrated abundant C3 expression and localization in FSHD muscle fibers compared with control fibers (Figure 7A). This supports the NanoString RNA expression findings. Human C3 was detected only in the humanized regions of transplanted mouse TA muscle, where it was localized on the surface and within FSHD muscle fibers, but was also enriched in the areas surrounding the muscle fibers. Based on this, we hypothesize that it is enriched in human immune cells. We quantified the abundance of C3 puncta within spectrin β1+ human myofibers and found that in all analyzed cohorts, FSHD transplant sections had a significantly higher percentage of fibers containing more than 10 C3 puncta (Fig. 7B). Numerous puncta are highlighted by white arrows in high-magnification FSHD images (Fig. 7A). Mouse C3 was not detected in xenografts by immunohistology using a mouse-specific C3 antibody (data not shown). Together, these data indicate that FSHD and control xenografts express human C3 and that FSHD xenografts have a greater percentage of myofibers highly decorated with C3.

[0346] Discussion and Conclusions We developed a humanized innate immune / muscle mouse model to investigate the role of the innate immune response to FSHD muscle. Our findings demonstrate that FSHD muscle xenografts from all three FSHD families generate an innate inflammatory response to their respective immune donors. FSHD xenografts induced enhanced infiltration of macrophages and early B cells compared with control xenografts, indicating that FSHD muscle is trophic for and / or promotes the expansion of innate immune cells within FSHD xenografts. FSHD xenografts expressed human early complement RNA and human C3 RNA and protein as part of the innate immune inflammatory response to FSHD muscle, whereas expression of mouse C3 protein was undetectable. FSHD xenografts also experienced what we hypothesize is donor-dependent muscle turnover, as demonstrated by the differential muscle turnover responses of 17A FSHD xenografts to the four different immune donors (Figure 6). Two of the four 17A immunized donors, 17D2 and 17D4, promoted extensive muscle turnover compared with donor 17D1 (which promoted low turnover) and donor 17D3, which promoted increased muscle gene expression. This likely reflects a regenerative response to muscle injury by resident muscle stem cells in the xenograft, as observed in FSHD muscle. While no muscle turnover was observed in 17D3, macrophages and early B cells from both HSC donors, 17D3 and 17D4, preferentially accumulated in FSHD muscle xenografts, expressed elevated C3, and demonstrated a robust inflammatory response. HSC donor-dependent differences in FSHD muscle turnover may reflect quantitative differences in the efficacy of immunized donors relative to the fixed endpoint of our assay. Studies are underway to establish live animal imaging reporter muscle stem cell lines for muscle xenograft establishment. This allows for monitoring of muscle turnover kinetics of individual muscle xenografts during stem cell differentiation and maturation in response to different immune donors.Our data indicate that individual immune donors generate innate immune cells with different capacities for immune responses, possibly modeling aspects of the variability observed in disease progression in FSHD patients and families with multiple affected members. Because innate immune responses vary within populations, we predict we will observe variability in immune responses from our healthy immune donors in response to FSHD xenografts. Future studies of immune donor variability in this model will address these possibilities.

[0347] Although our innate immune muscle xenograft model demonstrates a role for innate immunity in FSHD muscle pathology, the mechanism by which FSHD muscle is trophic for innate immune cells remains to be investigated. Our working hypothesis is that FSHD muscle attracts macrophages and early B cells through DUX4-mediated production of DAMPs, stimulating the production of complement factor C3 and early complement classical and alternative pathway convertases to process C3 into C3b. Through this mechanism, C3b binds to and opsonizes FSHD muscle for recognition and turnover by macrophage phagocytosis. Current research focuses on investigating the function of DUX4 and C3 in FSHD muscle turnover using DUX4 siRNA therapeutics and early complement pathway-specific immunotherapeutics, with the goal of developing combinatorial therapeutics for treating FSHD disease initiation and progression.

[0348] To investigate the innate immune response to FSHD muscle, we generated a humanized innate immune-FSHD muscle xenograft model using NSG-SGM3-W41 mice. By standardizing our model using muscle biopsy-derived myoblasts from three FSHD patients and paired healthy controls, as well as HSCs from seven healthy donors, we found that human B cells and macrophages preferentially infiltrated FSHD muscle in all cohorts. Although immune cells infiltrated FSHD xenografts from all cohorts, FSHD muscle turnover was observed in only four of the seven cohorts, suggesting that the response is immune donor-dependent. Finally, we observed higher expression of complement genes from both the classical and alternative pathways in FSHD transplants than in control transplants. This suggests a potential mechanism and novel druggable pathway for ameliorating FSHD muscle pathology.

[0349] method Mouse model generation NOD.Cg-Kit em1Mvw Prkdc scid IL2rg tm1Wjl Tg(CMV-IL3, CSF2, KITL)Eav / MloySzJ (NSG-SGM3-W41) mice were developed as described in Table 1 above. NSG-SGM3. The W41 mutation (V831M) in the mouse Kit gene, consisting of a G to A point mutation in the kinase domain, was created directly in NSG zygotes using CRISPR-Cas9 and oligo-mediated homology-directed repair, as previously described. To reduce the potential for off-target mutations, a truncated guide was used to target the sequence: GCACGACTGCCCGTGAAG (SEQ ID NO: 1) and generate NSG-Kit. W41 Alleles are assigned to the donor oligonucleotide template: AGGGGAGGTGGCTGGAGGTCACAAGGTTTAAGGTCCTCGTCTATCGCTGTCTTCATTAGCTGCTTGAATTTGCTGTGTTCCGTTCTAGGCACGACTGCCCATGAAGTGGATGGCACCAGAGAGCATTTTCAGCTGCGTGTACACATTTGAAAGTGATGTCTGGTCCTATGGGATTTTCCTCTGGGAGCTCTTCTCCTTAG (SEQ ID NO: 2) was generated using NSG-SGM3 mice were cultured using NSG-Kit W41 The entire gene was then transgenic for the NSG-SGM3 Kit. W41 It was fixed to homozygosity in mice.

[0350] Isolation of human umbilical cord blood (UCB)-HSCs and transplantation into mice Human UCB was obtained in accordance with the Committee for the Protection of Human Subjects in Research guidelines of the University of Massachusetts Chan Medical School. UCB was provided by the University of Massachusetts Memorial Umbilical Cord Blood Donation Program. Groups of 4- to 8-week-old male and female NSG-SGM3-W41 mice were inoculated with 1 × 10 5 CD3-depleted (Miltenyi Biotech) human UCB containing CD34+ HSCs was injected intravenously. At the indicated time points, human immune engraftment was quantified by flow cytometry analysis of the blood of transplanted mice. For experimental studies, mice with >10% peripheral human CD45+ cells and >5% human CD3+ T cells were used.

[0351] Flow cytometry To analyze the development of the human immune system in HSC-transplanted NSG-SGM3-W41 mice, the following monoclonal antibodies specific for human antigens were used: human CD45 (2D1), CD3 (UCHT1), CD20 (2H7), and CD33 (WM53). Anti-mouse CD45 (30F-11) was used to exclude mouse leukocytes. The above antibodies were purchased from BD Biosciences, Inc. (CA) or BioLegend (CA). Single-cell suspensions of spleens were prepared from transplanted mice, and whole blood was collected in heparin. 5 × 10 cells were collected in 50 μl or 100 μl of whole blood. 5 Single-cell suspensions of splenocytes were washed with FACS buffer (PBS supplemented with 2% fetal bovine serum (HyClone, UT) and 0.02% sodium azide (Sigma, MO)) and then preincubated with rat anti-mouse FcR11b (clone 2.4G2, BD Biosciences, CA) to block Fc binding. A specific antibody against a cell surface antigen was then added to the sample and incubated for 30 minutes at 4°C. The stained samples were then washed and fixed with 2% paraformaldehyde for cell suspensions or treated with BD FACS lysing solution for whole blood. At least 100,000 events were acquired on an LSRII instrument (BD Biosciences, CA) or Aurora (Cytek Biosciences, CA). Data analysis was performed using FlowJo software (Tree Star, Inc., OR).

[0352] cell culture CD56+ FAC-sorted FSHD and control myoblasts from families 12, 15, and 17 were cultured in HMP medium (Ham's F10 (Cellgro 10-070-CV)) supplemented with 20% FBS (Hyclone SH30071.03) and 1% chicken embryo extract (in-house) on 15-cm dishes coated with 0.1% gelatin (Sigma G9391) and passaged using TrypLE (ThermoFisher) when 70% confluence was achieved.

[0353] muscle xenograft NSG-SGM3-W41 mice were used in accordance with the Institutional Animal Care and Use Committee (IACUC) of UMass Chan Medical School. Mice were anesthetized with ketamine / xylazine, and their hind limbs were subjected to 18 Gy of irradiation using a Faxitron CellRad X-ray cabinet (Faxitron Bioptics LLC) to eliminate host mouse satellite cell populations. Lead shielding was used to limit radiation exposure to the hind limbs only. One day after irradiation, mice were anesthetized using an isoflurane vaporizer (SurgiVet model 100) and injected bilaterally with 50 μl of 1.2% barium chloride (Sigma) into the tibialis anterior (TA) muscle to degenerate the mouse muscle. Three days after muscle injury, 1 × 10 6 CD56+ biopsy-derived myoblasts were resuspended in 50 μl of 1 mg / mL laminin (Sigma, L2020) in phosphate-buffered saline (PBS) and injected bilaterally into the body of the TA muscle. Xenografted mice were euthanized by CO2 asphyxiation followed by cervical dislocation 3–4 weeks after transplantation. For immunohistology experiments, TA muscles were embedded in Tissue-Tek OCT compound (Sakura), frozen in liquid nitrogen-cooled isopentane, and maintained at −80°C until cryosectioning. For RNA isolation, xenografted TA muscles were snap-frozen in liquid nitrogen and maintained at −80°C until RNA isolation.

[0354] RNA Isolation for NanoString RNA was isolated from xenografted TA muscles using the Aurum Total RNA Fatty and Fibrous Tissue Kit (Bio-Rad) according to the manufacturer's specifications. For NanoString Digital RNA quantification, 150 ng of total RNA was used for each xenografted TA muscle. A custom inflammation NanoString panel with human-specific probes for muscle protein genes (MEF2C, MYH8, and MYL2), DUX4 target genes (LEUTX and MBD3L2), inflammatory genes, and multiple housekeeping genes was used for all analyses on the nCounter Sprint Profiler (NanoString Technologies, Seattle, WA). Raw mRNA counts for each TA sample were normalized to a panel of housekeeping genes (RPL13A, GAPDH, GUSB, HRPT1, PGK1, TUBB, and VCP) using nSolver software (NanoString Technologies, Seattle, WA).

[0355] TA sectioning and immunohistology Frozen TA muscles embedded in Tissue-Tek OCT compound (Sakura) were cryosectioned using a Leica CM3050 S Cryostat. 10 μm-thick tissue sections were mounted on Superfrost Plus microscope slides (Fisher Scientific) and kept at -20°C. Upon thawing, sections were fixed with ice-cold acetone at -20°C for 10 minutes. For lamin A / C (mab636) and spectrin β1 (NCL-SPEC1) co-staining, we employed a "mouse-on-mouse" (MOM) kit (Vector Laboratories) to reduce nonspecific antibody staining according to the manufacturer's specifications. Antibodies were applied sequentially, and then slides were incubated in Hoechst block for 10 minutes. For human CD45 (Dako, M0701), CD19 (Abcam, ab134114), CD68 (Agilent, clone PG-M1), or human-specific C3 (ThermoFisher, JF10-30) immunostaining, primary antibodies were incubated with slides overnight at 4°C, followed by two 5-minute PBS washes. The corresponding secondary antibodies were added and incubated for 1 hour at room temperature, followed by two 5-minute PBS washes. Slides were incubated with Hoechst for 10 minutes at room temperature, then dried and coverslipped with Fluorogel. Fluorescence images were acquired using a Leica DMR fluorescence microscope equipped with an IKona monochromatic high-sensitivity 6MP camera with a Sony sensor.

[0356] statistics NanoString, flow cytometry, and immunostaining quantitative data are presented as mean ± SEM. Statistical differences between NanoString RNA expression data and immunofluorescence quantification were assessed using Welch's t-test, and P values ​​less than 0.05 were considered significant ( * =P<0.05, ** =P<0.01, *** =P<0.001, ****=P<0.0001). Statistical analysis was performed using Prism V9 (Graphpad Software LLC).

[0357] Example 7 – Transplantation of Unfractionated Human Umbilical Cord Blood (UCB) into NSG Mouse Strains Eight to 12 week old NSG-MHC DKO Tg(Hu-IL15), NSG-MHC DKO, and NSG-Tg(Hu-IL7)(Hu-IL15) mice (lines 7, 2, and 5, respectively, in Table 1 above) were irradiated with 200 cGy radiation and then injected with 5 × 10 4 CD34 + Human hematopoietic stem cells (HSCs) and 1.9 × 10 6 Human CD3 + Unfractionated human umbilical cord blood (UCB) containing T cells was transplanted. 2 / 10, 7 / 8, and 0 / 10 of the NSG-MHC DKO Tg(Hu-IL15), NSG-MHC DKO, and NSG-Tg(Hu-IL7)(Hu-IL15) mice, respectively, survived for at least 6 weeks after irradiation and transplantation. These survival rates suggest that transplantation of unfractionated human UCB in NSG mice expressing Hu-IL15 reduces overall survival. To increase survival to at least 6 weeks, the amount of radiation could be reduced, the number of transplanted human T cells could be reduced, human interleukin-4 could be expressed (e.g., using any of the expression vectors provided herein), or some combination of these could be performed.

[0358] The mean percentage of human immune cells expressed in surviving NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice was assessed 6 weeks after irradiation and transplantation (Figure 9). + The average percentage of monocytic cells was approximately 30% and 50% of total CD45+ cells in NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice, respectively. +The mean percentage of T cells was 100% total CD3+ in NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice. + Approximately 100% of T cells were CD4 + The mean percentage of T cells was 0.01% of total CD4 T cells in NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice. + Approximately 55% and 80% of T cells were human CD8 + The mean percentage of T cells was total CD8+ in NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice. + Approximately 45% and 20% of T cells.

[0359] These results suggest that transgenic expression of human IL15 in NSG-MHC DKO mice significantly inhibits the growth of human white blood cells (CD45 + ) and CD4 + These results indicate that transgenic expression of human IL15 in NSG-MHC DKO mice reduces CD8 T cell proliferation. + Taken together, these results demonstrate that transplantation of unfractionated UCB as described above in cells expressing human IL15 increases T cell proliferation. + Reduces the expression of monocytic cells and CD4 + CD8 at the expense of T cells + This suggests a preference for T cell expression.

[0360] Example 8 - Transplantation of Unfractionated Human UCB into NSG Mouse Strains with Reduced Irradiation and T Cell Engraftment Eight to twelve week old NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7) (Hu-IL15) mice (lines 7 and 5, respectively, in Table 1 above) were irradiated with 100 cGy radiation and then injected with 5 × 10 4 CD34 + Human hematopoietic stem cells (HSCs) and 1.0 × 10 6Human CD3 + Unfractionated human umbilical cord blood (UCB) containing T cells was transplanted. The AAV-IL4 vector was also introduced into the mice to express IL4. The radiation dose and the number of human CD3+ T cells transplanted in unfractionated UCB were approximately half that of the experiment in Example 7. 13 / 13 and 14 / 14 NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7) (Hu-IL15) mice survived for 3 weeks after irradiation and transplantation (Figure 10B), and 12 / 13 and 9 / 14 NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7) (Hu-IL15) mice survived for 3 weeks after irradiation and transplantation (Figure 10E). These results indicate that reduced irradiation, reduced human CD3+ T cell transfer, and / or expression of AAV-IL4 increases survival of NSG mice expressing human-IL15.

[0361] The percentage of human immune cells expressing human CD45 in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice was assessed 3 weeks after irradiation and transplantation (Figures 10A and 10B). + The mean percentage of leukocytes was approximately 18% and 25% in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, respectively. + The mean percentage of T cells was 100% total CD3+ in NSG-MHC DKO Tg(Hu-IL15) and NSG-MHC DKO mice. + Approximately 97% of T cells were human CD19 + The average percentage of B cells was approximately 1% of total CD45+ cells in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, respectively. + The mean percentage of T cells was 100% of total CD4 T cells in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, respectively. +Approximately 72% and 80% of T cells were human CD8 + The mean percentage of T cells was 100% total CD8+ / 100% in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, respectively. + Approximately 15% and 10% of T cells were human CD56 + The average expression of natural killer cells was approximately 1% of total CD45+ cells in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7) (Hu-IL15) mice. Collectively, these results suggest that expression of MHC DKO alleles and / or Hu-IL7 contributes to the relative abundance of human CD45+ cells in NSG mice transplanted with unfractionated UCB as described above. + Leukocyte expression, human CD4 + T cell expression, and human CD8 + This suggests that it alters T cell expression.

[0362] The mean percentages of various human T cell populations expressed in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice were also assessed 3 weeks after irradiation and transplantation (Figures 10C, 10D). + CD38 + The mean percentage of T cells was 100% in total CD4 T cells in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice, respectively. + CD38 + Approximately 65% ​​of T cells were human CD4 + HLA-DR + The mean percentages of T cells were total CD4 + HLA-DR + Approximately 5% and 20% of T cells were human CD8 + CD38 + The mean percentages of T cells were total and CD8 + CD38 + Approximately 70% and 50% of T cells were human CD8 + HLA-DR+ The mean percentages of T cells were total and CD8 + HLA-DR + These results suggest that the expression of MHC DKO alleles and / or Hu-IL7 expression significantly increased the expression of human CD4 T cells in NSG mice transplanted with unfractionated UCB as described above. + HLA-DR + T cell expression, CD8 + CD38 + T cell expression, and CD8 + HLA-DR + This suggests that it alters T cell expression.

[0363] The percentage of human CD45+ cells among total CD45+ cells in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice was also assessed 3, 6, and 9 weeks after irradiation and transplantation (Figure 10E). The average percentage of human CD45+ cells decreased from approximately 18% to approximately 10% to approximately 8% in NSG-MHC DKO Tg(Hu-IL15) mice 3, 6, and 9 weeks after irradiation and transplantation. The average percentage of human CD45+ cells was approximately 25%, 30%, and 32% in NSG-Tg(Hu-IL7)(Hu-IL15) mice 3, 6, and 9 weeks after irradiation and transplantation. Of these human CD45+ cells, approximately 92% were CD3+ T cells in NSG-MHC DKO Tg(Hu-IL15) and NSG-Tg(Hu-IL7)(Hu-IL15) mice (Figure S10F). Collectively, these results suggest that expression of the MHC DKO allele reduces the percentage of human CD45+ cells from 3 to 9 weeks in NSG mice transplanted with unfractionated UCB as described above, relative to NSG mice that do not express the MHC DKO allele and express Hu-IL7.

[0364] Example 9 – Split cell injection of unfractionated UCB into NSG mouse strain NSG-MHC DKO Tg(Hu-IL15) mice (line 7) were treated with split cell injections for human transplantation. These split cell injections were performed with CD34 + Hematopoietic stem cells (HSCs) are selected (e.g., isolated) from human UCB and transplanted (injected) into NSG-MHC DKO Tg(Hu-IL15) mice. The flow-through from this selection, which contains at least T cells, B cells, macrophages, dendritic cells, and natural killer (NK) cells, is referred to as the negative fraction. The negative fraction is cryopreserved and transferred to NSG-MHC DKO Tg(Hu-IL15) mice, where these mice are transfected with CD34 + HSCs are transplanted (injected) 6 weeks later.

[0365] The mean percentage of human immune cells expressing human CD45 in NSG-MHC DKO Tg(Hu-IL15) mice was assessed 6 and 9 weeks after human UCB split cell transplantation (Figures 11A-11C). + The average percentage of leukocytes was approximately 18% of the total in NSG-MHC DKO Tg(Hu-IL15). This percentage of human CD45+ cells increased from approximately 1%-25% to approximately 2%-40% from approximately 6 to 9 weeks after split cell transplantation in NSG-MHC DKO Tg(Hu-IL15) mice (Figure 11C). + The mean percentage of T cells was 100% in total CD3 T cells in NSG-MHC DKO Tg(Hu-IL15) mice. + Approximately 1% of T cells. Human CD19 + The average percentage of B cells was approximately 90% of the total CD45+ cells in NSG-MHC DKO Tg(Hu-IL15) mice. + The mean percentage of NK cells was 100% in total CD56 cells in NSG-MHC DKO Tg(Hu-IL15) mice. + Approximately 2% of the cells were human CD33 + The mean percentage of myeloid cells was 100% total CD33 in NSG-MHC DKO Tg(Hu-IL15) mice. +Approximately 3% of the cells (Figs. 11A and 11B). Taken together, these results suggest that the percentage of human CD3+ T cells decreases with split cell transplantation, as described above (compare Fig. 10F above with Figs. 11A and 11B). Furthermore, human CD45 + Cellular expression increases from 6 to 9 weeks.

[0366] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may include the entire document.

[0367] The indefinite articles "a" and "an," as used in this specification and claims, unless expressly indicated to the contrary, should be understood to mean "at least one."

[0368] Unless expressly indicated to the contrary, it should also be understood that in any method claimed herein that includes more than one step or act, the order of the method steps or acts is not necessarily limited to the order in which the method steps or acts are described.

[0369] In the claims and the above specification, all transitional phrases (e.g., "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," etc.) are to be understood to mean open ended, i.e., including, but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" shall be closed or semi-closed transitional phrases, respectively, as set forth in the U.S. Patent Office Manual of Patent Examining Procedure, Section 2111.03.

[0370] The terms "about" and "substantially" preceding a numerical value mean ±10% of the stated numerical value.

[0371] Where a range of values ​​is provided, each value between the upper and lower limits of the range is specifically contemplated and described herein.

Claims

1. 1. An immunodeficient non-obese diabetic (NOD) mouse, (a) an endogenous Il2rg allele comprising a null mutation, an endogenous Prkdc allele comprising a null mutation, and an endogenous Kit allele comprising a null mutation; and (b) a transgene encoding human interleukin 3 (huIL3), a transgene encoding human granulocyte-macrophage colony-stimulating factor (huGM-CSF), and a transgene encoding human Steel factor (huSCF); Immunodeficient mice containing.

2. The immunodeficient mouse of claim 1 , which has been transplanted with human hematopoietic stem cells.

3. The immunodeficient mouse of claim 1 , which has been transplanted with human peripheral blood mononuclear cells.

4. The immunodeficient mouse according to any one of claims 1 to 3, which has been transplanted with pathological human cells.

5. The immunodeficient mouse of claim 4 , wherein the pathological human cells are obtained from a subject with a genetic disorder.

6. The immunodeficient mouse of claim 5 , wherein the genetic disorder is facioscapulohumeral muscular dystrophy (FSHD).

7. The immunodeficient mouse of claim 6 , wherein the pathological human cells are human muscle cells.

8. The immunodeficient mouse of claim 7 , wherein the human muscle cells are CD56+ muscle stem cells.

9. Administering human hematopoietic stem cells to the non-irradiated immunodeficient mouse of claim 1, wherein the human HSCs develop into innate immune cells; and administering human diseased cells to said non-irradiated immunodeficient mice; A method that encompasses

10. about 10 4 ~about 10 6 10. The method of claim 9, wherein human HSCs are administered.

11. The method of claim 9 or 10, wherein the human pathological cells are administered about 4 to about 10 weeks after administration of the human HSCs.

12. about 10 4 ~about 10 6 The method of any one of claims 9 to 11, wherein human pathological cells, optionally muscle cells, and optionally CD56+ muscle stem cells are administered.

13. 13. The method of claim 12, wherein the human diseased cells are obtained from a subject with facioscapulohumeral muscular dystrophy (FSHD).

14. The method of any one of claims 9 to 13, further comprising administering a therapeutic modality to said immunodeficient mouse.

15. The method of any one of claims 9 to 14, further comprising assaying for a response of said innate immune cells to said human diseased cells.

16. 16. The method of claim 15, wherein the response is an inflammatory response.

17. 1. An immunodeficient non-obese diabetic (NOD) mouse, (a) Endogenous Il2rg allele containing a null mutation, endogenous Prkdc allele containing a null mutation, endogenous H2-K allele containing a null mutation (H2-K null ); endogenous H2-D alleles containing null mutations (H2-D null ); endogenous H2-A alleles containing null mutations (H2-A null ); and (b) a transgene encoding human interleukin 15 (huIL15); Immunodeficient mice containing.

18. 1. An immunodeficient non-obese diabetic (NOD) mouse, (a) an endogenous Il2rg allele containing a null mutation and an endogenous Prkdc allele containing a null mutation; and (b) a transgene encoding human interleukin 15 (huIL15) and a transgene encoding human interleukin 7 (huIL7); Immunodeficient mice containing.

19. Administering human hematopoietic stem cells (HSCs) or human peripheral blood mononuclear cells (PBMCs) to the immunodeficient mouse of claim 17 or 18, wherein the human HSCs develop into innate immune cells, optionally wherein the mouse is not irradiated; and administering human diseased cells to said immunodeficient mouse; A method that encompasses

20. about 10 4 ~about 10 6 20. The method of claim 19, wherein human HSCs or human PBMCs are administered.

21. 21. The method of claim 19 or 20, wherein the human pathological cells are administered about 4 to about 10 weeks after administration of the human HSCs or human PBMCs.

22. about 10 4 ~about 10 6 The method according to any one of claims 19 to 21, wherein human pathological cells are administered.

23. 23. The method of any one of claims 19 to 22, further comprising administering a therapeutic modality to said immunodeficient mouse.

24. The method of any one of claims 19 to 23, further comprising assaying for a response of said innate immune cells to said human diseased cells.

25. 25. The method of claim 24, wherein the response is an inflammatory response.