Process for generating TIL products using PD-1 / TIGIT TALEN double knockdown

Abstract

To provide a method for gene editing at least a portion of a therapeutic TIL population to enhance their therapeutic efficacy. The present invention provides a method for preparing expanded tumor-infiltrating lymphocytes (TILs) with reduced expression of PD-1 and TIGIT using sequential electroporation of two TALEN systems targeting PD-1 and TIGIT, which have applications in therapeutic treatment regimens for cancer patients.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 375,194, filed September 9, 2022, U.S. Provisional Application No. 63 / 376,263, filed September 19, 2022, and U.S. Provisional Application No. 63 / 489,171, filed March 8, 2023, all of which are incorporated by reference in their entirety. [Background technology]

[0002] The treatment of large refractory cancers using adoptive autologous transfer of tumor-infiltrating lymphocytes (TILs) represents a powerful approach to treating patients with poor prognosis. Gattinoni, et al., Nat. Rev. Immunol. 2006, 6, 383-393. TILs are dominated by T cells, and IL-2-based TIL expansion followed by the "rapid expansion process" (REP) has become the preferred method of TIL expansion due to its speed and efficiency. Dudley, et al., Science 2002, 298, 850-54; Dudley, et al., J. Clin. Oncol. 2005, 23, 2346-57; Dudley, et al., J. Clin. Oncol. 2008, 26, 5233-39; Riddell, et al., Science 1992, 257, 238-41; Dudley, et al., J. Immunother. 2003, 26, 332-42. Many approaches to improve response to TIL therapy in melanoma and to extend TIL therapy to other tumor types have met with limited success, and the field remains challenging. Goff et al., J. Clin. Oncol. 2016, 34, 2389-97; Dudley et al., J. Clin. Oncol. 2008, 26, 5233-39; Rosenberg et al., Clin. Cancer Res. 2011, 17, 4550-57. Combination studies with single immune checkpoint inhibitors have also been described, but further research is ongoing and additional treatment options are needed (Kverneland et al., Oncotarget, 2020, 11(22), 2092-2105).

[0003] The present invention provides methods for gene editing at least a portion of a therapeutic TIL population to enhance their therapeutic efficacy by performing a sequential double KO process that utilizes spaced delivery of TALEN systems targeting PD-1 and TIGIT to eliminate the risk of chromosomal translocations. Summary of the Invention

[0004] In some embodiments, provided herein are methods for preparing expanded tumor-infiltrating lymphocytes (TILs) having reduced expression of PD-1 and TIGIT, comprising: (a) culturing the first TIL population in a first cell culture medium containing IL-2 for about 5-7 days to produce a second TIL population; (b) activating the second TIL population for about 2-4 days to produce a third TIL population; (c) introducing a first TALE nuclease (TALEN) system targeting a first gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the third TIL population to produce a fourth TIL population; (d) placing the fourth TIL population in the first cell culture medium containing IL-2 for about 2-3 days; (e) introducing a second TALEN system targeting a second gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the fourth TIL population to produce a fifth TIL population, wherein the first gene and the second gene are different; (f) culturing the fifth TIL population in a second cell culture medium comprising antigen-presenting cells (APCs), OKT-3, and IL-2 for about 7 to 11 days to produce a sixth TIL population having reduced expression of the first gene and the second gene.

[0005] In some embodiments, the step of activating the second TIL population occurs for about 2 days. In some embodiments, the step of activating the second TIL population occurs for about 3 days. In some embodiments, the step of activating the second TIL population occurs for about 4 days. In some embodiments, the step of culturing the first TIL population occurs for about 5 days. In some embodiments, the step of culturing the first TIL population occurs for about 6 days. In some embodiments, the step of culturing the first TIL population occurs for about 7 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 8 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 9 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 10 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 11 days. In some embodiments, all steps are completed within a period of about 21 days. In some embodiments, all steps are completed within a period of about 19-22 days. In some embodiments, all steps are completed within a period of about 19-21 days. In some embodiments, all steps are completed within a period of about 20-22 days. In some embodiments, all steps are completed within a period of about 24 days. In some embodiments, all steps are completed within a period of about 22 days.

[0006] In some embodiments, the method further comprises an overnight incubation step after introducing the first and / or second TALE-nuclease system. In some embodiments, the method further comprises an overnight incubation step after introducing the first TALE-nuclease system and an overnight incubation step after introducing the second TALE-nuclease system. In some embodiments, the overnight incubation steps are performed at about 28-32°C at about 5% CO2. In some embodiments, step (d) comprises incubating the fourth TIL population at about 37°C at about 5% CO2.

[0007] In some embodiments, activating the second TIL population is performed using an anti-CD3 agonist and an anti-CD28 agonist. In some embodiments, activating the second TIL population is performed using TransAct. In some embodiments, activating the second TIL population is performed using TransAct at a dilution of 1:17.5.

[0008] In some embodiments, the first TALEN system targets the gene encoding PD-1, and the second TALEN system targets the gene encoding TIGIT. In some embodiments, the first TALEN system targets the gene encoding TIGIT, and the second TALEN system targets the gene encoding PD-1. In some embodiments, the target sequence of the PD-1-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 18, and the target sequence of the TIGIT-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 23 or 28. In some embodiments, the first TALEN system comprises a first half-TALE pair targeting a first gene, the second TALEN system comprises a second half-TALE pair targeting a second gene, and the introduction of the first TALEN system comprises a first electroporation into a third TIL population with a first mRNA pair encoding the first half-TALE pair, and / or the introduction of the second TALEN system comprises a second electroporation into a fifth TIL population with a second mRNA pair encoding the second half-TALE pair. In some embodiments, the first half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 15 and 17. In some embodiments, the second half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 20 and 22. In some embodiments, the second half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 25 and 27. In some embodiments, in the first electroporation, the first mRNA pair is introduced at about 1-2 μg of mRNA / million cells of the third TIL population, and / or in the second electroporation, the second mRNA pair is introduced at about 1-2 μg of mRNA / million cells of the fifth TIL population.

[0009] In some embodiments, step (c) is preceded by washing the third TIL population in a cytoporation buffer. In some embodiments, the first TIL population is obtained from tumor tissue excised from a patient. In some embodiments, the first TIL population is obtained from a sample of tumor tissue produced by surgical resection, needle biopsy, core biopsy, minibiopsy, or other means for obtaining tumor tissue from a patient. In some embodiments, the method further comprises digesting the tumor tissue in an enzyme medium to produce a tumor digest. In some embodiments, the enzyme medium comprises DNase. In some embodiments, the enzyme medium comprises collagenase. In some embodiments, the enzyme medium comprises neutral protease. In some embodiments, the enzyme medium comprises hyaluronidase. In some embodiments, the IL-2 concentration is about 10,000 IU / mL to about 5,000 IU / mL or about 1000 IU / mL to 5000 IU / mL.

[0010] In some embodiments, one or more of steps (a)-(f) are performed in a closed system. In some embodiments, the transition from step (a) to step (b) occurs without opening the system. In some embodiments, the transition from step (b) to step (c) occurs without opening the system. In some embodiments, the transition from step (c) to step (d) occurs without opening the system. In some embodiments, the transition from step (d) to step (e) occurs without opening the system. In some embodiments, the transition from step (e) to step (f) occurs without opening the system. In some embodiments, the tumor tissue is processed into a plurality of tumor fragments. In some embodiments, the plurality of tumor fragments is added to the closed system. In some embodiments, no more than 150 of the plurality of tumor fragments, no more than 100 of the plurality of tumor fragments, or no more than 50 of the plurality of tumor fragments is added to the closed system.

[0011] In some embodiments, a closed system is used for TIL expansion, as described herein. In some embodiments, a single bioreactor is used. In some embodiments, the single bioreactor used is, for example, a GREX-10 or a GREX-100M. In some embodiments, the closed system bioreactor is a single bioreactor. In some embodiments, the transition from the first expansion by priming to the rapid second expansion involves scaling up the vessel size. In some embodiments, the first expansion by priming is performed in a smaller vessel than the rapid second expansion. In some embodiments, the first expansion by priming is performed in a GREX-100M, and the rapid second expansion is performed in a GREX-500M.

[0012] In some embodiments, provided herein are methods for preparing expanded tumor-infiltrating lymphocytes (TILs) having reduced expression of PD-1 and TIGIT, comprising: (a) obtaining a first population of TILs from a tumor sample resected from a patient by processing the tumor sample obtained from the patient into a plurality of tumor fragments, or from a tumor sample obtained from a patient by surgical resection, needle biopsy, core biopsy, mini-biopsy, or other means; (b) culturing the first TIL population in a first cell culture medium containing IL-2 for about 5-7 days to produce a second TIL population; (c) activating the second TIL population for about 2-4 days to produce a third TIL population; (d) introducing a first TALE nuclease (TALEN) system targeting a first gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the third TIL population to produce a fourth TIL population; (e) placing the fourth TIL population in the first cell culture medium containing IL-2 for about 2-3 days; (f) introducing a second TALEN system targeting a second gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the fourth TIL population to produce a fifth TIL population, wherein the first gene and the second gene are different; (g) culturing the fifth TIL population in a second cell culture medium comprising antigen-presenting cells (APCs), OKT-3, and IL-2 for about 7 to 11 days to produce a sixth TIL population having reduced expression of the first gene and the second gene.

[0013] In some embodiments, the method further comprises (h) harvesting the sixth population of TILs obtained from step (g). In some embodiments, the method further comprises (i) transferring the harvested therapeutic TIL population from step (h) to an infusion bag. In some embodiments, the method further comprises (j) cryopreserving the infusion bag from step (i) using a cryopreservation process.

[0014] In some embodiments, the step of activating the second TIL population occurs for about 2 days. In some embodiments, the step of activating the second TIL population occurs for about 3 days. In some embodiments, the step of activating the second TIL population occurs for about 4 days. In some embodiments, the step of culturing the first TIL population occurs for about 5 days. In some embodiments, the step of culturing the first TIL population occurs for about 6 days. In some embodiments, the step of culturing the first TIL population occurs for about 7 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 8 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 9 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 10 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 11 days. In some embodiments, all steps are completed within a period of about 21 days. In some embodiments, all steps are completed within a period of about 19-22 days. In some embodiments, all steps are completed within a period of about 19-21 days. In some embodiments, all steps are completed within a period of about 20-22 days. In some embodiments, all steps are completed within a period of about 24 days. In some embodiments, all steps are completed within a period of about 22 days.

[0015] In some embodiments, the method further comprises an overnight incubation step after introducing the first and / or second TALE-nuclease system. In some embodiments, the method further comprises an overnight incubation step after introducing the first TALE-nuclease system and an overnight incubation step after introducing the second TALE-nuclease system. In some embodiments, the overnight incubation step is performed at about 28-32°C at about 5% CO2. In some embodiments, step (d) comprises incubating the fourth TIL population at about 37°C at about 5% CO2.

[0016] In some embodiments, activating the second TIL population is performed using an anti-CD3 agonist and an anti-CD28 agonist. In some embodiments, activating the second TIL population is performed using TransAct. In some embodiments, activating the second TIL population is performed using TransAct at a dilution of 1:17.5.

[0017] In some embodiments, the first TALEN system targets the gene encoding PD-1, and the second TALEN system targets the gene encoding TIGIT. In some embodiments, the first TALEN system targets the gene encoding TIGIT, and the second TALEN system targets the gene encoding PD-1. In some embodiments, the target sequence of the PD-1-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 18, and the target sequence of the TIGIT-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 23 or 28. In some embodiments, the first TALEN system comprises a first half-TALE pair targeting a first gene, the second TALEN system comprises a second half-TALE pair targeting a second gene, and the introduction of the first TALEN system comprises a first electroporation into a third TIL population with a first mRNA pair encoding the first half-TALE pair, and / or the introduction of the second TALEN system comprises a second electroporation into a fifth TIL population with a second mRNA pair encoding the second half-TALE pair. In some embodiments, the first half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 15 and 17. In some embodiments, the second half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 20 and 22. In some embodiments, the second half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 25 and 27. In some embodiments, in the first electroporation, the first mRNA pair is introduced at about 1-2 μg of mRNA / million cells of the third TIL population, and / or in the second electroporation, the second mRNA pair is introduced at about 1-2 μg of mRNA / million cells of the fifth TIL population.

[0018] In some embodiments, step (d) is preceded by washing the third TIL population in cytoporation buffer. In some embodiments, the first TIL population is obtained from tumor tissue excised from a patient. In some embodiments, the first TIL population is obtained from a sample of tumor tissue produced by surgical resection, needle biopsy, core biopsy, minibiopsy, or other means for obtaining tumor tissue from a patient. In some embodiments, the method further comprises digesting the tumor tissue in an enzyme medium to produce a tumor digest. In some embodiments, the enzyme medium comprises DNase. In some embodiments, the enzyme medium comprises collagenase. In some embodiments, the enzyme medium comprises neutral protease. In some embodiments, the enzyme medium comprises hyaluronidase. In some embodiments, the IL-2 concentration is about 10,000 IU / mL to about 5,000 IU / mL or about 1000 IU / mL to 5000 IU / mL.

[0019] In some embodiments, one or more of steps (b) through (g) are performed in a closed system. In some embodiments, the transition from step (b) to step (c) occurs without opening the system. In some embodiments, the transition from step (c) to step (d) occurs without opening the system. In some embodiments, the transition from step (d) to step (e) occurs without opening the system. In some embodiments, the transition from step (e) to step (f) occurs without opening the system. In some embodiments, the transition from step (f) to step (g) occurs without opening the system. In some embodiments, the tumor tissue is processed into a plurality of tumor fragments. In some embodiments, the plurality of tumor fragments is added to the closed system. In some embodiments, no more than 150 of the plurality of tumor fragments, no more than 100 of the plurality of tumor fragments, or no more than 50 of the plurality of tumor fragments is added to the closed system.

[0020] In some embodiments, provided herein is a gene-edited tumor-infiltrating lymphocyte (TIL) population, comprising an expanded TIL population having reduced expression of a first gene and a second gene produced by the methods disclosed herein.

[0021] In some embodiments, about 64% of the expanded TIL population comprises knockouts of both PD-1 and TIGIT. In some embodiments, the expanded TIL population comprises a therapeutically effective dose of TILs. In some embodiments, a therapeutically effective dose of TILs comprises about 1 x 10 9 ~Approx. 1×10 11 Includes TILs.

[0022] In some embodiments, disclosed herein is a pharmaceutical composition comprising a population of gene-edited TILs disclosed herein and a pharmaceutically acceptable carrier.

[0023] In some embodiments, provided herein are methods for treating a cancer patient, comprising administering to the cancer patient a therapeutically effective dose of a gene-edited TIL population or pharmaceutical composition disclosed herein. In some embodiments, the cancer is selected from the group consisting of melanoma, metastatic melanoma, ovarian cancer, cervical cancer, non-small cell lung cancer (NSCLC), metastatic NSCLC, lung cancer, bladder cancer, breast cancer, cancer caused by human papillomavirus, head and neck cancer (including head and neck squamous cell carcinoma (HNSCC)), renal cancer, and renal cell carcinoma.

[0024] In some embodiments, provided herein is a method for treating a cancer patient, comprising: (a) obtaining a first population of TILs from a tumor sample resected from a cancer patient by processing the tumor sample obtained from the cancer patient into a plurality of tumor fragments, or from a tumor sample obtained from a cancer patient by surgical resection, needle biopsy, core biopsy, mini-biopsy, or other means; (b) culturing the first TIL population in a first cell culture medium containing IL-2 for about 5-7 days to produce a second TIL population; (c) activating the second TIL population for about 2-4 days to produce a third TIL population; (d) introducing a first TALE nuclease (TALEN) system targeting a first gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the third TIL population to produce a fourth TIL population; (e) placing the fourth TIL population in the first cell culture medium containing IL-2 for about 2-3 days; (f) introducing a second TALEN system targeting a second gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the fourth TIL population to produce a fifth TIL population, wherein the first gene and the second gene are different; (g) culturing the fifth TIL population in a second cell culture medium comprising antigen-presenting cells (APCs), OKT-3, and IL-2 for about 7 to 11 days to produce a sixth TIL population having reduced expression of the first gene and the second gene; (h) administering a therapeutically effective dose of the sixth population of TILs to the cancer patient.

[0025] In some embodiments, the method further comprises harvesting the sixth population of TILs obtained from step (g). In some embodiments, the method further comprises transferring the harvested therapeutic TIL population to an infusion bag. In some embodiments, the method further comprises cryopreserving the infusion bag using a cryopreservation process. In some embodiments, the cancer is selected from the group consisting of melanoma, metastatic melanoma, ovarian cancer, cervical cancer, non-small cell lung cancer (NSCLC), metastatic NSCLC, lung cancer, bladder cancer, breast cancer, cancer caused by human papillomavirus, head and neck cancer (including head and neck squamous cell carcinoma (HNSCC)), renal cancer, and renal cell carcinoma.

[0026] In some embodiments, the step of activating the second TIL population occurs for about 2 days. In some embodiments, the step of activating the second TIL population occurs for about 3 days. In some embodiments, the step of activating the second TIL population occurs for about 4 days. In some embodiments, the step of culturing the first TIL population occurs for about 5 days. In some embodiments, the step of culturing the first TIL population occurs for about 6 days. In some embodiments, the step of culturing the first TIL population occurs for about 7 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 8 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 9 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 10 days. In some embodiments, the step of culturing the fifth TIL population occurs for about 11 days. In some embodiments, all steps are completed within a period of about 21 days. In some embodiments, all steps are completed within a period of about 19-22 days. In some embodiments, all steps are completed within a period of about 19-21 days. In some embodiments, all steps are completed within a period of about 20-22 days. In some embodiments, all steps are completed within a period of about 24 days. In some embodiments, all steps are completed within a period of about 22 days.

[0027] In some embodiments, the method further comprises an overnight incubation step after introducing the first and / or second TALE-nuclease system. In some embodiments, the method further comprises an overnight incubation step after introducing the first TALE-nuclease system and an overnight incubation step after introducing the second TALE-nuclease system. In some embodiments, the overnight incubation step is performed at about 28-32°C at about 5% CO2. In some embodiments, step (d) comprises incubating the fourth TIL population at about 37°C at about 5% CO2.

[0028] In some embodiments, activating the second TIL population is performed using an anti-CD3 agonist and an anti-CD28 agonist. In some embodiments, activating the second TIL population is performed using TransAct. In some embodiments, activating the second TIL population is performed using TransAct at a dilution of 1:17.5.

[0029] In some embodiments, the first TALEN system targets the gene encoding PD-1, and the second TALEN system targets the gene encoding TIGIT. In some embodiments, the first TALEN system targets the gene encoding TIGIT, and the second TALEN system targets the gene encoding PD-1. In some embodiments, the target sequence of the PD-1-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 18, and the target sequence of the TIGIT-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 23 or 28. In some embodiments, the first TALEN system comprises a first half-TALE pair targeting a first gene, the second TALEN system comprises a second half-TALE pair targeting a second gene, and the introduction of the first TALEN system comprises a first electroporation into a third TIL population with a first mRNA pair encoding the first half-TALE pair, and / or the introduction of the second TALEN system comprises a second electroporation into a fifth TIL population with a second mRNA pair encoding the second half-TALE pair. In some embodiments, the first half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 15 and 17. In some embodiments, the second half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 20 and 22. In some embodiments, the second half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 25 and 27. In some embodiments, in the first electroporation, the first mRNA pair is introduced at about 1-2 μg of mRNA / million cells of the third TIL population, and / or in the second electroporation, the second mRNA pair is introduced at about 1-2 μg of mRNA / million cells of the fifth TIL population.

[0030] In some embodiments, step (d) is preceded by washing the third TIL population in cytoporation buffer. In some embodiments, the first TIL population is obtained from tumor tissue excised from a patient. In some embodiments, the first TIL population is obtained from a sample of tumor tissue produced by surgical resection, needle biopsy, core biopsy, minibiopsy, or other means for obtaining tumor tissue from a patient. In some embodiments, the method further comprises digesting the tumor tissue in an enzyme medium to produce a tumor digest. In some embodiments, the enzyme medium comprises DNase. In some embodiments, the enzyme medium comprises collagenase. In some embodiments, the enzyme medium comprises neutral protease. In some embodiments, the enzyme medium comprises hyaluronidase. In some embodiments, the IL-2 concentration is about 10,000 IU / mL to about 5,000 IU / mL or about 1000 IU / mL to 5000 IU / mL.

[0031] In some embodiments, one or more of steps (b) through (g) are performed in a closed system. In some embodiments, the transition from step (b) to step (c) occurs without opening the system. In some embodiments, the transition from step (c) to step (d) occurs without opening the system. In some embodiments, the transition from step (d) to step (e) occurs without opening the system. In some embodiments, the transition from step (e) to step (f) occurs without opening the system. In some embodiments, the transition from step (f) to step (g) occurs without opening the system. In some embodiments, the tumor tissue is processed into a plurality of tumor fragments. In some embodiments, the plurality of tumor fragments is added to the closed system. In some embodiments, no more than 150 of the plurality of tumor fragments, no more than 100 of the plurality of tumor fragments, or no more than 50 of the plurality of tumor fragments is added to the closed system.

[0032] In some embodiments, a non-myeloablative lymphodepletion regimen is administered to the cancer patient prior to administering the therapeutically effective dose of the sixth population of TILs in step (h). In some embodiments, the method further comprises treating the cancer patient with a high-dose IL-2 regimen starting the day after administering the therapeutically effective dose of the sixth population of TILs to the cancer patient in step (h).

[0033] In some embodiments, any of the methods described herein are optionally performed in a closed system.

[0034] In some embodiments, provided herein is a method of preparing genetically modified tumor infiltrating lymphocytes (TILs) comprising reduced expression of TIGIT, the method comprising: (a) introducing into TILs nucleic acid(s) encoding one or more first transcription activator-like effector nucleases (TALE nucleases) capable of selectively inactivating the gene encoding TIGIT by DNA cleavage, wherein the one or more first TALE nucleases comprise a TALE nuclease directed against the nucleic acid sequence of SEQ ID NO: 23 or 28, and optionally introducing one or more second TALE nucleases capable of selectively inactivating the gene encoding PD-1 by DNA cleavage; (b) expanding the TIL.

[0035] In some embodiments, introducing the nucleic acid(s) encoding the one or more first TALE-nucleases into the TILs comprises an electroporation step. In some embodiments, the nucleic acid(s) encoding the one or more first TALE-nucleases are RNA, and the RNA is introduced into the TILs by electroporation. In some embodiments, the method further comprises, prior to the introducing step, activating the TILs by culturing the TILs in cell culture medium in the presence of OKT-3 for about 1-3 days. In some embodiments, the method further comprises, after the introducing step and prior to the expansion step, resting the TILs in cell culture medium containing IL-2 for about 1 day. In some embodiments, the method further comprises, prior to the introducing step, cryopreserving the TILs, and subsequently thawing and culturing the TILs in cell culture medium containing IL-2 for about 1-3 days. In some embodiments, the IL-2 in the resting step is at a concentration of about 3000 IU / ml.

[0036] In some embodiments, the one or more first TALE nucleases are each composed of a first half-TALE nuclease and a second half-TALE nuclease. In some embodiments, the first half-TALE nuclease is a first fusion protein composed of a first TALE nucleic acid binding domain fused to a first nuclease catalytic domain, and the second half-TALE nuclease is a second fusion protein composed of a second TALE nucleic acid binding domain fused to a second nuclease catalytic domain. In some embodiments, the first TALE nucleic acid binding domain has a first amino acid sequence and the second TALE nucleic acid binding domain has a second amino acid sequence, wherein the first amino acid sequence is different from the second amino acid sequence. In some embodiments, the first nuclease catalytic domain has a first amino acid sequence and the second nuclease catalytic domain has a second amino acid sequence, wherein the first amino acid sequence is the same as the second amino acid sequence. In some embodiments, the first nuclease catalytic domain and the second nuclease catalytic domain both have the amino acid sequence of Fok-I. In some embodiments, the first half-TALE nuclease and the second half-TALE nuclease form a heterodimeric DNA cleavage complex to perform DNA cleavage at a target site in the gene encoding TIGIT, wherein the target site in the gene encoding TIGIT comprises the nucleic acid sequence of SEQ ID NO: 23 or 28. In some embodiments, the first half-TALE nuclease recognizes a first half target located at a first position of the target site in the gene encoding TIGIT, and the second half-TALE nuclease recognizes a second half target located at a second position of the target site in the gene encoding TIGIT that does not overlap with the first position. In some embodiments, the TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 25, and SEQ ID NO: 27. In some embodiments, the TALE nuclease comprises a sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 25, and SEQ ID NO: 27.In some embodiments, the first half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 20, and the second half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 22. In some embodiments, the first half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 20, and the second half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 25, and the second half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 27. In some embodiments, the first half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 25, and the second half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 27.

[0037] In some embodiments, the expanded TILs comprise sufficient TILs to administer a therapeutically effective dose of TILs to a subject in need thereof. In some embodiments, a therapeutically effective dose of expanded TILs is about 1 x 10 9 ~Approx. 9×10 10 Includes TILs.

[0038] In some embodiments, provided herein is a population of expanded tumor-infiltrating lymphocytes (TILs) comprising reduced expression of TIGIT and optionally PD-1, wherein the population of expanded TILs can be obtained by the methods disclosed herein.

[0039] In some embodiments, provided herein is a transcription activator-like effector nuclease (TALE nuclease) that recognizes and affects DNA cleavage at a target site within a gene encoding TIGIT, wherein the target site comprises the nucleic acid sequence of SEQ ID NO: 23 or 28.

[0040] In some embodiments, the TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 25, and SEQ ID NO: 27. In some embodiments, the TALE nuclease comprises a sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 25, and SEQ ID NO: 27. In some embodiments, the TALE nuclease is composed of a first half TALE nuclease and a second half TALE nuclease, wherein the first half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 20, and the second half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 22. In some embodiments, the first half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 20, and the second half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 22. In some embodiments, the TALE nuclease is composed of a first half TALE nuclease and a second half TALE nuclease, wherein the first half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 25, and the second half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 27. In some embodiments, the first half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 25, and the second half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 27.In some embodiments, the first half-TALE nuclease is a first fusion protein composed of a first TALE nucleic acid binding domain fused to a first nuclease catalytic domain, and the second half-TALE nuclease is a second fusion protein composed of a second TALE nucleic acid binding domain fused to a second nuclease catalytic domain. In some embodiments, the first TALE nucleic acid binding domain has a first amino acid sequence and the second TALE nucleic acid binding domain has a second amino acid sequence, where the first amino acid sequence is different from the second amino acid sequence. In some embodiments, the first nuclease catalytic domain has a first amino acid sequence and the second nuclease catalytic domain has a second amino acid sequence, where the first amino acid sequence is the same as the second amino acid sequence. In some embodiments, both the first nuclease catalytic domain and the second nuclease catalytic domain have the amino acid sequence of Fok-I. In some embodiments, the first half TALE nuclease and the second half TALE nuclease can form a heterodimeric DNA cleavage complex to perform DNA cleavage at a target site in the gene encoding TIGIT. In some embodiments, the first half TALE nuclease recognizes a first half target located at a first position of the target site in the gene encoding TIGIT, and the second half TALE nuclease recognizes a second half target located at a second position of the target site in the gene encoding TIGIT that does not overlap with the first position.

[0041] In some embodiments, the TALE nuclease is encoded by a nucleic acid sequence having at least 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 24, and SEQ ID NO: 26. In some embodiments, the TALE nuclease is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 24, and SEQ ID NO: 26. In some embodiments, the TALE nuclease is composed of a first half TALE nuclease and a second half TALE nuclease, wherein the first half TALE nuclease is encoded by a nucleic acid sequence having at least 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 19, and the second half TALE nuclease is encoded by a nucleic acid sequence having at least 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 21. In some embodiments, the first half TALE nuclease is encoded by the nucleic acid sequence of SEQ ID NO: 20, and the second half TALE nuclease is encoded by the nucleic acid sequence of SEQ ID NO: 22. In some embodiments, the TALE nuclease is composed of a first half TALE nuclease and a second half TALE nuclease, wherein the first half TALE nuclease is encoded by a nucleic acid sequence having at least 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 24, and the second half TALE nuclease is encoded by a nucleic acid sequence having at least 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 26. In some embodiments, the first half TALE nuclease is encoded by the amino acid sequence of SEQ ID NO: 24, and the second half TALE nuclease is encoded by the amino acid sequence of SEQ ID NO: 26.

[0042] In some embodiments, provided herein is a method for expanding genetically modified tumor infiltrating lymphocytes (TILs) into a therapeutic TIL population comprising reduced expression of TIGIT, the method comprising: (a) obtaining and / or receiving a first population of TILs from a tumor sample; (b) adding the first TIL population to the closed system; (c) performing a first expansion by culturing the first TIL population in a cell culture medium containing IL-2 to produce a second TIL population, wherein the first expansion is performed in a sealed container that provides a first gas permeable surface area, and the first expansion is performed for about 3 to 14 days to obtain the second TIL population, and the transition from step (b) to step (c) occurs without opening the system; and (d) introducing into the TILs nucleic acid(s) encoding one or more first transcription activator-like effector nucleases (TALE nucleases) capable of selectively inactivating the gene encoding TIGIT by DNA cleavage, wherein the one or more first TALE nucleases comprise TALE nucleases directed against a target site within the gene encoding TIGIT, the target site comprising the nucleic acid sequence of SEQ ID NO: 23 or 28, and the transition from step (c) to step (d) occurs without opening the system; (e) performing a second expansion of the TILs obtained from step (d) by culturing them in a cell culture medium comprising IL-2, OKT-3, and antigen-presenting cells (APCs) to produce a third TIL population, wherein the second expansion is performed for about 7 to 14 days to obtain a third TIL population, the third TIL population being a therapeutic TIL population, and wherein the second expansion is performed in a sealed container that provides a second gas-permeable surface area, and the transition from step (d) to step (e) occurs without opening the system. (f) harvesting the therapeutic TIL population obtained from step (e), wherein the transition from step (e) to step (f) occurs without opening the system.

[0043] In some embodiments, the nucleic acid(s) encoding the one or more first TALE nucleases are RNA. In some embodiments, the nucleic acid(s) encoding the one or more first TALE nucleases are introduced into the TILs by electroporation. In some embodiments, the method further comprises, prior to the introducing step, activating the TILs by culturing the TILs in cell culture medium in the presence of OKT-3 for about 1 to 3 days. In some embodiments, the OKT-3 is at a concentration of about 300 ng / ml. In some embodiments, the method further comprises, after the introducing step and prior to the second expansion step, resting the TILs in cell culture medium containing IL-2 for about 1 day. In some embodiments, the IL-2 in the resting step is at a concentration of about 3000 IU / ml. In some embodiments, steps (a)-(f) are carried out for about 13 days to about 29 days, optionally about 15 days, about 16 days, about 17 days, about 18 days, about 19 days, about 20 days, about 21 days, about 22 days, about 23 days, about 24 days, or about 25 days. In some embodiments, the nucleic acid(s) encoding the one or more first TALE nucleases are RNA, and the RNA is introduced into the TILs by electroporation.

[0044] In some embodiments, the one or more first TALE nucleases are each composed of a first half-TALE nuclease and a second half-TALE nuclease. In some embodiments, the first half-TALE nuclease is a first fusion protein composed of a first TALE nucleic acid binding domain fused to a first nuclease catalytic domain, and the second half-TALE nuclease is a second fusion protein composed of a second TALE nucleic acid binding domain fused to a second nuclease catalytic domain. In some embodiments, the first TALE nucleic acid binding domain has a first amino acid sequence and the second TALE nucleic acid binding domain has a second amino acid sequence, wherein the first amino acid sequence is different from the second amino acid sequence. In some embodiments, the first nuclease catalytic domain has a first amino acid sequence and the second nuclease catalytic domain has a second amino acid sequence, wherein the first amino acid sequence is the same as the second amino acid sequence. In some embodiments, the first nuclease catalytic domain and the second nuclease catalytic domain both have the amino acid sequence of Fok-I. In some embodiments, the first half TALE nuclease and the second half TALE nuclease can form a heterodimeric DNA cleavage complex to perform DNA cleavage at the target site. In some embodiments, the first half TALE nuclease recognizes a first half target located at a first position of the target site, and the second half TALE nuclease recognizes a second half target located at a second position of the target site that does not overlap with the first position. In some embodiments, the TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:27. In some embodiments, the TALE nuclease comprises a sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:27.In some embodiments, the first half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 20, and the second half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 22. In some embodiments, the first half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 20, and the second half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 22. In some embodiments, the first half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 25, and the second half TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 27. In some embodiments, the first half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 25, and the second half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 27.

[0045] In some embodiments, the harvested TILs comprise sufficient TILs to administer a therapeutically effective dose of TILs to a subject in need thereof. In some embodiments, a therapeutically effective dose of TILs is about 1 x 10 9 ~Approx. 9×10 10 Includes TILs. [Brief explanation of the drawings]

[0046] [Figure 1] Viability of TILs after successive electroporations. [Figure 2] LAG3 and PD-1 KO efficiency in CD3+ (Fig. 2A), CD8+ (Fig. 2B), and CD4+ (Fig. 2C) TILs. [Figure 3]Fold expansion (Figure 3A) and viability (Figure 3B) of simultaneously and sequentially electroporated TILs after REP. [Figure 4] Cell growth after stimulation on different days (Figure 4A), first electroporation PD-1 KO efficiency (Figure 4B), and second electroporation PD-1 KO efficiency (Figure 4C). [Figure 5] Percentage of TIL growth over a 3-day resting period with stimulation on different days (day 0, day 3, day 5, day 7). [Figure 6] PD-1 and TIGIT KO efficiency in total CD3+ TILs with 4-day and 2-day stimulation. [Figure 7] PD-1 and TIGIT KO efficiency in total CD8+ TILs with 4-day and 2-day stimulation. [Figure 8] PD-1 and TIGIT KO efficiency in total CD4+ TILs with 4-day and 2-day stimulation. [Figure 9] Frequency of PD-1 and TIGIT expression in CD3+ TILs. [Figure 10] 1 shows an exemplary process for expanding TILs by sequential electroporation of TALE nucleases directed against target sequences in PD-1 and TIGIT. [Figure 11] Figure 1 shows cell recovery after electroporation of different concentrations of PD-1 TALEN mRNA. [Figure 12] Figure 1 shows cell viability after electroporation of different concentrations of PD-1 TALEN mRNA. [Figure 13] Figure 1 shows cell doublings after electroporation of different concentrations of PD-1 TALEN mRNA. [Figure 14] Extrapolated total live cells after electroporation of different concentrations of PD-1 TALEN mRNA are shown. [Figure 15] Figure 1 shows the median PD-1 KO efficiency after electroporation of different concentrations of PD-1 TALEN mRNA. [Figure 16]The final PD-1 KO efficiency after electroporation of different concentrations of PD-1 TALEN mRNA is shown. [Figure 17] Figure 1 shows cell recovery after electroporation of different concentrations of TIGIT TALEN mRNA. [Figure 18] Figure 1 shows cell viability after electroporation with different concentrations of TIGIT TALEN mRNA. [Figure 19] Figure 1 shows the cell doublings after electroporation with different concentrations of TIGIT TALEN mRNA. [Figure 20] Extrapolated total live cells after electroporation of different concentrations of TIGIT TALEN mRNA are shown. [Figure 21] Figure 1 shows the median TIGIT KO efficiency after electroporation of different concentrations of TIGIT TALEN mRNA. [Figure 22] Figure 1 shows the final TIGIT KO efficiency after electroporation of different concentrations of TIGIT TALEN mRNA. [Figure 23A] FIG. 1 shows an exemplary process flow for genetic modification of PD-1 and TIGIT as part of a preferred embodiment of a TIL expansion method, including (A) an alternative electroporation method and (B) a method for scaling up TIL cultures during rapid expansion. [Figure 23B] FIG. 1 shows an exemplary process flow for genetic modification of PD-1 and TIGIT as part of a preferred embodiment of a TIL expansion method, including (A) an alternative electroporation method and (B) a method for scaling up TIL cultures during rapid expansion. [Figure 24] A and B show that adoptive transfer of PD1 / TIGIT dKO TILs leads to increased tumor control compared to PD1 sKO and mock controls. [Figure 25] Figure 1 shows similar recovery of TILs 21 days after adoptive transfer between PD1 sKO and PD1 / TIGIT dKO cells. [Figure 26A]The strongest KO efficiency was observed with the 39233 / 39234 TALEN pair, but overall strong KO efficiency was observed with both TALEN mRNA pairs at concentrations of 2–4 μg / million cells. [Figure 26B] The strongest KO efficiency was observed with the 39233 / 39234 TALEN pair, but overall strong KO efficiency was observed with both TALEN mRNA pairs at concentrations of 2–4 μg / million cells. [Figure 26C] The strongest KO efficiency was observed with the 39233 / 39234 TALEN pair, but overall strong KO efficiency was observed with both TALEN mRNA pairs at concentrations of 2–4 μg / million cells. [Figure 27] A-B show the efficiency of PD-1 and TIGIT KO using flow cytometry and ddPCR assays. [Figure 28A] PD-1 and TIGIT KO efficiencies measured by flow cytometry or ddPCR are shown. [Figure 28B] PD-1 and TIGIT KO efficiencies measured by flow cytometry or ddPCR are shown. [Figure 28C] PD-1 and TIGIT KO efficiencies measured by flow cytometry or ddPCR are shown. [Figure 28D] PD-1 and TIGIT KO efficiencies measured by flow cytometry or ddPCR are shown. [Figure 29] 1 shows that IL-2-independent proliferation assay results of PD1 / TIGIT dKO TILs showed no proliferation. [Figure 30A] The single KO efficiency and double KO efficiency of PD1 and LAG3 are shown, respectively. [Figure 30B] The single KO efficiency and double KO efficiency of PD1 and LAG3 are shown, respectively. [Figure 31] A and B show the fold expansion and survival observed for LAG3 single KO and double KO TILs. [Figure 32A]Decreased CD69, CD39, CD127, Eomes, Tbet, and TOX expression in single and double KO TILs is shown. [Figure 32B] Decreased CD69, CD39, CD127, Eomes, Tbet, and TOX expression in single and double KO TILs is shown. [Figure 32C] Decreased CD69, CD39, CD127, Eomes, Tbet, and TOX expression in single and double KO TILs is shown. [Figure 32D] Decreased CD69, CD39, CD127, Eomes, Tbet, and TOX expression in single and double KO TILs is shown. [Figure 32E] Decreased CD69, CD39, CD127, Eomes, Tbet, and TOX expression in single and double KO TILs is shown. [Figure 32F] Decreased CD69, CD39, CD127, Eomes, Tbet, and TOX expression in single and double KO TILs is shown. [Figure 33A] Similar levels of IFNγ and TNFα expression and killing activity were observed in single KO and double KO TILs. [Figure 33B] Similar levels of IFNγ and TNFα expression and killing activity were observed in single KO and double KO TILs. [Figure 33C] Similar levels of IFNγ and TNFα expression and killing activity were observed in single KO and double KO TILs. [Figure 33D] Similar levels of IFNγ and TNFα expression and killing activity were observed in single KO and double KO TILs. [Figure 34A] LAG3 and PD1 KO efficiency, fold expansion during REP, and survival rate after REP are shown, respectively. [Figure 34B]LAG3 and PD1 KO efficiency, fold expansion during REP, and survival rate after REP are shown, respectively. [Figure 34C] LAG3 and PD1 KO efficiency, fold expansion during REP, and survival rate after REP are shown, respectively. [Figure 35A] PD-1, TIGIT, and LAG3 KO efficiencies are shown, respectively. [Figure 35B] PD-1, TIGIT, and LAG3 KO efficiencies are shown, respectively. [Figure 35C] PD-1, TIGIT, and LAG3 KO efficiencies are shown, respectively. [Figure 36] PD-1 on-target hyperbolic fit options are shown. [Figure 37A] PD-1 off-target signals of candidates 3, 1, 19, 9, 17, and 4 are shown, respectively. [Figure 37B] PD-1 off-target signals of candidates 3, 1, 19, 9, 17, and 4 are shown, respectively. [Figure 37C] PD-1 off-target signals of candidates 3, 1, 19, 9, 17, and 4 are shown, respectively. [Figure 37D] PD-1 off-target signals of candidates 3, 1, 19, 9, 17, and 4 are shown, respectively. [Figure 37E] PD-1 off-target signals of candidates 3, 1, 19, 9, 17, and 4 are shown, respectively. [Figure 37F] PD-1 off-target signals of candidates 3, 1, 19, 9, 17, and 4 are shown, respectively. [Figure 38] Figure 1 shows the TIGIT on-target hyperbolic fit option. [Figure 39A] The TIGIT off-target signals of candidates 1, 2, 10, 12, and 17 are shown, respectively. [Figure 39B] The TIGIT off-target signals of candidates 1, 2, 10, 12, and 17 are shown, respectively. [Figure 39C] The TIGIT off-target signals of candidates 1, 2, 10, 12, and 17 are shown, respectively. [Figure 39D] The TIGIT off-target signals of candidates 1, 2, 10, 12, and 17 are shown, respectively. [Figure 39E] The TIGIT off-target signals of candidates 1, 2, 10, 12, and 17 are shown, respectively. DETAILED DESCRIPTION OF THE INVENTION

[0047] I. Definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All patents and publications referenced herein are incorporated by reference in their entirety.

[0048] As used herein, the terms "co-administration," "co-administering," "administered in combination," "administering in combination," "simultaneous," and "concurrent" encompass administration of two or more active pharmaceutical ingredients (e.g., multiple TILs in preferred embodiments of the present invention) to a subject such that both active pharmaceutical ingredients and / or their metabolites are present in the subject at the same time. Simultaneous administration includes simultaneous administration in separate compositions, administration at different times in separate compositions, or administration in a composition in which two or more active pharmaceutical ingredients are present. Concurrent administration in separate compositions and administration in a composition in which both agents are present are preferred.

[0049] The term "in vivo" refers to events that take place inside a subject's body.

[0050] The term "in vitro" refers to events that occur outside a subject's body. In vitro assays include cell-based assays, in which living or dead cells are used, and can also include cell-free assays, in which no intact cells are used.

[0051] The term "ex vivo" refers to events involving the administration of a therapy or treatment to cells, tissues, and / or organs that have been removed from a subject's body. Suitably, the cells, tissues, and / or organs may be returned to the subject's body in a surgical or therapeutic manner.

[0052] The term "rapid expansion" refers to an increase in the number of antigen-specific TILs of at least about 3-fold (or 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, or 9-fold) over a period of one week, more preferably at least about 10-fold (or 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, or 90-fold) over a period of one week, or most preferably at least about 100-fold over a period of one week. Several rapid expansion protocols are described herein.

[0053] As used herein, "tumor infiltrating lymphocytes" or "TILs" refers to a population of cells initially obtained as leukocytes that have left the bloodstream of a subject and migrated into a tumor. TILs include CD8 + Cytotoxic T cells (lymphocytes), Th1 and Th17 CD4 + These include, but are not limited to, T cells, natural killer cells, dendritic cells, and M1 macrophages. TILs include both primary and secondary TILs. "Primary TILs" are those obtained from a patient tissue sample as outlined herein (sometimes referred to as "freshly harvested"), and "secondary TILs" are any expanded or propagated TIL cell populations discussed herein, including, but not limited to, bulk TILs and expanded TILs ("REP TILs" or "post-REP TILs"). TIL cell populations may include genetically modified TILs.

[0054] As used herein, a "cell population" (including TILs) refers to a large number of cells that share a common trait. Generally, a population is roughly 1 x 10 6 ~1×10 10 The number of TILs ranges from approximately 1 x 10 to 1 x 10, with different TIL populations containing different numbers. For example, the initial growth of primary TILs in the presence of IL-2 is approximately 1 x 10 8REP expansion generally results in a bulk TIL population of 1.0 x 10 cells for injection. 9 ~1.0×10 11 This is done to provide a population of cells.

[0055] As used herein, "cryopreserved TILs" refers to TILs, either primary, bulk, or expanded (REP TILs), that have been processed and stored at temperatures ranging from approximately -150°C to -60°C. General methods for cryopreservation are also described elsewhere herein, including in the Examples. For clarity, "cryopreserved TILs" can be distinguished from frozen tissue samples that can be used as a source of primary TILs.

[0056] By "thawed cryopreserved TILs" herein is meant a population of TILs that have previously been cryopreserved and then processed to return to room temperature or above, including but not limited to, cell culture temperature or the temperature at which the TILs can be administered to a patient.

[0057] TILs can generally be defined biochemically using cell surface markers or functionally by their ability to infiltrate tumors and influence therapy. TILs can generally be classified by expressing one or more of the following biomarkers: CD4, CD8, TCR αβ, CD27, CD28, CD56, CCR7, CD45Ra, CD95, PD-1, and CD25. Additionally and alternatively, TILs can be functionally defined by their ability to infiltrate solid tumors upon reintroduction into patients.

[0058] The term "cryopreservation media" or "cryopreservation medium" refers to any medium that can be used for cryopreserving cells. Such media can include media containing 7% to 10% DMSO. Exemplary media include CryoStor CS10, Hyperthermasol, and combinations thereof. The term "CS10" refers to cryopreservation media obtained from Stemcell Technologies or Biolife Solutions. CS10 medium may be referred to by the trade name "CryoStor® CS10." CS10 medium is a serum-free, animal-component-free medium that contains DMSO. In some embodiments, CS10 medium contains 10% DMSO.

[0059] The term "central memory T cells" refers to cells that are CD45R0+ and CCR7 (CCR7 hi ) and CD62L (CD62 hi ) is a subset of T cells that constitutively express the CD4 receptor. The surface phenotype of central memory T cells also includes TCR, CD3, CD127 (IL-7R), and IL-15R. Transcription factors of central memory T cells include BCL-6, BCL-6B, MBD2, and BMI1. After TCR triggering, central memory T cells primarily secrete IL-2 and CD40L as effector molecules. Central memory T cells predominate in the CD4 compartment in the blood and are proportionally enriched in lymph nodes and tonsils in humans.

[0060] The term "effector memory T cells" refers to T cells that, like central memory T cells, are CD45R0+ but have lost constitutive expression of CCR7 (CCR7 lo ), CD62L expression (CD62L loCD8+ refers to a subset of human or mammalian T cells with heterogeneous or low expression levels of CD8+. The surface phenotype of central memory T cells also includes TCR, CD3, CD127 (IL-7R), and IL-15R. Transcription factors of central memory T cells include BLIMP1. Effector memory T cells rapidly secrete high levels of inflammatory cytokines after antigen stimulation, including interferon-γ, IL-4, and IL-5. Effector memory T cells predominate in the CD8 compartment in the blood and are proportionally enriched in the lungs, liver, and intestine in humans. CD8+ effector memory T cells carry large amounts of perforin.

[0061] A "closed system" refers to a system that is closed to the external environment. Any closed system suitable for cell culture methods can be used in the methods of the present invention. Examples of closed systems include, but are not limited to, sealed G containers. Once tumor segments are added to the closed system, the system is not opened to the external environment until the TILs are ready to be administered to a patient.

[0062] The terms "fragmenting," "fragments," and "fragmented" as used herein to describe processes for destroying tumors include mechanical fragmentation methods such as crushing, slicing, dividing, and mincing tumor tissue, as well as any other method for disrupting the physical structure of tumor tissue.

[0063] The terms "peripheral blood mononuclear cells" and "PBMCs" refer to peripheral blood cells with round nuclei, including lymphocytes (T cells, B cells, NK cells) and monocytes. When used as antigen-presenting cells (PBMCs are a type of antigen-presenting cell), the peripheral blood mononuclear cells are preferably irradiated allogeneic peripheral blood mononuclear cells.

[0064] The terms "peripheral blood lymphocytes" and "PBLs" refer to T cells expanded from peripheral blood. In some embodiments, PBLs are isolated from whole blood or apheresis products from a donor. In some embodiments, PBLs are isolated from whole blood or apheresis products from a donor by positive or negative selection of a T cell phenotype, such as a CD3+CD45+ T cell phenotype.

[0065] The term "anti-CD3 antibody" refers to an antibody or variant thereof, e.g., a monoclonal antibody, including a human, humanized, chimeric, or murine antibody, directed against the CD3 receptor in the T cell antigen receptor of mature T cells. Anti-CD3 antibodies include OKT-3, also known as muromonab. Anti-CD3 antibodies also include the UHCT1 clone, also known as T3 and CD3ε. Other anti-CD3 antibodies include, for example, otelixizumab, teplizumab, and visilizumab.

[0066] The term "OKT-3" (also referred to herein as "OKT3") refers to a monoclonal antibody, including a human, humanized, chimeric, or murine antibody against the CD3 receptor in the T cell antigen receptor of mature T cells, or a biosimilar or variant thereof, including commercially available forms such as OKT-3 (30 ng / mL, MACS GMP CD3 pure, Miltenyi Biotech, Inc., San Diego, CA, USA) and muromonab, or variants, conservative amino acid substitutions, glycoforms, or biosimilars thereof. The amino acid sequences of the heavy and light chains of muromonab are shown in Table 1 (SEQ ID NO: 1 and SEQ ID NO: 2). A hybridoma capable of producing OKT-3 has been deposited with the American Type Culture Collection and assigned ATCC accession number CRL8001. A hybridoma capable of producing OKT-3 has also been deposited with the European Collection of Authenticated Cell Cultures (ECACC) and assigned catalog number 86022706.

[0067] [Table 1]

[0068] The term "IL-2" (also referred to herein as "IL2") refers to the T cell growth factor known as interleukin-2 and includes all forms of IL-2, including human and mammalian forms, conservative amino acid substitutions, glycoforms, biosimilars, and variants. IL-2 is described, for example, in Nelson, J. Immunol. 2004, 172, 3983-88 and Malek, Annu. Rev. Immunol. 2008, 26, 453-79, the disclosures of which are incorporated herein by reference. The amino acid sequence of recombinant human IL-2 suitable for use in the present invention is shown in Table 2 (SEQ ID NO: 3). For example, the term IL-2 encompasses human recombinant forms of IL-2, such as aldesleukin (PROLEUKIN, commercially available from multiple suppliers at 22 million IU per single-use vial), as well as forms of recombinant IL-2 commercially supplied by CellGenix, Inc., Portsmouth, NH, USA (CELLGRO GMP) or ProSpec-Tany TechnoGene Ltd., East Brunswick, NJ, USA (catalog number CYT-209-b), and other commercial equivalents from other vendors. Aldesleukin (des-alanyl-1, serine-125 human IL-2) is a non-glycosylated human recombinant IL-2 with a molecular weight of approximately 15 kDa. The amino acid sequence of aldesleukin suitable for use in the present invention is shown in Table 2 (SEQ ID NO: 4). The term IL-2 also refers to the pegylated IL-2 prodrug bempegaldesleukin (NKTR-214, an IL-2 prodrug in which an average of six lysine residues are replaced with [(2,7-bis{[methylpoly(oxyethylene)]carbamoyl}-9H-fluoren-9-yl)methoxy]carbonyl). 6The present invention also encompasses pegylated forms of IL-2 described herein, including pegylated human recombinant IL-2 such as SEQ ID NO: 4, which is available from Nektar Therapeutics (South San Francisco, CA, USA) or can be prepared by methods known in the art, such as those described in Example 19 of International Patent Application Publication No. WO 2018 / 132496 A1 or Example 1 of U.S. Patent Application Publication No. 2019 / 0275133 A1, the disclosures of which are incorporated herein by reference. Benpegaldesleukin (NKTR-214) and other pegylated IL-2 molecules suitable for use in the present invention are described in U.S. Patent Application Publication No. 2014 / 0328791 A1 and International Patent Application Publication No. WO 2012 / 065086 A1, the disclosures of which are incorporated herein by reference. Alternative forms of conjugated IL-2 suitable for use in the present invention are described in U.S. Patent Nos. 4,766,106, 5,206,344, 5,089,261, and 4,902,502, the disclosures of which are incorporated herein by reference. Formulations of IL-2 suitable for use in the present invention are described in U.S. Patent No. 6,706,289, the disclosure of which is incorporated herein by reference.

[0069] In some embodiments, a suitable IL-2 form for use in the present invention is THOR-707, available from Synthorx, Inc. The preparation and properties of THOR-707 and additional alternative forms of IL-2 suitable for use in the present invention are described in U.S. Patent Application Publication Nos. 2020 / 0181220A1 and 2020 / 0330601A1, the disclosures of which are incorporated herein by reference. In some embodiments, a suitable IL-2 form for use in the present invention is an interleukin-2 (IL-2) conjugate comprising an isolated and purified IL-2 polypeptide; and a conjugate moiety that binds the isolated and purified IL-2 polypeptide at an amino acid position selected from K35, T37, R38, T41, F42, K43, F44, Y45, E61, E62, E68, K64, P65, V69, L72, and Y107 (amino acid residue numbering corresponds to SEQ ID NO: 5). In some embodiments, the amino acid position is selected from T37, R38, T41, F42, F44, Y45, E61, E62, E68, K64, P65, V69, L72, and Y107. In some embodiments, the amino acid position is selected from T37, R38, T41, F42, F44, Y45, E61, E62, E68, P65, V69, L72, and Y107. In some embodiments, the amino acid position is selected from T37, T41, F42, F44, Y45, P65, V69, L72, and Y107. In some embodiments, the amino acid position is selected from R38 and K64. In some embodiments, the amino acid position is selected from E61, E62, and E68. In some embodiments, the amino acid position is E62. In some embodiments, an amino acid residue selected from K35, T37, R38, T41, F42, K43, F44, Y45, E61, E62, E68, K64, P65, V69, L72, and Y107 is further mutated to lysine, cysteine, or histidine. In some embodiments, the amino acid residue is mutated to cysteine. In some embodiments, the amino acid residue is mutated to lysine. In some embodiments, K35, T37, R38, T41, F42, K43, F44, Y45, E61, E62, E68, K64, P65, V69, L72, and Y107 are ...and Y107 are further mutated to an unnatural amino acid. In some embodiments, the unnatural amino acid is selected from N6-azidoethoxy-L-lysine (AzK), N6-propargylethoxy-L-lysine (PraK), BCN-L-lysine, norbornene lysine, TCO-lysine, methyltetrazine lysine, allyloxycarbonyl lysine, 2-amino-8-oxononanoic acid, 2-amino-8-oxooctanoic acid, p-acetyl-L-phenylalanine, p-azidomethyl-L-phenylalanine (pAMF), p-iodo-L-phenylalanine, m-acetylphenylalanine, 2-amino-8-oxononanoic acid, p-propargyloxyphenylalanine, p-propargyl-phenylalanine, 3-methyl-phenylalanine, L-dopa, fluorinated phenylalanine, isopropyl and selenocysteine, or selenocysteine. In some embodiments, the IL-2 conjugate has reduced affinity for the IL-2 receptor alpha (IL-2Rα) subunit compared to a wild-type IL-2 polypeptide. In some embodiments, the reduced affinity is about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or greater than a 99% decrease in binding affinity for IL-2Rα compared to a wild-type IL-2 polypeptide. In some embodiments, the reduced affinity is about a 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 30-fold, 50-fold, 100-fold, 200-fold, 300-fold, 500-fold, or greater decrease in binding affinity for IL-2Rα compared to a wild-type IL-2 polypeptide.1000-fold or more. In some embodiments, the conjugate moiety impairs or blocks the binding of IL-2 to IL-2Rα. In some embodiments, the conjugate moiety comprises a water-soluble polymer. In some embodiments, the additional conjugate moiety comprises a water-soluble polymer. In some embodiments, each of the water-soluble polymers independently comprises polyethylene glycol (PEG), poly(propylene glycol) (PPG), copolymers of ethylene glycol and propylene glycol, poly(oxyethylated polyol), poly(olefin alcohol), poly(vinylpyrrolidone), poly(hydroxyalkyl methacrylamide), poly(hydroxyalkyl methacrylate), poly(saccharide), poly(α-hydroxy acid), poly(vinyl alcohol), polyphosphazene, polyoxazoline (POZ), poly(N-acryloylmorpholine), or a combination thereof. In some embodiments, each of the water-soluble polymers independently comprises PEG. In some embodiments, the PEG is linear PEG or branched PEG. In some embodiments, each of the water-soluble polymers independently comprises a polysaccharide. In some embodiments, the polysaccharide comprises dextran, polysialic acid (PSA), hyaluronic acid (HA), amylose, heparin, heparan sulfate (HS), dextrin, or hydroxyethyl starch (HES). In some embodiments, each of the water-soluble polymers independently comprises a glycan. In some embodiments, each of the water-soluble polymers independently comprises a polyamine. In some embodiments, the conjugate moiety comprises a protein. In some embodiments, the additional conjugate moiety comprises a protein. In some embodiments, each of the proteins independently comprises albumin, transferrin, or transthyretin. In some embodiments, each of the proteins independently comprises an Fc portion. In some embodiments, each of the proteins independently comprises an Fc portion of an IgG. In some embodiments, the conjugate moiety comprises a polypeptide. In some embodiments, the additional conjugate moiety comprises a polypeptide. In some embodiments, each of the polypeptides independently comprisesIndependently, the conjugate moiety may comprise an XTEN peptide, a glycine-rich homoamino acid polymer (HAP), a PAS polypeptide, an elastin-like polypeptide (ELP), a CTP peptide, or a gelatin-like protein (GLK) polymer. In some embodiments, the isolated and purified IL-2 polypeptide is modified by glutamylation. In some embodiments, the conjugate moiety is directly attached to the isolated and purified IL-2 polypeptide. In some embodiments, the conjugate moiety is indirectly attached to the isolated and purified IL-2 polypeptide via a linker. In some embodiments, the linker comprises a homobifunctional linker. In some embodiments, the homobifunctional linker is selected from the group consisting of the Romant reagents dithiobis(succinimidyl propionate) DSP, 3′3′-dithiobis(sulfosuccinimidyl propionate) (DTSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl)suberate (BS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfo-DST), ethylene glycobis(succinimidyl succinate) (EGS), disuccinimidyl glutarate (DSG), N,N′-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3,3′-dithiobispropionimidate (DTBP), 1,4- Di-(3'-(2'-pyridyldithio)propionamido)butane (DPDPB), bismaleimidohexane (BMH), halogenated aryl-containing compounds (DFDNB), such as 1,5-difluoro-2,4-dinitrobenzene or 1,3-difluoro-4,6-dinitrobenzene, 4,4'-difluoro-3,3'-dinitrophenyl sulfone (DFDNPS), bis-[β-(4-azidosalicylamido)ethyl] disulfide (BASED), formaldehyde, glutaraldehyde, 1,4-butanediol diglycidyl ether, adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, α,α'-p-diaminodiphenyl, diiodo-p-xylenesulfonic acid, N,N'-ethylene-bis(iodoacetamide),or N,N'-hexamethylenebis(iodoacetamide). In some embodiments, the linker comprises a heterobifunctional linker. In some embodiments, the heterobifunctional linker is selected from the group consisting of N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (LC-sPDP), water-soluble long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-[α-methyl-α-(2-pyridyldithio)] ... m-maleimidobenzoyl-N-hydroxysuccinimide ester (MB), m-maleimidobenzoyl-N-hydroxysuccinimide ester (sulfo-MB), N-succinimidyl (4-iodomethyl) hexanoate (sulfo-LC-sMPT), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC), sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MB), m-maleimidobenzoyl-N-hydroxysulfos ... (4-iodoacetyl)aminobenzoate (sIAB), sulfosuccinimidyl (4-iodoacetyl)aminobenzoate (sulfo-sIAB), succinimidyl-4-(p-maleimidophenyl)butyrate (sMPB), sulfosuccinimidyl-4-(p-maleimidophenyl)butyrate (sulfo-sMPB), N-(γ-maleimidobutyryloxy)succinimide ester (GMB), N-(γ-maleimidobutyryloxy)sulfosuccinimide ester (sulfo-GMB), succinimidyl 6-iodoacetylaminobenzoate (sulfo-sIAB), succinimidyl 4-(p-maleimidophenyl)butyrate (sulfo-sMP ... -((iodoacetyl)amino)hexanoate (sIAX), succinimidyl 6-[6-(((iodoacetyl)amino)hexanoyl)amino]hexanoate (slAXX), succinimidyl 4-(((iodoacetyl)amino)methyl)cyclohexane-1-carboxylate (sIAC), succinimidyl 6-(((((4-iodoacetyl)amino)methyl)cyclohexane-1-carbonyl)amino)hexanoate (sIACX), p-nitrophenyl iodoacetate (NPIA),Carbonyl-reactive and sulfhydryl-reactive crosslinkers, such as 4-(4-N-maleimidophenyl)butyric acid hydrazide (MPBH), 4-(N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide-8 (M2C2H), 3-(2-pyridyldithio)propionyl hydrazide (PDPH), N-hydroxysuccinimidyl-4-azidosalicyl, Acid (NHs-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylic acid (sulfo-NHs-AsA), sulfosuccinimidyl-(4-azidosalicylamido)hexanoate (sulfo-NHs-LC-AsA), sulfosuccinimidyl-2-(p-azidosalicylamido)ethyl-1,3'-dithiopropionate (sAsD), N-hydroxysuccinimidyl-4-azidobenzoate (HsAB), N-hydroxysulfosuccinimidyl-4-azidobenzoate (sulfo-HsAB), N- ... Succinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sANPAH), sulfosuccinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sulfo-sANPAH), N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NO), sulfosuccinimidyl-2-(m-azido-o-nitrobenzamido)-ethyl-1,3'-dithiopropionate (sAND), N-succinimidyl-4(4-azidophenyl)1,3'-dithiopropionate N-sulfosuccinimidyl (4-azidophenyl)-1,3'-dithiopropionate (sulfo-sADP), sulfosuccinimidyl 4-(p-azidophenyl)butyrate (sulfo-sAPB), sulfosuccinimidyl 2-(7-azido-4-methylcoumarin-3-acetamido)ethyl-1,3'-dithiopropionate (sAED), sulfosuccinimidyl 7-azido-4-methylcoumarin-3-acetate (sulfo-sAMCA), p-nitrophenyl diazopyruvate (pNPDP), Examples of suitable linkers include p-nitrophenyl-2-diazo-3,3,3-trifluoropropionate (PNP-DTP), 1-(ρ-azidosalicylamido)-4-(iodoacetamido)butane (AsIB), N-[4-(ρ-azidosalicylamido)butyl]-3'-(2'-pyridyldithio)propionamide (APDP), benzophenone-4-iodoacetamide, p-azidobenzoylhydrazide (ABH), 4-(ρ-azidosalicylamido)butylamine (AsBA), or p-azidophenylglyoxal (APG). In some embodiments, the linker comprises a cleavable linker, optionally including a dipeptide linker.In some embodiments, the dipeptide linker comprises Val-Cit, Phe-Lys, Val-Ala, or Val-Lys. In some embodiments, the linker comprises a non-cleavable linker. In some embodiments, the linker optionally comprises a maleimido group comprising maleimidocaproyl (mc), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC), or sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC). In some embodiments, the linker further comprises a spacer. In some embodiments, the spacer comprises p-aminobenzyl alcohol (PAB), p-aminobenzyloxycarbonyl (PABC), a derivative, or an analog thereof. In some embodiments, the conjugate moiety is capable of extending the serum half-life of the IL-2 conjugate. In some embodiments, the additional conjugate moiety is capable of extending the serum half-life of the IL-2 conjugate. In some embodiments, IL-2 forms suitable for use in the present invention are fragments of any of the IL-2 forms described herein. In some embodiments, IL-2 forms suitable for use in the present invention are pegylated as disclosed in U.S. Patent Application Publication Nos. 2020 / 0181220A1 and 2020 / 0330601A1. In some embodiments, an IL-2 form suitable for use in the present invention is an IL-2 conjugate comprising an IL-2 polypeptide comprising N6-azidoethoxy-L-lysine (AzK) covalently attached to a conjugate moiety comprising polyethylene glycol (PEG), wherein the IL-2 polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:5, and wherein AzK substitutes an amino acid at position K35, F42, F44, K43, E62, P65, R38, T41, E68, Y45, V69, or L72 relative to amino acid position SEQ ID NO:5. In some embodiments, the IL-2 polypeptide comprises an N-terminal deletion of one residue relative to SEQ ID NO:5.In some embodiments, IL-2 forms suitable for use in the present invention lack participation of the IL-2R alpha chain but retain normal binding to the intermediate-affinity IL-2R beta-gamma signaling complex. In some embodiments, IL-2 forms suitable for use in the present invention are IL-2 conjugates comprising an IL-2 polypeptide comprising N6-azidoethoxy-L-lysine (AzK) covalently attached to a conjugate moiety comprising polyethylene glycol (PEG), wherein the IL-2 polypeptide comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO:5, and wherein AzK substitutes for amino acid positions K35, F42, F44, K43, E62, P65, R38, T41, E68, Y45, V69, or L72 relative to amino acid position(s) in SEQ ID NO:5. In some embodiments, an IL-2 form suitable for use in the present invention is an IL-2 conjugate comprising an IL-2 polypeptide comprising N6-azidoethoxy-L-lysine (AzK) covalently attached to a conjugate moiety comprising polyethylene glycol (PEG), wherein the IL-2 polypeptide comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO:5, and wherein AzK substitutes for amino acid at position K35, F42, F44, K43, E62, P65, R38, T41, E68, Y45, V69, or L72 relative to amino acid position in SEQ ID NO:5. In some embodiments, a suitable IL-2 form for use in the present invention is an IL-2 conjugate comprising an IL-2 polypeptide comprising N6-azidoethoxy-L-lysine (AzK) covalently attached to a conjugate moiety comprising polyethylene glycol (PEG), wherein the IL-2 polypeptide comprises an amino acid sequence having at least 98% sequence identity to SEQ ID NO:5, and wherein AzK substitutes for amino acid at position K35, F42, F44, K43, E62, P65, R38, T41, E68, Y45, V69, or L72 relative to amino acid position in SEQ ID NO:5.

[0070] In some embodiments, a form of IL-2 suitable for use in the present invention is nembareukin alfa, also known as ALKS-4230 (SEQ ID NO: 6), available from Alkermes, Inc. Nembareukin alfa is a nucleotide analogue of IL-2 that is linked via a peptidyl linker ( 60 GG 61 ) and fused to human interleukin-2 fragment (62-132) via a peptidyl linker ( 133 GSGGGS 138 Human interleukin-2 receptor α-chain fragment (139-303) fused via a nucleotide sequence (Cys), produced in Chinese hamster ovary (CHO) cells, and glycosylated. 125 >Ser 51 ; human interleukin-2 (IL-2) (4-74)-peptide (62-132) fused via a G2 peptide linker (60-61) and human interleukin-2 receptor alpha chain (IL2R subunit alpha, IL2Rα, IL2RA) (1-165)-peptide (139-303) fused via a GSG3S peptide linker (133-138), produced in Chinese hamster ovary (CHO) cells, and alpha-glycosylated human interleukin-2 (IL-2) (75-133)-peptide [Cys 125(51)>Ser]-mutant (1-59). The amino acid sequence of nembareukin alpha is set forth in SEQ ID NO: 6. In some embodiments, nembareukin alpha exhibits the following post-translational modifications: disulfide bridges at positions 31-116, 141-285, 184-242, 269-301, 166-197 or 166-199, 168-199 or 168-197 (using the numbering of SEQ ID NO: 6), and glycosylation sites at positions N187, N206, and T212 (using the numbering of SEQ ID NO: 6). The preparation and properties of nembareukin alpha, as well as additional alternative forms of IL-2 suitable for use in the present invention, are described in U.S. Patent Application Publication No. 2021 / 0038684A1 and U.S. Patent No. 10,183,979, the disclosures of which are incorporated herein by reference. In some embodiments, an IL-2 form suitable for use in the present invention is a protein having at least 80%, at least 90%, at least 95%, or at least 90% sequence identity to SEQ ID NO:6. In some embodiments, an IL-2 form suitable for use in the present invention has the amino acid sequence set forth in SEQ ID NO:6 or conservative amino acid substitutions thereof. In some embodiments, an IL-2 form suitable for use in the present invention is a fusion protein comprising amino acids 24-452 of SEQ ID NO:7, or a variant, fragment, or derivative thereof. In some embodiments, an IL-2 form suitable for use in the present invention is a fusion protein comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, or at least 90% sequence identity to amino acids 24-452 of SEQ ID NO:7, or a variant, fragment, or derivative thereof. Other IL-2 forms suitable for use in the present invention are described in U.S. Pat. No. 10,183,979, the disclosure of which is incorporated herein by reference.Optionally, in some embodiments, a form of IL-2 suitable for use in the present invention is a fusion protein comprising a first fusion partner linked to a second fusion partner by a mucin domain polypeptide linker, wherein the first fusion partner is IL-1Rα or a protein having at least 98% amino acid sequence identity to IL-1Rα and having receptor antagonist activity for IL-Rα, the second fusion partner comprises all or a portion of an immunoglobulin comprising an Fc region, and the mucin domain polypeptide linker comprises SEQ ID NO:8 or an amino acid sequence having at least 90% sequence identity to SEQ ID NO:8, and wherein the half-life of the fusion protein is improved compared to the fusion of the first fusion partner with the second fusion partner in the absence of the mucin domain polypeptide linker.

[0071] [Table 2-1] [Table 2-2]

[0072] When an "antitumor effective amount," "tumor suppression effective amount," or "therapeutic amount" is indicated, the exact amount of the composition of the present invention to be administered can be determined by a physician taking into account individual differences in age, weight, tumor size, extent of infection or metastasis, and patient (subject) condition. Generally, pharmaceutical compositions containing tumor-infiltrating lymphocytes (e.g., secondary TILs or genetically modified cytotoxic lymphocytes) described herein are administered in a dose of 10 per kg of body weight. 4 ~10 11 cells (e.g., 10 per kg of body weight) 5 ~10 6 , 10 5 ~10 10 , 10 5 ~10 11 , 10 6 ~10 10 , 10 6 ~10 11 , 10 7 ~10 11 , 10 7~10 10 , 10 8 ~10 11 , 10 8 ~10 10 , 10 9 ~10 11 , or 10 9 ~10 10 It can be stated that the TIL (optionally including genetically modified cytotoxic lymphocytes) compositions can be administered at doses of 1000-15000 cells (including all integer values ​​within those ranges). TIL (optionally including genetically modified cytotoxic lymphocytes) compositions can also be administered multiple times at these doses. TIL (optionally including genetically engineered TIL) can be administered by using injection techniques commonly known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 1988, 319, 1676). Optimal dosages and treatment regimes for a particular patient can be readily determined by one skilled in the medical arts by monitoring the patient for signs of disease and adjusting treatment accordingly.

[0073] The terms "hematological malignancies," "blood malignancies," or terms of related meaning, refer to mammalian cancers and tumors of hematopoietic and lymphatic tissues, including, but not limited to, blood, bone marrow, lymph nodes, and lymphatic tissues. Hematological malignancies are also referred to as "liquid tumors." Hematological malignancies may include, but are not limited to, acute lymphoblastic leukemia (ALL), chronic lymphocytic lymphoma (CLL), small lymphocytic lymphoma (SLL), acute myeloid leukemia (AML), chronic myelogenous leukemia (CML), multiple myeloma, acute monocytic leukemia (AMoL), Hodgkin's lymphoma, and non-Hodgkin's lymphoma. The term "B-cell hematological malignancies" refers to hematological malignancies affecting B cells.

[0074] The term "liquid tumor" refers to an abnormal mass of cells that is liquid in nature. Liquid tumor cancers include, but are not limited to, leukemia, myeloma, and lymphoma, as well as other hematological malignancies. TILs obtained from liquid tumors may also be referred to herein as bone marrow-infiltrating lymphocytes (MILs). TILs obtained from liquid tumors, including those circulating in peripheral blood, may also be referred to herein as PBLs. The terms MILs, TILs, and PBLs are used interchangeably herein and differ only based on the tissue type from which the cells are derived.

[0075] As used herein, the term "microenvironment" may refer to the microenvironment of a solid or hematologic tumor as a whole, or to individual subsets of cells within the microenvironment. As used herein, the tumor microenvironment refers to a complex mixture of "cells, soluble factors, signaling molecules, extracellular matrix, and mechanical cues that promote neoplastic transformation, support tumor growth and invasion, protect tumors from host immunity, foster therapeutic resistance, and provide a niche for successful and dominant metastasis," as described in Swartz, et al., Cancer Res., 2012, 72, 2473. Tumors express antigens that are recognized by T cells, but tumor clearance by the immune system is rare due to immunosuppression by the microenvironment.

[0076] In some embodiments, the invention includes methods of treating cancer with a TIL population, wherein the patient is pretreated with non-myeloablative chemotherapy prior to infusion of TILs according to the invention. In some embodiments, a TIL population may be provided, wherein the patient is pretreated with non-myeloablative chemotherapy prior to infusion of TILs according to the invention. In some embodiments, the non-myeloablative chemotherapy is cyclophosphamide 60 mg / kg / day for two days (days 27 and 26 prior to TIL infusion) and fludarabine 25 mg / m2 / day for five days (days 27-23 after TIL infusion). In some embodiments, after non-myeloablative chemotherapy and TIL infusion according to the invention (day 0), the patient receives an intravenous infusion of IL-2 at 720,000 IU / kg every 8 hours to physiological tolerance.

[0077] Experimental results indicate that lymphodepletion prior to adoptive transfer of tumor-specific T lymphocytes plays an important role in enhancing therapeutic efficacy by eliminating regulatory T cells and competing elements of the immune system ("cytokine sinks"). Accordingly, some embodiments of the present invention utilize a lymphodepletion step (sometimes referred to as "immunosuppressive conditioning") in patients prior to introducing the TILs of the present invention.

[0078] The term "effective amount" or "therapeutically effective amount" refers to an amount of a compound or combination of compounds described herein sufficient to accomplish its intended purpose, including, but not limited to, disease treatment. A therapeutically effective amount may vary depending on the intended use (in vitro or in vivo), or the subject and condition being treated (e.g., the subject's weight, age, and sex), the severity of the condition, or the method of administration. The term also applies to a dose that induces a specific response in target cells (e.g., reduced platelet adhesion and / or cell migration). The specific dose will vary depending on the particular compound selected, the dosing regimen to be followed, whether the compound is administered in combination with other compounds, the timing of administration, the tissue to which it is administered, and the physical delivery system by which the compound is delivered.

[0079] As used herein, the terms "treatment," "treating," "treat," and the like refer to obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic, in terms of completely or partially preventing the disease or condition, and / or therapeutic, in terms of partially or completely curing the disease and / or side effects caused by the disease. As used herein, "treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes (a) preventing the disease from occurring in a subject who may be susceptible to the disease but has not yet been diagnosed with it; (b) inhibiting the disease, i.e., arresting its onset or progression; and (c) palliating the disease, i.e., causing the disease to regress and / or alleviate one or more disease symptoms. "Treatment" is also intended to include the delivery of an agent to produce a pharmacological effect even in the absence of a disease or condition. For example, "treatment" encompasses the delivery of a composition capable of eliciting an immune response or conferring immunity in the absence of a pathology, e.g., in the case of a vaccine.

[0080] "Non-myeloablative chemotherapy," "non-myeloablative lymphodepletion," "NMALD," "NMA LD," "NMA-LD," and any variants of the foregoing, are used interchangeably to refer to chemotherapy regimens designed to deplete a patient's lymphoid immune cells while avoiding depletion of a patient's myeloid immune cells. Typically, a patient undergoes a course of non-myeloablative chemotherapy before administering tumor-infiltrating lymphocytes to the patient, as described herein.

[0081] The term "heterologous," when used with reference to a portion of a nucleic acid or protein, indicates that the nucleic acid or protein comprises two or more subsequences that are not found in the same relationship to each other in nature. For example, nucleic acids are typically produced recombinantly, with two or more sequences from unrelated genes arranged to create a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source, or coding regions from different sources. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).

[0082] The terms "sequence identity," "percent identity," and "percent sequence identity" (or their synonyms, e.g., "99% identical") in the context of two or more nucleic acids or polypeptides refer to two or more sequences or subsequences that are the same or have a specified percentage of the same nucleotide or amino acid residues when compared and aligned for maximum correspondence (introducing gaps, if necessary), without considering any conservative amino acid substitutions as part of the sequence identity. Percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain alignment of amino acid or nucleotide sequences are known in the art. Suitable programs for determining percent sequence identity include, for example, the BLAST suite of programs available from the BLAST website of the U.S. government's National Center for Biotechnology Information. Comparison between two sequences can be performed using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, and BLASTP is used to compare amino acid sequences. ALIGN, ALIGN-2 (Genentech, South San Francisco, California), or MegAlign, available from DNASTAR, are additional publicly available software programs that can be used to align sequences. Those skilled in the art can determine the appropriate parameters for maximum alignment depending on the particular alignment software. In certain embodiments, the default parameters of the alignment software are used.

[0083] As used herein, the term "variant" includes, but is not limited to, an antibody or fusion protein comprising an amino acid sequence that differs from the amino acid sequence of a reference antibody by one or more substitutions, deletions, and / or additions at specific positions within or adjacent to the amino acid sequence of the reference antibody. A variant may contain one or more conservative substitutions in its amino acid sequence compared to the amino acid sequence of the reference antibody. Conservative substitutions may include, for example, substitutions of similarly charged or uncharged amino acids. A variant retains the ability of the reference antibody to specifically bind to an antigen. The term variant also includes pegylated antibodies or proteins.

[0084] The term "deoxyribonucleotide" encompasses natural and synthetic, unmodified and modified deoxyribonucleotides. Modifications include changes to the sugar moiety, the base moiety, and / or the linkages between deoxyribonucleotides in an oligonucleotide.

[0085] The term "RNA" defines a molecule containing at least one ribonucleotide residue. The term "ribonucleotide" defines a nucleotide having a hydroxyl group at the 2' position of a bD-ribofuranose moiety. The term RNA includes double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, and altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. The nucleotides of the RNA molecules described herein can also include non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs may be referred to as analogs or analogs of naturally occurring RNA.

[0086] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and inactive ingredients. The use of such pharmaceutically acceptable carriers or pharmaceutically acceptable excipients for active pharmaceutical ingredients is well known in the art. Except insofar as any conventional pharmaceutically acceptable carrier or pharmaceutically acceptable excipient is incompatible with the active pharmaceutical ingredient, its use in the therapeutic compositions of the present invention is contemplated. Additional active pharmaceutical ingredients, such as other drugs, may also be incorporated into the compositions and methods described herein.

[0087] The terms "about" and "approximately" refer to values ​​within a statistically meaningful range. Such ranges may be within one order of magnitude of a given value or range, preferably within 50%, more preferably within 20%, even more preferably within 10%, and even more preferably within 5%. The allowable variation encompassed by the terms "about" or "approximately" depends on the particular system under study and can be readily understood by one of ordinary skill in the art. Furthermore, as used herein, the terms "about" and "approximately" mean that dimensions, sizes, formulations, parameters, shapes, and other quantities and characteristics are not, and need not be, exact, but may be approximate and / or larger or smaller, as appropriate, reflecting tolerances, conversion factors, rounding, measurement errors, and the like, as well as other factors known to those of ordinary skill in the art. In general, a dimension, size, formulation, parameter, shape, or other quantity or characteristic is "about" or "approximately" regardless of whether it is explicitly stated as such. It should be noted that embodiments of widely different sizes, shapes, and dimensions may employ the described configurations.

[0088] The transitional phrases "comprising," "consisting essentially of," and "consisting of," when used in the appended claims, in their original and amended forms, define the scope of the claim with respect to whether any additional, unrecited claim elements or steps are excluded from the claim. The term "comprising" is intended to be inclusive or open-ended and does not exclude any additional, unrecited elements, methods, steps, or materials. The term "consisting of" excludes elements, steps, or materials other than those specified in the claim, and in the latter case, excludes impurities normally associated with the specified material(s). The term "consisting essentially of" limits the claim to the specified element, step, or material(s) and those that do not materially affect the basic and novel feature(s) of the claimed invention. All compositions, methods, and kits described herein embodying the present invention may, in alternative embodiments, be more specifically defined by any of the transitional terms "comprising," "essentially consisting of," and "consisting of."

[0089] The terms "antibody" and its plural "antibodies" refer to whole immunoglobulins and any antigen-binding fragment ("antigen-binding portion") or single chains thereof. "Antibody" also refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, or antigen-binding portions thereof. Each heavy chain contains a heavy chain variable region (referred to herein as V H Each light chain is composed of a light chain variable region (abbreviated herein as V) and a heavy chain constant region. The heavy chain constant region is composed of three domains: CH1, CH2, and CH3. L The light chain constant region consists of one domain, C L The V of the antibody H and V L The regions can be further subdivided into regions of hypervariability, termed complementarity-determining regions (CDRs) or hypervariable regions (HVRs), which may be interspersed with more conserved regions called framework regions (FRs). H and V Lis composed of three CDRs and four FRs arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with one or more antigen epitopes. The constant region of the antibody may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.

[0090] The term "antigen" refers to a substance that induces an immune response. In some embodiments, an antigen is a molecule that can be bound by an antibody or TCR when presented by a major histocompatibility complex (MHC) molecule. As used herein, the term "antigen" also encompasses T cell epitopes. An antigen can additionally be recognized by the immune system. In some embodiments, an antigen can induce a humoral or cellular immune response, leading to the activation of B and / or T lymphocytes. In some cases, this may require that the antigen contain or be bound by a Th cell epitope. An antigen may also have one or more epitopes (e.g., B- and T-epitopes). In some embodiments, an antigen preferably reacts with a corresponding antibody or TCR, typically in a highly specific and selective manner, and not with many other antibodies or TCRs that may be induced by other antigens.

[0091] The terms "monoclonal antibody," "mAb," "monoclonal antibody composition," or their plurals, refer to a preparation of antibody molecules of single molecular composition. A monoclonal antibody composition exhibits a single binding specificity and affinity for a particular epitope. Monoclonal antibodies specific for a particular receptor can be produced using knowledge and techniques in the art by injecting a test subject with an appropriate antigen and then isolating hybridomas expressing antibodies with the desired sequence or functional characteristics. DNA encoding the monoclonal antibody is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that can specifically bind to genes encoding the heavy and light chains of the monoclonal antibody). Hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA can be placed into an expression vector and then transfected into host cells such as E. coli cells, monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin protein to obtain the synthesis of the monoclonal antibody in the recombinant host cells. Recombinant production of antibodies is described in more detail below.

[0092] II. Method for preparing expanded TILs with reduced expression of PD-1 and TIGIT using sequential electroporation of two TALEN systems Embodiments of the present invention are directed to a method for preparing expanded tumor-infiltrating lymphocytes (TILs) with reduced expression of PD-1 and TIGIT using sequential electroporation of two TALEN systems targeting PD-1 and TIGIT.

[0093] A. Overview: TIL expansion + TALEN gene editing

[0004] Embodiments disclosed herein provide methods for expanding TILs into a therapeutic population, further comprising gene editing at least a portion of the TILs by the TALE method to produce TILs with reduced expression of PD-1 and TIGIT. According to certain embodiments, the use of the TALE method during the TIL expansion process silences or reduces expression of PD-1 and TIGIT in at least a portion of the therapeutic TIL population.

[0094] As used herein, "gene-editing," "gene editing," and "genome editing" refer to a type of genetic modification in which DNA is permanently modified within a cell's genome, e.g., DNA is inserted, deleted, modified, or replaced within a cell's genome. In some embodiments, gene editing silences (sometimes referred to as gene knockout) or inhibits / reduces (sometimes referred to as gene knockdown) the expression of a DNA sequence. According to embodiments of the present invention, gene editing techniques are used to enhance the efficacy of a therapeutic population of TILs.

[0095] Methods for expanding TILs with reduced expression of PD-1 and TIGIT can be performed according to any embodiment of the methods described herein, or by modifying the methods described in WO2012 / 129201A1, WO2018 / 081473A1, WO2018 / 129332A1, or WO2018 / 182817A1 (the contents of which are incorporated by reference in their entireties) to incorporate steps for reducing expression of PD-1 and TIGIT in TILs as described herein. Briefly, in some embodiments, a method for expanding TILs includes a first expansion step ("pre-REP" step) in which a population of TILs is cultured for about 7-14 days in a first cell culture medium containing IL-2; an activation step, a step of introducing a first TALEN system targeting a first gene selected from the group consisting of PD-1 and TIGIT; a resting step, a step of introducing a second TALEN system targeting a second gene selected from the group consisting of PD-1 and TIGIT (the second gene and the first gene are not identical); and, after the second introduction step, a second expansion step ("REP" step) in which the population of TILs is cultured for about 7-14 days in a second cell culture medium containing antigen-presenting cells (APCs), OKT-3, and IL-2.

[0096] Examples of systems, methods, and compositions that can be used in accordance with embodiments of the present invention for altering the expression of one or more target gene sequences by the TALE method are described in U.S. Pat. No. 8,586,526 and WO2018 / 007263A1, the contents of which are incorporated herein by reference in their entireties.

[0097] TALE stands for "Transcription Activator-Like Effector" protein and includes TALENs ("Transcription Activator-Like Effector Nucleases"). Methods using the TALE system for gene editing may also be referred to herein as the TALE method. TALEs are naturally occurring proteins derived from the plant pathogenic fungus Xanthomonas genus. They contain a DNA-binding domain composed of a series of 33-35 amino acid repeat domains, each of which recognizes a single base pair. TALE specificity is determined by two hypervariable amino acids known as repeat variable dimers (RVDs). Modular TALE repeats are joined together to recognize adjacent DNA sequences. Specific RVDs within the DNA-binding domain recognize bases within the target locus and provide structural features for assembling a predictable DNA-binding domain. The DNA-binding domain of TALEs is fused to the catalytic domain of a type IIS Fok-I endonuclease to create a targetable TALE nuclease. To induce site-specific mutations, two individual TALEN arms, separated by a 14–20 base pair spacer region, bring Fok-I monomers into close proximity and dimerize, producing the targeted double-stranded break.

[0098] Several large-scale systematic studies utilizing various assembly methods have shown that TALE repeats can be combined to recognize virtually any user-defined sequence. Custom-designed TALE arrays are also commercially available from Life Technologies (Grand Island, NY, USA). TALE and TALEN methods suitable for use in the present invention are described in U.S. Patent Application Publication Nos. 2011 / 0201118A1, 2013 / 0117869A1, 2013 / 0315884A1, 2015 / 0203871A1, and 2016 / 0120906A1, the disclosures of which are incorporated herein by reference in their entireties.

[0099] An exemplary process for producing and expanding TILs with reduced expression of PD-1 and TIGIT is shown in Figure 10, where the expanded TILs are genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA encoding TALEN systems that target PD-1 and TIGIT, into the TILs.

[0100] In some embodiments, the method comprises: (a) culturing the first TIL population in a first cell culture medium containing IL-2 for about 5-7 days to produce a second TIL population; (b) activating the second TIL population for 2-4 days to produce a third TIL population; (c) introducing a first TALE nuclease (TALEN) system targeting a first gene selected from the group consisting of PD-1 and TIGIT into at least a portion of the third TIL population to produce a fourth TIL population; (d) placing the fourth population of TILs in the first cell culture medium containing IL-2 for 3 days; (e) introducing a second TALEN system targeting a second gene selected from the group consisting of PD-1 and TIGIT into at least a portion of the fourth TIL population to produce a fifth TIL population, wherein the first gene and the second gene are different; (f) culturing the fifth TIL population in a second cell culture medium comprising antigen-presenting cells (APCs), OKT-3, and IL-2 for about 7 to 11 days to produce a sixth TIL population having reduced expression of PD-1 and TIGIT.

[0101] In some embodiments, the method comprises a first expansion step (step (a)), an activation step (step (b)), two TALEN-mediated gene editing steps (steps (c) and (e)) separated by a resting period (step (d)), followed by a second expansion step (step (f)).

[0102] In alternative embodiments, the first expansion step and the activation step may be partially or completely combined. In some embodiments, the activation step may be considered a continuation of the first expansion step. For example, the activation step is performed in a first cell culture medium containing IL-2 by adding an anti-CD3 agonist and an anti-CD28 agonist, such as TransAct.

[0103] B. Obtaining a patient tumor sample Generally, TILs are initially obtained from a patient tumor sample ("primary TILs") and then expanded into larger populations for further manipulation as described herein, where the expanded TILs are genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA, encoding TALEN systems targeting PD-1 and TIGIT into the TILs.

[0104] Patient tumor samples can be obtained using methods known in the art, generally via surgical resection, needle biopsy, core biopsy, mini-biopsy, or other means for obtaining a sample containing a mixture of tumor cells and TIL cells. In some embodiments, multi-lesion sampling is used. In some embodiments, surgical resection, needle biopsy, core biopsy, mini-biopsy, or other means for obtaining a sample containing a mixture of tumor cells and TIL cells involves multi-lesion sampling (i.e., obtaining samples from one or more tumor sites and / or locations in a patient, as well as one or more tumors in the same or adjacent locations). Generally, tumor samples can be derived from any solid tumor, including primary tumors, invasive tumors, or metastatic tumors. Tumor samples can be liquid tumors, such as tumors obtained from hematological malignancies. Solid tumors can be of skin tissue. In some embodiments, useful TILs are obtained from melanoma.

[0105] Once obtained, tumor samples are generally cut into sections of 1 to approximately 8 mm using sharp dissection. 3 fragmented into small pieces of about 2-3 mm 3are particularly useful. In some embodiments, TILs are cultured from these fragments using enzymatic tumor digests. Such tumor digests can be produced by incubation in enzymatic medium (e.g., Roswell Park Memorial Institute (RPMI) 1640 buffer, 2 mM glutamic acid, 10 mcg / mL gentamicin, 30 units / mL DNase, and 1.0 mg / mL collagenase) followed by mechanical dissociation (e.g., using a tissue dissociation agent). Tumor digests can be produced by placing the tumor in enzymatic medium, mechanically dissociating the tumor for approximately 1 minute, followed by incubation at 37°C in 5% CO2 for 30 minutes, and then repeating cycles of mechanical dissociation and incubation under the aforementioned conditions until only small tissue fragments are present. At the end of this process, if the cell suspension contains a large number of red blood cells or dead cells, density gradient separation using FICOLL branched hydrophilic polysaccharides can be performed to remove these cells. Alternative methods known in the art can be used, such as those described in U.S. Patent Application Publication No. 2012 / 0244133A1, the disclosure of which is incorporated herein by reference. Any of the foregoing methods can be used in any of the embodiments described herein for methods of expanding TILs or methods of treating cancer.

[0106] As described above, in some embodiments, the TILs are derived from a solid tumor. In some embodiments, the solid tumor is not fragmented. In some embodiments, the solid tumor is not fragmented and is subjected to enzymatic digestion as a whole tumor. In some embodiments, the tumor is digested in an enzyme mixture comprising collagenase, DNase, and neutral protease. In some embodiments, the tumor is digested in an enzyme mixture comprising collagenase, DNase, and neutral protease for 1-2 hours. In some embodiments, the tumor is digested in an enzyme mixture comprising collagenase, DNase, and neutral protease for 1-2 hours at 37°C and 5% CO2. In some embodiments, the tumor is digested in an enzyme mixture comprising collagenase, DNase, and neutral protease for 1-2 hours at 37°C and 5% CO2 with rotation. In some embodiments, the tumor is digested overnight with constant rotation. In some embodiments, the tumor is digested overnight at 37°C and 5% CO2 with constant rotation. In some embodiments, the whole tumor is combined with the enzymes to form a tumor digestion reaction mixture.

[0107] In some embodiments, the tumor is reconstituted with lyophilized enzyme in a sterile buffer, hi some embodiments, the buffer is sterile HBSS.

[0108] In some embodiments, the enzyme mixture includes collagenase. In some embodiments, the collagenase is collagenase IV. In some embodiments, the working stock of collagenase is a 10x working stock of 100 mg / ml.

[0109] In some embodiments, the enzyme mixture comprises DNAse. In some embodiments, the working stock of DNAse is a 10x working stock of 10,000 IU / ml.

[0110] In some embodiments, the enzyme mixture comprises hyaluronidase. In some embodiments, the working stock of hyaluronidase is a 10-mg / ml 10x working stock.

[0111] In some embodiments, the enzyme mixture comprises 10 mg / ml collagenase, 1000 IU / ml DNAse, and 1 mg / ml hyaluronidase.

[0112] In some embodiments, the enzyme mixture comprises 10 mg / ml collagenase, 500 IU / ml DNAse, and 1 mg / ml hyaluronidase.

[0113] In some embodiments, the enzyme mixture comprises a neutral protease. In some embodiments, a working stock of neutral protease is reconstituted at a concentration of 175 DMC U / mL.

[0114] In some embodiments, the enzyme mixture comprises a neutral protease, a DNase, and a collagenase.

[0115] In some embodiments, the enzyme mixture comprises 10 mg / ml collagenase, 1000 IU / ml DNase, and 0.31 DMC U / ml neutral protease, hi some embodiments, the enzyme mixture comprises 10 mg / ml collagenase, 500 IU / ml DNase, and 0.31 DMC U / ml neutral protease.

[0116] Generally, the harvested cell suspension is referred to as a "primary cell population" or "freshly harvested" cell population.

[0117] In some embodiments, fragmentation includes physical fragmentation, including, for example, dissection and digestion. In some embodiments, fragmentation is physical fragmentation. In some embodiments, fragmentation is dissection. In some embodiments, fragmentation is by digestion. In some embodiments, TILs can be initially cultured from enzymatic tumor digests and tumor fragments obtained from a patient. In some embodiments, TILs can be initially cultured from enzymatic tumor digests and tumor fragments obtained from a patient prior to genetic modification via TALEN gene editing by sequentially introducing into the TILs nucleic acids, such as mRNA, encoding TALEN systems targeting PD-1 and TIGIT.

[0118] In some embodiments where the tumor is a solid tumor, after a tumor sample is obtained (as provided in FIG. 10), the tumor undergoes physical fragmentation. In some embodiments, fragmentation occurs prior to cryopreservation. In some embodiments, fragmentation occurs after cryopreservation. In some embodiments, fragmentation occurs after tumor acquisition in the absence of any cryopreservation. In some embodiments, the tumor is fragmented and 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more fragments or pieces are placed in each container for the first expansion. In some embodiments, the tumor is fragmented and 30 or 40 fragments or pieces are placed in each container for the first expansion. In some embodiments, the tumor is fragmented and 40 fragments or pieces are placed in each container for the first expansion. In some embodiments, the tumor is fragmented and 40 fragments or pieces are placed in each container for the first expansion. In some embodiments, the plurality of fragments comprises about 4 to about 50 fragments, each fragment being about 27 mm. 3 In some embodiments, the plurality of pieces has a total volume of about 1300 mm 3 ~about 1500mm 3 In some embodiments, the plurality of fragments has a total volume of about 1350 mm or less. 3In some embodiments, the plurality of fragments comprises about 50 fragments with a total mass of about 1 gram to about 1.5 grams. In some embodiments, the plurality of fragments comprises about 4 fragments. In some embodiments, the plurality of fragments comprises about 100 fragments.

[0119] In some embodiments, the TILs are obtained from tumor fragments. In some embodiments, the tumor fragments are obtained by sharp dissection. In some embodiments, the tumor fragments are about 1 mm 3 ~10mm 3 In some embodiments, the tumor fragment is about 1 mm 3 ~8mm 3 In some embodiments, the tumor fragment is about 1 mm 3 In some embodiments, the tumor fragment is about 2 mm 3 In some embodiments, the tumor fragment is about 3 mm 3 In some embodiments, the tumor fragment is about 4 mm 3 In some embodiments, the tumor fragment is about 5 mm 3 In some embodiments, the tumor fragment is about 6 mm 3 In some embodiments, the tumor fragment is about 7 mm 3 In some embodiments, the tumor fragment is about 8 mm 3 In some embodiments, the tumor fragment is about 9 mm 3 In some embodiments, the tumor fragment is about 10 mm 3 In some embodiments, the tumor is 1-4 mm x 1-4 mm x 1-4 mm. In some embodiments, the tumor is 1 mm x 1 mm x 1 mm. In some embodiments, the tumor is 2 mm x 2 mm x 2 mm. In some embodiments, the tumor is 3 mm x 3 mm x 3 mm. In some embodiments, the tumor is 4 mm x 4 mm x 4 mm.

[0120] In some embodiments, the tumor is resected to minimize the amount of hemorrhagic, necrotic, and / or fatty tissue on each piece. In some embodiments, the tumor is resected to minimize the amount of hemorrhagic tissue on each piece. In some embodiments, the tumor is resected to minimize the amount of necrotic tissue on each piece. In some embodiments, the tumor is resected to minimize the amount of fatty tissue on each piece.

[0121] In some embodiments, tumor fragmentation is performed to maintain the internal structure of the tumor. In some embodiments, tumor fragmentation is performed without sawing with a scalpel. In some embodiments, TILs are obtained from tumor digests. In some embodiments, tumor digests are generated by incubation in an enzyme medium, such as, but not limited to, RPMI 1640, 2 mM GlutaMAX, 10 mg / mL gentamicin, 30 U / mL DNase, and 1.0 mg / mL collagenase (GentleMACS, Miltenyi Biotec, Auburn, CA), followed by mechanical dissociation. After placing the tumor in the enzyme medium, the tumor may be mechanically dissociated for approximately 1 minute. The solution may then be incubated at 37°C in 5% CO2 for 30 minutes, after which it may be mechanically disrupted again for approximately 1 minute. After again incubating at 37°C in 5% CO2 for 30 minutes, the tumor may be mechanically disrupted a third time for approximately 1 minute. In some embodiments, if large tissue fragments were present, one or two additional rounds of mechanical dissociation were applied to the sample after the third mechanical disruption, with incubation for an additional 30 minutes at 37°C in 5% CO. In some embodiments, if the cell suspension contains a large number of red blood cells or dead cells, density gradient separation using Ficoll can be performed at the end of the final incubation to remove these cells.

[0122] In some embodiments, the cell suspension harvested prior to the first expansion step is referred to as a "primary cell population" or "freshly harvested" cell population.

[0123] In some embodiments, the cells may be optionally frozen after sampling and cryopreserved before undergoing expansion, as described in more detail below and also illustrated in FIG. 10.

[0124] C. First Expansion For example, after dissection or digestion of tumor fragments, such as those described in Figure 10, the resulting cells are cultured in serum containing IL-2 under conditions that favor the growth of TILs over tumor and other cells. In some embodiments, tumor digests are incubated in 2 mL wells in medium containing inactivated human AB serum with 6000 IU / mL of IL-2. This primary cell population is cultured for several days, generally 3-14 days, resulting in a bulk TIL population, generally about 1 x 10 8 In some embodiments, the expanded TILs are genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA, encoding TALEN systems targeting PD-1 and TIGIT into the TILs. In some embodiments, this primary cell population is cultured for 3-9 days, resulting in a bulk TIL population, generally about 1 x 10 cells. 8 In some embodiments, the expanded TILs are genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA, encoding TALEN systems targeting PD-1 and TIGIT into the TILs. In some embodiments, this primary cell population is cultured for 5-7 days, resulting in a bulk TIL population, generally about 1 x 10 cells. 8 In some embodiments, the expanded TILs are genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA, encoding TALEN systems targeting PD-1 and TIGIT into the TILs. In some embodiments, this primary cell population is cultured for about 7 days, resulting in a bulk TIL population, generally about 1 x 10 cells. 8 This results in bulk TIL cells, where the expanded TILs are genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA, encoding TALEN systems targeting PD-1 and TIGIT into the TILs.

[0125] In embodiments in which TIL cultures are initiated in 24-well plates, e.g., using Costar 24-well cell culture clusters, flat bottom (Corning Incorporated, Corning, NY), 1 × 10 cells were cultured in 2 mL of complete medium (CM) containing IL-2 (6000 IU / mL; Chiron Corp., Emeryville, CA). 6 Tumor digested cells or one tumor fragment can be seeded into each well, where the expanded TILs are genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA encoding TALEN systems targeting PD-1 and TIGIT, into the TILs. In some embodiments, the tumor fragments are approximately 1 mm in size. 3 ~10mm 3 is.

[0126] In some embodiments, the first expansion culture medium is referred to as "CM," an abbreviation for culture medium. In some embodiments, the CM in step B consists of RPMI 1640 with GlutaMAX supplemented with 10% human AB serum, 25 mM Hepes, and 10 mg / mL gentamicin. The cultures are grown in a 40 mL volume and 10 cm 2 In embodiments initiated in gas-permeable flasks with gas-permeable silicon bottoms (e.g., G-Rex 10; Wilson Wolf Manufacturing, New Brighton, MN), each flask contains 10-40 x 10 cells in 10-40 mL of CM with IL-2. 6 Live tumor cells or 5-30 tumor fragments can be loaded. Both G-Rex10 and 24-well plates are incubated in a humidified incubator at 37 °C in 5% CO. After 5 days of culture, half of the medium is removed and replaced with fresh CM and IL-2. After 5 days, half of the medium can be replaced every 2-3 days.

[0127] After preparation of tumor fragments, the resulting cells (i.e., fragments) are cultured in serum containing IL-2 under conditions that favor the growth of TILs over tumor and other cells, and the favored TILs are genetically modified via TALEN gene editing by sequentially introducing into the TILs nucleic acids, such as mRNA, encoding TALEN systems targeting PD-1 and TIGIT. In some embodiments, tumor digests are incubated in 2 mL wells (or in some cases, in the presence of an aAPC cell population, as outlined herein) in media containing inactivated human AB serum with 6000 IU / mL of IL-2. This primary cell population is cultured for several days, generally 10-14 days, resulting in a bulk TIL population, generally about 1 x 10 8 In some embodiments, the growth medium during the first expansion contains IL-2 or a variant thereof. In some embodiments, the IL is recombinant human IL-2 (rhIL-2). In some embodiments, the IL-2 stock solution contains 20-30 x 10 cells for a 1 mg vial. 6 IU / mg specific activity. In some embodiments, the IL-2 stock solution contains 20×10 6 IU / mg specific activity. In some embodiments, the IL-2 stock solution contains 25×10 6 IU / mg specific activity. In some embodiments, the IL-2 stock solution contains 30×10 6 IU / mg specific activity. In some embodiments, the IL-2 stock solution contains 4-8 x 10 6 In some embodiments, the IL-2 stock solution has a final concentration of 5-7 x 10 IU / mg IL-2. 6 In some embodiments, the IL-2 stock solution has a final concentration of 6×10 IU / mg of IL-2. 6IU / mg IL-2. In some embodiments, the first expansion culture medium contains about 10,000 IU / mL IL-2, about 9,000 IU / mL IL-2, about 8,000 IU / mL IL-2, about 7,000 IU / mL IL-2, about 6,000 IU / mL IL-2, or about 5,000 IU / mL IL-2. In some embodiments, the first expansion culture medium contains about 9,000 IU / mL to about 5,000 IU / mL IL-2. In some embodiments, the first expansion culture medium contains about 8,000 IU / mL to about 6,000 IU / mL IL-2. In some embodiments, the first expansion culture medium contains about 7,000 IU / mL to about 6,000 IU / mL IL-2. In some embodiments, the first expansion culture medium comprises about 6,000 IU / mL of IL-2. In some embodiments, the cell culture medium further comprises IL-2. In some embodiments, the cell culture medium comprises about 3000 IU / mL of IL-2. In some embodiments, the cell culture medium further comprises IL-2. In some embodiments, the cell culture medium comprises about 3000 IU / mL of IL-2. In some embodiments, the cell culture medium comprises about 1000 IU / mL, about 1500 IU / mL, about 2000 IU / mL, about 2500 IU / mL, about 3000 IU / mL, about 3500 IU / mL, about 4000 IU / mL, about 4500 IU / mL, about 5000 IU / mL, about 5500 IU / mL, about 6000 IU / mL, about 6500 IU / mL, about 7000 IU / mL, about 7500 IU / mL, or about 8000 IU / mL of IL-2. In some embodiments, the cell culture medium contains 1000-2000 IU / mL, 2000-3000 IU / mL, 3000-4000 IU / mL, 4000-5000 IU / mL, 5000-6000 IU / mL, 6000-7000 IU / mL, 7000-8000 IU / mL, 1000-5000 IU / mL, or about 8000 IU / mL of IL-2.

[0128] In some embodiments, the cell culture medium comprises an OKT-3 antibody. In some embodiments, the cell culture medium comprises about 30 ng / mL of the OKT-3 antibody. In some embodiments, the cell culture medium comprises about 0.1 ng / mL, about 0.5 ng / mL, about 1 ng / mL, about 2.5 ng / mL, about 5 ng / mL, about 7.5 ng / mL, about 10 ng / mL, about 15 ng / mL, about 20 ng / mL, about 25 ng / mL, about 30 ng / mL, about 35 ng / mL, about 40 ng / mL, about 50 ng / mL, about 60 ng / mL, about 70 ng / mL, about 80 ng / mL, about 90 ng / mL, about 100 ng / mL, about 200 ng / mL, about 500 ng / mL, or about 1 μg / mL of the OKT-3 antibody. In some embodiments, the cell culture medium comprises OKT-3 antibody at concentrations of 0.1 ng / mL to 1 ng / mL, 1 ng / mL to 5 ng / mL, 5 ng / mL to 10 ng / mL, 10 ng / mL to 20 ng / mL, 20 ng / mL to 30 ng / mL, 30 ng / mL to 40 ng / mL, 40 ng / mL to 50 ng / mL, and 50 ng / mL to 100 ng / mL. In some embodiments, the cell culture medium does not contain OKT-3 antibody. In some embodiments, the OKT-3 antibody is muromonab (see Table 1).

[0129] In some embodiments, the cell culture medium comprises one or more TNFRSF agonists in the cell culture medium. In some embodiments, the TNFRSF agonist comprises a 4-1BB agonist. In some embodiments, the TNFRSF agonist is a 4-1BB agonist, and the 4-1BB agonist is selected from the group consisting of urelumab, utomilumab, EU-101, fusion proteins, and fragments, derivatives, variants, biosimilars, and combinations thereof. In some embodiments, the TNFRSF agonist is added at a concentration sufficient to achieve a cell culture medium concentration of 0.1 μg / mL to 100 μg / mL. In some embodiments, the TNFRSF agonist is added at a concentration sufficient to achieve a cell culture medium concentration of 20 μg / mL to 40 μg / mL.

[0130] In some embodiments, in addition to the one or more TNFRSF agonists, the cell culture medium further comprises IL-2 at an initial concentration of about 3000 IU / mL and OKT-3 antibody at an initial concentration of about 30 ng / mL, and the one or more TNFRSF agonists comprise a 4-1BB agonist.

[0131] In some embodiments, the first TIL expansion can continue for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, or 14 days, and the expanded TILs are genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA, encoding TALEN systems targeting PD-1 and TIGIT into the TILs. In some embodiments, the first TIL expansion can continue for 1 day to 14 days. In some embodiments, the first TIL expansion can continue for 2 days to 14 days. In some embodiments, the first TIL expansion can continue for 3 days to 14 days. In some embodiments, the first TIL expansion can continue for 4 days to 14 days. In some embodiments, the first TIL expansion can continue for 5 days to 14 days. In some embodiments, the first TIL expansion can continue for 6 days to 14 days. In some embodiments, the first TIL expansion can continue for 7 days to 14 days. In some embodiments, the first TIL expansion can continue for 8 to 14 days. In some embodiments, the first TIL expansion can continue for 9 to 14 days. In some embodiments, the first TIL expansion can continue for 10 to 14 days. In some embodiments, the first TIL expansion can continue for 11 to 14 days. In some embodiments, the first TIL expansion can continue for 12 to 14 days. In some embodiments, the first TIL expansion can continue for 13 to 14 days. In some embodiments, the first TIL expansion can continue for 14 days. In some embodiments, the first TIL expansion can continue for 1 to 11 days. In some embodiments, the first TIL expansion can continue for 2 to 11 days. In some embodiments, the first TIL expansion can continue for 3 to 11 days. In some embodiments, the first TIL expansion can continue for 4 to 11 days. In some embodiments, the first TIL expansion can continue for 5 to 11 days. In some embodiments, the first TIL expansion can continue for 6 to 11 days.In some embodiments, the first TIL expansion can continue for 7 to 11 days. In some embodiments, the first TIL expansion can continue for 8 to 11 days. In some embodiments, the first TIL expansion can continue for 9 to 11 days. In some embodiments, the first TIL expansion can continue for 10 to 11 days. In some embodiments, the first TIL expansion can continue for 11 days. In some embodiments, the first TIL expansion can continue for 5 to 7 days. In some embodiments, the first TIL expansion can continue for 6 to 7 days. In some embodiments, the first TIL expansion can continue for 7 to 12 days. In some embodiments, the first TIL expansion can continue for 8 to 12 days. In some embodiments, the first TIL expansion can continue for 9 to 12 days. In some embodiments, the first TIL expansion can continue for 10 to 12 days. In some embodiments, the first TIL expansion can continue for 7 days. In some embodiments, the first TIL expansion can continue for 9 days.

[0132] In some embodiments, the first expansion is performed in a closed system bioreactor. In some embodiments, a closed system is used for TIL expansion as described herein. In some embodiments, a single bioreactor is used. In some embodiments, the single bioreactor used is, for example, a G-REX-10 or G-REX-100. In some embodiments, the closed system bioreactor is a single bioreactor.

[0133] In some embodiments, the first cell culture medium comprises 6000 IU / mL of IL-2. In some embodiments, the first cell culture medium comprises 3000 IU / mL of IL-2. In some embodiments, the first cell culture medium comprises 2000 IU / mL of IL-2. In some embodiments, the first cell culture medium comprises 1000 IU / mL of IL-2.

[0134] D. Activation In some embodiments, after the first expansion (pre-REP) step, the TILs are activated by adding an anti-CD3 agonist, such as TransAct, and an anti-CD28 agonist to the culture medium and culturing for about 1-3 days, and the TILs are genetically modified via TALEN gene editing by sequentially introducing into the TILs nucleic acids, such as mRNA, encoding TALEN systems targeting PD-1 and TIGIT.

[0135] In some embodiments, the step of activating the second TIL population (obtained from the first expansion or pre-REP step) can be performed for 1 day, 2 days, 3 days, or for a period of time that is about, less than, greater than, or between any of the above values. For example, in some embodiments, the step of activating the second TIL population is performed for about 1 day. In some embodiments, the step of activating the second TIL population is performed for about 2 days. In some embodiments, the step of activating the second TIL population is performed for about 3 days.

[0136] In some embodiments, activating the second TIL population (obtained from the first expansion step or pre-REP step) is performed using an anti-CD3 agonist and an anti-CD28 agonist, e.g., TransAct. In some embodiments, activating the second TIL population is performed using TransAct at a dilution of 1:10, 1:17.5, 1:20, 1:25, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, or 1:100.

[0137] In some embodiments, activating the second TIL population (obtained from the first expansion step or pre-REP step) can be performed by adding an anti-CD3 agonist and an anti-CD28 agonist, e.g., TransAct, to the first cell culture medium. In some embodiments, activating the second TIL population can be performed by replacing the first cell culture medium with cell culture medium containing an anti-CD3 agonist and an anti-CD28 agonist, such as TransAct.

[0138] E. First and Second TALEN Gene Modification Steps TALE stands for "Transcription Activator-Like Effector" protein and includes TALENs ("Transcription Activator-Like Effector Nucleases"). Methods using the TALE system for gene editing may also be referred to herein as TALE methods. TALEs are naturally occurring proteins derived from the plant pathogenic fungus Xanthomonas genus. They contain a DNA-binding domain composed of a series of 33-35 amino acid repeat domains, each of which recognizes a single base pair. TALE specificity is determined by two hypervariable amino acids known as repeat variable dimers (RVDs). Modular TALE repeats are joined together to recognize adjacent DNA sequences. Specific RVDs within the DNA-binding domain recognize bases within the target locus and provide the structural features for assembling predictable DNA-binding domains. The DNA-binding domain of a TALE is fused to the catalytic domain of the type IIS Fok-I endonuclease to create a targetable TALE nuclease (TALEN). TALE nucleases are highly specific reagents because they must bind to DNA in a paired heterodimeric form, resulting in the dimerization of the cleavage domain Fok-I. The left and right heterodimer members each recognize different nucleic acid sequences of approximately 14–20 bp, and together span a target sequence of 30–50 bp for overall specificity. To induce site-specific mutagenesis, two individual TALEN arms, separated by a 14–20 base pair spacer region, dimerize with the Fok-I monomer in close proximity, generating the targeted double-stranded break.

[0139] Several large-scale, systematic studies utilizing various assembly methods have demonstrated that TALE repeats can be combined to recognize virtually any user-defined sequence. Strategies that enable rapid assembly of custom TALE arrays include Golden Gate molecular cloning, high-throughput solid-phase assembly, and ligation-independent cloning technologies. Custom-designed TALE arrays are also commercially available from Cellectis Bioresearch (Paris, France), Transposagen Biopharmaceuticals (Lexington, KY, USA), and Life Technologies (Grand Island, NY, USA). Additionally, web-based tools such as TAL Effector-Nucleotide Target 2.0 are available, which allow the design of custom TAL effector repeat arrays for desired targets and also provide predicted TAL effector binding sites. See Doyle, et al., Nucleic Acids Research, 2012, Vol. 40, W117-W122. Examples of TALE and TALEN methods suitable for use in the present invention are described in U.S. Patent Publication Nos. 2011 / 0201118A1, 2013 / 0117869A1, 2013 / 0315884A1, 2015 / 0203871A1, and 2016 / 0120906A1, the disclosures of which are incorporated herein by reference.

[0140] According to some embodiments of the present invention, the TALE method involves silencing or reducing the expression of one or more genes by inhibiting or preventing the transcription of the target gene(s). For example, the TALE method may involve utilizing KRAB-TALE, which involves fusing a transcriptional Kruppel-associated box (KRAB) domain to a DNA-binding domain that targets the transcription start site of the gene, leading to the inhibition or prevention of transcription of the gene.

[0141] According to another embodiment, the TALE method involves silencing or reducing the expression of one or more genes by introducing mutations into target gene(s). For example, the TALE method may involve fusing a nuclease effector domain, such as Fok-I, to a TALE DNA binding domain, resulting in a TALEN. Fok-I is active as a dimer, so this method involves constructing a TALEN pair to position the Fok-I nuclease domain at adjacent genomic target sites, thereby introducing a DNA double-strand break. After correct positioning and dimerization of Fok-I, the double-strand break can be completed. Once the double-strand break is introduced, DNA repair can be achieved through two different mechanisms: high-fidelity homology-directed repair (HRR) (also known as homology-directed repair or HDR) or error-prone non-homologous end joining (NHEJ). Repair of double-strand breaks via NHEJ preferably results in deletion, insertion, or substitution of the DNA target site; that is, NHEJ typically results in the introduction of small insertions and deletions at the break site, often inducing a frameshift that knocks out gene function. According to certain embodiments, a TALEN pair targets the 5'-most exon of a gene, promoting a premature frameshift mutation or a premature stop codon. The gene mutation(s) introduced by TALENs are generally permanent. Thus, according to some embodiments, the method includes using dimerized TALENs to induce a site-specific double-strand break that is repaired via error-prone NHEJ, resulting in one or more mutations in the target gene, thereby silencing or reducing the expression of the target gene.

[0142] In another embodiment, TALENs, hybrid proteins derived from Fok-I and AvrXa7, as disclosed in U.S. Patent Publication No. 2011 / 0201118, may be used in accordance with embodiments of the present invention. These TALENs retain the target nucleotide recognition specificity of AvrXa7 and the double-stranded DNA cleavage activity of Fok-I. Using the same method, other TALENs with different recognition specificities can be prepared. For example, compact TALENs can be generated by engineering a core TALE scaffold with a different set of RVDs to alter DNA binding specificity and target specific single dsDNA target sequences. See U.S. Patent Publication No. 2013 / 0117869. A selection of catalytic domains can be attached to the scaffold to effect DNA processing, which can be engineered to ensure that the catalytic domain, when fused to the core TALE scaffold, is capable of processing DNA near a single dsDNA target sequence. Peptide linkers can also be engineered to fuse catalytic domains to scaffolds, creating compact TALENs consisting of a single polypeptide chain that does not require dimerization to target a specific single dsDNA sequence. The core TALE scaffold can also be modified by fusing a catalytic domain, which may be a TAL monomer, to its N-terminus, allowing this catalytic domain to potentially interact with another catalytic domain fused to another TAL monomer, thereby creating a catalytic entity that is more likely to process DNA in the vicinity of the target sequence. See U.S. Patent Publication No. 2015 / 0203871. This architecture allows for targeting only one DNA strand, which is not an option for classical TALEN architecture.

[0143] In some embodiments, the activation step is followed by two steps of genetically modifying the TILs by introducing into the TILs nucleic acids, such as mRNA, encoding two TALEN systems targeting PD-1 and TIGIT. In some embodiments, the TALEN genetic modification step is carried out by genetically modifying the TILs obtained from the activation step by sequentially electroporating the TILs with nucleic acids, such as mRNA, encoding two TALEN systems targeting PD-1 and TIGIT. In some embodiments, the TALEN genetic modification step is carried out by genetically modifying the TILs obtained from the activation step by electroporating the TILs with nucleic acids, such as mRNA, encoding a TALEN system targeting PD-1, followed by electroporating the TILs with nucleic acids, such as mRNA, encoding a TALEN system targeting TIGIT. In some embodiments, the TALEN genetic modification step is carried out by genetically modifying the TILs obtained from the activation step by electroporating the TILs with nucleic acids, such as mRNA, encoding a TALEN system targeting TIGIT, followed by electroporating the TILs with nucleic acids, such as mRNA, encoding a TALEN system targeting PD-1.

[0144] In some embodiments, the activation step is followed by two steps of genetically modifying the TILs by introducing into the TILs nucleic acids, such as mRNA, encoding two TALEN systems targeting PD-1 and LAG3. In some embodiments, the TALEN genetic modification step is carried out by genetically modifying the TILs obtained from the activation step by sequentially electroporating the TILs with nucleic acids, such as mRNA, encoding two TALEN systems targeting PD-1 and LAG3. In some embodiments, the TALEN genetic modification step is carried out by genetically modifying the TILs obtained from the activation step by electroporating the TILs with nucleic acids, such as mRNA, encoding a TALEN system targeting PD-1, followed by electroporating the TILs with nucleic acids, such as mRNA, encoding a TALEN system targeting LAG3. In some embodiments, the TALEN genetic modification step is carried out by genetically modifying the TILs obtained from the activation step by electroporating the TILs with nucleic acids, such as mRNA, encoding a TALEN system targeting LAG3, followed by electroporating the TILs with nucleic acids, such as mRNA, encoding a TALEN system targeting PD-1.

[0145] Embodiments disclosed herein further provide polynucleotide sequences encoding TALEN heterodimers (also referred to as half-TALENs), particularly mRNA sequences encoding TALEN proteins targeting PD-1 and / or TIGIT, DNA sequences encoding mRNAs encoding TALEN proteins targeting PD-1 and / or TIGIT, and the like.

[0146] Embodiments disclosed herein further provide polynucleotide sequences encoding TALEN heterodimers (also referred to as half-TALENs), particularly mRNA sequences encoding TALEN proteins that target PD-1 and / or LAG3, DNA sequences encoding mRNAs encoding TALEN proteins that target PD-1 and / or LAG3, and the like.

[0147] In some embodiments, mRNA sequences encoding TALEN systems targeting PD-1, TIGIT, and / or LAG3 may be produced in vitro. In some embodiments, TALEN mRNA may be transcribed from linearized plasmid DNA encoding each TALEN arm of interest by RNA polymerase. In some embodiments, the present invention provides an in vitro transcription process comprising a mixture of a DNA template, RNA polymerase, and nucleotide triphosphates (NTPs), a magnesium-containing buffer, an RNase inhibitor, and inorganic pyrophosphatase.

[0148] In some embodiments, the present invention provides methods for post-transcriptional modification of transcribed mRNA to add a cap by further treating the mRNA with an enzyme to form a 5'-capped mRNA. See Ensinger, et al., PNAS, 1975, 72(7) 2525-2529; Moss, et al., Virology, 1976, 72(2), 341-351, the contents of which are incorporated herein by reference in their entireties. Alternatively, capped transcripts can be produced by using cap analogs during in vitro transcription reactions. See Ishikawa, et al., Nucl. Acids Symp. Series, 2009, 53, 129-131; Sikorski, et al., Nucl. Acid Res., 2020, 48(4), 1607-1626; Stepinski, et al., RNA, 2001, 7(10), 1486-1495, the contents of which are incorporated herein by reference in their entireties. In some embodiments, the present invention provides a process for in vitro transcription that can produce 5'-capped mRNA transcripts by using cap analogs during the in vitro transcription reaction without any post-transcriptional modifications. In some embodiments, mRNA sequences encoding TALEN systems targeting PD-1 or TIGIT can be produced in vitro using CleanCap® AG technology by TriLink Biotechnologies, as described in Henderson, et al., Current Protocols, 2021, 1, e39.doi:10.1002 / cpz1.39, and PCT Patent Publication No. WO2017053297A1, the contents of which are incorporated herein by reference in their entireties. In some embodiments, mRNA sequences encoding TALEN systems targeting PD-1 or TIGIT can be transcribed from linearized plasmid DNA encoding each TALEN arm of interest using "Basic Protocol 1:IVT WITH CleanCap" as described in Henderson, et al., (supra).

[0149] In some embodiments, the present invention provides DNA templates for transcription of mRNA that include a sequence encoding a TALEN system targeting PD-1, TIGIT, or LAG3, and further include a 5' untranscribed region (UTR) compatible with CleanCap® AG technology having the sequence AGCTAGCGCCGCCACC (SEQ ID NO: 30). In some embodiments, the DNA template of the mRNA sequence encoding the TALEN system targeting PD-1, TIGIT, or LAG3 includes a T7 RNA polymerase promoter sequence of TAATACGACTCACTATA (SEQ ID NO: 31) before the 5'UTR.

[0150] In some embodiments, the present invention provides a process for preparing expanded tumor-infiltrating lymphocytes (TILs) with reduced expression of PD-1 and TIGIT, or reduced expression of PD-1 and LAG3, using mRNA encoding a TALEN system targeting PD-1, TIGIT, or LAG3, delivered at approximately 0.1-20 μg of mRNA / million cells. For example, mRNA encoding a TALEN system targeting PD-1, TIGIT, or LAG3 may be expressed at about 0.1 μg mRNA / million cells, about 0.2 μg mRNA / million cells, about 0.3 μg mRNA / million cells, about 0.4 μg mRNA / million cells, about 0.5 μg mRNA / million cells, about 0.6 μg mRNA / million cells, about 0.7 μg mRNA / million cells, about 0.8 μg mRNA / million cells, about 0.9 μg mRNA / million cells, about 1 μg mRNA / million cells, about 1.5 μg mRNA / million cells, about 2 μg mRNA / million cells, about 3 μg mRNA / million cells, about 4 μg mRNA / million cells, about 5 μg mRNA / million cells, about 6 μg The mRNA is introduced at about 7 μg mRNA / million cells, about 8 μg mRNA / million cells, about 9 μg mRNA / million cells, about 10 μg mRNA / million cells, or about 20 μg mRNA / million cells. In some embodiments, the mRNA encoding a TALEN system targeting PD-1, TIGIT, or LAG3 is introduced at about 0.1 to 10 μg mRNA / million cells. In some embodiments, the mRNA encoding a TALEN system targeting PD-1, TIGIT, or LAG3 is introduced at about 0.1 to 4 μg mRNA / million cells. In some embodiments, the mRNA encoding a TALEN system targeting PD-1, TIGIT, or LAG3 is introduced at about 0.5 to 4 μg mRNA / million cells. In some embodiments, mRNA encoding a TALEN system targeting PD-1, TIGIT, or LAG3 is introduced at about 0.5 μg of mRNA / million cells.In some embodiments, mRNA encoding a TALEN system targeting PD-1, TIGIT, or LAG3 is introduced at about 1 μg of mRNA per million cells. In some embodiments, mRNA encoding a TALEN system targeting PD-1, TIGIT, or LAG3 is introduced at about 2 μg of mRNA per million cells. In some embodiments, mRNA encoding a TALEN system targeting PD-1, TIGIT, or LAG3 is introduced at about 4 μg of mRNA per million cells.

[0151] In some embodiments, the present invention provides a process for preparing expanded tumor-infiltrating lymphocytes (TILs) with reduced expression of PD-1 and TIGIT using mRNA encoding a TALEN system targeting PD-1, comprising the amino acid sequences of SEQ ID NOs: 14 and 16, introduced at approximately 10 μg / mL or 12.5 μg / mL of mRNA per TALEN arm, and mRNA encoding a TALEN system targeting TIGIT, comprising the amino acid sequences of SEQ ID NOs: 20 and 22, introduced at approximately 40 μg / mL or 50 μg / mL of mRNA per TALEN arm. In some embodiments, the present invention provides a process for preparing expanded tumor infiltrating lymphocytes (TILs) with reduced expression of PD-1 and TIGIT using mRNA encoding a TALEN system targeting PD-1 comprising the amino acid sequences of SEQ ID NOs: 14 and 16, introduced at about 10 μg / mL of mRNA per TALEN arm, and mRNA encoding a TALEN system targeting TIGIT comprising the amino acid sequences of SEQ ID NOs: 20 and 22, introduced at about 40 μg / mL of mRNA per TALEN arm. In some embodiments, the present invention provides a process for preparing expanded tumor infiltrating lymphocytes (TILs) with reduced expression of PD-1 and TIGIT using mRNA encoding a TALEN system targeting PD-1 comprising the amino acid sequences of SEQ ID NOs: 14 and 16, introduced at about 10 μg / mL of mRNA per TALEN arm, and mRNA encoding a TALEN system targeting TIGIT comprising the amino acid sequences of SEQ ID NOs: 20 and 22, introduced at about 50 μg / mL of mRNA per TALEN arm. In some embodiments, the present invention provides a process for preparing expanded tumor-infiltrating lymphocytes (TILs) with reduced expression of PD-1 and TIGIT using mRNA encoding a TALEN system targeting PD-1, comprising the amino acid sequences of SEQ ID NOs: 14 and 16, introduced at approximately 12.5 μg / mL of mRNA per TALEN arm, and mRNA encoding a TALEN system targeting TIGIT, comprising the amino acid sequences of SEQ ID NOs: 20 and 22, introduced at approximately 40 μg / mL of mRNA per TALEN arm.In some embodiments, the present invention provides a process for preparing expanded tumor-infiltrating lymphocytes (TILs) with reduced expression of PD-1 and TIGIT using mRNA encoding a TALEN system targeting PD-1, comprising the amino acid sequences of SEQ ID NOs: 14 and 16, introduced at approximately 12.5 μg / mL of mRNA per TALEN arm, and mRNA encoding a TALEN system targeting TIGIT, comprising the amino acid sequences of SEQ ID NOs: 20 and 22, introduced at approximately 50 μg / mL of mRNA per TALEN arm.

[0152] Electroporation methods are known in the art and are described, for example, in Tsong, Biophys. J. 1991, 60, 297-306 and U.S. Patent Application Publication No. 2014 / 0227237A1, the disclosures of each of which are incorporated herein by reference. Other electroporation methods known in the art, such as those described in U.S. Patent Nos. 5,019,034, 5,128,257, 5,137,817, 5,173,158, 5,232,856, 5,273,525, 5,304,120, 5,318,514, 6,010,613, and 6,078,490 (the disclosures of which are incorporated herein by reference), can also be used. In some embodiments, the electroporation method is a sterile electroporation method. In some embodiments, the electroporation method is a pulsed electroporation method. In some embodiments, the electroporation method is a pulsed electroporation method comprising treating a TIL with a pulsed electric field to modify, manipulate, or cause a defined and controlled permanent or temporary change in the TIL, comprising applying to the TIL a sequence of at least three single, operator-controlled, individually programmed DC electric pulses having a field strength of 100 V / cm or greater, wherein the sequence of at least three DC electric pulses has one, two, or three of the following characteristics: (1) at least two of the at least three pulses differ from each other in pulse amplitude; (2) at least two of the at least three pulses differ from each other in pulse width; or (3) a first pulse interval in a first set of two of the at least three pulses differs from a second pulse interval in a second set of two of the at least three pulses.In some embodiments, the electroporation method is a pulsed electroporation method comprising treating a TIL with a pulsed electric field to alter, manipulate, or cause a controlled, permanent or temporary alteration of the TIL's definition, comprising applying to the TIL at least three single-operator-controlled, independently programmed DC electrical pulse trains having a field strength of 100 V / cm or greater, wherein at least two of the at least three pulses have different pulse amplitudes. In some embodiments, the electroporation method is a pulsed electroporation method comprising treating a TIL with a pulsed electric field to alter, manipulate, or cause a controlled, permanent or temporary alteration of the TIL's definition, comprising applying to the TIL at least three single-operator-controlled, independently programmed DC electrical pulse trains having a field strength of 100 V / cm or greater, wherein at least two of the at least three pulses have different pulse widths. In some embodiments, the electroporation method is a pulsed electroporation method comprising treating TILs with a pulsed electric field to alter, manipulate, or cause defined and controlled permanent or temporary alteration of the TILs, comprising applying to the TILs at least three single-operator-controlled, independently programmed DC electrical pulse trains having a field strength of 100 V / cm or greater, wherein a first pulse interval of at least two of the at least three pulses is different from a second pulse interval of two of the at least three pulses.In some embodiments, the electroporation method is a pulsed electroporation method comprising treating the TILs with a pulsed electric field to induce pore formation in the TILs, the method comprising applying to the TILs a sequence of at least three DC electric pulses having a field strength of 100 V / cm or greater, wherein the sequence of at least three DC electric pulses has one, two, or three of the following characteristics: (1) at least two of the at least three pulses differ from each other in pulse amplitude; (2) at least two of the at least three pulses differ from each other in pulse width; or (3) a first pulse interval in a first set of two of the at least three pulses differs from a second pulse interval in a second set of two of the at least three pulses, thereby allowing the induced pores to persist for a relatively long time and maintaining the viability of the TILs. In some embodiments, the method for genetically modifying a TIL population comprises a calcium phosphate transfection step. Calcium phosphate transfection methods (calcium phosphate DNA precipitation, cell surface coating, and endocytosis) are known in the art and are described in Graham and van der Eb, Virology 1973, 52, 456-467; Wigler, et al., Proc. Natl. Acad. Sci. 1979, 76, 1373-1376; and Chen and Okayarea, Mol. Cell. Biol. 1987, 7, 2745-2752, and U.S. Patent No. 5,593,875, the disclosures of each of which are incorporated herein by reference. In some embodiments, the method of genetically modifying a TIL population includes a liposome transfection step.Liposomal transfection methods, such as those using a 1:1 (w / w) liposomal formulation of the cationic lipids N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA) and dioleoylphosphotidylethanolamine (DOPE), are known in the art and are described in Rose, et al., Biotechniques 1991, 10, 520-525 and Felgner, et al. al., Proc. Natl. Acad. Sci. USA, 1987, 84, 7413-7417, and U.S. Patent Nos. 5,279,833, 5,908,635, 6,056,938, 6,110,490, 6,534,484, and 7,687,070, the disclosures of each of which are incorporated herein by reference. In some embodiments, the method of genetically modifying a TIL population comprises a transfection step using the methods described in U.S. Patent Nos. 5,766,902, 6,025,337, 6,410,517, 6,475,994, and 7,189,705, the disclosures of each of which are incorporated herein by reference.

[0153] In some embodiments of the present invention, electroporation is used to deliver the desired TALEN-encoding nucleic acid, including TALEN-encoding RNA and / or DNA. In some embodiments of the present invention, the electroporation system is a flow electroporation system. An example of a suitable flow electroporation system suitable for use with some embodiments of the present invention is the commercially available MaxCyte STX system. There are several alternative commercially available electroporation instruments that may be suitable for use with the present invention, such as the CTS Xenon Electroporation System or Neon Transfection System available from Thermo-Fisher, the AgilePulse System or ECM830 available from BTX-Harvard Apparatus, Cellaxess Elektra (Cellectricon), Nucleofector (Lonza / Amaxa), GenePulser MXcell (BIORAD), iPorator-96 (Primax), or siPORTer96 (Ambion). In some embodiments of the present invention, the electroporation system, together with the rest of the TIL expansion method, forms a sterile, closed system. In some embodiments of the invention, the electroporation system is a pulsed electroporation system as described herein, which, together with the rest of the TIL expansion method, forms a sterile closed system.

[0154] 1.PD-1 One of the most studied targets for inducing checkpoint blockade is the programmed death receptor (PD1 or PD-1, also known as PDCD1), a member of the CD28 superfamily of T cell regulatory factors. Its ligands, PD-L1 and PD-L2, are expressed on a variety of tumor cells, including melanoma. The interaction of PD-1 with PD-L1 inhibits T cell effector function, leads to T cell exhaustion in the setting of chronic stimulation, and induces T cell apoptosis in the tumor microenvironment. PD-1 may also play a role in tumor-specific escape from immune surveillance.

[0155] The expression of PD-1 in TILs can be silenced or reduced according to the compositions and methods of the present invention. For example, a method for expanding tumor-infiltrating lymphocytes (TILs) into a therapeutic TIL population can be carried out according to any of the methods described herein, and the method includes gene editing at least a portion of the TILs to silence or suppress the expression of PD-1. As described in more detail below, the gene editing process can include the use of programmable nucleases that mediate the generation of double-stranded or single-stranded breaks in immune checkpoint genes such as PD-1. For example, the TALEN method can be used to silence or reduce the expression of PD-1 in TILs.

[0156] According to certain embodiments, the present invention provides a method for expanding genetically modified tumor-infiltrating lymphocytes (TILs) into a therapeutic TIL population, wherein the genetically modified TILs are produced by introducing into the TILs nucleic acids, optionally mRNA, encoding one or more TALE nucleases capable of selectively inactivating the gene encoding TIGIT by DNA cleavage, wherein the one or more TALE nucleases include a TALE nuclease directed against one of the gene target sequences of PD-1 comprising the nucleic acid sequence of SEQ ID NO: 18, and the method optionally further comprises TALEN gene editing of at least a portion of the TILs to silence or suppress the expression of TIGIT. For example, this TALE method can be used to silence or reduce the expression of TIGIT in the TILs in addition to PD-1. In some embodiments, the TALEN targeting the PD-1 gene is one described in WO2013 / 176915A1, WO2014 / 184744A1, WO2014 / 184741A1, WO2018 / 007263A1, and WO2018 / 073391A1, and is any of the PD-1 TALENs listed in Table 10 on pages 62-63 of WO2013 / 176915A1, any of the PD-1 TALENs listed in Table 11 on page 78 of WO2014 / 184744A1, any of the PD-1 TALENs listed in Table 11 on page 75 of WO2014 / 184741A1, any of the PD-1 TALENs listed in Table 3 on pages 48-52 of WO2018 / 007263A1. and any of the PD-1 TALENs listed in Table 4 on pages 62-68 and / or Table 5 on pages 73-99 of WO2018 / 073391A1, the contents of which are incorporated by reference in their entireties.

[0157] Examples of TALE nucleases targeting the PD-1 gene and sequences encoding the TALE nucleases are provided below in Table 3. According to particular embodiments, a TALE nuclease according to the present invention recognizes and cleaves the target sequence of SEQ ID NO: 18. According to particular embodiments, a TALE nuclease according to the present invention comprises the amino acid sequences of SEQ ID NOs: 14 and 16. According to particular embodiments, a TALE nuclease according to the present invention is encoded by the nucleotide sequences of SEQ ID NOs: 13 and 15.

[0158] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5]

[0159] 2.TIGIT TIGIT is a cell surface protein expressed on regulatory T cells, memory T cells, and activated T cells. TIGIT belongs to the poliovirus receptor (PVR) family of immunoglobulin proteins and suppresses T cell activation (Yu et al., Nat Immunol., 2009, 10(1):48-57).

[0160] The expression of TIGIT in TILs is silenced or reduced according to the compositions and methods of the present invention. According to certain embodiments, the expression of both PD-1 and TIGIT in TILs is silenced or reduced according to the compositions and methods of the present invention. For example, a method for expanding tumor-infiltrating lymphocytes (TILs) into a therapeutic TIL population can be performed according to any of the methods described herein, where the method includes gene editing at least a portion of the TILs to silence or suppress TIGIT expression. As described in more detail below, the gene editing process can include the use of programmable nucleases that mediate the generation of double- or single-strand breaks in immune checkpoint genes such as TIGIT. For example, CRISPR, TALE, or zinc finger methods can be used to silence or suppress TIGIT expression in TILs. In some embodiments, TIGIT is silenced using TALEN knockout. In some embodiments, TIGIT is silenced using TALE-KRAB transcription inhibitor knockin. Further details of these methods can be found in Boettcher and McManus, Mol. Cell Review, 2015, 58, 575-585. In some embodiments, TALEN methods can be used to silence or reduce the expression of PD-1 and TIGIT in TILs.

[0161] According to certain embodiments, expression of TIGIT in TILs is silenced or reduced according to the compositions and methods of the present invention, and the genetically modified TILs are produced by introducing into the TILs nucleic acids, optionally mRNA, encoding one or more TALE nucleases capable of selectively inactivating the gene encoding TIGIT by DNA cleavage, wherein the one or more TALE nucleases comprise a TALE nuclease directed against a nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO: 23 or 28, and the method comprises TALEN gene editing of at least a portion of the TIL to silence or suppress expression of TIGIT. In some embodiments, the present invention provides a TALEN directed against a nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO: 23 or 28. In some embodiments, the present invention provides an mRNA encoding a TALEN directed against a nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO: 23 or 28.

[0162] Examples of TALE nucleases that target the TIGIT gene and sequences encoding the TALE nucleases are provided in Table 4 below. According to particular embodiments, a TALE nuclease according to the present invention recognizes and cleaves the target sequence of SEQ ID NO: 23 or 28. In some embodiments, the present invention provides a TALEN having an amino acid sequence of SEQ ID NO: 20, 22, 25 or 27. In some embodiments, the present invention provides an mRNA sequence encoding a TALEN having an amino acid sequence of SEQ ID NO: 20, 22, 25 or 27. In some embodiments, the present invention provides a TALEN encoding a nucleotide sequence of SEQ ID NO: 19, 21, 24 or 26.

[0163] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8]

[0164] 3.LAG3 Lymphocyte activation gene 3, also known as LAG-3, is a protein encoded by the LAG3 gene in humans. LAG-3 is a cell surface molecule with diverse biological effects on T cell function. It is an immune checkpoint receptor.

[0165] Expression of LAG3 in TILs is silenced or reduced according to the compositions and methods of the present invention. According to certain embodiments, expression of both PD-1 and LAG3 in TILs is silenced or reduced according to the compositions and methods of the present invention. For example, a method for expanding tumor-infiltrating lymphocytes (TILs) into a therapeutic TIL population can be performed according to any of the method embodiments described herein, where the method includes gene editing at least a portion of the TILs to silence or suppress expression of LAG3. As described in more detail below, the gene editing process can include the use of programmable nucleases that mediate the generation of double- or single-strand breaks in immune checkpoint genes such as LAG3. For example, CRISPR, TALE, or zinc finger methods can be used to silence or suppress expression of LAG-3 in TILs. In some embodiments, LAG3 is silenced using TALEN knockout. In some embodiments, LAG3 is silenced using TALE-KRAB transcription inhibitor knockin. Further details of these methods can be found in Boettcher and McManus, Mol. Cell Review, 2015, 58, 575-585. In some embodiments, TALEN methods can be used to silence or reduce the expression of PD-1 and LAG3 in TILs.

[0166] According to certain embodiments, expression of LAG3 in TILs is silenced or reduced according to the compositions and methods of the present invention, and the genetically modified TILs are produced by introducing into the TILs nucleic acids, optionally mRNA, encoding one or more TALE nucleases capable of selectively inactivating the gene encoding TIGIT by DNA cleavage, wherein the one or more TALE nucleases comprise a TALE nuclease directed against a nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO: 36, and the method comprises TALEN gene editing of at least a portion of the TILs to silence or suppress expression of LAG3. In some embodiments, the present invention provides a TALEN directed against a nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO: 36. In some embodiments, the present invention provides an mRNA encoding a TALEN directed against a nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO: 36.

[0167] Examples of TALE nucleases that target the LAG3 gene and sequences encoding the TALE nucleases are provided below in Table 21. According to certain embodiments, a TALE nuclease according to the present invention recognizes and cleaves the target sequence of SEQ ID NO: 36. In some embodiments, the present invention provides a TALEN having the amino acid sequence of SEQ ID NO: 33 or 35. In some embodiments, the present invention provides an mRNA sequence encoding a TALEN having the amino acid sequence of SEQ ID NO: 33 or 35. In some embodiments, the present invention provides a TALEN encoding the nucleotide sequence of SEQ ID NO: 32 or 34.

[0168] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4]

[0169] The main class of nucleases developed to enable site-specific genome editing includes transcription activator-like nucleases (TALENs), which achieve specific DNA binding through protein-DNA interaction.See, for example, Cox et al., Nature Medicine, 2015, Vol.21, No.2.The TALE method, the embodiment of which will be described in more detail below, can be used as the gene editing method of the present invention.

[0170] As discussed above, an embodiment of the present invention provides tumor-infiltrating lymphocytes (TILs) that have been genetically modified via TALEN gene editing by introducing into the TILs a nucleic acid, such as mRNA, encoding one or more TALE nucleases that selectively inactivate the gene encoding PD-1 by DNA cleavage, wherein the one or more TALE nucleases include a TALE nuclease directed against the nucleic acid sequence of SEQ ID NO: 18 as the PD-1 gene target sequence, and optionally introducing into the TILs a nucleic acid, such as mRNA, encoding one or more TALE nucleases that selectively inactivate the gene encoding TIGIT by DNA cleavage, wherein the one or more TALE nucleases include a TALE nuclease directed against the nucleic acid sequence of SEQ ID NO: 23 or 28 as the TIGIT gene target sequence, thereby enhancing their therapeutic efficacy. Some embodiments of the present invention provide tumor-infiltrating lymphocytes (TILs) genetically modified via TALEN gene editing by introducing into the TILs a nucleic acid, e.g., mRNA, encoding one or more TALE nucleases that selectively inactivate a gene encoding PD-1 by DNA cleavage, where the one or more TALE nucleases include a TALE nuclease directed against the nucleic acid sequence of SEQ ID NO: 18 as a PD-1 gene target sequence, and optionally introducing into the TILs a nucleic acid, e.g., mRNA, encoding one or more TALE nucleases that selectively inactivate a gene encoding LAG3 by DNA cleavage, where the one or more TALE nucleases include a TALE nuclease directed against the nucleic acid sequence of SEQ ID NO: 36 as a LAG3 gene target sequence, thereby enhancing their therapeutic efficacy. Embodiments of the present invention encompass methods for expanding such gene-edited TILs into a TIL population. Embodiments of the present invention also provide methods for expanding such gene-edited TILs into a therapeutic population.

[0171] In some embodiments, the present invention provides mRNAs encoding one or more TALE nucleases comprising a TALEN coding sequence, a 3' UTR sequence, and a poly-A tail. In some embodiments, the present invention provides mRNAs encoding one or more TALE nucleases comprising a 3' UTR from the mouse HBA gene. In some embodiments, the present invention provides mRNAs encoding one or more TALE nucleases comprising a 3' UTR having the sequence GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG (SEQ ID NO: 29). In some embodiments, the present invention provides mRNAs encoding one or more TALE nucleases comprising a poly-A tail, wherein the poly-A tail is 20 bp, 25 bp, 30 bp, 35 bp, 40 bp, 45 bp, 50 bp, 55 bp, 60 bp, 65 bp, 70 bp, 75 bp, 80 bp, 85 bp, 90 bp, 95 bp, or 100 bp in length. In some embodiments, the polyA tail is 80 bp in length.

[0172] a.Still step In some embodiments, two steps of sequential electroporation of TILs with nucleic acids, such as mRNAs, encoding two TALEN systems targeting PD-1 and TIGIT are separated by a incubation step. According to some embodiments, the incubation step comprises incubating the fourth TIL population at about 30-40°C and about 5% CO2. According to some embodiments, the incubation step is performed at about 30°C, about 30.5°C, about 31°C, about 31.5°C, about 32°C, about 32.5°C, about 33°C, about 33.5°C, about 34°C, about 34.5°C, about 35°C, about 35.5°C, about 36°C, about 36.5°C, about 37°C, about 37.5°C, about 38°C, about 38.5°C, about 39°C, about 39.5°C, or about 40°C. According to some embodiments, the resting step is carried out for about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 13 hours, about 14 hours, about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours, about 24 hours, about 2 days, about 3 days, about 4 days, or longer. According to some embodiments, the resting step comprises incubating the fourth population of TILs in cell culture medium comprising IL-2. According to some embodiments, the resting step comprises incubating the fourth population of TILs in cell culture medium comprising IL-2 at 300 IU / mL, 1,000 IU / mL, 2,000 IU / mL, 3,000 IU / mL, or 6,000 IU / mL. According to some embodiments, the incubation step comprises incubating the fourth population of TILs in CM1 with 1,000 IU / mL of IL-2. According to some embodiments, the incubation step comprises incubating the third or fourth TIL population in cell culture medium containing IL-2 at about 30°C and about 5% CO for about 15 to about 23 hours. According to some embodiments, the incubation step comprises incubating the fourth TIL population in cell culture medium containing IL-2 at 37°C and about 5% CO for about 1 to about 3 days.According to some embodiments, the resting step comprises incubating the fourth TIL population in cell culture medium containing IL-2 at 37° C. at about 5% CO 2 for about 2 days.

[0173] In some embodiments, each of the two steps of sequentially electroporating TILs with nucleic acids, such as mRNA, encoding two TALEN systems targeting PD-1 and TIGIT is followed by an overnight incubation step. According to some embodiments, the overnight incubation step comprises incubating the fourth or fifth TIL population in cell culture medium containing IL-2 at about 25-37°C, at about 5% CO2. According to some embodiments, the overnight incubation step is carried out at about 25° C., about 25.5° C., about 26° C., about 26.5° C., about 27° C., about 27.5° C., about 28° C., about 28.5° C., about 29° C., about 29.5° C., about 30° C., about 30.5° C., about 31° C., about 31.5° C., about 32° C., about 32.5° C., about 33° C., about 33.5° C., about 34° C., about 34.5° C., about 35° C., about 35.5° C., about 36° C., about 36.5° C., and about 37° C. According to some embodiments, the overnight incubation step comprises incubating the fourth or fifth TIL population in cell culture medium comprising IL-2 at about 30° C. at about 5% CO2.

[0174] In some embodiments, two steps of sequential electroporation of TILs with nucleic acids, such as mRNAs, encoding two TALEN systems targeting PD-1 and TIGIT are each followed by an overnight resting step, and the two electroporation steps are separated by a resting step of about 1-3 days. According to some embodiments, the overnight resting step comprises incubating the fourth or fifth TIL population in cell culture medium containing IL-2 at about 25-37°C in about 5% CO2, and the resting step between the two electroporation steps comprises incubating the fourth TIL population at about 30-40°C in about 5% CO2 for about 1-3 days. According to some embodiments, the overnight resting step comprises incubating the fourth or fifth TIL population in cell culture medium containing IL-2 at about 30° C. and about 5% CO, and the resting step between two electroporation steps comprises incubating the fourth TIL population for about 1-3 days at about 37° C. and about 5% CO. According to some embodiments, the overnight resting step comprises incubating the fourth or fifth TIL population in cell culture medium containing IL-2 at about 30° C. and about 5% CO, and the resting step between two electroporation steps comprises incubating the fourth TIL population for about 1 day at about 37° C. and about 5% CO. According to some embodiments, the overnight resting step comprises incubating the fourth or fifth TIL population in cell culture medium containing IL-2 at about 30° C. and at about 5% CO, and the resting step between two electroporation steps comprises incubating the fourth TIL population for about two days at about 37° C. and at about 5% CO. According to some embodiments, the overnight resting step comprises incubating the fourth or fifth TIL population in cell culture medium containing IL-2 at about 30° C. and at about 5% CO, and the resting step between two electroporation steps comprises incubating the fourth TIL population for about three days at about 37° C. and at about 5% CO.

[0175] F. Second Expansion In some embodiments, the TIL cell population is expanded in number after initial bulk processing, pre-REP expansion, and genetic modification, and the expanded TILs are genetically modified via TALEN gene editing by sequentially introducing into the TILs nucleic acids, e.g., mRNA, encoding two TALEN systems targeting PD-1 and TIGIT. This further expansion is referred to herein as second expansion, which may include an expansion process commonly referred to in the art as rapid expansion process (REP). Secondary expansion is generally accomplished in a gas-permeable container using culture medium containing several components, including feeder cells, a cytokine source, and an anti-CD3 agonist antibody.

[0176] In some embodiments, the second expansion of TILs or second TIL expansion (which may include expansion sometimes referred to as REP) can be performed using any TIL flask or vessel known to one of skill in the art, and the expanded TILs are genetically modified via TALEN gene editing by sequentially introducing into the TILs nucleic acids, e.g., mRNA, encoding two TALEN systems targeting PD-1 and TIGIT. In some embodiments, the second TIL expansion can proceed for 7, 8, 9, 10, 11, 12, 13, or 14 days. In some embodiments, the second TIL expansion can proceed for about 7 days to about 14 days. In some embodiments, the second TIL expansion can proceed for about 7 days to about 12 days. In some embodiments, the second TIL expansion can proceed for about 7 days to about 10 days. In some embodiments, the second TIL expansion can proceed for about 7 days to about 9 days. In some embodiments, the second TIL expansion can proceed for about 8 days to about 9 days. In some embodiments, the second TIL expansion can continue for about 9 days. In some embodiments, the second TIL expansion can continue for about 10 days. In some embodiments, the second TIL expansion can continue for about 11 days.

[0177] In some embodiments, the second expansion can be performed in a gas-permeable container using the methods of the present disclosure (including, for example, expansion referred to as REP). For example, TILs can be rapidly expanded using nonspecific T cell receptor stimulation in the presence of interleukin-2 (IL-2) or interleukin-15 (IL-15). Nonspecific T cell receptor stimulation can include, for example, an anti-CD3 agonist antibody, such as about 30 ng / ml OKT3, a mouse monoclonal anti-CD3 antibody (commercially available from Ortho-McNeil, Raritan, NJ or Miltenyi Biotech, Auburn, CA), or UHCT-1 (commercially available from BioLegend, San Diego, CA, USA). TILs can be expanded in vitro to induce further stimulation of TILs by including one or more antigens during the second expansion, including an antigenic moiety, such as a cancer epitope(s), which can be expressed from a vector, e.g., a human leukocyte antigen A2 (HLA-A2)-binding peptide, e.g., 0.3 μM MART-1:26-35(27L) or gpl00:209-217(210M), optionally in the presence of a T cell growth factor, such as 300 IU / mL IL-2 or IL-15. Other suitable antigens can include, e.g., NY-ESO-1, TRP-1, TRP-2, tyrosinase cancer antigen, MAGE-A3, SSX-2, and VEGFR2, or antigenic moieties thereof. TILs can also be rapidly expanded by restimulating with the same cancer antigen(s) pulsed onto antigen-presenting cells expressing HLA-A2. Alternatively, TILs can be further restimulated, for example, with irradiated autologous lymphocytes or irradiated HLA-A2+ allogeneic lymphocytes and IL-2. In some embodiments, the restimulation occurs as part of a second expansion. In some embodiments, the second expansion occurs in the presence of irradiated autologous lymphocytes or with irradiated HLA-A2+ allogeneic lymphocytes and IL-2.

[0178] In some embodiments, the cell culture medium further comprises IL-2. In some embodiments, the cell culture medium comprises about 3000 IU / mL of IL-2. In some embodiments, the cell culture medium comprises about 1000 IU / mL, about 1500 IU / mL, about 2000 IU / mL, about 2500 IU / mL, about 3000 IU / mL, about 3500 IU / mL, about 4000 IU / mL, about 4500 IU / mL, about 5000 IU / mL, about 5500 IU / mL, about 6000 IU / mL, about 6500 IU / mL, about 7000 IU / mL, about 7500 IU / mL, or about 8000 IU / mL of IL-2. In some embodiments, the cell culture medium contains between 1000-2000 IU / mL, 2000-3000 IU / mL, 3000-4000 IU / mL, 4000-5000 IU / mL, 5000-6000 IU / mL, 6000-7000 IU / mL, 7000-8000 IU / mL, or 8000 IU / mL of IL-2.

[0179] In some embodiments, the cell culture medium comprises an OKT-3 antibody. In some embodiments, the cell culture medium comprises about 30 ng / mL of the OKT-3 antibody. In some embodiments, the cell culture medium comprises about 0.1 ng / mL, about 0.5 ng / mL, about 1 ng / mL, about 2.5 ng / mL, about 5 ng / mL, about 7.5 ng / mL, about 10 ng / mL, about 15 ng / mL, about 20 ng / mL, about 25 ng / mL, about 30 ng / mL, about 35 ng / mL, about 40 ng / mL, about 50 ng / mL, about 60 ng / mL, about 70 ng / mL, about 80 ng / mL, about 90 ng / mL, about 100 ng / mL, about 200 ng / mL, about 500 ng / mL, or about 1 μg / mL of the OKT-3 antibody. In some embodiments, the cell culture medium contains 0.1 ng / mL to 1 ng / mL, 1 ng / mL to 5 ng / mL, 5 ng / mL to 10 ng / mL, 10 ng / mL to 20 ng / mL, 20 ng / mL to 30 ng / mL, 30 ng / mL to 40 ng / mL, 40 ng / mL to 50 ng / mL, or 50 ng / mL to 100 ng / mL of OKT-3 antibody. In some embodiments, the cell culture medium does not contain OKT-3 antibody. In some embodiments, the OKT-3 antibody is muromonab.

[0180] In some embodiments, the cell culture medium comprises one or more TNFRSF agonists in the cell culture medium. In some embodiments, the TNFRSF agonist comprises a 4-1BB agonist. In some embodiments, the TNFRSF agonist is a 4-1BB agonist, and the 4-1BB agonist is selected from the group consisting of urelumab, utomilumab, EU-101, fusion proteins, and fragments, derivatives, variants, biosimilars, and combinations thereof. In some embodiments, the TNFRSF agonist is added at a concentration sufficient to achieve a cell culture medium concentration of 0.1 μg / mL to 100 μg / mL. In some embodiments, the TNFRSF agonist is added at a concentration sufficient to achieve a cell culture medium concentration of 20 μg / mL to 40 μg / mL.

[0181] In some embodiments, in addition to the one or more TNFRSF agonists, the cell culture medium comprises IL-2 at an initial concentration of about 3000 IU / mL and OKT-3 antibody at an initial concentration of about 30 ng / mL, and the one or more TNFRSF agonists comprise a 4-1BB agonist.

[0182] In some embodiments, the antigen-presenting feeder cells (APCs) are PBMCs. In some embodiments, the ratio of TILs to PBMCs and / or antigen-presenting cells during rapid expansion and / or secondary expansion is about 1:25, about 1:50, about 1:100, about 1:125, about 1:150, about 1:175, about 1:200, about 1:225, about 1:250, about 1:275, about 1:300, about 1:325, about 1:350, about 1:375, about 1:400, or about 1:500. In some embodiments, the ratio of TILs to PBMCs during rapid expansion and / or secondary expansion is 1:50 to 1:300. In some embodiments, the ratio of TILs to PBMCs during rapid expansion and / or secondary expansion is 1:100 to 1:200.

[0183] In some embodiments, REP and / or secondary expansion is performed in flasks in which bulk TILs are mixed with a 100-fold or 200-fold excess of inactivated feeder cells, 30 mg / mL OKT3 anti-CD3 antibody, and 3000 IU / mL IL-2 in 150 ml of medium. Medium changes are performed (typically a two-thirds medium change by breathing in fresh medium) until the cells are transferred to an alternative growth chamber. Alternative growth chambers include G-REX flasks and gas-permeable vessels, as discussed more fully below.

[0184] In some embodiments, as discussed in the Examples and Figures, the second expansion (which may include a process referred to as the REP process) is shortened to 7-14 days, and the TILs expanded by such second expansion are genetically modified via TALEN gene editing by sequentially introducing into the TILs nucleic acids, such as mRNAs, encoding two TALEN systems targeting PD-1 and TIGIT. In some embodiments, the second expansion is shortened to 9 days.

[0185] In some embodiments, REP and / or second expansion may be performed using T-175 flasks and previously described gas-permeable bags (Tran, et al., J. Immunother. 2008, 31, 742-51; Dudley, et al., J. Immunother. 2003, 26, 332-42) or gas-permeable culture ware (G-Rex flasks), and TILs expanded by such second expansion are genetically modified via TALEN gene editing by sequentially introducing into the TILs nucleic acids, such as mRNAs, encoding two TALEN systems targeting PD-1 and TIGIT. In some embodiments, second expansion (including expansion referred to as rapid expansion) is performed in T-175 flasks, containing approximately 1 x 10 cells suspended in 150 mL of medium. 6TILs may be added to each T-175 flask. The TILs may be cultured in a 1:1 mixture of CM and AIM-V medium supplemented with 3000 IU / mL IL-2 and 30 ng / mL anti-CD3. The T-175 flasks may be incubated at 37°C in 5% CO2. The expanded TILs from this second expansion are genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA, encoding two TALEN systems targeting PD-1 and TIGIT into the TILs. Half of the medium may be replaced on day 5 with 50 / 50 medium containing 3000 IU / mL IL-2. In some embodiments, on day 7, cells from two T-175 flasks may be combined in a 3L bag, and 300 mL of AIM-V containing 5% human AB serum and 3000 IU / mL IL-2 is added to the 300 mL TIL suspension. Count the number of cells in each bag daily or every other day and add fresh medium to culture at a concentration of 0.5–2.0 × 10 cells. 6 Cell counts were maintained between cells / mL.

[0186] In some embodiments, the second expansion (which can include an expansion referred to as REP) may be performed in a 500 mL capacity gas permeable flask (G-Rex100, commercially available from Wilson Wolf Manufacturing Corporation, New Brighton, MN, USA) with a 100 cm gas permeable silicone bottom, containing 5 × 10 6 or 10 x 10 6The TILs may be cultured with PBMCs in 400 mL of 50 / 50 medium supplemented with 5% human AB serum, 3000 IU / mL IL-2, and 30 ng / mL anti-CD3 (OKT3). The expanded TILs are then genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA, encoding two TALEN systems targeting PD-1 and TIGIT into the TILs. The G-Rex 100 flask may be incubated at 37°C in 5% CO2. On day 5, 250 mL of supernatant is removed and placed in a centrifuge bottle. The flask is then centrifuged at 1500 rpm (491 x g) for 10 minutes. The TIL pellet may be resuspended in 150 mL of fresh medium containing 5% human AB serum, 3000 IU / mL IL-2, and added back to the original G-Rex 100 flask. If TILs are continuously expanded in G-Rex100 flasks, on day 7, the TILs in each G-Rex100 flask can be suspended in 300 mL of medium present in each flask, and the cell suspension can be divided into three 100 mL aliquots, which can be used to seed three G-Rex100 flasks. Then, 150 mL of AIM-V containing 5% human AB serum and 3000 IU / mL IL-2 can be added to each flask. The G-Rex100 flasks can be incubated at 37°C in 5% CO2, and after 4 days, 150 mL of AIM-V containing 3000 IU / mL IL-2 can be added to each G-Rex100 flask. On day 14 of culture, the cells can be harvested.

[0187] In some embodiments, the second expansion (which can include an expansion referred to as REP) may be performed in a 500 mL capacity gas permeable flask (G-REX100, commercially available from Wilson Wolf Manufacturing Corporation, New Brighton, MN, USA) with a 100 cm gas permeable silicone bottom, containing 5 × 10 6 or 10 x 10 6TILs can be cultured with PBMCs in 400 mL of 50 / 50 medium supplemented with 5% human AB serum, 3000 IU / mL IL-2, and 30 ng / mL anti-CD3 (OKT3). The G-REX-100 (or G-REX100M) flask can be incubated at 37°C in 5% CO2. On day 5, 250 mL of supernatant is removed and placed in a centrifuge bottle. The flask is centrifuged at 1500 rpm (491 x g) for 10 minutes. The TIL pellet is resuspended in 150 mL of fresh medium containing 5% human AB serum and 6000 IU / mL IL-2 and transferred back to the original GREX-100 flask. If TILs are continuously expanded in the GREX-100 flask, they can be transferred to a larger flask, such as a GREX-500 (or G-REX500M) flask, on day 10 or 11. On day 14 of culture, the cells can be harvested. On day 15 of culture, cells may be harvested. On day 16 of culture, cells may be harvested. In some embodiments, medium changes are performed until the cells are transferred to an alternate growth chamber. In some embodiments, two-thirds of the medium is exchanged by aspirating the spent medium and replacing it with an equal volume of fresh medium. In some embodiments, alternate growth chambers include GREX flasks and gas-permeable vessels, as discussed more fully below. In some embodiments, the process used various centrifugation speeds (400 g, 300 g, 200 g for 5 minutes) and various numbers of iterations.

[0188] In some embodiments, the second expansion (including expansion referred to as REP) is performed in a flask where bulk TILs are mixed with 100-fold or 200-fold excess inactivated feeder cells, 30 mg / mL OKT3 anti-CD3 antibody, and 3000 IU / mL IL-2 in 150 ml of medium. In some embodiments, medium changes are performed until the cells are transferred to an alternative growth chamber, and the TILs expanded by such second expansion are genetically modified via TALEN gene editing by sequentially introducing nucleic acids, such as mRNA, encoding two TALEN systems targeting PD-1 and TIGIT into the TILs. In some embodiments, two-thirds of the medium is replaced by aspirating spent medium followed by injecting fresh medium. In some embodiments, the alternative growth chamber includes a G-REX flask and a gas-permeable vessel, as discussed more fully below.

[0189] In some embodiments, the second expansion culture medium (e.g., sometimes referred to as CM2 or second cell culture medium) comprises IL-2, OKT-3, and antigen-presenting feeder cells (APCs), as discussed in more detail below.

[0190] In some embodiments, the second expansion is performed in a closed system bioreactor. In some embodiments, a closed system is used for TIL expansion as described herein. In some embodiments, a single bioreactor is used. In some embodiments, the single bioreactor used is, for example, a G-REX-10 or G-REX-100. In some embodiments, the closed system bioreactor is a single bioreactor.

[0191] In some embodiments, the method steps are completed within a period of about 22 days. In some embodiments, the method steps are completed within a period of about 8 days. In some embodiments, the method steps are completed within a period of about 9 days. In some embodiments, the method steps are completed within a period of about 10 days. In some embodiments, the method steps are completed within a period of about 11 days. In some embodiments, the method steps are completed within a period of about 12 days. In some embodiments, the method steps are completed within a period of about 13 days. In some embodiments, the method steps are completed within a period of about 14 days. In some embodiments, the method steps are completed within a period of about 15 days. In some embodiments, the method steps are completed within a period of about 16 days. In some embodiments, the method steps are completed within a period of about 17 days. In some embodiments, the method steps are completed within a period of about 18 days. In some embodiments, the method steps are completed within a period of about 19 days. In some embodiments, the method steps are completed within a period of about 20 days. In some embodiments, the method steps are completed within a period of about 21 days. In some embodiments, the method steps are completed within a period of about 22 days. In some embodiments, the method steps are completed within a period of about 23 days. In some embodiments, the method steps are completed within a period of about 24 days. In some embodiments, the method steps are completed within a period of about 25 days. In some embodiments, the method steps are completed within a period of about 26 days. In some embodiments, the method steps are completed within a period of about 27 days. In some embodiments, the method steps are completed within a period of about 28 days. In some embodiments, the method steps are completed within a period of about 29 days. In some embodiments, the method steps are completed within a period of about 30 days. In some embodiments, the method steps are completed within a period of about 31 days.

[0192] In some embodiments, the antigen presenting cells (APCs) are PBMCs. According to some embodiments, the PBMCs are irradiated. According to some embodiments, the PBMCs are allogeneic. According to some embodiments, the PBMCs are irradiated and allogeneic. According to some embodiments, the antigen presenting cells are artificial antigen presenting cells.

[0193] In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 1000 IU / mL to 6000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 1500 IU / mL to 6000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 2000 IU / mL to 6000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 2500 IU / mL to 6000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 3000 IU / mL to 6000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 3500 IU / mL to 6000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 4000 IU / mL to 6000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 4500 IU / mL to 6000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 5000 IU / mL to 6000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 5500 IU / mL to 6000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 1000 IU / mL to 5000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 1500 IU / mL to 5000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 2000 IU / mL to 5000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 2500 IU / mL to 5000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 3000 IU / mL to 5000 IU / mL during the first expansion.In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 3500 IU / mL to 5000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 4000 IU / mL to 5000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 4500 IU / mL to 5000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 1000 IU / mL to 4000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 1500 IU / mL to 4000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 2000 IU / mL to 4000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 2500 IU / mL to 4000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 3000 IU / mL to 4000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 3500 IU / mL to 4000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 1000 IU / mL to 3000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 1500 IU / mL to 3000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 2000 IU / mL to 3000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 2500 IU / mL to 3000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 1000 IU / mL to 2000 IU / mL during the first expansion. In some embodiments, IL-2 is present in the cell culture medium at an initial concentration of 1500 IU / mL to 2000 IU / mL during the first expansion.

[0194] In some embodiments, in the second expansion step, IL-2 is present at an initial concentration of 1000 IU / mL to 6000 IU / mL and the OKT-3 antibody is present at an initial concentration of about 30 ng / mL.

[0195] In some embodiments, the first cell culture medium and / or the second cell culture medium further comprise a 4-1BB agonist and / or an OX40 agonist.

[0196] In some embodiments, the first expansion is performed using a gas-permeable container. In some embodiments, the second expansion is performed using a gas-permeable container.

[0197] In some embodiments, the first cell culture medium further comprises a cytokine selected from the group consisting of IL-4, IL-7, IL-15, IL-21, and combinations thereof. In some embodiments, the second cell culture medium and / or the third culture medium further comprise a cytokine selected from the group consisting of IL-4, IL-7, IL-15, IL-21, and combinations thereof.

[0198] 1. Feeder cells and antigen-presenting cells In some embodiments, the second expansion procedure described herein requires excess feeder cells during REP TIL expansion and / or during the second expansion. In many embodiments, the feeder cells are peripheral blood mononuclear cells (PBMCs) obtained from a standard whole blood unit from a healthy blood donor. PBMCs are obtained using standard methods, such as Ficoll-Paque gradient separation.

[0199] Generally, allogeneic PBMCs are inactivated by either irradiation or heat treatment and used in the REP procedure, as described in the Examples, which provide an exemplary protocol for assessing the replicative incompetence of irradiated allogeneic PBMCs.

[0200] In some embodiments, if the total number of viable cells on day 14 is less than the initial number of viable cells cultured on day 0 of REP and / or day 0 of second expansion (i.e., the start day of second expansion), the PBMCs are considered replication-incompetent and are approved for use in the TIL expansion procedures described herein.

[0201] In some embodiments, if the total number of viable cells cultured in the presence of OKT3 and IL-2 on days 7 and 14 does not increase from the initial number of viable cells cultured on REP day 0 and / or second expansion day 0 (i.e., the start day of second expansion), the PBMCs are considered replication-incompetent and are approved for use in the TIL expansion procedures described herein. In some embodiments, PBMCs are cultured in the presence of 30 ng / mL OKT3 antibody and 3000 IU / mL IL-2.

[0202] In some embodiments, if the total number of viable cells cultured in the presence of OKT3 and IL-2 on days 7 and 14 does not increase from the initial number of viable cells cultured on day 0 of REP and / or day 0 of second expansion (i.e., the start day of second expansion), the PBMCs are considered replication-incompetent and are approved for use in the TIL expansion procedures described herein. In some embodiments, PBMCs are cultured in the presence of 5-60 ng / mL OKT3 antibody and 1000-6000 IU / mL IL-2. In some embodiments, PBMCs are cultured in the presence of 10-50 ng / mL OKT3 antibody and 2000-5000 IU / mL IL-2. In some embodiments, PBMCs are cultured in the presence of 20-40 ng / mL OKT3 antibody and 2000-4000 IU / mL IL-2. In some embodiments, PBMCs are cultured in the presence of 25 to 35 ng / mL of OKT3 antibody and 2500 to 3500 IU / mL of IL-2.

[0203] In some embodiments, the antigen-presenting feeder cells are PBMCs. In some embodiments, the antigen-presenting feeder cells are artificial antigen-presenting feeder cells. In some embodiments, the ratio of TILs to antigen-presenting feeder cells in the second expansion is about 1:25, about 1:50, about 1:100, about 1:125, about 1:150, about 1:175, about 1:200, about 1:225, about 1:250, about 1:275, about 1:300, about 1:325, about 1:350, about 1:375, about 1:400, or about 1:500. In some embodiments, the ratio of TILs to antigen-presenting feeder cells in the second expansion is 1:50 to 1:300. In some embodiments, the ratio of TILs to antigen-presenting feeder cells in the second expansion is 1:100 to 1:200.

[0204] In some embodiments, the second expansion procedure described herein is performed at a concentration of about 2.5×10 9 Feeder cells: approximately 100 x 10 6 In other embodiments, the second expansion procedure described herein requires a ratio of about 2.5 x 10 TILs. 9 Feeder cells: approximately 50 x 10 6 In yet another embodiment, the second expansion procedure described herein requires a ratio of about 2.5 x 10 TILs. 9 Feeder cells: approximately 25 x 10 6 Requires TIL.

[0205] In some embodiments, the second expansion procedure described herein requires excess feeder cells during the second expansion. In many embodiments, the feeder cells are peripheral blood mononuclear cells (PBMCs) obtained from a standard whole blood unit from a healthy blood donor. PBMCs are obtained using standard methods, such as Ficoll-Paque gradient separation. In some embodiments, artificial antigen-presenting (aAPC) cells are used in place of PBMCs.

[0206] In some embodiments, artificial antigen-presenting cells are used in the second expansion as a replacement for or in combination with PBMCs.

[0207] 2. Cytokines and other additives The expansion methods described herein generally use culture media containing high doses of cytokines, particularly IL-2, as is known in the art.

[0208] Alternatively, the use of cytokine combinations for rapid and / or secondary expansion of TILs is possible using combinations of two or more of IL-2, IL-15, and IL-21, as described in U.S. Patent Application Publication No. 2017 / 0107490A1 (the disclosure of which is incorporated herein by reference). Thus, possible combinations include IL-2 and IL-15, IL-2 and IL-21, IL-15 and IL-21, and IL-2, IL-15, and IL-21, the latter of which finds particular use in many embodiments. The use of cytokine combinations is particularly advantageous for the generation of lymphocytes, particularly T cells as described therein.

[0209] G. Collect TILs After the second expansion step, cells can be harvested.TIL can be harvested by any suitable sterilization method, including, for example, centrifugation.The method for harvesting TIL is well known in the art, and any such known method can be used in this process.In some embodiments, TIL is harvested using an automated system.

[0210] Cell harvesters and / or cell processing systems are commercially available from a variety of sources, including, for example, Fresenius Kabi, Tomtec Life Science, Perkin Elmer, and Inotech Biosystems International, Inc. Any cell-based harvester can be used for the present methods. In some embodiments, the cell harvester and / or cell processing system is a membrane-based cell harvester. In some embodiments, cell harvesting is by a cell processing system, such as the LOVO system (manufactured by Fresenius Kabi). The term "LOVO cell processing system" also refers to any device or apparatus manufactured by any vendor that can pump a cell-containing solution through a membrane or filter, such as a spinning membrane or spinning filter, in a sterile and / or closed environment, allowing for continuous flow, processing the cells, and removing the supernatant or cell culture medium without pelleting. In some embodiments, the cell harvester and / or cell processing system can perform cell separation, washing, fluid exchange, concentration, and / or other cell processing steps within a sterile, closed system.

[0211] In some embodiments, harvesting is from a closed system bioreactor. In some embodiments, a closed system is used for TIL expansion as described herein. In some embodiments, a single bioreactor is used. In some embodiments, the single bioreactor used is, for example, a G-REX-10 or G-REX-100. In some embodiments, the closed system bioreactor is a single bioreactor.

[0212] In some embodiments, the closed system is accessed via a syringe under sterile conditions to maintain the sterility and closure of the system. In some embodiments, the closed system described in the Examples is used.

[0213] H. Final formulation and transfer to infusion container After completing the steps outlined above and in detail herein, the TILs are transferred to a container for administration to a patient, such as an infusion bag or sterile vial. In some embodiments, once a therapeutically sufficient number of TILs are obtained using the expansion methods described above, they are transferred to a container, such as an infusion bag, for administration to a patient. In some embodiments, the TILs are cryopreserved within the infusion bag. In some embodiments, the TILs are cryopreserved prior to being placed in the infusion bag. In some embodiments, the TILs are cryopreserved and are not placed in an infusion bag. In some embodiments, cryopreservation is performed using a cryopreservation medium. In some embodiments, the cryopreservation medium contains dimethyl sulfoxide (DMSO). This is generally achieved by placing the TIL population in a freezing solution, for example, 85% complement-inactivated AB serum and 15% dimethyl sulfoxide (DMSO). The cells in solution are placed in a cryogenic vial, stored at -80°C for 24 hours, and optionally transferred to a gaseous nitrogen freezer for cryopreservation. See Sadeghi, et al., Acta Oncologica 2013, 52, 978-986.

[0214] If appropriate, the cells are removed from the freezer and thawed in a 37°C water bath until approximately four-fifths of the solution has thawed. The cells are generally resuspended in complete medium and optionally washed one or more times. In some embodiments, the thawed TILs can be counted and assessed for viability as known in the art.

[0215] In some embodiments, the population of TILs is cryopreserved using CS10 cryopreservation medium (CryoStor 10, BioLife Solutions). In some embodiments, the TIL population is cryopreserved using cryopreservation medium containing dimethyl sulfoxide (DMSO). In some embodiments, the TIL population is cryopreserved using a 1:1 (volume:volume) ratio of CS10 and cell culture medium. In some embodiments, the TIL population is cryopreserved using an approximately 1:1 (volume:volume) ratio of CS10 and cell culture medium, further comprising additional IL-2.

[0216] In some embodiments, the TILs are administered to a patient as a pharmaceutical composition. In some embodiments, the pharmaceutical composition is a suspension of TILs in a sterile buffer. TILs expanded by the methods described in this disclosure may be administered by any suitable route known in the art. In some embodiments, the T cells are administered as a single intra-arterial or intravenous infusion, preferably lasting approximately 30-60 minutes. Other suitable routes of administration include intraperitoneal, intrathecal, and intralymphatic administration.

[0217] I. Closed system for TIL production The present invention provides for the use of a closed system during the TIL culture process. Such a closed system allows for the prevention and / or reduction of microbial contamination, allows for the use of fewer flasks, and allows for cost savings. In some embodiments, the closed system uses two vessels.

[0218] Such closed systems are well known in the art and can be found, for example, at http: / / www.fda.gov / cber / guidelines.htm and https: / / www.fda.gov / BiologicsBloodVaccines / GuidanceComplianceRegulatoryInformation / Guidances / Blood / ucm076779.htm.

[0219] A Sterile Connection Device (STCD) creates a sterile joint between two compatible tubes. This procedure allows for sterile connections between a variety of containers and tubing diameters. In some embodiments, the closed system includes a luer lock system and a heat seal system as described in the Examples. In some embodiments, the closed system is accessed via a syringe under sterile conditions to maintain the sterility and closure of the system. In some embodiments, the closed system described in the Examples is used. In some embodiments, the TILs are formulated into a final product formulation container according to the methods described herein in the Examples.

[0220] In some embodiments, a closed system uses one container from the time the tumor fragments are obtained until the TILs are ready for administration to a patient or cryopreservation. In some embodiments, when two containers are used, the first container is a sealed G container (G-rex100M or G-rex500M flask), and the TIL population is centrifuged and transferred to an infusion bag without opening the first sealed G container. In some embodiments, when two containers are used, the infusion bag is a hypothermosol-containing infusion bag. A closed system or closed TIL cell culture system is characterized in that, once the tumor sample and / or tumor fragments are added, the system is tightly sealed from the outside, forming a closed environment that is impervious to bacterial, fungal, and / or any other microbial contamination.

[0221] In some embodiments, the reduction in microbial contamination is about 5% to about 100%. In some embodiments, the reduction in microbial contamination is about 5% to about 95%. In some embodiments, the reduction in microbial contamination is about 5% to about 90%. In some embodiments, the reduction in microbial contamination is about 10% to about 90%. In some embodiments, the reduction in microbial contamination is about 15% to about 85%. In some embodiments, the reduction in microbial contamination is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or about 100%.

[0222] The closed system allows for TIL growth without and / or with greatly reduced microbial contamination.

[0223] Furthermore, the pH, carbon dioxide partial pressure, and oxygen partial pressure of the TIL cell culture environment each change as the cells are cultured. Therefore, even if a suitable medium is circulated for cell culture, it is necessary to maintain the closed environment at a constant level as an optimal environment for TIL proliferation. For this purpose, it is desirable that the physical factors of pH, carbon dioxide partial pressure, and oxygen partial pressure in the culture medium of the closed environment are monitored by sensors, the signals are used to control a gas exchanger installed at the inlet of the culture environment, and the gas partial pressure of the closed environment is adjusted in real time in response to changes in the culture medium to optimize the cell culture environment. In some embodiments, the present invention provides a closed cell culture system that optimizes the cell culture environment by incorporating a gas exchanger equipped with a monitoring device at the inlet of the closed environment that measures the pH, carbon dioxide partial pressure, and oxygen partial pressure of the closed environment, and automatically adjusting the gas concentrations based on signals from the monitoring device.

[0224] In some embodiments, the pressure within the enclosed environment is controlled continuously or intermittently. That is, the pressure within the enclosed environment can be varied, for example, by a pressure maintenance device, thereby ensuring that the space is suitable for TIL growth under positive pressure conditions or promoting fluid exudation and thus cell proliferation under negative pressure conditions. Furthermore, by applying negative pressure intermittently, temporary contractions of the volume within the enclosed environment can uniformly and efficiently replace the circulating liquid within the enclosed environment.

[0225] In some embodiments, additional equipment, such as an electroporator (e.g., a Neon electroporator), is a component of the entire closed system. In some embodiments, culture components optimal for TIL growth can be substituted or added, and factors such as IL-2 and / or OKT3, as well as combinations, can be added.

[0226] In other embodiments, the invention provides a method as set forth in any of the applicable paragraphs above, modified so that each vessel described in the method is a GREX-10. In other embodiments, the invention provides a method as set forth in any of the applicable paragraphs above, modified so that each vessel described in the method is a GREX-100M. In other embodiments, the invention provides a method as set forth in any of the applicable paragraphs above, modified so that each vessel described in the method is a GREX-500M.

[0227] III. Therapeutic TIL Populations and Pharmaceutical Compositions Embodiments of the present invention are also directed to gene-edited tumor-infiltrating lymphocyte (TIL) populations, including expanded TIL populations with reduced expression of PD-1 and TIGIT, produced by the methods disclosed herein.

[0228] In some embodiments, the gene-edited TIL population comprises an expanded TIL population, at least a portion of which comprise a knockout of both PD-1 and TIGIT. In some embodiments, the gene-edited TIL population comprises an expanded TIL population, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of which comprise a knockout of both PD-1 and TIGIT. In some embodiments, the gene-edited TIL population comprises an expanded TIL population, about 60% of which comprise a knockout of both PD-1 and TIGIT. In some embodiments, the gene-edited TIL population comprises an expanded TIL population, about 64% of which comprise a knockout of both PD-1 and TIGIT.

[0229] In some embodiments, the gene-edited TIL population comprises an expanded TIL population that has about 5%, about 10%, about 10%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% reduction in PD-1 and / or TIGIT expression. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with at least about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95% reduction in PD-1 and / or TIGIT expression. In some embodiments, the gene-edited TIL population comprises an expanded TIL population in which PD-1 and / or TIGIT expression is reduced by at least about 75%, about 80%, about 85%, about 90%, or about 95%. In some embodiments, the gene-edited TIL population comprises an expanded TIL population in which PD-1 and / or TIGIT expression is reduced by at least about 80%, about 85%, about 90%, or about 95%. In some embodiments, the gene-edited TIL population comprises an expanded TIL population in which PD-1 and / or TIGIT expression is reduced by at least about 85%, about 90%, or about 95%. In some embodiments, the gene-edited TIL population comprises an expanded TIL population in which PD-1 and / or TIGIT expression is reduced by at least about 80%. In some embodiments, the gene-edited TIL population comprises an expanded TIL population in which PD-1 and / or TIGIT expression is reduced by at least about 85%. In some embodiments, the gene-edited TIL population comprises an expanded TIL population in which PD-1 and / or TIGIT expression is reduced by at least about 90%. In some embodiments, the gene-edited TIL population comprises an expanded TIL population in which PD-1 and / or TIGIT expression is reduced by at least about 95%. In some embodiments, the gene-edited TIL population comprises an expanded TIL population in which PD-1 and / or TIGIT expression is reduced by at least about 99%.

[0230] In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT expression, along with an increase in stem cell memory T cells (TSCM). TSCM are early progenitors of antigen-experienced central memory T cells. TSCM generally exhibit the long-term survival, self-renewal, and multipotency that define stem cells, and are generally desirable for generating effective TIL products. TSCM have shown enhanced anti-tumor activity compared to other T cell subsets in mouse models of adoptive cell transfer. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT expression, resulting in a TIL population with a composition that includes a high percentage of TSCM. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT expression accompanied by an increase in TSCM percentage of at least 5%, at least 10%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT expression accompanied by an increase in TSCM in the TIL population of at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, or 10-fold. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT with TSCM of at least 5%, at least 10%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.In some embodiments, the gene-edited TIL population comprises a therapeutic TIL population with reduced PD-1 and TIGIT with TSCM of at least 5%, at least 10%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0231] In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT, accompanied by rejuvenation of antigen-experienced T cells, in some embodiments, rejuvenation includes, for example, increased proliferation, increased T cell activation, and / or increased antigen recognition.

[0232] In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT that has enhanced anti-tumor activity. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT that has enhanced anti-tumor activity in a mouse model of adoptive cell transfer. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT that has enhanced anti-tumor activity compared to another expanded TIL population in a mouse model of adoptive cell transfer. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT that has enhanced anti-tumor activity compared to another expanded TIL population that has reduced PD-1 only in a mouse model of adoptive cell transfer. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT that has at least 5%, at least 10%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% greater anti-tumor activity compared to another expanded TIL population in a mouse model of adoptive cell transfer. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT that has at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, or at least 100-fold greater anti-tumor activity compared to another expanded TIL population in a mouse model of adoptive cell transfer.In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT that has at least 5%, at least 10%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% greater anti-tumor activity compared to another expanded TIL population with reduced TIGIT alone in a mouse model of adoptive cell transfer. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT that has at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, or at least 100-fold greater anti-tumor activity compared to another expanded TIL population with reduced TIGIT alone in a mouse model of adoptive cell transfer. In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT that has at least 5%, at least 10%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% greater anti-tumor activity compared to another expanded TIL population with reduced PD-1 alone in a mouse model of adoptive cell transfer.In some embodiments, the gene-edited TIL population comprises an expanded TIL population with reduced PD-1 and TIGIT that has at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, or at least 100-fold greater anti-tumor activity compared to another expanded TIL population with reduced PD-1 only in a mouse model of adoptive cell transfer.

[0233] In some embodiments, the gene-edited TIL population comprises a therapeutically effective dose of TILs that have reduced expression of PD-1 and TIGIT. In some embodiments, the number of TILs in a therapeutically effective dose of TILs is 1 x 10 6 , 2 × 10 6 , 3×10 6 , 4×10 6 , 5×10 6 , 6×10 6 , 7×10 6 , 8×10 6 , 9×10 6 , 1×10 7 , 2 × 10 7 , 3×10 7 , 4×10 7 , 5×10 7 , 6×10 7 , 7×10 7 , 8×10 7 , 9×10 7 , 1×10 8 , 2 × 10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , 9×10 8 , 1×10 9 , 2 × 10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×109 , 9×10 9 , 1×10 10 , 2 × 10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , 9×10 10 , 1×10 11 , 2 × 10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , 9×10 11 , 1×10 12 , 2 × 10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , 9×10 12 , 1×10 13 , 2 × 10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , 9×10 13 In some embodiments, the number of TILs in a therapeutically effective dose of TILs is about 1 x 10, is about 1 x 10, is less than 1 x 10, is greater than 1 x 10, or is in a range between any two of the above values. 6 ~Approx. 5×10 6 , about 5×10 6 ~Approx. 1×10 7 , about 1×10 7 ~Approx. 5×10 7 , about 5×10 7 ~Approx. 1×10 8 , about 1×10 8 ~Approx. 5×10 8 , about 5×10 8 ~Approx. 1×10 9, about 1×10 9 ~Approx. 5×10 9 , about 5×10 9 ~Approx. 1×10 10 , about 1×10 10 ~Approx. 5×10 10 , about 5×10 10 ~Approx. 1×10 11 , about 5×10 11 ~Approx. 1×10 12 , about 1×10 12 ~Approx. 5×10 12 , and approximately 5 × 10 12 ~Approx. 1×10 13 In some embodiments, the number of TILs for a therapeutically effective dose of TILs ranges from about 1 x 10 9 ~Approx. 1×10 13 In some embodiments, the number of TILs for a therapeutically effective dose of TILs ranges from about 1 x 10 9 ~Approx. 1×10 11 The range is.

[0234] In some embodiments, the gene-edited TIL population, including an expanded TIL population with reduced expression of PD-1 and TIGIT produced by the methods disclosed herein, is administered to a patient as a pharmaceutical composition. In some embodiments, the pharmaceutical composition is a suspension of TILs in a sterile buffer. TILs with reduced expression of PD-1 and TIGIT produced by the methods disclosed herein may be administered by any suitable route known in the art. In some embodiments, TILs with reduced expression of PD-1 and TIGIT produced by the methods disclosed herein are administered as a single intra-arterial or intravenous infusion, preferably lasting approximately 30-60 minutes. Other suitable routes of administration include intraperitoneal, intrathecal, and intralymphatic administration.

[0235] Any suitable dose of TILs with reduced PD-1 and TIGIT expression produced by the methods disclosed herein can be administered. In some embodiments, about 2.3 x 10 10 ~Approx. 13.7×10 10 TILs were administered, with an average of approximately 7.8 × 1010 In some embodiments, the TILs are about 2.3 x 10 10 ~Approx. 13.7×10 10 TILs were administered, with an average of approximately 7.8 × 10 10 In some embodiments, the TILs are about 1.2 x 10 10 ~Approx. 4.3×10 10 In some embodiments, about 3 x 10 TILs are administered. 10 ~Approx. 12×10 10 In some embodiments, about 4 x 10 TILs are administered. 10 ~About 10×10 10 In some embodiments, about 5 x 10 TILs are administered. 10 ~Approx. 8×10 10 In some embodiments, about 6 x 10 TILs are administered. 10 ~Approx. 8×10 10 In some embodiments, about 7 x 10 TILs are administered. 10 ~Approx. 8×10 10 of TILs will be administered.

[0236] In some embodiments, the concentration of TILs provided in the pharmaceutical compositions of the present invention is, for example, 100%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.16%, 0.18%, 0.19%, 0.20%, 0.21%, 0.22%, 0.23%, 0.24%, 0.25%, 0.26%, 0.27%, 0.28%, 0.29%, 0.30%, 0.31%, 0.32%, 0.33%, 0.34%, 0.35%, 0.36%, 0.37%, 0.38%, 0.39 ... %, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.009%, 0.008%, 0.007%, 0.006%, 0.005%, 0.004%, 0.003%, 0.002%, 0.001%, 0.0009%, 0.0008%, 0.0007%, 0.0006%, 0.0005%, 0.0004%, 0.0003%, 0.0002% or less than 0.0001% w / w, w / v or v / v.

[0237] In some embodiments, the concentration of TILs provided in the pharmaceutical compositions of the present invention is 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 19.75%, 19.50%, 19.25%, 19%, 18.75%, 18.50%, 18.25%, 18%, 17.75%, 17.50%, 17.25%, 17%, 16.75%, 16.50%, 16.25%, 16%, 15.75%, 15.50%, 16.25%, 16%, 15.50%, 15.75%, 15.50%, 16.75%, 16.50%, 16.25%, 16 ... %, 15.25%15%, 14.75%, 14.50%, 14.25%14%, 13.75%, 13.50%, 13.25%13%, 12.75%, 12.50%, 12.25%12%, 11.75%, 11.50%, 11.25%11%, 10.75%, 10.50%, 10.25%10%, 9.75%, 9.50%, 9.25%9%, 8.75%, 8.50%, 8.25%8%, 7.75%, 7.50% ,7.25%7%,6.75%,6.50%,6.25%6%,5.75%,5.50%,5.25%5%,4.75%,4.50%,4.25%,4%,3.75%,3.50%,3.25%,3%,2.75%,2.50%,2.25%,2%,1.75%,1.50%,125%,1%,0.5%,0.4%,0.3%,0.2%,0.1%,0.09%,0.08%,0.07%,0.06%,0. 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.009%, 0.008%, 0.007%, 0.006%, 0.005%, 0.004%, 0.003%, 0.002%, 0.001%, 0.0009%, 0.0008%, 0.0007%, 0.0006%, 0.0005%, 0.0004%, 0.0003%, 0.0002% or greater than 0.0001% w / w, w / v, or v / v.

[0238] In some embodiments, the concentration of TILs provided in the pharmaceutical compositions of the present invention is between about 0.0001% and 50%, between about 0.001% and about 40%, between about 0.01% and about 30%, between about 0.02% and about 29%, between about 0.03% and about 28%, between about 0.04% and about 27%, between about 0.05% and about 26%, between about 0.06% and about 25%, between about 0.07% and about 24%, between about 0.08% and about 16%, between about 0.09% and about 28%, between about 1.00% and about 1.20%, between about 1.20% and about 1.40%, between about 1.40% and about 1.60%, between about 1.60% and about 1.80%, between about 1.8 ... The range is from about 0.08% to about 23%, from about 0.09% to about 22%, from about 0.1% to about 21%, from about 0.2% to about 20%, from about 0.3% to about 19%, from about 0.4% to about 18%, from about 0.5% to about 17%, from about 0.6% to about 16%, from about 0.7% to about 15%, from about 0.8% to about 14%, from about 0.9% to about 12%, or from about 1% to about 10% w / w, w / v, or v / v.

[0239] In some embodiments, the concentration of TILs provided in the pharmaceutical compositions of the present invention ranges from about 0.001% to 10%, about 0.01% to about 5%, about 0.02% to about 4.5%, about 0.03% to about 4%, about 0.04% to about 3.5%, about 0.05% to about 3%, about 0.06% to about 2.5%, about 0.07% to about 2%, about 0.08% to about 1.5%, about 0.09% to about 1%, or about 0.1% to about 0.9% w / w, w / v, or v / v of the pharmaceutical composition.

[0240] In some embodiments, the amount of TILs provided in the pharmaceutical compositions of the present invention is 10 g, 9.5 g, 9.0 g, 8.5 g, 8.0 g, 7.5 g, 7.0 g, 6.5 g, 6.0 g, 5.5 g, 5.0 g, 4.5 g, 4.0 g, 3.5 g, 3.0 g, 2.5 g, 2.0 g, 1.5 g, 1.0 g, 0.95 g, 0.9 g, 0.85 g, 0.8 g, 0.75 g, 0.7 g, 0.65 g, 0.6 g, 0.55 g, 0.5 g, 0.45 g, 0.4 g, 0.35 g, 0.3 g, 0.25 g, 0.2g, 0.15g, 0.1g, 0.09g, 0.08g, 0.07g, 0.06g, 0.05g, 0.04g, 0.03g, 0.02g, 0.01g, 0.009g, 0.008g, 0.007g, 0.006g, 0.005g, 0.004g, 0.003g, 0.002g, 0.001g, 0.0009g, 0.0008g, 0.0007g, 0.0006g, 0.0005g, 0.0004g, 0.0003g, 0.0002g, or 0.0001g.

[0241] In some embodiments, the amount of TILs provided in the pharmaceutical compositions of the present invention is 0.0001g, 0.0002g, 0.0003g, 0.0004g, 0.0005g, 0.0006g, 0.0007g, 0.0008g, 0.0009g, 0.001g, 0.0015g, 0.002g, 0.002 5g, 0.003g, 0.0035g, 0.004g, 0.0045g, 0.005g, 0.0055g, 0.006g, 0.0065g, 0.00 7g, 0.0075g, 0.008g, 0.0085g, 0.009g, 0.0095g, 0.01g, 0.015g, 0.02g, 0.025g, 0 .03g, 0.035g, 0.04g, 0.045g, 0.05g, 0.055g, 0.06g, 0.065g, 0.07g, 0.075g, 0.0 8g, 0.085g, 0.09g, 0.095g, 0.1g, 0.15g, 0.2g, 0.25g, 0.3g, 0.35g, 0.4g, 0.45g, 0 0.5g, 0.55g, 0.6g, 0.65g, 0.7g, 0.75g, 0.8g, 0.85g, 0.9g, 0.95g, 1g, 1.5g, 2g, 2.5, 3g, 3.5, 4g, 4.5g, 5g, 5.5g, 6g, 6.5g, 7g, 7.5g, 8g, 8.5g, 9g, 9.5g, or greater than 10g.

[0242] The TILs provided in the pharmaceutical compositions of the present invention are effective over a wide dosage range. The exact dosage will depend on the route of administration, the form in which the compound is administered, the gender and age of the subject being treated, the body weight of the subject being treated, and the preferences and experience of the attending physician. Where appropriate, clinically established dosages of TILs may be used. The amount of the pharmaceutical composition administered using the methods herein, such as the dosage of TILs, will depend on the human or mammal being treated, the severity of the disorder or condition, the rate of administration, the nature of the active pharmaceutical ingredient, and the discretion of the prescribing physician.

[0243] In some embodiments, TILs can be administered in a single dose. Such administration can be by injection, for example, intravenous injection. In some embodiments, TILs can be administered in multiple doses. Administration can be once, twice, three times, four times, five times, six times, or more than six times per year. Administration can be once a month, once every two weeks, once a week, or once every other day. Administration of TILs can be continued as long as necessary.

[0244] In some embodiments, an effective dosage of TILs is about 0.01 mg / kg to about 4.3 mg / kg, about 0.15 mg / kg to about 3.6 mg / kg, about 0.3 mg / kg to about 3.2 mg / kg, about 0.35 mg / kg to about 2.85 mg / kg, about 0.15 mg / kg to about 2.85 mg / kg, about 0.3 mg to about 2.15 mg / kg, about 0.45 mg / kg to about 1.7 mg / kg, about 0.15 mg / kg to about 1.3 mg / kg, about 0.3 mg / kg to about 1.15 mg / kg, about 0.45 mg / kg to about 1 mg / kg, about 0.55 mg / kg to about 0.85 mg / kg, about 0.65 mg / kg to about 0.8 mg / kg, or about 0.7 mg / kg about 0.75 mg / kg, about 0.7 mg / kg to about 2.15 mg / kg, about 0.85 mg / kg to about 2 mg / kg, about 1 mg / kg to about 1.85 mg / kg, about 1.15 mg / kg to about 1.7 mg / kg, about 1.3 mg / kg to about 1.6 mg / kg, about 1.35 mg / kg to about 1.5 mg / kg, about 2.15 mg / kg to about 3.6 mg / kg, about 2.3 mg / kg to about 3.4 mg / kg, about 2.4 mg / kg to about 3.3 mg / kg, about 2.6 mg / kg to about 3.15 mg / kg, about 2.7 mg / kg to about 3 mg / kg, about 2.8 mg / kg to about 3 mg / kg, or about 2.85 mg / kg to about 2.95 mg / kg.

[0245] In some embodiments, an effective dose of TILs is about 1 mg to about 500 mg, about 10 mg to about 300 mg, about 20 mg to about 250 mg, about 25 mg to about 200 mg, about 1 mg to about 50 mg, about 5 mg to about 45 mg, about 10 mg to about 40 mg, about 15 mg to about 35 mg, about 20 mg to about 30 mg, about 23 mg to about 28 mg, about 50 mg to about 150 mg, about 60 mg to about 140 mg, or about The range is 70 mg to about 130 mg, about 80 mg to about 120 mg, about 90 mg to about 110 mg, or about 95 mg to about 105 mg, about 98 mg to about 102 mg, about 150 mg to about 250 mg, about 160 mg to about 240 mg, about 170 mg to about 230 mg, about 180 mg to about 220 mg, about 190 mg to about 210 mg, about 195 mg to about 205 mg, or about 198 mg to about 207 mg.

[0246] An effective dose of TILs can be administered in single or multiple doses by any of the accepted modes of administration of agents with similar utilities, including intra-arterial injection, intravenous, intraperitoneal, parenteral, intramuscular, subcutaneous, topical, by implantation, or by inhalation, including intranasal and transdermal routes.

[0247] In other embodiments, the invention provides an infusion bag comprising a therapeutic TIL population as described in any of the preceding paragraphs above.

[0248] In other embodiments, the invention provides a tumor-infiltrating lymphocyte (TIL) composition comprising a therapeutic TIL population described in any of the preceding paragraphs above and a pharmaceutically acceptable carrier.

[0249] In other embodiments, the present invention provides an infusion bag comprising a TIL composition described in any of the preceding paragraphs above.

[0250] In other embodiments, the invention provides a cryopreserved preparation of a therapeutic TIL population described in any of the preceding paragraphs above.

[0251] In other embodiments, the invention provides a tumor infiltrating lymphocyte (TIL) composition comprising a therapeutic TIL population described in any of the preceding paragraphs above and a cryopreservation medium.

[0252] In other embodiments, the invention provides a TIL composition according to any of the preceding paragraphs above, wherein the cryopreservation medium is adjusted to include DMSO.

[0253] In other embodiments, the invention provides a TIL composition described in any of the preceding paragraphs above, wherein the cryopreservation medium is adjusted to contain 7-10% DMSO.

[0254] In other embodiments, the invention provides a cryopreserved preparation of a TIL composition described in any of the preceding paragraphs above.

[0255] In some embodiments, TILs expanded using the methods of the present disclosure are administered to a patient as a pharmaceutical composition. In some embodiments, the pharmaceutical composition is a suspension of TILs in a sterile buffer. TILs expanded using the methods of the present disclosure may be administered by any suitable route known in the art. In some embodiments, T cells are administered as a single intra-arterial or intravenous infusion, preferably lasting approximately 30-60 minutes. Other suitable routes of administration include intraperitoneal, intrathecal, and intralymphatic administration.

[0256] The TILs provided in the pharmaceutical compositions of the present invention are effective over a wide dosage range. The exact dosage will depend on the route of administration, the form in which the compound is administered, the gender and age of the subject being treated, the body weight of the subject being treated, and the preferences and experience of the attending physician. Where appropriate, clinically established dosages of TILs may be used. The amount of the pharmaceutical composition administered using the methods herein, such as the dosage of TILs, will depend on the human or mammal being treated, the severity of the disorder or condition, the rate of administration, the nature of the active pharmaceutical ingredient, and the discretion of the prescribing physician.

[0257] IV. Methods of Treating Cancer Patients

[0013] Embodiments of the present invention are further directed to methods for treating a cancer patient, the method comprising administering to the cancer patient a therapeutically effective dose of a gene-edited tumor-infiltrating lymphocyte (TIL) population comprising an expanded TIL population with reduced expression of PD-1 and TIGIT produced by the methods disclosed herein, or a pharmaceutical composition disclosed herein.

[0258] In some embodiments, the cancer is a solid tumor cancer. In some embodiments, the solid tumor cancer is anal cancer, bladder cancer, breast cancer (including triple-negative breast cancer), bone cancer, cancer caused by human papillomavirus (HPV), central nervous system-related cancer (including ependymoma, medulloblastoma, neuroblastoma, pineoblastoma, and primitive neuroectodermal tumor), cervical cancer (including squamous cell carcinoma, adenosquamous carcinoma, and cervical adenocarcinoma), colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, esophagogastric junction cancer, gastric cancer, gastrointestinal cancer, gastrointestinal stromal tumor, glioblastoma, glioma, head and neck cancer (head and neck squamous cell carcinoma (HNSCC), hypopharyngeal cancer, laryngeal cancer, and pharyngeal cancer), kidney cancer, liver cancer, lung cancer (including non-small cell lung cancer (NSCLC), metastatic NSCLC and small cell lung cancer), melanoma (including uveal melanoma, choroidal melanoma, ciliary body melanoma, iris melanoma, or metastatic melanoma), mesothelioma (including malignant pleural mesothelioma), ovarian cancer, pancreatic cancer (including pancreatic ductal adenocarcinoma), penile cancer, rectal cancer, kidney cancer, renal cell carcinoma, sarcoma (including Ewing's sarcoma, osteosarcoma, rhabdomyosarcoma, and other bone and soft tissue sarcomas), thyroid cancer (including anaplastic thyroid carcinoma), uterine cancer, and vaginal cancer.

[0259] In some embodiments, the cancer is a hematological malignancy, hi some embodiments, the hematological malignancy is selected from the group consisting of chronic lymphocytic leukemia, acute lymphoblastic leukemia, diffuse large B-cell lymphoma, non-Hodgkin's lymphoma, Hodgkin's lymphoma, follicular lymphoma, mantle cell lymphoma, and multiple myeloma.

[0260] In some embodiments, the cancer is one of the aforementioned cancers, including solid tumor cancers and hematological malignancies, that has relapsed or is refractory to treatment with at least one prior therapy, including chemotherapy, radiation therapy, or immunotherapy. In some embodiments, the cancer is one of the aforementioned cancers that has relapsed or is refractory to treatment with at least two prior therapies, including chemotherapy, radiation therapy, and / or immunotherapy. In some embodiments, the cancer is one of the aforementioned cancers that has relapsed or is refractory to treatment with at least three prior therapies, including chemotherapy, radiation therapy, and / or immunotherapy.

[0261] In other embodiments, the invention provides methods for treating a subject having a cancer described herein, modified such that a non-myeloablative lymphodepletion regimen is administered to the subject prior to administering a therapeutically effective dose of a therapeutic TIL population and a TIL composition described herein, respectively.

[0262] In other embodiments, the invention provides methods for treating a subject having a cancer described herein, wherein the non-myeloablative lymphodepletion regimen is modified to include administration of cyclophosphamide at a dose of 60 mg / m2 / day for two days, followed by administration of fludarabine at a dose of 25 mg / m2 / day for five days.

[0263] In other embodiments, the invention provides methods for treating a subject having cancer described herein, modified to further include treating the subject with a high-dose IL-2 regimen starting the day after administering the TIL cells to the subject.

[0264] In other embodiments, the invention provides methods for treating a subject having a cancer described herein, wherein the high-dose IL-2 regimen is modified to include 600,000 or 720,000 IU / kg administered as a 15-minute bolus intravenous infusion every 8 hours until tolerated.

[0265] 1. Lymphocyte depletion preconditioning of patients In some embodiments, the invention includes a method of treating cancer with a TIL population, wherein the patient is pretreated with non-myeloablative chemotherapy prior to infusion of TILs according to the present disclosure. In some embodiments, the invention includes a TIL population for use in treating cancer in a patient pretreated with non-myeloablative chemotherapy. In some embodiments, the TIL population is for administration by infusion. In some embodiments, the non-myeloablative chemotherapy comprises cyclophosphamide 60 mg / kg / day for two days (days 27 and 26 prior to TIL infusion) and fludarabine 25 mg / m 2 / day for 5 days (days 27-23 of TIL infusion). In some embodiments, after non-myeloablative chemotherapy according to the present disclosure and TIL infusion (day 0), the patient receives an intravenous infusion of IL-2 (aldesleukin, commercially available as PROLEUKIN) at 720,000 IU / kg intravenously every 8 hours to physiological tolerance. In certain embodiments, the TIL population is for use in treating cancer in combination with IL-2, and the IL-2 is administered after the TIL population.

[0266] Experimental results indicate that lymphodepletion prior to adoptive transfer of tumor-specific T lymphocytes plays an important role in enhancing therapeutic efficacy by eliminating regulatory T cells and competing elements of the immune system ("cytokine sinks"). Accordingly, some embodiments of the present invention utilize a lymphodepletion step (sometimes referred to as "immunosuppressive conditioning") in patients prior to introducing the TILs of the present invention.

[0267] Lymphocyte depletion is typically achieved using the administration of fludarabine or cyclophosphamide (the active form of which is called mafosfamide) and combinations thereof. Such methods are described in Gassner, et al., Cancer Immunol. Immunother. 2011, 60, 75-85; Muranski, et al., Nat. Clin. Pract. Oncol. 2006, 3, 668-681; Dudley, et al., J. Clin. Oncol. 2008, 26, 5233-5239; and Dudley, et al., J. Clin. Oncol. 2005, 23, 2346-2357, all of which are incorporated herein by reference in their entirety.

[0268] In some embodiments, fludarabine is administered at a concentration of 0.5 μg / mL to 10 μg / mL fludarabine. In some embodiments, fludarabine is administered at a fludarabine concentration of 1 μg / mL. In some embodiments, fludarabine treatment is administered for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days or more. In some embodiments, fludarabine is administered at a dose of 10 mg / kg / day, 15 mg / kg / day, 20 mg / kg / day, 25 mg / kg / day, 30 mg / kg / day, 35 mg / kg / day, 40 mg / kg / day, or 45 mg / kg / day. In some embodiments, fludarabine treatment is administered at 35 mg / kg / day for 2-7 days. In some embodiments, fludarabine treatment is administered at 35 mg / kg / day for 4-5 days. In some embodiments, fludarabine treatment is administered at 25 mg / kg / day for 4-5 days.

[0269] In some embodiments, the active form of cyclophosphamide, mafosfamide, is obtained by administering cyclophosphamide at a concentration of 0.5 μg / mL to 10 μg / mL. In some embodiments, the active form of cyclophosphamide, mafosfamide, is obtained by administering cyclophosphamide at a concentration of 1 μg / mL. In some embodiments, cyclophosphamide treatment is administered for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days or more. In some embodiments, cyclophosphamide is administered at a concentration of 100 mg / m 2 / day, 150mg / m 2 / day, 175mg / m 2 / day, 200mg / m 2 / day, 225mg / m 2 / day, 250mg / m 2 / day, 275mg / m 2 / day, or 300 mg / m 2 In some embodiments, cyclophosphamide is administered at a dose of 35 mg / kg / day for 2-7 days. In some embodiments, cyclophosphamide is administered at a dose of 250 mg / kg / day. In some embodiments, cyclophosphamide is administered intravenously (i.e., iv). In some embodiments, cyclophosphamide treatment is administered at 35 mg / kg / day for 2-7 days. In some embodiments, cyclophosphamide treatment is administered at 250 mg / kg / day. 2 / day iv for 4-5 days. In some embodiments, cyclophosphamide treatment is administered at 250 mg / m 2 / day iv for 4 days.

[0270] In some embodiments, lymphodepletion is performed by administering fludarabine and cyclophosphamide together to the patient. In some embodiments, fludarabine is administered at a dose of 25 mg / m 2 / day and cyclophosphamide at 250 mg / m 2 / day for 4 days.

[0271] In some embodiments, lymphodepletion is achieved by administering cyclophosphamide at 60 mg / m 2 / day for 2 days, followed by fludarabine at 25 mg / m 2 This is performed by administering the drug at a dose of 100 mg / day for 5 days.

[0272] In some embodiments, lymphodepletion is achieved by administering cyclophosphamide at 60 mg / m 2 / day for 2 days, followed by fludarabine at 25 mg / m 2 / day for 5 days, with both cyclophosphamide and fludarabine given on the first 2 days, and cyclophosphamide given for a total of 5 days.

[0273] In some embodiments, lymphodepletion is achieved by administering cyclophosphamide at about 50 mg / m 2 / day for 2 days, followed by fludarabine at 25 mg / m 2 / day for 5 days, with both cyclophosphamide and fludarabine given on the first 2 days, and cyclophosphamide given for a total of 5 days.

[0274] In some embodiments, lymphodepletion is achieved by administering cyclophosphamide at about 50 mg / m 2 / day for 2 days, followed by fludarabine at 20 mg / m 2 / day for 5 days, with both cyclophosphamide and fludarabine given on the first 2 days, and cyclophosphamide given for a total of 5 days.

[0275] In some embodiments, lymphodepletion is achieved by administering cyclophosphamide at about 40 mg / m 2 / day for 2 days, followed by fludarabine at 20 mg / m 2 / day for 5 days, with both cyclophosphamide and fludarabine given on the first 2 days, and cyclophosphamide given for a total of 5 days.

[0276] In some embodiments, lymphodepletion is achieved by administering cyclophosphamide at about 40 mg / m 2 / day for 2 days, followed by fludarabine at 15 mg / m 2 / day for 5 days, with both cyclophosphamide and fludarabine given on the first 2 days, and cyclophosphamide given for a total of 5 days.

[0277] In some embodiments, lymphodepletion is achieved by administering cyclophosphamide at 60 mg / m 2 / day dose, and fludarabine at 25 mg / m 2 / day for 2 days, followed by fludarabine at 25 mg / m 2 This is performed by administering the drug at a dose of 100 mg / day for 3 days.

[0278] In some embodiments, cyclophosphamide is administered with mesna. In some embodiments, mesna is administered at 15 mg / kg. In some embodiments where mesna is infused, if infused continuously, mesna can be infused with cyclophosphamide over about 2 hours (on day -5 and / or day -4), then concomitantly with each dose of cyclophosphamide at a rate of 3 mg / kg / hour for the remaining 22 hours of the 24 hour period.

[0279] In some embodiments, lymphodepletion comprises treating the patient with an IL-2 regimen starting the day after administering the third population of TILs to the patient.

[0280] In some embodiments, lymphodepletion comprises treating the patient with an IL-2 regimen starting on the same day the patient is administered the third population of TILs.

[0281] In some embodiments, lymphodepletion comprises 5 days of preconditioning therapy. In some embodiments, the days are referred to as days -5 to -1 or days 0 to 4. In some embodiments, the regimen includes cyclophosphamide on days -5 and -4 (i.e., days 0 and 1). In some embodiments, the regimen includes intravenous cyclophosphamide on days -5 and -4 (i.e., days 0 and 1). In some embodiments, the regimen includes 60 mg / kg intravenous cyclophosphamide on days -5 and -4 (i.e., days 0 and 1). In some embodiments, the cyclophosphamide is administered with mesna. In some embodiments, the regimen further includes fludarabine. In some embodiments, the regimen further includes intravenous fludarabine. In some embodiments, the regimen includes 25 mg / m 2 In some embodiments, the regimen further comprises intravenous fludarabine at 25 mg / m on days -5 and -1 (i.e., days 0-4). 2 In some embodiments, the regimen further comprises intravenous fludarabine at 25 mg / m on days -5 and -1 (i.e., days 0-4). 2 of intravenous fludarabine.

[0282] In some embodiments, the non-myeloablative lymphodepletion regimen is 60 mg / m 2 / day dose of cyclophosphamide and 25 mg / m 2 / day for 2 days followed by 25 mg / m 2 The method includes administering fludarabine at a dose of 100 mg / day for 5 days.

[0283] In some embodiments, the non-myeloablative lymphodepletion regimen is 60 mg / m 2 / day cyclophosphamide for 2 days, then 25 mg / m 2 The method includes administering fludarabine at a dose of 100 mg / day for 5 days.

[0284] In some embodiments, the non-myeloablative lymphodepletion regimen is 60 mg / m 2 / day cyclophosphamide for 2 days, then 25 mg / m 2 The method includes administering fludarabine at a dose of 100 mg / day for three days.

[0285] In some embodiments, the non-myeloablative lymphodepletion regimen is 60 mg / m 2 / day dose of cyclophosphamide and 25 mg / m 2 / day for 2 days followed by 25 mg / m 2 / day for 3 days.

[0286] In some embodiments, the non-myeloablative lymphodepletion regimen is 60 mg / m 2 / day dose of cyclophosphamide and 25 mg / m 2 / day for 2 days followed by 25 mg / m 2 / day for one day.

[0287] In some embodiments, the non-myeloablative lymphodepletion regimen is 60 mg / m 2 / day cyclophosphamide for 2 days, then 25 mg / m 2 / day dose of fludarabine for 3 days.

[0288] In some embodiments, the non-myeloablative lymphodepletion regimen is 60 mg / m 2 / day dose of cyclophosphamide and 25 mg / m 2 / day for 2 days followed by 25 mg / m 2 The method comprises administering fludarabine at a dose of 100 mg / day for 3 days.

[0289] In some embodiments, the non-myeloablative lymphodepletion regimen is administered according to Table 26.

[0290] [Table 6]

[0291] In some embodiments, the non-myeloablative lymphodepletion regimen is administered according to Table 27.

[0292] [Table 7]

[0293] In some embodiments, the non-myeloablative lymphodepletion regimen is administered according to Table 28.

[0294] [Table 8]

[0295] In some embodiments, the non-myeloablative lymphodepleting regimen is administered according to Table 29.

[0296] [Table 9]

[0297] In some embodiments, the non-myeloablative lymphodepleting regimen is administered according to Table 30.

[0298] [Table 10]

[0299] In some embodiments, the non-myeloablative lymphodepletion regimen is administered according to Table 31.

[0300] [Table 11]

[0301] In some embodiments, the non-myeloablative lymphodepleting regimen is administered according to Table 32.

[0302] [Table 12]

[0303] In some embodiments, the non-myeloablative lymphodepleting regimen is administered according to Table 33.

[0304] [Table 13]

[0305] In some embodiments, the TIL infusion used in the foregoing embodiments of the myeloablative lymphodepletion regimen may be any TIL composition described herein, and may be in addition to an IL-2 regimen as described herein.

[0306] 2.IL-2 regimen In some embodiments, the IL-2 regimen includes a high-dose IL-2 regimen, which includes aldesleukin or a biosimilar or variant thereof administered intravenously starting the day after administration of a therapeutically effective portion of the therapeutic TIL population, wherein aldesleukin or a biosimilar or variant thereof is administered using a 15-minute bolus intravenous infusion at a dose of 0.037 mg / kg or 0.044 mg / kg IU / kg (patient body weight) every 8 hours for a maximum of 14 doses until tolerated. After a 9-day rest period, this schedule can be repeated for an additional 14 doses, for a total of up to 28 doses. In some embodiments, IL-2 is administered in 1, 2, 3, 4, 5, or 6 doses. In some embodiments, IL-2 is administered at a maximum dose of up to 6 doses.

[0307] In some embodiments, the IL-2 regimen comprises a decrescendo IL-2 regimen, such as that described in O'Day, et al., J. Clin. Oncol. 1999, 17, 2752-61 and Eton, et al., Cancer 2000, 88, 1703-9, the disclosures of which are incorporated herein by reference. In some embodiments, the decrescendo IL-2 regimen comprises 18 x 10 IL-2 administered intravenously over 6 hours. 6 IU / m 2 Aldesleukin, or its biosimilar or variant, followed by 18 × 10 administered intravenously over 12 hours 6 IU / m 2 , followed by 18 × 10 intravenous injections over 24 hours 6 IU / m 2 , followed by 4.5 × 10 intravenous doses over 72 hours 6 IU / m 2 This treatment cycle can be repeated every 28 days for up to four cycles. In some embodiments, the decrescendo IL-2 regimen includes 18,000,000 IU / m on day 1. 2 , 9,000,000 IU / m on the second day 2 , 4,500,000 IU / m on days 3 and 4 2 Includes:

[0308] In some embodiments, the IL-2 regimen comprises a low-dose IL-2 regimen. Any low-dose IL-2 regimen known in the art can be used, including those described in Dominguez-Villar and Hafler, Nat. Immunology 2000, 19, 665-673; Hartemann, et al., Lancet Diabetes Endocrinol. 2013, 1, 295-305; and Rosenzwaig, et al., Ann. Rheum. Dis. 2019, 78, 209-217, the disclosures of which are incorporated herein by reference. In some embodiments, the low-dose IL-2 regimen comprises m 2 Winning 18 x 10 6IU of aldesleukin, or its biosimilar or variant, given as a continuous infusion every 24 hours for 5 days, followed by 2 to 6 days without IL-2 therapy, followed optionally by an additional 5 days of intravenous aldesleukin or its biosimilar or variant, given as a continuous infusion every 24 hours. 2 Winning 18 x 10 6 IU as a continuous infusion, optionally followed by 3 weeks without IL-2 therapy, after which additional cycles may be administered.

[0309] In some embodiments, IL-2 is administered at a maximum dose of up to six doses. In some embodiments, a high-dose IL-2 regimen is adapted for pediatric use. In some embodiments, a dose of 600,000 international units (IU) / kg of aldesleukin is used every 8-12 hours for up to six doses. In some embodiments, a dose of 500,000 international units (IU) / kg of aldesleukin is used every 8-12 hours for up to six doses. In some embodiments, a dose of 400,000 international units (IU) / kg of aldesleukin is used every 8-12 hours for up to six doses. In some embodiments, a dose of 500,000 international units (IU) / kg of aldesleukin is used every 8-12 hours for up to six doses. In some embodiments, a dose of 300,000 international units (IU) / kg of aldesleukin is used every 8-12 hours for up to six doses. In some embodiments, a dose of 200,000 International Units (IU) / kg of aldesleukin is used every 8-12 hours, up to a maximum of 6 doses. In some embodiments, a dose of 100,000 International Units (IU) / kg of aldesleukin is used every 8-12 hours, up to a maximum of 6 doses.

[0310] In some embodiments, the IL-2 regimen comprises administering pegylated IL-2 at a dose of 0.10 mg / day to 50 mg / day every 1, 2, 4, 6, 7, 14, or 21 days. In some embodiments, the IL-2 regimen comprises administering bempegaldesleukin, or a fragment, variant, or biosimilar thereof, at a dose of 0.10 mg / day to 50 mg / day every 1, 2, 4, 6, 7, 14, or 21 days.

[0311] In some embodiments, the IL-2 regimen comprises administering THOR-707, or a fragment, variant, or biosimilar thereof, at a dose of 0.10 mg / day to 50 mg / day every 1, 2, 4, 6, 7, 14, or 21 days.

[0312] In some embodiments, the IL-2 regimen includes administration of nemvaleukin alfa, or a fragment, variant, or biosimilar thereof, after administration of TILs. In certain embodiments, the patient is administered nemvaleukin at a dose of 0.10 mg / day to 50 mg / day every 1, 2, 4, 6, 7, 14, or 21 days.

[0313] In some embodiments, the antibody cytokine transplant proteins described herein have a longer serum half-life than wild-type IL-2 molecules, such as, but not limited to, aldesleukin (Proleukin®) or equivalent molecules. [Example]

[0314] Embodiments encompassed herein will now be described with reference to the following examples, which are provided for illustrative purposes only, and the disclosure encompassed herein should in no way be construed as being limited to these examples, but rather as encompassing any and all variations that become evident as a result of the teachings provided herein.

[0315] Example 1: Preparation of media for pre-REP and REP processes This example describes a procedure for the preparation of tissue culture medium for use in protocols involving the culture of tumor-infiltrating lymphocytes (TILs) derived from various solid tumors. This medium can be used to prepare any of the TILs described in this application and other examples.

[0316] Preparation of CM1. Remove the following reagents from refrigeration and warm them in a 37°C water bath: (RPMI 1640, human AB serum, 200 mM L-glutamine). Prepare CM1 medium according to Table 42 below by adding each component to the top of a 0.2 μm filter unit appropriate for the volume to be filtered. Store at 4°C.

[0317] [Table 14]

[0318] On the day of use, the required amount of CM1 was pre-warmed in a 37°C water bath and supplemented with 6000 IU / mL of IL-2.

[0319] Additional supplementation was made as needed according to Table 43.

[0320] [Table 15]

[0321] Preparation of CM2 Prepared CM1 was removed from the refrigerator or fresh CM1 was prepared. The required amount of CM2 was prepared by removing AIM-V® from the refrigerator and mixing prepared CM1 with an equal volume of AIM-V® in a sterile media bottle. 3000 IU / mL of IL-2 was added to the CM2 medium on the day of use. A sufficient amount of CM2 containing 3000 IU / mL of IL-2 was made on the day of use. CM2 medium bottles were labeled with the name, preparer's initials, filtration / preparation date, and a 2-week expiration date and stored at 4°C until needed for tissue culture.

[0322] Preparation of CM3 CM3 was prepared on the day it was needed. CM3 was the same as AIM-V® medium, supplemented with 3000 IU / mL IL-2 on the day of use. A sufficient amount of CM3 was prepared for the experiment by adding IL-2 stock solution directly to the AIM-V bottle or bag. Shake gently to mix well. Immediately after adding to the AIM-V, the bottle was labeled "3000 IU / mL IL-2." If excess CM3 was present, it was stored at 4°C in a bottle labeled with the medium name, preparer's initials, the date the medium was prepared, and its expiration date (7 days after preparation). After 7 days of storage at 4°C, the IL-2-supplemented medium was discarded.

[0323] Preparation of CM4 CM4 was the same as CM3, supplemented with 2 mM GlutaMAX™ (final concentration). For every 1 L of CM3, 10 mL of 200 mM GlutaMAX™ was added. A sufficient amount of CM4 was prepared for the experiment by adding the IL-2 stock solution and GlutaMAX™ stock directly to the AIM-V bottle or bag. Shake gently to mix well. Immediately after adding to the AIM-V, the bottle was labeled "3000 IL / mL IL-2 and GlutaMAX." If excess CM4 was present, it was stored at 4°C in a bottle labeled with the medium name, "GlutaMAX," and its expiration date (7 days after preparation). After 7 days of storage at 4°C, the IL-2-supplemented medium was discarded.

[0324] Example 2: Comparison of combined and sequential electroporation method 8 mL of a 300 ng / mL OKT3 solution was prepared in carbonate / bicarbonate buffer. 300 uL of the OKT3 solution was added to each well of a Nunclon 24-well TC plate and incubated overnight at 4°C.

[0325] Pre-REP TIL lines (N=2) from different indications (head and neck and breast) were thawed in CM1 containing 300 IU / mL IL-2 and activated at 2e6 cells per well in OKT3 coated 24-well plates and incubated for 2 days at 37° C. Activated TILs were combined to >14e6 viable cells, pelleted, and resuspended at 50e6 / mL in electroporation medium T.

[0326] PD-1 and LAG3 TALEN mRNAs were prepared according to the following conditions.

[0327] [Table 16]

[0328] A 24-well plate was prepared with 2 mL of CM1 + 1000 IU / mL IL-2 per well and maintained at 30°C for at least 30 minutes before the start of electroporation. The BTX electroporator was set up to run the following protocol:

[0329] [Table 17]

[0330] TILs were electroporated with either the LAG3 TAL, the PD-1 TAL, or the LAG3 + PD-1 TAL. For sequential electroporation, TILs were electroporated with the LAG3 TAL, incubated overnight at 30°C, and then incubated in CM1 containing 1,000 IU / mL IL-2 at 37°C for 2 days (total incubation time of 3 days) before being electroporated again with the PD-1 TAL.

[0331] After electroporation, cells were incubated overnight at 30°C in CM1 containing 1,000 IU / mL IL-2. Simultaneously or sequentially electroporated TILs were incubated overnight at 30°C in CM1 containing 1,000 IU / mL IL-2, and then subjected to REP using 3 mL of CM2, 3,000 IU / mL IL-2, 30 ng / mL OKT3, and 30e6 feeders per well of a GREX 24-well plate. On day 5 of REP, 5 mL of CM4 + 3,000 IU / mL IL-2 was added to each well. TILs were harvested after 10 days of REP.

[0332] result Figure 1 shows the viability of TILs after sequential electroporation. Figure 2 shows the LAG3 and PD-1 KO efficiencies in CD3+ (Figure 2A), CD8+ (Figure 2B), and CD4+ (Figure 2C) TILs. KO target expression was measured by flow cytometry after overnight stimulation of cells with aCD3 / aCD28 beads (1:5 ratio, beads:cells). KO efficiency was calculated by subtracting the expression of the KO target in TALEN-treated cells from the expression of the KO target in mock cells (cells that underwent mock electroporation and no RNA was present), and dividing by the expression of the KO target in mock cells. ((Mock - TALEN) / (Mock)) * 100 = % KO efficiency. Figure 3 shows the fold expansion (Figure 3A) and viability (Figure 3B) of simultaneously and sequentially electroporated TILs after REP.

[0333] Example 3: Stimulation Day Test Tumor preparation Freshly resected tumor samples from patients with two different cancers (head and neck and breast) were collected from approximately 2-6 mm 3 Fragmented into pieces.

[0334] Tumor Processing. Tumor specimens were obtained and transferred to a 2-8°C room for immediate processing. Tumor wash medium was aliquoted. Tumor wash 1 was performed using 8-inch forceps (W3009771). The tumor was removed from the specimen bottle and transferred to the prepared "Wash 1" dish. This was followed by tumor wash 2 and tumor wash 3. Tumors were measured and evaluated. The tumor was assessed for whether greater than 30% of the total tumor area was observed to be necrotic and / or fatty tissue. If applicable, a clean-up dissection was performed. If the tumor was large and greater than 30% of the outer tissue was observed to be necrotic / fatty tissue, a "clean-up dissection" was performed by removing the necrotic / fatty tissue using a combination of scalpel and / or forceps while preserving the internal structure of the tumor. Tumor dissection. Using a combination of scalpel and / or forceps, the tumor specimen was cut into equal, appropriately sized pieces (up to six intermediate pieces). The intermediate tumor fragments were transferred. The tumor fragments were excised into small pieces approximately 3 x 3 x 3 mm in size. The intermediate fragment was saved to prevent drying. The dissection of the intermediate fragment was repeated. The number of sections collected was determined. If desired tissue remained, additional desired tumor fragments were selected from the "preferred intermediate fragment" 6-well plate and filled with droplets for up to 50 fragments.

[0335] Generation of pre-REP TIL products Day 0

[0336] Preparation of CM1 medium. In a biological safety cabinet (BSC), reagents were added to a bottle of RPMI 1640 medium. Add per bottle: inactivated human AB serum (100.0 mL), GlutaMax™ (10.0 mL), gentamicin sulfate 50 mg / mL (1.0 mL), and 2-mercaptoethanol (1.0 mL). Heat.

[0337] Remove unwanted materials from the BSC. Remove media reagents from the BSC, leaving gentamicin sulfate and HBSS in the BSC for preparation of formulated wash media.

[0338] Thaw IL-2 aliquots. Thaw one 1.1 mL IL-2 aliquot (6 x 10 mL) until all ice has melted.6 IL-2: The lot number and expiration date were recorded.

[0339] Transfer IL-2 stock solution to the medium. In the BSC, transfer 1.0 mL of IL-2 stock solution to the prepared bottle of CM1 day 0 medium. Transfer one bottle of CM1 day 0 medium and IL-2 (6x10 6 IU / mL) 1.0 mL was added.

[0340] G-REX100MCS was passed through the BSC. G-REX100MCS (W3013130) was passed through the BSC under sterile conditions.

[0341] All complete CM1 day 0 media was pumped into G-REX100MCS flasks. Tissue fragment conical or GRex100MCS.

[0342] Preparation of tumor wash medium. In a BSC, 5.0 mL of gentamicin (W3009832 or W3012735) was added to 1 x 500 mL bottle of HBSS medium (W3013128). Add per bottle: HBSS (500.0 mL), gentamicin sulfate 50 mg / mL (5.0 mL). Filter the prepared HBSS containing gentamicin through a 1 L 0.22 micron filter unit (W1218810).

[0343] Prepare a conical tube. Transfer the tumor fragments to a 50 mL conical tube. Prepare a BSC for the G-REX100MCS. Remove the G-REX100MCS from the incubator. Aseptically pass the G-REX100MCS flask into the BSC. Add the tumor fragments to the G-REX100MCS flask. Distribute the fragments evenly.

[0344] Incubate the G-REX100MCS at the following parameters: Incubated G-REX flask: Temperature LED display: 37.0±2.0°C, CO2 percentage: 5.0±1.5% CO2.

[0345] The pre-REP step was performed by culturing 50 or fewer tumor fragments in G-REX-100MCS flasks for 6–9 days in the presence of CM1 with 6000 IU / mL of IL-2.

[0346] After the process was complete, any remaining warmed medium was discarded and an aliquot of IL-2 was thawed.

[0347] TIL collection. Pretreatment table. Incubator parameters: Temperature LED display: 37.0±2.0℃, CO2 percentage: 5.0±1.5% CO2. The G-REX100MCS was removed from the incubator. A 300mL transfer pack was prepared. The transfer pack was welded to the G-REX100MCS.

[0348] To prepare the flask for TIL harvest and initiate TIL harvest: Using a GatheRex, the cell suspension was transferred through a blood filter into a 300 mL transfer pack. The membrane was inspected for attached cells.

[0349] Rinse flask membrane. Close clamps on G-REX100MCS. Ensure all clamps are closed. Heat seal TIL and "supernatant" transfer packs. Calculate volume of TIL suspension. Prepare supernatant transfer pack for sampling.

[0350] The TILs were incubated. The TIL transfer pack was placed in the incubator until needed. Cell counts and calculations were performed. The average viable cell concentration and viability of the cell counts performed was determined. Viability ÷ 2. Viable cell concentration ÷ 2. Upper and lower number limits were determined. Lower limit: average viable cell concentration x 0.9. Upper limit: average viable cell concentration x 1.1. Both counts were confirmed to be within the acceptable range. The average viable cell concentration was determined from all four counts performed.

[0351] The procedure for obtaining cell and viability counts used a Nexcelom Cellometer K2 or equivalent cell counter.

[0352] Adjust the volume of the TIL suspension: The adjusted volume of the TIL suspension after removing the cell count sample was calculated. Total TIL cell volume (A). Volume of the removed cell count sample (4.0 mL) (B). Adjusted total TIL cell volume C = AB.

[0353] Calculate total viable TIL cells. Average viable cell concentration*: total volume, total viable cells: C = A x B.

[0354] Electroporation of pre-rep TIL products Pre-REP TIL products were thawed and resuspended at 1e6 / mL in CM1 containing 6000 IU / mL IL-2. 3e6 TILs were seeded into GREX 24-well plates.

[0355] TILs were activated on different days (day 0, 3, 5, 7) with GMP TransAct™ (Miltenyi Biotec) at a dilution of 1:17.5. Plates were incubated at 37°C until day 9. Activated TILs were matched to >14e6 viable cells, pelleted, and resuspended at 50e6 / mL in electroporation medium T.

[0356] PD-1 TALEN mRNA was prepared according to the following conditions.

[0357] [Table 18]

[0358] A 24-well plate was prepared with 2 mL of CM1 + 1000 IU / mL IL-2 per well and maintained at 30°C for at least 30 minutes before the start of electroporation. The BTX electroporator was set up to run the following protocol:

[0359] [Table 19]

[0360] TILs were electroporated with PD-1 TAL on day 9, incubated overnight at 30°C, then incubated in CM1 containing 1000 IU / mL IL-2 at 37°C for 2 days (total incubation time of 3 days), and then electroporated again with PD-1 TAL. For the second electroporation, PD-1 TAL mRNA was prepared according to the following conditions.

[0361] [Table 20]

[0362] After electroporation, cells were incubated overnight in CM1 containing 1,000 IU / mL IL-2 at 30° C. Simultaneously or sequentially electroporated TILs were incubated overnight at 30° C. in CM1 containing 1,000 IU / mL IL-2 and then underwent a rapid expansion process (REP) using 3 mL of CM2, 3,000 IU / mL IL-2, 30 ng / mL OKT3, and 30e6 feeders per well of a GREX 24-well plate.

[0363] Preparation of feeder cells. REP of TILs requires gamma-irradiated peripheral mononuclear cells (PBMCs). Feeder cells were prepared from leukapheresis of whole blood collected from individual donors. The leukapheresis product was centrifuged over Ficoll-Hypaque, washed, irradiated, and stored frozen under GMP conditions.

[0364] On day 5 of REP, 5 mL of CM4 + 3000 IU / mL of IL-2 was added to each well. TILs were harvested after 10 days of REP.

[0365] result Figures 4A-4C show cell growth after stimulation on different days (Figure 4A), the first electroporation PD-1 KO efficiency (Figure 4B), and the second electroporation PD-1 KO efficiency (Figure 4C). KO target expression was measured by flow cytometry after overnight stimulation of cells with aCD3 / aCD28 beads (1:5 ratio, beads:cells). KO efficiency was calculated by subtracting the expression of the KO target in TALEN cells from the expression of the KO target in mock cells (cells that underwent mock electroporation and no RNA was present), and dividing by the expression of the KO target in mock cells. ((Mock - TALEN) / (Mock)) * 100 = % KO efficiency.

[0366] FIG. 5 shows the percentage of TIL growth over a 3-day rest period with stimulation on different days (day 0, day 3, day 5, day 7).

[0367] Example 4: Ordering of PD1 and TIGIT TALEN electroporation method Pre-REP TIL lines (N=2) from different indications (head and neck and breast) were thawed, resuspended in 6.6 mL of CM1 containing 3000 IU / mL of IL-2, and seeded into GREX 24-well plates.

[0368] TILs were activated with GMP TransAct at a dilution of 1:17.5 on days 0 and 2 to simulate a 2- or 4-day activation period before the first electroporation. Plates were incubated at 37°C until day 4.

[0369] TIGIT and PD-1 TALEN mRNA were prepared according to the following conditions.

[0370] [Table 21]

[0371] A 24-well plate was prepared with 2 mL of CM1 + 1000 IU / mL IL-2 per well and maintained at 30°C for at least 30 minutes before the start of electroporation. The BTX electroporator was set up to run the following protocol:

[0372] [Table 22]

[0373] On day 4, cells were electroporated with PD-1 or TIGIT TAL, incubated overnight at 30°C, then incubated in CM1 containing 1,000 IU / mL IL-2 at 37°C for 2 days (total incubation time of 3 days), and then electroporated again with TIGIT or PD-1 TAL to determine the order of electroporation and stimulation time to maximize both PD-1 and TIGIT KO efficiency.

[0374] After electroporation, cells were incubated overnight at 30°C in CM1 containing 1,000 IU / mL IL-2. Simultaneously or sequentially electroporated TILs were incubated overnight at 30°C in CM1 containing 1,000 IU / mL IL-2, and then subjected to REP using 3 mL of CM2, 3,000 IU / mL IL-2, 30 ng / mL OKT3, and 30e6 feeders per well of a GREX 24-well plate. On day 5 of REP, 5 mL of CM4 + 3,000 IU / mL IL-2 was added to each well. TILs were harvested after 10 days of REP.

[0375] result Figures 6A and 6B show the PD-1 and TIGIT KO efficiencies in total CD3+ TILs after 4 and 2 days of stimulation. Figures 7A and 7B show the PD-1 and TIGIT KO efficiencies in total CD8+ TILs after 4 and 2 days of stimulation. Figures 8A and 8B show the PD-1 and TIGIT KO efficiencies in total CD4+ TILs after 4 and 2 days of stimulation. Figures 9A-9D show the frequency of PD-1 and TIGIT expression in CD3+ TILs. KO target expression was measured by flow cytometry after overnight stimulation of cells with aCD3 / aCD28 beads (1:5 ratio, beads:cells). KO efficiency was calculated by subtracting the expression of the KO target in TALEN cells from the expression of the KO target in mock cells (cells mock-electroporated and without RNA), and dividing by the expression of the KO target in mock cells. ((Mock - TALEN) / (Mock)) * 100 = % KO efficiency.

[0376] Example 5: Titration of PD-1 and TIGIT TALEN mRNA method Tumor samples from different indications (kidney, lung, and melanoma) were cut into 3 mm fragments and incubated in CM1 with 6000 IU / ml IL-2 at 37° C. On day 7, a 1:17.5 dilution of TransAct was added to the TILs to start the stimulation process.

[0377] On day 9, 5e6 TILs were resuspended in 250ul of thermoelectroporation buffer and electroporated with PD-1 or TIGIT TALEN mRNA at concentrations of 1ug / 1e6 cells, 2ug / 1e6 cells, 3ug / 1e6 cells, 4ug / 1e6 cells, or 8ug / 1e6 cells. TILs were electroporated using a Neon (ThermoFisher) at 2300V, 2ms, 3 pulses. On day 12, after a 3-day rest period, TILs were again electroporated with PD-1 or TIGIT TALEN mRNA, followed by an overnight rest period.

[0378] On day 13, 2e5 TILs were subjected to REP using 10 mL of CM2, 3000 IU / mL IL-2, 30 ng / mL OKT3, and 10e6 iPBMCs. On day 5 of REP, 80 mL of CM4 was added to each well. TILs were harvested 9 or 11 days after REP (day 22 or 24).

[0379] result Figures 11A-11C show cell recovery after electroporation of different concentrations of PD-1 TALEN mRNA and incubation for 3 days. Figures 12A-12C show cell viability after electroporation of different concentrations of PD-1 TALEN mRNA and incubation for 3 days. A: harvested on D22, B: harvested on D24.

[0380] Figures 13A-13C show the cell doublings in REP (D22 and D24) after electroporation of different concentrations of PD-1 TALEN mRNA and resting for 3 days. Figures 14A-14C show the extrapolated total viable cells in REP (D22 and D24) after electroporation of different concentrations of PD-1 TALEN mRNA and resting for 3 days.

[0381] Figures 15A-15C show the median PD-1 KO efficiency after electroporation of different concentrations of PD-1 TALEN mRNA and incubation for 3 days. Figures 16A-16C show the final PD-1 KO efficiency after electroporation of different concentrations of PD-1 TALEN mRNA and incubation for 3 days. A: harvested on D22, B: harvested on D24. KO target expression was measured by flow cytometry after overnight stimulation of cells with aCD3 / aCD28 beads (1:5 ratio, beads:cells). KO efficiency was calculated by subtracting the expression of the KO target in TALEN cells from the expression of the KO target in mock cells (cells subjected to mock electroporation and no RNA present), and dividing by the expression of the KO target in mock cells. ((Mock - TALEN) / (Mock)) * 100 = % KO efficiency.

[0382] Figures 17A to 17C show cell recovery after electroporation of different concentrations of TIGIT TALEN mRNA and leaving it for 3 days. Figures 18A to 18C show cell viability after electroporation of different concentrations of TIGIT TALEN mRNA and leaving it for 3 days. A: D22 harvest, B: D24 harvest.

[0383] Figures 19A-19C show the cell doubling numbers in REP (D22 and D24) after electroporation of different concentrations of TIGIT TALEN mRNA and resting for 3 days. Figures 20A-20C show the extrapolated total viable cells in REP (D22 and D24) after electroporation of different concentrations of TIGIT TALEN mRNA and resting for 3 days.

[0384] Figure 21 shows the median TIGIT KO efficiency after electroporation of different concentrations of TIGIT TALEN mRNA and incubation for 3 days. Figures 22A-22C show the final TIGIT KO efficiency after electroporation of different concentrations of TIGIT TALEN mRNA and incubation for 3 days. A: D22 harvest; B: D24 harvest. KO target expression was measured by flow cytometry after overnight stimulation of cells with aCD3 / aCD28 beads (1:5 ratio, beads:cells). KO efficiency was calculated by subtracting the expression of the KO target in TALEN cells from the expression of the KO target in mock cells (cells subjected to mock electroporation and no RNA present), and dividing by the expression of the KO target in mock cells. ((Mock - TALEN) / (Mock)) * 100 = % KO efficiency.

[0385] Example 6: Scale-up process of PD-1 TIGIT DKO TILs using 1 / 5 mock electroporation method Tumor samples are received in HypoThemosol approximately 24-96 hours after resection. After fragmentation, the small bioburden sample is removed in transport medium, and the remaining fragments are transferred to a G-Rex 100MCS containing 1 L of CM1 and 6000 IU / mL of IL-2.

[0386] On day 7, the volume is reduced to approximately 100 mL, followed by addition of TransAct directly to the G-Rex100MCS.

[0387] On day 9, the volume was reduced again for electroporation using a Neon electroporator (ThermoFisher) at 2300V, 2ms, and 3 pulses. The TILs were initially divided into two groups: one containing approximately 80% of the cultured cells (TALEN group). This group was electroporated with PD-1 TALEN mRNA at a concentration of 2ug / 1e6 cells. The second group of TILs (mock group), containing approximately 20% of the cultured cells, was subjected to a "mock" electroporation in the absence of RNA.

[0388] On day 12, after a 3-day resting period, TILs in the TALEN group are subjected to electroporation with TIGIT TALEN mRNA at a concentration of 2ug / 1e6 cells, and TILs in the mock group are subjected to mock electroporation followed by an overnight resting period.

[0389] On day 13, seed 4-10e6 TILs from the TALEN and mock groups into G-REX100MCS flasks containing 1 L of CM2, 3000 IU / mL of IL-2, 30 ng / mL of OKT3, and 10e9 iPBMCs per flask.

[0390] On day 18, the entire 1 L sample is transferred from the G-Rex100MCS to a G-Rex500MCS. The total volume is brought up to 5 L with CM4. Cells are harvested on day 22 or 24.

[0391] 23A and 23B show an exemplary process flow for this scaled-up expansion method.

[0392] Example 7: M1152 PDX TALEN Mouse Study Forty NOG hIL-2 female mice were randomized and injected with 1e6 cells of IOVM053119 (a patient-derived melanoma cell line - passage 4). On day 7, tumor measurements were initiated twice weekly with 3-5 days between measurements. Most tumors were between 20-30 mm. 2 Adoptive transfer was performed on day 19, when the cells reached a size of 10e6. For injection, cells were resuspended at 50e6 / mL in PBS. Mice were randomized into groups A-C to receive 10e6 TILs.

[0393] Figures 24A and 24B show that adoptive transfer of PD1 / TIGIT dKO TILs resulted in increased tumor control compared to PD1 sKO TILs and mock control TILs.

[0394] FIG. 25 shows similar recovery of TILs 21 days after adoptive transfer between PD1 sKO and PD1 / TIGIT dKO TILs.

[0395] Example 8: TIGIT mRNA titration Pre-REP TIL lines (N=3) from different indications (head and neck, lung, and breast) were thawed, activated (OKT3 plate-bound 300ng / mL), and electroporated in duplicate with various concentrations of TIGIT mRNA TALEN (0.5ug, 1ug, 2ug, 4ug per 1e6 cells). After electroporation, cells were incubated overnight at 30°C in CM1 containing 1,000IU / mL IL-2, followed by REP.

[0396] Figures 26A-26C show that the strongest KO efficiency was observed with the 39233 / 39234 TALEN pair, but overall strong KO efficiency was observed with both TALEN mRNA pairs at concentrations of 2-4 μg / million cells.

[0397] A decrease in TIL viability was observed after electroporation at higher TALEN mRNA concentrations (from over 75% with mock electroporation to less than 70% at 4ug / million cells).

[0398] Example 9: PD-1 and TIGIT mRNA titration Five frozen pre-REP TIL lines (L4376, K7098, K7159, B5031, and M1243) were thawed, activated for 2 or 5 days, and electroporated with various concentrations of PD-1 or TIGIT mRNA TALENs (0.25 μg, 0.5 μg, 1 μg, or 2 μg per 1e6 cells). After electroporation, cells were rested for 1 day before undergoing REP for 9 days (harvested on day 22) or 11 days (harvested on day 24). After harvesting, TILs were measured for post-EP recovery and viability, harvest TVC, and cell doublings. KO efficiency was assessed by flow cytometry and droplet digital PCR (ddPCR).

[0399] Figures 27A-27B show that PD-1 and TIGIT KO efficiencies plateaued at 1-2 ug / 1e6 cells.

[0400] Recovery rates, viability, harvested TVC, and cell doublings were similar across all mRNA concentrations.

[0401] Example 10: Small-scale optimization for PD-1 / TIGIT dKO TIL generation Four tumor specimens (M1248, EP11276, EP11277, T6086) (one melanoma, two ER / PR+, one TNBC) were used in this study.

[0402] On day 0, pre-REP was initiated by processing recently resected patient tumor samples into 3mm fragments and culturing them in CM1. On day 7, TILs were activated for 2 days by adding MACS® GMP T cell TransAct to the tumor fragment cell culture. On day 9, TILs were electroporated with PD-1 mRNA TALEN at 2µg per 1e6 cells or subjected to mock electroporation and left undisturbed for 3 days. On day 12, TILs were electroporated with TIGIT mRNA TALEN at 2µg per 1e6 cells or subjected to mock electroporation. On day 13, TILs were REP'd by co-culturing cells with irradiated PBMCs and anti-CD3 in CM2. On day 18, CM4 was added for scale-up. TILs were harvested on day 22 or 24 and cryopreserved in CS10.

[0403] In-process testing parameters included post-electroporation recovery and viability, harvest TVC, and cell doublings. KO efficiency was assessed by flow cytometry and ddPCR using cryopreserved samples harvested on days 22 and 24 (Table 17, Figure 28). IL-2-independent proliferation assays of PD-1 / TIGIT double KO TILs showed no proliferation (Figure 29).

[0404] [Table 23]

[0405] [Table 24]

[0406] [Table 25]

[0407] [Table 26]

[0408] [Table 27]

[0409] [Table 28]

[0410] Example 11: Exemplary Gen2 process for generating PD-1 TIGIT dKO TILs On day 0, tumor samples are cut into 3 mm pieces and incubated at 37° C. in CM1 with 6000 IU / ml IL-2 in GREX 6-well plates, 8-12 pieces per well.

[0411] On day 7, TransAct at a 1:17.5 dilution is added to the TILs to begin the stimulation process. Incubate at 37°C for 2 days.

[0412] On day 9, 24-well tissue culture plates were filled with 2 mL of CM1 + 1000 IU / mL IL-2 per well for both mock and PD-1 TALENs and kept in a 30°C incubator for at least 30 minutes prior to initiation. 2e6 TILs were resuspended in electrolysis buffer and electroporated with both the left and right arms of PD-1 TALEN mRNA at a concentration of 1 μg / 1e6 cells. TILs were electroporated using a Neon electroporator (ThermoFisher) at 2300 V, 2 ms, 3 pulses, and transferred to a pre-warmed 24-well plate containing CM1 + 1000 IU / mL IL-2.31. Cells were stored overnight at 30°C. Transferred to 37°C and incubated for 2 days.

[0413] On day 12, TILs are electroporated with TIGIT TALEN mRNA at a concentration of 1 ug / 1e6 cells using the same conditions as PD-1 TALEN mRNA, followed by overnight incubation at 30°C.

[0414] On day 13, add 17 mL of CM2 medium, 3000 IU / mL IL-2, 30 ng / mL OKT3, and 25e6 feeders to each well in a GREX 6-well plate. Add 0.1e6 TILs to each well. On day 18, add 17 mL of CM4 medium + 3000 IU / mL IL-2 to each well. TILs are harvested on day 22.

[0415] Example 12: PD-1 LAG3 dKO TILs using co-electroporation Patient tumors (N=6) from different indications (NSCLC, head and neck, ovarian, and breast) were received, fragmented, and subjected to an 11-day pre-REP process. After pre-REP, they were stimulated with plate-bound OKT3 (300 ng / ml) for 2 days, and then 1e6 cells resuspended in T buffer were electroporated with 4 μg / million cells of each of the right-arm or left-arm TALENs in a 1 mm gap electroporation cuvette. After electroporation, the cells were incubated overnight in CM1 medium containing IL-2 at 30°C, followed by REP. Post-REP TILs were stimulated overnight with anti-CD3 / CD28 beads and subsequently FACS-stained to maximize inhibitory receptor expression.

[0416] The PD-1 TALEN sequence is shown in Table 3. The LAG3 TALEN sequence is listed in Table 21.

[0417] Figures 30A and 30B show the single and double KO efficiencies for PD1 and LAG3, respectively. Figures 31A and 31B show the fold expansion and survival observed for LAG3 single and double KO TILs. Figures 32A-32F show the reduction in CD69, CD39, CD127, Eomes, Tbet, and TOX expression in single and double KO TILs. No changes were observed in CD25, CD28, TIM3, and TIGIT expression (data not shown).

[0418] TILs were stimulated overnight with anti-CD3 / CD28 beads, followed by a 5-hour incubation with brefeldin A. Similar levels of IFNγ and TNFα expression were observed in single- and double-KO TILs (Figures 33A-33C).

[0419] For cytotoxicity assessment, TILs were cultured overnight with KILR THP-1 cells. Similar levels of killing activity were observed in single-KO and double-KO TILs (Figure 33D).

[0420] Example 13: PD-1 LAG3 dKO TILs using co-electroporation and sequential electroporation Frozen pre-REP cells (N=2) from different indications (breast and H&N) were thawed. After pre-REP, cells were stimulated with plate-bound OKT3 (300ng / ml) for 2 days, after which 1e6 cells resuspended in T buffer were electroporated with 4ug / million cells of each of the right-arm or left-arm TALENs in a 1mm gap electroporation cuvette. After electroporation, cells were incubated overnight in CM1 medium containing IL-2 at 30°C, followed by REP. Both simultaneous and sequential electroporation processes were tested.

[0421] The PD-1 TALEN sequence is shown in Table 3. The LAG3 TALEN sequence is listed in Table 21.

[0422] Figures 34A-34C show LAG3 and PD1 KO efficiency, fold expansion during REP, and survival rate after REP, respectively.

[0423] Example 14: PD-1 TIGIT dKO and PD-1 LAG3 dKO TILs using simultaneous and sequential electroporation Pre-REP TIL lines (N=2) from different indications (head and neck and breast) were thawed and activated with GMP TransAct 1:17.5 for 2 days before electroporation in either a simultaneous format (2 days post-stimulation) or sequential format (2 days post-stimulation, then again after 3 days of rest).

[0424] PD-1 was knocked out during the first electroporation step (2 days after stimulation), and TIGIT or LAG3 was knocked out during the second electroporation step (after 3 days of rest). PD-1 and TIGIT were also knocked out individually to compare single knockout efficiency with dKO efficiency. Cells were then purified, activated with CD3 / CD28 beads, and stained to determine knockout efficiency.

[0425] PD-1 TALEN sequences are listed in Table 3. TIGIT TALEN sequences are listed in Table 4.

[0426] Figures 35A to 35C show the KO efficiency of PD-1, TIGIT, and LAG3, respectively.

[0427] Example 15: PD-1 TIGIT On / Off Target mRNA Titration Detailed protocol (for experiment #10) Pre-REP TILs were thawed and counted. TILs were activated for 2 days using 5 mL of GMP TransAct (Miltenyi Biotec, catalog number 170-076-156) in 100 mL of CM1. After activation, TILs were counted and split between electroporation conditions (below). TILs were washed once with PBS and once with CTS™ Xenon™ Genome Editing Buffer (Thermo Fisher, catalog number A4998001). TILs were resuspended in CTS™ Xenon™ Genome Editing Buffer and TALEN mRNA (volumes based on the conditions below, total volume 1 mL). Each condition was transferred to a CTS Xenon SingleShot Electroporation Chamber (Thermo Fisher, catalog number A50305) and electroporated using a Xenon electroporator with settings of 2300 V, 2 ms pulse width, and 3 pulses. TILs were placed in CM2 overnight at 30°C. REPs were set up after overnight settling using 50e6 iPBMCs per condition, 30ng / ml MACS® GMP CD3 Pure (Miltenyi Biotec, Cat. No. 170-076-116), 4e5 TILs, and 100ml CM2. After 5 days, samples were split and scaled up by adding CM4 (100mL total). TILs were harvested after 4 days and frozen in CS10.

[0428] For small-scale and full-scale runs, PD-1 and TIGIT TALEN mRNA were added at 2ug / 1e6 cells. In experiments #6-9, thawed REP TILs (as opposed to thawed pre-REP TILs) were used for electroporation.

[0429] PD-1 TALEN sequences are listed in Table 3. TIGIT TALEN sequences are listed in Table 4. Detailed protocol (for experiment #10) Day 0 - Thawing and Activation 1) Frozen pre-REP vials (D11) TILs were thawed in warm CM1 and counted. 2) Cells were transferred to a Grex100M flask in 100 mL of CM1. 3) One bottle of TransAct (5 mL) was added to the flask. 4) The flasks were placed in an incubator for stimulation at 37°C for 2 days. Day 2 - PD-1 electroporation 1) Cells were harvested from the flask by resuspending the cell suspension and passing it through a 70 μm cell strainer into a 250 mL conical tube. 2) Cell counting was performed 3) The samples were divided into the following conditions, each in a 50 ml conical tube:

[0430] [Table 29]

[0431] [Table 30-1] [Table 30-2] 4) The cells were washed with PBS and centrifuged at 400g for 5 minutes. 5) The cells were washed with 10 mL of CTS™ Xenon™ Genome Editing Buffer (Thermo Fisher, Cat. No. A4998001) and centrifuged at 400 g for 5 minutes. 6) Cells were resuspended in CTS™ Xenon™ genome editing buffer and mRNA (1 mL total) and electroporated using a Xenon electroporator with settings of 2300V, 2 ms pulse width, and 3 pulses. 7) The cells were incubated overnight in CM2 at 30°C. Day 3 - REP 1) Cells were collected and counted 2) 4e5 TILs were seeded in 100 mL of CM2 in GREX 6-well plates (1 well per condition) 3) 50e6 iPBMCs + 30ng / ml OKT3 were added to each well 4) Cells were incubated at 37°C. Day 8 - Scale-up 1) Reduce the volume of each well by approximately 80 mL 2) Each well was resuspended and transferred to a 50 ml conical tube. 3) Half of the sample was re-seeded onto a Grex 6-well plate. 4) CM4 was added to each well to a total volume of 100 mL. Day 12 - Harvest 1) Reduce the volume of each well by approximately 80 mL 2) Each well was resuspended and transferred to a 50 ml conical tube. 1) Cell counting was performed 2) Cells were frozen at approximately 10e6 cells / ml in 1 ml of CS10.

[0432] DNA sequencing DNA was isolated from the collected TILs using the QIAamp DNA Blood Mini Kit (Qiagen, Catalog No. 51106), followed by library preparation for next-generation sequencing using the CleanPlex Custom Panel Kit (Paragon Genomics, Catalog No. 937001). All DNA samples were sequenced on an Illumina NextSeq2000 using either the Illumina NextSeq1000 / 2000 P1 Reagent-300 Cycle (Illumina, Catalog No. 20050264) or the NextSeq1000 / 2000 P2 Reagent-300 Cycle (Illumina, Catalog No. 20046813) with paired-end 2 × 150 bp reads.

[0433] Sequencing analysis Targeted DNA sequencing analysis was performed using the R package ampliCan1 (v1.22.1). Local alignment of fastq reads to the expected amplicon sequence was performed using the amplicanAlign function with default parameters. Alignment events observed in overlapping primers or primer-dimer infected reads were filtered out. Insertions and deletions (indels) were then quantified for each sample. Further analysis was performed via custom Python scripts to further summarize and normalize the data. TALEN-associated editing in each target region of interest was calculated by subtracting the frequency of indels in the unedited control sample from the signal observed in the TALEN-treated sample.

[0434] The observed on-target and candidate off-target editing in individual samples from various experiments was further analyzed by comparing them with their corresponding mRNA concentrations used for electroporation. Individual values ​​converted to μg mRNA per mL of solution were plotted, and nonlinear regressions were calculated using hyperbolic interpolation in GraphPad Prism. For each curve generated, the inflection point indicates where increasing mRNA concentration does not substantially increase the editing rate. The optimal mRNA concentration maximizes editing of the on-target site and minimizes the signal observed for the candidate off-target site.

[0435] Figure 36 shows PD-1 on-target hyperbolic fit selection. The observed PD-1 editing rates are shown as dots for the corresponding mRNA concentration (µg / mL) of the sample used for electroporation. Nonlinear regression using hyperbolic interpolation was derived for the experimental group and identified as a curve. Recommended examples of mRNA concentrations (µg / mL) are identified by vertical lines at 10µg / mL (green) and 12.5µg / mL (orange dotted line). This finding indicates that the selection of mRNA concentration can be used to optimize the KO efficiency of on-target editing, regardless of cell number.

[0436] Figures 37A-37F show the PD-1 off-target signals of candidates 3, 1, 19, 9, 17, and 4, respectively. The observed editing rates for selected PD-1 candidate off-targets are shown as dots relative to the corresponding mRNA concentration (µg / mL) of the sample used for electroporation. Nonlinear regression using hyperbolic interpolation was performed for the experimental group and identified as a curve. Recommended mRNA concentrations (µg / mL) are identified by the vertical lines at 10 µg / mL (green) and 12.5 µg / mL (orange dotted line). This finding indicates that off-target editing can be minimized using mRNA concentration selection, regardless of cell number.

[0437] Figure 38 shows the TIGIT on-target hyperbolic fit selection. The observed editing rate for TIGIT is shown as a dot for the corresponding mRNA concentration (µg / mL) of the sample used for electroporation. Nonlinear regression using hyperbolic interpolation was derived for the experimental group and identified as a curve. Recommended examples of mRNA concentrations (µg / mL) are identified by the vertical lines at 40µg / mL (green) and 50µg / mL (blue dotted line). This finding identifies that the selection of mRNA concentration can be used to optimize the KO efficiency of on-target editing, regardless of the number of cells.

[0438] Figures 39A-39...

Claims

1. 1. A method for preparing expanded tumor-infiltrating lymphocytes (TILs) with reduced expression of PD-1 and TIGIT, comprising: (a) culturing the first TIL population in a first cell culture medium containing IL-2 for about 5-7 days to produce a second TIL population; (b) activating the second TIL population for about 2-4 days to produce a third TIL population; (c) introducing a first TALE nuclease (TALEN) system that targets a first gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the third TIL population to produce a fourth TIL population; (d) placing the fourth population of TILs in the first cell culture medium containing IL-2 for about 2-3 days; (e) introducing a second TALEN system targeting a second gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the fourth TIL population to produce a fifth TIL population, wherein the first gene and the second gene are different in the fifth TIL population; (f) culturing the fifth TIL population in a second cell culture medium comprising antigen-presenting cells (APCs), OKT-3, and IL-2 for about 7 to 11 days to produce a sixth TIL population having reduced expression of the first gene and the second gene.

2. 10. The method of claim 1, wherein the step of activating the second TIL population is carried out for about 2 days.

3. 10. The method of claim 1, wherein the step of activating the second TIL population is carried out for about 3 days.

4. 10. The method of claim 1, wherein the step of activating the second TIL population is carried out for about 4 days.

5. The method of any one of claims 1 to 4, wherein the step of culturing the first TIL population is carried out for about 5 days.

6. The method of any one of claims 1 to 4, wherein the step of culturing the first TIL population is carried out for about 6 days.

7. The method of any one of claims 1 to 4, wherein the step of culturing the first TIL population is carried out for about 7 days.

8. The method of any one of claims 1 to 7, wherein the step of culturing the fifth TIL population is carried out for about 7 days.

9. The method of any one of claims 1 to 7, wherein the step of culturing the fifth TIL population is carried out for about 8 days.

10. The method of any one of claims 1 to 7, wherein the step of culturing the fifth TIL population is carried out for about 9 days.

11. The method of any one of claims 1 to 7, wherein the step of culturing the fifth TIL population is carried out for about 10 days.

12. The method of any one of claims 1 to 7, wherein the step of culturing the fifth TIL population is carried out for about 11 days.

13. The method of any one of claims 1 to 12, wherein all steps are completed within a period of about 21 days.

14. 13. The method of any one of claims 1 to 12, wherein all steps are completed within a period of about 19 to 22 days.

15. 13. The method of any one of claims 1 to 12, wherein all steps are completed within a period of about 19 to 21 days.

16. The method of any one of claims 1 to 12, wherein all steps are completed within a period of about 20 to 22 days.

17. The method of any one of claims 1 to 16, further comprising an overnight incubation step after introducing the first and / or second TALE nuclease system.

18. The method of any one of claims 1 to 16, further comprising an overnight incubation step after introducing the first TALE nuclease system, and an overnight incubation step after introducing the second TALE nuclease system.

19. The overnight resting step is performed in a temperature range of about 5% CO ２ The method according to claim 17 or 18, wherein the method is carried out at about 28 to 32°C.

20. Step (d) comprises culturing the fourth population of TILs at about 37° C. and about 5% CO ２ 20. The method of any one of claims 1 to 19, comprising incubating with

21. The method of any one of claims 1 to 20, wherein the step of activating the second TIL population is performed using an anti-CD3 agonist and an anti-CD28 agonist.

22. 22. The method of claim 21, wherein the step of activating the second TIL population is performed using TransAct.

23. 23. The method of claim 22, wherein the step of activating the second TIL population is performed using TransAct at a dilution of 1:17.

5.

24. 24. The method of any one of claims 1 to 23, wherein the first TALEN system targets the gene encoding PD-1 and the second TALEN system targets the gene encoding TIGIT.

25. 24. The method of any one of claims 1 to 23, wherein the first TALEN system targets a gene encoding TIGIT and the second TALEN system targets a gene encoding PD-1.

26. 26. The method of Claim 24 or 25, wherein the target sequence of the PD-1-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 18, and the target sequence of the TIGIT-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 23 or 28.

27. 27. The method of any one of claims 1 to 26, wherein the first TALEN system comprises a first half TALE pair targeting the first gene, the second TALEN system comprises a second half TALE pair targeting the second gene, the introducing of the first TALEN system comprises a first electroporation into the third TIL population with a first mRNA pair encoding the first half TALE pair, and / or the introducing of the second TALEN system comprises a second electroporation into the fifth TIL population with a second mRNA pair encoding the second half TALE pair.

28. 28. The method of claim 27, wherein the first half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 15 and 17.

29. 29. The method of claim 27 or 28, wherein the second half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 20 and 22.

30. 29. The method of claim 27 or 28, wherein the second half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 25 and 27.

31. 31. The method of any one of claims 27 to 30, wherein in the first electroporation, the first mRNA pair is introduced at about 1-2 μg of mRNA per million cells of the third TIL population, and / or in the second electroporation, the second mRNA pair is introduced at about 1-2 μg of mRNA per million cells of the fifth TIL population.

32. 32. The method of any one of claims 1-31, wherein step (c) is preceded by washing the third population of TILs in a cytoporation buffer.

33. The method of any one of claims 1 to 32, wherein the first population of TILs is obtained from tumor tissue resected from a patient.

34. 33. The method of any one of claims 1-32, wherein the first population of TILs is obtained from a sample of tumor tissue produced by surgical resection, needle biopsy, core biopsy, mini-biopsy, or other means for obtaining tumor tissue from a patient.

35. 35. The method of any one of claims 1 to 34, further comprising digesting the tumor tissue in an enzymatic medium to produce a tumor digest.

36. 36. The method of claim 35, wherein the enzyme medium comprises DNase.

37. 37. The method of claim 35 or 36, wherein the enzyme medium comprises collagenase.

38. 38. The method of any one of claims 35 to 37, wherein the enzyme medium comprises a neutral protease.

39. The method of any one of claims 35 to 38, wherein the enzyme medium comprises hyaluronidase.

40. 40. The method of any one of claims 1 to 39, wherein the IL-2 concentration is from about 10,000 IU / mL to about 5,000 IU / mL or from about 1000 IU / mL to 5000 IU / mL.

41. 41. The method of any one of claims 1 to 40, wherein one or more of steps (a) to (f) are carried out in a closed system.

42. 42. The method of claim 41, wherein the transition from step (a) to step (b) occurs without opening the system.

43. 43. The method of claim 41 or 42, wherein the transition from step (b) to step (c) occurs without opening the system.

44. 44. The method of any one of claims 41 to 43, wherein the transition from step (c) to step (d) occurs without opening the system.

45. 45. The method of any one of claims 41 to 44, wherein the transition from step (d) to step (e) occurs without opening the system.

46. 46. ​​The method of any one of claims 41 to 45, wherein the transition from step (e) to step (f) occurs without opening the system.

47. The method of any one of claims 1 to 46, wherein the tumor tissue is processed into multiple tumor fragments.

48. 48. The method of claim 47, wherein the multiple tumor fragments are added to the closed system.

49. 49. The method of claim 48, wherein no more than 150 of the plurality of tumor fragments, no more than 100 of the plurality of tumor fragments, or no more than 50 of the plurality of tumor fragments are added to the closed system.

50. 1. A method for preparing expanded tumor-infiltrating lymphocytes (TILs) with reduced expression of PD-1 and TIGIT, comprising: (a) obtaining a first population of TILs from a tumor sample excised from a patient by processing the tumor sample obtained from the patient into a plurality of tumor fragments, or from a tumor sample obtained from the patient by surgical resection, needle biopsy, core biopsy, mini-biopsy, or other means; (b) culturing the first TIL population in a first cell culture medium containing IL-2 for about 5-7 days to produce a second TIL population; (c) activating the second TIL population for about 2-4 days to produce a third TIL population; (d) introducing a first TALE nuclease (TALEN) system that targets a first gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the third TIL population to produce a fourth TIL population; (e) placing the fourth population of TILs in the first cell culture medium containing IL-2 for about 2-3 days; (f) introducing a second TALEN system targeting a second gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the fourth TIL population to produce a fifth TIL population, wherein the first gene and the second gene are different in the fifth TIL population; (g) culturing the fifth TIL population in a second cell culture medium comprising antigen-presenting cells (APCs), OKT-3, and IL-2 for about 7 to 11 days to produce a sixth TIL population having reduced expression of the first gene and the second gene.

51. 51. The method of claim 50, further comprising: (h) harvesting the sixth population of TILs obtained from step (g).

52. 52. The method of claim 51, further comprising: (i) transferring the harvested therapeutic TIL population from step (h) to an infusion bag.

53. 53. The method of claim 52, further comprising: (j) cryopreserving the infusion bag from step (i) using a cryopreservation process.

54. 54. The method of any one of claims 50-53, wherein the step of activating the second TIL population is carried out for about 2 days.

55. 54. The method of any one of claims 50-53, wherein the step of activating the second TIL population is carried out for about 3 days.

56. 54. The method of any one of claims 50-53, wherein the step of activating the second TIL population is carried out for about 4 days.

57. The method of any one of claims 50 to 56, further comprising an overnight incubation step after introducing the first and / or second TALE nuclease system.

58. The method of any one of claims 50 to 56, further comprising an overnight incubation step after introducing the first TALE nuclease system, and an overnight incubation step after introducing the second TALE nuclease system.

59. The overnight resting step is performed in a temperature range of about 5% CO ２ 59. The method of claim 57 or 58, wherein the method is carried out at about 28 to 32°C.

60. Step (e) comprises culturing the fourth population of TILs at about 37° C. and about 5% CO ２ 60. The method of any one of claims 50 to 59, comprising incubating with

61. 61. The method of any one of claims 50 to 60, wherein the step of activating the second TIL population is performed using an anti-CD3 agonist and an anti-CD28 agonist.

62. 62. The method of claim 61, wherein the step of activating the second TIL population is performed using TransAct.

63. 63. The method of claim 62, wherein the step of activating the second TIL population is performed using TransAct at a dilution of 1:17.

5.

64. 64. The method of any one of claims 50-63, wherein the first TALEN system targets the gene encoding PD-1 and the second TALEN system targets the gene encoding TIGIT.

65. 64. The method of any one of claims 50-63, wherein the first TALEN system targets the gene encoding TIGIT and the second TALEN system targets the gene encoding PD-1.

66. 66. The method of Claim 64 or 65, wherein the target sequence of said PD-1-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 18, and the target sequence of said TIGIT-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 23 or 28.

67. 67. The method of any one of claims 50-66, wherein the first TALEN system comprises a first half TALE pair targeting the first gene, the second TALEN system comprises a second half TALE pair targeting the second gene, said introducing of the first TALEN system comprises a first electroporation into the third TIL population with a first mRNA pair encoding the first half TALE pair, and / or said introducing of the second TALEN system comprises a second electroporation into the fifth TIL population with a second mRNA pair encoding the second half TALE pair.

68. 68. The method of claim 67, wherein the first half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 15 and 17.

69. 69. The method of claim 67 or 68, wherein the second half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 20 and 22.

70. 69. The method of claim 67 or 68, wherein the second half TALE pair comprises the amino acid sequences of SEQ ID NOs: 25 and 27.

71. 71. The method of any one of claims 67 to 70, wherein in the first electroporation, the first mRNA pair is introduced at about 1-2 μg of mRNA per million cells of the third TIL population, and / or in the second electroporation, the second mRNA pair is introduced at about 1-2 μg of mRNA per million cells of the fifth TIL population.

72. 72. The method of any one of claims 50-71, wherein step (d) is preceded by washing the third population of TILs in a cytoporation buffer.

73. 73. The method of any one of claims 50 to 72, wherein the IL-2 concentration is from about 10,000 IU / mL to about 5,000 IU / mL or from about 1000 IU / mL to 5000 IU / mL.

74. 74. The method of any one of claims 50 to 73, wherein one or more of steps (b) to (g) are carried out in a closed system.

75. 75. The method of claim 74, wherein the transition from step (b) to step (c) occurs without opening the system.

76. 76. The method of claim 74 or 75, wherein the transition from step (c) to step (d) occurs without opening the system.

77. 77. The method of any one of claims 74 to 76, wherein the transition from step (d) to step (e) occurs without opening the system.

78. 78. The method of any one of claims 74 to 77, wherein the transition from step (e) to step (f) occurs without opening the system.

79. 79. The method of any one of claims 74 to 78, wherein the transition from step (f) to step (g) occurs without opening the system.

80. 80. The method of any one of claims 74 to 79, wherein the plurality of tumor fragments are added to the closed system.

81. 81. The method of claim 80, wherein no more than 150 of the plurality of tumor fragments, no more than 100 of the plurality of tumor fragments, or no more than 50 of the plurality of tumor fragments are added to the closed system.

82. 82. A gene-edited tumor-infiltrating lymphocyte (TIL) population comprising an expanded TIL population having reduced expression of the first gene and the second gene produced by the method of any one of claims 1-81.

83. 83. The gene-edited TIL population of Claim 82, wherein about 64% of the expanded TIL population comprises a knockout of both PD-1 and TIGIT.

84. 84. The gene-edited TIL population of Claim 82 or 83, wherein the expanded TIL population comprises a therapeutically effective dose of TILs.

85. The therapeutically effective dose of TILs is about 1 x 10 ９ ~Approx. 1×10 １１ 85. The gene-edited TIL population of Claim 84, comprising TILs.

86. 86. A pharmaceutical composition comprising the gene-edited TIL population of any one of claims 82 to 85 and a pharmaceutically acceptable carrier.

87. 86. A method for treating a cancer patient, comprising administering to the cancer patient a therapeutically effective dose of the gene-edited TIL population of any one of claims 82-85 or the pharmaceutical composition of claim 86.

88. 88. The method of claim 87, wherein the cancer is selected from the group consisting of melanoma, metastatic melanoma, ovarian cancer, cervical cancer, non-small cell lung cancer (NSCLC), metastatic NSCLC, lung cancer, bladder cancer, breast cancer, cancer caused by human papillomavirus, head and neck cancer (including head and neck squamous cell carcinoma (HNSCC)), renal cancer, and renal cell carcinoma.

89. 1. A method for treating a cancer patient, comprising: (a) obtaining a first population of TILs from a tumor sample excised from a cancer patient by processing the tumor sample obtained from the cancer patient into a plurality of tumor fragments, or from a tumor sample obtained from the cancer patient by surgical resection, needle biopsy, core biopsy, mini-biopsy, or other means; (b) culturing the first TIL population in a first cell culture medium containing IL-2 for about 5-7 days to produce a second TIL population; (c) activating the second TIL population for about 2-4 days to produce a third TIL population; (d) introducing a first TALE nuclease (TALEN) system that targets a first gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the third TIL population to produce a fourth TIL population; (e) placing the fourth population of TILs in the first cell culture medium containing IL-2 for about 2-3 days; (f) introducing a second TALEN system targeting a second gene selected from the group consisting of a gene encoding PD-1 and a gene encoding TIGIT into at least a portion of the fourth TIL population to produce a fifth TIL population, wherein the first gene and the second gene are different in the fifth TIL population; (g) culturing the fifth TIL population in a second cell culture medium comprising antigen-presenting cells (APCs), OKT-3, and IL-2 for about 7 to 11 days to produce a sixth TIL population having reduced expression of the first gene and the second gene; (h) administering a therapeutically effective dose of the sixth population of TILs to the cancer patient.

90. 90. The method of claim 89, further comprising harvesting the sixth population of TILs obtained from step (g).

91. 91. The method of claim 90, further comprising transferring the harvested therapeutic TIL population to an infusion bag.

92. 92. The method of claim 91, further comprising cryopreserving the infusion bag using a cryopreservation process.

93. 93. The method of any one of claims 89 to 92, wherein the cancer is selected from the group consisting of melanoma, metastatic melanoma, ovarian cancer, cervical cancer, non-small cell lung cancer (NSCLC), metastatic NSCLC, lung cancer, bladder cancer, breast cancer, cancer caused by human papillomavirus, head and neck cancer (including head and neck squamous cell carcinoma (HNSCC)), renal cancer, and renal cell carcinoma.

94. 94. The method of any one of claims 89-93, wherein the step of activating the second TIL population is carried out for about 2 days.

95. 94. The method of any one of claims 89-93, wherein the step of activating the second TIL population is carried out for about 3 days.

96. 94. The method of any one of claims 89-93, wherein the step of activating the second TIL population is carried out for about 4 days.

97. The method of any one of claims 89 to 96, further comprising an overnight incubation step after introducing the first and / or second TALE nuclease system.

98. The method of any one of claims 89 to 97, further comprising an overnight incubation step after introducing the first TALE nuclease system, and an overnight incubation step after introducing the second TALE nuclease system.

99. The overnight resting step is performed in a temperature range of about 5% CO ２ The method of claim 97 or 98, wherein the method is carried out at about 28 to 32°C.

100. Step (e) comprises culturing the fourth population of TILs at about 37° C. and about 5% CO ２ 99. The method of claim 88, comprising incubating with

101. 101. The method of any one of claims 89 to 100, wherein the step of activating the second TIL population is performed using an anti-CD3 agonist and an anti-CD28 agonist.

102. 102. The method of claim 101, wherein the step of activating the second TIL population is performed using TransAct.

103. 103. The method of claim 102, wherein the step of activating the second TIL population is performed using TransAct at a dilution of 1:17.

5.

104. 104. The method of any one of claims 89-103, wherein the first TALEN system targets the gene encoding PD-1 and the second TALEN system targets the gene encoding TIGIT.

105. 104. The method of any one of claims 89-103, wherein the first TALEN system targets the gene encoding TIGIT and the second TALEN system targets the gene encoding PD-1.

106. 106. The method of Claim 104 or 105, wherein the target sequence of said PD-1-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 18, and wherein the target sequence of said TIGIT-targeting TALEN system comprises the nucleic acid sequence of SEQ ID NO: 23 or 28.

107. 107. The method of any one of claims 89-106, wherein the first TALEN system comprises a first half TALE pair targeting the first gene, the second TALEN system comprises a second half TALE pair targeting the second gene, the introducing of the first TALEN system comprises a first electroporation into the third TIL population with a first mRNA pair encoding the first half TALE pair, and / or the introducing of the second TALEN system comprises a second electroporation into the fifth TIL population with a second mRNA pair encoding the second half TALE pair.

108. 108. The method of claim 107, wherein the first half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 15 and 17.

109. 109. The method of claim 107 or 108, wherein the second half TALE pair comprises the amino acid sequences of SEQ ID NOs: 20 and 22.

110. 109. The method of claim 107 or 108, wherein the second half-TALE pair comprises the amino acid sequences of SEQ ID NOs: 25 and 27.

111. 111. The method of any one of claims 107 to 110, wherein in the first electroporation, the first mRNA pair is introduced at about 2-4 μg of mRNA per million cells of the third TIL population, and / or in the second electroporation, the second mRNA pair is introduced at about 2-4 μg of mRNA per million cells of the fifth TIL population.

112. 112. The method of any one of claims 89-111, wherein step (d) is preceded by washing the third population of TILs in a cytoporation buffer.

113. 113. The method of any one of claims 89 to 112, wherein the IL-2 concentration is from about 10,000 IU / mL to about 5,000 IU / mL or from about 1000 IU / mL to 5000 IU / mL.

114. 114. The method of any one of claims 89 to 113, wherein one or more of steps (b) to (g) are carried out in a closed system.

115. 115. The method of claim 114, wherein the transition from step (b) to step (c) occurs without opening the system.

116. 116. The method of claim 114 or 115, wherein the transition from step (c) to step (d) occurs without opening the system.

117. 117. The method of any one of claims 114 to 116, wherein the transition from step (d) to step (e) occurs without opening the system.

118. 118. The method of any one of claims 114 to 117, wherein the transition from step (e) to step (f) occurs without opening the system.

119. 119. The method of any one of claims 114 to 118, wherein the transition from step (f) to step (g) occurs without opening the system.

120. 120. The method of any one of claims 114 to 119, wherein the multiple tumor fragments are added to the closed system.

121. 121. The method of claim 120, wherein no more than 150 of the plurality of tumor fragments, no more than 100 of the plurality of tumor fragments, or no more than 50 of the plurality of tumor fragments are added to the closed system.

122. 122. The method of any one of claims 89-121, wherein a non-myeloablative lymphodepletion regimen has been administered to the cancer patient prior to administering a therapeutically effective dose of the sixth population of TILs in step (h).

123. 123. The method of any one of claims 89-122, further comprising treating said cancer patient with a high-dose IL-2 regimen starting the day after administering said therapeutically effective dose of said sixth population of TILs to said cancer patient in step (h).

124. 10. The method of any one of the preceding claims, wherein the process is optionally carried out in a closed system.

125. 1. A method for preparing genetically modified tumor infiltrating lymphocytes (TILs) comprising reduced expression of TIGIT, comprising: (a) introducing into said TILs nucleic acid(s) encoding one or more first transcription activator-like effector nucleases (TALE nucleases) capable of selectively inactivating a gene encoding TIGIT by DNA cleavage, wherein said one or more first TALE nucleases comprise a TALE nuclease directed against a nucleic acid sequence of SEQ ID NO: 23 or 28, and optionally introducing one or more second TALE nucleases capable of selectively inactivating a gene encoding PD-1 by DNA cleavage; (b) expanding the TIL.

126. 126. The method of Claim 125, wherein introducing into said TILs nucleic acid(s) encoding said one or more first TALE nucleases comprises an electroporation step.

127. 127. The method of Claim 125 or 126, wherein the nucleic acid(s) encoding the one or more first TALE nucleases are RNA, and the RNA is introduced into the TIL by electroporation.

128. 128. The method of any one of claims 125 to 127, wherein the method further comprises, prior to the introducing step, activating the TILs by culturing the TILs in cell culture medium in the presence of OKT-3 for about 1 to 3 days.

129. 129. The method of any one of claims 125 to 128, wherein the method further comprises, after the introducing step and before the expanding step, allowing the TILs to rest in a cell culture medium containing IL-2 for about 1 day.

130. 130. The method of any one of claims 125 to 129, wherein the method further comprises the steps of cryopreserving the TILs prior to the introducing step, and subsequently thawing the TILs and culturing them in cell culture medium containing IL-2 for about 1 to 3 days.

131. 131. The method of claim 129 or 130, wherein the IL-2 in the standing step is at a concentration of about 3000 IU / ml.

132. The method of any one of claims 125 to 131, wherein the one or more first TALE nucleases are each composed of a first half TALE nuclease and a second half TALE nuclease.

133. 133. The method of claim 132, wherein the first half-TALE nuclease is a first fusion protein comprising a first TALE nucleic acid binding domain fused to a first nuclease catalytic domain, and the second half-TALE nuclease is a second fusion protein comprising a second TALE nucleic acid binding domain fused to a second nuclease catalytic domain.

134. 134. The method of claim 133, wherein the first TALE nucleic acid binding domain has a first amino acid sequence and the second TALE nucleic acid binding domain has a second amino acid sequence, and the first amino acid sequence is different from the second amino acid sequence.

135. 135. The method of claim 133 or 134, wherein the first nuclease catalytic domain has a first amino acid sequence, the second nuclease catalytic domain has a second amino acid sequence, and the first amino acid sequence is the same as the second amino acid sequence.

136. 136. The method of any one of claims 133 to 135, wherein the first nuclease catalytic domain and the second nuclease catalytic domain both have the amino acid sequence of Fok-I.

137. The method of any one of claims 132 to 136, wherein the first half-TALE nuclease and the second half-TALE nuclease form a heterodimeric DNA cleavage complex to perform DNA cleavage at a target site within the gene encoding TIGIT, and the target site within the gene encoding TIGIT comprises the nucleic acid sequence of SEQ ID NO: 23 or 28.

138. The method of any one of claims 132 to 137, wherein the first half-TALE nuclease recognizes a first half target located at a first position of the target site in the gene encoding TIGIT, and the second half-TALE nuclease recognizes a second half target located at a second position of the target site in the gene encoding TIGIT that does not overlap with the first position.

139. 139. The method of any one of claims 125-138, wherein the TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:

27.

140. 140. The method of claim 139, wherein the TALE nuclease comprises a sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:

27.

141. 141. The method of any one of claims 133-140, wherein the first half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO:20, and the second half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO:

22.

142. 142. The method of claim 141, wherein the first half-TALE nuclease comprises the amino acid sequence of SEQ ID NO: 20 and the second half-TALE nuclease comprises the amino acid sequence of SEQ ID NO:

22.

143. 141. The method of any one of claims 133-140, wherein the first half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO:25, and the second half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO:

27.

144. 144. The method of claim 143, wherein the first half-TALE nuclease comprises the amino acid sequence of SEQ ID NO: 25 and the second half-TALE nuclease comprises the amino acid sequence of SEQ ID NO:

27.

145. 145. The method of any of claims 125-144, wherein the expanded TILs comprise sufficient TILs to administer a therapeutically effective dose of the TILs to a subject in need thereof.

146. The therapeutically effective dose of the expanded TILs is about 1 x 10 ９ ~Approx. 9×10 １０ The method of claim 145, comprising TIL.

147. 147. A population of expanded tumor infiltrating lymphocytes (TILs) comprising reduced expression of TIGIT and optionally PD-1, said population of expanded TILs being obtainable by the method of any one of claims 125 to 146.

148. A transcription activator-like effector nuclease (TALE nuclease) that recognizes and affects DNA cleavage at a target site within a gene encoding TIGIT, wherein the target site comprises the nucleic acid sequence of SEQ ID NO: 23 or 28.

149. The TALE nuclease of claim 148, wherein the TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:

27.

150. 150. The TALE nuclease of claim 149, wherein the TALE nuclease comprises a sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:

27.

151. The TALE nuclease of claim 148, wherein the TALE nuclease is composed of a first half-TALE nuclease and a second half-TALE nuclease, wherein the first half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity with SEQ ID NO: 20, and the second half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity with SEQ ID NO:

22.

152. 152. The TALE nuclease of claim 151, wherein the first half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 20 and the second half TALE nuclease comprises the amino acid sequence of SEQ ID NO:

22.

153. The TALE nuclease of claim 148, wherein the TALE nuclease is composed of a first half-TALE nuclease and a second half-TALE nuclease, wherein the first half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 25, and the second half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO:

27.

154. 154. The TALE nuclease of claim 153, wherein the first half TALE nuclease comprises the amino acid sequence of SEQ ID NO: 25 and the second half TALE nuclease comprises the amino acid sequence of SEQ ID NO:

27.

155. 155. The TALE nuclease of any one of claims 151 to 154, wherein the first half-TALE nuclease is a first fusion protein comprised of a first TALE nucleic acid binding domain fused to a first nuclease catalytic domain, and the second half-TALE nuclease is a second fusion protein comprised of a second TALE nucleic acid binding domain fused to a second nuclease catalytic domain.

156. 156. The TALE nuclease of claim 155, wherein the first TALE nucleic acid binding domain has a first amino acid sequence and the second TALE nucleic acid binding domain has a second amino acid sequence, and the first amino acid sequence is different from the second amino acid sequence.

157. 157. The TALE nuclease of claim 155 or 156, wherein the first nuclease catalytic domain has a first amino acid sequence, the second nuclease catalytic domain has a second amino acid sequence, and the first amino acid sequence is the same as the second amino acid sequence.

158. 158. The TALE nuclease of any one of claims 155 to 157, wherein the first nuclease catalytic domain and the second nuclease catalytic domain both have the amino acid sequence of Fok-I.

159. The TALE nuclease of any one of claims 148 to 158, wherein the first half-TALE nuclease and the second half-TALE nuclease form a heterodimeric DNA cleavage complex to effect DNA cleavage at the target site within the gene encoding TIGIT.

160. 160. The TALE nuclease of any one of claims 148 to 159, wherein the first half-TALE nuclease recognizes a first half target located at a first position of the target site in the gene encoding TIGIT, and the second half-TALE nuclease recognizes a second half target located at a second position of the target site in the gene encoding TIGIT that does not overlap with the first position.

161. 161. The TALE nuclease of any one of claims 148 to 160, wherein the TALE nuclease is encoded by a nucleic acid sequence having at least 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24, and SEQ ID NO:

26.

162. 162. The TALE nuclease of claim 161, wherein the TALE nuclease is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24, and SEQ ID NO:

26.

163. The TALE nuclease of claim 161, wherein the TALE nuclease is composed of a first half-TALE nuclease and a second half-TALE nuclease, wherein the first half-TALE nuclease is encoded by a nucleic acid sequence having at least 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 19, and the second half-TALE nuclease is encoded by a nucleic acid sequence having at least 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO:

21.

164. The TALE nuclease of claim 163, wherein the first half TALE nuclease is encoded by the nucleic acid sequence of SEQ ID NO: 20, and the second half TALE nuclease is encoded by the nucleic acid sequence of SEQ ID NO:

22.

165. The TALE nuclease of claim 161, wherein the TALE nuclease is composed of a first half-TALE nuclease and a second half-TALE nuclease, wherein the first half-TALE nuclease is encoded by a nucleic acid sequence having at least 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 24, and the second half-TALE nuclease is encoded by a nucleic acid sequence having at least 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO:

26.

166. The TALE nuclease of claim 165, wherein the first half TALE nuclease is encoded by the amino acid sequence of SEQ ID NO: 24, and the second half TALE nuclease is encoded by the amino acid sequence of SEQ ID NO:

26.

167. 1. A method for expanding genetically modified tumor infiltrating lymphocytes (TILs) into a therapeutic TIL population comprising reduced expression of TIGIT, comprising: (a) obtaining and / or receiving a first population of TILs from a tumor sample; (b) adding the first TIL population to a closed system; (c) performing a first expansion by culturing the first TIL population in a cell culture medium comprising IL-2 to produce a second TIL population, wherein the first expansion is performed in a sealed container that provides a first gas permeable surface area, and the first expansion is performed for about 3 to 14 days to obtain the second TIL population, and the transition from step (b) to step (c) occurs without opening the system; (d) introducing into the TIL a nucleic acid(s) encoding one or more first transcription activator-like effector nucleases (TALE nucleases) capable of selectively inactivating the gene encoding TIGIT by DNA cleavage, wherein the one or more first TALE nucleases comprise a TALE nuclease directed against a target site within the gene encoding TIGIT, the target site comprising the nucleic acid sequence of SEQ ID NO: 23 or 28, and the transition from step (c) to step (d) occurs without opening the system; (e) performing a second expansion of the TILs obtained from step (d) by culturing them in a cell culture medium comprising IL-2, OKT-3, and antigen presenting cells (APCs) to produce a third TIL population, wherein the second expansion is performed for about 7-14 days to obtain the third TIL population, the third TIL population being a therapeutic TIL population, and wherein the second expansion is performed in a sealed container that provides a second gas permeable surface area, and the transition from step (d) to step (e) occurs without opening the system. (f) harvesting the therapeutic TIL population obtained from step (e), wherein the transition from step (e) to step (f) occurs without opening the system.

168. 161. The method of Claim 160, wherein the nucleic acid(s) encoding the one or more first TALE nucleases are RNA.

169. 162. The method of Claim 160 or 161, wherein the nucleic acid(s) encoding the one or more first TALE nucleases are introduced into the TIL by electroporation.

170. The method of any one of claims 160 to 162, wherein the method further comprises, prior to the introducing step, activating the TILs by culturing the TILs in cell culture medium in the presence of OKT-3 for about 1 to 3 days.

171. 164. The method of claim 163, wherein the OKT-3 is at a concentration of about 300 ng / ml.

172. 165. The method of any one of claims 160 to 164, wherein the method further comprises, after the introducing step and before the second expansion step, allowing the TILs to rest in cell culture medium containing IL-2 for about 1 day.

173. 166. The method of claim 165, wherein the IL-2 in the standing step is at a concentration of about 3000 IU / ml.

174. 167. The method of any one of claims 160-166, wherein steps (a) through (f) are carried out for about 13 days to about 29 days, optionally about 15 days, about 16 days, about 17 days, about 18 days, about 19 days, about 20 days, about 21 days, about 22 days, about 23 days, about 24 days, or about 25 days.

175. 168. The method of any one of claims 160-167, wherein the nucleic acid(s) encoding the one or more first TALE nucleases are RNA, and the RNA is introduced into the TIL by electroporation.

176. The method of any one of claims 160 to 168, wherein the one or more first TALE nucleases are each composed of a first half TALE nuclease and a second half TALE nuclease.

177. 170. The method of claim 169, wherein the first half-TALE nuclease is a first fusion protein comprising a first TALE nucleic acid binding domain fused to a first nuclease catalytic domain, and the second half-TALE nuclease is a second fusion protein comprising a second TALE nucleic acid binding domain fused to a second nuclease catalytic domain.

178. 171. The method of claim 170, wherein the first TALE nucleic acid binding domain has a first amino acid sequence and the second TALE nucleic acid binding domain has a second amino acid sequence, and the first amino acid sequence is different from the second amino acid sequence.

179. 172. The method of claim 170 or 171, wherein the first nuclease catalytic domain has a first amino acid sequence, the second nuclease catalytic domain has a second amino acid sequence, and the first amino acid sequence is the same as the second amino acid sequence.

180. 173. The method of any one of claims 170 to 172, wherein the first nuclease catalytic domain and the second nuclease catalytic domain both have the amino acid sequence of Fok-I.

181. 174. The method of any one of claims 170 to 173, wherein the first half-TALE nuclease and the second half-TALE nuclease form a heterodimeric DNA cleavage complex to effect DNA cleavage at the target site.

182. 175. The method of any one of claims 170 to 174, wherein the first half-TALE nuclease recognizes a first half target located at a first position of the target site, and the second half-TALE nuclease recognizes a second half target located at a second position of the target site that does not overlap with the first position.

183. 176. The method of claim 175, wherein the TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:

27.

184. 177. The method of claim 176, wherein the TALE nuclease comprises a sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:

27.

185. 177. The method of claim 176, wherein the first half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO: 20, and the second half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO:

22.

186. 177. The method of claim 176, wherein the first half-TALE nuclease comprises the amino acid sequence of SEQ ID NO: 20 and the second half-TALE nuclease comprises the amino acid sequence of SEQ ID NO:

22.

187. 177. The method of claim 176, wherein the first half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO:25, and the second half-TALE nuclease comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, 98%, or 99% sequence identity to SEQ ID NO:

27.

188. 177. The method of claim 176, wherein the first half-TALE nuclease comprises the amino acid sequence of SEQ ID NO: 25 and the second half-TALE nuclease comprises the amino acid sequence of SEQ ID NO:

27.

189. 182. The method of any one of claims 160-181, wherein the harvested TILs comprise sufficient TILs to administer a therapeutically effective dose of the TILs to a subject in need thereof.

190. The therapeutically effective dose of the TILs is about 1 x 10 ９ ~Approx. 9×10 １０ 183. The method of claim 182, comprising TIL.

Images