Antibody-resistant engineered receptors for enhancing cell-based therapies

Abstract

Methods for improving donor cell engraftment in a subject are provided. Such methods may include providing donor cells that have been modified to express a first isoform of a target protein (e.g., interleukin-2 receptor subunit gamma (IL2RG)) that is functionally indistinguishable but immunologically distinguishable from a second isoform of the target protein, administering the donor cells to the subject, and then selectively inhibiting host cells in the subject based on the expression of the second isoform of the target protein, thereby improving donor cell engraftment in the subject. Also provided are combinations for administration to a subject in need thereof.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Application No. 63 / 377,444, filed September 28, 2022, and U.S. Application No. 63 / 578,729, filed August 25, 2023, each of which is incorporated by reference herein in its entirety for all purposes.

[0002] Reference to a sequence listing submitted as an XML file via EFS WEB The sequence listing set forth in file 602716SEQLIST.xml is 163 kilobytes, was created on September 27, 2023, and is incorporated herein by reference. [Background technology]

[0003] background Host conditioning is an essential step before transplantation or adoptive cell therapy, in which immunosuppressants are administered to the transplant recipient to support the uptake of donor transplant cells. Conditioning treatments serve several important purposes, including clearing niche space for transplanted immune cells, suppressing allograft rejection, and depleting or reducing diseased cells (e.g., hematological and solid tumors or defective immune cells). However, standard of care agents for pre-transplant conditioning and post-transplant immunosuppression are genotoxic drugs that cause damage to multiple tissues, render patients highly immunocompromised, and may induce secondary malignancies, thus excluding many patients from potentially curative transplant treatments.

[0004] Non-genotoxic lymphosuppressive agents, such as monoclonal antibodies that target lymphocytes, are alternative conditioning treatments. However, a drawback to using lymphosuppressive agents as conditioning therapies is that transplanted cells are susceptible to their effects in addition to the target host cells. Summary of the Invention [Means for solving the problem]

[0005] overview Methods for improving donor cell engraftment in a subject in need thereof are provided. Also provided are combinations or combined pharmaceuticals for administration to a subject in need thereof. Also provided are isolated cells or cell populations modified to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is different from a second isoform of IL2RG. Also provided are methods for producing the isolated cells or cell populations. Also provided are genetically engineered interleukin-2 receptor subunit gamma (IL2RG) proteins and nucleic acids encoding the proteins.

[0006] Methods for improving donor cell engraftment in a subject in need thereof are provided. Some such methods include: (a) providing donor cells that have been modified to express a first isoform of a target protein, where the target protein is a protein expressed on the cell surface of a hematopoietic cell, the first isoform of the target protein being different from a second isoform of the target protein, and the second isoform is expressed in host cells of the subject; (b) administering the donor cells to the subject; and (c) selectively inhibiting host cells in the subject based on the expression of the second isoform of the target protein, thereby improving donor cell engraftment in the subject.

[0007] In some such methods, the target protein is a receptor. In some such methods, the target protein is a cytokine receptor or a chemokine receptor, and optionally, the target protein is a cytokine receptor. In some such methods, the target protein is a protein expressed on the cell surface of a lymphocyte. In some such methods, the target protein is a cytokine receptor subunit of the interleukin-2 (IL-2) receptor, IL-4 receptor, IL-7 receptor, IL-9 receptor, IL-15 receptor, or IL-21 receptor. In some such methods, the target protein is interleukin-2 receptor subunit gamma (IL2RG).

[0008] In some such methods, the selective inhibition of host cells in step (c) does not include ablation of host cells or ablation of host cells by an active killing mechanism. In some such methods, the selective inhibition in step (c) includes (1) blocking host cell growth to provide a competitive growth advantage to the donor cells, (2) blocking host cell localization or trafficking to provide a competitive homing advantage to the donor cells, (3) blocking host cell cell-cell interaction or adhesion to provide a competitive tissue invasion advantage to the donor cells, or (4) blocking immune cell activation in the host cells to provide a competitive advantage to the donor cells. In some such methods, the selective inhibition in step (c) includes blocking host cell growth (i.e., blocking proliferation) and / or blocking immune cell activation in the host cells to provide a competitive growth advantage to the donor cells.

[0009] In some of such methods, the first isoform and the second isoform are functionally indistinguishable but immunologically distinguishable.In some of such methods, donor cells express both the first isoform of target protein and the second isoform of target protein.In some of such methods, donor cells only express the first isoform of target protein.

[0010] In some such methods, the first isoform of the target protein is expressed from an expression vector in the donor cell. In some such methods, the genomic locus is edited to express the first isoform of the target protein in the donor cell. In some such methods, the genomic locus is an endogenous genomic locus encoding the target protein, optionally the target protein is IL2RG and the genomic locus is the IL2RG genomic locus. In some such methods, the genomic locus is not an endogenous genomic locus encoding the target protein, optionally the target protein is IL2RG and the genomic locus is not the IL2RG genomic locus.

[0011] In some such methods, the first isoform of the target protein is a genetically engineered isoform of the target protein. In some such methods, the first isoform of the target protein is genetically engineered to include a mutation that provides an altered epitope, and optionally, the mutation is an artificial mutation. In some such methods, the altered epitope is the binding region of a target protein antagonist (e.g., an antigen-binding protein), such that the target protein antagonist exhibits reduced or lost ability to bind to and / or inhibit the first isoform of the target protein (e.g., compared to its ability to bind to and / or inhibit the second isoform of the target protein). In some such methods, both the first isoform of the target protein and the second isoform of the target protein retain the ability to bind to endogenous ligands, and optionally, the target protein antagonist (e.g., an antigen-binding protein) blocks the binding of the endogenous ligand to the second isoform of the target protein but does not block the binding to the first isoform of the target protein.

[0012] In some such methods, the target protein is IL2RG, the altered epitope is in the binding region of a target protein antagonist, and the target protein antagonist is an antibody comprising an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such methods, the target protein is IL2RG and the mutation comprises a mutation encoded by nucleotides within exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus. In some such methods, the target protein is IL2RG and the mutation comprises a mutation or substitution within the region from positions T127 to N150 and / or within the region from positions L87 to D97. In some such methods, the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, and / or K147. In some such methods, the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145, optionally wherein the substitution is an M145K, M145D, M145E, M145P, M145W, or M145Y substitution. In some such methods, the target protein is IL2RG and the mutation comprises an M145K substitution. In some such methods, the target protein is IL2RG and the mutation comprises a mutation or substitution at position W90, optionally a W90V, W90R, W90Q, W90L, W90K, W90E, or W90D substitution, optionally a W90Q substitution. In some such methods, the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

[0013] In some such methods, the selective inhibition in step (c) comprises administering a target protein antagonist to the subject, wherein the target protein antagonist specifically binds to the second isoform of the target protein but not to the first isoform of the target protein, and optionally, step (c) comprises multiple administrations of the target protein antagonist. In some such methods, the target protein antagonist is an antigen-binding protein. In some such methods, the antigen-binding protein is an antibody or an antigen-binding fragment thereof.

[0014] In some such methods, the target protein is IL2RG and the antigen binding protein comprises an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such methods, the three light chain CDRs comprise, consist essentially of, or consist of sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such methods, the target protein is IL2RG and the antigen binding protein comprises an immunoglobulin light chain variable region comprising, consisting essentially of, or consisting of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 10, and the antigen binding protein comprises an immunoglobulin heavy chain variable region comprising, consisting essentially of, or consisting of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 2. In some such methods, the target protein is IL2RG and the immunoglobulin light chain variable region comprises, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain variable region comprises, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 2. In some such methods, the target protein is IL2RG and the antigen binding protein comprises an immunoglobulin light chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 20, and the antigen binding protein comprises an immunoglobulin heavy chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 18.

[0015] In some such methods, the donor and / or host cells are hematopoietic cells. In some such methods, the donor and / or host cells are immune cells. In some such methods, the donor and / or host cells are lymphocytes or lymphoid progenitor cells. In some such methods, the donor and / or host cells are T cells. In some such methods, the donor and / or host cells are tumor-infiltrating lymphocytes (TILs). In some such methods, the donor and / or host cells are B cells. In some such methods, the donor and / or host cells are NK cells. In some such methods, the donor and / or host cells are hematopoietic stem and progenitor cells. In some such methods, the donor and / or host cells are derived from hematopoietic stem cells or hematopoietic stem and progenitor cells. In some such methods, the donor cells are derived from induced pluripotent stem cells. In some such methods, the subject is a mammal or a non-human mammal and the donor cells are mammalian cells or non-human mammalian cells. In some such methods, the subject is a human and the donor cells are human cells.

[0016] In some such methods, the donor cells comprise or express a therapeutic molecule. In some such methods, the therapeutic molecule does not target a target protein. In some such methods, the donor cells comprise or express an immunoglobulin. In some such methods, the immunoglobulin does not target a target protein. In some such methods, the donor cells comprise a chimeric antigen receptor (CAR) or an exogenous T cell receptor (TCR). In some such methods, the CAR or exogenous TCR does not target a target protein.

[0017] In some such methods, the donor cells are autologous. In some such methods, the donor cells are allogeneic or syngeneic.

[0018] In some such methods, the subject has a disease or disorder, and the method is for treating the disease or disorder. In some such methods, the subject has cancer. In some such methods, the cancer is a solid tumor cancer. In some such methods, the cancer is a blood cancer. In some such methods, the subject has a hematopoietic malignancy, and the method is for treating the hematopoietic malignancy in the subject. In some such methods, the subject has defective immune cells or a genetic hematopoietic deficiency. In some such methods, the genetic hematopoietic deficiency is sickle cell disease or severe combined immunodeficiency (SCID). In some such methods, the therapeutic molecule targets diseased cells.

[0019] In some such methods, steps (b) and (c) are performed simultaneously. In some such methods, step (b) is performed before step (c), and optionally, step (c) comprises multiple administrations of the target protein antagonist after step (b). In some such methods, step (b) is performed after step (c), and optionally, step (c) comprises multiple administrations of the target protein antagonist before step (b). In some such methods, step (c) is performed both before and after step (b), and optionally, step (c) comprises multiple administrations of the target protein antagonist before step (b) and / or multiple administrations of the target protein antagonist after step (b).

[0020] Some such methods further comprise, prior to step (a), generating donor cells by modifying the cell population to express a first isoform of the target protein. In some such methods, the cell population is an induced pluripotent stem cell population, and the method further comprises, prior to step (a), differentiating the induced pluripotent stem cells into the donor cells administered in step (a), optionally differentiating the induced pluripotent stem cells into hematopoietic cells, lymphocytes or lymphoid progenitor cells, T cells, B cells, NK cells, hematopoietic stem cells, or hematopoietic stem and progenitor cells. In some such methods, the cell population is a population of hematopoietic stem cells or hematopoietic stem and progenitor cells, and the method further comprises, prior to step (a), differentiating the hematopoietic stem cells or hematopoietic stem and progenitor cells into the donor cells administered in step (a), optionally differentiating the hematopoietic stem cells or hematopoietic stem and progenitor cells into differentiated hematopoietic cells, lymphocytes or lymphoid progenitor cells, T cells, B cells, or NK cells.

[0021] In some such methods, generating the donor cells comprises, prior to step (a), introducing an expression vector encoding a first isoform of the target protein so as to express the first isoform of the target protein. In some such methods, generating the donor cells comprises, prior to step (a), editing a genomic locus in the cell population so as to express the first isoform of the target protein. In some such methods, the genomic locus is an endogenous genomic locus encoding the target protein, optionally wherein the target protein is IL2RG and the genomic locus is the IL2RG genomic locus. In some such methods, the genomic locus is not an endogenous genomic locus encoding the target protein, optionally wherein the target protein is IL2RG and the genomic locus is not the IL2RG genomic locus.

[0022] In some such methods, the editing step includes introducing into the cell population (1) a nuclease agent or one or more nucleic acids encoding the nuclease agent, where the nuclease agent targets a nuclease target sequence in a genomic locus, and (2) an exogenous donor nucleic acid, where the nuclease agent cleaves the genomic locus and the exogenous donor nucleic acid is inserted into or recombines with the genomic locus to generate a donor cell that expresses a first isoform of the target protein. In some such methods, the nuclease agent comprises (a) a zinc finger nuclease (ZFN), (b) a transcription activator-like effector nuclease (TALEN), or (c) (i) a Cas protein and (ii) a guide RNA comprising a DNA-targeting segment that targets a guide RNA target sequence that is a nuclease target sequence, wherein the guide RNA binds to the Cas protein and directs the Cas protein to the guide RNA target sequence. In some such methods, the nuclease agent comprises a Cas protein and a guide RNA, and optionally, the target protein is IL2RG and the DNA-targeting segment comprises the sequence set forth in any one of SEQ ID NOs: 76-87, or the guide RNA target sequence comprises the sequence set forth in any one of SEQ ID NOs: 64-75, or optionally, the target protein is IL2RG and the DNA-targeting segment comprises the sequence set forth in any one of SEQ ID NOs: 136-153, or the guide RNA target sequence comprises the sequence set forth in any one of SEQ ID NOs: 118-135. In some such methods, the Cas protein is a Cas9 protein. In some such methods, the exogenous donor nucleic acid comprises homology arms.In some such methods, the exogenous donor nucleic acid is a single-stranded oligodeoxynucleotide (ssODN), and optionally, the target protein is IL2RG and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 88-117, or optionally, the target protein is IL2RG and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 154-173.

[0023] In some such methods, the target protein is IL2RG, and (I) the DNA-targeting segment comprises the sequence set forth in SEQ ID NO: 77, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 65, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 88-97; (II) the DNA-targeting segment comprises the sequence set forth in SEQ ID NO: 83, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 71, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 98-107; (III) the DNA-targeting segment comprises the sequence set forth in SEQ ID NO: 86, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 65; (IV) the DNA targeting segment comprises the sequence set forth in SEQ ID NO: 137, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 119, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 154-163, or (V) the DNA targeting segment comprises the sequence set forth in SEQ ID NO: 138, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 120, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 164-173.

[0024] Some such methods further comprise the step of isolating the cell population from the subject or from a different subject prior to the step of modifying the cell population.

[0025] In another aspect, a combination or pharmaceutical combination for administration to a subject in need thereof is provided. Some such combinations include (a) a donor cell population modified to express a first isoform of a target protein, where the target protein is a protein expressed on the cell surface of a hematopoietic cell, and the first isoform of the target protein is different from a second isoform of the target protein, and (b) a target protein antagonist that specifically binds to the second isoform of the target protein but not to the first isoform of the target protein.

[0026] In some such combinations, the target protein is a receptor. In some such combinations, the target protein is a cytokine receptor or a chemokine receptor, and optionally, the target protein is a cytokine receptor. In some such combinations, the target protein is a protein expressed on the cell surface of a lymphocyte. In some such combinations, the target protein is a cytokine receptor subunit of interleukin-2 (IL-2) receptor, IL-4 receptor, IL-7 receptor, IL-9 receptor, IL-15 receptor, or IL-21 receptor. In some such combinations, the target protein is interleukin-2 receptor subunit gamma (IL2RG).

[0027] In some such combinations, the target protein antagonist selectively inhibits host cells in a subject based on the expression of the second isoform of the target protein. In some such combinations, the selective inhibition of host cells does not involve the ablation of host cells by an active killing mechanism. In some such combinations, the selective inhibition includes (1) blocking the growth of host cells to provide a competitive growth advantage to donor cells, (2) blocking the localization or transport of host cells to provide a competitive homing advantage to donor cells, (3) blocking the cell-cell interaction or adhesion of host cells to provide a competitive tissue infiltration advantage to donor cells, or (4) blocking immune cell activation in host cells to provide a competitive advantage to donor cells. In some such combinations, the selective inhibition includes blocking the growth (i.e., blocking proliferation) of host cells and / or blocking immune cell activation in host cells to provide a competitive growth advantage to donor cells.

[0028] In some such combinations, the first isoform and the second isoform are functionally indistinguishable but immunologically distinguishable. In some such combinations, the donor cells express both the first isoform of the target protein and the second isoform of the target protein. In some such combinations, the donor cells express only the first isoform of the target protein.

[0029] In some such combinations, the first isoform of the target protein is expressed from an expression vector in the donor cell population. In some such combinations, the genomic locus has been edited to express the first isoform of the target protein in the donor cell population. In some such combinations, the genomic locus is an endogenous genomic locus encoding the target protein, optionally the target protein is IL2RG and the genomic locus is the IL2RG genomic locus. In some such combinations, the genomic locus is not an endogenous genomic locus encoding the target protein, optionally the target protein is IL2RG and the genomic locus is not the IL2RG genomic locus.

[0030] In some such combinations, the first isoform of the target protein is a genetically engineered isoform of the target protein. In some such combinations, the first isoform of the target protein is genetically engineered to include a mutation that provides a modified epitope, and optionally, the mutation is an artificial mutation. In some such combinations, the modified epitope is the binding region of a target protein antagonist, such that the target protein antagonist (e.g., antigen-binding protein) exhibits reduced or lost ability to bind to and / or inhibit the first isoform of the target protein (e.g., compared to its ability to bind to and / or inhibit the second isoform of the target protein). In some such combinations, both the first isoform of the target protein and the second isoform of the target protein retain the ability to bind to endogenous ligands, and optionally, the target protein antagonist (e.g., antigen-binding protein) blocks the binding of endogenous ligands to the second isoform of the target protein but does not block the binding to the first isoform of the target protein.

[0031] In some such combinations, the target protein is IL2RG, the altered epitope is in the binding region of a target protein antagonist, and the target protein antagonist is an antibody comprising an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively.

[0032] In some such combinations, the target protein is IL2RG and the mutation comprises a mutation encoded by nucleotides in exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus. In some such combinations, the target protein is IL2RG and the mutation comprises a mutation or substitution within the region from positions T127 to N150 and / or within the region from positions L87 to D97. In some such combinations, the target protein is IL2RG and the mutation comprises a mutation or substitution at positions M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, and / or K147. In some such combinations, the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145, optionally wherein the substitution is an M145K substitution, an M145D substitution, an M145E substitution, an M145P substitution, an M145W substitution, or an M145Y substitution. In some such combinations, the target protein is IL2RG and the mutation comprises an M145K substitution. In some such combinations, the target protein is IL2RG and the mutation comprises a mutation or substitution at position W90, optionally wherein the substitution is a W90V substitution, a W90R substitution, a W90Q substitution, a W90L substitution, a W90K substitution, a W90E substitution, or a W90D substitution, optionally wherein the mutation comprises a W90Q substitution. In some such combinations, the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

[0033] In some such combinations, the target protein antagonist is an antigen-binding protein. In some such combinations, the antigen-binding protein is an antibody or an antigen-binding fragment thereof. In some such combinations, the target protein is IL2RG, and the antigen-binding protein comprises an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such combinations, the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such combinations, the target protein is IL2RG and the antigen binding protein comprises an immunoglobulin light chain variable region comprising, consisting essentially of, or consisting of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 10, and the antigen binding protein comprises an immunoglobulin heavy chain variable region comprising, consisting essentially of, or consisting of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 2. In some such combinations, the target protein is IL2RG and the immunoglobulin light chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 2.In some such combinations, the target protein is IL2RG and the antigen binding protein comprises an immunoglobulin light chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO:20, and the antigen binding protein comprises an immunoglobulin heavy chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO:18.

[0034] In some such combinations, the donor cells are hematopoietic cells. In some such combinations, the donor cells are immune cells. In some such combinations, the donor cells are lymphocytes or lymphoid progenitor cells. In some such combinations, the donor cells are T cells. In some such combinations, the donor cells are tumor-infiltrating lymphocytes (TILs). In some such combinations, the donor cells are B cells. In some such combinations, the donor cells are NK cells. In some such combinations, the donor cells are hematopoietic stem cells or hematopoietic stem and progenitor cells. In some such combinations, the donor cells are derived from induced pluripotent stem cells or derived from hematopoietic stem cells or hematopoietic stem and progenitor cells.

[0035] In some such combinations, the subject is a mammal or a non-human mammal and the donor cells are mammalian cells or non-human mammalian cells. In some such combinations, the subject is a human and the donor cells are human cells.

[0036] In some such combinations, the donor cells comprise or express a therapeutic molecule. In some such combinations, the therapeutic molecule does not target a target protein. In some such combinations, the donor cells comprise or express an immunoglobulin. In some such combinations, the immunoglobulin does not target a target protein. In some such combinations, the donor cells comprise a chimeric antigen receptor (CAR) or an exogenous T cell receptor (TCR). In some such combinations, the CAR or exogenous TCR does not target a target protein.

[0037] In some such combinations, the donor cells are autologous. In some such combinations, the donor cells are allogeneic or syngeneic.

[0038] In some such combinations, the subject has a disease or disorder, and the pharmaceutical combination is for treating the disease or disorder. In some such combinations, the subject has cancer. In some such combinations, the cancer is solid tumor cancer. In some such combinations, the cancer is a blood cancer. In some such combinations, the subject has a hematopoietic malignancy, and the pharmaceutical combination is for treating the hematopoietic malignancy in the subject. In some such combinations, the subject has defective immune cells or a hereditary hematopoietic deficiency. In some such combinations, the hereditary hematopoietic deficiency is sickle cell disease or severe combined immunodeficiency (SCID). In some such combinations, the therapeutic molecule targets diseased cells.

[0039] In another aspect, an isolated cell or cell population is provided that has been modified to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is distinct from a second isoform of IL2RG. In some such cells or populations, the first isoform of IL2RG has been engineered to include a mutation that provides an altered epitope, the altered epitope being a binding region for an IL2RG antagonist, such that the IL2RG antagonist (e.g., an antigen binding protein) exhibits reduced or lost ability to bind to and / or inhibit the first isoform of IL2RG (e.g., compared to its ability to bind to and / or inhibit the second isoform of IL2RG), and the first isoform of IL2RG retains binding to its endogenous ligand. In some such cells or populations, the mutation is an artificial mutation. In some such cells or populations, both the first isoform of IL2RG and the second isoform of IL2RG retain the ability to bind to endogenous ligand, and optionally, an IL2RG antagonist (e.g., an antigen binding protein) blocks binding of the endogenous ligand to the second isoform of IL2RG but not to the first isoform of IL2RG.

[0040] In some such cells or populations, the first and second isoforms are functionally indistinguishable but immunologically distinguishable. In some such cells or populations, the cell(s) express both the first isoform of IL2RG and the second isoform of IL2RG. In some such cells or populations, the cell(s) express only the first isoform of IL2RG.

[0041] In some such cells or populations, the first isoform of IL2RG is expressed from an expression vector in the cell(s), or the genomic locus has been edited to express the first isoform of IL2RG in the cell(s). In some such cells or populations, the genomic locus is an endogenous IL2RG genomic locus. In some such cells or populations, the genomic locus is not an endogenous IL2RG genomic locus.

[0042] In some such cells or populations, the altered epitope is in the binding region of an IL2RG antagonist, and the IL2RG antagonist is an antibody comprising an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively.

[0043] In some such cells or populations, the mutation comprises a mutation encoded by nucleotides within exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus. In some such cells or populations, the mutation comprises a mutation or substitution within the region from positions T127 to N150 and / or within the region from positions L87 to D97. In some such cells or populations, the mutation comprises a mutation or substitution at positions M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, and / or K147. In some such cells or populations, the mutation comprises a mutation or substitution at position M145, optionally with the substitution being M145K, M145D, M145E, M145P, M145W, or M145Y. In some such cells or populations, the mutation comprises an M145K substitution. In some such cells or populations, the mutation comprises a mutation or substitution at position W90, optionally wherein the substitution is a W90V, W90R, W90Q, W90L, W90K, W90E, or W90D substitution, optionally wherein the mutation comprises a W90Q substitution. In some such cells or populations, the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

[0044] In some such cells or populations, the first and second isoforms are immunologically distinguishable by an IL2RG antagonist, which specifically binds to the second isoform of IL2RG but not to the first isoform of IL2RG. In some such cells or populations, the IL2RG antagonist is an antigen-binding protein. In some such cells or populations, the antigen-binding protein is an antibody or an antigen-binding fragment thereof. In some such cells or populations, the antigen-binding protein comprises an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such cells or populations, the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such cells or populations, the antigen binding protein comprises an immunoglobulin light chain variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO: 10; The antigen binding protein comprises an immunoglobulin heavy chain variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO: 2. In some such cells or populations, the immunoglobulin light chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10 and the immunoglobulin heavy chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 2. In some such cells or populations, the antigen binding protein comprises an immunoglobulin light chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 20 and the antigen binding protein comprises an immunoglobulin heavy chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 18.

[0045] In some such cells or populations, the cell(s) are hematopoietic cell(s). In some such cells or populations, the cell(s) are immune cell(s). In some such cells or populations, the cell(s) are lymphocytes or lymphoid progenitor cell(s). In some such cells or populations, the cell(s) are T cell(s). In some such cells or populations, the cell(s) are tumor-infiltrating lymphocyte(s) (TIL). In some such cells or populations, the cell(s) are B cell(s). In some such cells or populations, the cell(s) are NK cell(s). In some such cells or populations, the cell(s) are hematopoietic stem cell(s) or hematopoietic stem and progenitor cell(s). In some such cells or populations, the cell(s) are induced pluripotent stem cell(s). In some such cells or populations, the cell(s) are mammalian cell(s) or non-human mammalian cell(s). In some such cells or populations, the cell(s) are human cell(s).

[0046] In some such cells or populations, the cell(s) comprise or express a therapeutic molecule. In some such cells or populations, the therapeutic molecule does not target IL2RG. In some such cells or populations, the cell(s) comprise or express an immunoglobulin. In some such cells or populations, the immunoglobulin does not target IL2RG. In some such cells or populations, the cell(s) comprise a chimeric antigen receptor (CAR) or an exogenous T cell receptor (TCR). In some such cells or populations, the CAR or exogenous TCR does not target IL2RG.

[0047] In some such cells or populations, the cell(s) have been isolated from a subject. In some such cells or populations, the cell(s) are for use in treating a subject having cells that express the second isoform of IL2RG.

[0048] In another aspect, methods of producing any of the above-described isolated cells or cell populations are provided. Some such methods include modifying a cell or cell population to express a first isoform of IL2RG. In some such methods, the modifying step includes introducing an expression vector encoding the first isoform of IL2RG. In some such methods, the modifying step includes editing a genomic locus to express the first isoform of IL2RG. In some such methods, the genomic locus is an endogenous IL2RG genomic locus. In some such methods, the genomic locus is not an endogenous IL2RG genomic locus. In some such methods, the editing step includes introducing into the cell (1) a nuclease agent or one or more nucleic acids encoding the nuclease agent, where the nuclease agent targets a nuclease target sequence in the genomic locus, and (2) an exogenous donor nucleic acid, where the nuclease agent cleaves the genomic locus and the exogenous donor nucleic acid is inserted into or recombines with the genomic locus to generate a donor cell that expresses the first isoform of IL2RG. In some such methods, the nuclease agent comprises (a) a zinc finger nuclease (ZFN), (b) a transcription activator-like effector nuclease (TALEN), or (c) (i) a Cas protein and (ii) a guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence that is a nuclease target sequence, wherein the guide RNA binds to and directs the Cas protein to the guide RNA target sequence.In some such methods, the nuclease agent comprises a Cas protein and a guide RNA, and optionally, the target protein is IL2RG and the DNA-targeting segment comprises the sequence set forth in any one of SEQ ID NOs: 76-87, or the guide RNA target sequence comprises the sequence set forth in any one of SEQ ID NOs: 64-75, or optionally, the target protein is IL2RG and the DNA-targeting segment comprises the sequence set forth in any one of SEQ ID NOs: 136-153, or the guide RNA target sequence comprises the sequence set forth in any one of SEQ ID NOs: 118-135. In some such methods, the Cas protein is a Cas9 protein. In some such methods, the exogenous donor nucleic acid comprises homology arms. In some such methods, the exogenous donor nucleic acid is a single-stranded oligodeoxynucleotide (ssODN), and optionally, the target protein is IL2RG and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 88-117, or optionally, the target protein is IL2RG and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 154-173.

[0049] In some such methods, the target protein is IL2RG, and (I) the DNA-targeting segment comprises the sequence set forth in SEQ ID NO: 77, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 65, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 88-97; (II) the DNA-targeting segment comprises the sequence set forth in SEQ ID NO: 83, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 71, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 98-107; (III) the DNA-targeting segment comprises the sequence set forth in SEQ ID NO: 86, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 65; (IV) the DNA targeting segment comprises the sequence set forth in SEQ ID NO: 137, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 119, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 154-163, or (V) the DNA targeting segment comprises the sequence set forth in SEQ ID NO: 138, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 120, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 164-173.

[0050] In another aspect, genetically engineered human interleukin-2 receptor subunit gamma (IL2RG) proteins are provided. In some such genetically engineered IL2RG proteins, the protein contains artificial mutations that provide an altered epitope, where the altered epitope is a binding region for an IL2RG antagonist (e.g., an antigen-binding protein), such that the IL2RG antagonist exhibits reduced or lost ability to bind to and / or inhibit the genetically engineered IL2RG protein (e.g., compared to its ability to bind to and / or inhibit wild-type human IL2RG protein), and the genetically engineered IL2RG protein retains binding to its endogenous ligand. In some such genetically engineered IL2RG proteins, the genetically engineered IL2RG protein is functionally indistinguishable from native IL2RG protein but immunologically distinguishable.

[0051] In some such genetically engineered IL2RG proteins, the altered epitope is in the binding region of an IL2RG antagonist, and the IL2RG antagonist is an antibody comprising an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively.

[0052] In some such engineered IL2RG proteins, the mutation comprises a mutation encoded by nucleotides within exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus. In some such engineered IL2RG proteins, the mutation comprises a mutation or substitution within the region from positions T127 to N150 and / or within the region from positions L87 to D97. In some such engineered IL2RG proteins, the artificial mutation comprises a mutation or substitution at positions M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, and / or K147. In some such engineered IL2RG proteins, the artificial mutation comprises a mutation or substitution at position M145, optionally wherein the substitution is an M145K substitution, an M145D substitution, an M145E substitution, an M145P substitution, an M145W substitution, or an M145Y substitution. In some such engineered IL2RG proteins, the artificial mutation comprises an M145K substitution. In some such engineered IL2RG proteins, the mutation comprises a mutation or substitution at position W90, optionally wherein the substitution is a W90V substitution, a W90R substitution, a W90Q substitution, a W90L substitution, a W90K substitution, a W90E substitution, or a W90D substitution, optionally wherein the mutation comprises a W90Q substitution. In some such engineered IL2RG proteins, the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

[0053] In some such engineered IL2RG proteins, the engineered IL2RG protein and the native IL2RG protein are functionally indistinguishable by an IL2RG antagonist but immunologically distinguishable. In some such engineered IL2RG proteins, the IL2RG antagonist is an antigen-binding protein. In some such engineered IL2RG proteins, the antigen-binding protein is an antibody or an antigen-binding fragment thereof. In some such engineered IL2RG proteins, the antigen-binding protein comprises an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such engineered IL2RG proteins, the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such engineered IL2RG proteins, the antigen binding protein comprises an immunoglobulin light chain variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO: 10, and the antigen binding protein comprises an immunoglobulin heavy chain or variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO:2.In some such engineered IL2RG proteins, the immunoglobulin light chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 2. In some such engineered IL2RG proteins, the antigen binding protein comprises an immunoglobulin light chain comprising, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 20, and the antigen binding protein comprises an immunoglobulin heavy chain comprising, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 18.

[0054] In another aspect, a nucleic acid encoding any of the above-described engineered IL2RG proteins is provided. Some such nucleic acids are expression vectors that encode the engineered human IL2RG protein.

[0055] Methods are provided for the in vivo selective depletion of non-edited cells in a subject thereof. Such methods may include providing cells edited to express a first isoform of a target protein (e.g., interleukin-2 receptor subunit gamma (IL2RG)), administering the edited cells to the subject, and then selectively depleting non-edited cells in the subject based on expression of a second isoform of the target protein. Such methods may include providing cells edited to express a first isoform of the target protein that is functionally indistinguishable but immunologically distinguishable from the second isoform of the target protein (e.g., interleukin-2 receptor subunit gamma (IL2RG)), administering the edited cells to the subject, and then selectively depleting non-edited cells in the subject based on expression of the second isoform of the target protein. Also provided is a combination for administration to a subject in need thereof, comprising: (1) a cell population edited to express a first isoform of a target protein (e.g., IL2RG); and (2) an antagonist (e.g., an anti-IL2RG antigen-binding protein) that specifically binds to a second isoform of the target protein but not to the first isoform of the target protein. Also provided is an isolated cell or cell population that has been modified to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is distinct from the second isoform of IL2RG. Also provided is an isolated cell or cell population whose genomic locus has been edited to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is distinct from the second isoform of IL2RG.Also provided are isolated cells or cell populations in which the IL2RG genomic locus has been edited to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is different from a second isoform of IL2RG, wherein the first and second isoforms are functionally indistinguishable but immunologically distinguishable. Also provided are methods of making the isolated cells or cell populations. Also provided are genetically engineered interleukin-2 receptor subunit gamma (IL2RG) proteins and nucleic acids encoding the proteins.

[0056] In one aspect, methods are provided for the in vivo selective depletion of non-edited cells in a subject in need thereof. Some such methods include: (a) providing edited cells, wherein the IL2RG genomic locus has been edited to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is different from a second isoform of IL2RG, wherein the first and second isoforms are functionally indistinguishable but immunologically distinguishable, and the second isoform is expressed in non-edited cells of the subject; (b) administering the edited cells to the subject; and (c) selectively depleting non-edited cells in the subject based on expression of the second isoform of IL2RG. In one aspect, methods are provided for the in vivo selective depletion of non-edited cells in a subject in need thereof and repopulation of edited cells. Some such methods include (a) providing edited cells that have been modified to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is different from a second isoform of IL2RG, where the second isoform is expressed in non-edited cells of the subject; (b) administering the edited cells to the subject; and (c) selectively depleting non-edited cells in the subject based on expression of the second isoform of IL2RG. In some such methods, the first isoform and the second isoform are functionally indistinguishable but immunologically distinguishable. In some such methods, the edited cells express both the first isoform of IL2RG and the second isoform of IL2RG. In some such methods, the edited cells express only the first isoform of IL2RG.

[0057] In some such methods, the first isoform of IL2RG is an engineered isoform of IL2RG. In some such methods, the first isoform of IL2RG has been engineered to include a mutation that provides an altered epitope, and optionally the mutation is an artificial mutation.

[0058] In some such methods, the altered epitope is in the binding region of an antibody comprising an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively.

[0059] In some such methods, the mutation comprises a mutation encoded by nucleotides within exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus. In some such methods, the mutation comprises a mutation or substitution within the region from positions T127 to N150 and / or within the region from positions L87 to D97. In some such methods, the mutation comprises a mutation or substitution at positions M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, or K147. In some such methods, the mutation comprises a mutation or substitution at position M145, optionally with the substitution being an M145K, M145D, M145E, M145P, M145W, or M145Y substitution. In some such methods, the mutation comprises an M145K substitution. In some such methods, the mutation comprises a mutation or substitution at position W90, and optionally the substitution is a W90V, W90R, W90Q, W90L, W90K, W90E, or W90D substitution. In some such methods, the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

[0060] In some such methods, the selective depletion in step (c) comprises administering to the subject an IL2RG antagonist, wherein the IL2RG antagonist specifically binds to the second isoform of IL2RG but not the first isoform of IL2RG. In some such methods, the IL2RG antagonist is an antigen-binding protein. In some such methods, the antigen-binding protein is an antibody or an antigen-binding fragment thereof. In some such methods, the antigen-binding protein comprises an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such methods, the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such methods, the immunoglobulin light chain or variable region thereof comprises, consists essentially of, or consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof comprises, consists essentially of, or consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 2. In some such methods, the immunoglobulin light chain or variable region thereof comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 2.

[0061] In some such methods, the edited cells are hematopoietic cells. In some such methods, the edited cells are lymphocytes or lymphoid progenitor cells. In some such methods, the edited cells are T cells. In some such methods, the edited cells are tumor-infiltrating lymphocytes (TILs). In some such methods, the edited cells are B cells. In some such methods, the edited cells are NK cells. In some such methods, the edited cells are hematopoietic stem and progenitor cells. In some such methods, the edited cells are derived from induced pluripotent stem cells. In some such methods, the edited cells are derived from hematopoietic stem cells or hematopoietic stem and progenitor cells. In some such methods, the subject is a mammal or a non-human mammal, and the edited cells are mammalian cells or non-human mammalian cells. In some such methods, the subject is human, and the edited cells are human cells. In some such methods, the edited cells contain or express a therapeutic molecule. In some such methods, the edited cells comprise or express immunoglobulins. In some such methods, the edited cells comprise a chimeric antigen receptor (CAR) or an exogenous T cell receptor (TCR). In some such methods, the edited cells are autologous. In some such methods, the edited cells are allogeneic or syngeneic.

[0062] In some such methods, the subject has a hematopoietic malignancy and the method is for treating the hematopoietic malignancy in the subject. In some such methods, the subject has cancer. In some such methods, the cancer is a blood cancer. In some such methods, the subject has a defective immune cell or a genetic hematopoietic deficiency. In some such methods, the genetic hematopoietic deficiency is sickle cell disease or severe combined immunodeficiency (SCID).

[0063] In some such methods, steps (b) and (c) are performed simultaneously. In some such methods, step (b) is performed before step (c). In some such methods, step (b) is performed after step (c).

[0064] Some such methods further comprise, prior to step (a), generating edited cells by modifying the cell population to express a first isoform of IL2RG. In some such methods, the cell population is an induced pluripotent stem cell population, and the method further comprises, prior to step (a), differentiating the edited induced pluripotent stem cells into the edited cells administered in step (a), optionally differentiating the induced pluripotent stem cells into hematopoietic cells, lymphocytes or lymphoid progenitor cells, T cells, B cells, NK cells, hematopoietic stem cells, or hematopoietic stem and progenitor cells. In some such methods, the cell population is a population of hematopoietic stem cells or hematopoietic stem and progenitor cells, and the method further comprises, prior to step (a), differentiating the edited hematopoietic stem cells or hematopoietic stem and progenitor cells into the edited cells administered in step (a), optionally differentiating the hematopoietic stem cells or hematopoietic stem and progenitor cells into differentiated hematopoietic cells, lymphocytes or lymphoid progenitor cells, T cells, B cells, or NK cells.

[0065] In some such methods, the genomic locus has been edited to express a first isoform of IL2RG in the edited cells. In some such methods, the genomic locus is an IL2RG genomic locus. In some such methods, the genomic locus is not an IL2RG genomic locus. In some such methods, the method further comprises, prior to step (a), generating edited cells by editing the genomic locus to express the first isoform of IL2RG in the cell population. In some such methods, the method further comprises, prior to step (a), generating edited cells by editing the IL2RG genomic locus to express the first isoform of IL2RG in the cell population. In some such methods, the cell population is an induced pluripotent stem cell population, and the IL2RG locus has been edited in the induced pluripotent stem cells to generate edited induced pluripotent stem cells that express a first isoform of IL2RG, and the method further comprises, prior to step (a), differentiating the edited induced pluripotent stem cells into the edited cells administered in step (a), optionally differentiating the induced pluripotent stem cells into hematopoietic cells, lymphocytes or lymphoid progenitor cells, T cells, B cells, NK cells, hematopoietic stem cells, or hematopoietic stem and progenitor cells. In some such methods, the cell population is a population of hematopoietic stem cells or hematopoietic stem and progenitor cells, and the IL2RG locus has been edited in the hematopoietic stem cells or hematopoietic stem and progenitor cells to generate edited hematopoietic stem cells or hematopoietic stem and progenitor cells that express a first isoform of IL2RG, and the method further comprises, prior to step (a), differentiating the edited hematopoietic stem cells or hematopoietic stem and progenitor cells into the edited cells administered in step (a), and optionally differentiating the hematopoietic stem cells or hematopoietic stem and progenitor cells into differentiated hematopoietic cells, lymphocytes or lymphoid progenitor cells, T cells, B cells, or NK cells.

[0066] In some such methods, the editing step includes introducing into the cell population (1) a nuclease agent or one or more nucleic acids encoding the nuclease agent, where the nuclease agent targets a nuclease target sequence in a genomic locus, and (2) an exogenous donor nucleic acid, wherein the nuclease agent cleaves the genomic locus and the exogenous donor nucleic acid is inserted into or recombines with the genomic locus to generate edited cells that express the first isoform of IL2RG. In some such methods, the editing step includes introducing into the cell population (1) a nuclease agent or one or more nucleic acids encoding the nuclease agent, where the nuclease agent targets a nuclease target sequence in the IL2RG genomic locus, and (2) an exogenous donor nucleic acid, wherein the nuclease agent cleaves the IL2RG genomic locus and the exogenous donor nucleic acid is inserted into or recombines with the IL2RG genomic locus to generate edited cells that express the first isoform of IL2RG. In some such methods, the nuclease agent comprises (a) a zinc finger nuclease (ZFN), (b) a transcription activator-like effector nuclease (TALEN), or (c) (i) a Cas protein and (ii) a guide RNA comprising a DNA-targeting segment that targets a guide RNA target sequence that is a nuclease target sequence, wherein the guide RNA binds to the Cas protein and directs the Cas protein to the guide RNA target sequence. In some such methods, the nuclease agent comprises a Cas protein and a guide RNA, and optionally, the DNA-targeting segment comprises a sequence set forth in any one of SEQ ID NOs: 76-87, or optionally, the guide RNA target sequence comprises a sequence set forth in any one of SEQ ID NOs: 64-75. In some such methods, the Cas protein is a Cas9 protein. In some such methods, the exogenous donor nucleic acid comprises homology arms.In some such methods, the exogenous donor nucleic acid is a single-stranded oligodeoxynucleotide (ssODN), and optionally, the ssODN comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 88-117.

[0067] In some such methods, the method further comprises isolating the cell population from the subject or a different subject prior to modifying the cell population. In some such methods, the method further comprises isolating the cell population from the subject or a different subject prior to editing the IL2RG genomic locus.

[0068] In another aspect, a combination or combined pharmaceutical for administration to a subject in need thereof is provided. In some such combinations, the combination comprises (a) a cell population modified to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is different from a second isoform of IL2RG, and (b) an IL2RG antagonist that specifically binds to the second isoform of IL2RG but not the first isoform of IL2RG. In some such combinations, the first isoform and the second isoform are functionally indistinguishable but immunologically distinguishable. In some such combinations, a genomic locus has been edited to express the first isoform of IL2RG in the cell population. In some such combinations, the genomic locus is an IL2RG genomic locus. In some such combinations, the genomic locus is not an IL2RG genomic locus. In some such combinations, the combination includes (a) a cell population in which the IL2RG genomic locus has been edited to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is different from a second isoform of IL2RG, wherein the first and second isoforms are functionally indistinguishable but immunologically distinguishable, and (b) an IL2RG antagonist that specifically binds to the second isoform of IL2RG but not the first isoform of IL2RG. In some such combinations, the cells express both the first isoform of IL2RG and the second isoform of IL2RG. In some such combinations, the cells express only the first isoform of IL2RG.

[0069] In some such combinations, the first isoform of IL2RG is a genetically engineered isoform of IL2RG. In some such combinations, the first isoform of IL2RG has been genetically engineered to include mutations that provide an altered epitope, and optionally the mutations are artificial mutations. In some such combinations, the altered epitope is in the binding region of an antibody comprising an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively.

[0070] In some such combinations, the mutation comprises a mutation encoded by nucleotides in exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus. In some such combinations, the mutation comprises a mutation or substitution within the region from positions T127 to N150 and / or within the region from positions L87 to D97. In some such combinations, the mutation comprises a mutation or substitution at position M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, or K147. In some such combinations, the mutation comprises a mutation or substitution at position M145, and optionally the substitution is an M145K, M145D, M145E, M145P, M145W, or M145Y substitution. In some such combinations, the mutation comprises an M145K substitution. In some such combinations, the mutation comprises a mutation or substitution at position W90, and optionally the substitution is a W90V, W90R, W90Q, W90L, W90K, W90E, or W90D substitution. In some such combinations, the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

[0071] In some such combinations, the IL2RG antagonist is an antigen-binding protein. In some such combinations, the antigen-binding protein is an antibody or an antigen-binding fragment thereof. In some such combinations, the antigen-binding protein comprises an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such combinations, the three light chain CDRs comprise, consist essentially of, or consist of sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such combinations, the immunoglobulin light chain or variable region thereof comprises, consists essentially of, or consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof comprises, consists essentially of, or consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 2. In some such combinations, the immunoglobulin light chain or variable region thereof comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 2.

[0072] In some such combinations, the cells are hematopoietic cells. In some such combinations, the cells are T cells. In some such combinations, the cells are lymphocytes or lymphoid progenitor cells. In some such combinations, the cells are tumor-infiltrating lymphocytes (TILs). In some such combinations, the cells are B cells. In some such combinations, the cells are NK cells. In some such combinations, the cells are hematopoietic stem cells or hematopoietic stem and progenitor cells. In some such combinations, the cells are derived from induced pluripotent stem cells. In some such combinations, the cells are derived from hematopoietic stem cells or hematopoietic stem and progenitor cells. In some such combinations, the subject is a mammal or a non-human mammal, and the cells are mammalian cells or non-human mammalian cells. In some such combinations, the subject is a human, and the cells are human cells. In some such combinations, the cells contain or express a therapeutic molecule. In some such combinations, the cells contain or express an immunoglobulin. In some such combinations, the cells comprise a chimeric antigen receptor (CAR) or an exogenous T cell receptor (TCR). In some such combinations, the cells are autologous. In some such combinations, the cells are allogeneic or syngeneic.

[0073] In some such combinations, the subject has a hematopoietic malignancy, and the combination pharmaceutical is for treating the hematopoietic malignancy in the subject. In some such combinations, the subject has cancer. In some such combinations, the cancer is a blood cancer. In some such combinations, the subject has a defective immune cell or a hereditary hematopoietic deficiency. In some such combinations, the hereditary hematopoietic deficiency is sickle cell disease or severe combined immunodeficiency (SCID).

[0074] In another aspect, an isolated cell or cell population is provided that has been modified to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is different from a second isoform of IL2RG. In some such cells or cell populations, the first and second isoforms are functionally indistinguishable but immunologically distinguishable. In some such cells or cell populations, a genomic locus has been edited to express the first isoform of IL2RG in the cell(s). In some such cells or cell populations, the genomic locus is an IL2RG genomic locus. In some such cells or cell populations, the genomic locus is not an IL2RG genomic locus. In another aspect, an isolated cell or cell population is provided in which the IL2RG genomic locus has been edited to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is different from a second isoform of IL2RG, wherein the first and second isoforms are functionally indistinguishable but immunologically distinguishable. In some such cells or cell populations, the cell(s) express both the first isoform of IL2RG and the second isoform of IL2RG. In some such cells or cell populations, the cell(s) express only the first isoform of IL2RG.

[0075] In some such cells or cell populations, the first isoform of IL2RG is an engineered isoform of IL2RG. In some such cells or cell populations, the first isoform of IL2RG has been engineered to include a mutation that provides an altered epitope, and optionally the mutation is an artificial mutation.

[0076] In some such cells or cell populations, the cell(s) further comprise an exogenous donor nucleic acid comprising the artificial mutation and a nuclease agent or one or more nucleic acids encoding a nuclease agent, wherein the nuclease agent targets a nuclease target sequence at the genomic locus. In some such cells or cell populations, the cell(s) further comprise an exogenous donor nucleic acid comprising the artificial mutation and a nuclease agent or one or more nucleic acids encoding a nuclease agent, wherein the nuclease agent targets a nuclease target sequence at the IL2RG genomic locus. In some such cells or cell populations, the nuclease agent comprises (a) a zinc finger nuclease (ZFN), (b) a transcription activator-like effector nuclease (TALEN), or (c) (i) a Cas protein and (ii) a guide RNA comprising a DNA-targeting segment that targets a guide RNA target sequence that is a nuclease target sequence, wherein the guide RNA binds to the Cas protein and directs the Cas protein to the guide RNA target sequence. In some such cells or cell populations, the nuclease agent comprises a Cas protein and a guide RNA, and optionally, the DNA-targeting segment comprises a sequence set forth in any one of SEQ ID NOs: 76-87, or optionally, the guide RNA target sequence comprises a sequence set forth in any one of SEQ ID NOs: 64-75. In some such cells or cell populations, the Cas protein is a Cas9 protein. In some such cells or cell populations, the exogenous donor nucleic acid comprises homology arms. In some such cells or cell populations, the exogenous donor nucleic acid is a single-stranded oligodeoxynucleotide (ssODN), and optionally, the ssODN comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 88-117.

[0077] In some such cells or cell populations, the altered epitope is in the binding region of an antibody comprising an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively.

[0078] In some such cells or cell populations, the mutation comprises a mutation encoded by nucleotides within exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus. In some such cells or cell populations, the mutation comprises a mutation or substitution within the region from positions T127 to N150 and / or within the region from positions L87 to D97. In some such cells or cell populations, the mutation comprises a mutation or substitution at position M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, or K147. In some such cells or cell populations, the mutation comprises a mutation or substitution at position M145, optionally with the substitution being M145K, M145D, M145E, M145P, M145W, or M145Y. In some such cells or cell populations, the mutation comprises an M145K substitution. In some such cells or cell populations, the mutation comprises a mutation or substitution at position W90, and optionally the substitution is a W90V, W90R, W90Q, W90L, W90K, W90E, or W90D substitution. In some such cells or cell populations, the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

[0079] In some such cells or cell populations, the first and second isoforms are functionally indistinguishable but immunologically distinguishable by an IL2RG antagonist. In some such cells or cell populations, the IL2RG antagonist is an antigen-binding protein. In some such cells or cell populations, the antigen-binding protein is an antibody or an antigen-binding fragment thereof. In some such cells or cell populations, the antigen-binding protein comprises an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such cells or cell populations, the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such cells or cell populations, the immunoglobulin light chain or variable region thereof comprises, consists essentially of, or consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof comprises, consists essentially of, or consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 2. In some such cells or cell populations, the immunoglobulin light chain or variable region thereof comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 2.

[0080] In some such cells or cell populations, the cell(s) are hematopoietic cell(s). In some such cells or cell populations, the cell(s) are lymphocytes or lymphoid progenitor cell(s). In some such cells or cell populations, the cell(s) are T cell(s). In some such cells or cell populations, the cell(s) are tumor-infiltrating lymphocyte(s) (TIL). In some such cells or cell populations, the cell(s) are B cell(s). In some such cells or cell populations, the cell(s) are NK cell(s). In some such cells or cell populations, the cell(s) are hematopoietic stem cell(s) or hematopoietic stem and progenitor cell(s). In some such cells or cell populations, the cell(s) are induced pluripotent stem cell(s). In some such cells or cell populations, the cell(s) are mammalian cell(s) or non-human mammalian cell(s). In some such cells or cell populations, the cell(s) are human cell(s). In some such cells or cell populations, the cell(s) comprise or express a therapeutic molecule. In some such cells or cell populations, the cell(s) comprise or express an immunoglobulin. In some such cells or cell populations, the cell(s) comprise a chimeric antigen receptor (CAR) or an exogenous T cell receptor (TCR). In some such cells or cell populations, the cell(s) have been isolated from a subject. In some such cells or cell populations, the cell(s) are for use in treating a subject having cells expressing the second isoform of IL2RG. In some such cells or cell populations, the cell(s) have been isolated from a subject.

[0081] In another aspect, methods of producing any of the above-described isolated cells or cell populations are provided. In some such methods, the method comprises modifying the cell or cell population to express a first isoform of IL2RG. In some such methods, the modifying comprises editing a genomic locus to express the first isoform of IL2RG. In some such methods, the genomic locus is the IL2RG genomic locus. In some such methods, the genomic locus is not the IL2RG genomic locus. In some such methods, the method comprises editing the IL2RG genomic locus to express the first isoform of IL2RG.

[0082] In some such methods, the editing step includes introducing into the cell (1) a nuclease agent or one or more nucleic acids encoding the nuclease agent, where the nuclease agent targets a nuclease target sequence in the genomic locus, and (2) an exogenous donor nucleic acid, wherein the nuclease agent cleaves the genomic locus and the exogenous donor nucleic acid is inserted into or recombines with the genomic locus to generate an edited cell that expresses the first isoform of IL2RG. In some such methods, the editing step includes introducing into the cell (1) a nuclease agent or one or more nucleic acids encoding the nuclease agent, where the nuclease agent targets a nuclease target sequence in the IL2RG genomic locus, and (2) an exogenous donor nucleic acid, wherein the nuclease agent cleaves the IL2RG genomic locus and the exogenous donor nucleic acid is inserted into or recombines with the IL2RG genomic locus to generate an edited cell that expresses the first isoform of IL2RG. In some such methods, the nuclease agent comprises (a) a zinc finger nuclease (ZFN), (b) a transcription activator-like effector nuclease (TALEN), or (c) (i) a Cas protein and (ii) a guide RNA comprising a DNA-targeting segment that targets a guide RNA target sequence that is a nuclease target sequence, wherein the guide RNA binds to the Cas protein and directs the Cas protein to the guide RNA target sequence. In some such methods, the nuclease agent comprises a Cas protein and a guide RNA, and optionally, the DNA-targeting segment comprises a sequence set forth in any one of SEQ ID NOs: 76-87, or optionally, the guide RNA target sequence comprises a sequence set forth in any one of SEQ ID NOs: 64-75. In some such methods, the Cas protein is a Cas9 protein. In some such methods, the exogenous donor nucleic acid comprises homology arms.In some such methods, the exogenous donor nucleic acid is a single-stranded oligodeoxynucleotide (ssODN), and optionally, the ssODN comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 88-117.

[0083] In another aspect, genetically engineered interleukin-2 receptor subunit gamma (IL2RG) proteins are provided that contain artificial mutations that provide altered epitopes. In some such proteins, the genetically engineered IL2RG proteins are functionally indistinguishable from, but immunologically distinguishable from, the native IL2RG protein. In another aspect, genetically engineered interleukin-2 receptor subunit gamma (IL2RG) proteins are provided that contain artificial mutations that provide altered epitopes, such that the genetically engineered IL2RG proteins are functionally indistinguishable from, but immunologically distinguishable from, the native IL2RG protein. In some such proteins, the altered epitope is in the binding region of an antibody comprising an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such proteins, the mutation comprises a mutation encoded by nucleotides within exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus. In some such proteins, the mutation comprises a mutation or substitution within the region from positions T127 to N150 and / or within the region from positions L87 to D97. In some such proteins, the artificial mutation comprises a mutation or substitution at positions M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, and / or K147. In some such proteins, the artificial mutation comprises a mutation or substitution at position M145, optionally wherein the substitution is an M145K, M145D, M145E, M145P, M145W, or M145Y substitution. In some such proteins, the artificial mutation comprises an M145K substitution.In some such proteins, the mutation comprises a mutation or substitution at position W90, and optionally the substitution is a W90V, W90R, W90Q, W90L, W90K, W90E, or W90D substitution. In some such proteins, the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

[0084] In some such proteins, the engineered IL2RG protein and the native IL2RG protein are functionally indistinguishable by an IL2RG antagonist but immunologically distinguishable. In some such proteins, the IL2RG antagonist is an antigen-binding protein. In some such proteins, the antigen-binding protein is an antibody or an antigen-binding fragment thereof. In some such proteins, the antigen-binding protein comprises an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such proteins, the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some such proteins, the immunoglobulin light chain or variable region thereof comprises, consists essentially of, or consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof comprises, consists essentially of, or consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 2. In some such proteins, the immunoglobulin light chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 2. In some such proteins, the IL2RG protein is a human IL2RG protein.

[0085] In another aspect, a nucleic acid encoding any of the above engineered IL2RG proteins is provided. [Brief explanation of the drawings]

[0086] [Figure 1] Figure 1 shows a schematic of the antibody-resistant engineered receptor (ARMoR) concept, which combines targeted host conditioning with donor cell editing to enhance cell-based therapies and transplants. This concept is a two-step approach that confers a competitive advantage to transplanted cells: (1) targeted suppression of host cells (e.g., T cells, NK cells, B cells, lymphoid precursors, hematologic cancers) with antibodies targeting IL2RG, and (2) ex vivo modification of transplanted cells to enhance survival in the host (IL2RG variant-antibody-resistant engineered receptor (ARMoR)). IL2RG variants retain cytokine signaling function but do not bind to anti-IL2RG antibodies.

[0087] [Figure 2-1]Figures 2A-2B show that host T cell suppression with IL2RG blockade creates a niche for sustained engraftment of donor REGN7257-resistant T cells in recipient Il2rghu / hu mice. Figure 2A shows a schematic of the experimental protocol. REGN7257 or REGN1945 isotype control was injected subcutaneously at 25 mg / kg twice weekly starting on day -25 (indicated by solid arrows). 20 x 10 donor CD4+ and CD8+ T cells were injected on day 0 (open arrows), and bone marrow, spleen, and blood samples were collected on day 24 (open arrows). Figure 2B shows that anti-IL2RG conditioning promoted the uptake of "ARMoR-type" donor T cells, which persisted and expanded over the course of 3 weeks post-transfer. At the indicated time points after transfer, blood was collected from mice treated with REGN7257 or isotype control, and the proportion (top row, as a percentage of total T cells) or count (bottom row, as cell counts / μL of blood) of donor T cells was quantified by flow cytometry. Data are presented as mean ± standard error. Multiple t-tests were performed between the REGN1945-treated group (n = 5 mice) and the REGN7257-treated group (n = 6 mice) at each week of blood collection using a two-step step-up (Benjamini, Krieger, and Yekutieli) multiple comparison test with a false discovery rate (FDR) set at 1%. Statistical significance was recorded for the following adjusted p-values: *<0.05, **<0.005, ***<0.001, ****<0.0001. [Figure 2-2] Same as above.

[0088] [Figure 3-1]Figures 3A-3C show that host T cell suppression with IL2RG blockade enhances antigen-specific REGN7257-resistant T cell infiltration into MC38-OVA tumors in Il2rgh u / hu mice. Figure 3A shows a schematic diagram of the experimental protocol. REGN7257 or REGN1945 isotype control was injected subcutaneously at 25 mg / kg twice weekly starting on day -25 (indicated by solid arrows). MC38 tumor cells expressing the ovalbumin (OVA) antigen were implanted on day 0 (open arrow), and 0.1–1 × 10 donor CD8+ T cells from OT-I mice were injected on day 3 (open arrow). Bone marrow, spleen, blood, tumor-draining lymph nodes, and tumor samples were collected on day 24 (open arrows). Figures 3B-3C show that donor OT-I CD8+ T cells predominate among tumor-infiltrating T cells in Il2rghu / hu mice conditioned with REGN7257. Three weeks after implantation, tumor-infiltrating leukocyte populations were quantified by flow cytometry. Figure 3B shows representative plots quantifying total CD4+ and CD8+ T cells (left column) and OVA-specific T cells (right column) identified by pMHC tetramer staining in mice receiving the indicated treatments. Figure 3C shows the percentages (top row) and counts (bottom row, cells per mg of tumor) of the indicated cell populations for all mice in this study. Data are presented as mean ± standard error. A standard one-way ANOVA was used to compare the following groups: treated with REGN1945 without OT-I transfer (n = 5 mice), treated with REGN1945 with 1E6 OT-I cells transferred (n = 3 mice), treated with REGN7257 without OT-I transfer (n = 6 mice), treated with REGN7257 with 1E5 OT-I cells transferred (n = 3 mice), and treated with REGN7257 with 1E6 OT-I cells transferred (n = 6 mice). Tukey's multiple comparison test was performed, and statistical significance was recorded for the following adjusted p-values: *<0.05, **<0.005, ***<0.001, ****<0.0001. [Figure 3-2] Same as above. [Figure 3-3] Same as above.

[0089] [Figure 4-1] Figures 4A-4C show that REGN7257 conditioning dramatically enhances the infiltration of "ARMoR" T cells into lymph nodes draining B16.F10.9-OVA tumors. Figure 4A shows a schematic of the experimental protocol. REGN7257 or REGN1945 isotype control was injected subcutaneously at 25 mg / kg twice weekly starting on day -25 (indicated by solid arrows). B16.F10.9 tumor cells expressing the ovalbumin (OVA) antigen were implanted on day 0 (open arrow), 1 x 10 donor CD8+ T cells from OT-I mice were injected on day 3 (open arrow), and samples were collected on day 24 (open arrow). Figures 4B-4C show that mice conditioned with REGN7257 exhibited enhanced infiltration of tumor-specific OT-I T cells into tumor-draining lymph nodes. Three weeks after implantation, leukocyte populations were quantified in tumor-draining lymph nodes (LNs) by flow cytometry. Figure 4B shows representative plots quantifying total CD4+ and CD8+ T cells (left column) and OVA-specific T cells identified by pMHC staining (right column) in mice receiving the indicated treatments. Figure 4C shows the percentages (top row) and counts (bottom row, cell numbers per LN) of the indicated cell populations for all mice in this study. Data are presented as mean ± standard error. A standard one-way ANOVA was used to compare the following groups: treated with REGN1945, no OT-I transfer (n = 7 mice), treated with REGN1945, transferred with 1E6 OT-I cells (n = 7 mice), treated with REGN7257, no OT-I transfer (n = 5 mice), and treated with REGN7257, transferred with 1E6 OT-I cells (n = 7 mice). Tukey's multiple comparison test was performed, and statistical significance was recorded for the following adjusted p-values: *<0.05, **<0.005, ***<0.001, ****<0.0001. [Figure 4-2] Same as above. [Figure 4-3] Same as above.

[0090] [Figure 5-1]Figures 5A-5D show that REGN7257 conditioning dramatically enhanced the ability of adoptively transferred "ARMoR" T cells to regress established B16.F10.9-OVA tumors, paralleling enhanced tumor infiltration. Figure 5A shows a schematic of the experimental protocol. REGN7257 or REGN1945 isotype control was injected subcutaneously at 25 mg / kg twice weekly starting on day -25 (indicated by solid arrows). B16.F10.9 tumor cells expressing the ovalbumin (OVA) antigen were implanted on day 0 (open arrow), and 1 x 10 donor CD8+ T cells from OT-I mice were injected on days 13, 18, and 24 (open arrows). Samples were subsequently collected for analysis. Figure 5B shows that REGN7257-conditioned mice receiving OT-I T cell infusions starting 13 days after tumor implantation exhibited enhanced tumor regression compared to isotype (REGN1945)-conditioned mice, as measured by tumor volume. Figure 5C shows a representative flow cytometry plot (left) and quantification summary (right) of CD8+ T cells infiltrating tumor-draining lymph nodes (LNs). Infiltration of OVA-specific OT-I T cells, as identified by pMHC tetramer staining, was enhanced in REGN7257-conditioned mice. Figure 5D shows quantification of tumor-infiltrating OVA-specific T cells as a percentage of total viable cells obtained from resected tumors. Infiltration of OVA-specific OT-I T cells, as identified by pMHC tetramer staining, was enhanced in REGN7257-conditioned mice. Data are presented as mean ± standard error. A standard one-way ANOVA was used to compare the following groups: treated with REGN1945, no OT-I transfer (n = 8 mice), treated with REGN1945, transferred with 1E6 OT-I cells (n = 8 mice), treated with REGN7257, no OT-I transfer (n = 6 mice), and treated with REGN7257, transferred with 1E6 OT-I cells (n = 7 mice). Tukey's multiple comparison test was performed, and statistical significance was recorded for the following adjusted p-values: *<0.05, **<0.005, ***<0.001, ****<0.0001. [Figure 5-2] Same as above. [Figure 5-3] Same as above. [Figure 5-4] Same as above.

[0091] [Figure 6-1] Figures 6A-6E show the generation of REGN7257 binding region 1 and variants. Figure 6A shows a comparison of human and mouse IL2RG sequences in binding region 1, as well as the generation of mutants. Figure 6B shows the expression of IL2RG (myc-tagged) variants and quantification of REGN7257 binding. Constructs were transfected into 293T cells, and the cells were stained with anti-myc (left column) or REGN7257 (right column). Figure 6C shows the binding of REGN7257 to YT cells expressing IL2RG variants. YT cells were transduced with lentiviral vectors encoding the indicated variants and stained with REGN7257 at the concentrations indicated on the x-axis. Binding was quantified by flow cytometry (y-axis, gMFI = geometric mean fluorescence intensity). Figures 6D-6E show the screening of additional substitutions at M145. Figure 6D shows anti-myc binding to myc-tagged IL2RG variants with the indicated amino acid substitutions at M145 expressed in 293T cells. Figure 6E shows REGN7257 binding to myc-tagged IL2RG variants with the indicated amino acid substitutions at M145 expressed in 293T cells. Binding was quantified by flow cytometry (y-axis, gMFI = geometric mean fluorescence intensity). [Figure 6-2] Same as above. [Figure 6-3] Same as above. [Figure 6-4] Same as above.

[0092] [Figure 7-1]Figures 7A-7F show that IL2RG variants with mutations in REGN7257-binding region 1 signal efficiently in response to gamma chain cytokines and avoid signaling blockade by REGN7257. Figure 7A shows endogenous IL2RG expression in YT cells engineered to have a STAT5-responsive luciferase response (YT.STAT5.luc, top row) compared to YT.STAT5.luc cells in which endogenous IL2RG was knocked out and the indicated IL2RG variants were reintroduced by lentiviral transduction (remaining rows). Figure 7B shows luciferase activity in YT.STAT5.luc cells expressing the indicated IL2RG variants in response to titration of human IL2 (triangles) or at a constant IL2 concentration (3.3e-11 M) in the presence of REGN7257 (squares) or isotype (circles). Figure 7C shows luciferase activity in YT.STAT5.luc cells expressing the indicated IL2RG variants in response to titration of human IL15 (triangles) or at a constant IL15 concentration (3.9e-11 M) in the presence of REGN7257 (squares) or isotype (circles). Figure 7D shows luciferase activity in YT.STAT5.luc.hIL7Ra cells expressing the indicated IL2RG variants in response to titration of human IL7 (triangles) or at a constant IL7 concentration (2.9e-11 M) in the presence of REGN7257 (squares) or isotype (circles). Figure 7E shows luciferase activity in YT.STAT5.luc cells expressing the indicated IL2RG variants in response to titration of human IL21 (triangles) or at a constant IL21 concentration (3.2e-11 M) in the presence of REGN7257 (squares) or isotype (circles). Figure 7F shows luciferase activity in Ramos.STAT3.luc cells expressing the indicated IL2RG variants in response to titration of human IL4 (triangles) or at a constant IL4 concentration (3.6e-11 M) in the presence of REGN7257 (squares) or isotype (circles). [Figure 7-2] Same as above. [Figure 7-3] Same as above. [Figure 7-4] Same as above. [Figure 7-5] Same as above. [Figure 7-6] Same as above. [Figure 7-7] Same as above. [Figure 7-8] Same as above. [Figure 7-9] Same as above. [Figure 7-10] Same as above. [Figure 7-11] Same as above. [Figure 7-12] Same as above.

[0093] [Figure 8] Figure 8 shows that REGN7257 suppresses the growth of primary human T cells in vitro. T cells isolated from peripheral blood were activated and grown in the presence of REGN7257 (squares) or isotype (circles) at low (20 U / mL, left plot) or high (100 U / mL) human IL2 levels.

[0094] [Figure 9-1]Figures 9A-B show that IL2RG variants with mutations in REGN7257-binding region 1 support IL2-dependent growth of primary T cells and confer resistance to REGN7257 growth inhibition. T cells isolated from human peripheral blood were activated and transduced with lentiviral vectors coexpressing IL2RG variants and green fluorescent protein (GFP). Cells were then cultured in the presence of human IL2 with REGN7257 or isotype, and cells expressing the indicated IL2RG variants were quantified based on GFP expression over time. Figure 9A shows that REGN7257 treatment (lower plot) increased the proportion of GFP+ cells expressing REGN7257-resistant variants, but not REGN7257-sensitive variants. Treatment with isotype (upper plot) did not change the proportion of GFP+ cells in either case. Thus, cells expressing IL2RG variants resistant to REGN7257 escaped growth inhibition and had a growth advantage over untransduced T cells. Figure 9B shows a comparison of the IL2-dependent growth kinetics of primary T cells expressing transduced IL2RG variants (GFP+, squares) compared with untransduced cells expressing only endogenous IL2RG (GFP-, circles). In the presence of REGN7257, GFP+ cells expressing the REGN7257-resistant variant (bottom row) showed similar expansion to untransduced cells, whereas GFP+ cells expressing the REGN7257-sensitive variant (top row) did not. Thus, cells expressing IL2RG variants with mutations in the REGN7257-binding region 1 that disrupt REGN7257 binding escaped growth inhibition and supported the IL2-dependent growth of normal human T cells. [Figure 9-2] Same as above.

[0095] [Figure 10]Figures 10A-10C show the screening and optimization of sgRNAs targeting the REGN7257 binding region 1 encoded within exon 3 of IL2RG in human T cells. Figure 10A shows a schematic diagram for editing exon 3 of the human IL2RG locus. Figure 10B shows the editing rate (indel formation) of 12 sgRNAs targeting exon 3. Three sgRNAs (sgRNAs 2, 8, and 11) showed the highest indel rates, and each was further tested in the presence of an ssODN donor template. Figure 10C shows the editing rate (introduction of the M145K mutation) when sgRNAs 2, 8, and 11 were cotransfected with 10 different ssODN designs (D1-D10) of various lengths, symmetries, and sense / antisense orientations relative to the sgRNA cleavage site.

[0096] [Figure 11-1] Figures 11A-11C show the expression of IL2RG variants with mutations in REGN7257-binding region 2 and the binding of REGN7257 to the IL2RG variants. Figure 11A shows a comparison of human and mouse IL2RG sequences in binding region 2 (top) and the expression and REGN7257 binding of the IL2RG (myc-tagged) W90 variant measured by flow cytometry (bottom). The constructs were transfected into 293T cells, and the cells were stained with anti-myc (left column) or REGN7257 (right column). Figure 11B shows the quantification of the expression of transfected myc-tagged IL2RG variants by flow cytometry (gMFI = geometric mean fluorescence intensity). Figure 11C shows the quantification of REGN7257 binding to transfected IL2RG variants (gMFI = geometric mean fluorescence intensity). [Figure 11-2] Same as above. [Figure 11-3] Same as above.

[0097] [Figure 12-1]Figures 12A-12E show that IL2RG variants with mutations in REGN7257-binding region 2 signal efficiently in response to gamma chain cytokines and avoid signaling blockade by REGN7257. Figure 12A shows luciferase activity in YT.STAT5.luc cells expressing the indicated IL2RG variants in response to titration of human IL2 (triangles) or at a constant IL2 concentration (3.3e-11M) in the presence of REGN7257 (squares) or isotype (circles). Figure 12B shows luciferase activity in YT.STAT5.luc cells expressing the indicated IL2RG variants in response to titration of human IL15 (triangles) or at a constant IL15 concentration (3.9e-11M) in the presence of REGN7257 (squares) or isotype (circles). Figure 12C shows luciferase activity in YT.STAT5.luc.hIL7Ra cells expressing the indicated IL2RG variants in response to titration of human IL7 (triangles) or at a constant IL7 concentration (2.9e-11 M) in the presence of REGN7257 (squares) or isotype (circles). Figure 12D shows luciferase activity in YT.STAT5.luc cells expressing the indicated IL2RG variants in response to titration of human IL21 (triangles) or at a constant IL21 concentration (3.2e-11 M) in the presence of REGN7257 (squares) or isotype (circles). Figure 12E shows luciferase activity in Ramos.STAT3.luc cells expressing the indicated IL2RG variants in response to titration of human IL4 (triangles) or at a constant IL4 concentration (3.6e-11M) in the presence of REGN7257 (squares) or isotype (circles). [Figure 12-2] Same as above. [Figure 12-3] Same as above. [Figure 12-4] Same as above. [Figure 12-5] Same as above. [Figure 12-6] Same as above. [Figure 12-7] Same as above. [Figure 12-8] Same as above.

[0098] [Figure 13] Figure 13 shows that IL2RG variants with mutations in REGN7257-binding region 2 support IL2-dependent growth of primary T cells and confer resistance to REGN7257 growth inhibition. T cells isolated from human peripheral blood were activated and transduced with lentiviral vectors co-expressing IL2RG variants and green fluorescent protein (GFP). Cells were then cultured in the presence of human IL2 with REGN7257 or isotype, and cells expressing the indicated IL2RG variants were quantified over time based on GFP expression. Growth kinetic curves of primary T cells expressing transduced IL2RG variants (GFP+, squares) compared with untransduced cells expressing only endogenous IL2RG (GFP-, circles). In the presence of REGN7257, GFP+ cells expressing the REGN7257-resistant variant (bottom row) expanded similarly to untransduced cells, whereas GFP+ cells expressing the REGN7257-sensitive variant (top row) did not. Thus, cells expressing an IL2RG variant with a mutation in REGN7257-binding region 2 that disrupts REGN7257 binding escape growth suppression and support the IL2-dependent growth of normal human T cells.

[0099] [Figure 14]Figures 14A-14C show the screening and optimization of sgRNAs targeting the REGN7257-binding region 2 encoded within exon 2 of IL2RG in human T cells. Figure 14A shows a schematic diagram for editing exon 2 of the human IL2RG locus. Figure 14B shows the editing rates (indel formation) of 18 sgRNAs targeting exon 2. Two sgRNAs (sgRNAs 14 and 15) that target the vicinity of the codon encoding W90 and showed high indel rates were further tested in the presence of ssODN donor templates. Figure 14C shows the editing rates (introduction of the W90Q mutation) when sgRNAs 14 and 15 were cotransfected with 10 different ssODN designs (D1-D10) of various lengths, symmetries, and sense / antisense orientations relative to the sgRNA cleavage site.

[0100] [Figure 15-1] Figures 15A-15D show the generation of iNKARMoR, which conferred resistance to REGN725 by targeted editing of the endogenous IL2RG locus. Figure 15A shows the schematic design for generating iNKARMoR through knocking in ARMoR (IL2RG M145K) into induced pluripotent stem cells (iPSCs) and differentiating iPSC-derived NK (iNK) cells. Figure 15B shows that iPSC-ARMoR have similar NK differentiation potential to iPSC-WT. iPSC-WT and iPSC-ARMoR cells were differentiated into iNK cells in vitro, and the percentage of resulting CD45+CD56+ iNK cells was determined by flow cytometry. Figure 15C shows that iNKARMoR cells have reduced REGN7257 binding compared to iNKWT cells, as measured by flow cytometry. FIG. 15D shows that iNKARMoR and iNKWT cells bind equivalently to a commercially available anti-IL2RG antibody that recognizes an epitope distal to REGN7257. [Figure 15-2] Same as above.

[0101] [Figure 16]Figure 16 shows that iNKARMoR cells evade the suppression of IL2- and IL15-dependent growth by REGN7257. Differentiated iNKARMoR and iNKWT cells were grown with IL2 (left graph) or IL15 (right graph) in the presence of REGN7257, isotype (REGN1945), or no antibody. Cell counts were determined at the indicated time points and reported normalized to cell counts at day 0 (D0).

[0102] [Figure 17] Figures 17A-17B show that human iNKARMoR cells engrafted in immunodeficient mice are resistant to suppression by REGN7257. Figure 17A shows a schematic diagram of the experimental protocol. Figure 17B shows that iNKARMoR has a competitive advantage over iNKWT in vivo in the presence of REGN7257. iNKARMoR and iNKWT cells were administered at a 1:1 ratio to irradiated host mice treated with REGN7257 or an isotype control. At the indicated time points after transfer, iNK cells (as a ratio to leukocytes) were quantified in peripheral blood by flow cytometry. Student's t-test was performed, and statistical significance was recorded for the following p-values: **<0.01. DETAILED DESCRIPTION OF THE INVENTION

[0103] definition The terms "protein," "polypeptide," and "peptide" are used interchangeably herein and include polymeric forms of amino acids of any length, including coded and non-coded amino acids, as well as amino acids that are chemically or biochemically modified or derivatized. The term also includes polymers that have been modified, e.g., polypeptides with modified peptide backbones. The term "domain" refers to any portion of a protein or polypeptide that has a specific function or structure.

[0104] Proteins are said to have an "N-terminus" (amino terminus) and a "C-terminus" (carboxy or carboxyl terminus). The term "N-terminus" refers to the beginning of a protein or polypeptide, ending with the amino acid having a free amine group (-NH2). The term "C-terminus" refers to the end of the amino acid chain (protein or polypeptide), ending with a free carboxyl group (-COOH).

[0105] The terms "nucleic acid" and "polynucleotide" are used interchangeably herein and include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. These include single-, double-, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers that contain purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, non-natural, or derivatized nucleotide bases.

[0106] Nucleic acids are said to have a "5' end" and a "3' end" because mononucleotides react to form oligonucleotides in such a way that the 5' phosphate of one mononucleotide pentose ring is unidirectionally linked to its adjacent 3' oxygen via a phosphodiester bond. The end of an oligonucleotide is referred to as the "5' end" if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring. The end of an oligonucleotide is referred to as the "3' end" if its 3' oxygen is not linked to the 5' phosphate of another mononucleotide pentose ring. A nucleic acid sequence can be said to have a 5' end and a 3' end even if it is internal to a larger oligonucleotide. In either a linear or circular DNA molecule, individual elements are referred to as being "upstream" or 5' of the "downstream" or 3' element.

[0107] The terms "expression vector" or "expression construct" or "expression cassette" refer to a recombinant nucleic acid containing a desired coding sequence operably linked to appropriate nucleic acid sequences required for expression of the operably linked coding sequence in a particular host cell or organism. Nucleic acid sequences required for expression in prokaryotes usually include a promoter, operator (optional), and ribosome binding site, as well as other sequences. Eukaryotic cells are known to generally utilize promoters, enhancers, and termination and polyadenylation signals, although some elements may be lacking and other elements may be added without sacrificing the necessary expression.

[0108] A "promoter" is a regulatory region of DNA, usually containing a TATA box, that can direct RNA polymerase II to initiate RNA synthesis at the appropriate transcription start site for a particular polynucleotide sequence. Generally, a "promoter" or "promoter sequence" is a DNA regulatory region that can bind RNA polymerase in a cell (e.g., directly or through other proteins or substances bound to the promoter) and initiate transcription of a coding sequence. A promoter can be operably linked to other expression control sequences, including enhancer and repressor sequences, and / or to a polynucleotide of the present invention.Promoters that can be used to control gene expression include the cytomegalovirus (CMV) promoter (U.S. Pat. Nos. 5,385,839 and 5,168,062, each of which is incorporated herein by reference in its entirety for all purposes), the SV40 early promoter region (Benoist et al. (1981) Nature 290:304-310, incorporated herein by reference in its entirety for all purposes), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al. (1980) Cell 22:787-797, incorporated herein by reference in its entirety for all purposes), the herpes thymidine kinase promoter (Wagner et al. (1981) Proc. Natl. Acad. Sci. USA 78:1441-1445, incorporated herein by reference in its entirety for all purposes), the regulatory sequences of the metallothionein gene (Brinster et al. (1982) Nature 296:39-42, incorporated herein by reference in its entirety for all purposes), prokaryotic expression vectors, such as the beta-lactamase promoter (Villa-Komaroff et al. (1978) Proc. Natl. Acad. Sci. USA 75:3727-3731, incorporated herein by reference in its entirety for all purposes), or the tac promoter (DeBoer et al. (1983) Proc. Natl. Acad. Sci. USA 80:21-25; see also "Useful proteins from recombinant bacteria" in Scientific American (1980) 242:74-94, each of which is incorporated herein by reference in its entirety for all purposes), and promoter elements derived from yeast or other fungi, such as, but not limited to, the Gal4 promoter, the ADC (alcohol dehydrogenase) promoter, the PGK (phosphoglycerol kinase) promoter, or the alkaline phosphatase promoter.

[0109] In some embodiments, the promoter may further comprise other regions that affect the rate of transcription initiation. The promoter sequence modulates the transcription of an operably linked polynucleotide. The promoter may be active in one or more cell types (e.g., eukaryotic cells, non-human mammalian cells, human cells, rodent cells, pluripotent cells, one-cell stage embryos, differentiated cells, or combinations thereof, but not limited to). The promoter may be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a temporally restricted promoter (e.g., but not limited to, a developmentally regulated promoter), or a spatially restricted promoter (e.g., but not limited to, a cell-specific or tissue-specific promoter).

[0110] "Operable linkage" or "operably linked" includes the juxtaposition of two or more components (e.g., but not limited to, a promoter and another sequence element) such that both components function normally and allow for the possibility that at least one of the components may mediate the function exerted by at least one of the other components. As a non-limiting example, a promoter may be operably linked to a coding sequence if the promoter controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. Operable linkage may include such sequences being adjacent to each other or acting in trans (e.g., but not limited to, a regulatory sequence may act at a distance to control transcription of a coding sequence). A polynucleotide encoding a polypeptide is "operably linked" to a promoter or other expression control sequence if, in a cell or other expression system, the sequence directs RNA polymerase-mediated transcription of the coding sequence into RNA, preferably mRNA, which can then undergo RNA splicing (if it contains introns) and, if necessary, be translated into the protein encoded by the coding sequence.

[0111] In the context of proteins, nucleic acids, and cells, the term "isolated" includes proteins, nucleic acids, and cells that have been purified relative to other cellular or biological components that may normally be present in situ, up to and including substantially pure preparations of proteins, nucleic acids, or cells. In some embodiments, the term "isolated" can include proteins and nucleic acids that have no naturally occurring counterpart, or proteins or nucleic acids that have been chemically synthesized and are therefore substantially free of other protein or nucleic acid contaminants. The term "isolated" can include proteins, nucleic acids, or cells that have been separated or purified from most other cellular or biological components that naturally accompany them (e.g., but are not limited to, other cellular proteins, nucleic acids, or cellular or extracellular components). "Isolated" antigen-binding proteins (e.g., antibodies or antigen-binding fragments thereof), polypeptides, polynucleotides, and vectors are at least partially free from other biological molecules derived from the cell or cell culture in which they are produced. Such biological molecules include nucleic acids, proteins, other antibodies or antigen-binding fragments, lipids, carbohydrates, or other materials, such as cell debris and growth medium. An isolated antigen-binding protein may further be at least partially free from components of the expression system, e.g., biological molecules derived from the host cell or its growth medium. In general, the term "isolated" is not intended to refer to the complete absence of such biological molecules (e.g., minor or insignificant amounts of impurities may remain), nor to the absence of water, buffers, or salts, nor to components of pharmaceutical formulations that include the antigen-binding protein (e.g., an antibody or antigen-binding fragment).

[0112] "Codon optimization" refers to the process of modifying a nucleic acid sequence to enhance expression in a particular host cell by taking advantage of the degeneracy of codons, which is represented by the multiplicity of three-base pair codon combinations that specify an amino acid, generally by replacing at least one codon of the native sequence with a codon that is more or most frequently used in the host cell's genes while maintaining the native amino acid sequence. As a non-limiting example, a nucleic acid encoding a protein can be modified to replace a codon with a higher frequency of use in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, or any other host cell, compared to the naturally occurring nucleic acid sequence. Codon usage tables are readily available, for example, in "codon usage databases." These tables can be adapted in several ways. See Nakamura et al. (2000) Nucleic Acids Res. 28(1):292, which is incorporated by reference in its entirety for all purposes. Computer algorithms for codon optimization of particular sequences for expression in particular hosts are also available (see, e.g., Gene Forge).

[0113] The term "locus" refers to the specific location on a chromosome of an organism's genome of a gene (or key sequence), DNA sequence, polypeptide-coding sequence, or location. As a non-limiting example, an "IL2RG locus" can refer to the specific location on a chromosome of an organism's genome of an IL2RG gene, IL2RG DNA sequence, IL2RG protein-coding sequence, or IL2RG location, which is specified with respect to where such sequence is located. An "IL2RG locus" can include regulatory elements of the IL2RG gene, including, as non-limiting examples, an enhancer, a promoter, a 5' and / or a 3' untranslated region (UTR), or a combination thereof.

[0114] The term "gene" refers to a DNA sequence in a chromosome that, when naturally occurring, may contain at least one coding region and at least one non-coding region. A DNA sequence in a chromosome that encodes a product (e.g., but not limited to, an RNA product and / or a polypeptide product) may include coding regions interrupted by non-coding introns and sequences located adjacent to the coding region at both the 5' and 3' ends, such that the gene corresponds to a full-length mRNA (including 5' and 3' untranslated sequences). In addition, other non-coding sequences may be present in a gene, including regulatory sequences (e.g., but not limited to, promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulator sequences, and matrix attachment regions. These sequences may be located near the coding region of a gene (e.g., within 10 kb) or at distal sites, and they may affect the level or rate of gene transcription and translation.

[0115] The term "allele" refers to a variant form of a gene. Some genes have different forms that are located at the same position on a chromosome, or genetic locus. Diploid organisms have two alleles at each genetic locus. Each pair of alleles represents a genotype at a particular genetic locus. A genotype is described as homozygous if there are two identical alleles at a particular locus, and as heterozygous if the two alleles are different.

[0116] The term "wild-type" includes entities having a structure (e.g., but not limited to, a nucleotide sequence or amino acid sequence) as found in a normal (as opposed to mutant, affected, altered, etc.) state or context. Wild-type genes and polypeptides often exist in multiple alternative forms (e.g., alleles).

[0117] The term "variant" refers to a nucleotide sequence that differs (for example, but not limited to, by a single nucleotide) from the most prevalent sequence in a population, or a protein sequence that differs (for example, but not limited to, by a single amino acid) from the most prevalent sequence in a population.

[0118] The term "fragment," when referring to a protein, refers to a protein that is shorter or has fewer amino acids than the full-length protein. The term "fragment," when referring to a nucleic acid, refers to a nucleic acid that is shorter or has fewer nucleotides than the full-length nucleic acid. Non-limiting examples of protein fragments can include an N-terminal fragment (i.e., removal of a portion of the C-terminus of the protein), a C-terminal fragment (i.e., removal of a portion of the N-terminus of the protein), or an internal fragment (i.e., removal of a portion of an internal portion of the protein).

[0119] "Sequence identity" or "identity" in the context of two polynucleotide or polypeptide sequences refers to residues that are the same in the two sequences when aligned for maximum correspondence over a specified comparison window. When percentage sequence identity is used in reference to proteins, non-identical residue positions often differ by conservative amino acid substitutions, in which an amino acid residue is replaced with another amino acid residue having similar chemical properties (e.g., but not limited to, charge or hydrophobicity), thus not altering the functional properties of the molecule. When sequences differ by conservative substitutions, the percent sequence identity may be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known. Typically, this involves scoring conservative substitutions as partial rather than complete mismatches, thereby increasing the percentage sequence identity. Thus, as a non-limiting example, where identical amino acids are given a score of 1 and non-conservative substitutions are given a score of 0, conservative substitutions are given a score between 0 and 1. Conservative substitution scoring is calculated, for example, as implemented in the program PC / GENE (Intelligenetics, Mountain View, California).

[0120] "Percentage sequence identity" includes a value determined by comparing two optimally aligned sequences (the maximum number of perfectly matched residues) over a comparison window, where the portion of the polynucleotide sequence within the comparison window may contain additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) due to optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base or amino acid residue occurs in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions within the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Unless otherwise specified (e.g., the shorter sequence includes a linked heterologous sequence), the comparison window is the full length of the shorter of the two sequences being compared.

[0121] Unless otherwise indicated, sequence identity / similarity values ​​include values ​​obtained using GAP version 10 using the following parameters: % identity and % similarity using a GAP weight of 50 and a length weight of 3, and the nwsgapdna.cmp scoring matrix for nucleotide sequences; % identity and % similarity using a GAP weight of 8 and a length weight of 2, and the BLOSUM62 scoring matrix for amino acid sequences; or any equivalent program. "Equivalent program" includes any sequence comparison program that produces alignments for any two sequences at issue that have identical nucleotide or amino acid residue matches and identical percent sequence identity compared to corresponding alignments produced by GAP version 10.

[0122] The term "in vitro" includes an artificial environment and processes or reactions that occur within an artificial environment (e.g., but not limited to, a test tube or an isolated cell or cell system). The term "in vivo" includes a natural environment (e.g., but not limited to, an organism or body, or a cell or tissue within an organism or body) and processes or reactions that occur within a natural environment. The term "ex vivo" includes cells that have been removed from an individual's body and processes or reactions that occur within such cells.

[0123] "As needed" or "as necessary" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where the event or circumstance does not occur.

[0124] References to ranges of values ​​include all integers within or defining the range, and all subranges defined by integers within that range.

[0125] Unless the context makes clear otherwise, the term "about" encompasses values ​​±5 of the specified value.

[0126] The term "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0127] The term "or" refers to any one member of a particular list.

[0128] The singular articles "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a protein" or "at least one protein" can include multiple proteins and can include mixtures thereof.

[0129] Statistically significant means p≦0.05. Detailed Description I. Overview

[0130] Immune cell therapy holds great promise for many human diseases. One of the oldest examples is bone marrow transplantation, in which the recipient's entire immune system can be replaced with autologous or allogeneic bone marrow transplantation. This procedure also allows for the correction of congenital hematopoietic deficiencies and the repopulation of the immune system after treatment to eradicate hematologic malignancies. Newer examples include immune cells engineered with antigen receptors to target tumors (e.g., CAR-T, eTCR, CAR-NK, and CAR macrophage). In all of these cases, patients must undergo a "conditioning" regimen before cell transplantation, which can function to "make room" in the host immune niche to support the uptake of donor cells and, in some cases, to suppress host-versus-graft immune responses that can lead to graft rejection.

[0131] Conditioning regimens range in intensity from partial to complete myeloablative, the latter being necessary when pathogenic host immune cells must be completely eradicated (e.g., for hematological malignancies). In any case, the current standard of care for host conditioning has significant drawbacks. First, the conditioning agents are toxins (e.g., DNA-damaging agents) that are not specific to the desired target cells and therefore pose harmful and even life-threatening risks to the patient. Furthermore, the conditioning agents are toxic to donor cells as well as the host, and therefore must be discontinued before transplantation to avoid inhibiting life-saving cell therapy. Due to these difficult challenges, the application of cell therapy is usually limited to urgent cases when no treatment options remain.

[0132] Lymphoid suppressants have numerous potential applications for host conditioning for transplantation and adoptive cell therapy: (1) preventing allograft rejection through T and NK cell suppression (e.g., bone marrow transplants, gene-corrected cell therapy), (2) non-genotoxic clearance of immune niche space for engineered cell therapies (e.g., CAR-T, TCR-T, Treg, NK, B cells, progenitor cells), (3) eliminating endogenous cytokine "sinks" and making essential factors more available to graft cells, and (4) post-transplant immunosuppression that is less stringent and less toxic than standard of care agents.

[0133] An obstacle to using lymphoid suppressive agents as conditioning therapies is the susceptibility of transplanted cells in addition to target host cells. Provided herein are strategies to address these challenges through (1) the development of targeted conditioning regimens utilizing antibodies that specifically target desired host cells, e.g., as monotherapy, combinations, bispecific antibodies, antibody-drug conjugates (ADCs), or scFv-engineered CAR-Ts, and (2) the modification of donor cells to render them resistant to these antibody-based conditioning agents. Collectively, this constitutes the concept of antibody-resistant modified receptor (ARMoR). The underlying idea is to make minimal changes to immune cell receptors in transplanted donor cells to abolish binding by suppressive antibody agents. An overview of this strategy is shown in Figure 1, using the non-limiting example of an engineered interleukin-2 receptor subunit gamma (IL2RG) variant that is resistant to anti-IL2RG-mediated blockade of cytokine signaling essential for lymphocyte function. The goal is to introduce a fully functional form of the receptor into the cell therapy product that is not recognized by the conditioning agent. This can be achieved by modifications to the antibody recognition site that abolish binding but preserve receptor function. As a result, the host cells remain sensitive to the conditioning agent, but the engineered transplant cells are resistant, thus gaining a competitive advantage in host repopulation. The fundamental goal is to confer a competitive advantage to transplant cell therapy in the host patient by applying selective pressure that specifically targets host cells while ensuring donor-derived cell therapy.

[0134] Methods are provided for improving engraftment of donor cells in a subject thereof. Such methods may include providing donor cells that express (e.g., have been modified to express) a first isoform of a target protein (e.g., interleukin-2 receptor subunit gamma (IL2RG)), administering the donor cells to the subject, and then selectively depleting host cells in the subject based on expression of a second isoform of the target protein, thereby improving engraftment of the donor cells in the subject. For example, such methods may include providing donor cells that express (e.g., have been modified to express) a first isoform of a target protein (e.g., interleukin-2 receptor subunit gamma (IL2RG)), administering the donor cells to the subject, and then selectively inhibiting host cells in the subject based on expression of the second isoform of the target protein, thereby improving engraftment of the donor cells in the subject. Alternatively, such methods may include providing donor cells that express (e.g., have been modified to express) a first isoform of a target protein (e.g., interleukin-2 receptor subunit gamma (IL2RG)), administering the donor cells to a subject, and then selectively ablating host cells in the subject based on expression of a second isoform of the target protein, thereby improving engraftment of the donor cells in the subject. The donor cells may express only the first isoform, or they may express both the first and second isoforms of the target protein. The first isoform may be functionally indistinguishable from the second isoform of the target protein, but may be immunologically distinguishable. In some embodiments, the target protein is a protein expressed on the cell surface of hematopoietic cells, e.g., lymphocytes. In some embodiments, the target protein is a receptor, e.g., a cytokine receptor or a chemokine receptor (e.g., in some embodiments, the receptor is a cytokine receptor).In some embodiments, the target protein is a cytokine receptor subunit of an interleukin-2 (IL-2) receptor, an IL-4 receptor, an IL-7 receptor, an IL-9 receptor, an IL-15 receptor, or an IL-21 receptor. For example, the target protein can be IL2RG. In some embodiments, the selective inhibition of host cells can be based on the expression of only the second isoform of the target protein and the absence of expression of the first isoform of the target protein. Alternatively, the selective inhibition of host cells can be based on the expression of the second isoform of the target protein, regardless of the expression of the first isoform of the target protein. The selective inhibition of host cells does not include ablation (i.e., killing) of host cells by a mechanism extrinsic to the cells, for example, via an active killing mechanism. The selective inhibition of host cells does not include ablation (i.e., killing) of host cells by an active killing mechanism. Active killing mechanisms mean that an agent directly kills host cells by a cytotoxic mechanism (e.g., antibody-drug conjugate (ADC), antibody radioconjugate (ARC), CAR-T, or other engineered cytotoxic) or recruits host cytotoxic effector mechanisms (e.g., complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP)), as opposed to blockade of a cellular function that does not involve exogenous cytotoxic effectors (e.g., growth or cytokine signaling, chemotactic tissue homing, cell-cell adhesion, e.g., by selective inhibition). Such host cytotoxic effector mechanisms are well known. See, e.g., Yu et al. (2020) J. Hematol. Oncol. 13(1):45 and Gogesch et al. (2021) Int. J. Mol. Sci. 22(16):8947, each of which is incorporated by reference in its entirety for all purposes. As a novel conditioning strategy, selective inhibition of host cells without cytotoxic ablation has the potential to improve the safety and efficacy of cell therapy and transplantation procedures.Non-ablative conditioning can avoid the undesirable and harmful effects of ablative agents, including direct killing of non-target (e.g., non-hematopoietic) cells expressing the drug target antigen, indirect toxicity to tissues adjacent to the target, and long-term immunosuppression during the post-transplant period. Selective blockade or inhibition of essential host cell factors can enhance the expansion, persistence, and trafficking of tolerant donor cells without the use of potent and potentially toxic ablative agents by providing desirable competition for limited host factors (e.g., cytokines, chemokines) and immune niche space. See, for example, Figures 2A-5D. In some embodiments, selective inhibition of host cells may include (1) blocking host cell growth to provide a competitive growth advantage to donor cells, (2) blocking host cell localization or trafficking to provide a competitive homing advantage to donor cells, (3) blocking host cell cell-cell interaction or adhesion to provide a competitive tissue infiltration advantage to donor cells, or (4) blocking immune cell activation in host cells to provide a competitive advantage to donor cells. For example, in some embodiments, selective inhibition of host cells includes blocking growth (i.e., proliferation) and / or blocking immune cell activation. For example, in some embodiments, selective inhibition of host cells includes blocking growth (i.e., proliferation) and blocking immune cell activation. For example, in some embodiments, selective inhibition of host cells includes blocking growth (i.e., proliferation). For example, in some embodiments, selective inhibition includes blocking immune cell activation. Also provided is a combination for administration to a subject in need thereof, comprising: (1) a donor cell population that expresses (e.g., has been modified to express) a first isoform of a target protein (e.g., IL2RG); and (2) an agent (e.g., an antagonist, e.g., an antigen-binding protein) that specifically binds to a second isoform of the target protein but not to the first isoform of the target protein.

[0135] Methods are provided for the in vivo selective depletion of non-edited cells in a subject. Methods are provided for the in vivo selective depletion of non-edited cells and the regrowth of edited cells in a subject. Such methods may include providing cells edited to express a first isoform of a target protein (e.g., interleukin-2 receptor subunit gamma (IL2RG)), administering the edited cells to the subject, and then selectively depleting non-edited cells in the subject based on expression of a second isoform of the target protein. Such methods may include providing cells edited to express a first isoform of the target protein that is functionally indistinguishable but immunologically distinguishable from the second isoform of the target protein (e.g., interleukin-2 receptor subunit gamma (IL2RG)), administering the edited cells to the subject, and then selectively depleting non-edited cells in the subject based on expression of the second isoform of the target protein. For example, selective depletion of non-edited cells can be based on the expression of only the second isoform of the target protein and the absence of expression of the first isoform of the target protein. Alternatively, they can be depleted based on the expression of the second isoform, regardless of the expression of the first isoform of the target protein. The first isoform can be functionally indistinguishable from the second isoform of the target protein, but immunologically distinguishable. Edited cells can express only the first isoform, or they can express both the first and second isoforms of the target protein. Also provided is a combination for administration to a subject in need thereof, comprising: (1) a cell population edited to express the first isoform of a target protein (e.g., IL2RG); and (2) an agent (e.g., an antagonist, e.g., an anti-IL2RG antigen-binding protein) that specifically binds to the second isoform of the target protein but not to the first isoform of the target protein.

[0136] Also provided are isolated cells or cell populations modified to express a first isoform of a target protein that is different from a second isoform of the target protein. The cells may express only the first isoform, or they may express both the first and second isoforms. In some embodiments, the target protein is a protein expressed on the cell surface of a hematopoietic cell, e.g., a lymphocyte. In some embodiments, the target protein is a receptor, e.g., a cytokine receptor or a chemokine receptor (e.g., in some embodiments, the receptor is a cytokine receptor). In some embodiments, the target protein is a cytokine receptor subunit of an interleukin-2 (IL-2) receptor, an IL-4 receptor, an IL-7 receptor, an IL-9 receptor, an IL-15 receptor, or an IL-21 receptor. For example, the target protein can be IL2RG. The first isoform can be functionally indistinguishable from the second isoform, but immunologically distinguishable. The cells may express only the first isoform, or they may express both the first and second isoforms. Also provided are isolated cells or cell populations in which a genomic locus has been edited to express a first isoform of a target protein that is different from a second isoform. Also provided are methods for producing such cells.

[0137] Also provided are isolated cells or cell populations that have been edited (i.e., modified) to express a first isoform of IL2RG that is different from a second isoform of IL2RG. The first isoform may be functionally indistinguishable from the second isoform of IL2RG, but may be immunologically distinguishable. The edited cells may express only the first isoform, or they may express both the first and second isoforms of IL2RG. Also provided are isolated cells or cell populations whose genomic loci have been edited to express a first isoform of IL2RG that is different from the second isoform of IL2RG. The first isoform may be functionally indistinguishable from the second isoform of IL2RG, but may be immunologically distinguishable. The edited cells may express only the first isoform, or they may express both the first and second isoforms of IL2RG. Also provided are isolated cells or cell populations in which the IL2RG genomic locus has been edited to express a first isoform of IL2RG that is different from a second isoform of IL2RG, wherein the first and second isoforms are functionally indistinguishable but immunologically distinguishable. Methods of making such cells are also provided, as are engineered IL2RG proteins and nucleic acids encoding the engineered IL2RG proteins.

[0138] In some embodiments, the cells (e.g., donor cells or edited cells) in the compositions and methods comprise or express a therapeutic molecule, e.g., a therapeutic protein or enzyme, an immunoglobulin (e.g., an antibody or an antigen-binding fragment thereof), a chimeric antigen receptor (CAR) (e.g., CAR-T cells, CAR-NK cells), or an exogenous T cell receptor (TCR). In some embodiments, the therapeutic molecule, immunoglobulin, CAR, or exogenous TCR does not target a target protein (e.g., IL2RG). For example, the donor cells or edited cells can be engineered to express a therapeutic molecule that has therapeutic activity against any disease, e.g., any type of cancer (e.g., regardless of whether the target protein is associated with the disease or cancer), including diseases or cancers that are not associated with the target protein (e.g., the target proteins discussed above are not targeted to treat a disease or cancer, but the compositions and methods disclosed herein may provide a competitive advantage to cells that comprise or express a therapeutic molecule). For example, the disease or cancer may be a disease or cancer not associated with the target protein (e.g., the target protein does not cause the disease or cancer and / or expression of the target protein does not correlate with the disease or cancer). In some such embodiments, the therapeutic molecule may target diseased cells and / or antigens expressed on diseased cells (e.g., tumor-associated antigens). II. Methods for Improving Engraftment of Donor Cells in a Subject

[0139] In some embodiments of the present invention, a method for improving the engraftment of donor cells in a subject is provided. Such a method may include providing donor cells that express (e.g., have been modified to express) a first isoform of a target protein that is different from a second isoform of the target protein, where the second isoform is expressed in host cells of the subject. The target protein may be, for example, a protein expressed on the cell surface of a hematopoietic cell. The first isoform may be functionally indistinguishable from the second isoform of the target protein, but may be immunologically distinguishable. In some embodiments, the donor cells express only the first isoform of the target protein. In other embodiments, the donor cells express both the first and second isoforms of the target protein. Such a method may include providing donor cells whose target genomic locus has been edited to express the first isoform of the target protein. The donor cells may then be administered to a subject, selectively depleting host cells in the subject based on the expression of the second isoform of the target protein, thereby improving the engraftment of donor cells in the subject. For example, the selective depletion of host cells can be based on the expression of only the second isoform of the target protein and the absence of expression of the first isoform of the target protein. Alternatively, the selective depletion of host cells can be based on the expression of the second isoform, regardless of the expression of the first isoform of the target protein. For example, host cells in a subject can be selectively inhibited based on the expression of the second isoform of the target protein, thereby improving the engraftment of donor cells in the subject. For example, the selective inhibition of host cells can be based on the expression of only the second isoform of the target protein and the absence of expression of the first isoform of the target protein. Alternatively, the selective inhibition of host cells can be based on the expression of the second isoform, regardless of the expression of the first isoform of the target protein. Alternatively, host cells in a subject can be selectively ablated based on the expression of the second isoform of the target protein, thereby improving the engraftment of donor cells in the subject.For example, the selective ablation of host cells can be based on the expression of only the second isoform of the target protein and the absence of expression of the first isoform of the target protein. Alternatively, the selective depletion of host cells can be based on the expression of the second isoform of the target protein, regardless of the expression of the first isoform of the target protein.

[0140] In some embodiments of the present invention, a method for selectively depleting non-edited cells in a subject is provided. In some embodiments of the present invention, a method for selectively depleting non-edited cells in a subject and repopulating the edited cells is provided. Such a method may include providing edited cells that have been modified to express a first isoform of a target protein that is different from a second isoform of the target protein, where the second isoform is expressed in non-edited cells of the subject. The first isoform may be functionally indistinguishable from the second isoform of the target protein but may be immunologically distinguishable. In some embodiments, the edited cells express only the first isoform of the target protein. In other embodiments, the edited cells express both the first and second isoforms of the target protein. Such a method may include providing edited cells in which a target genomic locus has been edited to express a first isoform of a target protein that is different from the second isoform of the target protein, where the second isoform is expressed in non-edited cells of the subject. The first isoform may be functionally indistinguishable from the second isoform of the target protein but may be immunologically distinguishable. In some embodiments, the edited cells express only the first isoform of the target protein. In other embodiments, the edited cells express both the first and second isoforms of the target protein. Such methods may include providing edited cells in which the target genomic locus has been edited to express a first isoform of the target protein that is different from the second isoform of the target protein, wherein the first and second isoforms are functionally indistinguishable but immunologically distinguishable, and the second isoform is expressed in non-edited cells of the subject. The edited cells may then be administered to a subject, and non-edited cells in the subject may be selectively depleted based on the expression of the second isoform of the target protein.For example, the selective depletion of non-edited cells can be based on the expression of only the second isoform of the target protein and the absence of expression of the first isoform of the target protein. Alternatively, they can be depleted based on the expression of the second isoform of the target protein, regardless of the expression of the first isoform of the target protein.

[0141] The donor cell or the edited cell can be any suitable cell. Similarly, the host cell or the non-edited cell can be any suitable cell. In some embodiments, the cell is a hematopoietic cell. The term hematopoietic cell refers to a cell that originates from a hematopoietic stem cell or hematopoietic progenitor cell and / or originates from the erythroid, lymphoid, or myeloid lineage. In some embodiments, the cell is an immune cell. The term immune cell refers to any cell derived from a hematopoietic stem cell that plays a role in the immune response. Immune cells include, without limitation, lymphocytes, e.g., T cells and B cells, antigen-presenting cells (APCs), dendritic cells, monocytes, macrophages, natural killer (NK) cells, mast cells, basophils, eosinophils, or neutrophils, and any precursors of such cells. In some embodiments, the cell is a lymphocyte or lymphoid progenitor cell. In some embodiments, the cell is a T cell (e.g., a CD4+ T cell, a CD8+ T cell, a memory T cell, a regulatory T cell, a gamma delta T cell, a mucosal-associated invariant T cell (MAIT), a tumor-infiltrating lymphocyte (TIL), or any combination thereof). In some embodiments, the cell is a TIL. In some embodiments, the cell is a B cell. In some embodiments, the cell is a natural killer (NK) cell. In some embodiments, the cell is an innate lymphoid cell. In some embodiments, the cell is a dendritic cell. In some embodiments, the cell is a hematopoietic stem cell (HSC) or hematopoietic stem and progenitor cell (HSPC) or their progeny. HSCs can give rise to both myeloid and lymphoid progenitor cells, which further give rise to myeloid cells (e.g., monocytes, macrophages, neutrophils, basophils, dendritic cells, erythrocytes, platelets, etc.) and lymphoid cells (e.g., T cells, B cells, NK cells), respectively. In some embodiments, the cells are derived from induced pluripotent stem cells (e.g., NK cells derived from induced pluripotent stem cells). In some embodiments, the cells are derived from HSCs or HSPCs.

[0142] In some embodiments, the cell (e.g., donor cell or edited cell) comprises a genetic modification (insertion of a transgene, correction of a mutation, deletion or inactivation of a gene (e.g., insertion of a premature stop codon or insertion of a regulatory repressor sequence), or alteration of an epigenetic modification important for expression of a gene) that corrects or counteracts a disease-associated genetic defect present in the subject. In some embodiments, the cell (e.g., donor cell or edited cell) comprises a transgene. In some embodiments, the cell (e.g., donor cell or edited cell) comprises or expresses a therapeutic molecule, e.g., a therapeutic protein or enzyme, an immunoglobulin (e.g., an antibody or antigen-binding fragment thereof), a chimeric antigen receptor (CAR) (e.g., CAR-T cell, CAR-NK cell), or an exogenous T cell receptor (TCR). In some embodiments, the cell (e.g., donor cell or edited cell) comprises a bicistronic nucleic acid construct encoding a therapeutic molecule and a first isoform of a target protein. See, e.g., Yeku et al. (2017) Sci. Rep. 7(1):10541 and Rafiq et al. (2018) Nat. Biotechnol. 36(9):847-856, each of which is incorporated by reference in its entirety for all purposes, e.g., regarding bicistronic constructs for expressing a CAR and another molecule. For example, a bicistronic construct may encode both a therapeutic protein (e.g., a CAR) and a first isoform (e.g., an engineered isoform) of a target protein (e.g., IL2RG). In one embodiment, the bicistronic construct encodes a therapeutic protein (e.g., a CAR) and an engineered isoform of IL2RG. In some embodiments, the therapeutic molecule, immunoglobulin, CAR, or exogenous TCR does not target the target protein (e.g., IL2RG). In some embodiments, the cell (e.g., donor cell or edited cell) comprises or expresses an immunoglobulin, CAR, or exogenous TCR. In some embodiments, the cell (e.g., the donor cell or the edited cell) comprises a CAR or an exogenous TCR.For example, donor cells or edited cells can be engineered to express a therapeutic molecule that has therapeutic activity against any disease, e.g., any type of cancer (e.g., regardless of whether the target protein is associated with a disease or cancer), including diseases or cancers not associated with the target protein (e.g., the target proteins discussed above are not targeted to treat a disease or cancer, but the compositions and methods disclosed herein may provide a competitive advantage to cells that contain or express the therapeutic molecule). In some embodiments, the therapeutic molecule targets diseased cells and / or antigens expressed in diseased cells (e.g., tumor-associated antigens). For example, the disease or cancer can be a disease or cancer not associated with the target protein (e.g., the target protein does not cause the disease or cancer, and / or expression of the target protein does not correlate with the disease or cancer). Exemplary cancer and tumor types that can be treated are described elsewhere herein.

[0143] In some embodiments, the donor cells are autologous (i.e., derived from the subject). In some embodiments, the donor cells are allogeneic (i.e., not derived from the subject) or syngeneic (i.e., genetically identical or sufficiently identical, immunologically compatible, and acceptable for transplantation). In some embodiments, the cells are mammalian cells or non-human mammalian cells (e.g., mouse or rat cells or non-human primate cells) (e.g., the subject is a mammal or non-human mammal and the donor cells are mammalian cells or non-human mammalian cells). In some embodiments, the cells are human cells (e.g., the subject is a human and the donor cells are human cells).

[0144] Any suitable target protein can be used. In some embodiments, the target protein is a cell surface protein, e.g., a receptor. For example, the target protein can be a cell surface protein (e.g., a receptor, e.g., a cytokine receptor or a chemokine receptor) expressed on the cell surface of a hematopoietic cell, e.g., a lymphocyte. In some embodiments, the cell surface protein is CD1a, CD1b, CD1c, CD1e, CD1e, CD2, CD3, CD3d, CD3e, CD3g, CD4, CD5, CD6, CD7, CD8a, CD8b, CD9, CD10, CD11a, CD11b, CD11c, CD11d, CDw12, CD13, CD14, CD15, CD15u, CD15s, CD15su, CD16, CD16b, CD17, CD18, CD19, CD20, CD21, CD22, CD 23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42a, CD42b, CD42c, CD42d, CD43, CD44, CD45, CD45RA, CD45RB, CD45RC, CD45RO, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CD60a, CD60b, CD60c, CD61, CD62E, CD62L, CD62P, CD63, CD64, CD65 , CD65s, CD66a, CD66b, CD66c, CD66d, CD66e, CD66f, CD68, CD69, CD70, CD71, CD72, CD73, CD74, CD75, CD75s, CD77, CD79a, CD79b, CD80, CD81, CD82, CD83, CD84, CD85a, CD85d, CD85j, CD85k, CD86, CD87, CD88, CD89, CD90, CD91, CD92, CD93, CD94, CD95, CD96, C D97, CD98, CD99, CD99R, CD100, CD101, CD102, CD103, CD104, CD105, CD106, CD107a, CD107b, CD108, CD109, CD110, CD111, CD112,CD113、CD114、CD115、CD116、CD117、CD118、CD119、CD120a、CD120b、CD121a、CD121b、CD122、CD123、CD124、CD125、CD126、CD127、CD129、CD130、CD131、CD132、CD133、CD134、CD135、CD136、CD137、CD138、CD139、CD140a、CD140b、CD141、CD142、CD143、CD144、CDw145、CD146、CD147、CD148、CDw149、CD150、CD151、CD152、CD153、CD154、CD155、CD156a、CD156b、CD156c、CD157、CD158e、CD158i、CD158k、CD159a、CD159c、CD160、CD161、CD162、CD163、CD164、CD165、CD166、CD167a、CD167b、CD168、CD169、CD170、CD171、CD172a、CD172b、CD172g、CD173、CD174、CD175、CD175s、CD176、CD177、CD178、CD179a、CD179b、CD180、CD181、CD182、CD183、CD184、CD185、CD186、CD191、CD192、CD193、CD194、CD195、CD196、CD197、CD198 / CDw198、CD199 / CDw199、CD200、CD201、CD202b、CD203c、CD204、CD205、CD206、CD207、CD208、CD209、CD210 / CD210A、CD210B / CDw210b、CD212、CD213a1、CD213a2、CD215、CD217a、CD218a、CD218b、CD220、CD221、CD222、CD223、CD224、CD225、CD226、CD227、CD228、CD229、CD230、CD231、CD232、CD233、CD234、CD235a、CD235b、CD236、CD236R、CD238、CD239、CD240CE、CD240DCE、CD240D、CD241、CD242、CD243、CD244、CD245、CD246、CD247、CD248、CD249、CD252、CD253、CD254、CD256、CD262、CD263、CD264、CD265, CD266, CD267, CD268, CD269(BCMA), CD270, CD271, CD272, CD273, CD274, CD275, CD276, CD277, CD278, CD279, CD280, CD281, CD282, CD283, CD28 4, CD286, CD289, CD290, CD292, CDw293, CD294, CD295, CD296, CD297, CD298, CD299, CD300a, CD300c, CD300e, CD301, CD302, CD303, CD304, CD305, CD306 , CD307a, CD307b, CD307c, CD307d, CD307e, CD308, CD309, CD312, CD314, CD315, CD316, CD317, CD318, CD319, CD320, CD321, CD322, CD324, CD325, CD32 6, CD327, CD328, CD329, CD331, CD332, CD333, CD334, CD335, CD336, CD337, CD338, CD339, CD340, CD344, CD349, CD350, CD351, CD352, CD353, CD354, CD3 55, CD357, CD358, CD360, CD361, CD362, CD363, CD364, CD365, CD366, CD367, CD368, CD369, CD370, CD371, ACKR2, ACKR4, CCR10, CCRL2, CNTFR, CX3CR1, CXCR7, CXCR8, EDA2R, EDAR, EPOR, FLT1, FLT4, GHR, GPR75, IFNAR1, IFNAR2, IFNGR2, IL11RA, IL12RB2, IL17RB, IL17RC, IL17RD, IL17RE, IL1RAP, IL1RAP L, IL1RL1, IL1RL2, IL20RA, IL20RB, IL22RA1, IL22RA2, IL23R, IL27RA, IL28RA, IL31RA, IL3RB, OSMR, PRLR, RELL, RELT, SIGIRR, TNFRSF11B, TNFRSF19, TNFRSF22, TNFRSF23, TNFRSF25, TNFRSF26, TNFRSF3, TNFRSF6B, TSLPR, XCR1, immunoglobulin light chain (lambda or kappa), HLA proteins (HLA refers to "human leukocyte antigens"; HLA-A, HLA-B,In some embodiments, the cell surface protein is selected from HLA-C, HLA-E, HLA-F, HLA-G, HLA-DM, HLA-DO, HLA-DP, HLA-DQ, and HLA-DR), and β2-microglobulin. In some embodiments, the cell surface protein is selected from CD1a, CD1b, CD1c, CD1e, CD1e, CD2, CD3, CD3d, CD3e, CD3g, CD4, CD5, CD6, CD7, CD8a, CD8b, CD9, CD10, CD11a, CD11b, CD11c, CD11d, CDw12, CD13, CD14, CD15, CD15u, CD15s, CD15su, CD16, CD16b, CD17, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD 26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42a, CD42b, CD42c, CD42d, CD43, CD44, C D45, CD45RA, CD45RB, CD45RC, CD45RO, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, C D56, CD57, CD58, CD59, CD60a, CD60b, CD60c, CD61, CD62E, CD62L, CD62P, CD63, CD64, CD65, CD65s, CD66a, CD66b, CD66c, CD66d, CD66e, CD 66f, CD68, CD69, CD70, CD71, CD72, CD73, CD74, CD75, CD75s, CD77, CD79a, CD79b, CD80, CD81, CD82, CD83, CD84, CD85a, CD85d, CD85j, CD85 k, CD86, CD87, CD88, CD89, CD90, CD91, CD92, CD93, CD94, CD95, CD96, CD97, CD98, CD99, CD99R, CD100, CD101, CD102, CD103, CD104, CD105 , CD106, CD107a, CD107b, CD108, CD109, CD110, CD111, CD112, CD113, CD114, CD115, CD116, CD117, CD118, CD119, CD120a, CD120b, CD121a,CD121b、CD122、CD123、CD124、CD125、CD126、CD127、CD129、CD130、CD131、CD132、CD133、CD134、CD135、CD136、CD137、CD138、CD139、CD140a、CD140b、CD141、CD142、CD143、CD144、CDw145、CD146、CD147、CD148、CDw149、CD150、CD151、CD152、CD153、CD154、CD155、CD156a、CD156b、CD156c、CD157、CD158e、CD158i、CD158k、CD159a、CD159c、CD160、CD161、CD162、CD163、CD164、CD165、CD166、CD167a、CD167b、CD168、CD169、CD170、CD171、CD172a、CD172b、CD172g、CD173、CD174、CD175、CD175s、CD176、CD177、CD178、CD179a、CD179b、CD180、CD181、CD182、CD183、CD184、CD185、CD186、CD191、CD192、CD193、CD194、CD195、CD196、CD197、CDw198、CD199、CD200、CD201、CD202b、CD203c、CD204、CD205、CD206、CD207、CD208、CD209、CD210、CDw210b、CD212、CD213a1、CD213a2、CD215、CD217a、CD218a、CD218b、CD220、CD221、CD222、CD223、CD224、CD225、CD226、CD227、CD228、CD229、CD230、CD231、CD232、CD233、CD234、CD235a、CD235b、CD236、CD236R、CD238、CD239、CD240CE、CD240DCE、CD240D、CD241、CD242、CD243、CD244、CD245、CD246、CD247、CD248、CD249、CD252、CD253、CD254、CD256、CD266、CD267、CD268、CD269(BCMA)、CD270、CD271、CD272、CD273、CD274、CD275、CD276、CD277、CD278、CD279、CD280、CD281、CD282、CD283, CD284, CD286, CD289, CD290, CD292, CDw293, CD294, CD295, CD296, CD297, CD298, CD299, CD300a, CD300c, CD300e, CD301, CD302, CD303, CD304, CD305, CD306, CD, 307a, CD307b, CD307c, CD307d, CD307e, CD308, CD309, CD312, CD314, CD315, CD316, CD317, CD318, CD319, CD320, CD321, CD322, CD324, CD325, CD3 26, CD327, CD328, CD329, CD331, CD332, CD333, CD334, CD335, CD336, CD337, CD338, CD339, CD340, CD344, CD349, CD350, CD351, CD352, CD353, CD35 4, CD355, CD357, CD358, CD360, CD361, CD362, CD363, CD364, CD365, CD366, CD367, CD368, CD369, CD370, CD371, immunoglobulin light chain (lambda or kappa), HLA proteins (HLA refers to "human leukocyte antigen" and includes HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, HLA-DM, HLA-DO, HLA-DP, HLA-DQ, and HLA-DR), and β2-microglobulin.

[0145] In some embodiments, the target protein may be a lineage-specific cell surface protein. In some embodiments, the target protein may be CD19, CD123, CD22, CD30, CD171, CS-1 (also referred to as CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24), C-type lectin-like molecule-1 (CLECLi), CD33, epidermal growth factor receptor variant III (EGFRvIII), ganglioside G2 (CD2), ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(1-4)bDGlep(1-1)Cer), TNF receptor family member B cell maturation (BCMA), Tn antigen ((Tn Ag) or (GalNAcα-Ser / Thr)), prostate-specific membrane antigen (PSMA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), Fms-like tyrosine kinase 3 (FLT3), tumor-associated glycoprotein 72 (TAG72), CD38, CD44v6, carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EPCAM), B7H3 (CD276), KIT (CD117), interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2), mesothelin, interleukin-11 receptor alpha (IL-11Ra), prostate stem cell Plasma cytoplasmic receptor antigen (PSCA), protease serine 21 (testisin or PRSS21), vascular endothelial growth factor receptor 2 (VEGFR2), Lewis (Y) antigen, CD24, platelet-derived growth factor receptor beta (PDGFR-beta), stage-specific embryonic antigen-4 (SSEA-4), CD20, folate receptor alpha, receptor tyrosine-protein kinase ERBB2 (Her2 / neu), cell surface-associated mucin 1 (MUC1), epidermal growth factor receptor (EGFR), neural cell adhesion molecule (NCAM), prostase, prostatic acid phosphatase (PAP), elongation factor 2 variantmutated) (ELF2M), ephrin B2, fibroblast activation protein alpha (FAP), insulin-like growth factor I receptor (IGF-I receptor), carbonic anhydrase IX (CAIX), proteasome (prosome, macropein) subunit, beta type 9 (LMP2), glycoprotein 100 (gp100), oncogene fusion protein (bcr-abl) consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl), tyrosinase, ephrin type A receptor 2 (E PhA2), fucosyl GM1, sialyl Lewis adhesion molecule (sLe), ganglioside GM3 (aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer), transglutaminase 5 (TGS5), high molecular weight melanoma-associated antigen (HMWMAA), o-acetyl-GD2 ganglioside (OAcGD2), folate receptor beta, tumor endothelial marker 1 (TEM1 / CD248), tumor endothelial marker 7-related (TEM7R), claudin 6 (CLDN6), thyroid-stimulating hormone receptor (TSHR), G protein-coupled receptor claudin RasC group 5, member D (GPRC5D), chromosome X open reading frame 61 (CXORF61), CD97, CD179a, anaplastic lymphoma kinase (ALK), polysialic acid, placenta-specific 1 (PLAC1), hexasaccharide moiety of GloboH glycoceramide (GloboH), mammary differentiation antigen (NY-BR-1), uroplakin 2 (UPK2), hepatitis A virus cellular receptor 1 (HAVCR1), adrenergic receptor beta 3 (ADRB3), pannexin 3 (PANX3), G protein-coupled receptor 20 (GPR20), and ribosomal protein 1 (RIPK1). Lymphocyte antigen 6 complex, locus K9 (LY6K), olfactory receptor 51E2 (OR51E2), TCR gamma alternative reading frame protein (TARP), Wilms tumor protein (WT1), cancer / testis antigen 1 (NY-ESO-1), cancer / testis antigen 2 (LAGE-1a), melanoma-associated antigen 1 (MAGE-A1), ETS rearrangement variant gene 6 located on chromosome 12p (ETV6-AML), sperm protein 17 (SPA17), X antigen family, member 1A (XAGE1), angiopoietin-binding cell surface receptor 2 (Tie2), melanoma cancer testis antigen-1 (MAD-CT-1), melanoma cancer testis antigen-2 (MAD-CT-2), Fos-related antigen 1, tumor protein p53 (p53), p53 mutant, prostein, survivin, telomerase, prostate cancer tumor antigen-1 (PCTA-1 or galectin-8), melanoma antigen 1 recognized by T cells (MelanA or MART1), rat sarcoma (Ras) mutant, human telomerase reverse transcriptase (hTERT), sarcoma metastasis breakpoint, melanoma inhibitor of apoptosis apoptosis (ML-AP), ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene), N-acetylglucosaminyl-transferase V (NA17), paired box protein Pax-3 (PAX3), androgen receptor, cyclin B1, v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN), Ras homolog family member C (RhoC), tyrosinase-related protein 2 (TRP-2), cytochrome P450 1B 1 (CYP1B1), CCCTC-binding factor (zinc finger protein)-like (BORIS, i.e., Brother of the Regulator of Imprinted Sites), squamous cell carcinoma antigen recognized by T cells 3 (SART3), paired box protein Pax-5 (PAX5), proacrosin-binding protein sp32 (OY-TES 1), lymphocyte-specific protein tyrosine kinase (LCK), A-kinase anchoring protein 4 (AKAP-4), synovial sarcoma, X breakpoint 2 (SSX2), receptor for advanced glycation end products (RAGE-1), renal ubiquitous 1 (RU1), renal ubiquitous 2 (RU2), legumain, human papillomavirus E6 (HPV E6), human papillomavirus E7 (HPV E7), intestinal carboxylesterase, heat shock protein 70-2 mutant (mut hsp70-2), CD79a, CD79b, CD72, leukocyte-associated immunoglobulin-like receptor 1 (LAIR)1), Fc fragment of IgA receptor (FCAR or CD89), leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2), CD300 molecule-like family member f (CD300LF), C-type lectin domain family 12 member A (CLEC12A), bone marrow stromal cell antigen 2 (BST2), EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2), lymphocyte antigen 75 (LY75), glypican-3 (GPC3), Fc receptor-like 5 (FCRL5), and immunoglobulin lambda-like polypeptide 1 (IGLL1).

[0146] In some embodiments, the target protein is a protein expressed on the cell surface of a hematopoietic cell. In some embodiments, the target protein is a receptor expressed on the cell surface of a hematopoietic cell. For example, in some embodiments, the target protein is ACKR2, ACKR4, CCR10, CCRL2, CD25, CD27, CD30, CD40, CD95, CD110, CD114, CD115, CD116, CD117, CD118, CD119, CD120a, CD120b, CD121a, CD121b, CD122, CD123, CD124, CD125, CD126, CD127, CD129, CD130, CD132, CD134, CD135, CD136, CD137, CD140a, CD140b, CD140c, CD140d, CD140e, CD140f, CD140f, CD140g, CD140h, CD140i, CD140i, CD140i, CD140ib, CD140i ...b, CD140i, CD140i, CD140i, CD140i, CD140b, CD140i, CD140i, CD140i, CD140b, CD140b, CD140b, CD140b, CD140b, CD140c, CD140b, CD140b, CD140b, CD140b, CD140b, CD140b, CD140b, D140b, CD181, CD182, CD183, CD184, CD185, CD186, CD191, CD192, CD193, CD194, CD195, CD196, CD197, CD198 / CDw198, CD199 / CDw199, CD20 2b, CD210A, CD210B, CD212, CD213A1, CD213A2, CD215, CD217, CD218a, CD218b, CD220, CD221, CD234, CD246, CD261, CD262, CD263, CD264, C D265, CD266, CD267, CD268, CD269, CD270, CD271, CD295, CD309, CD331, CD332, CD333, CD334, CD357, CD358, CD360, CNTFR, CX3CR1, CXCR7, CXCR8, EDA2R, EDAR, EPOR, FLT1, FLT4, GHR, GPR75, IFNAR1, IFNAR2, IFNGR2, IL11RA, IL12RB2, IL17RB, IL17RC, IL17RD, IL17RE, IL1RAP, I The receptor may be a receptor expressed on the cell surface of a hematopoietic cell selected from L1RAPL, IL1RL1, IL1RL2, IL20RA, IL20RB, IL22RA1, IL22RA2, IL23R, IL27RA, IL28RA, IL31RA, IL3RB, OSMR, PRLR, RELL, RELT, SIGIRR, TNFRSF11B, TNFRSF19, TNFRSF22, TNFRSF23, TNFRSF25, TNFRSF26, TNFRSF3, TNFRSF6B, TSLPR, and XCR1.

[0147] In some embodiments, the target protein is a cytokine receptor or a chemokine receptor (e.g., expressed on the cell surface of a hematopoietic cell). For example, in some embodiments, the target protein is CD25, CD30, CD95, CD110, CD114, CD115, CD116, CD117, CD118, CD119, CD120a, CD120b, CD121a, CD121b, CD122, CD123, CD124, CD125, CD126, CD127, CD129, CD130, CD132, CD135, CD136, CD140a, CD140b, CD202b, CD202c, CD202d, CD202e, CD202f, CD202g, CD202h, CD202i, CD202m, CD202m, CD202mc, CD202mcg ... D210A, CD210B, CD212, CD213A1, CD213A2, CD215, CD217, CD218a, CD218b, CD220, CD221, CD246, CD261, CD262, CD263, C D264, CD265, CD266, CD267, CD268, CD269, CD270, CD295, CD309, CD331, CD332, CD333, CD334, CD360, EPOR, FLT1, FLT4, I L11RA, IL12RB2, IL17RB, IL17RC, IL17RD, IL17RE, IL1RAP, IL1RAPL, IL1RL1, IL1RL2, IL20RA, IL20RB, IL22RA1, IL22R A2, IL23R, IL27RA, IL28RA, IL31RA, IL3RB, OSMR, RELT, SIGIRR, TNFRSF25, TNFRSF3, TNFRSF6B, TSLPR, ACKR2, CCRL2, CC The cytokine receptor or chemokine receptor may be expressed on the cell surface of a hematopoietic cell selected from R10, CD181, CD182, CD183, CD184, CD185, CD186, CD191, CD192, CD193, CD194, CD195, CD196, CD197, CD198 / CDw198, CD199 / CDw199, CD234, CXCR7, CXCR8, CX3CR1, GPR75, and XCR1.

[0148] In some embodiments, the target protein is a cytokine receptor (e.g., expressed on the cell surface of a hematopoietic cell). For example, in some embodiments, the target protein is CD25, CD30, CD95, CD110, CD114, CD115, CD116, CD117, CD118, CD119, CD120a, CD120b, CD121a, CD121b, CD122, CD123, CD124, CD125, CD126, CD127, CD129, CD13 0, CD132, CD135, CD136, CD140a, CD140b, CD202b, CD210A, CD210B, CD212, CD213A1, CD213A2, CD215, CD217, CD218a, CD218b, CD220, CD221, CD246, CD261, CD262, CD263, CD264, CD265, CD2 66, CD267, CD268, CD269, CD270, CD295, CD309, CD331, CD332, CD333, CD334, CD360, EPOR, FLT1, FLT4, IL11RA, IL12RB2, IL17RB, IL17RC, IL17RD, IL17RE, IL1RAP, IL1RAPL, IL1RL1, IL1RL2, IL20RA, IL20RB, IL22RA1, IL22RA2, IL23R, IL27RA, IL28RA, IL31RA, IL3RB, OSMR, RELT, SIGIRR, TNFRSF25, TNFRSF3, TNFRSF6B, and TSLPR.

[0149] In some embodiments, the target protein is a chemokine receptor (e.g., expressed on the cell surface of a hematopoietic cell). For example, in some embodiments, the target protein may be a chemokine receptor expressed on the cell surface of a hematopoietic cell selected from ACKR2, CCRL2, CCR10, CD181, CD182, CD183, CD184, CD185, CD186, CD191, CD192, CD193, CD194, CD195, CD196, CD197, CD198 / CDw198, CD199 / CDw199, CD234, CXCR7, CXCR8, CX3CR1, GPR75, and XCR1.

[0150] In some embodiments, the target protein is a cytokine receptor or a chemokine receptor expressed on the cell surface of a lymphocyte. For example, in some embodiments, the target protein may be selected from CD25, CD30, CD95, CD117, CD118, CD120a, CD120b, CD121a, CD121b, CD122, CD124, CD125, CD126, CD127, CD129, CD130, CD132, CD210A, CD210B, CD212, CD215, CD217, CD267, CD268, CD269, CD360, IL12RB2, IL23R, IL27RA, SIGIRR, TNFRSF25, CCRL2, CCR10, CD183, CD184, CD185, CD186, CD191, CD194, CD195, CD196, CD197, CXCR7, CX3CR1, and XCR1.

[0151] In some embodiments, the target protein is a cytokine receptor expressed on the cell surface of lymphocyte.For example, in some embodiments, the target protein can be selected from CD25, CD30, CD95, CD117, CD118, CD120a, CD120b, CD121a, CD121b, CD122, CD124, CD125, CD126, CD127, CD129, CD130, CD132, CD210A, CD210B, CD212, CD215, CD217, CD267, CD268, CD269, CD360, IL12RB2, IL23R, IL27RA, SIGIRR and TNFRSF25.

[0152] In some embodiments, the target protein is a chemokine receptor expressed on the cell surface of lymphocytes.For example, in some embodiments, the target protein can be selected from CCRL2, CCR10, CD183, CD184, CD185, CD186, CD191, CD194, CD195, CD196, CD197, CXCR7, CX3CR1 and XCR1.

[0153] In some embodiments, the target protein is a cytokine receptor subunit of an interleukin-2 (IL-2) receptor, an IL-4 receptor, an IL-7 receptor, an IL-9 receptor, an IL-15 receptor, or an IL-21 receptor. For example, in some embodiments, the target protein may be selected from CD25, CD122, CD124, CD127, CD129, CD132 (IL2RG), CD215, and CD360.

[0154] In some embodiments of the present invention, the target protein is interleukin-2 receptor subunit gamma (IL2RG, also known as cytokine receptor common subunit gamma, IL-2 receptor subunit gamma, IL-2R subunit gamma, IL-2RG, IL2Rγ, IL-2Rγ, and CD132). The IL2RG blocking antibody REGN7257 efficiently suppresses lymphocytes in vivo. See, for example, WO2020 / 160242A1 and US2020 / 0247894A1, each of which is incorporated herein by reference in its entirety for all purposes. IL2RG is a subunit common to several interleukin receptors, including IL-2R, IL-4R, IL-7R, IL-9R, IL-15R, and IL-21R. The common cytokine receptor gamma chain was first identified as the third chain of the interleukin-2 (IL-2) receptor complex and was named IL2RG. The same subunit has been identified as part of several other cytokine receptor complexes: IL-4, IL-7, IL-9, IL-15, and IL-21. Therefore, it can be referred to as γc (common cytokine receptor gamma chain). γc is involved in signal transduction and ligand binding of these cytokine receptors. Human IL2RG has been assigned UniProt accession number P31785. The canonical isoform of human IL2RG has been assigned UniProt accession number P31785-1 and NCBI accession number NP_000197.1 and is set forth in SEQ ID NO: 21. The engineered M145K variant of human IL2RG is set forth in SEQ ID NO: 22. An exemplary messenger RNA encoding the canonical isoform of human IL2RG has been assigned NCBI accession number NM_000206.3 and is set forth in SEQ ID NO: 23. The coding sequence for the canonical isoform of human IL2RG has been assigned CCDS ID CCDS14406.1 and is set forth in SEQ ID NO: 24. The gene encoding the human interleukin-2 receptor subunit gamma is called IL2RG, is located on chromosome X, and has been assigned NCBI GeneID 3561.It is located at position Xq13.1 (assembly:GRCh38.p14(GCF_000001405.40), position:NC_000023.11(71107404..71111577, complement)).

[0155] The term "functionally indistinguishable" refers to first and second isoforms that can perform the same function equally well in a cell without significant impairment. For example, the function can be binding to an endogenous ligand and / or activating a downstream signaling pathway in the cell. In other words, the first and second isoforms are largely functionally indistinguishable. In certain embodiments, slight functional impairment is acceptable. A largely indistinguishable function can be, for example, binding to an endogenous ligand and / or activating a downstream signaling pathway. In some embodiments, the function can be binding to an endogenous ligand and activating a downstream signaling pathway. The term "immunologically distinguishable" refers to the ability of a first and second isoform of a protein to be distinguished by an antigen-binding protein that specifically binds to either the first or second isoform but not the other, for example, an antigen-binding protein that specifically binds only to the second (unmodified) isoform of the target protein. In other words, the antigen-binding protein can distinguish between two isoforms by specifically binding to only one isoform but not the other. In certain embodiments, the endogenous ligand binds to both the first and second isoforms (e.g., equally or with only slight hindrance), but the engineered antigen-binding protein, e.g., an antibody, is able to distinguish between the two isoforms by specifically binding to only one isoform but not the other (e.g., specifically binding to only the second isoform but not the first isoform).

[0156] In some embodiments, the second isoform of target protein refers to the form that exists in a subject. In some embodiments, the second isoform of target protein refers to the wild-type or native form of target protein (i.e., the form that normally exists in nature), and the first isoform refers to the isoform that is obtained by introducing mutations into the nucleic acid sequence that encodes the second isoform. The native form of protein refers to the protein that is encoded by the nucleic acid sequence in the genome of a cell, and is not inserted or mutated by genetic manipulation (i.e., the native protein is not a transgenic protein or a genetically engineered protein).

[0157] The mutation in the first isoform can be of any type and size. In some embodiments, the mutation comprises an insertion, deletion, and / or substitution of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids (e.g., 1 to 20 amino acids, 1 to 5 amino acids, 1 to 3 amino acids, or 1 amino acid). In some embodiments, the mutation comprises a substitution (e.g., a substitution of one amino acid). In some embodiments, the mutation consists essentially of a substitution (e.g., a substitution of one amino acid). In some embodiments, the mutation consists of a substitution (e.g., a substitution of one amino acid). The mutation can be at any site in the target protein. For example, if the target protein is a cell surface protein, the mutation may, in some embodiments, be in the extracellular domain of the target protein. In some embodiments, the site of mutation may be a site that is non-conserved among different mammalian species. In some embodiments, the mutation does not result in a change in the secondary structure of the surface protein. In some embodiments, the mutation is within the epitope targeted by the antigen-binding protein or at a site accessible for ligand binding. In some embodiments, the mutation is not located at a site of the surface protein involved in predicted or experimentally established or confirmed protein-protein interactions. In some embodiments, the mutation does not result in the deletion or introduction of a disulfide bond, an intermolecular or intramolecular interaction, or hydrophobic stacking. In some embodiments, the mutation does not result in the deletion or introduction of a post-translational protein modification site, e.g., a glycosylation site. In some embodiments, the mutation is located at a site with a unique topology compared to other mammalian proteins as determined by crystal structure analysis or computer-aided structure prediction. In instances where an antibody or antigen-binding protein reactive to the target protein already exists, information about the epitope of the target protein recognized by the antibody or antigen-binding protein can be used to select the site of mutation.

[0158] In some embodiments, the first isoform of the target protein is a genetically engineered isoform of the target protein. For example, the first isoform of the target protein can be genetically engineered to include a mutation (e.g., a non-naturally occurring artificial mutation) that provides a modified epitope. The modified epitope can be, for example, in the binding region of an antigen-binding protein such as an antibody. In some embodiments, the target protein is IL2RG (e.g., human IL2RG), and the modified epitope is in the binding region of the REGN7257 anti-IL2RG antibody described elsewhere herein. REGN7257 binding region 1 is encoded by exon 3 of IL2RG (e.g., human IL2RG) and includes T127, F128, V129, V130, Q131, L132, Q133, D134, P135, R136, E137, P138, R139, R140, Q141, A142, T143, Q144, M145, L146, K147, L148, Q149, and N150. REGN7257-binding region 2 is encoded by exons 2 and 3 of IL2RG (e.g., human IL2RG) and includes L87, H88, Y89 (exon 2), W90 (codon split between exons 2 and 3), Y91, K92, N93, S94, D95, N96, and D97 (exon 3). In some embodiments, the mutation may comprise a mutation (e.g., substitution) encoded by nucleotides in exon 2 of the IL2RG gene (e.g., human IL2RG gene). In some embodiments, the mutation may comprise a mutation (e.g., substitution) encoded by nucleotides in exon 3 of the IL2RG gene (e.g., human IL2RG gene). In some embodiments, the mutation may comprise a mutation (e.g., substitution) encoded by nucleotides in exons 2 and 3 of the IL2RG gene (e.g., human IL2RG gene). In some embodiments, the mutation may comprise a mutation (e.g., a substitution) within a region from positions T127 to N150 of IL2RG (e.g., human IL2RG). In some embodiments, the mutation may comprise a mutation (e.g., a substitution) within a region from positions L87 to D97 of IL2RG (e.g., human IL2RG).In some embodiments, the mutations may include mutations (e.g., substitutions) within the region from positions T127 to N150 of IL2RG (e.g., human IL2RG) and within the region from positions L87 to D97 of IL2RG (e.g., human IL2RG). In some embodiments, the mutations may include mutations (e.g., substitutions) within REGN7257-binding region 1 (SEQ ID NO: 25). In some embodiments, the mutations may include mutations (e.g., substitutions) within REGN7257-binding region 2 (SEQ ID NO: 62). In some embodiments, the mutations may include mutations (e.g., substitutions) within REGN7257-binding region 1 (SEQ ID NO: 25) and REGN7257-binding region 2 (SEQ ID NO: 62). In some embodiments, the mutations may include mutations (e.g., substitutions) at one or more of the following positions: T127, F128, V129, V130, Q131, L132, Q133, D134, P135, R136, E137, P138, R139, R140, Q141, A142, T143, Q144, M145, L146, K147, L148, Q149, and N150. In some embodiments, the mutations may include mutations (e.g., substitutions) at one or more of the following positions: L87, H88, Y89, W90, Y91, K92, N93, S94, D95, N96, and D97. In some embodiments, the mutations may include mutations (e.g., substitutions) at one or more of the following positions: T127, F128, V129, V130, Q131, L132, Q133, D134, P135, R136, E137, P138, R139, R140, Q141, A142, T143, Q144, M145, L146, K147, L148, Q149, N150, L87, H88, Y89, W90, Y91, K92, N93, S94, D95, N96, and D97. For example, mutations can include mutations (e.g., substitutions) at positions M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, K147 of IL2RG (e.g., human IL2RG), or any combination thereof. A mutation at a position within IL2RG includes a mutation (e.g., substitution) involving only the residue at that position, or a mutation (e.g., substitution) involving the residue at that position as well as other residues at other positions.The amino acid position nomenclature for mutations or residues disclosed herein refers to the position of the mutation or residue in the canonical isoform of human IL2RG set forth in SEQ ID NO:21. In some embodiments, the mutation comprises a mutation (e.g., substitution) at position M145. Examples of suitable M145 substitutions include an M145K substitution, an M145D substitution, an M145E substitution, an M145P substitution, an M145W substitution, or an M145Y substitution. In some embodiments, the mutation comprises a M145K substitution. In some embodiments, the mutation comprises a mutation (e.g., substitution) at position W90. Examples of suitable W90 substitutions include a W90V substitution, a W90R substitution, a W90Q substitution, a W90L substitution, a W90K substitution, a W90E substitution, or a W90D substitution. In some embodiments, the mutation comprises a W90Q substitution. In some embodiments, the mutation comprises mutations (e.g., substitutions) at positions M145 and W90.

[0159] Donor cells or edited cells can be administered to a subject by any suitable means. The term administering refers to the administration of a composition (e.g., donor cells or edited cells) to a subject or system (e.g., but not limited to, a cell, organ, tissue, organism, or associated component or set of components thereof). The route of administration can vary depending, for example, on the subject or system to which the composition is administered, the nature of the composition, the purpose of the administration, etc. The term "administration" or "administering" is intended to include routes of introducing donor cells or edited cells into a subject to perform their intended function. In some embodiments, non-limiting examples of administration routes that can be used include, for example, injection (subcutaneous, intravenous, parenteral, intraperitoneal, intrathecal), e.g., intravenous injection. In some embodiments of the present invention, donor cells or edited cells are administered by intravenous injection. Administration can include intermittent administration or continuous administration (e.g., but not limited to, perfusion) for at least a selected period of time. The donor cells or edited cells may be administered alone or in combination with any other agent (such as, but not limited to, an agent for the selective inhibition or selective depletion of host cells or non-edited cells in a subject) or a pharmaceutically acceptable carrier, or both. The donor cells or edited cells may be administered before, simultaneously with, or after the administration of the other agent.

[0160] Host cells or non-edited cells in a subject can be selectively inhibited or selectively depleted based on the expression of the second isoform of the target protein by any suitable means. For example, they can be depleted or inhibited based on the expression of only the second isoform of the target protein and the absence of the first isoform of the target protein. Alternatively, they can be depleted or inhibited based on the expression of the second isoform of the target protein, regardless of the expression of the first isoform of the target protein. The selective inhibition or depletion of host cells or non-edited cells can be performed before, simultaneously with, or after the administration of donor cells or edited cells. Selective depletion refers to selectively reducing the total number or concentration of cells expressing a certain isoform of the target protein. The selective depletion of cells expressing the second isoform can correspond to the enrichment of cells expressing the first isoform.

[0161] In some embodiments, selective depletion refers to the selective ablation of host cells. Selective ablation of host cells refers to the ablation (i.e., killing) of host cells by an active killing mechanism. An active killing mechanism means that the agent directly kills host cells by a cytotoxic mechanism (e.g., antibody-drug conjugate (ADC), antibody-radioconjugate (ARC), CAR-T, or other engineered cytotoxic) or recruits a host cytotoxic effector mechanism (e.g., complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP)), as opposed to blocking a cell function that does not involve an exogenous cytotoxic effector (e.g., growth or cytokine signaling, chemotactic tissue homing, cell-cell adhesion, for example, by selective inhibition). In some embodiments, selective depletion of host cells or non-edited cells comprises ablating host cells or non-edited cells by active killing mechanisms, such as complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), antibody-drug conjugates (ADC), CAR-T, or other engineered cytotoxicity.

[0162] In other embodiments, selective depletion refers to the selective inhibition of host cells. In contrast to selective ablation, selective inhibition of host cells does not include the ablation (i.e., killing) of host cells by an active killing mechanism. That is, selective inhibition of host cells does not include the cytotoxic ablation of host cells. In some embodiments, selective inhibition of host cells or non-edited cells does not include the ablation or killing of host cells or non-edited cells, even indirectly. In some embodiments, selective inhibition or depletion of host cells or non-edited cells includes (1) blocking growth of host cells or non-edited cells (e.g., blocking proliferation or immune cell activation) to provide a competitive growth advantage to donor cells or edited cells, (2) blocking localization or trafficking of host cells or non-edited cells to provide a competitive homing advantage to donor cells or edited cells, (3) blocking cell-cell interaction or adhesion of host cells or non-edited cells to provide a competitive tissue invasion advantage to donor cells or edited cells, or (4) blocking immune cell activation in host cells or non-edited cells to provide a competitive advantage to donor cells or edited cells. For example, in some embodiments, selective inhibition or depletion of host cells or non-edited cells includes blocking growth (i.e., proliferation) and / or blocking immune cell activation. For example, in some embodiments, selective inhibition or depletion of host cells or non-edited cells includes blocking growth (i.e., proliferation) and blocking immune cell activation. For example, in some embodiments, selective inhibition or depletion of host cells or non-edited cells comprises blocking growth (i.e., proliferation). For example, in some embodiments, selective inhibition or depletion of host cells or non-edited cells comprises blocking immune cell activation. As a novel conditioning strategy, selective inhibition of host cells without cytotoxic ablation has the potential to improve the safety and efficacy of cell therapy and transplantation procedures.Non-ablative conditioning can avoid the undesirable and harmful effects of ablative agents, including direct killing of non-target (e.g., non-hematopoietic) cells expressing drug target antigens, indirect toxicity to tissues adjacent to the target, and long-term immunosuppression in the post-transplant period. Selective blockade or inhibition of essential host cell factors can enhance the expansion, persistence, and trafficking of tolerant donor cells without the use of unpleasant and potentially toxic ablative agents by providing desirable competition for limited host factors (e.g., cytokines, chemokines) and immune niche space. See, for example, Figures 2A-5D.

[0163] In some embodiments of the present invention, selective inhibition or selective depletion of host cells or non-edited cells in a subject may include administering an agent (e.g., an antagonist, an antigen-binding protein, or a population of cells expressing the antigen-binding protein (i.e., immune effector cells, e.g., chimeric antigen receptor T cells (CAR-T))) that specifically binds to a second isoform of the target protein but not to a first isoform of the target protein. For example, the agent may be an antagonist that blocks the interaction between an endogenous ligand and the second isoform of the target protein but not the first isoform of the target protein. In some embodiments of the invention, selective inhibition or selective depletion of host cells or non-edited cells in a subject may comprise administering an antagonist (e.g., an antigen binding protein, or a population of cells expressing an antigen binding protein (i.e., immune effector cells, e.g., chimeric antigen receptor T cells (CAR-T))) that specifically binds to a second isoform of a target protein but not to a first isoform of the target protein. In some embodiments of the invention, selective inhibition or selective depletion of host cells or non-edited cells in a subject may comprise administering an antigen binding protein (e.g., an isolated antigen binding protein) or one or more nucleic acids encoding an antigen binding protein, e.g., an antibody (e.g., a human antibody, a monoclonal antibody, and / or a recombinant antibody) or an antigen-binding fragment thereof that specifically binds to a second isoform of a target protein (or an antigenic fragment thereof (e.g., an extracellular domain)) but not to a first isoform of a target protein. In some embodiments of the invention, selective inhibition or selective depletion of host cells or non-edited cells in a subject may comprise administering a population of cells (i.e., immune effector cells) (e.g., T cells expressing a chimeric antigen receptor or an exogenous T cell receptor) that express an antigen binding protein that specifically binds to a second isoform of the target protein but not to the first isoform of the target protein.Immune effector cells are cells that can execute or enhance an immune response. In some embodiments (i.e., for selective ablation), selective depletion (e.g., selective ablation) can be achieved by cytotoxic mechanisms (e.g., antibody-drug conjugates (ADCs), antibody-radioconjugates (ARCs), CAR-Ts, or other engineered cytotoxicity). In some embodiments (i.e., for selective ablation), selective depletion (e.g., selective ablation) can be achieved by recruiting host cytotoxic effector mechanisms (e.g., complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP)), as opposed to blocking cell functions that do not involve exogenous cytotoxic effectors (e.g., growth or cytokine signaling, chemotactic tissue homing, cell-cell adhesion, e.g., by selective inhibition). In some embodiments (i.e., for selective ablation), the antigen-binding protein is linked to a toxin, thereby forming an immunotoxin. In some embodiments, the antigen-binding protein is not linked to a toxin. In some embodiments, the antigen-binding protein is a bispecific antigen-binding protein capable of simultaneously binding to two different antigens. In some embodiments, selective depletion (e.g., selective ablation) can be achieved by complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), or antibody-drug conjugates (ADCs). In some embodiments, selective inhibition or depletion is not achieved by a cytotoxic mechanism or by recruiting host cytotoxic effector mechanisms. In some embodiments, selective inhibition or depletion is achieved by blocking cellular functions (e.g., growth or cytokine signaling, chemotactic tissue homing, cell-cell adhesion) without the involvement of exogenous cytotoxic effectors.In some embodiments, selective inhibition or selective depletion is not achieved by complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), or antibody-drug conjugate (ADC).Toxins or drugs suitable for use in antibody-drug conjugates are well known in the art.See, for example, Peters et al. (2015) Biosci. Rep. 35(4):e00225, Beck et al. (2017) Nature Reviews Drug Discovery 16:315-337, Marin-Acevedo et al. (2018) J. Hematol. Oncol. 11:8, Elgundi et al. (2017) Advanced Drug Delivery Reviews 122: 2-19, each of which is incorporated herein by reference in its entirety for all purposes. In some embodiments, the antibody-drug conjugate may further comprise a linker (e.g., a peptide linker, e.g., a cleavable linker) connecting the antigen-binding protein (e.g., an antibody) and the drug molecule. Selective inhibition or selective depletion can also be achieved by administering an antigen-binding protein that is not linked to an effector compound, such as a drug or toxin. In some embodiments, selective inhibition or selective depletion is achieved by blocking binding by an endogenous ligand.

[0164] In methods in which an agent for selective inhibition or selective depletion of host cells or non-edited cells is administered, the agent can be administered simultaneously with donor cells or edited cells in some embodiments. In some embodiments, the donor cells or edited cells are administered after the agent. For example, in some embodiments, the donor cells or edited cells are administered within one day after the agent, or at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about one week, at least about two weeks, at least about three weeks, at least about four weeks, at least about five weeks, at least about six weeks, at least about seven weeks, at least about eight weeks, at least about nine weeks, at least about ten weeks, at least about 11 weeks, at least about 12 weeks, at least about three months, at least about four months, at least about five months, at least about six months, or more after the agent. In some embodiments, the donor cells or edited cells are administered before the agent. For example, in some embodiments, the donor cells or edited cells are administered within 1 day before the agent, or at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, or more before the agent.

[0165] In some embodiments, the donor cells or edited cells are administered in multiple administrations (e.g., doses). In some embodiments, the donor cells or edited cells are administered to the subject once. In some embodiments, the donor cells or edited cells are administered to the subject more than once (e.g., at least two, at least three, at least four, at least five, or more times). In some embodiments, the donor cells or edited cells are administered to the subject at regular intervals (e.g., every six months). In methods in which an agent for selective inhibition or selective depletion of host cells or non-edited cells is administered, it may, in some embodiments, be administered in multiple administrations (e.g., doses). In some embodiments, the agent is administered to the subject once. In some embodiments, the agent is administered to the subject more than once (e.g., at least two, at least three, at least four, at least five, or more times). In some embodiments, the agent is administered to the subject at regular intervals (e.g., every six months).

[0166] In some embodiments, the agent is administered to the subject before and after administration of the donor cells or edited cells. In some embodiments, the agent is administered to the subject before and after administration of the donor cells or edited cells, and the donor cells or edited cells are administered to the subject once. In some embodiments, for example, the agent is administered to the subject about 1 to about 2 weeks before administration of the donor cells or edited cells, and about 1 to about 2 weeks after administration of the donor cells or edited cells (e.g., to provide a competitive advantage to the donor cells or edited cells).

[0167] In some embodiments, the agent is administered to the subject in multiple doses (e.g., at least two, at least three, at least four, at least five, or more times) prior to administration of the donor cells or edited cells. In some embodiments, the agent is administered to the subject in multiple doses (e.g., at least two, at least three, at least four, at least five, or more times) after administration of the donor cells or edited cells. In some embodiments, the agent is administered to the subject in multiple doses (e.g., at least two, at least three, at least four, at least five, or more times) prior to administration of the donor cells or edited cells, and in multiple doses (e.g., at least two, at least three, at least four, at least five, or more times) after administration of the donor cells or edited cells.

[0168] In some embodiments, about 10 6 ~10 11 In some embodiments, 10 donor cells or edited cells are administered. 6 It may be desirable to administer fewer than 10 cells to a subject. 11 It may be desirable to administer more than 10 cells to a subject. In some embodiments, one or more doses of cells comprise more than about 10 6 cells to approximately 10 11 cells, approximately 10 7 cells to approximately 10 10 cells, approximately 10 8 cells to approximately 10 9 cells, approximately 10 6 cells to approximately 10 8 cells, approximately 10 7 cells to approximately 10 9 cells, approximately 10 7 cells to approximately 10 10 cells, approximately 10 7 cells to approximately 10 11 cells, approximately 10 8 cells to approximately 10 10 cells, approximately 10 8 cells to approximately 10 11cells, approximately 10 9 cells to approximately 10 10 cells, approximately 10 9 cells to approximately 10 11 cells, or approximately 10 10 cells to approximately 10 11 In some embodiments, one or more doses of cells comprise about 10 cells per kg. 6 ~10 7 Contains cells.

[0169] "Antagonist" includes molecules that inhibit the activity of a target protein to any detectable extent. For example, an antagonist of IL2RG includes a molecule that inhibits the activity of IL2RG (e.g., binding to a cytokine, e.g., IL-2, IL-4, IL-7, IL-9, IL-15, and / or IL-21, to any detectable extent, from binding of a hybrid receptor comprising IL2RG complexed with a cytokine-specific receptor subunit).

[0170] In some embodiments, the agent for selective inhibition or selective depletion of host cells or non-edited cells is an antigen binding protein.

[0171] The terms "specifically binds" or "binds specifically" mean that an antigen-binding protein (e.g., an antibody or antigen-binding fragment thereof) binds to an antigen, e.g., IL2RG protein, with an affinity of at least about 10 as measured by a real-time label-free biolayer interferometry assay, e.g., at 25°C or 37°C, e.g., by an Octet® HTX biosensor, or by surface plasmon resonance, e.g., BIACORE™, or by solution affinity ELISA. -7 M (e.g., 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M, or 10 -12 M)'s K DIn some embodiments, an antigen-binding protein as used herein specifically binds to an IL2RG protein or a human IL2RG protein (e.g., a wild-type or native IL2RG protein, e.g., a wild-type or native human IL2RG protein). "Anti-IL2RG" refers to an antigen-binding protein (or another molecule), e.g., an antibody or antigen-binding fragment thereof, that specifically binds to IL2RG.

[0172] An antigen is, for example, a molecule to which an antibody binds, such as a peptide (e.g., IL2RG or a fragment thereof (antigenic fragment)). The specific region on an antigen that an antibody recognizes and binds to is called an epitope.

[0173] The term "epitope" refers to a specific antigen-binding site of an antigen-binding protein, e.g., an antigenic determinant (e.g., on IL2RG) that interacts with the variable region of an antibody molecule known as the paratope. A single antigen can have more than one epitope. Thus, different antigen-binding proteins (e.g., antibodies) may bind to different regions on an antigen and have different biological effects. The term "epitope" also refers to the site on an antigen to which B cells and / or T cells respond and / or the region of an antigen to which an antibody binds. Epitopes can be defined as structural or functional. Functional epitopes are generally a subset of structural epitopes and have residues that directly contribute to the affinity of the interaction. Epitopes can be linear or conformational, i.e., composed of nonlinear amino acids. In certain embodiments, an epitope may include determinants that are chemically active surface groupings of a molecule, such as amino acids, sugar side chains, phosphoryl groups, or sulfonyl groups, and in certain embodiments, may have specific three-dimensional structural features and / or specific charge characteristics. The epitope to which an antigen-binding protein used in the present invention binds may be contained in a fragment of IL2RG, e.g., human IL2RG, such as the ectodomain, domain 1, or domain 2 thereof.

[0174] Methods for determining the epitope of an antigen-binding protein, such as an antibody or fragment or polypeptide, include alanine scanning mutation analysis, peptide blot analysis (Reineke (2004) Methods Mol. Biol. 248: 443-63, incorporated herein by reference in its entirety for all purposes), peptide truncation analysis, crystallographic studies, and NMR analysis. In addition, methods such as epitope excision, epitope extraction, and chemical modification of antigens can be used (Tomer (2000) Prot. Sci. 9: 487-496, incorporated herein by reference in its entirety for all purposes). Another method that can be used to identify the amino acids in a polypeptide with which an antigen-binding protein (e.g., an antibody or fragment or polypeptide) interacts is hydrogen / deuterium exchange detected by mass spectrometry. See, e.g., Ehring (1999) Analytical Biochemistry 267: 252-259, Engen and Smith (2001) Anal. Chem. 73: 256A-265A, each of which is incorporated by reference in its entirety for all purposes.

[0175] The term "antibody," as used herein, refers to an immunoglobulin molecule (i.e., a "full-length antibody molecule") (e.g., IgG) comprising four polypeptide chains: two heavy chains (HC) and two light chains (LC) interconnected by disulfide bonds, e.g., REGN7257 (also referred to as H4H12889P). In some embodiments, each antibody heavy chain (HC) comprises a heavy chain variable region ("HCVR" or "V"). H ") (e.g., SEQ ID NO: 2 or a variant thereof) and a heavy chain constant region (domain C H 1. C H 2, and C H 3), and each antibody light chain (LC) comprises a light chain variable region ("LCVR" or "V L ") (e.g., SEQ ID NO: 10 or a variant thereof) and a light chain constant region (C L ) included. VH and V L The region can be further divided into regions of hypervariability called complementarity determining regions (CDRs), interspersed with regions of high conservation called framework regions (FRs). H and V L each comprises three CDRs and four FRs arranged from amino terminus to carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. In certain embodiments, the FRs of the antibody (or antigen-binding fragment thereof) are identical to human germline sequences or are naturally or artificially modified.

[0176] Typically, the variable domains of both heavy and light immunoglobulin chains contain three hypervariable regions, also called complementarity-determining regions (CDRs), located within relatively conserved framework regions (FRs). Generally, from N- to C-terminal, both light and heavy chain variable domains contain FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. In some embodiments, the assignment of amino acids to each domain is based on the information in Sequences of Proteins of Immunological Interest, Kabat et al.; National Institutes of Health, Bethesda, Md.; 5 th ed., NIH Publ. No. 91-3242 (1991), Kabat (1978) Adv. Prot. Chem. 32:1-75, Kabat et al., (1977) J. Biol. Chem. 252:6609-6616, Chothia et al., (1987) J. Mol. Biol. 196:901-917, or Chothia et al., (1989) Nature 342:878-883, each of which is incorporated herein by reference in its entirety for all purposes. Thus, an antigen-binding protein may, in some embodiments, be a V H CDR and V Land antibodies and antigen-binding fragments comprising the CDRs of V H and V L comprises an amino acid sequence as described herein (or a variant thereof), and the CDRs are as defined according to Kabat and / or Chothia.

[0177] As used herein, the terms "antigen-binding portion" or "antigen-binding fragment" of an antibody or antigen-binding protein include any naturally occurring, enzymatically obtainable, synthetic, or genetically engineered polypeptide or glycoprotein that specifically binds to an antigen to form a complex. Non-limiting examples of antigen-binding fragments include: (i) Fab fragments, (ii) F(ab')2 fragments, (iii) Fd fragments (the heavy chain portion of the Fab fragment cleaved with papain), (iv) Fv fragments (V H or V L ), and (v) single-chain Fv (scFv) molecules (consisting of amino acid residues that mimic the hypervariable region (e.g., an isolated complementarity-determining region (CDR), e.g., a CDR3 peptide) or a constrained FR3-CDR3-FR4 peptide of an antibody). Other engineered molecules, such as domain-specific antibodies, single-domain antibodies, domain-deleted antibodies, chimeric antibodies, CDR-grafted antibodies, diabodies, triabodies, tetrabodies, minibodies, and small modular immunopharmaceuticals (SMIPs), are also encompassed by the term "antigen-binding fragment" as used herein. In some embodiments, the antigen-binding fragment comprises three or more CDRs of H4H12889P (e.g., CDR-H1, CDR-H2, and CDR-H3, or CDR-L1, CDR-L2, and CDR-L3).

[0178] In some embodiments, the antigen binding proteins are "neutralizing" or "antagonist" anti-target protein antigen binding proteins (e.g., antibodies or antigen-binding fragments), including molecules that inhibit the activity of the target protein (e.g., inhibit the binding of a receptor to one of its ligands) to any detectable degree.

[0179] In some embodiments, antigen-binding proteins may include monoclonal antigen-binding proteins, such as antibodies and antigen-binding fragments thereof, as well as monoclonal compositions comprising a plurality of isolated monoclonal antigen-binding proteins. The term "monoclonal antibody" or "mAb," as used herein, refers to a member of a substantially homogeneous antibody population, i.e., the antibody molecules comprising the population are identical in amino acid sequence, except for possible minor naturally occurring mutations. The presence of a "plurality" of such monoclonal antibodies and fragments in a composition refers to an enrichment of identical (in amino acid sequence, except for possible minor naturally occurring mutations) antibodies and fragments above those that would normally be present in nature, for example, in the blood of a host organism, such as a mouse or human.

[0180] In some embodiments, the antigen-binding protein, e.g., an antibody or antigen-binding fragment, comprises a heavy chain constant domain, e.g., of the IgA (e.g., IgA1 or IgA2), IgD, IgE, IgG (e.g., IgG1, IgG2, IgG3, and IgG4 (e.g., comprising an S228P and / or S108P mutation)), or IgM type. In some embodiments, the antigen-binding protein, e.g., an antibody or antigen-binding fragment, comprises a light chain constant domain, e.g., of the kappa or lambda type. In some embodiments, the antigen-binding protein comprises an antigen-binding protein comprising a variable domain described herein (e.g., H4H12889P), which is linked to a heavy and / or light chain constant domain, e.g., as described above.

[0181] In some embodiments, the antigen-binding protein is a human antigen-binding protein (e.g., an antibody or antigen-binding fragment thereof, e.g., H4H12889P). The term "human" antigen-binding protein, e.g., antibody or antigen-binding fragment, as used herein, includes antibodies and fragments having variable and constant regions derived from human germline immunoglobulin sequences, either in human cells or transplanted into non-human cells, e.g., mouse cells. See, e.g., U.S. Patent Nos. 850,2018, 6,596,541, or 5,789,215, each of which is incorporated herein by reference in its entirety for all purposes. Human antibodies and antigen-binding fragments, in some embodiments, may include amino acid residues (e.g., with mutations introduced by random or site-directed mutagenesis in vitro or by somatic mutation in vivo) not encoded by human germline immunoglobulin sequences, for example, in the CDRs, particularly CDR3. However, the term "human antibody," as used herein, is not intended to include mAbs in which CDR sequences derived from the germline of another mammalian species (e.g., a mouse) have been grafted onto human FR sequences. This term includes antibodies that are recombinantly produced in a non-human mammal or in the cells of a non-human mammal. This term is not intended to include antibodies isolated from or generated in a human subject.

[0182] In some embodiments, the antigen-binding protein is a chimeric antigen-binding protein (e.g., a chimeric antibody comprising a variable domain described herein (e.g., derived from H4H12889P)). As used herein, a "chimeric antibody" is an antibody having a variable domain derived from a first antibody and a constant domain derived from a second antibody, wherein the first and second antibodies are derived from different species. See, e.g., U.S. Pat. No. 4,816,567 and Morrison et al., (1984) Proc. Natl. Acad. Sci. USA 81: 6851-6855, each of which is incorporated by reference in its entirety for all purposes.

[0183] In some embodiments, the antigen binding protein is a recombinant antigen binding protein (e.g., a recombinant antigen binding protein described herein (e.g., H4H12889P)). The term "recombinant" antigen binding protein, e.g., an antibody or antigen-binding fragment thereof, refers to a molecule that is made, expressed, isolated, or obtained by techniques or methods known in the art as recombinant DNA technology, including, for example, DNA splicing and transgenic expression. The term includes antibodies expressed in a non-human mammal (including a transgenic non-human mammal, e.g., a transgenic mouse), or a host cell (e.g., a Chinese hamster ovary (CHO) cell), or a cellular expression system, or antibodies isolated from a recombinant combinatorial human antibody library.

[0184] In some embodiments, the antigen-binding protein is an antigen-binding fragment of an antibody (e.g., an antigen-binding fragment of an antigen-binding protein described herein, e.g., H4H12889P). An antigen-binding fragment of an antibody, in some embodiments, comprises at least one variable domain. A variable domain can be of any size or amino acid composition and generally comprises at least one (e.g., three) CDRs adjacent to or in-frame with one or more framework sequences. V L V associated with the domainH In an antigen-binding fragment having a domain, V H Domains and V L The domains may be arranged relative to each other in any suitable arrangement. For example, the variable region may be a dimer, with the V H -V H , V H -V L , or V L -V L Alternatively, the antigen-binding fragment of an antibody may comprise a dimer of non-covalently bound monomeric V H Domain and / or V L It may include a domain.

[0185] In certain embodiments, an antigen-binding fragment of an antibody may comprise at least one variable domain covalently linked to at least one constant domain. Non-limiting exemplary configurations of variable and constant domains that may be found in an antigen-binding fragment of an antibody include: (i) a V H -C H 1, (ii) V H -C H 2. OD V H -C H 3, (iv) V H -C H 1-C H 2. (v) V H -C H 1-C H 2-C H 3. (vi) V H -C H 2-C H 3, (vii)V H -C L , (viii) V L -C H 1, (ix)V L -C H 2. (x)V L -C H 3. (xi) V L -C H 1-C H 2, (xii)V L -C H 1-C H 2-C H3, (xiii)V L -C H 2-C H 3, and (xiv) V L -C L In any configuration of variable and constant domains, including any of the exemplary configurations listed above, the variable and constant domains may be either directly linked to each other or may be linked by a complete or partial hinge or linker region. The hinge region may consist of at least two (e.g., 5, 10, 15, 20, 40, 60, or more) amino acids, providing flexible or semi-flexible linkage between adjacent variable and / or constant domains in a single polypeptide molecule. Furthermore, antigen-binding fragments of antibodies may be linked to each other and / or to one or more monomeric V H Or V L The variable domains may comprise homodimers or heterodimers (or other multimers) of any of the above-listed variable and constant domain configurations non-covalently associated with each other (e.g., by disulfide bond(s)).

[0186] Antigen-binding proteins (e.g., antibodies and antigen-binding fragments) can be monospecific or multispecific (e.g., bispecific), and can be monospecific as well as multispecific (e.g., bispecific) antigen-binding fragments that include, for example, one or more variable domains derived from the antigen-binding proteins specifically described herein (e.g., H4H12889P).

[0187] In some embodiments, the antigen-binding protein is an antigen-binding protein, e.g., an antibody (e.g., a human antibody, monoclonal antibody, or recombinant antibody) or antigen-binding fragment thereof, that specifically binds to an IL2RG protein or an antigenic fragment thereof (e.g., the extracellular domain of IL2RG or human IL2RG). See, e.g., WO2020 / 160242A1 and US2020 / 0247894A1, each of which is incorporated by reference herein in its entirety for all purposes. For example, the antigen-binding protein can comprise any polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 18 and / or 20, or a variant thereof. Optionally, the antigen-binding protein comprises one or more other polypeptides, e.g., a human Fc (e.g., a human IgG, e.g., an IgG1 or IgG4 (e.g., comprising an S108P mutation)). Antigen binding proteins that bind to the same epitope on IL2RG as any of the antigen binding proteins described herein (e.g., H4H12889P or REGN7257) or that compete with any of the antigen binding proteins described herein (e.g., H4H12889P or REGN7257) for binding to IL2RG can also be used.

[0188] In some embodiments, the antigen binding protein (e.g., an antibody or antigen-binding fragment thereof) comprises a V heavy chain CDR (CDR-H1, CDR-H2, and CDR-H3) combination set forth in SEQ ID NOs: 4, 6, and 8, respectively. H and / or a V comprising a combination of light chain CDRs (CDR-L1, CDR-L2, and CDR-L3) set forth in SEQ ID NOs: 12, 14, and 16, respectively. L and an immunoglobulin light chain (e.g., LC) comprising:

[0189] In some embodiments, the antigen binding protein (e.g., an antibody or antigen-binding fragment thereof) comprises a combination of heavy and light chain CDRs (CDR-H1, CDR-H2, and CDR-H3, and CDR-L1, CDR-L2, and CDR-L3) set forth in SEQ ID NOs: 4, 6, 8, 12, 14, and 16, respectively. H (e.g., HC) and V L (e.g., LC) and includes immunoglobulin heavy and light chains.

[0190] In some embodiments, the antigen binding protein (e.g., an antibody or antigen-binding fragment thereof) has the following V H and V L Amino acid sequences include polypeptide pairs including SEQ ID NOs: 2 and 10.

[0191] In some embodiments, the antigen binding protein (eg, an antibody or antigen-binding fragment thereof) comprises the following amino acid sequence pair encoding the HC and LC: SEQ ID NOs: 18 and 20.

[0192] In some embodiments, the antigen-binding protein (e.g., an antibody or antigen-binding fragment thereof) is immunoglobulin V. H and V L or HC and LC, which may be combined with the corresponding V specifically described herein. H , V L

[0033] In some embodiments, the CDRs of the variant antigen binding protein include variant amino acid sequences that have 70% or more (e.g., 80%, 85%, 90%, 95%, 97%, or 99%) overall amino acid sequence identity or similarity to the amino acid sequence of the CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 of such immunoglobulins are not variant and comprise the amino acid sequences described herein. Thus, in such embodiments, the CDRs within the variant antigen binding protein are not themselves variant.

[0193] In some embodiments, the antigen-binding protein (e.g., an antibody or antigen-binding fragment thereof) binds to the same epitope as H4H12889P. In some embodiments, the antigen-binding protein (e.g., an antibody or antigen-binding fragment thereof) competes with H4H12889P for binding to IL2RG. The term "compete," as used herein, refers to an antigen-binding protein (e.g., an antibody or antigen-binding fragment thereof) binding to an antigen (e.g., IL2RG) and inhibiting or blocking the binding of another antigen-binding protein (e.g., an antibody or antigen-binding fragment thereof) to that antigen. Unless otherwise indicated, this term also includes competition between two antigen-binding proteins, e.g., antibodies, in both directions, i.e., a first antibody binds to an antigen and blocks binding by a second antibody, and vice versa. Thus, in some embodiments, competition occurs in one such direction. In certain embodiments, a first antigen-binding protein (e.g., an antibody) and a second antigen-binding protein (e.g., an antibody) may bind to the same epitope. Alternatively, the first and second antigen-binding proteins (e.g., antibodies) can bind to different, but overlapping or non-overlapping, epitopes, where the binding of one inhibits or blocks the binding of the second antibody, for example, by steric hindrance. Competition between antigen-binding proteins (e.g., antibodies) can be measured by methods known in the art, for example, by real-time label-free biolayer interferometry assays. Binding competition between anti-IL2RG antigen-binding proteins (e.g., monoclonal antibodies (mAbs)) can also be determined using real-time label-free biolayer interferometry assays with an Octet RED384 biosensor (Pall ForteBio Corp.).

[0194] In some embodiments, the antigen-binding protein is a variant of H4H12889P. Typically, an antibody or antigen-binding fragment that has been modified in some way retains the ability to specifically bind to IL2RG, e.g., retains at least 10% of its IL2RG-binding activity (compared to the parent antibody), when that activity is expressed on a molar basis. Preferably, the antibody or antigen-binding fragment thereof retains at least 20%, 50%, 70%, 80%, 90%, 95%, or 100%, or more, of the IL2RG-binding affinity of the parent antibody. It is also intended that an antibody or antigen-binding fragment thereof may contain conservative or non-conservative amino acid substitutions that do not substantially alter its biological activity (referred to as "conservative variants" or "functionally conservative variants" of the antibody).

[0195] Such polypeptides, for example, immunoglobulin chains (e.g., H4H12889P V comprising the amino acid sequences specifically described herein) are also useful. H , V L , HC, or LC, or CDRs thereof) refers to a polypeptide comprising an amino acid sequence that is at least about 70-99.9% (e.g., at least 70, 72, 74, 75, 76, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, or 99.9%) identical or similar to a reference amino acid sequence described herein (e.g., any of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, or 20) when compared using the BLAST algorithm, where the algorithm parameters are selected to obtain the greatest match between the respective sequences over the entire length of the respective reference sequences (e.g., expectation threshold: 10, word size: 3, maximum match within query: 0, BLOSUM 62 matrix, gap costs: presence 11, extension 1, conditional compositional score matrix adjustment.

[0196] Furthermore, a variant of a polypeptide can comprise the amino acid sequence of a reference polypeptide, e.g., an immunoglobulin chain (e.g., H4H12889P V), whose amino acid sequence is specifically set forth herein, except for one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) mutations, e.g., one or more missense mutations (e.g., conservative substitutions), nonsense mutations, deletions, or insertions. H , V L For example, an immunoglobulin light chain (or VH chain) comprising the amino acid sequence set forth in SEQ ID NO: 10 but having one or more of such mutations may be used. L ) variants, and / or immunoglobulin heavy chains (or V) comprising the amino acid sequence set forth in SEQ ID NO:2 but having one or more of such mutations. H In some embodiments, anti-IL2RG antigen binding proteins comprising immunoglobulin light chain variants comprising CDR-L1, CDR-L2, and CDR-L3, wherein one or more (e.g., one, two, or three) of such CDRs have one or more of such mutations (e.g., conservative substitutions), and / or immunoglobulin heavy chain variants comprising CDR-H1, CDR-H2, and CDR-H3, wherein one or more (e.g., one, two, or three) of such CDRs have one or more of such mutations (e.g., conservative substitutions).

[0197] The following references relate to the BLAST algorithm, which is often used for sequence analysis: BLAST Algorithm: Altschul et al. (2005) FEBS J. 272(20): 5101-5109, Altschul et al. (1990) J. Mol. Biol. 215:403-410, Gish et al. (1993) Nature Genet. 3:266-272, Madden et al. (1996) Meth. Enzymol. 266:131-141, Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402, Zhang et al. (1997) Genome Res. 7:649-656, Wootton et al. (1993) Comput. Chem. 17:149-163, Hancock et al. (1994) Comput. Appl. Biosci. 10:67-70; Alignment scoring system: Dayhoff et al. "A model of evolutionary change in proteins." In Atlas of Protein Sequence and Structure, (1978) vol. 5, suppl. 3. MO Dayhoff (ed.), pp. 345-352, Natl. Biomed. Res. Found., Washington, DC; Schwartz, RM, et al., "Matrices for detecting distant relationships." In Atlas of Protein Sequence and Structure, (1978) vol. 5, suppl. 3. MO Dayhoff (ed.), pp. 353-358, Natl. Biomed. Res. Found., Washington, DC; Altschul (1991) J. Mol. Biol. 219:555-565; States et al. (1991) Methods 3:66-70, Henikoff et al. (1992) Proc. Natl.Acad. Sci. USA 89:10915-10919, Altschul et al. (1993) J. Mol. Evol. 36:290-300, Alignment statistics: Karlin et al. (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, Karlin et al. (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877, Dembo et al. (1994) Ann. Prob. 22:2022-2039, and Altschul, “Evaluating the statistical significance of multiple distinct local alignments.” in Theoretical and Computational Methods in Genome Research (S. Suhai, ed.), (1997) pp. 1-14, Plenum, NY, each of which is incorporated herein by reference in its entirety for all purposes.

[0198] For example, "conservatively modified variants" or "conservative substitutions" of immunoglobulin chains described herein refer to variants in which one or more amino acids in a polypeptide are substituted with other amino acids having similar characteristics (e.g., charge, side chain size, hydrophobicity / hydrophilicity, backbone configuration, rigidity, etc.). Such changes can frequently be made without significantly destroying the biological activity of the antibody or fragment. Those skilled in the art recognize that single amino acid substitutions in non-essential regions of a polypeptide generally do not substantially alter biological activity (see, e.g., Watson et al. (1987) Molecular Biology of the Gene, The Benjamin / Cummings Pub. Co., p. 224 (4th Ed.), which is incorporated herein by reference in its entirety for all purposes). In addition, substitutions of structurally or functionally similar amino acids are unlikely to significantly destroy biological activity. Anti-IL2RG antigen-binding proteins comprising such conservatively modified variant immunoglobulin chains may be used in some embodiments.

[0199] Examples of groups of amino acids with side chains that have similar chemical properties include: (1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; (2) aliphatic hydroxyl side chains: serine and threonine; (3) amide-containing side chains: asparagine and glutamine; (4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; (5) basic side chains: lysine, arginine, and histidine; (6) acidic side chains: aspartic acid and glutamic acid; and (7) sulfur-containing side chains: cysteine ​​and methionine. Alternatively, a conservative substitution is any change that has a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992) Science 256: 1443-45, which is incorporated herein by reference in its entirety for all purposes.

[0200] "H4H12889P" (also referred to as REGN7257) refers to an immunoglobulin heavy chain or variable region thereof (V) comprising an amino acid sequence specifically described herein for H4H12889P (e.g., SEQ ID NO: 2 (or a variant thereof)), unless otherwise indicated. H ) and / or an immunoglobulin light chain or variable region thereof (V) comprising an amino acid sequence specifically described herein for H4H12889P (e.g., SEQ ID NO: 10 (or a variant thereof)). L and / or a V domain comprising a heavy chain or its CDRs (CDR-H1 (or a variant thereof), CDR-H2 (or a variant thereof), and CDR-H3 (or a variant thereof)). H , and / or a V comprising a light chain or its CDRs (CDR-L1 (or a variant thereof), CDR-L2 (or a variant thereof), and CDR-L3 (or a variant thereof)). L In some embodiments, V H is linked to an IgG heavy chain constant domain, e.g., a human IgG heavy chain constant domain (e.g., IgG1 or IgG4 (e.g., containing an S228P and / or S108P mutation)), and / or V L is linked to a light chain constant domain, e.g., a human light chain constant domain (e.g., a lambda or kappa light chain constant domain). In some embodiments, any such immunoglobulin chain (e.g., V H , V L Polynucleotides encoding one or more of the following are provided:

[0201] In some embodiments, antigen-binding proteins (e.g., antibodies and antigen-binding fragments thereof (e.g., H4H12889P)) comprise immunoglobulin chains comprising the amino acid sequences (and variants thereof) specifically described herein, as well as cellular and in vitro post-translational modifications to the antibodies or fragments. For example, antigen-binding proteins include antibodies and antigen-binding fragments thereof that specifically bind to IL2RG comprising the heavy and / or light chain amino acid sequences described herein, as well as antibodies and fragments in which one or more asparagine, serine, and / or threonine residues are glycosylated, one or more asparagine residues are deamidated, one or more residues (e.g., Met, Trp, and / or His) are oxidized, the N-terminal glutamine is pyroglutamate (pyroE), and / or the C-terminal lysine or other amino acid is missing.

[0202] In some embodiments, nucleic acid(s) encoding an antigen-binding protein are provided. Nucleic acids encoding antigen-binding proteins include deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Such nucleic acids can be DNA, RNA, or hybrids or derivatives of either DNA or RNA. Optionally, in some embodiments, nucleic acids can be codon-optimized for efficient translation into proteins in a particular cell or organism. As a non-limiting example, nucleic acids can be modified to replace codons with higher usage frequencies in human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other intended host cell, compared to the naturally occurring polynucleotide sequence. Any portion or fragment of a nucleic acid molecule can be produced by (1) isolating the molecule from its natural environment, (2) using recombinant DNA technology (e.g., but not limited to, PCR amplification or cloning), or (3) using chemical synthesis methods. Nucleic acids can include modifications to improve stability or reduce immunogenicity. Non-limiting examples of modifications include: (1) altering or replacing one or both of the non-linking phosphate oxygens and / or one or more of the linking phosphate oxygens in the phosphodiester backbone linkage; (2) altering or replacing a component of the ribose sugar, e.g., altering or replacing the 2' hydroxyl of the ribose sugar; (3) replacing a phosphate moiety with a dephospholinker; (4) altering or replacing a naturally occurring nucleobase; (5) replacing or modifying the ribose-phosphate backbone; (6) modifying the 3' or 5' end of the oligonucleotide (e.g., but not limited to, removing, altering, or replacing a terminal phosphate group or conjugating a moiety); and (7) modifying the sugar.

[0203] Such nucleic acids may be used to encode immunoglobulin V, e.g., H4H12889P, optionally operably linked to a promoter or other expression control sequence. H , V LThe nucleic acid may comprise any polynucleotide encoding a CDR-H, CDR-L, HC, or LC. For example, such a nucleic acid may comprise any polynucleotide (e.g., DNA) comprising the nucleotide sequence set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19. In some embodiments, the polynucleotide of interest is fused to a secretory signal sequence.

[0204] In some embodiments, the nucleic acid may be in the form of an expression construct as defined elsewhere herein. Non-limiting examples of nucleic acids include regulatory regions (e.g., but not limited to, transcriptional or translational control regions) that control the expression of nucleic acid molecules, full-length or partial coding regions, and combinations thereof. Non-limiting examples of nucleic acids include promoters that are active in cells or organisms of interest. Examples of promoters that can be used in such expression constructs include promoters that are active in one or more eukaryotic cells, such as mammalian cells (e.g., non-human mammalian cells or human cells), including, but not limited to, rodent cells (e.g., mouse or rat cells). Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters.

[0205] Generally, a "promoter" or "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell (e.g., directly or through other proteins or substances bound to the promoter) and initiating transcription of a coding sequence. A promoter can be operably linked to other expression control sequences, including enhancer and repressor sequences, and / or to a polynucleotide encoding an antigen-binding protein (e.g., an antibody or antigen-binding fragment thereof).Promoters that can be used to control gene expression include the cytomegalovirus (CMV) promoter (U.S. Pat. Nos. 5,385,839 and 5,168,062, each of which is incorporated herein by reference in its entirety for all purposes), the SV40 early promoter region (Benoist et al. (1981) Nature 290:304-310, incorporated herein by reference in its entirety for all purposes), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al. (1980) Cell 22:787-797, incorporated herein by reference in its entirety for all purposes), the herpes thymidine kinase promoter (Wagner et al. (1981) Proc. Natl. Acad. Sci. USA 78:1441-1445, incorporated herein by reference in its entirety for all purposes), the regulatory sequences of the metallothionein gene (Brinster et al. (1982) Nature 296:39-42, incorporated herein by reference in its entirety for all purposes), prokaryotic expression vectors, such as the beta-lactamase promoter (Villa-Komaroff et al. (1978) Proc. Natl. Acad. Sci. USA 75:3727-3731, incorporated herein by reference in its entirety for all purposes), or the tac promoter (DeBoer et al. (1983) Proc. Natl. Acad. Sci. USA 80:21-25; see also "Useful proteins from recombinant bacteria" in Scientific American (1980) 242:74-94, each of which is incorporated herein by reference in its entirety for all purposes), and promoter elements derived from yeast or other fungi, such as, but not limited to, the Gal4 promoter, the ADC (alcohol dehydrogenase) promoter, the PGK (phosphoglycerol kinase) promoter, or the alkaline phosphatase promoter.

[0206] A polynucleotide encoding a polypeptide is "operably linked" to a promoter or other expression control sequence if, in a cell or other expression system, the sequence directs RNA polymerase-mediated transcription of the coding sequence into RNA, preferably mRNA, which can then undergo RNA splicing (if it contains introns) and, if necessary, translation into the protein encoded by the coding sequence.

[0207] In some embodiments, the nucleic acid(s) is / are V H and V LIn some embodiments, the nucleic acid(s) comprise the following polynucleotide pair encoding CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3: SEQ ID NOs: 3, 5, 7, 11, 13, and 15. In some embodiments, the nucleic acid(s) comprise the following polynucleotide pair encoding the HC and LC: SEQ ID NOs: 17 and 19. In some embodiments, the nucleic acid(s) comprise polynucleotides encoding immunoglobulin polypeptide chains whose nucleotide sequences are variants of those specifically described herein. A "variant" of such a polynucleotide or nucleic acid refers to a polynucleotide or nucleic acid comprising a nucleotide sequence that is at least about 70-99.9% (e.g., 70, 72, 74, 75, 76, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, 99.9%) identical to a reference nucleotide sequence described herein when compared using the BLAST algorithm, where the algorithm parameters are selected to maximize matches between the respective sequences over the entire length of the respective reference sequences (e.g., expectation threshold: 10, word size: 28, maximum match in query range: 0, match / mismatch score: 1, -2, gap cost: linear). In some embodiments, variants of the nucleotide sequences specifically described herein contain one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) point mutations, insertions (e.g., in-frame insertions), or deletions (e.g., in-frame deletions) of one or more nucleotides. Such mutations may, in some embodiments, be missense or nonsense mutations. In some embodiments, such variant polynucleotides encode immunoglobulin polypeptide chains that can be incorporated into anti-IL2RG antigen binding proteins, i.e., the resulting protein retains specific binding to IL2RG.

[0208] In some embodiments, the antigen-binding protein is an anti-IL2RG antibody or antigen-binding fragment thereof. In some embodiments, the antigen-binding protein comprises an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs comprise sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some embodiments, the antigen-binding protein comprises an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs consist essentially of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs consist essentially of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some embodiments, the antigen binding protein comprises an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs, wherein the three light chain CDRs consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively.

[0209] In some embodiments, the three light chain CDRs comprise the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs comprise the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some embodiments, the three light chain CDRs consist essentially of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs consist essentially of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively. In some embodiments, the three light chain CDRs consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively, and the three heavy chain CDRs consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively.

[0210] In some embodiments, the immunoglobulin light chain or variable region thereof comprises a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof comprises a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 2. In some embodiments, the immunoglobulin light chain or variable region thereof consists essentially of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof consists essentially of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 2. In some embodiments, the immunoglobulin light chain or variable region thereof consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 2.

[0211] In some embodiments, the immunoglobulin light chain or variable region thereof comprises the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof comprises the sequence set forth in SEQ ID NO: 2. In some embodiments, the immunoglobulin light chain or variable region thereof consists essentially of the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof consists essentially of the sequence set forth in SEQ ID NO: 2. In some embodiments, the immunoglobulin light chain or variable region thereof consists of the sequence set forth in SEQ ID NO: 10, and the immunoglobulin heavy chain or variable region thereof consists of the sequence set forth in SEQ ID NO: 2.

[0212] In some embodiments, the immunoglobulin light chain comprises a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 20, and the immunoglobulin heavy chain comprises a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 18. In some embodiments, the immunoglobulin light chain consists essentially of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 20, and the immunoglobulin heavy chain consists essentially of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 18. In some embodiments, the immunoglobulin light chain consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 20, and the immunoglobulin heavy chain consists of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO: 18.

[0213] In some embodiments, the immunoglobulin light chain comprises the sequence set forth in SEQ ID NO: 20 and the immunoglobulin heavy chain comprises the sequence set forth in SEQ ID NO: 18. In some embodiments, the immunoglobulin light chain consists essentially of the sequence set forth in SEQ ID NO: 20 and the immunoglobulin heavy chain consists essentially of the sequence set forth in SEQ ID NO: 18. In some embodiments, the immunoglobulin light chain consists of the sequence set forth in SEQ ID NO: 20 and the immunoglobulin heavy chain consists of the sequence set forth in SEQ ID NO: 18.

[0214] Agents for selective inhibition or selective depletion of host cells or non-edited cells can be administered to a subject by any suitable means. The term administering refers to the administration of a composition to a subject or system (e.g., but not limited to, a cell, organ, tissue, organism, or a set of related components or components thereof). The route of administration can vary depending, for example, on the subject or system to which the composition is administered, the nature of the composition, the purpose of administration, etc. The term "administration" or "administering" is intended to include routes of introducing an agent into a subject to perform its intended function. In some embodiments, non-limiting examples of administration routes that can be used include injection (subcutaneous, intravenous, parenteral, intraperitoneal, intrathecal), oral, inhalation, rectal, and transdermal. By way of non-limiting example, administration to a subject (e.g., but not limited to, a human or rodent) can be bronchial (including by bronchial instillation), buccal, enteral, interdermal, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (including by intratracheal instillation), transdermal, vaginal, and / or vitreous. The agent can be administered in tablet or capsule form (e.g., but not limited to, by injection, inhalation, eye drops, ointments, suppositories, etc.), topically by lotion or ointment, or rectally by suppository. Administration can be by bolus or continuous infusion. Administration can include intermittent or continuous administration (e.g., but not limited to, perfusion) for at least a selected period of time. Depending on the route of administration, the agent may be coated with or disposed within a selected material to protect it from natural conditions that may adversely affect its ability to perform its intended function. The agent may be administered alone or in combination with another agent (e.g., but not limited to, donor cells or edited cells described herein) or a pharmaceutically acceptable carrier, or both. The agent may be administered prior to, simultaneously with, or after the administration of the other agent.Additionally, agents may also be administered in a proform that is converted in vivo to its active or more active metabolite.

[0215] In some embodiments of the present invention, the subject may include, for example, any type of animal or mammal. Mammals include, for example, humans, non-human mammals, non-human primates, monkeys, apes, cats, dogs, horses, cows, deer, bison, sheep, rabbits, rodents (e.g., but not limited to, mice, rats, hamsters, and guinea pigs), and livestock (e.g., bovine species such as dairy cows and steers, ovine species such as sheep and goats, and porcine species such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, and ducks. Domestic and agricultural animals are also included. The term "non-human mammal" excludes humans. Specific, non-limiting examples of non-human mammals include rodents, such as mice and rats. In some embodiments of the present invention, the subject is a human.

[0216] In some embodiments of the present invention, any of the methods for improving engraftment of donor cells or for selectively inhibiting or depleting host cells or non-edited cells in a subject described herein may further include generating donor cells or edited cells by modifying a cell population to express a first isoform of a target protein (e.g., an IL2RG protein). Suitable methods and reagents for generating donor cells or edited cells are described in more detail elsewhere herein. In some embodiments of the present invention, any of the methods for improving engraftment of donor cells or for selectively inhibiting or depleting host cells or non-edited cells in a subject described herein may further include isolating the cell population from the subject (or from a different subject) before modifying the cell population. In some embodiments of the present invention, any of the methods for improving engraftment of donor cells in a subject or for selective inhibition or depletion of host cells or non-edited cells described herein may further include generating donor cells or edited cells by editing a target genomic locus (e.g., an IL2RG locus) to express a first isoform of a target protein (e.g., an IL2RG protein) in a cell population. Suitable methods and reagents for editing the target genomic locus are described in more detail elsewhere herein. In some embodiments, the genomic locus is an endogenous genomic locus that encodes a target protein (e.g., the target protein is IL2RG and the genomic locus is an IL2RG genomic locus). In some embodiments, the genomic locus is not an endogenous genomic locus that encodes a target protein (e.g., the target protein is IL2RG and the genomic locus is not an IL2RG genomic locus). In some embodiments of the invention, any of the methods for improving engraftment of donor cells in a subject or for the selective inhibition or depletion of host cells or non-edited cells described herein may further comprise the step of isolating the cell population from the subject (or from a different subject) prior to editing the target genomic locus in the cell population.The isolated cell can be, for example, any suitable cell. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a hematopoietic cell. In some embodiments, the cell is a lymphocyte or lymphoid progenitor cell. In some embodiments, the cell is a T cell (e.g., a CD4+ T cell, a CD8+ T cell, a memory T cell, a regulatory T cell, a gamma delta T cell, a mucosal-associated invariant T cell (MAIT), a tumor-infiltrating lymphocyte (TIL), or any combination thereof). In some embodiments, the cell is a TIL. In some embodiments, the cell is a B cell. In some embodiments, the cell is a natural killer (NK) cell. In some embodiments, the cell is an innate lymphocyte. In some embodiments, the cell is a dendritic cell. In some embodiments, the cell is a hematopoietic stem cell (HSC) or a hematopoietic stem and progenitor cell (HSPC) or their progeny. HSCs can give rise to both myeloid and lymphoid progenitor cells, which further give rise to myeloid cells (e.g., monocytes, macrophages, neutrophils, basophils, dendritic cells, erythrocytes, platelets, etc.) and lymphoid cells (e.g., T cells, B cells, NK cells), respectively. In some embodiments, the cells are autologous (i.e., derived from the subject). In some embodiments, the cells are allogeneic (i.e., not derived from the subject) or syngeneic (i.e., genetically identical or sufficiently identical, immunologically compatible, and amenable to transplantation). In some embodiments, the cells are mammalian cells or non-human mammalian cells (e.g., mouse or rat cells or non-human primate cells) (e.g., the subject is a mammal or non-human mammal and the cells are mammalian cells or non-human mammalian cells). In some embodiments, the cells are human cells (e.g., the subject is a human and the cells are human cells).

[0217] In some embodiments of the invention, any of the methods for improving engraftment of donor cells or for the selective inhibition or depletion of host cells or non-edited cells in a subject described herein may further comprise generating donor cells or edited cells by modifying an induced pluripotent stem cell (e.g., human induced pluripotent stem cell (iPSC)) population to express a first isoform of a target protein (e.g., an IL2RG protein), and then differentiating the induced pluripotent cells into a different cell type prior to administration to the subject. In some embodiments of the invention, any of the methods for improving engraftment of donor cells or for the selective inhibition or depletion of host cells or non-edited cells in a subject described herein may further comprise generating donor cells or edited cells by editing a target genomic locus (e.g., the IL2RG locus) in an induced pluripotent stem cell (e.g., human induced pluripotent stem cell (iPSC)) population to express a first isoform of a target protein (e.g., an IL2RG protein), and then differentiating the induced pluripotent cells into a different cell type prior to administration to the subject. For example, induced pluripotent stem cells can be differentiated into any suitable cell. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a hematopoietic cell. In some embodiments, the cell is a lymphocyte or lymphoid progenitor cell. In some embodiments, the cell is a T cell (e.g., a CD4+ T cell, a CD8+ T cell, a memory T cell, a regulatory T cell, a gamma delta T cell, a mucosal-associated invariant T cell (MAIT), a tumor-infiltrating lymphocyte (TIL), or any combination thereof). In some embodiments, the cell is a TIL. In some embodiments, the cell is a B cell. In some embodiments, the cell is a natural killer (NK) cell. In some embodiments, the cell is an innate lymphocyte. In some embodiments, the cell is a dendritic cell. In some embodiments, the cell is a hematopoietic stem cell (HSC) or hematopoietic stem and progenitor cell (HSPC) or their progeny. HSC refers to true stem cells that give rise to all blood and immune lineages.HPSCs include not only HSCs but also more differentiated precursors that give rise to more restricted lineages. For example, some HSPCs may only be capable of developing into myeloid lineages, or lymphoid lineages, or erythroblasts, etc. HSCs can give rise to both myeloid and lymphoid progenitors, which further give rise to myeloid cells (e.g., monocytes, macrophages, neutrophils, basophils, dendritic cells, erythrocytes, platelets, etc.) and lymphoid cells (e.g., T cells, B cells, NK cells), respectively. In some embodiments, the donor or edited cells are autologous (i.e., derived from the subject). In some embodiments, the donor or edited cells are allogeneic (i.e., not derived from the subject) or syngeneic (i.e., genetically identical or sufficiently identical, immunologically compatible, and amenable to transplantation). In some embodiments, the cell is a mammalian cell or a non-human mammalian cell (e.g., a mouse or rat cell or a non-human primate cell) (e.g., the subject is a mammal or a non-human mammal and the cell is a mammalian cell or a non-human mammalian cell). In some embodiments, the cell is a human cell (e.g., the subject is a human and the cell is a human cell).

[0218] In some embodiments of the invention, any of the methods for improving engraftment of donor cells or for the selective inhibition or depletion of host cells or non-edited cells in a subject described herein may further include generating the donor cells or edited cells by modifying a hematopoietic stem cell (HSC) or hematopoietic stem and progenitor cell (HSPC) (e.g., human HSC or HSPC) population to express a first isoform of a target protein (e.g., an IL2RG protein), and then differentiating the HSC or HSPC into a different cell type prior to administration to the subject. In some embodiments of the present invention, any of the methods for improving engraftment of donor cells or selectively inhibiting or depleting host cells or non-edited cells in a subject described herein may further include generating donor cells or edited cells by editing a target genomic locus (e.g., an IL2RG locus) to express a first isoform of a target protein (e.g., an IL2RG protein) in a population of hematopoietic stem cells (HSCs) or hematopoietic stem and progenitor cells (HSPCs) (e.g., human HSCs or HSPCs), and then differentiating the HSCs or HSPCs into a different cell type prior to administration to the subject. For example, the HSCs or HSPCs can be differentiated into any suitable cell. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a hematopoietic cell. In some embodiments, the cell is a lymphocyte or lymphoid progenitor cell. In some embodiments, the cell is a T cell (e.g., a CD4+ T cell, a CD8+ T cell, a memory T cell, a regulatory T cell, a gamma delta T cell, a mucosal-associated invariant T cell (MAIT), a tumor-infiltrating lymphocyte (TIL), or any combination thereof). In some embodiments, the cell is a TIL. In some embodiments, the cell is a B cell. In some embodiments, the cell is a natural killer (NK) cell. In some embodiments, the cell is an innate lymphocyte. In some embodiments, the cell is a dendritic cell. In some embodiments, the donor cell or the edited cell is autologous (i.e., derived from the subject).In some embodiments, the donor cells or edited cells are allogeneic (i.e., not derived from the subject) or syngeneic (i.e., genetically identical or sufficiently identical, immunologically compatible, and acceptable for transplantation). In some embodiments, the cells are mammalian cells or non-human mammalian cells (e.g., mouse or rat cells or non-human primate cells) (e.g., the subject is a mammal or a non-human mammal and the cells are mammalian cells or non-human mammalian cells). In some embodiments, the cells are human cells (e.g., the subject is a human and the cells are human cells). III. Methods for generating donor cells or edited cells

[0219] In some embodiments of the present invention, any of the methods for improving donor cell engraftment in a subject or for selectively inhibiting or depleting host cells or non-edited cells described herein may further include generating donor cells or edited cells. The donor cells or edited cells may be generated by modifying a cell population to express a first isoform of a target protein (e.g., an IL2RG protein). In some embodiments of the present invention, any of the methods for improving donor cell engraftment in a subject or for selectively inhibiting or depleting host cells or non-edited cells described herein may further include generating donor cells or edited cells by editing a target genomic locus (e.g., the IL2RG locus) to express a first isoform of a target protein (e.g., an IL2RG protein) in a cell population. The donor cells or edited cells may express only the first isoform, or they may express both the first and second isoforms of the target protein (e.g., modified to express the first isoform of the target protein but retain expression of the second isoform of the target protein).

[0220] In some embodiments, the step of generating donor cells or edited cells may include introducing an expression vector into a cell population, wherein the expression vector expresses a first isoform of a target protein (e.g., an IL2RG protein). Such an expression vector may include the entire coding sequence of the first isoform of a target protein (e.g., an IL2RG protein) operably linked to a promoter suitable for driving expression in the donor cells or edited cells. Any suitable promoter may be used. In one example, a promoter specific to or active in hematopoietic cells or a subset of hematopoietic cells may be used. In another example, a constitutive promoter may be used. Examples of such promoters include human cytomegalovirus (hCMV), chicken beta-actin / CMV enhancer (CAG), and elongation factor-1 alpha (EF1 alpha). In another example, an inducible promoter may be used. In some embodiments, the expression vector may be a bicistronic expression vector encoding a therapeutic molecule and a first isoform of a target protein (e.g., IL2RG) and a therapeutic molecule (e.g., CAR), as described elsewhere herein. See, e.g., Yeku et al. (2017) Sci. Rep. 7(1):10541 and Rafiq et al. (2018) Nat. Biotechnol. 36(9):847-856, each of which is incorporated herein by reference in its entirety for all purposes, e.g., regarding bicistronic constructs expressing CAR and another molecule. Any suitable vector may be used. For example, the vector may be a viral vector, e.g., a lentiviral vector or an adeno-associated viral (AAV) vector. In some embodiments, a lentiviral vector is used. In some embodiments, an AAV vector is used, e.g., an AAV vector having a serotype (e.g., AAV6) for expression in hematopoietic cells.Optionally, the endogenous locus encoding the second isoform of the target protein can also be modified (e.g., disrupted) so that the first isoform is expressed but the second isoform is not. As one example, the endogenous locus can be modified to include an insertion, deletion, or one or more point mutations in the endogenous locus (e.g., the IL2RG locus) that result in the loss of expression of a functional target protein (e.g., IL2RG). Such a locus can include the deletion or disruption of all of the endogenous coding sequence, or can include the deletion or disruption of a fragment (i.e., a portion or part) of the endogenous locus. In one example, a 5' fragment of the coding sequence can be deleted or disrupted (e.g., including the start codon). As one example, the endogenous locus can be modified such that the start codon of the endogenous locus is deleted or disrupted or mutated so that it is no longer functional. For example, the start codon can be disrupted by a deletion or insertion within the start codon. Alternatively, the start codon can be mutated, for example, by substitution of one or more nucleotides. In another example, a 3' fragment of the endogenous locus can be deleted or disrupted (e.g., including a stop codon). In another example, an internal fragment of the endogenous locus can be deleted or disrupted. In another example, all of the coding sequence at the endogenous locus can be deleted or disrupted. Alternatively, the endogenous locus can be left unmodified, and both the first and second isoforms are expressed.

[0221] In some embodiments, generating donor cells or edited cells may include editing a genomic locus to express a first isoform of a target protein (e.g., an IL2RG protein) in a cell population. The genomic locus may be an endogenous locus encoding the target protein, a safe harbor locus, or a random genomic locus targeted by random integration. Safe harbor loci include chromosomal loci at which a transgene or other exogenous nucleic acid insert can be stably and reliably expressed in all tissues of interest without appreciably altering cellular behavior or phenotype (i.e., without any deleterious effects on the host cell). See, e.g., Sadelain et al. (2012) Nat. Rev. Cancer 12:51-58, which is incorporated herein by reference in its entirety for all purposes. For example, a safe harbor locus may be one in which expression of the inserted gene sequence is not disrupted by any read-through expression from adjacent genes. For example, safe harbor loci may include chromosomal loci where exogenous DNA can be integrated and function in a predictable manner without adversely affecting endogenous gene structure or expression.Safe harbor loci may include extragenic or intragenic regions, such as intragenic loci that are non-essential, non-essential, or can be disrupted without obvious phenotypic consequences.Such safe harbor loci can provide an open chromatin structure in all tissues and can be ubiquitously expressed during embryonic development and in adults.See, for example, Zambrowicz et al. (1997) Proc. Natl. Acad. Sci. USA 94:3789-3794, which is incorporated herein by reference in its entirety for all purposes.In addition, safe harbor loci can be targeted with high efficiency, and safe harbor loci can be disrupted without obvious phenotypes.Examples of safe harbor loci include albumin, CCR5, HPRT, AAVS1, and Rosa26.See, for example, U.S. Patent Nos. 7,888,121, 7,972,854, 7,914,796, 7,951,925, 8,110,379, 8,409,861, and 8,586,526, as well as U.S. Patent Publication Nos. 2003 / 0232410, 2005 / 0208489, 2005 / 0026157, 2006 / 0063231, and 2008 / 0159 See, e.g., Nos. 2010 / 00218264, 2012 / 0017290, 2011 / 0265198, 2013 / 0137104, 2013 / 0122591, 2013 / 0177983, 2013 / 0177960, and 2013 / 0122591, each of which is incorporated by reference in its entirety for all purposes. In some embodiments, the genomic locus is an endogenous genomic locus that encodes a target protein (e.g., the target protein is IL2RG and the genomic locus is the IL2RG genomic locus). In some embodiments, the genomic locus is not an endogenous genomic locus that encodes a target protein (e.g., the target protein is IL2RG and the genomic locus is not the IL2RG genomic locus). The coding sequence for a first isoform of a target protein (e.g., IL2RG) can be operably linked to a promoter suitable for driving expression in the donor cell or the edited cell. If necessary, the endogenous locus encoding the second isoform of the target protein can also be modified (e.g., disrupted) so that the first isoform is expressed but the second isoform is not. As one example, the endogenous locus can be modified to include an insertion, deletion, or one or more point mutations in the endogenous locus (e.g., the IL2RG locus) that result in the loss of expression of a functional target protein (e.g., IL2RG). Such a locus can include the deletion or disruption of all of the endogenous coding sequence, or can include the deletion or disruption of a fragment (i.e., a portion or part thereof) of the endogenous locus. In one example, a 5' fragment of the coding sequence can be deleted or disrupted (e.g., including the start codon).In one example, the endogenous locus can be modified such that the start codon of the endogenous locus is deleted, or disrupted or mutated so that it is no longer functional. For example, the start codon can be disrupted by a deletion or insertion within the start codon. Alternatively, the start codon can be mutated, for example, by substituting one or more nucleotides. In another example, a 3' fragment of the endogenous locus can be deleted or disrupted (e.g., including a stop codon). In another example, an internal fragment of the endogenous locus can be deleted or disrupted. In another example, the entire coding sequence at the endogenous locus can be deleted or disrupted. Alternatively, the endogenous locus can be left unmodified, and both the first and second isoforms are expressed.

[0222] In some embodiments, the donor cells or edited cells generated may include editing a target genomic locus (e.g., an IL2RG locus) to express a first isoform of a target protein (e.g., an IL2RG protein) in a cell population.

[0223] In some embodiments, the editing step may include introducing into the cell population (1) a nuclease agent or one or more nucleic acids encoding the nuclease agent, where the nuclease agent targets a nuclease target sequence at the target genomic locus, and (2) an exogenous donor nucleic acid. The nuclease can cleave the target genomic locus, and the exogenous donor nucleic acid can be inserted into or recombined at the target genomic locus to generate a donor cell or an edited cell that expresses a first isoform of the target protein. However, those skilled in the art will recognize that alternative methods can also be used. For example, in some embodiments, an isoform switch can be performed using a base editor. See, for example, Komor et al. (2016) Nature 533(7603):420-424, which is incorporated herein by reference in its entirety for all purposes. This approach allows for the editing of desired amino acids without the need for double-stranded DNA breaks.

[0224] Any suitable nuclease agent can be used. In some embodiments, for example, the method can utilize a nuclease agent, such as a clustered regularly interspersed short palindromic repeats (CRISPR) / CRISPR-associated (Cas) system, a zinc finger nuclease (ZFN) system, or a transcription activator-like effector nuclease (TALEN) system, or components of such systems, to modify a target genomic locus (e.g., an IL2RG gene, e.g., a human IL2RG gene). Generally, nuclease agents involve the use of an engineered cleavage system to induce a double-strand break or nick (i.e., a single-strand break) at the nuclease target site. Cleavage or nicking can occur through the use of a specific nuclease, such as an engineered ZFN, TALEN, or CRISPR / Cas system, together with an engineered guide RNA to guide the specific cleavage or nicking of the nuclease target site. Any nuclease agent that induces a nick or double-strand break in the desired target sequence can be used in the methods and compositions disclosed herein. The nuclease agent can be used to generate a target gene modification in an IL2RG gene (e.g., a human IL2RG gene). For example, in some embodiments, the target gene modification can include a target gene modification in exon 3 of IL2RG (e.g., exon 3 of human IL2RG). In some embodiments, the target gene modification is in exon 3 of human IL2RG. For example, in some embodiments, the target gene modification can include a target gene modification in exon 2 of IL2RG (e.g., exon 2 of human IL2RG). In some embodiments, the target gene modification is in exon 2 of human IL2RG. For example, in some embodiments, the target gene modification can include a target gene modification in exons 2 and 3 of IL2RG (e.g., exons 2 and 3 of human IL2RG). In some embodiments, the target gene modification is in exons 2 and 3 of human IL2RG.

[0225] In some embodiments, the nuclease agent is a CRISPR / Cas system. In some embodiments, the nuclease agent comprises one or more ZFNs. In some embodiments, the nuclease agent comprises one or more TALENs.

[0226] CRISPR / Cas systems include transcripts and other elements involved in directing the expression or activity of Cas genes. CRISPR / Cas systems can be, for example, Type I, Type II, Type III, or Type V systems (e.g., subtype VA or subtype VB). The methods and compositions disclosed herein can employ CRISPR / Cas systems by utilizing a CRISPR complex (comprising a guide RNA (gRNA) complexed with a Cas protein) for site-specific binding or cleavage of nucleic acids. A CRISPR / Cas system that targets a target genomic locus includes a Cas protein (or a nucleic acid encoding a Cas protein) and one or more guide RNAs (or DNA encoding one or more guide RNAs), each of which targets a different guide RNA target sequence in the target genomic locus.

[0227] The CRISPR / Cas system used in the compositions and methods disclosed herein can be non-naturally occurring.Non-naturally occurring systems include all those that show the involvement of human hands, for example, those in which one or more components of the system are changed or mutated from their naturally occurring state, those that are at least substantially free of at least one other component that they are naturally associated with in nature, or those that are associated with at least one other component that they are not naturally associated with.For example, some CRISPR / Cas systems utilize non-naturally occurring CRISPR complexes that include gRNA and Cas protein that do not naturally occur together, or utilize non-naturally occurring Cas protein, or utilize non-naturally occurring gRNA.

[0228] The nuclease agents and CRISPR / Cas systems described in the compositions and methods disclosed herein target nuclease target sequences (e.g., guide RNA target sequences) in a target genomic locus encoding a target protein. In some embodiments, the nuclease target sequence is in the IL2RG gene. In some embodiments, the nuclease target sequence is in the human IL2RG gene. In some embodiments, the nuclease target sequence is in exon 3 of the IL2RG gene. In some embodiments, the nuclease target sequence is in exon 3 of the human IL2RG gene. In some embodiments, the nuclease target sequence is in exon 2 of the IL2RG gene. In some embodiments, the nuclease target sequence is in exons 2 and 3 of the IL2RG gene. In some embodiments, the nuclease target sequence is in exons 2 and 3 of the human IL2RG gene.

[0229] Cas proteins. Cas proteins generally contain at least one RNA recognition or binding domain capable of interacting with a guide RNA. Cas proteins may also contain a nuclease domain (e.g., a DNase domain or an RNase domain), a DNA-binding domain, a helicase domain, a protein-protein interaction domain, a dimerization domain, and other domains. Some such domains (e.g., a DNase domain) may be derived from native Cas proteins. Other such domains may be added to create modified Cas proteins. The nuclease domain has catalytic activity for nucleic acid cleavage, which involves breaking covalent bonds in nucleic acid molecules. Cleavage can generate blunt or staggered ends, which may be single-stranded or double-stranded. For example, wild-type Cas9 proteins typically produce blunt cleavage products. Alternatively, wild-type Cpf1 proteins (e.g., FnCpf1) can produce cleavage products with a 5-nucleotide 5' overhang, with cleavage occurring after the 18th base pair from the PAM sequence on the non-targeted strand and after the 23rd base on the targeted strand. The Cas protein may have full cleavage activity, generating a double-stranded break at the target genomic locus (e.g., a double-stranded break with blunt ends), or it may be a nickase, generating a single-stranded break at the target genomic locus.

[0230] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), and C se4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, as well as homologs or modified versions thereof.

[0231] Exemplary Cas proteins are Cas9 proteins or proteins derived from Cas9 proteins.Cas9 proteins are derived from type II CRISPR / Cas systems and typically share four important motifs with conserved architecture.Modifiers 1, 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif. Exemplary Cas9 proteins are Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of Cas9 family members are described in WO2014 / 131833, which is incorporated by reference in its entirety for all purposes. S.Cas9 from S. pyogenes (SpCas9) (e.g., assigned UniProt accession number Q99ZW2) is an exemplary Cas9 protein. An exemplary SpCas9 protein sequence is set forth in SEQ ID NO:41 (encoded by the DNA sequence set forth in SEQ ID NO:42). Smaller Cas9 proteins (e.g., Cas9 proteins whose coding sequences are compatible with maximal AAV packaging capacity when combined with a guide RNA coding sequence and regulatory elements for Cas9 and the guide RNA, e.g., SaCas9, CjCas9, and Nme2Cas9) are other exemplary Cas9 proteins. For example, Cas9 from S. aureus (SaCas9) (e.g., assigned UniProt accession number J7RUA5) is another exemplary Cas9 protein. Similarly, Cas9 from Campylobacter jejuni (CjCas9) (e.g., assigned UniProt accession number Q0P897) is another exemplary Cas9 protein. See, e.g., Kim et al. (2017) Nat. Commun. 8:14500, which is incorporated herein by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9. Cas9 (Nme2Cas9) from Neisseria meningitidis is another exemplary Cas9 protein. See, e.g., Edraki et al. (2019) Mol.See Cell 73(4):714-726, which is incorporated by reference in its entirety for all purposes. Cas9 proteins from Streptococcus thermophilus (e.g., Streptococcus thermophilus LMD-9 Cas9 (St1Cas9) encoded by the CRISPR1 locus or Streptococcus thermophilus Cas9 (St3Cas9) derived from the CRISPR3 locus) are other exemplary Cas9 proteins. Cas9 from Francisella novicida (FnCas9) or the RHA Francisella novicida Cas9 variant, which recognizes an alternative PAM (E1369R / E1449H / R1556A substitutions), are other exemplary Cas9 proteins. These and other exemplary Cas9 proteins are reviewed, for example, in Cebrian-Serrano and Davies (2017) Mamm. Genome 28(7):247-261, which is incorporated herein by reference in its entirety for all purposes. Examples of Cas9 coding sequences, Cas9 mRNA, and Cas9 protein sequences are provided in WO2013 / 176772, WO2014 / 065596, WO2016 / 106121, WO2019 / 067910, WO2020 / 082042, US2020 / 0270617, WO2020 / 082041, US2020 / 0268906, WO2020 / 082046, and US2020 / 0289628, each of which is incorporated herein by reference in its entirety for all purposes. Specific examples of ORFs and Cas9 amino acid sequences are provided in Table 30 of paragraph

[0449] of WO2019 / 067910, and specific examples of Cas9 mRNAs and ORFs are provided in paragraphs

[0214] to

[0234] of WO2019 / 067910. See also WO2020 / 082046A2 (pp. 84-85) and Table 24 of WO2020 / 069296, each of which is incorporated herein by reference in its entirety for all purposes.

[0232] Another example of a Cas protein is the Cpf1 (CRISPR from Prevotella and Francisella 1, Cas12a) protein. Cpf1 is a large protein (approximately 1300 amino acids) that contains a RuvC-like nuclease domain that is homologous to the corresponding domain in Cas9, along with a counterpart to the characteristic arginine-rich cluster in Cas9. However, in contrast to Cas9, which contains a long insert containing an HNH domain, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein, and the RuvC-like domain is adjacent in the Cpf1 sequence. See, e.g., Zetsche et al. (2015) Cell 163(3):759-771, which is incorporated herein by reference in its entirety for all purposes. Exemplary Cpf1 proteins are Francisella tularensis 1, Francisella tularensis subsp. GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis Cpf1 from Francisella novicida U112 (FnCpf1, assigned UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.

[0233] Another example of a Cas protein is CasX (Cas12e). CasX is an RNA-guided DNA endonuclease that generates staggered double-strand breaks in DNA. CasX is less than 1,000 amino acids in size. Exemplary CasX proteins are derived from Deltaproteobacteria (DpbCasX or DpbCas12e) and Planctomycetes (PlmCasX or PlmCas12e). Like Cpf1, CasX uses a single RuvC active site for DNA cleavage. See, e.g., Liu et al. (2019) Nature 566(7743):218-223, which is incorporated herein by reference in its entirety for all purposes.

[0234] Another example of a Cas protein is CasΦ (CasPhi or Cas12j), which is found uniquely in bacteriophages. CasΦ is less than 1000 amino acids in size (e.g., 700-800 amino acids). CasΦ cleavage generates staggered 5' overhangs. A single RuvC active site in CasΦ is capable of crRNA processing and DNA cleavage. See, e.g., Pausch et al. (2020) Science 369(6501):333-337, which is incorporated herein by reference in its entirety for all purposes.

[0235] The Cas protein can be a wild-type protein (i.e., one occurring in nature), a modified Cas protein (i.e., a Cas protein variant), or a fragment of a wild-type or modified Cas protein. The Cas protein can also be a catalytically active variant or fragment of a wild-type or modified Cas protein. A catalytically active variant or fragment can contain at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to a wild-type or modified Cas protein or portion thereof, and an active variant retains the ability to cleave at the desired cleavage site and thus retains nick-inducing or double-strand break-inducing activity. Assays for nick-inducing or double-strand break-inducing activity are known and generally measure the overall activity and specificity of a Cas protein on a DNA substrate containing the cleavage site.

[0236] One example of a modified Cas protein is the modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 with modifications (N497A / R661A / Q695A / Q926A) designed to reduce non-specific DNA contact. See, e.g., Kleinstiver et al. (2016) Nature 529(7587):490-495, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas protein is the modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce off-target effects. See, e.g., Slaymaker et al. (2016) Science 351(6268):84-88, which is incorporated herein by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are, for example, reviewed in Cebrian-Serrano and Davies (2017) Mamm. Genome 28(7):247-261, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas9 protein is xCas9, which is an SpCas9 variant that can recognize an expanded PAM sequence range. See, for example, Hu et al. (2018) Nature 556:57-63, which is incorporated herein by reference in its entirety for all purposes.

[0237] Cas proteins can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. Cas proteins can also be modified to change any other activity or property of the protein, such as stability. For example, one or more nuclease domains of a Cas protein can be modified, deleted, or inactivated, or the Cas protein can be truncated to remove domains that are not essential for the function of the protein or to optimize (e.g., enhance or reduce) the activity or property of the Cas protein.

[0238] Cas proteins can contain at least one nuclease domain, such as a DNase domain. For example, wild-type Cpf1 proteins typically contain a RuvC-like domain, likely in a dimeric configuration, that cleaves both strands of target DNA. Similarly, CasX and CasΦ typically contain a single RuvC-like domain that cleaves both strands of target DNA. Cas proteins can also contain at least two nuclease domains, such as a DNase domain. For example, wild-type Cas9 proteins typically contain a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC and HNH domains can each cleave different strands of double-stranded DNA to create double-strand breaks in DNA. See, e.g., Jinek et al. (2012) Science 337(6096):816-821, which is incorporated herein by reference in its entirety for all purposes.

[0239] One or more of the nuclease domains can be deleted or mutated so that they are no longer functional or have reduced nuclease activity. For example, if one of the nuclease domains is deleted or mutated in a Cas9 protein, the resulting Cas9 protein can be called a nickase and can generate single-strand breaks in double-stranded target DNA but not double-strand breaks (i.e., it can cleave either the complementary strand or the non-complementary strand, but not both). If all of the nuclease domains are not deleted or mutated in a Cas9 protein, the Cas9 protein retains double-strand break-inducing activity. An example of a mutation that converts Cas9 into a nickase is the D10A (aspartic acid at position 10 of Cas9 becomes alanine) mutation in the RuvC domain of Cas9 from S. pyogenes. Similarly, Cas9 can be converted into a nickase by H939A (histidine to alanine at amino acid position 839), H840A (histidine to alanine at amino acid position 840), or N863A (asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from S. pyogenes. Other examples of mutations that convert Cas9 into a nickase include corresponding mutations in Cas9 from S. thermophilus. See, e.g., Sapranauskas et al. (2011) Nucleic Acids Res. 39(21):9275-9282 and WO2013 / 141680, each of which is incorporated by reference in its entirety for all purposes. Such mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Other examples of nickase-generating mutations can be found, for example, in WO2013 / 176772 and WO2013 / 142578, each of which is incorporated herein by reference in its entirety for all purposes.

[0240] Examples of inactivating mutations in the catalytic domain of xCas9 are the same as those described above for SpCas9. Examples of inactivating mutations in the catalytic domain of the Staphylococcus aureus Cas9 protein are also known. For example, the Staphylococcus aureus Cas9 enzyme (SaCas9) can include a substitution at position N580 (e.g., an N580A substitution) or at position D10 (e.g., a D10A substitution) to generate a Cas nickase. See, for example, WO2016 / 106236, which is incorporated herein by reference in its entirety for all purposes. Examples of inactivating mutations in the catalytic domain of Nme2Cas9 are also known (e.g., D16A or H588A). Examples of inactivating mutations in the catalytic domain of St1Cas9 are also known (e.g., D9A, D598A, H599A, or N622A). Examples of inactivating mutations in the catalytic domain of St3Cas9 are also known (e.g., D10A or N870A). Examples of inactivating mutations in the catalytic domain of CjCas9 are also known (e.g., the combination of D8A and H559A). Examples of inactivating mutations in the catalytic domain of FnCas9 and RHA FnCas9 are also known (e.g., N995A).

[0241] Examples of inactivating mutations in the catalytic domain of Cpf1 protein are also known. With reference to the Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), and Moraxella bovoculi 237 (MbCpf1 Cpf1), such mutations may include mutations at positions 908, 993, or 1263 of AsCpf1, or at corresponding positions in Cpf1 orthologs, or at positions 832, 925, 947, or 1180 of LbCpf1, or at corresponding positions in Cpf1 orthologs. Such mutations may include, for example, one or more of the mutations D908A, E993A, and D1263A in AsCpf1, or corresponding mutations in Cpf1 orthologs, or D832A, E925A, D947A, and D1180A in LbCpf1, or corresponding mutations in Cpf1 orthologs. See, for example, US2016 / 0208243, which is incorporated herein by reference in its entirety for all purposes. Examples of inactivating mutations in the catalytic domain of CasX proteins are also known. With reference to the CasX protein from Deltaproteobacteria, D672A, E769A, and D935A (individually or in combination), or corresponding positions in other CasX orthologs, are inactivating. See, for example, Liu et al. (2019) Nature 566(7743):218-223, which is incorporated herein by reference in its entirety for all purposes. Examples of inactivating mutations in the catalytic domain of CasΦ protein are also known. For example, D371A and D394A, alone or in combination, are inactivating mutations. See, for example, Pausch et al. (2020) Science 369(6501):333-337, which is incorporated herein by reference in its entirety for all purposes.

[0242] Cas proteins can also be operably linked to heterologous polypeptides as fusion proteins. For example, Cas proteins can be fused to a cleavage domain. See WO2014 / 089290, which is incorporated herein by reference in its entirety for all purposes. Cas proteins can also be fused to heterologous polypeptides to provide increased or decreased stability. The fusion domain or heterologous polypeptide can be located at the N-terminus, C-terminus, or internally within the Cas protein.

[0243] As one example, a Cas protein can be fused to one or more heterologous polypeptides that provide subcellular localization. Such heterologous polypeptides can include, for example, one or more nuclear localization signals (NLSs) for targeting to the nucleus, such as a monopartite SV40 NLS and / or a bipartite alpha-importin NLS, a mitochondrial localization signal for targeting to mitochondria, an ER retention signal, etc. See, e.g., Lange et al. (2007) J. Biol. Chem. 282(8):5101-5105, which is incorporated herein by reference in its entirety for all purposes. Such subcellular localization signals can be located at the N-terminus, C-terminus, or anywhere within the Cas protein. The NLS can include a stretch of basic amino acids and can be a monopartite or bipartite sequence. Optionally, the Cas protein can contain two or more NLSs, including an NLS at the N-terminus (e.g., an alpha-importin NLS or a monokaryotic NLS) and an NLS at the C-terminus (e.g., an SV40 NLS or a bikaryotic NLS). The Cas protein can also contain two or more NLSs at the N-terminus and / or two or more NLSs at the C-terminus.

[0244] The Cas protein may be fused to, for example, 1 to 10 NLSs (e.g., 1 to 5 NLSs, or 1 NLS). When 1 NLS is used, the NLS may be linked to the N-terminus or C-terminus of the Cas protein sequence. It may also be inserted within the Cas protein sequence. Alternatively, the Cas protein may be fused to more than 1 NLS. For example, the Cas protein may be fused to 2, 3, 4, or 5 NLSs. In a specific example, the Cas protein may be fused to two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. For example, the Cas protein may be fused to two SV40 NLSs linked to the carboxy terminus. The Cas protein may be fused to an NLS sequence. Alternatively, the Cas protein may be fused to two NLSs, one linked to the N-terminus and one linked to the C-terminus. In other examples, the Cas protein may be fused to three NLSs or no NLSs. The NLS may be a monokaryotic sequence, such as the SV40 NLS, PKKKRKV (SEQ ID NO: 43) or PKKKRRV (SEQ ID NO: 44). The NLS may be a bikaryotic sequence, such as the nucleoplasmin NLS, KRPAATKKAGQAKKKK (SEQ ID NO: 45). In a specific example, a single PKKKRKV (SEQ ID NO: 43) NLS may be linked to the C-terminus of the Cas protein. One or more linkers may be included at the fusion site, as needed.

[0245] Cas proteins can also be operably linked to a cell penetration domain or protein transduction domain. For example, the cell penetration domain can be derived from HIV-1 TAT protein, the TLM cell penetration motif derived from human hepatitis B virus, MPG, Pep-1, VP22, the cell penetration peptide derived from herpes simplex virus, or a polyarginine peptide sequence. See, for example, WO2014 / 089290 and WO2013 / 176772, each of which is incorporated herein by reference in its entirety for all purposes. The cell penetration domain can be located at the N-terminus, C-terminus, or anywhere within the Cas protein.

[0246] The Cas protein can be provided in any form. For example, the Cas protein can be provided in the form of a protein, such as a Cas protein complexed with a gRNA. Alternatively, the Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. If necessary, the nucleic acid encoding the Cas protein can be codon-optimized for efficient translation into a protein in a particular cell or organism. For example, the nucleic acid encoding the Cas protein can be modified to replace codons with high usage frequencies in bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other host cell of interest, compared to the naturally occurring polynucleotide sequence. When the nucleic acid encoding the Cas protein is introduced into a cell, the Cas protein can be expressed transiently, conditionally, or constitutively in the cell.

[0247] The nucleic acid encoding the Cas protein can be stably integrated into the genome of the cell and operably linked to a promoter active in the cell. Alternatively, the nucleic acid encoding the Cas protein can be operably linked to a promoter in an expression construct. Expression constructs include any nucleic acid construct that can direct the expression of a gene or other nucleic acid sequence of interest (e.g., a Cas gene) and transfer such a nucleic acid sequence of interest into a target cell. For example, the nucleic acid encoding the Cas protein can be in a vector containing DNA encoding a gRNA. Alternatively, it can be in a vector or plasmid separate from the vector containing DNA encoding the gRNA. Promoters that can be used in expression constructs include, for example, promoters active in human cells or human hematopoietic cells. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Optionally, the promoter can be a bidirectional promoter that drives expression of both the Cas protein in one direction and the guide RNA in the other direction. Such a bidirectional promoter can consist of (1) a complete conventional unidirectional Pol III promoter containing three external control elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box; and (2) a second basic Pol III promoter containing a PSE and a TATA box fused to the 5' end of the DSE in the opposite orientation. For example, in the H1 promoter, the DSE is adjacent to the PSE and TATA box, and the promoter can be made bidirectional by creating a hybrid promoter in which transcription in the opposite direction is controlled by adding a PSE and a TATA box derived from the U6 promoter. See, for example, US2016 / 0074535, which is incorporated herein by reference in its entirety for all purposes. Using a bidirectional promoter to simultaneously express genes encoding Cas proteins and guide RNAs allows for the generation of small expression cassettes that facilitate delivery.In certain embodiments, the promoter is accepted by a regulatory agency for use in humans, hi certain embodiments, the promoter drives expression in hematopoietic cells.

[0248] Different promoters can be used to drive Cas or Cas9 expression. In some methods, small promoters are used so that the Cas or Cas9 coding sequence can fit into an AAV construct. For example, Cas or Cas9 and one or more gRNAs (e.g., one gRNA, two gRNAs, three gRNAs, or four gRNAs) can be delivered via LNP-mediated delivery (e.g., in the form of RNA) or adeno-associated virus (AAV)-mediated delivery (e.g., AAV8-mediated delivery). For example, the nuclease agent can be CRISPR / Cas9, and Cas9 mRNA and gRNA (e.g., targeting the IL2RG gene (e.g., human IL2RG gene)) can be delivered via LNP-mediated delivery or AAV-mediated delivery. Cas or Cas9 and gRNA(s) can be delivered via a single AAV or two separate AAVs. For example, the first AAV may carry a Cas or Cas9 expression cassette, and the second AAV may carry a gRNA expression cassette. Similarly, the first AAV may carry a Cas or Cas9 expression cassette, and the second AAV may carry two or more gRNA expression cassettes. Alternatively, a single AAV may carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably linked to a promoter) and a gRNA expression cassette (e.g., a gRNA coding sequence operably linked to a promoter). Similarly, a single AAV may carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably linked to a promoter) and two or more gRNA expression cassettes (e.g., a gRNA coding sequence operably linked to a promoter). Different promoters, such as a U6 promoter or a small tRNA Gln, may be used to drive gRNA expression. Similarly, different promoters may be used to drive Cas9 expression. For example, a small promoter is used so that the Cas9 coding sequence can fit into the AAV construct.Similarly, small Cas9 proteins (e.g., SaCas9 or CjCas9) are used to maximize AAV packaging capacity.

[0249] Cas proteins provided as mRNA can be modified to improve stability and / or immunogenicity. Modifications can be made to one or more nucleosides within the mRNA. Additionally, the mRNA encoding the Cas protein can be capped. The Cas mRNA can further comprise a polyadenylation (poly-A or poly(A) or poly-adenine) tail. For example, the Cas mRNA can comprise modifications to one or more nucleosides within the mRNA, the Cas mRNA can be capped, or the Cas mRNA can comprise a poly(A) tail.

[0250] Guide RNA. A "guide RNA" or "gRNA" is an RNA molecule that binds to a Cas protein (e.g., a Cas9 protein) and directs the Cas protein to a specific location within a target DNA. A guide RNA may contain two segments: a "DNA-targeting segment" (also called a "guide sequence") and a "protein-binding segment." A "segment" comprises a section or region of a molecule, e.g., a continuous stretch of nucleotides in an RNA. Some gRNAs, such as those for Cas9, may contain two separate RNA molecules: an "activator-RNA" (e.g., a tracrRNA) and a "targeter-RNA" (e.g., a CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides), which may also be referred to as "single-molecule gRNA," "single guide RNA," or "sgRNA." See, for example, WO2013 / 176772, WO2014 / 065596, WO2014 / 089290, WO2014 / 093622, WO2014 / 099750, WO2013 / 142578, and WO2014 / 131833, each of which is incorporated herein by reference in its entirety for all purposes. Guide RNA can refer to either CRISPR RNA (crRNA) or a combination of crRNA and trans-activating CRISPR RNA (tracrRNA). The crRNA and tracrRNA can be associated as a single RNA molecule (single guide RNA or sgRNA) or as two separate RNA molecules (dual guide RNA or dgRNA). For Cas9, for example, a single guide RNA can include a crRNA fused to a tracrRNA (e.g., via a linker). For Cpfl and CasΦ, for example, only the crRNA is required to achieve binding to the target sequence. The terms "guide RNA" and "gRNA" include both double-molecule (i.e., modular) gRNAs and single-molecule gRNAs. In some of the methods and compositions disclosed herein, the gRNA is an S. pyogenes Cas9 gRNA or its equivalent.In some of the methods and compositions disclosed herein, the gRNA is a S. aureus Cas9 gRNA or an equivalent thereof.

[0251] Exemplary bimolecular gRNAs include crRNA-like ("CRISPR RNA" or "targeter-RNA" or "crRNA" or "crRNA repeat") molecules and corresponding tracrRNA-like ("trans-activating CRISPR RNA" or "activator-RNA" or "tracrRNA") molecules. The crRNA contains both the DNA-targeting segment (single strand) of the gRNA and a stretch of nucleotides that forms one half of the dsRNA duplex of the protein-binding segment of the gRNA. Examples of crRNA tails (e.g., for use with S. pyogenes Cas9) placed downstream (3') of the DNA-targeting segment comprise, consist essentially of, or consist of GUUUUAGAGCUAUGCU (SEQ ID NO: 46) or GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 47). Any of the DNA-targeting segments disclosed herein can be attached to the 5' end of SEQ ID NO: 46 or 47 to form a crRNA.

[0252] Th...

Claims

1. 1. A method for improving donor cell engraftment in a subject in need thereof, comprising: (a) providing donor cells that have been modified to express a first isoform of a target protein, wherein the target protein is a protein expressed on the cell surface of a hematopoietic cell, the first isoform of the target protein being different from a second isoform of the target protein, the second isoform being expressed in a host cell of the subject; (b) administering the donor cells to the subject; (c) selectively inhibiting host cells in the subject based on expression of the second isoform of the target protein, thereby improving engraftment of donor cells in the subject. A method comprising:

2. The method of claim 1 , wherein the target protein is a receptor.

3. 3. The method of claim 1 or 2, wherein the target protein is a cytokine receptor or a chemokine receptor, optionally wherein the target protein is the cytokine receptor.

4. 10. The method of any preceding claim, wherein the target protein is a protein expressed on the cell surface of a lymphocyte.

5. 10. The method of any preceding claim, wherein the target protein is a cytokine receptor subunit of an interleukin-2 (IL-2) receptor, an IL-4 receptor, an IL-7 receptor, an IL-9 receptor, an IL-15 receptor, or an IL-21 receptor.

6. 10. The method of any preceding claim, wherein the target protein is interleukin-2 receptor subunit gamma (IL2RG).

7. 10. The method of any preceding claim, wherein the selective inhibition of host cells in step (c) does not include ablation of host cells by an active killing mechanism.

8. 10. The method of any preceding claim, wherein the selective inhibition in step (c) comprises: (1) blocking growth of the host cells, thereby providing a competitive growth advantage to the donor cells; (2) blocking localization or trafficking of the host cells, thereby providing a competitive homing advantage to the donor cells; (3) blocking cell-cell interaction or adhesion of the host cells, thereby providing a competitive tissue infiltration advantage to the donor cells; or (4) blocking immune cell activation in the host cells, thereby providing a competitive advantage to the donor cells.

9. 10. The method of any preceding claim, wherein the selective inhibition in step (c) comprises blocking growth of the host cells and / or blocking immune cell activation in the host cells to provide a competitive growth advantage to the donor cells.

10. 10. The method of any preceding claim, wherein the first isoform and the second isoform are functionally indistinguishable but immunologically distinguishable.

11. 10. The method of any preceding claim, wherein the donor cells express both the first isoform of the target protein and the second isoform of the target protein.

12. The method of any one of claims 1 to 10, wherein the donor cells express only the first isoform of the target protein.

13. 10. The method of any preceding claim, wherein the first isoform of the target protein is expressed from an expression vector in the donor cell, or a genomic locus has been edited to express the first isoform of the target protein in the donor cell.

14. 14. The method of claim 13, wherein the genomic locus is an endogenous genomic locus encoding the target protein, optionally wherein the target protein is IL2RG and the genomic locus is an IL2RG genomic locus.

15. 14. The method of claim 13, wherein the genomic locus is not an endogenous genomic locus encoding the target protein, optionally wherein the target protein is IL2RG and the genomic locus is not an IL2RG genomic locus.

16. 10. The method of any preceding claim, wherein the first isoform of the target protein is a genetically engineered isoform of the target protein.

17. 10. The method of any preceding claim, wherein the first isoform of the target protein is genetically engineered to include a mutation that provides an altered epitope, and optionally the mutation is an artificial mutation.

18. 18. The method of claim 17, wherein the altered epitope is a binding region of a target protein antagonist, such that the target protein antagonist exhibits reduced or lost ability to bind to and / or inhibit the first isoform of the target protein compared to its ability to bind to and / or inhibit the second isoform of the target protein.

19. 19. The method of claim 18, wherein both the first isoform of the target protein and the second isoform of the target protein retain the ability to bind to an endogenous ligand, and optionally the target protein antagonist blocks binding of the endogenous ligand to the second isoform of the target protein but not to the first isoform of the target protein.

20. the target protein is IL2RG, the altered epitope is in a binding region of the target protein antagonist, and the target protein antagonist is an antibody comprising an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs; the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; 20. The method of claim 18 or 19.

21. 21. The method of any one of claims 17 to 20, wherein the target protein is IL2RG and the mutation comprises a mutation encoded by nucleotides within exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus.

22. The method of any one of claims 17 to 21, wherein the target protein is IL2RG and the mutation comprises a mutation or substitution within the region from T127 to N150 and / or within the region from L87 to D97.

23. 23. The method of any one of claims 17 to 22, wherein the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, and / or K147.

24. 24. The method of any one of claims 17 to 23, wherein the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145, optionally wherein the substitution is an M145K substitution, an M145D substitution, an M145E substitution, an M145P substitution, an M145W substitution, or an M145Y substitution.

25. 25. The method of any one of claims 17 to 24, wherein the target protein is IL2RG and the mutation comprises an M145K substitution.

26. 26. The method of any one of claims 17 to 25, wherein the target protein is IL2RG and the mutation comprises a mutation or substitution at position W90, optionally wherein the substitution is a W90V, W90R, W90Q, W90L, W90K, W90E, or W90D substitution, optionally wherein the mutation comprises a W90Q substitution.

27. The method of any one of claims 17 to 26, wherein the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

28. 10. The method of any preceding claim, wherein the selective inhibition in step (c) comprises administering to the subject a target protein antagonist, wherein the target protein antagonist specifically binds to the second isoform of the target protein but not the first isoform of the target protein, and optionally, step (c) comprises multiple administrations of the target protein antagonist.

29. The method of any one of claims 18 to 20 and 28, wherein the target protein antagonist is an antigen-binding protein.

30. 30. The method of claim 29, wherein the antigen-binding protein is an antibody or an antigen-binding fragment thereof.

31. the target protein is IL2RG, the antigen binding protein comprises an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs; the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; 31. The method of claim 29 or 30.

32. the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; 32. The method of claim 31 .

33. the target protein is IL2RG, the antigen binding protein comprises an immunoglobulin light chain variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO: 10; the antigen binding protein comprises an immunoglobulin heavy chain variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO:2; 31. The method of claim 29 or 30.

34. the target protein is IL2RG, the immunoglobulin light chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10; the immunoglobulin heavy chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:2; 34. The method of claim 33.

35. the target protein is IL2RG, the antigen binding protein comprises an immunoglobulin light chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO:20; the antigen binding protein comprises an immunoglobulin heavy chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 18; 31. The method of claim 29 or 30.

36. 10. The method of any preceding claim, wherein the donor cells and / or the host cells are hematopoietic cells, and optionally the donor cells and / or the host cells are immune cells.

37. 10. The method of any preceding claim, wherein the donor cells and / or the host cells are lymphocytes or lymphoid progenitor cells.

38. 10. The method of any preceding claim, wherein the donor cells and / or the host cells are T cells.

39. 10. The method of any preceding claim, wherein the donor cells and / or the host cells are tumor infiltrating lymphocytes (TILs).

40. The method of any one of claims 1 to 37, wherein the donor cells and / or the host cells are B cells.

41. The method of any one of claims 1 to 37, wherein the donor cells and / or the host cells are NK cells.

42. The method of any one of claims 1 to 36, wherein the donor cells and / or the host cells are hematopoietic stem and progenitor cells.

43. The method of any one of claims 1 to 41, wherein the donor cells and / or the host cells are derived from hematopoietic stem cells or hematopoietic stem and progenitor cells.

44. The method of any one of claims 1 to 42, wherein the donor cells are derived from induced pluripotent stem cells.

45. 10. The method of any preceding claim, wherein the subject is a mammal or a non-human mammal, and the donor cells are mammalian cells or non-human mammalian cells.

46. 10. The method of any preceding claim, wherein the subject is a human and the donor cells are human cells.

47. 10. The method of any preceding claim, wherein the donor cells contain or express a therapeutic molecule.

48. 48. The method of claim 47, wherein the therapeutic molecule does not target the target protein.

49. 10. The method of any preceding claim, wherein the donor cells contain or express immunoglobulins.

50. 50. The method of claim 49, wherein the immunoglobulin does not target the target protein.

51. 10. The method of any preceding claim, wherein the donor cells comprise a chimeric antigen receptor (CAR) or an exogenous T cell receptor (TCR).

52. 52. The method of claim 51 , wherein the CAR or the exogenous TCR does not target the target protein.

53. 10. The method of any preceding claim, wherein the donor cells are autologous.

54. 53. The method of any one of claims 1 to 52, wherein the donor cells are allogeneic or syngeneic.

55. 10. The method of any preceding claim, wherein the subject has a disease or disorder and the method is for treating the disease or disorder.

56. 10. The method of any preceding claim, wherein the subject has cancer.

57. 57. The method of claim 56, wherein the cancer is a solid tumor cancer.

58. 57. The method of claim 56, wherein the cancer is a hematological cancer.

59. 10. The method of any preceding claim, wherein the subject has a hematopoietic malignancy and the method is for treating the hematopoietic malignancy in the subject.

60. 10. The method of any preceding claim, wherein the subject has a defective immune cell or inherited hematopoietic deficiency.

61. 61. The method of claim 60, wherein the inherited hematopoietic deficiency is sickle cell disease or severe combined immunodeficiency (SCID).

62. 10. The method of any preceding claim, wherein steps (b) and (c) are performed simultaneously.

63. 62. The method of any one of claims 1-61, wherein step (b) is performed before step (c), and optionally step (c) comprises multiple administrations of the target protein antagonist after step (b).

64. 62. The method of any one of claims 1-61, wherein step (b) occurs after step (c), and optionally step (c) comprises multiple administrations of the target protein antagonist prior to step (b).

65. 65. The method of any one of claims 1-64, wherein step (c) is performed both before and after step (b), and optionally step (c) comprises multiple administrations of the target protein antagonist before step (b) and / or multiple administrations of said target protein antagonist after step (b).

66. 10. The method of any preceding claim, further comprising, prior to step (a), generating the donor cells by modifying a cell population to express the first isoform of the target protein.

67. 67. The method of claim 66, wherein the cell population is an induced pluripotent stem cell population, and the method further comprises, prior to step (a), differentiating the induced pluripotent stem cells into the donor cells administered in step (a), optionally differentiating the induced pluripotent stem cells into hematopoietic cells, lymphocytes or lymphoid progenitor cells, T cells, B cells, NK cells, hematopoietic stem cells, or hematopoietic stem and progenitor cells.

68. 67. The method of claim 66, wherein the cell population is a population of hematopoietic stem cells or hematopoietic stem and progenitor cells, and the method further comprises, prior to step (a), a step of differentiating the hematopoietic stem cells or hematopoietic stem and progenitor cells into the donor cells administered in step (a), and optionally differentiating the hematopoietic stem cells or hematopoietic stem and progenitor cells into differentiated hematopoietic cells, lymphocytes or lymphoid progenitor cells, T cells, B cells, or NK cells.

69. 69. The method of any one of Claims 66-68, wherein generating the donor cells comprises, prior to step (a), introducing an expression vector encoding the first isoform of the target protein so as to express the first isoform of the target protein, or wherein generating the donor cells comprises, prior to step (a), editing a genomic locus in the cell population so as to express the first isoform of the target protein.

70. 70. The method of claim 69, wherein the genomic locus is an endogenous genomic locus encoding the target protein, optionally wherein the target protein is IL2RG and the genomic locus is an IL2RG genomic locus.

71. 70. The method of claim 69, wherein the genomic locus is not an endogenous genomic locus encoding the target protein, optionally wherein the target protein is IL2RG and the genomic locus is not an IL2RG genomic locus.

72. The editing step includes: (1) a nuclease agent or one or more nucleic acids encoding said nuclease agent, wherein said nuclease agent targets a nuclease target sequence in said genomic locus; and (2) exogenous donor nucleic acid; into the cell population, the nuclease agent cleaves the genomic locus and the exogenous donor nucleic acid is inserted into or recombines with the genomic locus to generate the donor cell expressing the first isoform of the target protein.

72. The method of any one of claims 69 to 71.

73. the nuclease agent (a) zinc finger nucleases (ZFNs); (b) a transcription activator-like effector nuclease (TALEN), or (c) (i) a Cas protein, and (ii) a guide RNA comprising a DNA-targeting segment that targets a guide RNA target sequence that is the nuclease target sequence, wherein the guide RNA binds to the Cas protein and directs the Cas protein to the guide RNA target sequence.

73. The method of claim 72, comprising:

74. 74. The method of Claim 73, wherein the nuclease agent comprises the Cas protein and the guide RNA, and optionally wherein the DNA-targeting segment comprises the sequence set forth in any one of SEQ ID NOs: 76-87, or the guide RNA target sequence comprises the sequence set forth in any one of SEQ ID NOs: 64-75, or optionally wherein the DNA-targeting segment comprises the sequence set forth in any one of SEQ ID NOs: 136-153, or the guide RNA target sequence comprises the sequence set forth in any one of SEQ ID NOs: 118-135.

75. 75. The method of claim 73 or 74, wherein the Cas protein is a Cas9 protein.

76. 76. The method of any one of claims 72 to 75, wherein the exogenous donor nucleic acid comprises homology arms.

77. 77. The method of any one of claims 72-76, wherein the exogenous donor nucleic acid is a single-stranded oligodeoxynucleotide (ssODN), optionally wherein the ssODN comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 88-117, or optionally wherein the ssODN comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 154-173.

78. (I) the DNA targeting segment comprises the sequence set forth in SEQ ID NO: 77, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 65, and the ssODN comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 88-97; (II) The DNA targeting segment comprises the sequence set forth in SEQ ID NO: 83, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 71, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 98-107; (III) The DNA targeting segment comprises the sequence set forth in SEQ ID NO: 86, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 74, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 108-117; (IV) the DNA-targeting segment comprises the sequence set forth in SEQ ID NO: 137, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 119, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 154-163; or (V) the DNA-targeting segment comprises the sequence set forth in SEQ ID NO: 138, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 120, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 164-173; 78. The method of claim 77.

79. 79. The method of any one of claims 66 to 78, further comprising isolating the cell population from the subject or from a different subject prior to modifying the cell population.

80. 1. A pharmaceutical combination for administration to a subject in need thereof, comprising: (a) a donor cell population modified to express a first isoform of a target protein, wherein the target protein is a protein expressed on the cell surface of a hematopoietic cell, and the first isoform of the target protein is different from a second isoform of the target protein; (b) a target protein antagonist that specifically binds to the second isoform of the target protein but does not specifically bind to the first isoform of the target protein; and A combination medicine comprising:

81. The pharmaceutical combination of claim 80, wherein the target protein is a receptor.

82. 82. The pharmaceutical combination of claim 80 or 81, wherein the target protein is a cytokine receptor or a chemokine receptor, optionally wherein the target protein is the cytokine receptor.

83. The pharmaceutical combination according to any one of claims 80 to 82, wherein the target protein is a protein expressed on the cell surface of a lymphocyte.

84. The pharmaceutical combination of any one of claims 80 to 83, wherein the target protein is a cytokine receptor subunit of interleukin-2 (IL-2) receptor, IL-4 receptor, IL-7 receptor, IL-9 receptor, IL-15 receptor, or IL-21 receptor.

85. The pharmaceutical combination according to any one of claims 80 to 84, wherein the target protein is interleukin-2 receptor subunit gamma (IL2RG).

86. The pharmaceutical combination of any one of claims 80 to 85, wherein the target protein antagonist selectively inhibits host cells in the subject based on expression of the second isoform of the target protein.

87. 87. The pharmaceutical combination of claim 86, wherein the selective inhibition of host cells does not include ablation of host cells by an active killing mechanism.

88. The pharmaceutical combination of claim 86 or 87, wherein the selective inhibition comprises (1) blocking growth of the host cells, providing a competitive growth advantage to the donor cells; (2) blocking localization or trafficking of the host cells, providing a competitive homing advantage to the donor cells; (3) blocking cell-cell interaction or adhesion of the host cells, providing a competitive tissue infiltration advantage to the donor cells; or (4) blocking immune cell activation in the host cells, providing a competitive advantage to the donor cells.

89. The pharmaceutical combination of any one of claims 86 to 88, wherein the selective inhibition comprises blocking growth of the host cells and / or blocking immune cell activation in the host cells to provide a competitive growth advantage to the donor cells.

90. The pharmaceutical combination of any one of claims 80 to 89, wherein the first and second isoforms are functionally indistinguishable but immunologically distinguishable.

91. The pharmaceutical combination of any one of claims 80 to 90, wherein the donor cells express both the first isoform of the target protein and the second isoform of the target protein.

92. The pharmaceutical combination of any one of claims 80 to 90, wherein the donor cells express only the first isoform of the target protein.

93. 93. The pharmaceutical combination of any one of claims 80 to 92, wherein the first isoform of the target protein is expressed from an expression vector in the donor cell population, or a genomic locus has been edited to express the first isoform of the target protein in the donor cell population.

94. 94. The pharmaceutical combination of claim 93, wherein the genomic locus is an endogenous genomic locus encoding the target protein, optionally wherein the target protein is IL2RG and the genomic locus is the IL2RG genomic locus.

95. 94. The pharmaceutical combination of claim 93, wherein the genomic locus is not an endogenous genomic locus encoding the target protein, optionally wherein the target protein is IL2RG and the genomic locus is not an IL2RG genomic locus.

96. The pharmaceutical combination of any one of claims 80 to 95, wherein the first isoform of the target protein is a genetically engineered isoform of the target protein.

97. 97. The pharmaceutical combination of any one of claims 80 to 96, wherein the first isoform of the target protein is engineered to contain a mutation that provides an altered epitope, optionally wherein the mutation is an artificial mutation.

98. 98. The pharmaceutical combination of claim 97, wherein the altered epitope is a binding region of the target protein antagonist such that the target protein antagonist exhibits reduced or lost ability to bind to and / or inhibit the first isoform of the target protein compared to its ability to bind to and / or inhibit the second isoform of the target protein.

99. 99. The pharmaceutical combination of claim 98, wherein both the first isoform of the target protein and the second isoform of the target protein retain the ability to bind to an endogenous ligand, and optionally the target protein antagonist blocks binding of the endogenous ligand to the second isoform of the target protein but not to the first isoform of the target protein.

100. the target protein is IL2RG, the altered epitope is in a binding region of the target protein antagonist, and the target protein antagonist is an antibody comprising an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs; the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; The pharmaceutical combination according to any one of claims 97 to 99.

101. The pharmaceutical combination of any one of claims 97 to 100, wherein the target protein is IL2RG and the mutation comprises a mutation encoded by a nucleotide within exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus.

102. The pharmaceutical combination according to any one of claims 97 to 101, wherein the target protein is IL2RG and the mutation comprises a mutation or substitution within the region from T127 to N150 and / or within the region from L87 to D97.

103. The pharmaceutical combination of any one of claims 97 to 102, wherein the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, and / or K147.

104. The pharmaceutical combination of any one of claims 97 to 103, wherein the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145, optionally wherein the substitution is an M145K substitution, an M145D substitution, an M145E substitution, an M145P substitution, an M145W substitution, or an M145Y substitution.

105. The pharmaceutical combination of any one of claims 97 to 104, wherein the target protein is IL2RG and the mutation comprises an M145K substitution.

106. The pharmaceutical combination of any one of claims 97 to 105, wherein the target protein is IL2RG and the mutation comprises a mutation or substitution at position W90, optionally wherein the substitution is a W90V substitution, a W90R substitution, a W90Q substitution, a W90L substitution, a W90K substitution, a W90E substitution, or a W90D substitution, optionally wherein the mutation comprises a W90Q substitution.

107. The pharmaceutical combination of any one of claims 97 to 106, wherein the target protein is IL2RG and the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

108. The pharmaceutical combination of any one of claims 80 to 107, wherein the target protein antagonist is an antigen-binding protein.

109. The pharmaceutical combination of claim 108, wherein the antigen-binding protein is an antibody or an antigen-binding fragment thereof.

110. the target protein is IL2RG, the antigen binding protein comprises an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs; the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; 110. The pharmaceutical combination of claim 108 or 109.

111. the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; The pharmaceutical combination of claim 110.

112. the target protein is IL2RG, the antigen binding protein comprises an immunoglobulin light chain variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO: 10; the antigen binding protein comprises an immunoglobulin heavy chain variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO:2; 110. The pharmaceutical combination of claim 108 or 109.

113. the target protein is IL2RG, the immunoglobulin light chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10; the immunoglobulin heavy chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:2; The pharmaceutical combination of claim 112.

114. the target protein is IL2RG, the antigen binding protein comprises an immunoglobulin light chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO:20; the antigen binding protein comprises an immunoglobulin heavy chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 18; 110. The pharmaceutical combination of claim 108 or 109.

115. The pharmaceutical combination of any one of claims 80 to 114, wherein the donor cells are hematopoietic cells, and optionally the donor cells are immune cells.

116. The pharmaceutical combination of any one of claims 80 to 115, wherein the donor cells are lymphocytes or lymphoid progenitor cells.

117. The pharmaceutical combination of any one of claims 80 to 116, wherein the donor cells are T cells.

118. The pharmaceutical combination of any one of claims 80 to 117, wherein the donor cells are tumor infiltrating lymphocytes (TILs).

119. The pharmaceutical combination of any one of claims 80 to 116, wherein the donor cells are B cells.

120. The pharmaceutical combination of any one of claims 80 to 116, wherein the donor cells are NK cells.

121. The pharmaceutical combination of any one of claims 80 to 115, wherein the donor cells are hematopoietic stem cells or hematopoietic stem and progenitor cells.

122. The pharmaceutical combination of any one of claims 80 to 121, wherein the donor cells are derived from induced pluripotent stem cells or from hematopoietic stem or stem and progenitor cells.

123. The pharmaceutical combination of any one of claims 80 to 122, wherein the subject is a mammal or a non-human mammal, and the donor cells are mammalian cells or non-human mammalian cells.

124. The pharmaceutical combination of any one of claims 80 to 123, wherein the subject is a human and the donor cells are human cells.

125. The pharmaceutical combination of any one of claims 80 to 124, wherein the donor cells contain or express a therapeutic molecule.

126. The pharmaceutical combination of claim 125, wherein the therapeutic molecule does not target the target protein.

127. The pharmaceutical combination of any one of claims 80 to 126, wherein the donor cells contain or express immunoglobulins.

128. The pharmaceutical combination of claim 127, wherein the immunoglobulin does not target the target protein.

129. The pharmaceutical combination of any one of claims 80 to 128, wherein the donor cells comprise a chimeric antigen receptor (CAR) or an exogenous T cell receptor (TCR).

130. The pharmaceutical combination of claim 129, wherein the CAR or the exogenous TCR does not target the target protein.

131. The pharmaceutical combination of any one of claims 80 to 130, wherein the donor cells are autologous.

132. The pharmaceutical combination of any one of claims 80 to 130, wherein the donor cells are allogeneic or syngeneic.

133. The pharmaceutical combination of any one of claims 80 to 132, wherein the subject has a disease or disorder and the pharmaceutical combination is for treating the disease or disorder.

134. The pharmaceutical combination of any one of claims 80 to 133, wherein the subject has cancer.

135. The pharmaceutical combination of claim 134, wherein the cancer is a solid tumor cancer.

136. The pharmaceutical combination of claim 134, wherein the cancer is a blood cancer.

137. The pharmaceutical combination of any one of claims 80 to 132, wherein the subject has a hematopoietic malignancy and the pharmaceutical combination is for treating the hematopoietic malignancy in the subject.

138. The pharmaceutical combination of any one of claims 80 to 137, wherein the subject has a defective immune cell or an inherited hematopoietic deficiency.

139. The pharmaceutical combination of claim 138, wherein the inherited hematopoietic deficiency is sickle cell disease or severe combined immunodeficiency (SCID).

140. 1. An isolated cell or cell population that has been modified to express a first isoform of interleukin-2 receptor subunit gamma (IL2RG) that is distinct from a second isoform of IL2RG, wherein said first isoform of IL2RG has been genetically engineered to include a mutation that provides an altered epitope, said altered epitope being a binding region for an IL2RG antagonist, such that said IL2RG antagonist exhibits reduced or lost ability to bind to and / or inhibit said first isoform of IL2RG compared to its ability to bind to and / or inhibit said second isoform of IL2RG, and wherein said first isoform of IL2RG retains binding to its endogenous ligand.

141. 141. The isolated cell or cell population of claim 140, wherein the mutation is an artificial mutation.

142. 142. The isolated cell or cell population of claim 140 or 141, wherein both the first isoform of IL2RG and the second isoform of IL2RG retain the ability to bind to an endogenous ligand, and optionally the IL2RG antagonist blocks binding of the endogenous ligand to the second isoform of IL2RG but does not block binding of IL2RG to the first isoform.

143. 143. The isolated cell or cell population of any one of claims 140-142, wherein said first and second isoforms are functionally indistinguishable but immunologically distinguishable.

144. 144. The isolated cell or cell population of any one of claims 140-143, wherein said cell(s) express both said first isoform of IL2RG and said second isoform of IL2RG.

145. 144. The isolated cell or cell population of any one of claims 140-143, wherein said cell(s) express only said first isoform of IL2RG.

146. 146. The isolated cell or cell population of any one of claims 140-145, wherein the first isoform of IL2RG is expressed in the cell(s) from an expression vector or a genomic locus has been edited to express the first isoform of IL2RG in the cell(s).

147. 147. The isolated cell or cell population of claim 146, wherein the genomic locus is an endogenous IL2RG genomic locus.

148. 147. The isolated cell or cell population of claim 146, wherein the genomic locus is not an endogenous IL2RG genomic locus.

149. the altered epitope is in the binding region of the IL2RG antagonist, and the IL2RG antagonist is an antibody comprising an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs; the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; 149. The isolated cell or cell population of any one of claims 140 to 148.

150. 150. The isolated cell or cell population of any one of claims 140 to 149, wherein the mutation comprises a mutation encoded by a nucleotide within exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus.

151. 151. The isolated cell or cell population of any one of claims 140 to 150, wherein the mutation comprises a mutation or substitution within the region from T127 to N150 and / or within the region from L87 to D97.

152. 152. The isolated cell or cell population of any one of claims 140 to 151, wherein the mutation comprises a mutation or substitution at positions M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, and / or K147.

153. 153. The isolated cell or cell population of any one of claims 140-152, wherein the mutation comprises a mutation or substitution at position M145, optionally wherein the substitution is an M145K, M145D, M145E, M145P, M145W, or M145Y substitution.

154. 154. The isolated cell or cell population of any one of claims 140 to 153, wherein the mutation comprises a M145K substitution.

155. 155. The isolated cell or cell population of any one of claims 140-154, wherein the mutation comprises a mutation or substitution at position W90, optionally wherein the substitution is a W90V, W90R, W90Q, W90L, W90K, W90E, or W90D substitution, optionally wherein the mutation comprises a W90Q substitution.

156. 156. The isolated cell or cell population of any one of claims 140 to 155, wherein the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

157. 157. The isolated cell or cell population of any one of claims 140-156, wherein the first isoform of IL2RG and the second isoform of IL2RG are immunologically distinguishable by the IL2RG antagonist, and the IL2RG antagonist specifically binds to the second isoform of IL2RG but not to the first isoform of IL2RG.

158. 158. The isolated cell or cell population of any one of claims 140-157, wherein the IL2RG antagonist is an antigen binding protein.

159. 159. The isolated cell or cell population of claim 158, wherein the antigen binding protein is an antibody or an antigen binding fragment thereof.

160. the antigen binding protein comprises an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs; the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; 160. The isolated cell or cell population of claim 158 or 159.

161. the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; 161. The isolated cell or cell population of claim 160.

162. the antigen binding protein comprises an immunoglobulin light chain variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO: 10; the antigen binding protein comprises an immunoglobulin heavy chain variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO:2; 160. The isolated cell or cell population of claim 158 or 159.

163. the immunoglobulin light chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10; the immunoglobulin heavy chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:2; 163. The isolated cell or cell population of claim 162.

164. the antigen binding protein comprises an immunoglobulin light chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO:20; the antigen binding protein comprises an immunoglobulin heavy chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 18; 160. The isolated cell or cell population of claim 158 or 159.

165. 165. The isolated cell or cell population of any one of claims 140-164, wherein the cell(s) are hematopoietic cell(s), and optionally the cell(s) are immune cell(s).

166. 166. The isolated cell or cell population of any one of claims 140 to 165, wherein said cell(s) is / are lymphocytes or lymphoid progenitor cell(s).

167. 167. The isolated cell or cell population of any one of claims 140 to 166, wherein said cell(s) is / are T cell(s).

168. 168. The isolated cell or cell population of any one of claims 140-167, wherein said cell(s) are tumor infiltrating lymphocyte(s) (TIL).

169. 167. The isolated cell or cell population of any one of claims 140 to 166, wherein said cell(s) is(are) a B cell(s).

170. 167. The isolated cell or cell population of any one of claims 140 to 166, wherein said cell(s) is / are NK cell(s).

171. 166. The isolated cell or cell population of any one of claims 140-165, wherein said cell(s) is / are hematopoietic stem cell(s) or hematopoietic stem and progenitor cell(s).

172. 172. The isolated cell or cell population of any one of claims 140-171, wherein said cell(s) are induced pluripotent stem cell(s).

173. 173. The isolated cell or cell population of any one of claims 140-172, wherein said cell(s) are mammalian cell(s) or non-human mammalian cell(s).

174. 174. The isolated cell or cell population of any one of claims 140 to 173, wherein said cell(s) are human cell(s).

175. 175. The isolated cell or cell population of any one of claims 140 to 174, wherein said cell(s) contain or express a therapeutic molecule.

176. 176. The isolated cell or cell population of claim 175, wherein said therapeutic molecule does not target IL2RG.

177. 177. The isolated cell or cell population of any one of claims 140 to 176, wherein said cell(s) comprise or express an immunoglobulin.

178. 178. The isolated cell or cell population of claim 177, wherein said immunoglobulin does not target IL2RG.

179. 179. The isolated cell or cell population of any one of claims 140-178, comprising the cell(s), a chimeric antigen receptor (CAR) or an exogenous T cell receptor (TCR).

180. 180. The isolated cell or cell population of claim 179, wherein the CAR or the exogenous TCR does not target IL2RG.

181. 181. The isolated cell or cell population of any one of claims 140 to 180, wherein said cell(s) are isolated from a subject.

182. 182. The isolated cell or cell population of any one of claims 140 to 181 for use in treating a subject having cells that express the second isoform of IL2RG.

183. 183. The isolated cell or cell population for use of claim 182, wherein said cell(s) are isolated from said subject.

184. 184. A method of producing the isolated cell or cell population of any one of claims 140-183, comprising modifying a cell or cell population to express said first isoform of IL2RG.

185. 185. The method of claim 184, wherein said modifying step comprises introducing an expression vector encoding said first isoform of IL2RG, or wherein said modifying step comprises editing a genomic locus to express said first isoform of IL2RG.

186. 186. The method of claim 185, wherein the genomic locus is an endogenous IL2RG genomic locus.

187. 186. The method of claim 185, wherein the genomic locus is not an endogenous IL2RG genomic locus.

188. The editing step includes: (1) a nuclease agent or one or more nucleic acids encoding said nuclease agent, wherein said nuclease agent targets a nuclease target sequence in said genomic locus; and (2) exogenous donor nucleic acid; into the cell, the nuclease agent cleaves the genomic locus and the exogenous donor nucleic acid is inserted into or recombines with the genomic locus to generate the donor cell expressing the first isoform of IL2RG.

188. The method of any one of claims 185 to 187.

189. the nuclease agent (a) zinc finger nucleases (ZFNs); (b) a transcription activator-like effector nuclease (TALEN), or (c) (i) a Cas protein, and (ii) a guide RNA comprising a DNA-targeting segment that targets a guide RNA target sequence that is the nuclease target sequence, wherein the guide RNA binds to the Cas protein and directs the Cas protein to the guide RNA target sequence.

189. The method of claim 188, comprising:

190. 190. The method of Claim 189, wherein the nuclease agent comprises the Cas protein and the guide RNA, and optionally wherein the DNA-targeting segment comprises the sequence set forth in any one of SEQ ID NOs: 76-87, or the guide RNA target sequence comprises the sequence set forth in any one of SEQ ID NOs: 64-75, or optionally wherein the DNA-targeting segment comprises the sequence set forth in any one of SEQ ID NOs: 136-153, or the guide RNA target sequence comprises the sequence set forth in any one of SEQ ID NOs: 118-135.

191. 191. The method of claim 189 or 190, wherein the Cas protein is a Cas9 protein.

192. 192. The method of any one of claims 188-191, wherein the exogenous donor nucleic acid comprises homology arms.

193. 193. The method of any one of claims 188-192, wherein the exogenous donor nucleic acid is a single-stranded oligodeoxynucleotide (ssODN), optionally wherein the ssODN comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 88-117, or optionally wherein the ssODN comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 154-173.

194. (I) the DNA targeting segment comprises the sequence set forth in SEQ ID NO: 77, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 65, and the ssODN comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 88-97; (II) The DNA targeting segment comprises the sequence set forth in SEQ ID NO: 83, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 71, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 98-107; (III) The DNA targeting segment comprises the sequence set forth in SEQ ID NO: 86, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 74, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 108-117; (IV) the DNA-targeting segment comprises the sequence set forth in SEQ ID NO: 137, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 119, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 154-163; or (V) the DNA-targeting segment comprises the sequence set forth in SEQ ID NO: 138, or the guide RNA target sequence comprises the sequence set forth in SEQ ID NO: 120, and the ssODN comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 164-173; The method of claim 193.

195. 1. A genetically engineered human interleukin-2 receptor subunit gamma (IL2RG) protein comprising artificial mutations that provide an altered epitope, wherein the altered epitope is a binding region for an IL2RG antagonist, such that the IL2RG antagonist exhibits reduced or lost ability to bind to and / or inhibit the genetically engineered IL2RG protein compared to its ability to bind to and / or inhibit wild-type human IL2RG protein, and wherein the genetically engineered IL2RG protein retains binding to its endogenous ligand.

196. 196. The genetically engineered human IL2RG protein of claim 195, wherein the genetically engineered IL2RG protein is functionally indistinguishable but immunologically distinguishable from the native IL2RG protein.

197. the altered epitope is in the binding region of the IL2RG antagonist, and the IL2RG antagonist is an antibody comprising an immunoglobulin light chain or a variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or a variable region thereof comprising three heavy chain CDRs; the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; 197. The genetically engineered human IL2RG protein of claim 195 or 196.

198. 198. The genetically engineered human IL2RG protein of any one of claims 195-197, wherein the mutation comprises a mutation encoded by a nucleotide within exon 2 and / or exon 3 of the IL2RG gene at the IL2RG genomic locus.

199. 199. The genetically engineered human IL2RG protein of any one of claims 195 to 198, wherein the mutation comprises a mutation or substitution within the region from T127 to N150 and / or within the region from L87 to D97.

200. 200. The engineered human IL2RG protein of any one of claims 195-199, wherein the artificial mutation comprises a mutation or substitution at positions M145, W90, K92, N93, D95, D97, T127, R139, R140, Q141, T143, and / or K147.

201. 201. The engineered human IL2RG protein of any one of claims 195-200, wherein the artificial mutation comprises a mutation or substitution at position M145, optionally wherein the substitution is an M145K, M145D, M145E, M145P, M145W, or M145Y substitution.

202. 202. The engineered human IL2RG protein of any one of claims 195-201, wherein the artificial mutation comprises a M145K substitution.

203. 203. The engineered human IL2RG protein of any one of claims 195-202, wherein the mutation comprises a mutation or substitution at position W90, optionally wherein the substitution is a W90V, W90R, W90Q, W90L, W90K, W90E, or W90D substitution, optionally wherein the mutation comprises a W90Q substitution.

204. 204. The engineered human IL2RG protein of any one of claims 195 to 203, wherein the mutation comprises a mutation or substitution at position M145 and a mutation or substitution at position W90.

205. 205. The genetically engineered human IL2RG protein of any one of claims 195-204, wherein the genetically engineered IL2RG protein and the native IL2RG protein are functionally indistinguishable by the IL2RG antagonist but immunologically distinguishable.

206. 206. The genetically engineered human IL2RG protein of any one of claims 195-205, wherein the IL2RG antagonist is an antigen-binding protein.

207. 207. The genetically engineered human IL2RG protein of claim 206, wherein the antigen-binding protein is an antibody or an antigen-binding fragment thereof.

208. the antigen binding protein comprises an immunoglobulin light chain or variable region thereof comprising three light chain CDRs and an immunoglobulin heavy chain or variable region thereof comprising three heavy chain CDRs; the three light chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of sequences at least 90% identical to the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; 208. The genetically engineered human IL2RG protein of claim 206 or 207.

209. the three light chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 12, 14, and 16, respectively; the three heavy chain CDRs comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOs: 4, 6, and 8, respectively; 209. The genetically engineered human IL2RG protein of claim 208.

210. the antigen binding protein comprises an immunoglobulin light chain variable region comprising, consisting essentially of, or consisting of a sequence at least 90% identical to the sequence set forth in SEQ ID NO: 10; the antigen binding protein comprises an immunoglobulin heavy chain or variable region comprising, consisting essentially of, or consisting of a sequence that is at least 90% identical to the sequence set forth in SEQ ID NO:2; 208. The genetically engineered human IL2RG protein of claim 206 or 207.

211. the immunoglobulin light chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 10; the immunoglobulin heavy chain variable region comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO:2; 211. The genetically engineered human IL2RG protein of claim 210.

212. the antigen binding protein comprises an immunoglobulin light chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO:20; the antigen binding protein comprises an immunoglobulin heavy chain comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 18; 208. The genetically engineered human IL2RG protein of claim 206 or 207.

213. 213. A nucleic acid encoding the engineered human IL2RG protein of any one of claims 195 to 212, optionally wherein the nucleic acid is an expression vector encoding the engineered human IL2RG protein.

Images