Immunosuppressive compounds

Novel compounds selectively deplete coronin 1 in immune cells by inhibiting the coronin 1 promoter and BRD3, addressing side effects of current immunosuppressants and effectively treating autoimmune diseases and transplant rejection.

JP2025534417APending Publication Date: 2025-10-15UNIVERSITY OF BASEL +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025519003
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-09-30
Filing Date
2023-09-30
Publication Date
2025-10-15

AI Technical Summary

Technical Problem

Current immunosuppressants target proteins widely expressed in the human body, leading to numerous side effects and toxicities, and there is a lack of effective methods to selectively inhibit coronin 1 expression for treating autoimmune diseases and transplant rejection.

Method used

Development of novel compounds that deplete coronin 1 levels in immune cells by inhibiting the coronin 1 promoter, utilizing asymmetric synthesis to achieve stereoselective inhibition, and targeting BRD3 to suppress coronin 1 expression.

Benefits of technology

Induces immunosuppression with minimal toxicity, promoting long-term transplant acceptance and suppressing autoimmune diseases while maintaining immunity against infections and cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025534417000001_ABST
    Figure 2025534417000001_ABST
Patent Text Reader

Abstract

The present invention relates to compounds of formula (I) or pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers, polymorphs, racemic mixtures, solvates, or isomers and mixtures thereof. The present invention further relates to processes for the stereoselective preparation of such compounds. Compounds of formula (I) can be used as pharmaceuticals for inhibiting coronin 1 expression, particularly in inducing immunosuppression or in the treatment and / or prevention of diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. The present invention further relates to a vector comprising a coronin 1 promoter element in a vertebrate genome, the coronin 1 promoter element beginning immediately upstream of the transcription starting site (TSS) of the coronin 1 gene and spanning at least about 700 bp of sequence within the genome. The present invention further relates to a method for identifying immunomodulatory compounds that alter coronin 1 promoter activity using the vector. The present invention further relates to BRD3 as an upstream target involved in driving the expression and activity of coronin-1 in immune cells, and to compounds, particularly compounds of formula (I), that selectively target the bromodomain of BRD3, thereby depleting coronin-1 levels. [Formula 1] JPEG2025534417000130.jpg27123
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to immunosuppressive compounds that deplete coronin 1 levels, in particular coronin 1 promoter inhibitors.

[0002] In particular, the present invention relates to compounds of formula (I) and methods for the asymmetric (i.e., stereoselective) synthesis of compounds of formula (I). Compounds of formula (I) are provided for use as pharmaceuticals and are particularly suitable for inhibiting coronin 1 expression via coronin 1 promoter inhibition in inducing immunosuppression or in the treatment and / or prevention of diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. The present invention further provides a vector comprising a coronin 1 promoter element in a vertebrate genome, the coronin 1 promoter element beginning immediately upstream of the transcription starting site (TSS) of the coronin 1 gene and spanning a 1500 bp, or at least about 700 bp, sequence region within the genome; and methods for identifying compounds that modulate coronin 1 promoter activity.

[0003] The present invention further relates to the epigenetic reader bromodomain-containing protein 3 (BRD3) as an upstream target that controls coronin-1 promoter activity and coronin-1 expression in immune cells, and to compounds that act through the inhibition of BRD3. [Background technology]

[0004] T cell homeostasis is central to the ability of vertebrates to mount effective immune responses. Lymphocyte precursors derived from the bone marrow home to the thymus, where negative and positive selection generates CD4 or CD8 single-positive T lymphocytes. From the thymus, single-positive T lymphocytes disseminate to peripheral organs, where they circulate in a naive state between secondary lymphoid organs and the blood for long periods of time. Upon infection, T cells become activated by dendritic cells in peripheral lymph nodes, which induce massive proliferation of so-called effector T cells. After the infection clears, effector cells must be eliminated to maintain peripheral T cell homeostasis.

[0005] Signals responsible for T cell selection, proliferation, and survival depend on stimulation of the T cell receptor by major histocompatibility complex (MHC) molecules present on antigen-presenting molecules. In the thymus, positive selection selects for thymocytes that recognize self-MHC molecules, while negative selection ensures the elimination of T cells that strongly recognize self-peptides in the context of self-MHC. Taken together, these selection processes within the thymus ensure the generation of naive, non-self-reactive T cells against peripheral organ populations.

[0006] Coronin 1, also known as coronin 1A (coro1a, CORO1A), IMD8, coronin-1, clipin A, P57, or TACO (tryptophan aspartate-containing coat protein), is a protein transcribed in all cells of the hematopoietic system and neurons (Ferrari, G., et al., Cell, 1999.97(4):pp.435-47; Pieters, J., et al., Nat Rev Immunol, 2013.13(7):pp.510). Coronin 1 is a member of the WD repeat family of coronin proteins that is widely expressed throughout the eukaryotic kingdom (Gatfield et al., Mol Biol Cell 2005,16,2786-2798; Pieters, J., et al., Nat Rev Immunol, 2013.13(7):pp.510).

[0007] The role of coronin 1 has been suggested to be to allow mycobacteria to survive within macrophage phagosomes. Coronin 1 has been shown to inhibit endosome / lysosome fusion and to confer non-fusogenic properties to certain mycobacteria-containing phagosomes (Ferrari, G., et al., Cell, 1999. 97(4): pp. 435-47; Jayachandran, R., et al., Cell, 2007. 130(1): pp. 37-50).

[0008] Studies analyzing complete coronin-1 knockout mice have shown that this molecule is a key regulator of naive T cell homeostasis and has been linked to immunodeficiency and autoimmune disorders (Mueller, P., et al., Nat Immunol, 2008.9(4):pp.424-31; Foger, N., et al., Science, 2006.313(5788):pp.839-42; Shiow, L.R., et al., Nat Immunol, 2008.9(11):pp.1307-15; Haraldsson, M.K., et al., Immunity, 2008.28(1):pp.40-51; Siegmund, K., et al., J Immunol, 2011.186(6):pp.3452-61). T cell-specific coronin 1 knockout mice were largely resistant to the induction of autoimmunity (Siegmund et al., J. Biol. Chem 2016, 291(42), 22086-22092). Thus, coronin 1 appears to have a predominantly T cell-intrinsic role. Furthermore, coronin 1-deficient mice tolerated allografts from MHC-mismatched donors, resulting in long-term survival of the transplanted organ and the absence of a graft-versus-host response. In these mice, loss of coronin 1 leads to immunosuppression, attenuating autoimmune responses and allograft rejection, while largely maintaining immunity to infectious and foreign antigens (Pieters et al., Nat Rev Immunol. 2013, 13(7), 510-518; Jayachandran, R., et al., Immunity, 2019. 50(1): p. 152-165; Siegmund, K., et al., J Immunol, 2011. 186(6): p. 3452-61).

[0009] Currently used immunosuppressants often target proteins widely expressed in the human body and cause numerous side effects and toxicities (Rodriguez-Peralvarez, et al., Curr Opin Organ Transplant, 2014, 19(3): pp. 253-60). For example, drugs such as calcineurin inhibitors (cyclosporine / FK506), corticosteroids, and sirolimus can cause various side effects and drug-induced toxicities, including cancer, opportunistic infections, hypertension, altered metabolic profiles, and reduced patient compliance (Dantal, J. and M. Campone, Transplantation, 2016, 100(12): pp. 2569-2583; Ross, K., J Natl Cancer Inst, 2007, 99(6): pp. 421-2).

[0010] The dihydropyridine skeleton has been used as a heterocyclic structure in drugs for the treatment of several diseases, with several functions including, but not limited to, antihypertensive, antitumor, and anticonvulsant activities (selected review: VK Sharmaa and SK Singh, RSC Adv., 2017, 7, 2682-2732). Most commercially used dihydropyridine-containing drugs are either achiral or used as racemates; few are used as single enantiomers. While asymmetric syntheses of dihydropyridines have been developed, no routes to related diaryl-substituted 4,6,7,8-tetrahydroquinolin-5(1H)-ones have been reported.

[0011] The Bromodomain Extra Terminal (BET) family of proteins is an epigenetic reader composed of four paralogous members (BDR2, BRD3, BRD4, and BRDT) that recognize the acetylated N-terminal tails of histones, act as readers of lysine acetylation status, and interact with components of the transcriptional and chromatin remodeling machinery. These proteins play important roles in malignant transformation and immune function (Gilan, O., et al., Science, 2020.368(6489):pp.387-394; Faivre, EJ, et al., Nature, 2020.578(7794):pp.306-310). They are characterized by the presence of two tandem bromodomains, bromodomain 1 (BD1) and bromodomain 2 (BD2), that assist in docking to acetylated lysines on histones, aiding in chromatin binding. The BD1 and BD2 domains are highly conserved in evolution and also retain a remarkable level of homology across paralogs. Structurally, they are characterized by an evolutionarily conserved sequence of approximately 110 amino acids that folds into four α-helices (αZ, αA, αB, αC) interconnected by two intervening loops (BC and ZA loops) that collectively form a hydrophobic binding cavity for interacting with acetylated lysines on histones. Due to the high level of similarity between paralogs, selectively targeting a specific BET protein has been challenging, with previously reported compounds either binding to both the BD1 and BD2 domains of all four members (pan-BET inhibitors) or to a single BD domain of all four BET proteins (either BD1 (pan-BD1-selective inhibitors) or BD2 (pan-BD2-selective inhibitors)) (Wang, N., et al., Signal Transduct Target Ther, 2021. 6(1):p. 23; Qi, J. and Y. Shi, Cancer Cell, 2020. 37(6):p. 764-766).BRD4 is the most well-studied member of this family, followed by BRD2. These members have been reported to play important roles in cancer development, embryogenesis, sepsis, immune function, and fibrosis. Knockout of the BRD4 and BRD2 genes results in embryonic lethality (Houzelstein, D., et al., Mol Cell Biol, 2002. 22(11): p. 3794-802; Shang, E., et al., Dev Dyn, 2009. 238(4): p. 908-17). On the other hand, the role of BRD3 is the least characterized, and its primary function remains largely unknown, as its functional overlap with BRD2 results in only minor changes (Daneshvar, K., et al., Nat Cell Biol, 2020. 22(10): p. 1211-1222. Stonestrom, AJ, et al., Drug Discov Today Technol, 2016. 19: p. 23-28.).

[0012] WO 2011 / 127164 discloses certain compositions for treating fibrosis.

[0013] WO 2006 / 122156 discloses certain compounds that modulate TRPV3 function.

[0014] WO 2008 / 070875 discloses certain polyhydroquinoline and dihydropyridine compounds for inhibiting β-amyloid production.

[0015] WO 2013 / 009799 discloses certain vitamin D receptor agonists and uses thereof.

[0016] The catalog "Aurora Building Blocks 7" dated April 4, 2022, published by Aurora Fine Chemicals (Graz, Austria), discloses certain compounds containing a 2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate moiety. Summary of the Invention

[0017] The present inventors have developed and identified novel compounds that deplete coronin 1 in cells, preferably immune cells, by inhibiting the coronin 1 promoter. Furthermore, the absolute configuration of the eutomers was determined, thereby separating the toxicity of certain compounds from their coronin 1 promoter inhibitory activity. Chiral separation methods and asymmetric synthetic routes for these compounds have been developed.These compounds are useful for immunosuppression, induction of allotolerance, or treatment of transplant rejection, preferably allograft rejection, autoimmune diseases (psoriasis, vitiligo, multiple sclerosis, systemic lupus erythematosus, primary sclerosing cholangitis, Hashimoto's thyroiditis, rheumatoid arthritis, myasthenia gravis, type I or II diabetes, disorders secondary to type I or II diabetes, vasculitis, pernicious anemia, Sjögren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis) via coronin 1 depletion. , allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis, and allergic contact dermatitis), inflammatory diseases (inflammatory bowel disease, Crohn's disease, ulcerative colitis, endogenous asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, cardiovascular disease, prurigo nodularis, hidradenitis suppurativa, fibrotic disorders, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, eosinophilic The present invention provides a novel approach for the prevention and / or treatment of diseases selected from the group consisting of, but not limited to, esophagitis, skin manifestations of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome, infectious diseases (preferably selected from the group consisting of, but not limited to, tuberculosis caused by mycobacteria, Salmonella spp. infections, Helicobacter spp. infections, retroviral infections, preferably HIV or HTLV, cytomegalovirus infections, Candida infections, Staphylococcus infections, lymphocytic choriomeningitis virus infections, and viral hepatitis), and lymphoproliferative disorders (selected from the group consisting of, but not limited to, T-cell lymphomas and T-cell leukemias).

[0018] The identified coronin 1 promoter inhibitors were validated for coronin 1 depletion at the mRNA and protein levels, demonstrating coronin 1 depletion. For example, compound 11 (methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate) induced approximately 40% coronin 1 depletion both in vitro and in vivo with minimal toxicity. Hematological parameters and general health, as assessed by weight change, were not associated with any potential toxicity. Furthermore, in vitro studies using human peripheral blood mononuclear cells (PBMCs) have demonstrated that coronin 1 promoter inhibitors deplete coronin 1 levels in human CD4 and CD8 T cells, which inhibit the production of proinflammatory cytokines (interleukin-2, tumor necrosis factor, and interferon-gamma) upon T cell receptor stimulation, demonstrating the immunosuppressive effects of coronin 1 promoter inhibitors. Therefore, administration of coronin 1 promoter inhibitors is expected to result in long-term transplant acceptance and suppression of autoimmune diseases over the long term (Jayachandran, R., et al., Cell, 2007. 130(1): p. 37-50.; Jayachandran, R., et al., Immunity, 2019. 50: p. 1-15. Siegmund, K., et al., J Immunol, 2011. 186(6): p. 3452-61.; Haraldsson, MK, et al., Immunity, 2008. 28(1): p. 40-51).

[0019] Coronin 1 is expressed in various immune subtypes and is particularly required for the survival of peripheral T cells (Pieters, J., et al., Nat Rev Immunol, 2013, 13(7):p.510). Coronin 1-deficient mice and humans exhibit depletion of T cells in peripheral lymphoid organs and blood. Despite this T cell deficiency, coronin 1-deficient mice have a normal lifespan and do not exhibit increased incidence of opportunistic infections or spontaneous cancers. On the other hand, the presence of coronin 1 extends survival in MHC-mismatched organ transplants and confers resistance to the development of autoimmune disorders (Jayachandran, R., et al., Immunity, 2019, 50:p.1-15; Siegmund, K., et al., J Immunol, 2011, 186(6):p.3452-61). These data further support the idea that depletion of coronin 1 levels in vivo induces a state of immunosuppression that results in prolonged organ transplant survival, suppression of autoimmune diseases, and the absence of any major complications associated with infection or malignancy. Because coronin 1 modulators primarily affect T cell-specific function and survival, side effects and toxicity are expected to be minimal. Furthermore, immunity (including T cell-dependent immunity) against microbial pathogens and cancer is maintained despite coronin 1 ablation (Jayachandran, R., et al., Immunity, 2019. 50: pp. 1-15).

[0020] The present inventors further identified bromodomain 3 (BRD3) as an upstream regulator of coronin 1 expression and identified novel compounds that selectively target the bromodomain of BRD3 to inhibit coronin 1 expression. In other words, the compounds of the present invention deplete coronin 1 in cells, preferably immune cells, by inhibiting BRD3 and suppressing coronin 1 promoter activity. Thus, these compounds provide a novel approach for immunosuppression, induction of allogeneic tolerance, or prevention and / or treatment of transplant rejection, preferably allograft rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders, via targeting BRD3 to result in coronin 1 depletion. Furthermore, BRD3 has been shown to play a role in certain malignant conditions and their metastasis (BRD3-driven Nuclear protein in Testis (NUT) Midline Carcinoma (NMC), BRD3-driven Ovarian Clear Cell Carcinoma (OCCC)), colorectal cancer, and rhabdomyosarcoma, suggesting that these compounds may be potentially applicable in the treatment of these oncological conditions (Ballenberger, M., et al., Chest, 2022. 161(1): p. e43-e49; French, CA, et al., Oncogene, 2008. 27(15): p. 2237-42; Roberts, TC, et al., Sci Rep, 2017. 7(1): p. 6153; Hsu, PL., et al., Sci Adv,2023.9,eade3422。)

[0021] Coronin 1 is also required for bacterial survival (e.g., Mycobacteria, Helicobacter, and Salmonella) within macrophages (Jayachandran, R., et al., Cell, 2007. 130(1): pp. 37-50; Jayachandran, R., et al., Immunity, 2019. 50: pp. 1-15; Zheng, P. Y. and N. L. Jones, Cell Microbiol, 2003. 5(1): pp. 25-40). Therefore, reduction of coronin 1 provides a method for killing bacteria and treating and / or preventing bacterial infections and diseases, such as tuberculosis, gastric ulcers, and gastric cancer.

[0022] Furthermore, we designed a reporter gene-based screening assay to identify compounds that selectively inhibit coronin 1 promoter activity, as measured by a reduction in reporter gene expression (e.g., green fluorescent protein (GFP) signal). The specificity of test compounds for selectively inhibiting the coronin 1 promoter was assessed by analyzing the inhibition of an unrelated promoter, e.g., the early cytomegalovirus promoter driving a different reporter gene (e.g., red fluorescent protein (RFP)).

[0023] In one aspect, the present invention relates to a vector comprising a coronin 1 (coro1a) promoter element, wherein the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in a vertebrate genome and spans a sequence region of at least about 700 bp within the genome. Preferably, the coronin 1 promoter element spans a sequence region of at least 1500 bp within the genome.

[0024] In a further aspect, the present invention provides a method for the identification of compounds that modulate coronin 1 promoter activity, comprising the steps of: a. providing a host cell comprising the vector of the present invention, wherein the host cell is capable of expressing the promoter reporter gene of the vector; b. exposing the host cells to the compound to be tested; c. measuring expression of the coronin 1 promoter reporter gene in the host cells exposed to the compound to be tested; The present invention relates to a method, including:

[0025] In a further aspect, the present invention relates to a cell comprising the vector of the present invention.

[0026] In a first embodiment, the present invention provides a compound of formula (I):

[0027] [ka]

[0028] or pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers, polymorphs, racemic mixtures, solvates or isomers and mixtures thereof, wherein R1 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2, halogen and -O-C1-C6-alkyl; R2 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl; R3 is -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m-(C1-C6-alkyl) (wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 or 3, and even more preferably 2)), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl; The present invention relates to the compounds or pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers, polymorphs, racemic mixtures, solvates or isomers and mixtures thereof.

[0029] Preferably, R1 is selected from phenyl and thienyl, said phenyl optionally substituted with one or more -O-C1-C6-alkyl. Preferably, R2 is selected from phenyl and thienyl, said phenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen. Preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl.

[0030] In a further aspect, the present invention provides a compound of formula (I):

[0031] [ka]

[0032] or pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers, polymorphs, racemic mixtures, solvates or isomers and mixtures thereof, wherein R1 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more -O-C1-C6-alkyl; R2 is 3-hydroxyphenyl; R3 is -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl) (wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 or 3, and even more preferably 2)), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl; The present invention relates to the compounds or pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers, polymorphs, racemic mixtures, solvates or isomers and mixtures thereof.

[0033] Preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl.

[0034] Preferably, the compound of formula (I) is Tetrahydro-2-furanylmethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1); Methyl-4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2); 2-(Ethylthio)ethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3); Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (4); Methyl-4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5); Tetrahydro-2-furanylmethyl-2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6); Tetrahydro-2-furanylmethyl-2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7); Methyl-4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8); Methyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9); Tetrahydro-2-furanylmethyl-4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10); Methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15); Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21); Methyl 7-(4-chlorophenyl)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (22); Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50); 4-Methyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51); 2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (52); 8-oxabicyclo[3.2.1]octan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53); Oxepan-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54); Hexahydrofuro[2,3-b]furan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (55); Cyclopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (56); Cyclohexyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (57); Ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (58); Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (59); Neopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (60); 2-Ethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (61); 2,2-Dimethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (62); 4,4-Dimethylpentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (63); 2-(2-ethoxyethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (64); 2-(2-(2-(hexyloxy)ethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (65); Tetrahydro-2H-pyran-4-yl 4-(4-fluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (66) and Tetrahydro-2H-pyran-4-yl 4-(2,4-difluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (67) is selected from.

[0035] Particularly preferred compounds of formula (I) are Tetrahydro-2-furanylmethyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12e-S and 12g-R); Tetrahydro-2H-pyran-4-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13a); Tetrahydrofuran-3-yl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50a-S and 50b-R) is.

[0036] Even more particularly preferred compounds of formula (I) are Tetrahydro-2H-pyran-4-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (13a).

[0037] In a further aspect, the present invention relates to a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, and a pharmaceutically acceptable carrier.

[0038] The present invention further relates to a process for preparing compounds of formula (I), comprising step (b) of asymmetric reduction of the pyridine motif by enantioselective partial transfer hydrogenation.

[0039] In a further aspect, the present invention relates to a compound of formula (I) or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof for use as a medicament.

[0040] In a further aspect, the present invention relates to a compound of formula (I) or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof for inhibiting coronin 1 expression in inducing immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders.

[0041] In a further aspect, the present invention relates to BRD3 selective bromodomain inhibitors for use in the treatment or prevention of diseases that may benefit from BRD3 inhibition directly or indirectly via reduced expression of coronin 1.

[0042] In a further aspect, the present invention provides a compound of formula (I):

[0043] [ka]

[0044] or pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers, polymorphs, racemic mixtures, solvates or isomers and mixtures thereof, wherein R1 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl; R2 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl; Preferably, R2 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen; R3 is -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m-(C1-C6-alkyl) (wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 or 3, and even more preferably 2)), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl; Preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl. The present invention relates to a compound or its pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers, polymorphs, racemic mixtures, solvates, or isomers and mixtures thereof. Further aspects and embodiments of the present invention will become clear as this description continues. The following sections outline the characterization of the coronin 1 promoter, the development of a screening assay based on the coronin 1 promoter, and provide diagrams for identifying coronin 1 promoter inhibitor compounds and verifying their validation, optimization, safety, and therapeutic efficacy in an autoimmune inflammation model of psoriasis. [Brief explanation of the drawings]

[0045] [Figure 1]Schematic diagram of the various coronin 1 promoter constructs generated and characterization of their luciferase activity in the J774 macrophage cell line. TSS: transcription start site. J774 macrophages transfected with the indicated coronin 1 promoter-luciferase plasmid construct sequences were assessed for luciferase activity. Controls: cells transfected with empty pGL plasmid (column 1) and pGL-SV40 positive control (column 2). [Figure 2] Principle of the coronin 1 promoter screening assay of the present invention: The promoter of the vertebrate (in this case, mouse) coronin 1 gene (coro1a) was cloned upstream of the coding region of a destabilized green fluorescent protein (GFP). A CMV promoter-driven red fluorescent protein (RFP) served as an internal control for nonspecific promoter inhibition. These constructs were stably transfected into rat basophilic leukemia (RBL) cells and subjected to treatment with small molecule compounds from a chemical library. [Figure 3A] (A) Selective reduction of coronin 1 promoter-driven GFP imaged by confocal microscopy upon incubation with compound 11 (10 μg / mL) for 48 hours. DMSO serves as a negative control. (B) Quantitative PCR analysis of coronin 1 mRNA upon incubation of RBL cells with compound 11 (3.5 μg / mL) for 7 days shows a reduction in coronin 1 transcripts. DMSO serves as a vehicle control. (C) Analysis of native coronin 1 promoter inhibition by Western blotting of RBL cell lines treated with compound 11 and assessing coronin 1 protein levels using a chemiluminescence imager. Compound 11 demonstrated up to approximately 80% depletion of coronin 1 levels, confirming it is a true modulator of coronin 1 expression. [Figure 3B](A) Selective reduction of coronin 1 promoter-driven GFP imaged by confocal microscopy upon incubation with compound 11 (10 μg / mL) for 48 hours. DMSO serves as a negative control. (B) Quantitative PCR analysis of coronin 1 mRNA upon incubation of RBL cells with compound 11 (3.5 μg / mL) for 7 days shows a reduction in coronin 1 transcripts. DMSO serves as a vehicle control. (C) Analysis of native coronin 1 promoter inhibition by Western blotting of RBL cell lines treated with compound 11 and assessing coronin 1 protein levels using a chemiluminescence imager. Compound 11 demonstrated up to approximately 80% depletion of coronin 1 levels, confirming it is a true modulator of coronin 1 expression. [Figure 3C] (A) Selective reduction of coronin 1 promoter-driven GFP imaged by confocal microscopy upon incubation with compound 11 (10 μg / mL) for 48 hours. DMSO serves as a negative control. (B) Quantitative PCR analysis of coronin 1 mRNA upon incubation of RBL cells with compound 11 (3.5 μg / mL) for 7 days shows a reduction in coronin 1 transcripts. DMSO serves as a vehicle control. (C) Analysis of native coronin 1 promoter inhibition by Western blotting of RBL cell lines treated with compound 11 and assessing coronin 1 protein levels using a chemiluminescence imager. Compound 11 demonstrated up to approximately 80% depletion of coronin 1 levels, confirming it is a true modulator of coronin 1 expression. [Figure 4] Overlay of GFP FACS profiles of GFP-RBL cells treated with calcium channel blockers. Flow cytometry-based assessment of GFP fluorescence in RBL-GFP cells incubated with the calcium channel blockers amlodipine (3.125 μM, right panel) and verapamil (8 μM, left panel) for 48 hours. Neither calcium channel blocker inhibited coronin 1 promoter activity, as assessed by GFP reduction. [Figure 5A]In vitro and in vivo toxicological evaluation of coronin 1 promoter inhibitors demonstrates their safety. In vitro toxicity analysis by Alamar blue assay (A) and MTT assay (B) in RBL cells using coronin 1 expression inhibitor 11 demonstrates minimal toxicity. Positive control: cycloheximide (1 μg / mL), vehicle control: DMSO. [Figure 5B] In vitro and in vivo toxicological evaluation of coronin 1 promoter inhibitors demonstrates their safety. In vitro toxicity analysis by Alamar blue assay (A) and MTT assay (B) in RBL cells using coronin 1 expression inhibitor 11 demonstrates minimal toxicity. Positive control: cycloheximide (1 μg / mL), vehicle control: DMSO. [Figure 6A] In vivo toxicity assessment of compound 11 by analysis of hematological parameters using the ADVIA platform in mouse blood following 6-day administration (150 mg / kg / body weight, BD, IP) indicates excellent safety and tolerability. Various parameters monitored included red blood cell (RBC) count (A), white blood cell (WBC) count (B), platelet count (C), and hemoglobin level (D) relative to the vehicle (DMSO)-treated group. (E) Compound 11 was administered daily in vivo to mice for 14 days, and weight change relative to day 0 was monitored as a measure of general health and tolerance to compound 11 (150 mg / kg / body weight, BD, IP). DMSO served as the vehicle control. [Figure 6B]In vivo toxicity assessment of compound 11 by analysis of hematological parameters using the ADVIA platform in mouse blood following 6-day administration (150 mg / kg / body weight, BD, IP) indicates excellent safety and tolerability. Various parameters monitored included red blood cell (RBC) count (A), white blood cell (WBC) count (B), platelet count (C), and hemoglobin level (D) relative to the vehicle (DMSO)-treated group. (E) Compound 11 was administered daily in vivo to mice for 14 days, and weight change relative to day 0 was monitored as a measure of general health and tolerance to compound 11 (150 mg / kg / body weight, BD, IP). DMSO served as the vehicle control. [Figure 6C] In vivo toxicity assessment of compound 11 by analysis of hematological parameters using the ADVIA platform in mouse blood following 6-day administration (150 mg / kg / body weight, BD, IP) indicates excellent safety and tolerability. Various parameters monitored included red blood cell (RBC) count (A), white blood cell (WBC) count (B), platelet count (C), and hemoglobin level (D) relative to the vehicle (DMSO)-treated group. (E) Compound 11 was administered daily in vivo to mice for 14 days, and weight change relative to day 0 was monitored as a measure of general health and tolerance to compound 11 (150 mg / kg / body weight, BD, IP). DMSO served as the vehicle control. [Figure 6D]In vivo toxicity assessment of compound 11 by analysis of hematological parameters using the ADVIA platform in mouse blood following 6-day administration (150 mg / kg / body weight, BD, IP) indicates excellent safety and tolerability. Various parameters monitored included red blood cell (RBC) count (A), white blood cell (WBC) count (B), platelet count (C), and hemoglobin level (D) relative to the vehicle (DMSO)-treated group. (E) Compound 11 was administered daily in vivo to mice for 14 days, and weight change relative to day 0 was monitored as a measure of general health and tolerance to compound 11 (150 mg / kg / body weight, BD, IP). DMSO served as the vehicle control. [Figure 6E] In vivo toxicity assessment of compound 11 by analysis of hematological parameters using the ADVIA platform in mouse blood following 6-day administration (150 mg / kg / body weight, BD, IP) indicates excellent safety and tolerability. Various parameters monitored included red blood cell (RBC) count (A), white blood cell (WBC) count (B), platelet count (C), and hemoglobin level (D) relative to the vehicle (DMSO)-treated group. (E) Compound 11 was administered daily in vivo to mice for 14 days, and weight change relative to day 0 was monitored as a measure of general health and tolerance to compound 11 (150 mg / kg / body weight, BD, IP). DMSO served as the vehicle control. [Figure 7]In vivo depletion of coronin 1 in mice by compound 11. In vivo administration of 11 depletes coronin 1 levels by 40%. Compound 11 was administered subcutaneously in a miglyol- and kolliphor-based vehicle (150 mg / kg / body weight, BD, SC) for 6 days, at the end of which mice were sacrificed and coronin 1 levels were examined in spleen lysates using an infrared dye-tagged secondary antibody and imaged using the Licor system. Left panel: Western blotting using the infrared-based Licor imaging system. Actin serves as a loading control. Right panel: Quantification of coronin 1 reduction by ratiometric analysis of actin band intensity. [Figure 8A] Depletion of coronin 1 in human PBMCs and suppression of proinflammatory cytokine production by compound 11. (A) Incubation of human peripheral blood mononuclear cells (PBMCs) with a coronin 1 expression inhibitor (compound 11, 10 μg / mL) for 5 days results in coronin 1 depletion, as assessed by Western blotting. (B) Flow cytometry analysis of PBMC cell viability upon incubation with a coronin 1 expression inhibitor (compound 11, 10-20 μg / mL) for 5 days. (C) Incubation of PBMCs with the coronin 1 expression inhibitor compound 11 (10 μg / mL) for 4.5 days attenuates immune responses in CD4 and CD8 T cells, as assessed by interleukin-2 (IL-2) production after T cell receptor stimulation with CD3 and CD28 antibodies in human PBMCs, as assessed by flow cytometry. DMSO and medium served as internal controls. [Figure 8B]Depletion of coronin 1 in human PBMCs and suppression of proinflammatory cytokine production by compound 11. (A) Incubation of human peripheral blood mononuclear cells (PBMCs) with a coronin 1 expression inhibitor (compound 11, 10 μg / mL) for 5 days results in coronin 1 depletion, as assessed by Western blotting. (B) Flow cytometry analysis of PBMC cell viability upon incubation with a coronin 1 expression inhibitor (compound 11, 10-20 μg / mL) for 5 days. (C) Incubation of PBMCs with the coronin 1 expression inhibitor compound 11 (10 μg / mL) for 4.5 days attenuates immune responses in CD4 and CD8 T cells, as assessed by interleukin-2 (IL-2) production after T cell receptor stimulation with CD3 and CD28 antibodies in human PBMCs, as assessed by flow cytometry. DMSO and medium served as internal controls. [Figure 8C] Depletion of coronin 1 in human PBMCs and suppression of proinflammatory cytokine production by compound 11. (A) Incubation of human peripheral blood mononuclear cells (PBMCs) with a coronin 1 expression inhibitor (compound 11, 10 μg / mL) for 5 days results in coronin 1 depletion, as assessed by Western blotting. (B) Flow cytometry analysis of PBMC cell viability upon incubation with a coronin 1 expression inhibitor (compound 11, 10-20 μg / mL) for 5 days. (C) Incubation of PBMCs with the coronin 1 expression inhibitor compound 11 (10 μg / mL) for 4.5 days attenuates immune responses in CD4 and CD8 T cells, as assessed by interleukin-2 (IL-2) production after T cell receptor stimulation with CD3 and CD28 antibodies in human PBMCs, as assessed by flow cytometry. DMSO and medium served as internal controls. [Figure 9A](A-C) Isomeric compositions of parent compound 11, parent compound 12, and parent compound 13, respectively, in mixtures and fractions. [Figure 9B] (A-C) Isomeric compositions of parent compound 11, parent compound 12, and parent compound 13, respectively, in mixtures and fractions. [Figure 9C] (A-C) Isomeric compositions of parent compound 11, parent compound 12, and parent compound 13, respectively, in mixtures and fractions. [Figure 10] One of the (4S,7R) isomers of compound 12 (designated compound 12e) showed inhibition of the mixed lymphocyte response (MLR) with human peripheral blood mononuclear cells, as indicated by a decrease in tritiated thymidine incorporation, suggesting its immunosuppressive activity in the context of a human alloimmune response. [Figure 11] Western blotting of RBL cell lines was used to analyze coronin 1 levels upon incubation of cell lysates with the indicated compounds. Compounds 12, 12e, and 13a (2 μg / mL) showed coronin 1 depletion by Western blot in RBL cell lines. [Figure 12A] (A) Compound 13a (50 mg / kg body weight, twice daily, topical route) reduces the severity of autoimmune inflammatory disease in an imiquimod-induced mouse model of psoriasis, as determined by disease scores (assessed by erythema, affected surface area, and psoriatic plaque formation) on day 4. DMSO served as vehicle control. n=7 mice per group. (B) GvHD study with compound 13a (50 mg / kg body weight, twice daily, subcutaneous route). Analysis of inhibition of alloantigen-driven proliferation of CD4 T cells (left) and CD8 T cells (center) and splenomegaly (right panel) by cell trace violet dye dilution on day 7. Each dot represents an individual animal (n=5 mice / group). Representative of two independent studies. [Figure 12B](A) Compound 13a (50 mg / kg body weight, twice daily, topical route) reduces the severity of autoimmune inflammatory disease in an imiquimod-induced mouse model of psoriasis, as determined by disease scores (assessed by erythema, affected surface area, and psoriatic plaque formation) on day 4. DMSO served as vehicle control. n=7 mice per group. (B) GvHD study with compound 13a (50 mg / kg body weight, twice daily, subcutaneous route). Analysis of inhibition of alloantigen-driven proliferation of CD4 T cells (left) and CD8 T cells (center) and splenomegaly (right panel) by cell trace violet dye dilution on day 7. Each dot represents an individual animal (n=5 mice / group). Representative of two independent studies. [Figure 13] Thermal Proteome Profiling (TPP) Identifies BRD3 as a Molecular Target: A procedure called thermal proteome profiling was used to identify the compound's target of action. This procedure revealed that the compound interacts with BRD3 and significantly stabilizes it with a q value of 0.0007. The thermal denaturation of the target increases by more than 4 degrees Celsius in the presence of 6 μM compound 12e. No significant thermal stabilization of BRD2 (no significant difference in q value) or BRD4 (no significant difference in q value) was observed, but BRD2 and BRD4 contained a larger number of unique peptides than BRD3. [Figure 14A](A) Validation of TPP-identified targets using an siRNA-based approach: brd3 siRNA (target-specific siRNA) was transfected into RBL GFP (a rat basophilic leukemia cell line expressing green fluorescent protein under the coronin 1 promoter). After 72 hours, GFP fluorescence levels were assessed using flow cytometry as a measure of reduced coronin 1 promoter activity. Transfection with target-specific siRNA resulted in a significant decrease in coronin 1 promoter-driven GFP fluorescence. (B) Validation of TPP-identified targets using a CRISPR / Cas9-based approach: Analysis of coronin 1 and BRD3 protein expression levels as median fluorescence intensity (MFI) by flow cytometry-based analysis of a series of RBL cell line clones with or without gene editing (using CRISPR / Cas9) on the brd3 gene. [Figure 14B] (A) Validation of TPP-identified targets using an siRNA-based approach: brd3 siRNA (target-specific siRNA) was transfected into RBL GFP (a rat basophilic leukemia cell line expressing green fluorescent protein under the coronin 1 promoter). After 72 hours, GFP fluorescence levels were assessed using flow cytometry as a measure of reduced coronin 1 promoter activity. Transfection with target-specific siRNA resulted in a significant decrease in coronin 1 promoter-driven GFP fluorescence. (B) Validation of TPP-identified targets using a CRISPR / Cas9-based approach: Analysis of coronin 1 and BRD3 protein expression levels as median fluorescence intensity (MFI) by flow cytometry-based analysis of a series of RBL cell line clones with or without gene editing (using CRISPR / Cas9) on the brd3 gene. [Figure 15]Validation of BRD3 as a target using bromoscan for direct target binding of compounds: The direct and competitive binding of compounds 12e and 13a to BRD3 was evaluated using the bromoscan platform at Eurofins. This analysis revealed that compounds 12e and 13a bind to the bromodomain BD1 and bromodomain BD2 in BRD3, with higher affinity for the BD2 domain, as indicated by lower Kd values ​​for the BRD3 BD2 domain. [Figure 16] Co-crystallization study of compound 13a with the bromodomain of BRD3: The crystal structures of compound 13a bound to BD1 (left, 1.4 Å) and BD2 (right, 2 Å) of human BRD3 reveal that the compound protrudes deep into the histone-binding pocket and therefore sterically competes with the acetylated lysine of the histone recognized by this pocket. In BD2, the ligand strongly interacts with the phenol ring containing residues His395 and Glu396, both of which are absent in BD1. The protein is represented as a schematic diagram, with residues involved in ligand binding represented as stick figures. Double bonds are not shown. Water: "w". [Figure 17] Psoriatic disease scores for wild-type K5.Stat3 mice subjected to tape stripping and left untreated (tape stripping only), or treated with either vehicle or Compound 11 (75 mg / kg / body weight, twice daily). N=6 mice per group. [Figure 18] DSS-induced colitis model: Wild-type mice were either left untreated (UT) or administered 2.5% dextran sodium sulfate (DSS) in drinking water and treated with either vehicle or Compound 12 (100 mg / kg / body weight, twice daily, subcutaneously). Disease activity was scored 5 days after disease induction. N=4 mice per group. [Figure 19](A) Methicillin-resistant Staphylococcus aureus (MRSA) infection model study. Wild-type mice were infected with MRSA and subcutaneously treated with compound 13a (50 mg / kg body weight, BD), FK506 (5 mg / kg body weight, BD), or tofacitinib (50 mg / kg body weight, BD), and bacterial burden was assessed. (B) Candida albicans infection model study. Wild-type mice were infected with C. albicans and subcutaneously treated with compound 13a (50 mg / kg body weight, BD), FK506 (5 mg / kg body weight, BD), or dexamethasone (100 mg / kg body weight, BD), and fungal burden was assessed. (C) Mycobacterial survival in macrophages. Lysosomal localization of the mycobacterium Mycobacterium bovis-BCG-GFP in J774 macrophages treated with compound 11. Quantification of lysosomal delivery of mycobacteria in macrophages using the indicated concentrations of compound 11. Rapid lysosomal delivery indicates lysosomal degradation and death of the mycobacteria. Three independent experiments, n = 50–70 per condition.

[0046] In summary, the in vitro and in vivo data presented in Figures 8-19 demonstrate that the coronin 1 promoter screening assay identified inhibitory compounds that bind to the hydrophobic cavity within the two bromodomains of BRD3, preferably within its BD2 bromodomain, and regulate coronin 1 promoter activity and coronin 1 expression to induce alloselective and autoimmune-selective immunosuppressive and anti-inflammatory activity. DETAILED DESCRIPTION OF THE INVENTION

[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0048] Throughout this specification and the claims that follow, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising" should be understood to mean the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of any other integer or step or group of integers or steps.

[0049] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise.

[0050] The term "about," when used in connection with a numerical value, is intended to encompass numerical values ​​in a range having a lower limit of 0 to 10% less than the stated numerical value and an upper limit of 0 to 10% greater than the stated numerical value.

[0051] As used herein, the term "alkyl" refers to a monovalent saturated acyclic (i.e., non-cyclic) hydrocarbon group which may be straight-chain or branched. Thus, an "alkyl" group does not contain any carbon-carbon double bonds or any carbon-carbon triple bonds. 1~8 "Alkyl" means an alkyl group having 1 to 8 carbon atoms. 1~8 Alkyl is C 1~6 As used herein, "C1-C6-alkyl" preferably refers to straight-chain or branched C1-C6-alkyl, which may be, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, straight-chain or branched pentyl, straight-chain or branched hexyl. Preferred C1-C6-alkyl is C1-C4-alkyl, more preferably C1-C3-alkyl. Unless otherwise defined, the term "alkyl" preferably refers to C 1~4 It refers to alkyl, more preferably methyl or ethyl, even more preferably methyl.

[0052] As used herein, "O-C1-C6-alkyl" preferably refers to a "substituted hydroxyl" of the formula (-OR'), where R' is a C1-C6-alkyl as defined herein, and the oxygen moiety is directly attached to the parent molecule; therefore, the term "O-C1-C6-alkyl" as used herein refers to a straight or branched chain C1-C6-alkoxy, which may be, for example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, straight or branched chain pentoxy, straight or branched chain hexyloxy. Preferred O-C1-C6-alkyls are O-C1-C6-alkoxy, 4- It is alkyl.

[0053] The term "alkylene" preferably refers to an alkanediyl group, i.e., a divalent saturated acyclic hydrocarbon group which may be straight-chain or branched. 1~6 "Alkylene" means an alkylene group having 1 to 6 carbon atoms. Preferred exemplary alkylene groups are methylene (-CH-), ethylene (e.g., -CH-CH- or -CH(-CH)-), propylene (e.g., -CH-CH-CH-, -CH(-CH-CH)-, -CH-CH(-CH)- or -CH(-CH)-CH), or butylene (e.g., -CH-CH-CH-CH-). Unless otherwise defined, the term "alkylene" preferably refers to a C 2~4 Alkylene (especially linear C 2~4 alkylene), more preferably methylene or ethylene, and even more preferably methylene.

[0054] As used herein, "halogen" preferably refers to fluorine (fluoro, -F), chlorine (chloro, -Cl), bromine (bromo, -Br) and iodine (iodo, -I). Preferably, it refers to fluorine, chlorine or bromine. This also applies accordingly to halogen in combination with other meanings, such as haloalkyl.

[0055] As used herein, the term "cycloalkyl" preferably refers to a saturated hydrocarbon ring group, including monocyclic rings as well as bridged, spiro, and / or fused ring systems (e.g., composed of two or three rings; e.g., fused ring systems composed of two or three fused rings, etc.). "Cycloalkyl" can refer to, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, decalinyl (i.e., decahydronaphthyl), or adamantyl. Unless otherwise defined, "cycloalkyl" preferably refers to C 3~11 It refers to cycloalkyl, more preferably C 3~6 Particularly preferred "cycloalkyl" is a monocyclic saturated hydrocarbon ring having 3 to 6 ring members (e.g., cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl).

[0056] The term "oxygen-containing saturated heterocyclyl" as used herein preferably refers to a fully saturated 5- to 14-membered ring system containing one to two oxygen atoms and no other atoms other than C, H, and O. The heterocyclyl may be a single ring or two or more condensed rings in which at least one ring contains an oxygen atom. Preferably, the term "oxygen-containing saturated heterocyclyl" as used herein refers to a fully saturated 4- to 7-membered monocyclic ring system containing one to two oxygen atoms and no other atoms other than C, H, and O. Examples of monocyclic oxygen-containing saturated heterocyclyl moieties include the following: oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 8-oxabicyclo[3.2.1]octan-3-yl, hexahydrofuro[2,3-b]furan-3-yl, and oxepanyl.

[0057] When a group is described as being optionally substituted, it may have one or more substituents, for example, one, two, three, or four substituents. It will be understood that the maximum number of substituents is limited by the number of available bonding sites on the substituted moiety. Preferably, there are 1 to 4 optional substituents, more preferably, 1 to 3 optional substituents, even more preferably, one or two optional substituents, and most preferably, one optional substituent. When a group is described as being optionally substituted and there are two or more optional substituents for the optional substitution of the group, the two or more substituents may be the same or different. As will be understood by those skilled in the art, the expression "substituted by," such as in "A is substituted by B," does not mean that B replaces A, but rather that at least one hydrogen atom of A is replaced by at least one group B. Therefore, the expression "substituted by" is equivalent to the expression "substituted with."

[0058] The compounds of the present invention may have one or more optically active carbon atoms and therefore may exist as racemic mixtures, stereoisomers, diastereomers, or enantiomers. All isomeric forms are included in the present invention. Compounds having one or more optically active carbon atoms may exist as individual stereoisomers, diastereomers, or enantiomers. Alternatively, mixtures thereof, such as racemic mixtures, or mixtures containing an excess of one of the stereoisomers, diastereomers, or enantiomers compared to the stereoisomer, diastereomer, or enantiomer having a different orientation at one or more optically active carbon atoms, can be provided. Preferably, the mixtures of the compounds of the present invention are characterized by an enantiomeric excess of a particular isomer over its enantiomer of at least 90%, more preferably at least 95%, and even more preferably at least 96%.

[0059] The term "polymorph" refers to compounds of the present invention that may exist in more than one crystal structure. Salts may be crystalline and may exist as more than one polymorph.

[0060] Solvates (including hydrates) and anhydrous forms of the salts are also encompassed by the present invention. The solvent contained in the solvate is not particularly limited and may be any pharmaceutically acceptable solvent. Examples include water and C 1~4 Alcohols (such as methanol or ethanol) are included.

[0061] "Pharmaceutically acceptable salts" are defined as derivatives of the compounds of the present invention in which the parent compound is modified by making acid or base salts thereof. A list of suitable salts is found in Remington's Pharmaceutical Sciences, 18 th ed., Mack Publishing Company, Easton, PA, 1990, p. 1445, the disclosure of which is incorporated herein by reference.

[0062] The terms "treating" and / or "treatment" refer to the management and care of a patient having a condition, such as a viral infection or other condition, for which the administration of one or more therapeutic compounds is indicated for the purpose of curing or alleviating the symptoms and complications of such a condition. Treating includes the administration of one or more formulations of the present invention to prevent the onset of symptoms or complications, alleviating symptoms or complications, or eliminating the disease, condition, or disorder. As used herein, "treatment" or "therapy" refers to both therapeutic treatment and prophylactic or preventative measures. The effect may be therapeutic in terms of partially or completely curing the disease or condition and / or symptoms caused by the disease or condition. The term refers to inhibiting the disease or condition, i.e., halting its development, or ameliorating the disease or condition, i.e., causing the regression or reduction of the symptoms of the disease or condition.

[0063] As used herein, the term "prophylaxis" refers to a measure of preventing or delaying the onset of a disease or condition and / or symptoms resulting from the disease or condition.

[0064] The terms "disease" and "disorder" are used interchangeably herein and refer to an abnormal condition, particularly an abnormal medical condition such as a disease or injury in which a tissue, organ, or individual can no longer perform its function efficiently. Typically, but not necessarily, a disease is accompanied by specific symptoms or signs that indicate the presence of such a disease. Thus, the presence of such symptoms or signs can be indicative of a tissue, organ, or individual suffering from a disease. A change in these symptoms or signs can be indicative of the progression of such a disease. Disease progression is typically characterized by an increase or decrease in such symptoms or signs, which can indicate a "worsening" or "improvement" of the disease. "Worsening" of a disease is characterized by a decrease in the ability of a tissue, organ, or organism to perform its function efficiently, while "improvement" of a disease is typically characterized by an increase in the ability of a tissue, organ, or individual to perform its function efficiently. A tissue, organ, or individual that is "at risk for developing" a disease is in a healthy state but exhibits the potential for the disease to manifest. Typically, the risk for developing a disease is accompanied by early or mild signs or symptoms of such a disease. In such cases, the onset of the disease may still be prevented by treatment. Examples of diseases include, but are not limited to, transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders.

[0065] As used herein, the term "subject" or "animal" or "patient" or "mammal" refers to any subject for whom diagnosis, prognosis, prevention or treatment is desired, particularly a mammalian subject, for example a human or a domestic mammal such as a dog, cat or horse, or a food animal such as a cow or sheep or pig, preferably a human.

[0066] As used herein, the term "for use" as used in "a composition for use in the treatment of a disease" is intended to also disclose the corresponding method of treatment and the corresponding use of the preparation for the manufacture of a medicament for the treatment of a disease.

[0067] A "therapeutically effective amount" or "effective amount" is the amount of a compound or pharmaceutical composition according to the present invention that elicits the biological or medical response in a subject, preferably a human subject, that is sought by a researcher, veterinarian, physician, or other clinician. As used herein, the term "therapeutic administration" shall refer to the administration of a therapeutically effective amount.

[0068] As used herein, the terms "promoter" or "promoter sequence" or "promoter element" refer to a nucleic acid sequence capable of directing transcription of a gene. The term coronin 1 (coro1a, e.g., NCBI mouse gene ID: 12721; human gene ID: 11151; rat gene ID: 155151, and other vertebrate) promoter, promoter sequence, or promoter element refers to one capable of directing transcription of the coro1a gene. The coronin 1 promoter is preferably a vertebrate coronin 1 promoter, more preferably a mammalian coronin 1 promoter, even more preferably a human, rat, mouse, bovine, canine, bovine, or hamster coronin 1 promoter, and even more preferably a human, rat, or mouse coronin 1 promoter.

[0069] Preferably, as understood herein, whenever a reference is made to a compound or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer, and mixtures thereof, it preferably refers to the compound or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer or isomer, and mixtures thereof, more preferably to the compound or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer or enantiomer thereof, and even more preferably to the compound or a pharmaceutically acceptable salt thereof. It is understood that the term "mixture" includes, but is not limited to, a racemic mixture of the compound or a pharmaceutically acceptable salt thereof.

[0070] As further preferably understood herein, whenever a reference is made to a compound of formula (I), a reference is preferably made to a compound of formula (I) or a pharmaceutically acceptable salt thereof.

[0071] In a first aspect, the present invention relates to a vector comprising a coronin 1 (coro1a) promoter element, wherein in a vertebrate genome, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene and spans a sequence region of at least about 700 bp within the genome.

[0072] The term "vector" as used herein refers to at least one nucleic acid molecule. It is used as a vehicle for artificially transferring nucleic acids and genetic material. A vector can be one or more closed or open nucleic acid molecules that are single-stranded (ss) or double-stranded (ds). When the vector is ss, the length specification should be understood as nucleotides (nt) or bases, and when the vector is ds, the length specification should be understood as base pairs (bp). The term vector includes expression cassettes, plasmids, viral vectors, phagemids, phages, cosmids and artificial chromosomes (such as YACs, BACs and PACs), expression vectors, and cloning vectors. In a preferred embodiment, the vector is a plasmid.

[0073] In a preferred embodiment, the vector further comprises a coronin 1 promoter reporter gene, and the coronin 1 promoter element is operably linked to the coronin 1 promoter reporter gene.

[0074] The term "operably linked" means that sequences such as a gene and a promoter are in a functional combination, i.e., the promoter is appropriately positioned to control, and preferably initiate, transcription of the coding gene. A reporter gene is a readout gene that is operably linked to a promoter to indicate the activity of the promoter, preferably in a semi-quantitative or quantitative manner.

[0075] The coronin 1 promoter element has a length of at least about 700 bp, and the coronin 1 promoter element is located immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome. The coronin 1 promoter element having a length of at least about 700 bp spans a sequence region in the vertebrate genome from a base pair located immediately upstream (5') of the TSS to a base pair located at least about 700 bp upstream of the TSS.

[0076] The transcription start site is the sequence at which transcription begins and is located at the 5' end of the gene sequence.

[0077] In a more preferred embodiment, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence region of at least about 700 bp to about 3000 bp. In an even more preferred embodiment, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence region of at least about 700 bp to about 1500 bp. In an even more preferred embodiment, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence region of about 700 bp.

[0078] In a more preferred embodiment, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence region of at least 700 bp. In a more preferred embodiment, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence region of at least 737 bp. In a more preferred embodiment, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence region of at least 700 bp to 3000 bp. In an even more preferred embodiment, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence region of at least 700 bp to 1530 bp. In an even more preferred embodiment, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence region of at least 737 bp to 1530 bp. In an even more preferred embodiment, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence region of 737 bp.

[0079] In a preferred embodiment, the coronin 1 promoter element has a length of approximately at least about 700 bp to about 3000 bp, and is located immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome. In a more preferred embodiment, the coronin 1 promoter element has a length of approximately at least about 700 bp to about 1500 bp, and is located immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome. In an even more preferred embodiment, the coronin 1 promoter element has a length of approximately 700 bp, and is located immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome.

[0080] In an even more preferred embodiment, the coronin 1 promoter element has a length of at least 700 bp. In a preferred embodiment, the coronin 1 promoter element has a length of at least 700 bp to 3000 bp. In a more preferred embodiment, the coronin 1 promoter element has a length of at least 700 bp to 1530 bp. In an even more preferred embodiment, the coronin 1 promoter element has a length of 737 bp.

[0081] The coronin 1 promoter is preferably a vertebrate coronin 1 promoter, more preferably a mammalian coronin 1 promoter, even more preferably a human, rat or mouse coronin 1 promoter.

[0082] In one embodiment, the vector comprises a coronin 1 promoter that comprises the coronin 1 promoter element, ie, the coronin 1 promoter element is contained in the coronin 1 promoter.

[0083] In a preferred embodiment, the coronin 1 promoter element is a sequence having at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, even more preferably at least 99%, and even more preferably at least 100% identity to a sequence selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:6.

[0084] In a preferred embodiment, the coronin 1 promoter element is a sequence having at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, even more preferably at least 99%, and even more preferably at least 100% identity to a sequence selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO: 6.

[0085] Preferably, said coronin 1 promoter elements having at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, even more preferably at least 99%, and even more preferably at least 100% identity to the sequences of SEQ ID NOs: 1 to 6 or SEQ ID NOs: 4 to 6 retain coronin 1 promoter activity, i.e., are capable of driving coronin 1 expression in any expression system. Preferably, said expression system is a eukaryotic expression system, more preferably a vertebrate expression system, and even more preferably a mammalian expression system.

[0086] In another preferred embodiment, the coronin 1 promoter element is a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6. In a further preferred embodiment, the coronin 1 promoter element is a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. In another preferred embodiment, the coronin 1 promoter element is a sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6. In yet another preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 1. In yet another preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 2. In yet another preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 3. In yet another preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 4. In yet another preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 5. In yet another preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 6.

[0087] In another preferred embodiment, the vector further comprises a second promoter and a second promoter-reporter gene, preferably the second promoter is different from the coronin 1 promoter.

[0088] The second promoter may be any promoter. Preferably, the second promoter is different from the coronin 1 promoter. Preferably, the promoter other than the coronin 1 promoter is a constitutively active promoter or a ubiquitously active promoter. In a more preferred embodiment, the second promoter is selected from the group consisting of a viral promoter, an actin promoter, a clathrin promoter, and an early cytomegalovirus (CMV) promoter. In a more preferred embodiment, the second promoter is an early cytomegalovirus (CMV) promoter.

[0089] In a preferred embodiment, the vector further comprises a second promoter and a second promoter-reporter gene, wherein the second promoter is different from the coronin 1 promoter, and the second promoter-reporter gene is the same as or different from the coronin 1 promoter-reporter gene. More preferably, the second promoter is different from the coronin 1 promoter, and the second promoter-reporter gene is different from the coronin 1 promoter-reporter gene. Independent readout of the two reporter genes is then possible.

[0090] In another embodiment, the second promoter reporter gene is the same as the coronin 1 promoter reporter gene, and the vector comprises a first plasmid and a second plasmid, wherein the coronin 1 promoter and the coronin promoter reporter gene are on the first plasmid and the second promoter and the second promoter reporter gene are on the second plasmid.

[0091] In a preferred embodiment, the vector comprises a first plasmid and a second plasmid, wherein the coronin 1 promoter and the coronin promoter reporter gene are on the first plasmid, and the second promoter and the second promoter reporter gene are on the second plasmid. Preferably, the second promoter is different from the coronin 1 promoter. More preferably, the second promoter is different from the coronin 1 promoter, and the second promoter reporter gene is different from the coronin 1 promoter reporter gene.

[0092] In a preferred embodiment, the coronin 1 promoter, the coronin 1 promoter reporter gene, the second promoter, and the second promoter reporter gene are on the same plasmid. Preferably, the second promoter is different from the coronin 1 promoter. More preferably, the second promoter is different from the coronin 1 promoter, and the second promoter reporter gene is different from the coronin 1 promoter reporter gene.

[0093] In a preferred embodiment, the coronin 1 promoter and the coronin 1 promoter reporter gene are contained in a first expression cassette, and the second promoter and the second promoter reporter gene are contained in a second expression cassette, preferably, the second promoter is different from the coronin 1 promoter, more preferably, the second promoter is different from the coronin 1 promoter, and the second promoter reporter gene is different from the coronin 1 promoter reporter gene.

[0094] In a preferred embodiment, the coronin promoter reporter gene and the second promoter reporter gene are selected from the group consisting of genes encoding a fluorescent protein, such as green fluorescent protein (GFP), red fluorescent protein (RFP), destabilized GFP or destabilized RFP; β-galactosidase; chloramphenicol acetyltransferase; alkaline phosphatase, secreted embryonic alkaline phosphatase (SEAP), and luciferase. In a preferred embodiment, the coronin 1 promoter reporter gene and the second promoter reporter gene are different and are selected from the group consisting of genes encoding fluorescent proteins such as green fluorescent protein (GFP), red fluorescent protein (RFP), destabilized GFP or destabilized RFP; β-galactosidase; chloramphenicol acetyltransferase; alkaline phosphatase, secreted embryonic alkaline phosphatase (SEAP); and luciferase. In a preferred embodiment, the coronin 1 promoter reporter gene and the second promoter reporter gene are based on fluorescence, luminescence, or protein expression, more preferably fluorescence. In a preferred embodiment, the coronin 1 promoter reporter gene and the second promoter reporter gene are different and are based on fluorescence, luminescence, or protein expression, more preferably fluorescence.

[0095] In a preferred embodiment, one of the coronin promoter reporter gene and the second promoter reporter gene encodes red fluorescent protein, and the other promoter reporter gene encodes green fluorescent protein. In a particularly preferred embodiment, one of the coronin promoter reporter gene and the second promoter reporter gene encodes GFP, preferably destabilized GFP, and the other encodes RFP, preferably destabilized RFP.

[0096] In a preferred embodiment, one of the coronin promoter reporter gene and the second promoter reporter gene encodes a fluorescent protein or a luminescent protein, and the second promoter is an early cytomegalovirus (CMV) promoter. In a preferred embodiment, one of the coronin promoter reporter gene and the second promoter reporter gene encodes a fluorescent protein, and the second promoter is an early cytomegalovirus (CMV) promoter. In a preferred embodiment, one of the coronin promoter reporter gene and the second promoter reporter gene encodes a red fluorescent protein, and the other promoter reporter gene encodes a green fluorescent protein, and the second promoter is an early cytomegalovirus (CMV) promoter. In a particularly preferred embodiment, the second promoter is an early Cytomegalovirus (CMV) promoter, and one of the coronin promoter reporter gene and the second promoter reporter gene encodes GFP, preferably destabilized GFP, and the other encodes RFP, preferably destabilized RFP.

[0097] In a preferred embodiment, the coronin 1 promoter element, which begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome, spans a region of at least about 700 bp to about 1500 bp in the genome, preferably, the coronin 1 promoter element spans a region of at least about 700 bp in the genome, and the second promoter is an early cytomegalovirus (CMV) promoter. In a preferred embodiment, the coronin 1 promoter element, which begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene in the vertebrate genome, spans a region of at least about 700 bp to about 1500 bp in the genome; preferably, the coronin 1 promoter element spans a region of at least about 700 bp in the genome; the second promoter is an early cytomegalovirus (CMV) promoter; and the promoter reporter genes encode fluorescent or luminescent proteins, preferably, one of the promoter reporter genes encodes red fluorescent protein and the other promoter reporter gene encodes green fluorescent protein.

[0098] In a preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, the second promoter is an early cytomegalovirus (CMV) promoter, and the promoter-reporter genes encode fluorescent or luminescent proteins, preferably one of the promoter-reporter genes encodes red fluorescent protein and the other promoter-reporter gene encodes green fluorescent protein.

[0099] In a particularly preferred embodiment, the vector of the present invention comprises a first expression cassette comprising the coronin 1 promoter and a coronin promoter reporter gene, and a second expression cassette comprising a second promoter and a second promoter reporter gene, one of which encodes GFP, preferably destabilized GFP, and the other encodes RFP, preferably destabilized RFP, and the second promoter is an early cytomegalovirus (CMV) promoter, and the first and second expression cassettes are located on the same or different plasmids. More preferably, the first and second expression cassettes are located on different plasmids.

[0100] In a preferred embodiment, the vector of the present invention is contained in a cell, preferably a vertebrate cell, more preferably a mammalian cell, even more preferably a human cell or a mouse cell. In another preferred embodiment, the vector of the present invention is contained in a mammalian immune cell, more preferably a rat basophil leukemia (RBL) cell.

[0101] We developed a cell-based screening assay that can identify compounds that deplete coronin 1 protein levels by suppressing promoter activity of the gene encoding coronin 1 (coro1a). In an exemplary embodiment, this assay involves using a genetically engineered immune cell line, namely, a rat basophilic leukemia (RBL) cell line in which expression of destabilized green fluorescent protein (GFP) is under the control of the coronin 1 gene promoter. To read out promoter activity, the GFP gene was used as a promoter-reporter gene. The coronin 1 promoter elements spanned approximately 700 to 3000 bp (737, 1530, and 3000 bp) upstream of the transcription start site of the coronin 1 gene. As an internal control for nonspecific promoter inhibition and to assess cytotoxicity, RBL cells were transfected with a plasmid driving destabilized red fluorescent protein (RFP) expression via the early cytomegalovirus (CMV) promoter. Any compound that selectively reduces GFP fluorescence without altering RFP is considered an inhibitor of coronin 1 expression.

[0102] In a preferred embodiment, the above-mentioned coronin 1 promoter sequence of the present invention is an isolated nucleic acid.

[0103] In a further aspect, the present invention relates to a cell, preferably a eukaryotic cell, more preferably a mammalian cell, comprising the vector of the present invention. In a preferred embodiment, the coronin 1 promoter of the vector of the present invention is capable of being transcribed and translated. Preferably, the mammalian cell of the present invention is a mammalian immune cell. More preferably, the mammalian cell of the present invention is a rat basophilic leukemia (RBL) cell or any cell that expresses coronin 1.

[0104] In a further aspect, the present invention provides a method for the identification of compounds that modulate coronin 1 promoter activity, comprising the steps of: (i) providing a host cell comprising the vector of the present invention, wherein the host cell is capable of expressing the promoter reporter gene; (ii) exposing the host cells to a compound to be tested; (ii) measuring expression of the coronin 1 promoter reporter gene in the host cells exposed to the compound to be tested; The present invention relates to a method, including:

[0105] In a preferred embodiment, providing a host cell comprising a vector of the invention comprises providing the vector of the invention and transfecting the vector into the host cell capable of expressing the coronin promoter reporter gene and the optional second promoter reporter gene.

[0106] The host cells are exposed to the compound to be tested under conditions suitable for binding of the compound to the coronin 1 promoter.

[0107] In a preferred embodiment, the vector used in the method of the invention comprises a second promoter and a second promoter reporter gene, and the host cell is preferably capable of expressing the second promoter reporter gene, and expression of the additional coronin 1 promoter reporter gene is measured, preferably in the host cell exposed to the compound to be tested, and compared to expression of coronin 1.

[0108] In a preferred embodiment, the method of the present invention for identifying a compound that inhibits coronin 1 promoter activity further comprises the step of comparing the expression of the coronin promoter reporter gene with a control value. The control value can be obtained by using a control compound instead of the compound being tested in the method of the present invention, i.e., by exposing the provided host cells to the control compound being tested and measuring the expression of the coronin promoter reporter gene. Optionally, the expression of the second promoter reporter gene in the host cells exposed to the control compound being tested is measured. In this way, the specificity of the test compound in inhibiting the coronin 1 promoter can be evaluated.

[0109] Because the optional second promoter reporter gene is operably linked to a promoter unrelated to the coronin 1 promoter, modulation of expression of the optional second promoter reporter gene in the host cells exposed to the compound being tested represents non-specific modulation.

[0110] A decrease in expression of the coronin 1 promoter reporter gene relative to the control value indicates that the test compound inhibits the coronin 1 promoter, while no decrease in expression of the coronin 1 promoter reporter gene indicates that the test compound does not regulate the coronin 1 promoter, and an increase in expression of the coronin 1 promoter reporter gene indicates that the test compound activates the coronin 1 promoter. Any compound that decreases expression of the coronin 1 promoter reporter gene without altering expression of a second promoter reporter gene is considered an inhibitor of coronin 1 expression.

[0111] In a preferred embodiment, the host cell is a eukaryotic cell, preferably a mammalian cell, more preferably a mammalian immune cell, more preferably a human, mouse or rat immune cell, preferably a rat basophil leukemia (RBL) cell expressing coronin 1.

[0112] In a preferred embodiment, the vector is a plasmid, and the coronin 1 promoter, the coronin promoter reporter gene, the second promoter, and the second promoter reporter gene are on the same plasmid. In a preferred embodiment, the vector comprises a first plasmid and a second plasmid, and the coronin 1 promoter and the coronin promoter reporter gene are on the first plasmid, and the optional second promoter and the optional second promoter reporter gene are on the second plasmid.

[0113] In a further aspect, the present invention provides a compound of formula (I):

[0114] [ka]

[0115] or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof.

[0116] In formula (I), R1 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2, halogen (preferably chloro) and -O-C1-C6-alkyl (preferably methoxy), preferably -O-C1-C6-alkyl (preferably methoxy). In one embodiment, R1 is thienyl. In another embodiment, R1 is phenyl, said phenyl being optionally substituted with one or more optional substituents independently selected from halogen (preferably chloro) and -O-C1-C6-alkyl (preferably methoxy), preferably -O-C1-C6-alkyl (preferably methoxy). Even more preferably, R1 is phenyl, said phenyl being optionally substituted with one or more optional substituents independently selected from halogen (preferably chloro) and -O-C1-C6-alkyl (preferably methoxy). Even more preferably, R1 is selected from 2-methoxyphenyl and phenyl.

[0117] R2 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen (preferably fluoro), and -O-C1-C6-alkyl (such as, for example, -O-CH3). In one embodiment, R2 is thienyl. In another embodiment, R2 is phenyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen, and -O-C1-C6-alkyl (such as, for example, -O-CH3). Preferably, R2 is phenyl, said phenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -O-C1-C6-alkyl (such as -O-CH3); even more preferably, R2 is phenyl, said phenyl optionally substituted with one or more optional substituents independently selected from -OH and -O-C1-C6-alkyl (such as -O-CH3). In a further preferred embodiment, R2 is phenyl, said phenyl optionally substituted with one or more optional substituents independently selected from -OH. In one embodiment, R2 is 3-hydroxyphenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen, and -O-C1-C6-alkyl (such as -O-CH3). In a further embodiment, R2 is 3-hydroxyphenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. Even more preferably, R2 is 3-hydroxyphenyl.

[0118] In one embodiment, R2 is selected from phenyl and thienyl, wherein said phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. Preferably, R2 is phenyl, wherein said phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. More preferably, R2 is 3-hydroxyphenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. Even more preferably, R2 is 3-hydroxyphenyl.

[0119] R3 is -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl) (wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 to 3, and even more preferably 2)), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the cycloalkyl in -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl. Cycloalkyl is preferably C3-C 11 -cycloalkyl, more preferably C3-C6 cycloalkyl.

[0120] Preferably, R3 is -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m-(C1-C6-alkyl) (wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 or 3, and even more preferably 2)), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the cycloalkyl in -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl.

[0121] More preferably, R3 is -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl) (wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 or 3, and even more preferably 2)), -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl.

[0122] Even more preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl.

[0123] Even more preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more -C1-C6-alkyl.

[0124] In one embodiment, R3 is selected from the group consisting of -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably 1 to 5, more preferably 2 to 3, and even more preferably 2). Preferably, R3 is selected from -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m and m is an integer from 1 to 10 (preferably 1 to 5, more preferably 2 to 3, and even more preferably 2). More preferably, R3 is selected from -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 to 3, and even more preferably 2). Even more preferably, R3 is -(C2-C4-alkylene-O) m -(C1-C6-alkyl), wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 to 3, and even more preferably 2).

[0125] In another embodiment, R3 is selected from -C1-C6-alkylene-cycloalkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the cycloalkyl in -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl), and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl. Even more preferably, R3 is selected from -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the oxygen-containing saturated heterocyclyl moiety in -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more -C1-C6-alkyl.

[0126] Thus, preferably, R3 is -C1-C6-alkylene-tetrahydro-2-furanyl.

[0127] [ka]

[0128] -C1-C6-Alkylenetetrahydro-2H-pyran-4-yl

[0129] [ka]

[0130] Tetrahydrofuran-3-yl

[0131] [ka]

[0132] Tetrahydro-2H-pyran-4-yl

[0133] [ka]

[0134] Oxepan-4-yl

[0135] [ka]

[0136] and 8-oxabicyclo[3.2.1]octan-3-yl

[0137] [ka]

[0138] wherein the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, the tetrahydrofuran-3-yl, the tetrahydro-2H-pyran-4-yl, the oxepan-4-yl and the 8-oxabicyclo[3.2.1]octan-3-yl are each optionally substituted with one or more -C1-C6-alkyl, and more preferably R3 is -C1-C6-alkylene-tetrahydro-2-furanyl

[0139] [ka]

[0140] -C1-C6-Alkylenetetrahydro-2H-pyran-4-yl

[0141] [ka]

[0142] and tetrahydro-2H-pyran-4-yl

[0143] [ka]

[0144] The tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, and the tetrahydro-2H-pyran-4-yl are each optionally substituted with one or more -C1-C6-alkyl.

[0145] Even more preferably, R3 is (tetrahydrofuran-2-yl)methyl

[0146] [ka]

[0147] Tetrahydrofuran-3-yl

[0148] [ka]

[0149] and tetrahydro-2H-pyran-4-yl

[0150] [ka]

[0151] Most preferably, R3 is selected from tetrahydro-2H-pyran-4-yl

[0152] [ka]

[0153] is.

[0154] In a further aspect, the present invention provides a compound of formula (I):

[0155] [ka]

[0156] or pharmaceutically acceptable salts, stereoisomers, enantiomers or isomers and mixtures thereof, During the ceremony, R1 is selected from phenyl and thienyl, said phenyl being optionally substituted with -O-C1-C6-alkyl; R2 is 3-hydroxyphenyl; R3 is -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl) (wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 or 3, and even more preferably 2)), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl; The present invention relates to a compound or a pharmaceutically acceptable salt, stereoisomer, enantiomer or isomer thereof, and mixtures thereof.

[0157] Preferably, R1 is phenyl optionally substituted with methoxy. Most preferably, R1 is selected from 2-methoxyphenyl and phenyl.

[0158] Cycloalkyl is preferably C3-C 11 -cycloalkyl, more preferably C3-C6 cycloalkyl.

[0159] Preferably, R3 is -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl) (wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 or 3, and even more preferably 2)), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the cycloalkyl in -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl.

[0160] More preferably, R3 is -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl) (wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 or 3, and even more preferably 2)), -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl.

[0161] Even more preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl.

[0162] Even more preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, and -(C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more -C1-C6-alkyl.

[0163] In one embodiment, R3 is selected from the group consisting of -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably 1 to 5, more preferably 2 to 3, and even more preferably 2). Preferably, R3 is selected from -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m and m is an integer from 1 to 10 (preferably 1 to 5, more preferably 2 to 3, and even more preferably 2). More preferably, R3 is selected from -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m-(C1-C6-alkyl), where m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 to 3, and even more preferably 2). Even more preferably, R3 is -(C2-C4-alkylene-O) m -(C1-C6-alkyl), wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 to 3, and even more preferably 2).

[0164] In another embodiment, R3 is selected from -C1-C6-alkylene-cycloalkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the cycloalkyl in -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl), and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl. Even more preferably, R3 is selected from -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the oxygen-containing saturated heterocyclyl moiety in -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more -C1-C6-alkyl.

[0165] Thus, preferably, R3 is -C1-C6-alkylene-tetrahydro-2-furanyl.

[0166] [ka]

[0167] -C1-C6-Alkylenetetrahydro-2H-pyran-4-yl

[0168] [ka]

[0169] Tetrahydrofuran-3-yl

[0170] [ka]

[0171] Tetrahydro-2H-pyran-4-yl

[0172] [ka]

[0173] Oxepan-4-yl

[0174] [ka]

[0175] and 8-oxabicyclo[3.2.1]octan-3-yl

[0176] [ka]

[0177] wherein the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, the tetrahydrofuran-3-yl, the tetrahydro-2H-pyran-4-yl, the oxepan-4-yl and the 8-oxabicyclo[3.2.1]octan-3-yl are each optionally substituted with one or more -C1-C6-alkyl, and more preferably R3 is -C1-C6-alkylene-tetrahydro-2-furanyl

[0178] [ka]

[0179] -C1-C6-Alkylenetetrahydro-2H-pyran-4-yl

[0180] [ka]

[0181] and tetrahydro-2H-pyran-4-yl

[0182] [ka]

[0183] The tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, and the tetrahydro-2H-pyran-4-yl are each optionally substituted with one or more -C1-C6-alkyl.

[0184] Even more preferably, R3 is (tetrahydrofuran-2-yl)methyl

[0185] [ka]

[0186] Tetrahydrofuran-3-yl

[0187] [ka]

[0188] and tetrahydro-2H-pyran-4-yl

[0189] [ka]

[0190] Most preferably, R3 is selected from tetrahydro-2H-pyran-4-yl

[0191] [ka]

[0192] is.

[0193] Preferably, the compound of formula (I) is Tetrahydro-2-furanylmethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1); Methyl-4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2); 2-(Ethylthio)ethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3); Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (4); Methyl-4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5); Tetrahydro-2-furanylmethyl-2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6); Tetrahydro-2-furanylmethyl-2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7); Methyl-4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8); Methyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9); Tetrahydro-2-furanylmethyl-4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10); Methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15); Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21); Methyl 7-(4-chlorophenyl)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (22); Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50); 4-Methyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51); 2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (52); 8-oxabicyclo[3.2.1]octan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53); Oxepan-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54); Hexahydrofuro[2,3-b]furan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (55); Cyclopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (56); Cyclohexyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (57); Ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (58); Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (59); Neopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (60); 2-Ethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (61); 2,2-Dimethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (62); 4,4-Dimethylpentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (63); 2-(2-ethoxyethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (64); 2-(2-(2-(hexyloxy)ethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (65); Tetrahydro-2H-pyran-4-yl 4-(4-fluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (66) and Tetrahydro-2H-pyran-4-yl 4-(2,4-difluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (67) is selected from.

[0194] More preferably, the compound of formula (I) is Tetrahydro-2-furanylmethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1); Methyl-4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2); 2-(Ethylthio)ethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3); Methyl-4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5); Tetrahydro-2-furanylmethyl-2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6); Tetrahydro-2-furanylmethyl-2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7); Methyl-4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8); Methyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9); Tetrahydro-2-furanylmethyl-4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10); Methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15); Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); and tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21) is selected from.

[0195] Even more preferably, the compound of formula (I) is Methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); and tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21) is selected from.

[0196] In one embodiment, the compound of formula (I) is Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); and Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50) is selected from.

[0197] Particularly preferred compounds of formula (I) are selected from compounds 12, 13 and 50.

[0198] In one embodiment, the compound of formula (I) is Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50); 4-Methyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51); 8-oxabicyclo[3.2.1]octan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53) and Oxepan-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54) is selected from.

[0199] It is to be understood herein that, preferably, in compounds of formula (I), the R1 and R2 substituents are on opposite sides of the ring system. Thus, preferably, compounds of formula (I) have the formula:

[0200] [ka]

[0201] Compounds of or the expression:

[0202] [ka]

[0203] is a compound of

[0204] More preferably, the compound of formula (I) has the formula:

[0205] [ka]

[0206] It has the absolute configuration of its stereogenic center shown in:

[0207] Thus, in a further embodiment, the compound of formula (I) is Tetrahydro-2-furanylmethyl (4S,7R)-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1a-S and 1b-R); Methyl (4S,7R)-4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2a); 2-(Ethylthio)ethyl (4S,7R)-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3a); Methyl (4S,7R)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (4a); Methyl (4S,7R)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5a); Tetrahydro(4S,7R)-2-furanylmethyl-2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6a-S and 6b-R); Tetrahydro-2-furanylmethyl (4S,7R)-2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7a-S and 7b-R); Methyl (4S,7R)-4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8a); Methyl (4S,7R)-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9a); Tetrahydro-2-furanylmethyl (4S,7R)-4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10a-S and 10b-R); Methyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11c); Tetrahydro-2-furanylmethyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12e-S and 12g-R); Tetrahydro-2H-pyran-4-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13a); Methyl (4S,7R)-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14a); Methyl (4S,7R)-7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15a); Methyl (4S,7R)-4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16a); 4-Methoxybutyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17a); (Tetrahydro-2H-pyran-4-yl)methyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18a); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19a); Oxetan-3-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20a); tert-Butyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21a); Methyl (4S,7R)-7-(4-chlorophenyl)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (22a); Tetrahydrofuran-3-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50a-S and 50b-R); 4-Methyltetrahydro-2H-pyran-4-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51a); 2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (52a); 8-oxabicyclo[3.2.1]octan-3-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53a); Oxepan-4-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54b-S and 54c-R); (3R,3aS,6aR)-Hexahydrofuro[2,3-b]furan-3-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (55a); Cyclopentyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (56a); Cyclohexyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (57a); Ethyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (58a); Butyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (59a); Neopentyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (60a); 2-Ethylbutyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (61a); 2,2-Dimethylbutyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (62a); 4,4-Dimethylpentyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (63a); 2-(2-ethoxyethoxy)ethyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (64a); 2-(2-(2-(hexyloxy)ethoxy)ethyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (65a); Tetrahydro-2H-pyran-4-yl(4S,7R)-4-(4-fluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (66a); and Tetrahydro-2H-pyran-4-yl(4S,7R)-4-(2,4-difluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (67a) is selected from.

[0208] In one preferred embodiment, the compound of formula (I) is Tetrahydro-2-furanylmethyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12e-S and 12g-R); Tetrahydro-2H-pyran-4-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13a); (Tetrahydro-2H-pyran-4-yl)methyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18a); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19a); Tetrahydrofuran-3-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50a-S and 50b-R); 4-Methyltetrahydro-2H-pyran-4-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51a); 8-oxabicyclo[3.2.1]octan-3-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53a) and Oxepan-4-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54b-S and 54c-R) is.

[0209] In another preferred embodiment, the compound of formula (I) is Methyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11c); Methyl (4S,7R)-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14a); 4-Methoxybutyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17a); tert-Butyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21a) and 2-(2-Ethoxyethoxy)ethyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (64a) is.

[0210] Highly preferred compounds of formula (I) are Tetrahydro-2-furanylmethyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12e-S and 12g-R); Tetrahydro-2H-pyran-4-yl(4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13a); and Tetrahydrofuran-3-yl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50a-S and 50b-R) is.

[0211] In a first particular embodiment of the compounds of formula (I), the compounds have the formula:

[0212] [ka]

[0213] The compound has the absolute configuration of its stereogenic center as shown in

[0214] In this first particular embodiment, R1, R2 and R3 are as defined for formula (I), including the preferred definitions of R1, R2 and R3 set forth above.

[0215] In this first particular embodiment, R1 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2, halogen (preferably chloro) and -O-C1-C6-alkyl (preferably methoxy), preferably -O-C1-C6-alkyl (preferably methoxy). In one embodiment, R1 is thienyl. In another embodiment, R1 is phenyl, said phenyl being optionally substituted with one or more optional substituents independently selected from halogen (preferably chloro) and -O-C1-C6-alkyl (preferably methoxy), preferably -O-C1-C6-alkyl (preferably methoxy). Even more preferably, R1 is phenyl, said phenyl being optionally substituted with one or more optional substituents independently selected from halogen (preferably chloro) and -O-C1-C6-alkyl (preferably methoxy). Even more preferably, R1 is selected from 2-methoxyphenyl and phenyl.

[0216] In this first particular embodiment, R2 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen, and -O-C1-C6-alkyl (such as, for example, -O-CH3). In one embodiment, R2 is thienyl. In another embodiment, R2 is phenyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen, and -O-C1-C6-alkyl (such as, for example, -O-CH3). Preferably, R2 is phenyl, said phenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -O-C1-C6-alkyl (such as -O-CH3); even more preferably, R2 is phenyl, said phenyl optionally substituted with one or more optional substituents independently selected from -OH and -O-C1-C6-alkyl (such as -O-CH3). In a further preferred embodiment, R2 is phenyl, said phenyl optionally substituted with one or more optional substituents independently selected from -OH. In one embodiment, R2 is 3-hydroxyphenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen, and -O-C1-C6-alkyl (such as -O-CH3). In a further embodiment, R2 is 3-hydroxyphenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. Even more preferably, R2 is 3-hydroxyphenyl.

[0217] In one embodiment, R2 is selected from phenyl and thienyl, wherein said phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. Preferably, R2 is phenyl, wherein said phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. More preferably, R2 is 3-hydroxyphenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. Even more preferably, R2 is 3-hydroxyphenyl.

[0218] In this first particular embodiment, R3 is selected from -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, and the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more -C1-C6-alkyl. Suitable oxygen-containing saturated heterocyclyl moieties include tetrahydrofuran-3-yl, 8-oxabicyclo[3.2.1]octan-3-yl, oxepan-4-yl, hexahydrofuro[2,3-b]furan-3-yl (particularly (3R,3aS,6aR)-(hexahydrofuro[2,3-b]furan-3-yl), tetrahydro-2-furanyl, tetrahydro-2H-pyran-4-yl, and oxetan-3-yl.

[0219] Preferably, in this first particular embodiment, R3 is selected from -C1-C6-alkylene-tetrahydro-2-furanyl, -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, tetrahydrofuran-3-yltetrahydro-2H-pyran-4-yl, oxepan-4-yl and 8-oxabicyclo[3.2.1]octan-3-yl, and in the above -C1-C6-alkylene-tetrahydro-2-furanyl the tetrahydro-2-furanyl moiety in the above -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, the tetrahydrofuran-3-yl, the tetrahydro-2H-pyran-4-yl, the oxepan-4-yl and the 8-oxabicyclo[3.2.1]octan-3-yl are each optionally substituted with one or more -C1-C6-alkyl groups.

[0220] Most preferably, in this first particular embodiment, R3 is selected from (tetrahydrofuran-2-yl)methyl, tetrahydrofuran-3-yl and tetrahydro-2H-pyran-4-yl.

[0221] In a second particular embodiment of the compounds of formula (I), the compound has the formula:

[0222] [ka]

[0223] The compound has the absolute configuration of its stereogenic center as shown in

[0224] In this second particular embodiment, R1 is selected from 2-methoxyphenyl and phenyl. Preferably, R1 is 2-methoxyphenyl.

[0225] In this second particular embodiment, R2 is 3-hydroxyphenyl.

[0226] In this second particular embodiment, R3 is selected from the group consisting of -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), and m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 or 3, and even more preferably 2).

[0227] Preferably, in this second particular embodiment, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl and -(C1-C6-alkylene)-O-C1-C6-alkyl.

[0228] Even more preferably, in this second particular embodiment, R3 is -C1-C6-alkyl. In this second particular embodiment, particularly suitable -(C2-C4-alkylene-O) m -(C1-C6-alkyl) includes 2-(2-ethoxyethoxy)ethyl and 2-(2-(2-(hexyloxy)ethoxy)ethoxy)ethyl.

[0229] The compounds of the present invention can be obtained according to the following scheme of Hantsch cyclization:

[0230] [ka]

[0231] wherein R1 to R3 are as defined in formula (I). Further details are provided in Example 1.

[0232] Asymmetric synthesis of compounds of the invention can be carried out according to or analogously to the synthetic methods described in Examples 2, 3 and 5, or as described herein below.

[0233] Alternatively, the enantiopure compound can be obtained by the synthesis method described in Example 4, late stage transesterification by hydrolysis and esterification, or as described herein below. Thus, the present invention further relates to a method for preparing the compound of formula (I), preferably in its enantiopure form.

[0234] For example, enantiopure compounds according to the present invention can be obtained either by A) diastereoselective synthesis followed by chromatographic separation, or B) asymmetric synthesis as shown by the following reaction, or C) late stage transesterification by hydrolysis and esterification (Scheme 1):

[0235] [ka]

[0236] In the formula, R1 to R3 are defined as in formula (I).

[0237] R4 is selected from the group consisting of amine protecting groups, most preferably a tert-butyloxycarbonyl group. Those skilled in the art are in a position to select the correct group to use as R4.

[0238] R5 is an activated ester equivalent or a carboxylic acid, preferably a carboxylic acid.The ester equivalent includes, but is not limited to, carboxylic acid chloride, carboxylic acid bromide and carboxylic acid anhydride.Those skilled in the art are in a position to select the appropriate group to be used as R5.Therefore, R5 can be selected from carboxylic acid, carboxylic acid chloride, carboxylic acid bromide and carboxylic acid anhydride, and preferably, R5 is a carboxylic acid.

[0239] The reaction shown may include the following reaction steps: reaction: a) Conversion of the 1,4-dihydropyridine motif to the corresponding pyridine motif by oxidation; b) asymmetric reduction of the pyridine motif by enantioselective partial transfer hydrogenation (chiral phosphoric acid, Hantzsch ester); c) Separation of diastereomers by preparative HPLC or flash chromatography; d) Introduction of alpha, beta unsaturation via silyl enol ether formation followed by oxidation (base, RSiX, hypervalent iodine(V)) or elimination of selenium oxide (RSeX, oxidant) or direct dehydrogenation of cyclohexanone (Pd II , O2); followed by aziridination to form aziridines ( N -protected- p -toluenesulfonamide, bisamine, base); e) Aziridine ring opening by photochemical irradiation (hν); f) optional nitrogen deprotection unless R4 is hydrogen; g) condensation of intermediate VIII with intermediate IX; h) ester hydrolysis and optionally formation of an active ester equivalent; and i) Esterification.

[0240] Suitable reaction conditions for steps a and f to i are known to those skilled in the art.

[0241] Alternatively, steps h and i may be replaced by a direct transesterification step.

[0242] Therefore, the present invention further relates to a method for preparing a compound of formula (I) as defined herein above, comprising a step (b) of asymmetric reduction of the pyridine motif by enantioselective partial transfer hydrogenation. Exemplary methods of the present invention are shown in Scheme 1A and Scheme B. In one embodiment, the method further comprises a step (e) of aziridine ring-opening by actinic irradiation (hv). Preferably, the compound of formula (I) prepared according to the method of the present invention has the formula:

[0243] [ka]

[0244] is a compound of

[0245] For step (b) of the asymmetric reduction of the pyridine motif by enantioselective partial transfer hydrogenation, the conditions of Org. Lett. 2014, 16, 2982 and ACIE, 2020, 59, 23107 were applied.

[0246] Further details are provided in Examples 2, 3 and 5.

[0247] The present invention further provides a compound of formula: An intermediate in the process for preparing a compound of the formula

[0248] [ka]

[0249] wherein R1, R2 and R3 are as defined in formula (I), the method comprises obtaining compound IX:

[0250] [ka]

[0251] and step (b) asymmetrically reducing the pyridine motif in the hydroxyl group by enantioselective partial transfer hydrogenation.

[0252] Preferably, the intermediate is selected from the group consisting of compound III, compound VI, compound VII, compound X, compound XI and compound XII, preferably selected from the group consisting of compound III, compound VI, compound X, compound XI and compound XII:

[0253] JPEG2025534417000043.jpg108170

[0254] R1, R2 and R3 are as defined in formula (I). R4 and R5 are as defined above.

[0255] The compounds of formula (I) above are useful for inhibiting coronin 1 expression.

[0256] Furthermore, the compounds of the present invention are useful for inhibiting coronin 1 promoter activity (without being bound by theory, preferably, the inhibition of coronin 1 activity occurs via binding to BRD3). Therefore, the compounds of formula (I) are useful for treating, preventing, and / or alleviating symptoms of diseases associated with (or caused by) coronin 1 expression. Furthermore, the compounds of formula (I) are useful for treating, preventing, and / or alleviating symptoms of diseases associated with (or caused by) coronin 1 promoter activity. Diseases associated with (or caused by) coronin 1 expression and / or diseases associated with (or caused by) coronin 1 promoter activity may be selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. Furthermore, the compounds of formula (I) are useful as pharmaceuticals for inhibiting coronin 1 expression in inducing immunosuppression or in the treatment and / or prevention of diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders.

[0257] In a further aspect, the present invention provides a compound of formula (I), as described herein above, for use as a medicament:

[0258] [ka]

[0259] or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer thereof and mixtures thereof.

[0260] In a further aspect, the present invention relates to a compound of formula (I) as described herein above for inhibiting coronin 1 expression in the induction of immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, an autoimmune disease, an inflammatory disease, an infectious disease and a lymphoproliferative disorder.

[0261] [ka]

[0262] or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof.

[0263] In a preferred embodiment, the compound of formula (I) as defined herein above

[0264] [ka]

[0265] The compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the treatment and / or prevention of diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders.

[0266] In an even more preferred embodiment, the present invention provides a compound of formula (I) for use as a medicament for inducing immunosuppression or inhibiting coronin 1 expression in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, an autoimmune disease, an inflammatory disease, an infectious disease and a lymphoproliferative disorder, said compound comprising Tetrahydro-2-furanylmethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1); Methyl-4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2); 2-(Ethylthio)ethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3); Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (4); Methyl-4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5); Tetrahydro-2-furanylmethyl-2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6); Tetrahydro-2-furanylmethyl-2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7); Methyl-4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8); Methyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9); Tetrahydro-2-furanylmethyl-4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10); Methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15); Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21); Methyl 7-(4-chlorophenyl)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (22); Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50); 4-Methyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51); 2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (52); 8-oxabicyclo[3.2.1]octan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53); Oxepan-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54); Hexahydrofuro[2,3-b]furan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (55); Cyclopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (56); Cyclohexyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (57); Ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (58); Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (59); Neopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (60); 2-Ethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (61); 2,2-Dimethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (62); 4,4-Dimethylpentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (63); 2-(2-ethoxyethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (64); 2-(2-(2-(hexyloxy)ethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (65); Tetrahydro-2H-pyran-4-yl 4-(4-fluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (66); and Tetrahydro-2H-pyran-4-yl 4-(2,4-difluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (67) is selected from Preferably, Tetrahydro-2-furanylmethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1); Methyl-4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2); 2-(Ethylthio)ethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3); Methyl-4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5); Tetrahydro-2-furanylmethyl-2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6); Tetrahydro-2-furanylmethyl-2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7); Methyl-4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8); Methyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9); Tetrahydro-2-furanylmethyl-4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10); Methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15); Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); and tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21) is selected from.

[0267] Thus, in an even more preferred embodiment as described above, the present invention provides a compound of formula (I) for use as a medicament for inhibiting coronin 1 expression in inducing immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders, wherein said compound is selected from a compound of any one of formulas 1 to 22 or formulas 50 to 65, and even more preferably said compound is selected from formulas 11, 12, 13, 14, 17, 18, 19, and 21. Alternatively, said compound is selected from formulas 12, 13, 18, 19, 50, 51, 53, and 54. Throughout the present invention, transplant rejection may be allograft rejection.

[0268] In a further preferred embodiment, the present invention relates to the use of a compound of the present invention for the manufacture of a medicament for inhibiting coronin 1 expression in inducing immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders.

[0269] In a further preferred embodiment, the present invention relates to a method for inhibiting coronin 1 expression in inducing immunosuppression or in the treatment and / or prevention and / or alleviation of symptoms of a disease or disorder selected from the group consisting of transplant rejection, an autoimmune disease, an inflammatory disease, an infectious disease and a lymphoproliferative disorder, comprising administering to a subject in need thereof a compound of the invention, wherein typically a therapeutically effective amount of a compound of the invention is administered.

[0270] In a preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 promoter activity. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for depleting coronin 1 in a subject.

[0271] In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the induction of immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the induction of immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the treatment and / or prevention of inflammatory and / or infectious diseases. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the induction of immunosuppression. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the treatment and / or prevention of transplant rejection. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the treatment and / or prevention of autoimmune diseases. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the treatment and / or prevention of lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals for inhibiting coronin 1 expression in the treatment and / or prevention of inflammatory diseases.In another preferred embodiment, the compounds of the invention are used as pharmaceuticals for inhibiting coronin 1 expression in the treatment and / or prevention of infectious diseases.

[0272] In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, an autoimmune disease, an inflammatory disease, an infectious disease, and a lymphoproliferative disorder. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, an autoimmune disease, and a lymphoproliferative disorder. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, an autoimmune disease, an inflammatory disease, an infectious disease, and a lymphoproliferative disorder. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, an autoimmune disease, and a lymphoproliferative disorder. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of transplant rejection and / or lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of an inflammatory disease and / or an infectious disease. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the induction of immunosuppression. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of transplant rejection. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of autoimmune diseases. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of inflammatory diseases. In another preferred embodiment, the compounds of the present invention are used as pharmaceuticals in the treatment and / or prevention of infectious diseases.

[0273] In a preferred embodiment, the compounds of the invention are used as pharmaceuticals in inducing immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders, wherein the disease or disorder to be treated and / or prevented is caused or promoted by coronin 1 expression.

[0274] In a preferred embodiment, the compounds of the invention are used as pharmaceuticals in the induction of immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders, wherein said induction, treatment and / or prevention is based on depletion of coronin 1. In a preferred embodiment, the compounds of the invention are used as pharmaceuticals in the induction of immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders, wherein said induction, treatment and / or prevention is based on inhibition of coronin 1 expression.

[0275] Preferably, the autoimmune disease is selected from the group consisting of psoriasis, vitiligo, multiple sclerosis, systemic lupus erythematosus, Hashimoto's thyroiditis, rheumatoid arthritis, primary sclerosing cholangitis, myasthenia gravis, type I or type II diabetes, disorders secondary to type I or type II diabetes, vasculitis, pernicious anemia, Sjogren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis and allergic contact dermatitis. More preferably, said autoimmune disease is selected from the group consisting of psoriasis, multiple sclerosis, systemic lupus erythematosus, Hashimoto's thyroiditis, rheumatoid arthritis, myasthenia gravis, type I or II diabetes, disorders secondary to type I or II diabetes, vasculitis, pernicious anemia, Sjogren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis and allergic contact dermatitis.

[0276] Preferably, the transplant rejection is selected from the group consisting of acute or chronic rejection of cells, tissues, organs, allografts and xenografts, poor graft functional status, and graft-versus-host disease. Preferably, the transplant rejection is selected from the group consisting of heart transplants, skin transplants, kidney transplants, liver transplants, pancreatic islet transplants, pancreas transplants, lung transplants, intestinal transplants, corneal transplants, blood vessel transplants, adrenal transplants, hair transplants, bone transplants, cartilage transplants, and ligament transplants.

[0277] Preferably, the inflammatory disease is inflammatory bowel disease, Crohn's disease, ulcerative colitis, intrinsic asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, prurigo nodularis, hidradenitis suppurativa, eosinophilic esophagitis, fibrotic disorders, cardiovascular diseases, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin symptoms of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, or the like. The inflammatory bowel disease may be selected from the group consisting of inflammatory bowel disease, Crohn's disease, ulcerative colitis, intrinsic asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin manifestations of immune-mediated disorders, inflammatory eye disease, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock and adult respiratory distress syndrome, preferably from the group consisting of inflammatory bowel disease, Crohn's disease, ulcerative colitis, intrinsic asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin manifestations of immune-mediated disorders, inflammatory eye disease, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock and adult respiratory distress syndrome. More preferably, the inflammatory disease is inflammatory bowel disease, Crohn's disease, ulcerative colitis, intrinsic asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, fibrotic disorders, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin symptoms of immune-mediated disorders, inflammatory eye disease, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and The disease is selected from the group consisting of adult respiratory distress syndrome, preferably from the group consisting of inflammatory bowel disease, Crohn's disease, ulcerative colitis, intrinsic asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin symptoms of immune-mediated disorders, inflammatory eye disease, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock and adult respiratory distress syndrome.

[0278] Preferably, the lymphoproliferative disorder is a T-cell lymphoma or a T-cell leukemia.

[0279] Preferably, said infection is selected from the group consisting of tuberculosis, preferably caused by mycobacteria, Salmonella spp. infection, Helicobacter spp. infection, retroviral infection, preferably HIV or HTLV, cytomegalovirus infection, candida infection, Staphylococcus infection, lymphocytic choriomeningitis virus infection and viral hepatitis.

[0280] The mycobacteria include Mycobacterium tuberculosis, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium bovis, Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium malmoense, Mycobacterium simiae, Mycobacterium szulgai, Mycobacterium xenopii, ... simiae, Mycobacterium szulgai, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium szolopii, Mycobacterium s The bacterial strains include, but are not limited to, Mycobacterium xenopi, Mycobacterium scrofulaceum, Mycobacterium abscessus, Mycobacterium chelonae, Mycobacterium haemophilum and / or Mycobacterium ulcerans.

[0281] In a further embodiment, the present invention relates to compounds of formula (I) as described herein above or pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers, polymorphs, racemic mixtures, solvates or isomers and mixtures thereof for use in the treatment or prevention of diseases that may benefit from BRD3 inhibition directly or indirectly via reduced expression of coronin 1.

[0282] Diseases that can benefit from BRD3 inhibition (directly or indirectly via reduced coronin 1 expression) can be understood to be diseases that are suitable for therapeutic intervention, preferably via direct BRD3 inhibition or via modulation of coronin 1 expression via BRD3 inhibition. Preferably, the disease is selected from transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. The listed diseases are as disclosed herein above. Furthermore, the BRD3-driven disease is preferably a malignant disease and its metastasis, such as NMC, OCCC, colorectal cancer, or rhabdomyosarcoma, preferably NMC, OCCC, or rhabdomyosarcoma.

[0283] Thus, the present invention provides compounds of formula (I) for use in the treatment or prevention of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders (as defined herein). The present invention further provides compounds of formula (I) for use in the treatment or prevention of NMC, colorectal cancer, OCCC or rhabdomyosarcoma and metastases thereof, preferably NMC, OCC or rhabdomyosarcoma.

[0284] As understood herein, BRD3 inhibition relates to blocking the binding site of BRD3, thereby preventing BRD3 from binding to its natural ligands (acetylated N-terminal tails of histones and other acetylated transcription factors such as GATA_1, RelA, STAT3, etc.) Compounds referred to as BRD3 inhibitors are therefore also sometimes referred to as BRD3 blockers, particularly BRD3 bromodomain blockers.

[0285] The present inventors have surprisingly discovered that the compounds of the present invention inhibit the expression of coronin 1 by selectively targeting the bromodomain of BRD3. The target, BRD3, is known to drive the development of highly invasive malignant tumors in one-third of patients diagnosed with NUT (Nuclear protein of Testis)-midline carcinoma (NMC) (Kervarrec, T., et al., Reply to: Expanding the Spectrum of Primary Cutaneous Carcinoma With BRD3-NUTM1 Fusion. Am J Surg Pathol, 2021. 45(11): p. 1584-1586). NMC is considered one of the most aggressive malignant tumors, with more than 80% of diagnosed patients dying within the first year. Currently, there is no specific treatment for NMC except for surgical resection if detected early before severe metastasis occurs, or the use of nonselective BET inhibitors or chemotherapy, which are prone to side effects (Shapiro, GI, et al., Br J Cancer, 2021. 124(4): pp. 744-753). Nonselective BET inhibitors also block BRD4 and BRD2, which not only results in toxicity but also induces overall immunosuppression by inhibiting BRD4- and BRD2-dependent immunoinflammatory responses. Targeting BRD3 has been reported to play an important role in controlling a rare type of gynecological malignancy called ovarian clear cell carcinoma (OCCC) (Shigeta, S., et al., Mol Cancer Ther, 2021. 20(4): pp. 691-703). Similar to NMC, the mortality rate of ovarian cancer patients is the highest among major gynecological malignancies. In the absence of the recently approved PARP inhibitors, patients with OCCC are often treated with platinum-based chemotherapy, which causes numerous side effects and toxicities. Many of these patients become resistant to these therapies, and therefore, safe and targeted therapies for these cancers are urgently needed.Thus, the present invention relates to compounds of the present invention for use in the treatment or prevention of diseases that can benefit from BRD3 inhibition, either directly or indirectly via reduced coronin 1 expression and activity. Preferably, the present invention relates to compounds of the present invention for use in the treatment or prevention of NMC or OCCC, preferably for use in the treatment or prevention of BRD3-driven NMC or BRD3-driven OCCC. Similarly, targeting BRD3 has been shown to play an important role in eradicating cancer metastasis in colorectal cancer models by providing a key phosphorylation substrate for TYRO3, thereby regulating anti-apoptotic gene expression and epithelial-mesenchymal transition (Hsu, P.L., et al., Sci Adv, 2023.9, eade3422.).

[0286] According to the present inventors, exemplary compounds of Formula (I) are selective BRD3-bromodomain inhibitors (blockers). As preferably understood herein, a BRD3-selective bromodomain blocker is defined as a compound that significantly stabilizes BRD3 and does not significantly stabilize other members of the bromodomain and extra-terminal (BET) family of bromodomain-containing proteins, as determined by thermoproteomic profiling. Preferably, a BRD3-selective bromodomain blocker significantly stabilizes BRD3 and does not significantly stabilize BRD2 or BRD4, as determined by thermoproteomic profiling. Thermoproteomic profiling is a technique well known to those skilled in the art. A suitable concentration range of compounds for thermoproteomic profiling is 1-6 μM. Exemplary results of thermoproteomic profiling are shown in FIG. 13, and exemplary experimental details of applying such a method are disclosed in Example 7. Preferably, thermoproteome profiling is performed using RBL cells at a compound concentration of 6 μM.

[0287] Preferably, the compounds of formula (I) as defined herein are selective BRD3-bromodomain inhibitors (BRD3-bromodomain blockers) as defined herein, in other words, the compounds of formula (I) preferably bind only to BRD3 and not to other members of the bromodomain and extra-terminal (BET) family of bromodomain-containing proteins, as determined by thermoproteomic profiling.

[0288] Furthermore, the inventors hypothesize that the medical application of the compounds of the present invention related to the inhibition / blocking of BRD3 (i.e., the bromodomain of BRD3) is not limited to the compounds of formula (I) provided herein, but can be carried out using any BRD3-selective bromodomain inhibitor (blocker). Accordingly, the present invention further provides a BRD3-selective bromodomain inhibitor for use in the treatment or prevention of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders (as defined herein). The present invention further provides a BRD3-selective bromodomain inhibitor for use in the treatment or prevention of NMC, colorectal cancer, OCCC, or rhabdomyosarcoma, preferably NMC, OCCC, or rhabdomyosarcoma. An exemplary preferred BRD3-selective bromodomain inhibitor is the compound of formula (I) disclosed herein.

[0289] In a further aspect of the present invention, the compounds of the present invention are used to inhibit coronin 1 expression in vitro, preferably in a cell-based assay. Furthermore, the compounds of the present invention are used to inhibit coronin 1 promoter activity in vitro, preferably in a cell-based assay. Furthermore, the compounds of the present invention are used to deplete coronin 1 in vitro, preferably in a cell-based assay. The cells are preferably vertebrate cells, more preferably mammalian cells, even more preferably mammalian immune cells, even more preferably human, mouse, or rat immune cells. The cells are preferably selected from the group consisting of CD4 T cells, CD8 T cells, B cells, neutrophils, macrophages, dendritic cells, Langerhans cells, eosinophils, NK cells, follicular antigen-presenting cells, monocytes, neurons, glial cells, or basophilic leukemia (RBL) cells, preferably of human, rat, or mouse origin.

[0290] Further examples and embodiments are disclosed in the following numbered sections:

[0291] 1. Formula (I):

[0292] [ka]

[0293] or pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers or isomers and mixtures thereof, During the ceremony, R1 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more -O-C1-C6-alkyl; R2 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen; R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl; The compound or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer or isomer and mixtures thereof. 2. The compound according to item 1, wherein R1 is phenyl optionally substituted with methoxy. 3. Compounds according to item 1 or 2, wherein R1 is selected from 2-methoxyphenyl and phenyl. 4. The compound according to any one of items 1 to 3, wherein R2 is 3-hydroxyphenyl. 5. The compound according to any one of items 1 to 4, wherein R3 is -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) or oxygen-containing saturated heterocyclyl, and the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more -C1-C6-alkyl. 6. The compound according to any one of items 1 to 4, wherein R3 is selected from —C1-C6-alkylene-tetrahydro-2-furanyl, C1-C6-alkylene-tetrahydro-2H-pyran-4-yl and tetrahydro-2H-pyran-4-yl, and the tetrahydro-2-furanyl moiety in the —C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, the tetrahydro-2H-pyran-4-yl moiety in the —C1-C6-alkylene-tetrahydro-2H-pyran-4-yl and the tetrahydro-2H-pyran-4-yl are each substituted with one or more —C1-C6-alkyl. 7. The compound according to any one of items 1 to 6, wherein R3 is tetrahydro-2H-pyran-4-yl. 8. The compound according to item 1, Tetrahydro-2-furanylmethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1); Methyl-4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2); 2-(Ethylthio)ethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3); Methyl-4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5); Tetrahydro-2-furanylmethyl-2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6); Tetrahydro-2-furanylmethyl-2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7); Methyl-4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8); Methyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9); Tetrahydro-2-furanylmethyl-4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10); Methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15); Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); and tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21) A compound selected from the group consisting of: 9. The compound according to item 1, Methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12), Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); and tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21) A compound selected from the group consisting of: 10. The compound of formula (I) has the formula:

[0294] [ka]

[0295] 10. The compound according to any one of items 1 to 9, having the absolute configuration of its stereogenic center as shown in 11. A pharmaceutical composition comprising a compound according to any one of items 1 to 10 and a pharmaceutically acceptable carrier. 12. A compound according to any one of items 1 to 10 or a pharmaceutical composition according to item 11 for use as a medicine. 13. A compound according to any one of items 1 to 10 or a pharmaceutical composition according to item 11 for use in inducing immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, an autoimmune disease, an inflammatory disease, an infectious disease, and a lymphoproliferative disorder. 14. the autoimmune disease is selected from the group consisting of psoriasis, multiple sclerosis, systemic lupus erythematosus, Hashimoto's thyroiditis, rheumatoid arthritis, myasthenia gravis, type I or type II diabetes, disorders secondary to type I or type II diabetes, vasculitis, pernicious anemia, Sjogren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis, and allergic contact dermatitis; the transplant rejection is selected from the group consisting of acute or chronic rejection of cells, tissues, organs, allografts and xenografts, poor graft function, graft-versus-host disease; rejection of heart transplants, skin transplants, kidney transplants, liver transplants, pancreatic islet transplants, pancreas transplants, lung transplants, intestinal transplants, corneal transplants, blood vessel transplants, adrenal transplants, hair transplants, bone transplants, cartilage transplants and ligament transplants; the inflammatory disease is selected from the group consisting of inflammatory bowel disease, Crohn's disease, ulcerative colitis, intrinsic asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, fibrotic disorders, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin symptoms of immune-mediated disorders, inflammatory eye disease, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome; the lymphoproliferative disorder is T-cell lymphoma or T-cell leukemia; the infection is selected from the group consisting of tuberculosis, preferably caused by mycobacteria, Salmonella spp. infection, Helicobacter spp. infection, retroviral infection, preferably HIV or HTLV, cytomegalovirus infection, candida infection, Staphylococcus infection, lymphocytic choriomeningitis virus infection and viral hepatitis, 14. A compound for use or a pharmaceutical composition for use according to item 13. 15. A compound for use or a pharmaceutical composition for use according to item 13 or 14, wherein the compound of formula (I) inhibits coronin 1 expression. 16. A vector comprising a coronin 1 (coro1a) promoter element, wherein in a vertebrate genome, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene and spans a sequence region of at least about 700 bp within the genome. 17. The vector according to item 16, further comprising a coronin 1 promoter reporter gene, wherein the coronin 1 promoter element is operably linked to the coronin 1 promoter reporter gene. 18. The vector according to item 16 or 17, wherein the coronin 1 promoter element spans at least about 700 bp to about 1500 bp of sequence within the genome, preferably, the coronin 1 promoter element spans a sequence region of at least about 700 bp within the genome. 19. The vector according to any one of items 16 to 18, wherein the coronin 1 promoter element has at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, even more preferably at least 99% identity to the sequences of SEQ ID NO:1 to SEQ ID NO:6. 20. A method for identifying a compound that modulates coronin 1 promoter activity, comprising: a. providing a host cell comprising the vector according to any one of items 15 to 17, wherein the host cell is capable of expressing the promoter reporter gene of the vector; b. exposing the host cells to the compound to be tested; c. measuring expression of the coronin 1 promoter reporter gene in the host cells exposed to the compound to be tested; A method comprising: 21. A process for preparing compounds of formula (I) as defined in item 10, comprising step (b) of asymmetric reduction of the pyridine motif by enantioselective partial transfer hydrogenation. 22. The method according to item 21, further comprising step (e) of ring-opening the aziridine by actinic irradiation (hν).

[0296] Further examples and embodiments are disclosed in the following numbered clauses.

[0297] 1. A compound of formula (I): for use in the treatment or prevention of a disease that may benefit from BRD3 inhibition directly or indirectly via reduced expression of coronin 1:

[0298] [ka]

[0299] or pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers or isomers and mixtures thereof, During the ceremony, R1 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more -O-C1-C6-alkyl; R2 is selected from phenyl and thienyl, said phenyl being optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen; R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, wherein the cycloalkyl, the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more C1-C6-alkyl; The compound or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer or isomer and mixtures thereof. 2. The compound for use according to clause 1, wherein R1 is phenyl optionally substituted with methoxy. 3. A compound for use according to clause 1 or 2, wherein R1 is selected from 2-methoxyphenyl and phenyl. 4. A compound for use according to any one of clauses 1 to 3, wherein R2 is 3-hydroxyphenyl. 5. The compound for use according to any one of clauses 1 to 4, wherein R3 is -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) or oxygen-containing saturated heterocyclyl, and the oxygen-containing saturated heterocyclyl moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl are each optionally substituted with one or more -C1-C6-alkyl. 6. The compound for use according to any one of clauses 1 to 4, wherein R3 is selected from -C1-C6-alkylene-tetrahydro-2-furanyl, C1-C6-alkylene-tetrahydro-2H-pyran-4-yl and tetrahydro-2H-pyran-4-yl, and wherein the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl and the tetrahydro-2H-pyran-4-yl are each substituted with one or more -C1-C6-alkyl. 7. The compound for use according to any one of clauses 1 to 6, wherein R3 is tetrahydro-2H-pyran-4-yl. 8. The compound is Tetrahydro-2-furanylmethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1); Methyl-4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2); 2-(Ethylthio)ethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3); Methyl-4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5); Tetrahydro-2-furanylmethyl-2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6); Tetrahydro-2-furanylmethyl-2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7); Methyl-4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8); Methyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9); Tetrahydro-2-furanylmethyl-4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10); Methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12), Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13), Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15); Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); and tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21) 2. The compound for use according to clause 1, selected from the group consisting of: 9. The compound of formula (I) has the formula:

[0300] [ka]

[0301] 9. The compound according to any one of clauses 1 to 8, having the absolute configuration of its stereogenic centre as shown in 10. A compound for use according to any one of clauses 1 to 9, which is suitable for therapeutic intervention by direct inhibition of BRD3 or via modulation of coronin 1 expression by BRD3 inhibition, in diseases which can benefit from BRD3 inhibition, preferably in transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders. 11. The compound for use according to any one of clauses 1 to 9, wherein the disease that can benefit from BRD3 inhibition is a BRD3-driven malignancy such as NMC, OCCC or rhabdomyosarcoma.

[0302] Compounds that selectively inhibit coronin 1 promoter activity identified by the fluorescence-based screening assay of the present invention Compounds 1 to 12 and 22 shown in Table 1 were purchased from ChemBridge, Inc., 11199 Sorrento Valley Rd, Suite 206, San Diego, CA 92121 (USA). Example 1 describes the racemic synthesis of Compounds 11 to 21.

[0303] In Example 2, the diastereoselective synthesis is exemplified for compound 13a and its isomers.

[0304] In Example 3, the asymmetric synthesis is exemplified for compound 11c.

[0305] Example 4 describes the synthesis of Compound 12e, Compound 12g, Compounds 50a, 50b, and Compounds 52a to 65a.

[0306] Further synthesis is exemplified in Example 5 by the enantioselective synthesis of compound 51a and the synthesis of compounds 66b and 67b.

[0307] [Table 1-1]

[0308] [Table 1-2]

[0309]

Table 1-3

[0310]

Table 1-4

[0311]

Table 1-5

[0312]

Table 1-6

[0313]

Table 1-7

[0314]

Table 1-8

[0315]

Table 1-9

[0316]

Table 1-10

[0317]

Table 1-11

[0318]

Table 1-12

[0319] [Table 1-13]

[0320] [Table 1-14]

[0321] [Table 1-15]

[0322] [Table 1-16]

[0323] Examples of intermediates for the synthesis of compounds that selectively inhibit coronin 1 promoter activity

[0324] [Table 2-1]

[0325] [Table 2-2]

[0326] [Table 2a]

[0327] General synthesis method for Examples 1 to 3 Solvents and Reagents: Chemicals were purchased from ABCR, Alfa Aesar, ACROS, Sigma-Aldrich, TCI, Strem, Combi-Blocks, or Fluorochem and used without further purification unless otherwise stated. Anhydrous solvents were obtained by molecular sieving or using an LC Technology Solutions SP-1 solvent purification system. Deuterated solvents were purchased from Armar Chemicals or Cambridge Isotope Laboratories. Chromatographic purification was performed as flash column chromatography using SiliaFlash® Silica Gel P60 from Sigma-Aldrich or SILICYCLE at a pressure of 0.3-0.5 bar. The yields reported refer to chromatographically purified, spectroscopically pure compounds unless otherwise stated. NMR Spectroscopy: BRUKER ASCEND spectrometer, BRUKER AVIII spectrometer, BRUKER DRX spectrometer, or BRUKER NEO spectrometer ( 1 Nuclear magnetic resonance spectra were recorded at 400 MHz / 500 MHz / 600 MHz for H NMR. Measurements were performed at room temperature or using a cryoprobe. Chemical shifts (δ) are reported in ppm with residual solvent signals as internal signals. Data are reported as (s = singlet, d = doublet, t = triplet, m = multiplet or unresolved, coupling constant(s), integral). For mixtures of diastereoisomers, the spectroscopic signal of the major species was reported unless otherwise stated. Mass spectrometry: Mass spectrometry was performed as high-resolution ESI and EI measurements by the Mass Spectrometry Service of the Laboratorium fur Organische Chemie at the Swiss Federal Institute of Technology Zurich (ETH Zurich) under the supervision of Dr. B. Gerrtis, L. Bertschi, M. Meier, and D. Wirz.

[0328] Example 1 Synthesis of the racemic scaffold for evaluation

[0329] [ka]

[0330] General Procedure A: A round-bottom flask equipped with a magnetic stir bar was charged with the aldehyde (1.00 equiv.), diketone (1.00 equiv.), acetoacetate (1.20 equiv.), and ammonium acetate (3.00 equiv.). The heterogeneous mixture was heated to 175 °C and over time transformed into a homogeneous red molten solution, with evaporation of volatile by-products evident. After evaporation significantly subsided, the solution was allowed to cool to room temperature. The crude residue was dissolved in ethyl acetate and water and transferred to a separatory funnel. The aqueous layer was extracted with ethyl acetate, and the organic extract was dried over MgSO4, filtered, and concentrated under reduced pressure to give a crude red / orange oily residue. The crude material was purified by silica gel column chromatography (DCM:EtOAc = 1:1) to give the 1,4-DHP product as a yellow solid.

[0331] General Procedure B: A round-bottom flask equipped with a magnetic stir bar was charged with the diketone (1.00 equiv.), aldehyde (1.00 equiv.), acetoacetate (1.00 equiv.), ammonium acetate (1.5 equiv.), and L-proline (0.100 equiv.). Ethanol (1 M) was added, and a red, homogeneous solution was observed, which was stirred at room temperature until complete conversion was observed by TLC. The reaction mixture was poured into brine and extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and evaporated to dryness. A crude solid was obtained. The product was purified by silica gel column chromatography (EtOAc:DCM=1:4) to give a yellow solid.

[0332] Prepared scaffolds compound 11

[0333] [ka]

[0334] Following general procedure B, 11 was synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (1.1 g, 5.0 mmol, 1.00 equiv.), 3-hydroxybenzaldehyde (611 mg, 5.00 mmol, 1.00 equiv.), methyl 3-oxobutanoate (964 mg, 5.00 mmol, 1.00 equiv.), ammonium acetate (385 mg, 5.00 mmol, 1.00 equiv.), and L-proline (58 mg, 0.5 mmol, 0.10 equiv.) in 5 mL of ethanol. The reaction was stirred overnight, and the crude material was purified to give a yellow solid (1.4 g, 3.3 mmol, 67% yield, 5.1:1.0 drupe). Compound 11 can be separated using preparative HPLC using either a nonchiral stationary phase to give 11a and 11b, or a chiral stationary phase to give 11c and 11d.

[0335] 1 H NMR(400MHz,CDCl3)δ:7.24-7.17(m,1H),7.07(dd,J=7.7,1.7Hz,1H),7.02(t,J=7.8Hz,1H),6.98-6.94(m,1H),6.92-6. 80(m,4H),6.65-6.53(m,1H),5.14(s,1H),3.72(s,3H),3.59(s,3H),3.58-3.48(m,1H),2.79-2.43(m,4H),2.32(s,3H).

[0336] HRMS(ESI):C 25 H 26 NO5[M+H] + The calculated value was 420.1805 and the measured value was 420.1807.

[0337] Non-chiral HPLC: Reprosil Gold 120 C18, H2O:ACN + 0.1% FA = 75:25 to 65:35 for 10 min, continued at 65:35 for 3 min, 26.5 mL / min, 125 mm × 20 mm, 5 μm, t R (D1; minor isomer) = 11.7 min; t R (D2; major isomer) = 12.7 min.

[0338] Chiral HPLC: Dr.Maisch ReproSil Chiral NR, H2O:ACN+0.1%FA=62:48, 1mL / min, 250mm×4.6mm, 5μm, t R (D1E1)=7.4 minutes;t R (D1E2)=7.8 min, er=>99:1(>98%ee), t R (D2E1)=8.6 minutes;t R (D2E2) = 10.1 min, er = > 99:1 (> 98% ee).

[0339] compound 12

[0340] [ka]

[0341] Following general procedure A, 12 was synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (3.96 g, 16.5 mmol, 1.00 equiv.), 3-hydroxybenzaldehyde (2.01 g, 16.5 mmol, 1.00 equiv.), (tetrahydrofuran-2-yl)methyl 3-oxobutanoate (3.7 g, 20 mmol, 1.2 equiv.), and ammonium acetate (3.8 g, 49 mmol, 3 equiv.). The reaction was stirred for 30 minutes, and the crude material was purified to give a yellow solid (4.6 g, 9.4 mmol, 57% yield, 2:2:1:1 dr). Compound 12 was separated using preparative HPLC using a non-chiral stationary phase to give 12a and 12b. Use of enantiopure (S) or (R)-(tetrahydrofuran-2-yl)methyl 3-oxobutanoate gives 12c and 12d, respectively, after separation by preparative HPLC. Use of enantiopure (S)-(tetrahydrofuran-2-yl)methyl 3-oxobutanoate followed by preparative HPLC using a chiral stationary phase gives 12e and 12f.

[0342] 1H-NMR1H NMR (400MHz, methanol-d4) δ7.26-7.17(m,4H),7.08-6.99(m,2H),6.99-6.87(m,4H),6.86- 6.74(m,4H),6.60-6.52(m,2H),5.06(s,1H),5.05(s,1H),4.12-3.96(m,6H),3.86-3.78( m,7H),3.76-3.69(m,3H),3.54(tq,J=11.9,4.0Hz,2H),2.85-2.75(m,2H),2.73-2.61(m ,4H),2.49-2.41(m,2H),2.39(s,3H),2.38(s,3H),1.96-1.77(m,6H),1.62-1.50(m,2H).

[0343] Representative analytical data using enantiopure (S)-(tetrahydrofuran-2-yl)methyl 3-oxobutanoate derived compound 12c: 1 H-NMR (400MHz, methanol-d4)δ:7.28-7.14(m,2H),7.03(t,J=7.9Hz,1H),6.99 -6.88(m,2H),6.84-6.73(m,2H),6.60-6.53(m,1H),5.05(s,1H),4.12-3.9 4(m,3H),3.81(s,3H),3.70(t,J=6.7,2H)3.60-3.47(m,1H),2.91-2.59(m, 3H), 2.52-2.40(m, 1H), 2.39(s, 3H), 1.95-1.76(m, 3H), 1.64-1.47(m, 1H).

[0344] HRMS(ESI):C 29 H 31 NNaO6[M+Na] + The calculated value was 512.2044, and the measured value was 512.2037.

[0345] Non-chiral HPLC: Reprosil Gold 120 C18, H2O:ACN + 0.1% FA = 75:25 to 65:35 for 22 min, continued at 65:35 for 5 min, 26.5 mL / min, 125 mm x 20 mm, 5 μm, t R (D1; minor isomer)=18.9 min;t R(D2; major isomer) = 20.9 min.

[0346] Chiral HPLC: Dr. Maisch ReproSil Chiral NR, HO:ACN + 0.1% FA = 56:44 to 40:60 for 10 min, continued for 3 min, 1 mL / min, 250 mm x 4.6 mm, 5 μm, t R (D1.1)=10.1 minutes;t R (D1.2)=10.6 minutes, t R (D2.1)=11.2 minutes;t R (D2.2)=12.4 minutes.

[0347] compound 13

[0348] [ka]

[0349] This was synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (109 mg, 0.50 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (61.1 mg, 0.50 mmol, 1.00 equiv), oxan-4-yl 3-oxobutanoate (94.1 mg, 0.50 mmol, 1.00 equiv), ammonium acetate (57.8 mg, 0.75 mmol, 1.50 equiv), and L-proline (11 mg, 0.1 mmol, 0.2 equiv) in 0.5 mL of ethanol. The reaction was stirred overnight, after which the product precipitated and was collected by vacuum filtration as a colorless solid (120 mg, 0.24 mmol, 49% yield, 5:1 dl).

[0350] 1H NMR(400MHz,DMSO-d6)δ:9.20(s,1H),9.16(s,1H),7.35-7.13(m,2H),7.11-6.87(m,3H),6.7 6-6.55(m,2H),6.49(d,J=8.1Hz,1H),4.89(s,1H),4.86-4.75(m,1H),3.87-3.66(m,4H),3.6 3-3.50(m,1H),3.49-3.39(m,2H),3.37-3.29(m,1H),2.86-2.65(m,1H),2.66-2.52(m,2H),2 .43-2.22(m,4H),1.88-1.75(m,1H),1.72-1.61(m,1H),1.60-1.46(m,1H),1.44-1.30(m,1H).

[0351] HR-MS(ESI):C 29 H 32 NO6[M+H] + The calculated value is 490.2224 and the measured value is 490.2223.

[0352] Chiral HPLC: Dr. Maisch ReproSil Chiral NR, H2O:ACN+0.1%FA=62:38, 1 mL / min, 250 mm × 4.6 mm, 5 μm, t R (D1E1, paraheteromorph) = 7.4 points; t R (D1E2, paraheteromorph) = 7.8 points, t R (D2E1, main heterosex) = 8.6 points; t R (D2E2, major heterosex) = 10.1 points.

[0353] Compound 14

[0354]

change

[0355] This was synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (218 mg, 1.00 mmol, 1.00 equiv), benzaldehyde (0.1 mL, 1.0 mmol, 1.0 equiv), methyl 3-oxobutanoate (116 mg, 1.00 mmol, 1.00 equiv), ammonium acetate (116 mg, 1.50 mmol, 1.50 equiv), and L-proline (11 mg, 0.1 mmol, 0.1 equiv) in 1 mL of ethanol. The reaction was stirred overnight, after which the product precipitated and was collected by vacuum filtration as a yellow solid (170 mg, 0.42 mmol, 42% yield, >20:1 dru).

[0356] 1 H NMR(400MHz,CDCl3)δ:7.40-7.30(m,2H),7.27-7.18(m,3H),7.17-7.08(m,2H),6.97-6.82(m,2H),6.22 (s,1H),5.17(s,1H),3.77(s,3H),3.69-3.52(m,4H),2.83-2.70(m,1H),2.68-2.49(m,3H),2.40(s,3H).

[0357] HR-MS(ESI):C 25 H 26 NO4[M+H] + The calculated value was 404.1856, and the measured value was 404.1855.

[0358] compound 15

[0359] [ka]

[0360] This was synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (227 mg, 1.00 mmol, 1.00 equiv), 3-methoxybenzaldehyde (136 mg, 1.00 mmol, 1.00 equiv), methyl 3-oxobutanoate (116 mg, 1.00 mmol, 1.00 equiv), ammonium acetate (116 mg, 1.50 mmol, 1.50 equiv), and L-proline (11 mg, 0.1 mmol, 0.1 equiv) in 1 mL of ethanol. The reaction was stirred overnight, and the crude material was purified to give a yellow solid (260 mg, 0.6 mmol, 60% yield, 4.4:1 dr).

[0361] 1 H NMR(400MHz,CDCl3)δ:7.25-7.20(m,1H),7.17-7.05(m,2H),7.01-6.80(m,4H),6.72-6.64(m,1H), 6.43(s,1H),5.15(s,1H),3.76(d,J=3.3Hz,6H),3.66-3.54(m,4H),2.81-2.49(m,4H),2.37(s,3H).

[0362] HR-MS(ESI):C 26 H 28 NO5[M+H] + The calculated value was 434.1962, and the measured value was 434.1960.

[0363] compound 16

[0364] [ka]

[0365] This was synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (227 mg, 1.00 mmol, 1.00 equiv), 2-hydroxybenzaldehyde (122 mg, 1.00 mmol, 1.00 equiv), methyl 3-oxobutanoate (116 mg, 1.00 mmol, 1.00 equiv), ammonium acetate (116 mg, 1.50 mmol, 1.50 equiv), and L-proline (11 mg, 0.1 mmol, 0.1 equiv) in 1 mL of ethanol. The reaction was stirred overnight, and the crude material was purified to give a yellow solid (130 mg, 0.3 mmol, 31% yield, 6.7:1 dr).

[0366] 1 H NMR(400MHz,CDCl3)δ:9.49(s,1H),7.25-7.17(m,1H),7.15-7.03(m,2H),6.99(dd,J=7.7,1.7Hz,1H),6.96-6.90(m ,2H),6.90-6.79(m,2H),5.19(s,1H),3.79(s,3H),3.74-3.56(m,1H),3.54(s,3H),2.87-2.53(m,4H),2.51(s,3H).

[0367] HR-MS(ESI):C 25 H 25 NNaO5[M+Na] + The calculated value was 442.1625, and the measured value was 442.1622.

[0368] compound 17

[0369] [ka]

[0370] This was synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (218 mg, 1.00 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (122 mg, 1.00 mmol, 1.00 equiv), 4-methoxybutyl 3-oxobutanoate (245 mg, 1.00 mmol, 1.00 equiv), ammonium acetate (116 mg, 1.50 mmol, 1.50 equiv), and L-proline (11 mg, 0.1 mmol, 0.1 equiv) in 1 mL of ethanol. The reaction was stirred overnight, and the crude material was purified to give a yellow solid (460 mg, 0.72 mmol, 72% yield, 5:1 dr).

[0371] 1 H NMR (400MHz, methanol-d4)δ:7.26-7.20(m,2H),7.08-6.89(m,3H),6.85-6.77(m,2H),6.62-6.55(m,1H),5.04(s,1H),4.10-3.97(m,2H),3.81(s,3 H),3.60-3.47(m,1H),3.38-3.32(m,2H),3.30(s,3H),2.86-2.56(m,3H ),2.51-2.41(m,1H),2.40(s,3H),1.73-1.57(m,2H),1.54-1.43(m,2H).

[0372] HR-MS(ESI):C 29 H 34 NO6[M+H] + The calculated value was 492.2381 and the measured value was 492.2376.

[0373] compound 18

[0374] [ka]

[0375] This was synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (125 mg, 0.57 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (69.9 mg, 0.57 mmol, 1.00 equiv), oxan-4-ylmethyl 3-oxobutanoate (115 mg, 0.57 mmol, 1.00 equiv), ammonium acetate (66.2 mg, 0.86 mmol, 1.50 equiv), and L-proline (13 mg, 0.1 mmol, 0.2 equiv) in 0.75 mL of ethanol. The reaction was stirred overnight, and the crude material was purified to give a yellow solid (113 mg, 0.22 mmol, 39% yield, 5.3:1 dr).

[0376] 1 H NMR(400MHz,DMSO-d6)δ:7.23(t,J=7.6Hz,2H),7.12-7.01(m,1H),6.99-6.88(m,2H),6.81(dd ,J=7.1,1.5Hz,2H),6.64-6.54(m,1H),5.04(s,1H),3.99(dd,J=10.8,6.9Hz,1H),3.93-3.82(m ,2H),3.87-3.75(m,4H),3.59-3.46(m,1H),3.42-3.27(m,2H),2.88-2.55(m,3H),2.51-2.41(m ,1H),2.41(s,3H),1.90-1.73(m,1H),1.53-1.44(m,1H),1.40-1.30(m,1H),1.24-1.08(m,2H).

[0377] HR-MS(ESI):C 30 H 34 NO6[M+H] + The calculated value was 504.2381 and the measured value was 504.2378.

[0378] compound 19

[0379] [ka]

[0380] This was synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (109 mg, 0.50 mmol, 1.00 equiv.), 3-hydroxybenzaldehyde (61.1 mg, 0.50 mmol, 1.00 equiv.), (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 3-oxobutanoate (128 mg, 0.50 mmol, 1.00 equiv.), ammonium acetate (57.8 mg, 0.75 mmol, 1.50 equiv.), and L-proline (11 mg, 0.1 mmol, 0.2 equiv.) in 0.5 mL of ethanol. The reaction was stirred overnight, after which the product precipitated and was collected by vacuum filtration as a yellow solid (172 mg, 0.31 mmol, 61% yield, 7.7:1 dl).

[0381] 1 H NMR(400MHz,DMSO-d6)δ:9.20(s,1H),9.12(s,1H),7.31-7.19(m,2H),7.04-6.90(m,3H),6.70-6.63(m,2H), 6.54-6.47(m,1H),4.93(s,1H),3.93(dd,J=10.8,6.4Hz,1H),3.76(s,3H),3.65(dd,J=10.7,6.3Hz,1H),3.40 (td,J=13.1,12.5,4.0Hz,1H),2.73(dd,J=17.2,11.8Hz,1H),2.62-2.51(m,2H),2.36(s,3H),2.32-2.22(m,1 H),2.10-1.97(m,1H),1.43-1.26(m,2H),1.12(s,3H),1.10(s,3H),1.03(d,J=2.9Hz,6H),0.87-0.70(m,2H).

[0382] HR-MS(ESI):C 34 H 41 NNaO6[M+Na] + The calculated value was 582.2826, and the measured value was 582.2822.

[0383] compound 20

[0384] [ka]

[0385] This was synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (35.9 mg, 0.16 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (20.1 mg, 0.16 mmol, 1.00 equiv), oxetan-3-yl 3-oxobutanoate (26 mg, 0.16 mmol, 1.00 equiv), ammonium acetate (19.0 mg, 0.25 mmol, 1.50 equiv), and L-proline (3.78 mg, 0.03 mmol, 0.20 equiv) in 0.3 mL of ethanol. The reaction was stirred overnight, and the crude material was purified to give a yellow solid (46 mg, 0.1 mmol, 61% yield, 3.8:1 dr).

[0386] 1 H NMR(400MHz,DMSO-d6)δ:9.30(s,1H),9.19(s,1H),7.35-7.20(m,2H),7.09-6.8 8(m,3H),6.72-6.64(m,2H),6.54-6.47(m,1H),5.36-5.25(m,1H),4.90(s,1H),4 .79-4.67(m,2H),4.54-4.42(m,1H),4.31(ddd,J=7.3,5.2,0.9Hz,1H),3.78(s, 3H), 3.53-3.40(m, 1H), 2.86-2.69(m, 1H), 2.67-2.51(m, 2H), 2.35-2.25(m, 4H).

[0387] HR-MS(ESI):C 27 H 28 NO6[M+H] + The calculated value was 462.1911 and the measured value was 462.1906.

[0388] compound 21

[0389] [ka]

[0390] This was synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (455 mg, 2.00 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (244 mg, 2.00 mmol, 1.00 equiv), tert-butyl 3-oxobutanoate (316 mg, 2.00 mmol, 1.00 equiv), ammonium acetate (231 mg, 3.00 mmol, 1.50 equiv), and L-proline (23 mg, 0.2 mmol, 0.1 equiv) in 2 mL of ethanol. The reaction was stirred overnight, and the crude material was purified to give a yellow solid (503 mg, 1.1 mmol, 54% yield, 5.9:1 dr).

[0391] 1 H NMR (400MHz, methanol-d4)δ:7.25-7.18(m,2H),7.03(t,J=7.8Hz,1H),6.98-6.66(m,4H),6.60-6.52 (m,1H),4.95(s,1H),3.80(s,3H),3.60-3.47(m,1H),2.86-2.39(m,4H),2.32(s,3H),1.37(s,9H).

[0392] HR-MS(ESI):C 28 H 31 NNaO5[M+Na] + The calculated value was 484.2094, and the measured value was 484.2093.

[0393] Reference compound 70

[0394] [ka]

[0395] To a solution of methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-4,6,7,8-tetrahydro-1H-quinoline-3-carboxylate (419 mg, 1.00 mmol, 1.00 equiv) in THF (4 mL, 0.25 M) was added LiOH (2 M aqueous solution) (5.0 mL, 10 mmol) at room temperature. The reaction was then heated to reflux and stirred overnight. The mixture was diluted with ethyl acetate and extracted with water. The aqueous layer was acidified to pH 1 with concentrated HCl. The aqueous layer was then extracted with ethyl acetate. The combined organic layers were dried (sodium sulfate), filtered, and concentrated to give the product as a yellow solid (270 mg, 0.66 mmol, 67% yield, 7:1 dr).

[0396] 1 See below for H NMR and LC-MS data.

[0397] Example 2 Diastereoselective synthesis of compound 13a and its isomers

[0398] [ka]

[0399] Compound 13b

[0400] [ka]

[0401] Racemic enaminone 28 (82.0 mg, 282 μmol, 1.00 equiv.) was dissolved in EtOH (0.25 mL, 1 M) and transferred to a vial equipped with a magnetic stir bar. Condensation of the aldehyde with the β-ketoester was carried out according to published procedures, e.g., Chemical and Pharmaceutical Bulletin, 1986, 34, 1589. Tetrahydro-2H-pyran-4-yl 2-(3-hydroxybenzylidene)-3-oxobutanoate (27) (61.4 mg, 282 μmol, 1.00 equiv.) was added, and the mixture was heated to 80 °C and stirred for 36 h. The solvent was removed under reduced pressure, and the residue was purified by flash silica gel column chromatography (DCM:MeOH = 20:1) to give the product as a yellow solid (72.0 mg, 147 μmol, 52%, 1:1 dr).

[0402] Alternative method: This was synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (4.04 g, 18.5 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (2.26 g, 18.5 mmol, 1.00 equiv), oxan-4-yl 3-oxobutanoate (3.44 g, 18.5 mmol, 1.00 equiv), ammonium acetate (2.14 g, 27.7 mmol, 1.50 equiv), and L-proline (426 mg, 0.37 mmol, 0.2 equiv) in ethanol (18.5 mL, 1 M). The reaction was stirred overnight, after which the product partially precipitated as an off-white solid (5.26 g, 10.7 mmol, 71% yield, 3:1 drupe). The filtrate was concentrated under reduced pressure, and the residue was purified by flash silica gel column chromatography (DCM:MeOH=20:1) to give the product as an off-white solid (1.20 g, 2.57 mmol, 14%, 4:1 dr). A combined yield of 85% was observed.

[0403] 1H NMR(400MHz,CD3OD)δ:7.27-7.18(m,2H),7.17-7.11(m,1H),7.04(t,J=7.8Hz,1H),7.00- 6.87(m,5H),6.84-6.77(m,2H),6.76-6.67(m,3H),6.60-6.48(m,2H),5.04(s,1H),5.00( s,1H),4.92-4.84(m,3H),3.94-3.69(m,10H),3.66-3.46(m,5H),3.46-3.38(m,2H),2.86 -2.50(m,8H),2.48-2.30(m,6H),1.98-1.80(m,2H),1.78-1.57(m,4H),1.52-1.41(m,2H).

[0404] HR-MS(ESI): See above compound 29

[0405] [ka]

[0406] A suspension of Hanchu 1,4-DHP13b (1.00 g, 2.04 mmol, 1.00 equiv) and 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (0.52 g, 2.25 mmol, 1.10 equiv) in DMSO (10.2 mL, 0.2 M) was stirred at room temperature for 15 min. The crude product was purified by flash silica gel column chromatography (DCM:MeOH = 10:1) to give the product as an off-white solid (0.93 g, 1.90 mmol, 93%).

[0407] 1H NMR(400MHz,CD3OD)δ:7.31-7.13(m,3H),7.06-6.89(m,2H),6.78(ddd,J=8.2,2.5,1.0Hz,1H),6.70-6.53(m,2H),4.95-4.90(m,1H),3.92- 3.82(m,4H),3.73-3.58(m,2H),3.54-3.38(m,4H),3.06-2.90(m,1H), 2.84-2.71(m,1H),2.57(s,3H),1.78-1.52(m,2H),1.42-1.22(m,2H).

[0408] HR-MS(ESI):C 29 H 30 NO6[M+H] + The calculated value was 488.2068, and the measured value was 488.2064.

[0409] Compound 13a

[0410] [ka]

[0411] Pyridine 29 (37.6 mg, 0.08 mmol, 1.00 equiv) was dissolved in anhydrous DCM (0.8 mL, 0.1 M) in a vial equipped with a magnetic stir bar. Diethyl 2,6-dimethyl-1,4-dihydropyridine-3,5-dicarboxylate (44.2 mg, 0.16 mmol, 2.00 equiv) and (S)-TRIP (2.9 mg, 0.004 mmol, 0.05 equiv) were added, and the mixture was stirred at room temperature for 42 h. The solvent was removed under reduced pressure, and the residue was purified by flash silica gel column chromatography (DCM:EtOAc = 2:3) to give the product as an off-white solid (37 mg, 0.07 mmol, 96%, 1:1 dr, >98% ee). The two diastereoisomers of compound 13c (13a and 13e) can be separated using Buchi Pure Chromatography Systems equipped with a silica gel column (hexane: EtOAc = 9:1 to 1:9) to give pure 13a and 13e.

[0412] Compound 13a 1 H NMR(500MHz,CD3OD)δ:7.24-7.19(m,2H),7.04(t,J=7.8Hz,1H),7.00-6.89(m,2H), 6.84-6.77(m,2H),6.58-6.55(m,1H),5.04(s,1H),4.92-4.86(m,1H),3.88-3.79(m, 4H),3.63-3.49(m,3H),3.46-3.39(m,1H),2.79(dd,J=17.6,11.9Hz,1H),2.72-2.63 (m,3H),2.48-2.35(m,4H),1.95-1.85(m,1H),1.78-1.60(m,2H),1.50-1.41(m,1H).

[0413] HR-MS(ESI):refer to the above Chiral HPLC: Dr. Maisch ReproSil Chiral NR, H2O:ACN+0.1%FA=62:38, 1 mL / min, 250 mm × 4.6 mm, 5 μm, t R (D1E1, parasitoid) = 7.4 points; t R (D1E2, parasex) = 7.8 points, t R (D2E1, major heterosex) = 8.6 points; t R (D2E2, major heterosex) = 10.1 points.

[0414] Compound 13e 1 H NMR(400MHz,MeOD)δ7.21-7.13(m,1H),7.00(dd,J=36.5,8.0Hz,1H),6.96-6.92(m,2H),6.77-6 .69(m,3H),6.55(ddd,J=8.1,2.5,1.0Hz,1H),5.02(s,1H),4.91(dd,J=7.4,3.6Hz,1H),3.91-3. 82(m,4H),3.82-3.76(m,1H),3.67-3.54(m,2H),3.45(ddd,J=11.5,7.6,3.6Hz,1H),2.82-2.74( m,2H),2.64-2.56(m,2H),2.40(s,3H),1.99-1.86(m,1H),1.79-1.63(m,3H),1.56-1.42(m,1H).

[0415] Other diastereoisomers of compound 13 (13d, 13f) can be conveniently obtained using (R)-TRIP.

[0416] Example 3 Enantioselective synthesis of compound 11c

[0417] [ka]

[0418] compound 30a

[0419] [ka]

[0420] A solution of [RHCl(C2H4)2]2 (152 mg, 0.39 mmol, 0.03 equiv., prepared from RhCl3·xH2O according to https: / / doi.org / 10.1002 / 047084289X.rn01715) and 2-((1R,4R,7R)-7-isopropyl-5-methylbicyclo[2.2.2]octa-2,5-dien-2-yl)propan-2-ol (115 mg, 0.52 mmol, 0.04 equiv.) in 1,4-dioxane (22 mL) was stirred at room temperature for 5 min. The synthesis of the ligand and the exact transformation are described in Org. Lett. 2008, 10, 19, 4387-4389. Aqueous 1.5M KOH (4.3 mL, 6.5 mmol, 0.5 equiv.) was added, and the resulting solution was stirred at room temperature for an additional 5 min. To this was added (2-methoxyphenyl)boronic acid (2.96 g, 19.5 mmol, 1.50 equiv.) and cyclohexenone (1.26 mL, 13.0 mmol, 1.00 equiv.) along with additional 1,4-dioxane (21 mL, 0.3 M overall), and the resulting mixture was stirred at room temperature overnight (15 h). The reaction mixture was passed directly through a pad of silica gel with EtO, and the solvent was removed under vacuum. The residue was purified by flash silica gel column chromatography (hexane:EtOAc = 4:1) to give the product as an orange oil (2.60 g, 12.7 mmol, 98%).

[0421] 1 H NMR and HR-MS (ESI) data are consistent with literature spectra.

[0422] Chiral HPLC: Daicel Chiralpak OD-H, Hexane: i PrOH=97:3, 1mL / min, λ=254, t R (major isomer)=11.2 min;t R (minor isomer) = 9.7 min, er = 97:3 (94% ee).

[0423] Compound 32a

[0424] [ka]

[0425] To a solution of 2,2,6,6-tetramethylpiperidine (2.28 mL, 13.4 mmol, 1.07 equiv) in THF (88 mL) was added a 1.43 M solution of n-BuLi in hexane (11 mL, 16.8 mmol, 1.34 equiv) at 4 °C (ice-water bath). After stirring at the same temperature for 1 h, the reaction mixture was cooled to -78 °C. Then, TMSCl (2.22 mL, 17.5 mmol, 1.4 equiv) was added, followed by a solution of 30a (2.55 g, 12.5 mmol, 1.00 equiv) in THF (88 mL, 0.07 M overall). After stirring at the same temperature for 2 h, the reaction mixture was quenched by the addition of saturated aqueous NaHCO3, extracted with Et2O, dried over Na2SO4, and concentrated to give crude enol silyl ether 31a, which was used in the next step without further purification.

[0426] The silyl-enol ether was dissolved in a minimal amount of DMSO, and IBX·MPO complex (52.8 mL, 0.4 M in DMSO, 21.1 mmol, 2.00 equiv.) was added at room temperature. The solution was stirred until completion was observed by TLC. After completion, the reaction mixture was diluted with aqueous NaHCO3 (5%) and extracted with diethyl ether (3 × 60 mL). The combined organic phases were washed with saturated aqueous NaHCO3, water, and brine. After drying (MgSO4), the solvent was removed in vacuo to give the crude product, which was purified by flash column chromatography (hexane:EtOAc = 9:1) to give the product as a pale yellow oil (1.57 g, 7.78 mmol, 62%).

[0427] 1 H NMR(400MHz,CDCl3)δ:7.24(ddd,J=8.1,7.4,1.8Hz,1H),7.18(dd,J=7.6,1.7Hz,1H),7.10-7.04(m,1H),6.95(td,J =7.5,1.2Hz,1H),6.89(dd,J=8.2,1.1Hz,1H),6.16-6.06(m,1H),3.83(s,3H),3.78-3.66(m,1H),2.82-2.54(m,4H).

[0428] HR-MS(ESI):C 13 H 14 NaO2 [M+Na] + The calculated value was 225.0886 and the measured value was 225.0888.

[0429] Compound 33a

[0430] [ka]

[0431] To a stirred solution of benzoic acid (246 mg, 2.01 mmol, 1.00 equiv.), sodium bicarbonate (846 mg, 10.1 mmol, 5.00 equiv.), and tert-butyl(tosyloxy)carbamate (579 mg, 2.01 mmol, 1.00 equiv.) in CHCl3 (15 mL) was added N1,N1-dimethylethane-1,2-diamine (0.13 mL, 1.01 mmol, 0.5 equiv.) at room temperature under a nitrogen atmosphere. Enone 32a (489 g, 2.42 mmol, 1.20 equiv.) in CHCl3 (5 mL) was added in one portion, and the resulting mixture was stirred at room temperature overnight (15 h). Water was added (30 mL), and the aqueous solution was extracted with CHCl3 (3 × 20 mL). The combined organic layers were washed once with saturated brine, dried over NaSO4, and concentrated in vacuo. The resulting oily residue was purified by column chromatography (hexane: EtOAc = 4:1) to give the product as an off-white solid (654 mg, 1.61 mmol, 73%, 2.8:1 dr).

[0432] 1 H NMR(400MHz,CDCl3)δ:7.24-7.16(m,1H),7.15-7.05(m,1H),6.97-6.81(m,2H),3.81(s,3H ),3.77-3.51(m,1H),3.24-3.09(m,1H),3.05-2.62(m,2H),2.48-2.05(m,3H),1.48(s,9H).

[0433] HR-MS(ESI):C 18 H 23 NNaO4[M+Na]+ The calculated value was 340.1519, and the measured value was 340.1515.

[0434] Chiral HPLC: Daicel Chiralpak OD-R, H2O:ACN+0.1%FA=1:1, 1mL / min, λ=254, t R (D1, major isomer)=32.3 min;t R (D1, minor isomer)=28.5 min;t R (D2, major isomer)=19.1 min;t R (D2, minor isomer) = 23.7 min, er = 97:3 (94%ee).

[0435] Compound 34a

[0436] [ka]

[0437] BOC-protected aziridine 33a (78% pure, enone impurity, 132 mg, 0.32 mmol, 1.00 equiv.) was divided into two heat-dried 20 mL Schlenk tubes, and degassed benzene (19 mL, 0.008 M) was added to both tubes. The vessels were transferred to a UV reactor and irradiated at approximately 350 nm for 5 h. The solutions were combined and concentrated under reduced pressure. The crude residue was purified by column chromatography (hexane: EtOAc = 3:2) to give the product as a colorless solid (84 mg, 0.26 mmol, 82%).

[0438] 1 H NMR(400MHz,CDCl3)δ:7.26-7.20(m,1H),7.15(dd,J=7.6,1.7Hz,1H),6.93(td,J=7.5,1.1Hz,1H),6.88(dd,J=8.2 ,1.1Hz,1H),6.55(brs,1H),6.44(d,J=1.6Hz,1H),3.81(s,3H),3.78-3.65(m,1H),2.84-2.51(m,5H),1.48(s,9H).

[0439] HR-MS(ESI):C 18 H 23NNaO4[M+Na] + The calculated value was 340.1519, and the measured value was 340.1518.

[0440] Chiral HPLC: Daicel Chiralpak OD-R, H2O:ACN+0.1%FA=1:1, 1mL / min, λ=254, t R (major isomer)=15.5 min;t R (minor isomer) = 18.1 min, er = 98:2 (96% ee).

[0441] Compound 11e

[0442] [ka]

[0443] A 10 mL flask equipped with a magnetic stir bar was charged with the BOC-protected enaminone 34a (81.0 mg, 0.25 mmol, 1.00 equiv.) and dissolved in a 1:1 mixture of DCM:TFA (2.2 mL, 0.2 M). The mixture was stirred at room temperature for 1 h, and the solvent was removed under reduced pressure. The residue was redissolved in ethyl acetate, washed with saturated aqueous sodium bicarbonate and brine, dried over magnesium sulfate, and concentrated under reduced pressure to give the crude deprotected enaminone 28a, which was used in the next step without further purification.

[0444] LC-MS / 1H NMR analysis data of 28a rt=0.84 min, 218.1 [M+H]+ (UV absorption 76%).

[0445] 1 H NMR(400MHz,DMSO-d6)δ7.27-7.17(m,2H),7.04-6.41(m,4H),4.98(d,J=0.9Hz,1H),3.79(s,3H),3. 50(tt,J=11.4,4.3Hz,1H),2.59-2.51(m,1H),2.45-2.29(m,2H),2.14(ddd,J=16.0,4.4,1.4Hz,1H).

[0446] The crude deprotected enaminone was dissolved in EtOH (0.25 mL, 1 M) and transferred to an HPLC vial equipped with a magnetic stir bar. Methyl (E / Z) 2-(3-hydroxybenzylidene)-3-oxobutanoate (73.2 mg, 0.33 mmol, 1.33 equiv) was added, and the mixture was heated to 80 °C and stirred for 20 h. The solvent was removed under reduced pressure, and the residue was purified by flash silica gel column chromatography (hexane: EtOAc = 1:1) to give the product as a yellow solid (72.3 mg, 0.17 mmol, 69%, 1:1 dr). Methyl (E / Z) 2-(3-hydroxybenzylidene)-3-oxobutanoate has been previously prepared; see Chemical and Pharmaceutical Bulletin, 1986, 34, 1589.

[0447] 1 See above for H NMR and HR-MS (ESI) data.

[0448] Chiral HPLC: Daicel Chiralpak OD-R, H2O:ACN+0.1%FA=58:42, 1mL / min, λ=362, t R (D1, major isomer)=14.8 min;t R (D1, minor isomer)=17.3 min;t R (D2, major isomer)=16.4 min;t R (D2, minor isomer) = 24.2 min, er = 98:2 (96%ee).

[0449] compound 35a

[0450] [ka]

[0451] A suspension of Hanchu 1,4-DHP11e (32.0 mg, 0.08 mmol, 1.00 equiv) and 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (17.3 mg, 0.08 mmol, 1.00 equiv) in dichloromethane (0.8 mL, 1 M) was stirred at 0 °C for 30 min. The precipitate was filtered and washed with dichloromethane (2 × 5 mL), and the filtrate was concentrated under reduced pressure. The residue was purified by flash silica gel column chromatography (hexane: EtOAc = 3:2) to give the product as an off-white solid (26.0 mg, 0.06 mmol, 82%).

[0452] 1 H NMR(400MHz,CDCl3)δ:7.26-7.16(m,3H),6.95(td,J=7.5,1.1Hz,1H),6.89(dd,J=8.3,1.1Hz,1H),6.82-6.73(m,1H),6.66(dd, J=14.0,7.5Hz,1H),6.57(d,J=17.4Hz,1H),3.93-3.83(m,1H),3.82(s,3H),3.56-3.36(m,5H),2.92-2.81(m,2H),2.60(s,3H).

[0453] HR-MS(ESI):C 25 H 24 NO5[M+H] + The calculated value was 418.1649, and the measured value was 418.1646.

[0454] Chiral HPLC: Daicel Chiralpak OD-R, H2O:ACN+0.1%FA=58:42, 1mL / min, λ=254, t R (major isomer)=26.1 min;t R (minor isomer) = 24.0 min, er = 98:2 (96% ee).

[0455] compound 11c

[0456] [ka]

[0457] Pyridine 35a (22.0 mg, 0.05 mmol, 1.00 equiv) was dissolved in anhydrous DCM (0.5 mL, 0.1 M) in an HPLC vial equipped with a magnetic stir bar. Diethyl 2,6-dimethyl-1,4-dihydropyridine-3,5-dicarboxylate (26.7 mg, 0.10 mmol, 2.00 equiv) and (S)-TRIP (1.984 mg, 0.003 mmol, 0.05 equiv) were added, and the mixture was stirred at 40 °C for 16 h. The solvent was removed under reduced pressure, and the residue was purified by flash silica gel column chromatography (hexane:EtOAc = 1:1) to give the product as an off-white solid (21 mg, 0.05 mmol, 95%, >20:1 dr).

[0458] 1 See above for H NMR and HR-MS (ESI) data.

[0459] Chiral HPLC: Daicel Chiralpak OD-R, H2O:ACN+0.1%FA=58:42, 1mL / min, λ=362, t R (major isomer)=16.3 min;t R (minor isomer) = 24.2 min, er = > 99:1 (> 99% ee).

[0460] Example 4 Synthesis of compounds 12e, 12g, 50a, 50b, 52a-65a

[0461] [ka]

[0462] General Procedure C: To a stirred solution of acid 70a (0.07–0.19 mmol, 1.00 equiv.) in acetonitrile (0.1 M), alcohol (4.00 equiv.), pyridine (4.00 equiv.), and propanephosphonic anhydride (4.00 equiv., 50% w / w in DMF) were added at room temperature. The reaction mixture was heated to 40 °C and stirred for 3 h–overnight. The mixture was cooled to room temperature, a saturated solution of NHCl was added, and the mixture was extracted with ethyl acetate. The combined organic layers were washed with water, and the solvent was removed under pressure to give the crude product. The crude product was purified by silica gel column chromatography (acetone:toluene) to give the product in 27–56% yield.

[0463] General Procedure D: To a stirred solution of acid 70a (0.12–0.20 mmol, 1.00 equiv.) and alcohol (3.00 equiv.) in a mixture of DCM / NMP (3:1, 0.08 M) was added N,N'-diisopropylmethanediimine (3.00 equiv.) dropwise at room temperature. The reaction mixture was stirred at 40 °C for 1 h to overnight. Ethyl acetate was added to the reaction mixture, and the organic layer was washed with water, dried using a phase separator, and concentrated in vacuo. The crude product was purified by silica gel column chromatography (DCM / MeOH) and reverse-phase flash chromatography (water / ACN), optionally followed by extraction (DCM / water), to give the product in 14–28% yield.

[0464] General Procedure E: To a stirred solution of acid 70a (0.07 mmol, 1.00 equiv.) in alcohol (0.25 M) was added N,N'-diisopropylmethanediimine (3.00 equiv.) at room temperature. The reaction mixture was stirred at room temperature overnight. The mixture was concentrated in vacuo. The crude product was purified by reverse-phase flash chromatography (water / ACN) to give the product in 52-60% yield.

[0465] compound 70a

[0466] [ka]

[0467] To a stirred solution of ester 11c (2.17 g, 5.17 mmol, 1.00 equiv.) in a mixture of water / THF (1:1, 0.14 M) was added LiOH·HO (2.00 g, 46.5 mmol, 9.00 equiv.) at room temperature. The reaction was then heated to 50 °C and stirred at this temperature overnight. The reaction mixture was diluted with ethyl acetate, and the two phases were separated. The aqueous phase was washed with ethyl acetate. The aqueous layer was acidified to pH 1 with concentrated HCl. The aqueous layer was extracted with ethyl acetate. The combined organic layers were dried using a phase separator and concentrated in vacuo to give the expected compound as a beige powder (1.4 g, 63%).

[0468] LC-MS / 1H NMR analysis data rt=1.25 min, 406.0 [M+H]+ (UV absorption 91%).

[0469] 1H NMR(400MHz,DMSO-d6)δ11.72(s,1H),9.12(s,1H),9.06(s,1H),7.29(dd,J=7.6,1.7Hz ,1H),7.26-7.19(m,1H),6.99(ddd,J=8.0,4.5,3.3Hz,2H),6.94(td,J=7.4,1.1Hz,1H) ,6.67-6.60(m,2H),6.49(ddd,J=8.0,2.4,1.1Hz,1H),4.88(s,1H),3.78(s,3H),3.44( t,J=12.7Hz,1H),2.75(dd,J=17.1,11.8Hz,1H),2.64-2.52(m,2H),2.34-2.24(m,4H).

[0470] [Table 3-1]

[0471] [Table 3-2]

[0472] [Table 3-3]

[0473] [Table 3-4]

[0474] [Table 3-5]

[0475] Example 5 Enantioselective synthesis of compound 51a and synthesis of compounds 66b and 67b

[0476] [ka]

[0477] Compound 51b

[0478] [ka]

[0479] A 1 mL vial was charged with 28a (55 mg, 0.25 mmol, 1.00 equiv.) in succession. The condensation of the aldehyde with the β-ketoester was carried out according to published procedures, e.g., Chemical and Pharmaceutical Bulletin, 1986, 34, 1589. (4-Methyltetrahydropyran-4-yl) 2-[(3-hydroxyphenyl)methylene]-3-oxo-butanoate (71) (101 mg, 0.33 mmol, 1.30 equiv.) in DMF (0.28 mL, 0.92 M) and molecular sieves were added. The reaction mixture was stirred at 100 °C overnight. The reaction mixture was concentrated in vacuo. The crude product was purified by silica gel column chromatography (acetone:toluene) to give the expected compound (86 mg, 61%, 1:1 dr).

[0480] LC-MS / 1H NMR analysis data 50 / 50 two diastereoisomers rt=0.85 min and 0.86 min, 504.2[M+H]+ and 504.2[M+H]+, UV absorption total 90% 1H NMR(DMSO)δ:9.12(d,J=6.5Hz,1H),9.02(d,J=12.8Hz,1H),7.34-7.10(m,1H),7.05 -6.42(m,7H),4.88(d,J=18.5Hz,1H),3.78(d,J=7.5Hz,3H),3.70-3.46(m,3H),3.2 9-3.23(m,2H),2.68(d,J=6.9Hz,1H),2.61-2.52(m,1H),2.49-2.38(m,1H),2.31(d ,J=6.2Hz,4H),1.97(d,J=13.2Hz,2H),1.56(d,J=10.8Hz,2H),1.34(d,J=1.3Hz,3H)

[0481] Compound 72a

[0482] [ka]

[0483] A suspension of Hanchu 1,4-DHP51b (86 mg, 90%, 0.15 mmol, 1.00 equiv) and 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (35 mg, 0.15 mmol, 1.00 equiv) in DCM (1.5 mL, 0.10 M) was stirred at 0 °C for 1 h. The reaction mixture was filtered, the solid was washed with DCM, and the filtrate was concentrated under reduced pressure to give a brown residue. The crude product was purified by silica gel column chromatography (acetone:toluene) to give the expected compound (67 mg, 81%).

[0484] LC-MS / 1H NMR analysis data rt=0.94 min, 502.1 [M+H]+ (UV absorbance 89%) (6% impurity from LCMS at rt=1.06 min, therefore true purity=93%) 1H NMR(DMSO)δ:9.42(s,1H),7.30-7.22(m,2H),7.21-7.11(m,1H),7.06-7.00( m,1H),6.95(td,J=7.5,1.1Hz,1H),6.74(dd,J=8.3,2.4Hz,1H),6.57-6.46( m,2H),3.81(s,4H),3.53-3.34(m,3H),3.26(d,J=16.6Hz,3H),3.04-2.86(m ,1H),2.71-2.57(m,1H),2.53(s,3H),1.78(s,2H),1.56(s,2H),1.19(s,3H)

[0485] Compound 51a

[0486] [ka]

[0487] Pyridine 72a (67 mg, 90%, 0.120 mmol, 1.00 equiv) was dissolved in DCM (0.60 mL, 0.20 M) in a vial. Diethyl 2,6-dimethyl-1,4-dihydropyridine-3,5-dicarboxylate (64 mg, 95%, 0.24 mmol, 2.00 equiv) and S-TRIP (1.9 mg, 97%, 2.40 μmol, 0.02 equiv) were then added. The reaction mixture was stirred at 40° C. overnight. The solvent was removed under reduced pressure, and the residue was purified by silica gel column chromatography (acetone:toluene) to give the expected compound (23 mg, 37%).

[0488] LC-MS / 1H NMR analysis data rt=2.38min, 504.3[M+H]+, 98%UV 220nm 1H NMR(DMSO-d6,500MHz)δ9.12(d,2H,J=7.5Hz),7.28(dd,1H,J=1.5,7.6Hz),7.23( dt,1H,J=1.6,7.8Hz),7.0-7.0(m,2H),6.94(t,1H,J=7.4Hz),6.6-6.7(m,2H),6. 5-6.5(m,1H),4.91(s,1H),3.77(s,3H),3.5-3.6(m,2H),3.4-3.5(m,1H),3.2-3. 3(m,2H),2.73(dd,1H,J=11.7,17.1Hz),2.5-2.6(m,2H),2.2-2.4(m,4H),1.98(br d,2H,J=14.1Hz),1.5-1.7(m,2H),1.35(s,3H) Chiral SFC: Pirkle Whelk-01 (R,R), CO2:MeOH+0.5%IPAm=6:3, 2.4 mL / min, 104 bar, λ=254, t R (minor isomer)=3.9 min;t R (major isomer)=4.7 min, dr=98:2.

[0489] compound 66b

[0490] [ka]

[0491] A 1 mL vial was charged with 28a (35 mg, 0.16 mmol, 1.00 equiv.). The condensation of the aldehyde with the β-ketoester was carried out according to published procedures, e.g., Chemical and Pharmaceutical Bulletin, 1986, 34, 1589. Tetrahydro-2H-pyran-4-yl 2-(4-fluoro-3-hydroxybenzylidene)-3-oxobutanoate (73) (74 mg, 0.21 mmol, 1.30 equiv., 87%) in DMF (0.18 mL, 0.92 M) and molecular sieves were added. The reaction mixture was stirred at 100 °C overnight. The reaction mixture was concentrated in vacuo. The crude product was purified by reverse-phase column chromatography (water:acetonitrile) to give the expected compound (47 mg, 57%, 1:1 dr).

[0492] LC-MS / 1H NMR analysis data 50 / 50 two diastereoisomers rt = 2.04 min and 2.08 min, 508.4 [M+H] +, 48% + 50.8% UV 220 nm 1H NMR(DMSO-d6,600MHz):δ(ppm)9.40-9.62(m,1H),9.00-9.31(m,1H),7.21-7.28(m,1H),7.12-7.19(m,1H) ,6.92-7.00(m,2H),6.83-6.89(m,1H),6.70-6.82(m,1H),6.50-6.63(m,1H),4.86(s,1H),4.77-4.83(m,1 H),3.76-3.80(m,3H),3.69-3.76(m,1H),3.34-3.68(m,4H),2.65-2.78(m,1H),2.51-2.61(m,1H),2.38-2 .49(m,1H),2.27-2.33(m,4H),1.77-1.83(m,1H),1.62-1.69(m,1H),1.49-1.56(m,1H),1.31-1.38(m,1H)

[0493] compound 67b

[0494] [ka]

[0495] A 1 mL vial was charged with 28a (40 mg, 0.18 mmol, 1.00 equiv.). The condensation of the aldehyde with the β-ketoester was carried out according to published procedures, e.g., Chemical and Pharmaceutical Bulletin, 1986, 34, 1589. Tetrahydro-2H-pyran-4-yl 2-(2,4-difluoro-3-hydroxybenzylidene)-3-oxobutanoate (74) (79 mg, 0.24 mmol, 1.30 equiv.) in DMF (0.20 mL, 0.92 M) and molecular sieves were added. The reaction mixture was stirred at 100 °C overnight. The reaction mixture was concentrated in vacuo. The crude product was purified by reverse-phase column chromatography (water:acetonitrile) to give the expected compound (33 mg, 34%, 1:1 dr).

[0496] LC-MS / 1H NMR analysis data 50 / 50 two diastereoisomers rt=2.06 min and 2.1 min, 526.3 [M+H]+ and 526.4 [M+H]+, 45.5% and 54.5% UV 220 nm 1H NMR (DMSO-d6,500MHz): δ(ppm)9.69-9.82(m,1H),9.11-9.25(m,1H),6.84-7.34(m,4H),6.75- 6.82(m,1H),6.50-6.70(m,1H),5.04(d,J=18.0Hz,1H),4.75(td,J=8.9,4.4Hz,1H),3.76-3.82 (m,4H),3.62-3.73(m,2H),3.33-3.47(m,3H),2.67-2.81(m,1H),2.52-2.65(m,1H),2.39-2.4 9(m,1H),2.23-2.31(m,3H),1.77-1.82(m,1H),1.52-1.63(m,2H),1.33(dt,J=12.8,3.3Hz,1H)

[0497] Example 6 Screening assays and biological characterization to identify inhibitors of coronin 1 promoter activity To identify compounds with coronin 1 promoter inhibitory activity, we first characterized the coronin 1 promoter by cloning it into a promoter-free plasmid driving a luciferase or fluorescent construct as a readout of promoter activity. We then screened various compounds from the library to identify coronin 1 promoter inhibitors. These were then validated by qPCR and Western blotting and employed for SAR-based optimization, safety evaluation, and immunosuppressive activity evaluation in an autoimmune inflammation model of psoriasis. These procedures are described in detail below.

[0498] Vector design, transfection and compound identification with fluorescent readout We designed a fluorescence-based screening assay to identify compounds that selectively inhibit coronin 1 promoter activity. The vectors used in the assay lacked a promoter sequence (promoter-less vector), but contained a promoter sequence consisting of 3 kb or 1.53 kb (P1.5; SEQ ID NOs: 1 to 3) or 1 kb or 737 bp (P.7; SEQ ID NOs: 4 to 6) located upstream of the TSS of the coronin 1 gene within a plasmid containing a luciferase expression gene as the readout. J774 macrophages or RBL cells were transfected with the plasmids and evaluated for luciferase activity (Figure 1). Instead of macrophages or RBL cells, any other non-immune or preferably immune cell type may be used. The 1530 base pair fragment of SEQ ID NOs: 1 to 3, located 5' (upstream) of the coronin 1 transcription start site, yielded the best coronin 1 promoter activity in the luciferase activity assay. Furthermore, fragment P0.7 also exhibited coronin 1 promoter activity in the luciferase activity assay (Figure 1). However, taking into account the presence of additional regulatory elements, the 1530 bp fragment was further characterized and used in the development of screening assays.

[0499] The mouse coronin 1 promoter sequences (SEQ ID NOs: 1 to 6) were cloned into promoter-less (promoter-less) plasmids containing a destabilized green fluorescent protein (GFP) cassette. The plasmids were transfected into rat basophilic leukemia (RBL) cells, and stable GFP-expressing cells were enriched and evaluated for coronin 1 promoter inhibition by incubating them with various compounds and assessing green fluorescence (Figure 2).

[0500] As an unrelated promoter, the early cytomegalovirus promoter element was cloned into a promoterless red fluorescent protein (RFP) expression plasmid. Rat basophilic leukemia (RBL) cells were transfected with the plasmid, and stable RFP-expressing cells were enriched, incubated with various compounds, and evaluated for red fluorescence. The nonspecificity of the compounds under analysis was assessed by analyzing the inhibition of the unrelated promoter (in this case, the early cytomegalovirus promoter) driving RFP expression.

[0501] The plasmids were independently transfected into immune cells (rat basophilic leukemia, RBL cells) to generate green and red fluorescent RBL cells, which were subsequently enriched by flow cytometry. These cells were then mixed in equal ratios (1:1) and incubated at 100,000 cells / well in 96-well plates in a volume of 200 μL of phenol red-free RPMI supplemented with 8% fetal bovine serum, L-glutamate, antibiotics (penicillin, streptomycin), and various compounds (3 μg / mL and 5 μg / mL) from available chemical libraries. At defined time points (8, 24, and 48 hours), GFP and RFP fluorescence were measured using a 96-well microplate reader (Synergy, BioTek Instruments). The top hit compounds that selectively reduced GFP fluorescence and were identified from this initial screening of 12,000 compounds are listed in Table 5. Selected compounds demonstrate differential levels of modulation of coronin 1 promoter-driven GFP fluorescence and CMV promoter-driven RFP fluorescence. GFP and RFP fluorescence were analyzed using a microplate reader upon incubation with the top coronin 1 promoter inhibitor compounds. The percentage of GFP reduction (left column) and RFP reduction (right column) over 48 hours for compounds at a concentration of 5 μg / mL are shown. Cycloheximide (CHX) served as a positive control, and medium and DMSO served as negative controls. Figures 3A–3C show compound 11, the top hit that selectively reduced GFP levels in the initial screening. Cells were imaged using a fluorescent microscope to verify fluorescence inhibition (Figure 3A), and morphology and viability were also assessed (in addition to confirming GFP downregulation). Furthermore, quantitative polymerase chain reaction (qPCR) analysis of coronin 1 mRNA transcripts demonstrates the reduction induced by compound 11 (Figure 3B). The primers used for qPCR on RBL cells are listed below; Cor1a forward primer: 5'GTG ACA GCT CTA TCC GGT ATT T 3' (SEQ ID NO: 7) Cor1a reverse primer: 5'ACG TTG AGA CTC CTT GGA AC 3' (SEQ ID NO: 8) GAPDH forward primer: 5'GGG AAA CCC ATC ACC ATC TT 3' (SEQ ID NO: 9) GAPDH Reverse: 5'CCA GTA GAC TCC ACG ACA TAC T 3' (SEQ ID NO: 10).

[0502] GAPDH was used as a housekeeping gene for normalization purposes. SYBR Green-based qPCR assay was performed.

[0503] Western blotting RBL cells incubated with compounds (10 μg / mL) for 96 h were lysed at 4°C in Triton-X 100 buffer containing 0.2% SDS containing protease and phosphatase inhibitors (Roche). Protein determination (BCA, Pierce) and SDS-PAGE were then performed. Equal protein amounts were transferred to nitrocellulose and probed with antibodies against the indicated proteins (actin and coronin 1) followed by HRP-conjugated secondary antibodies, and developed using an enhanced chemiluminescence imager (Fuji) (Figure 3C).

[0504] Splenocytes from mice treated with either compound 11 (150 mg / kg body weight, BD, SC route) or vehicle control (DMSO) for 5 days were lysed in Triton-X 100 buffer containing 0.2% SDS containing protease and phosphatase inhibitors (Roche) at 4°C, followed by protein determination (BCA, Pierce) and SDS-PAGE, transferred to nitrocellulose, probed with antibodies against the indicated proteins (actin and coronin 1) followed by infrared dye-tagged secondary antibodies, and imaged using the Licor system (Figures 7 and 11).

[0505] Human PBMCs incubated with the indicated compounds (at a concentration of 20 μg / mL) for 96 h were lysed at 4°C in Triton-X 100 buffer containing 0.2% SDS containing protease and phosphatase inhibitors (Roche), followed by protein determination (BCA, Pierce) and SDS-PAGE, transferred to nitrocellulose, probed with antibodies against the indicated proteins (actin and coronin 1) followed by HRP-conjugated secondary antibodies, and developed using an enhanced chemiluminescence imager (Fuji) (Figure 8A).

[0506] Analysis of coronin 1 promoter-driven GFP fluorescence in RBL cells incubated with calcium channel blockers: RBL cells incubated for 48 h with the indicated concentrations of calcium channel blockers (amlodipine (3.125 μM) and verapamil (8 μM)) were analyzed by flow cytometry for any changes in coronin 1 promoter-driven GFP fluorescence. The results show that there was no effect of calcium channel blockers on coronin 1 promoter activity (Figure 4).

[0507] EC for cell viability using Live-Dead staining for inhibition of coronin 1 promoter-driven GFP (specific activity), inhibition of CMV promoter-driven RFP (non-specific activity), and cytotoxicity. 50 analysis: Equal numbers of RBL cells expressing GFP under the coronin 1 promoter and optionally RFP under the CMV promoter were mixed and incubated with the indicated concentrations of compounds for 48 to 65 hours. Changes in the coronin 1 promoter (GFP fluorescence) and CMV promoter (RFP fluorescence) levels were analyzed by flow cytometry. Furthermore, cells were labeled with live / dead markers to assess cell viability by flow cytometry. Cycloheximide (CHX) served as a positive control, and DMSO served as a negative control. For compounds 10-22 and 50a-65a, the effective concentrations (EC) for coronin 1 promoter inhibition by GFP fluorescence analysis, nonspecific promoter inhibition by CMV promoter-driven RFP fluorescence analysis, and cell viability by live / dead staining as a measure of toxicity in flow cytometry were determined. 50 ) values ​​are shown in Tables 6 and 7. EC 50 Based on the analysis, a eutomer of the (4S,7R) configuration was identified (structures in Figures 9A-9C). This is exemplified by eutomer 11c and eutomer 13a for compounds containing two stereocenters. For compounds with three or more stereocenters, the most active core configuration is also shown for (4S,7R) compound 12e. Using compound 13a as the reference for relative potency normalized to a value of 1.00, the subsequent EC 50 The GFP-inhibitory EC of 13a was evaluated (Table 7). 50 ] / [GFP inhibition EC of target compound 50 ] (relative efficacy calculated as [relative efficacy]).

[0508] In vitro toxicity assessment by Alamar Blue assay: In vitro cytotoxicity tests were performed using Alamar blue (Invitrogen, USA) according to the manufacturer's protocol. Briefly, RBL cells pretreated with coronin 1 expression inhibitors or vehicle control were cultured at 1 × 10 4The cells were replated into a 96-well plate at a concentration of 0.1 cells / mL of culture medium and cultured. Alamar blue was added to the wells and further incubated at 37°C for 4 hours. The absorbance was measured at 600 nm using a microplate reader (Synergy, BioTek Instruments). DMSO and cycloheximide served as vehicle and positive controls, respectively (Figure 5A).

[0509] In vitro toxicity assessment by MTT assay: MTT assays were performed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Cayman Chemicals) according to the manufacturer's protocol. Briefly, RBL cells pretreated with coronin 1 expression inhibitors or vehicle control were cultured at 1 × 10 4 The cells were replated into a 96-well plate at a concentration of 100 cells / mL of culture medium, cultured, and 10 μL of MTT was added and incubated at 37°C for 4 hours. Finally, the culture supernatant was removed, and the formazan crystals were dissolved in 100 μL of crystal dissolution solution. The absorbance was measured at 570 nm using a plate reader (Synergy) (Figure 5B).

[0510] In vivo administration of coronin 1 promoter inhibitors to modulate body weight as a measure of toxicity and ADVIA analysis: First, a coronin 1 expression inhibitor (compound 11) was dissolved in DMSO at a concentration of 100 mg / mL. Simultaneously, a 50:50 solution of miglyol 812 and kolliphor EL (M+K) was prepared. The coronin 1 expression inhibitor and M+K were mixed in a 30:70 ratio and vortexed for 5 minutes to create a uniform suspension at a final concentration of 30 mg / mL. Subsequently, 100 μl per mouse was administered intraperitoneally or subcutaneously using an insulin syringe. Mice used in the study were divided into age- and sex-matched cohorts. They were weighed before the start of the study and regularly monitored for weight, behavioral changes, hair changes, fecal consistency, and urine color. Compound administration continued for 14 days, at the end of which the animals were sacrificed and blood parameters were evaluated using the ADVIA platform (Figures 6A-E).

[0511] In vivo administration of coronin 1 promoter inhibitors as a measure of in vivo coronin 1 reduction: First, the coronin 1 expression inhibitor was dissolved in DMSO at a concentration of 100 mg / mL. Simultaneously, a 50:50 solution of miglyol 812 and kolliphor EL (M+K) was prepared. The coronin 1 expression inhibitor and M+K were mixed at a ratio of 30:70 and vortexed for 5 minutes to create a uniform suspension at a final concentration of 30 mg / mL. Subsequently, 100 μl per mouse was administered intraperitoneally or subcutaneously using an insulin syringe. Mice used in the study were divided into age- and sex-matched cohorts. They were weighed before the start of the study and regularly monitored for weight, behavioral changes, hair changes, fecal consistency, and urine color. For the coronin 1 downregulation study, treatment was continued for 5 days, after which spleens were harvested and analyzed by Western blotting (Figure 7).

[0512] Human peripheral blood mononuclear cell cultures for Western blotting of coronin 1 and pro-inflammatory cytokine production: Heparin- or EDTA-treated blood or buffy coats from healthy volunteers were enriched for monocytes using standard Histopaque 1.077 gradient centrifugation. After enrichment, the monocyte fraction was washed extensively with unsupplemented RPMI, counted, and seeded into 96-well plates at a density of 200,000 cells / well in 200 μl of RPMI-1640 (Sigma) containing 1× penicillin and streptomycin (Gibco), 2 mM L-glutamine (Gibco), 10% heat-inactivated FCS (PAA), and 50 units / mL heparin, along with the indicated concentrations of carrier (DMSO) or coronin 1 inhibitor. Cells were incubated with the inhibitor for 5 days in a humidified incubator at 37°C with 5% CO2, and the carrier was replenished by a 50% medium change 48 hours after seeding. Cells were then assessed for downregulation of coronin 1 by Western blotting (Figure 8A), simultaneously stimulated overnight with anti-CD3 (2 μg / mL) and anti-CD28 (10 μg / mL) antibodies, treated with brefeldin A for 4 hours, subjected to surface staining (for CD3, CD4, CD8, and CD19) along with live / dead markers, fixed with 4% formaldehyde, permeabilized with 0.1% saponin, and subjected to intracellular staining for interleukin-2 (Figure 8B, Figure 8C).

[0513] Human peripheral blood mononuclear cell culture for mixed lymphocyte reaction: The mixed lymphocyte reaction (MLR) is an in vitro model for assessing alloantigen-driven immune responses and is therefore considered an in vitro model of transplant rejection (or alloimmune response). To assess the suppression of alloresponses by coronin 1 modulators using the MLR method, heparin- or EDTA-treated blood or buffy coats from two healthy volunteers were enriched for monocytes using standard Histopaque 1.077 gradient centrifugation, as detailed above. After enrichment, one donor PBMC was designated as the "responder cell" and the other as the "stimulator cell." The "stimulator cell" was treated with mitomycin to inhibit proliferation, while the "responder cell" PBMC was left untreated. After enrichment, stimulator and responder PBMCs were washed extensively with unsupplemented RPMI, counted, and seeded into 96-well plates at a density of 100,000 cells / well (responder + stimulator = 200,000 cells / well) in 200 μl of RPMI-1640 (Sigma) containing 1× penicillin and streptomycin (Gibco), 2 mM L-glutamine (Gibco), and 10% heat-inactivated FCS (PAA) with the indicated concentrations of either vehicle (DMSO) or coronin 1 expression inhibitor. Cells were incubated with the expression inhibitor for 5 days in a humidified incubator at 37°C with 5% CO, at the end of which 0.5 μCi of tritiated thymidine was added to all wells. After an additional 20 hours of incubation, the cells were harvested onto GF / C filters, and DNA uptake counts were measured using a Packard instrument as a measure of immune response (Figure 10).

[0514] Evaluation of the therapeutic activity of compounds in imiquimod-induced psoriasis: Wild-type mice (Balb / c strain, 8-12 weeks old) were matched for age and sex. The dorsal skin was cut approximately 2 cm 2The mice were shaved with a trimmer over an area of ​​100 mm and subjected to topical application of 5% imiquimod cream (Aldara) in the morning, starting on day 1 and continuing for up to 7 days. Compound administration was performed by topically applying the compound to the mice twice daily throughout the experiment, starting 48 hours before the first imiquimod application and continuing for up to day 7. Compound was applied in the morning, 2 hours before imiquimod application (FIG. 12A). Mice were scored daily for inflammatory lesions and general health as follows:

[0515] JPEG2025534417000108.jpg85170

[0516] Evaluation of the therapeutic activity of compounds in K5.Stat3-induced psoriasis: Anesthetize wild-type K5.Stat3 mice (FVB strain) and inject them into the dorsal area approximately 2 cm. 2 The area was tape stripped 30 times with clear Scotch tape. Compound 11 (75 mg / kg body weight per dose) was applied topically in a vehicle formulation containing PPG400 and Kolliphor EL (3:1 ratio) 2 days before tape stripping and then twice daily until the end of the study. Lesions were scored on a scale of 0 to 4 for erythema, scaling, and thickening as follows:

[0517] JPEG2025534417000109.jpg86166

[0518] The time scores of the disease scores are shown in FIG.

[0519] Evaluation of the therapeutic activity of compounds in the DSS colitis model: Wild-type mice were given 2.5% or 3% DSS (MP Biomedicals, molecular weight 36,000-50,000, product number 02160110, colitis grade) in drinking water ad libitum for 5-7 days as indicated, and the kinetics of colitis disease progression were monitored. The DSS solution was replaced with fresh solution every 3 days. Compound administration began 2 days before DSS water administration (Compound 12, 100 mg / kg body weight per dose). The compound was administered subcutaneously twice daily (BID) throughout the study period. Mice were regularly evaluated for signs of hair loss, lethargy, anal / perianal inflammation, perianal soiling, fecal consistency, and weight loss. Scoring was based on three main criteria: fecal consistency, fecal blood, and weight loss. Feces were scored as follows: normal (score 0), semisolid (score 1), unformed, muddy (score 2), loose (score 3), and watery (score 4). Fecal blood was scored as follows: no blood (score 0), occult blood (score 1), orange-red discoloration (score 2), red discoloration (score 3), and bloody (score 4). Weight loss was scored as follows: 0% loss (score 0), 8-10% (score 1), 10-15% (score 2), 15-19% (score 3), and 20% or more (score 4). Disease scores were plotted and the scores from all three criteria were added together. The study was terminated when mice reached 20% weight loss. The colon was dissected from the ileocecal junction to the anus, and its length was measured with a ruler on a non-absorbent surface. Care was taken not to stretch the intestine. The results are shown in Figure 18.

[0520] Evaluation of the therapeutic activity of compounds in a foreign body infection model: To investigate whether compound 13a can induce suppression of autoimmune responses while maintaining anti-pathogen responses, we used a foreign body infection model established with approval from the Swiss Kantonale Veterinaeramt Basel-Stadt, Switzerland (license number 1710). Experiments were conducted in accordance with Swiss veterinary regulations and in the animal house of the Department of Biomedicine, University Hospital Basel, Switzerland. Healthy, 13-week-old wild-type female C57BL / 6 mice (Janvier Labs, France) were housed under specific pathogen-free conditions (biosafety level 2) and anesthetized. They were subcutaneously implanted with a cylindrical, sterile Teflon tissue cage (32 × 10 mm; volume: 1.9 mL) with 130 regularly spaced holes (Angst+ Pfister AG, Zurich, Switzerland). After complete wound healing, the cage was tested for sterility. Prophylaxis began 12 hours before infection with either vehicle control or compound 13a (50 MPK, BID). Either methicillin-resistant Staphylococcus aureus (MRSA) ATCC 43300 (526 CFU / cage) or Candida albicans ATCC 5341 (2000 CFU / cage) was administered directly into the lumen of each cage. Treatment began immediately after infection, twice daily for 8 days. Tissue cage fluid was collected on days 1, 3, and 8 post-infection, and planktonic bacterial load was assessed by plating. On day 8, mice were sacrificed, and tissue cages from each mouse were explanted under aseptic conditions. The explanted tissue cages were washed twice with phosphate-buffered saline, then vortexed for 30 seconds, sonicated at 130 W for 3 minutes, and vortexed for an additional 30 seconds to release adherent bacteria from the biofilm. Quantification of adherent bacteria was performed by plating assigned dilutions. The sonicated cages were further incubated in pathogen-appropriate growth medium at 37°C for 48 hours to determine whether adherent bacteria regrowth occurred. Visualization of a positive culture was considered treatment failure.The results of this study are summarized in Figures 19A-19B.

[0521] Evaluation of the therapeutic activity of compounds in mycobacterial infection models: Murine macrophages (J774, from ATCC) were cultured with compound 11 (3 mg / mL and 5 mg / mL) in culture medium (DMEM containing 10% heat-inactivated FCS) for 4 days, refreshing the compound every 48 hours. Cells were then seeded onto 10-well slides and infected with GFP-expressing Mycobacterium bovis BCG at 0.02 OD at 37°C and 5% CO for 1 hour. Cells were subsequently washed three times to remove free bacteria and then chased in complete medium at 37°C and 5% CO for 3 hours. Cells were washed with PBS and fixed in cold methanol (-20°C) for 4 minutes. Then, cells were blocked (PBS containing 5% FCS) and stained with primary antibodies against coronin 1 (rabbit serum 1002) and LAMP-1 (rat, 1D4B), followed by Alexa-fluorescent goat anti-rabbit 633-conjugated and Alexa-fluorescent goat anti-rat 568-conjugated secondary antibodies. The images were then mounted with antifade reagent (Biorad). Slides were imaged using a confocal laser scanning microscope (LSM510Meta, Zeiss) and processed with the corresponding software. The results are shown in Figure 19C.

[0522] Evaluating the therapeutic activity of compounds in graft-versus-host disease (GvHD); Assessment of GvHD responses was performed as follows. Briefly, WT C57BL / 6 Ly5.1 (IA) mice were cultured using a Stem cell technologies kit (number 19851). b Total T cells were isolated from recipient BDF1 Ly5.2 (IA) mice by negative selection. The isolated cells were labeled with cell trace violet (Thermo Fisher). bd ) mice were intravenously injected with the antibody (approximately 14 × 10 6(cells) (day 0). Mice were then divided into groups receiving either vehicle or compound 13a (50MPK, BD, SC) for 7 consecutive days from day 1 to day 7. On day 7, spleens were harvested to analyze the proliferation of transferred T cells based on CTV dilution. Single cells were prepared, stained for CD3, CD4, CD8, Ly5.1, and viability markers, and subjected to flow cytometry analysis. The percentage of Ly5.1+ CTV-low cells (dividing cells) was extracted using FlowJo software (Figure 12B).

[0523] [Table 4-1]

[0524] [Table 4-2]

[0525] [Table 4-3]

[0526] [Table 4-4]

[0527] JPEG2025534417000114.jpg96170

[0528] [Table 5]

[0529] [Table 6-1]

[0530] [Table 6-2]

[0531] [Table 6-3]

[0532] [Table 6-4]

[0533] [Table 7-1]

[0534] [Table 7-2]

[0535] [Table 7-3]

[0536] [Table 7-4]

[0537] Characterization of the compounds identified in the screening assay, as well as in vitro and in vivo biological assays performed therewith, demonstrate that the compounds identified in the screening assay are immunosuppressive in nature and inhibit coronin 1 promoter activity.

[0538] Example 7 To identify targets of coronin 1-modulating compounds, we used thermal proteome profiling (TPP), a methodology based on the property that proteins change their thermal stability upon interaction with small molecules (Savitski, MM, et al., Science, 2014.346(6205):p.1255784). To this end, rat basophilic leukemia (RBL) cells were incubated with compound 12e, followed by gradient thermal denaturation (37°C / 41°C / 44°C / 47°C / 50°C / 53°C / 56°C / 59°C / 63°C / 67°C) and mass spectrometry assessment of proteins stabilized or destabilized upon interaction with the compound. This procedure identified the bromodomain-containing 3 (BRD3) protein as the top hit stabilized by the compound (Figure 13). Interestingly, this was the only member of the bromodomain and extra-terminal (BET) family of proteins to be stabilized. Currently, no compounds selectively target BRD3, and the effects of selective BRD3 inhibition by in vivo gene knockout or depletion in animal models have not been determined.

[0539] The BET family consists of four members (BDR2, BRD3, BRD4, and BRDT) characterized by the presence of two bromodomains, namely, bromodomain 1 (BD1) and bromodomain 2 (BD2), which recognize the acetylated N-terminal tails of histones and thereby act as readers of the lysine acetylation status of chromatin. Furthermore, by interacting with components of the transcriptional machinery and chromatin-remodeling enzymes (Taniguchi, Y., Int J Mol Sci, 2016.17(11)), they regulate diverse transcriptional processes, including cell cycle, organogenesis, oncogenic pathways, and inflammatory pathways. The bromodomains of the four BET family members are highly conserved and fold into a bromodomain module consisting of a bundle of four left-handed helices (aZ, aA, aB, aC) connected by loop regions (ZA and BC loops) that contribute to substrate specificity. These bromodomains are approximately 110 amino acids long (Fujisawa, T. and P. Filippakopoulos, Nat Rev Mol Cell Biol, 2017.18(4):pp.246-262). BRD2 and BRD4 are involved in cell cycle regulation, learning and memory, and inflammation (Korb, E., et al., Nat Neurosci, 2015.18(10):pp.1464-73; Belkina, AC, et al., J Immunol, 2013.190(7):pp.3670-8; LeRoy, et al., Mol Cell, 2008.30(1):pp.51-60). On the other hand, the function of BRD3 is less clear, and it has been suggested that it overlaps with BRD2 (Stonestrom, AJ, et al., Blood, 2015.125(18):pp.2825-34).

[0540] "BET inhibitors" refer to compounds that interact with these bromodomains BD1 and BD2 and inhibit their function. Compounds that nonselectively interact with these bromodomains by binding to both BD1 and BD2 have been identified, including the small molecule JQ1 (Filippakopoulos, P., et al., Nature, 2010. 468(7327): pp. 1067-73). However, such compounds have toxicity due to their nonselectivity and inhibition of all BET family members (Shorstova, T., et. Al. Br J Cancer, 2021. 124(9): pp. 1478-1490, Qi, J. and Y. Shi, Cancer Cell, 2020. 37(6): pp. 764-766). To minimize these problems, compounds that selectively bind to either BD1 of the entire BET family or BD2 of the BET family have been developed and characterized in recent years (Gilan, O., et al., Science, 2020.368(6489):pp.387-394, Faivre, EJ, et al., Nature, 2020.578(7794):pp.306-310). However, to the best of our knowledge, no compounds selectively targeting BRD3 have been reported in the literature. Interestingly, with our compound 12e, BRD3 was the only member of the BET family of proteins that was statistically significantly stabilized with a q-value of 0.0007. The TPP profiles of BRD2 and BRD4 showed insignificant changes. This observation is in stark contrast to the TPP data reported for other BET inhibitors (JQ1, IBET-BD1, IBET-BD2, RVX-208, IBET-151), which induce thermostabilization of BRD2, BRD3, and BRD4 proteins by binding to bromodomain BD1 and / or bromodomain BD2. Currently, no compounds selectively target BRD3, and the effects of selective BRD3 inhibition or depletion by in vivo gene knockout in animal models have not been demonstrated.

[0541] Following the initial data from TPP, to further confirm the compound's interaction with BRD3, we analyzed the affinity of compound 12e in the (4S,7R) configuration for the two bromodomains of BRD3 using an in vitro assay system called bromoscan (Eurofins). This revealed that compound 12e preferentially bound to BD2 (Kd ∼10 nM) and much weaker to BD1 (Kd ∼200 nM) (see Figure 15). In this assay, compound 13a (Short Oxanyl D2E1, also known as SOD2E1) showed approximately 40-fold selectivity for BD2 with even lower Kd values ​​of 4 nM for BD2 and 150 nM for BD1, demonstrating higher potency and greater selectivity for BD2 (Figure 15).

[0542] To assess the role of BRD3 in regulating coronin 1 expression, RBL cells expressing GFP under the control of the coronin 1 promoter were treated with brd3-targeting siRNA, which significantly downregulated coronin 1 promoter-driven GFP (Figure ​(Figure5A). 14A). Together, these data suggest that the compound binds to BRD3, thereby suppressing coronin 1 transcription.

[0543] To understand the mode of interaction between the compound and the BRD3 bromodomains, we co-crystallized compound 13a with its bromodomain BD1 and bromodomain BD2 and obtained crystal diffraction data. Electron density maps of BRD3 BD1 (Figure 16, left panel) and BRD3 BD2 (Figure 16, right panel) bound to compound 13a were analyzed at 1.4 Å and 2 Å resolution, respectively. The amino acids in the hydrophobic pocket of the ZA loop that interact with compound 13a were identified, thereby confirming the molecular mechanism of binding between the compound and the two bromodomains of BRD3.

[0544] These data support the molecular target of the compound being BRD3, through which coronin 1 expression in immune cells and immune responses are regulated. Having demonstrated the immunosuppressive potential of coronin 1 promoter inhibitors in the context of autoimmune-inflammatory diseases and alloimmune responses, the information provided herein highlights the potential for targeting BRD3 to regulate unwanted immune responses in the context of autoantigen- and alloantigen-mediated disorders, in addition to BRD3-driven diseases.

[0545] Materials and Methods Thermal proteome profiling: Thermal proteome profiling was performed as described (Savitski, MM, et al., Science, 2014.346(6205):p.1255784). Briefly, RBL cells (50 million cells / condition) were incubated with the carrier DMSO or compound 12e at concentrations of 6 μM, 3 μM, or 0 μM for 1 hour. At the end of the incubation period, the cells were washed in ice-cold PBS, counted, subjected to 3 minutes of heat denaturation (37°C / 41°C / 44°C / 47°C / 50°C / 53°C / 56°C / 59°C / 63°C / 67°C), lysed by freeze-thawing in liquid nitrogen, and the supernatant containing soluble proteins was separated by centrifugation at 100,000g for 30 minutes. Equal volumes of supernatant were collected, subjected to trypsin digestion, and labeled with 10plex-TMT (Thermo Fisher), and the labeled peptides were analyzed and quantified using mass spectrometry (Figure 13).

[0546] Bromoscan analysis of BRD3: Bromodomain-displaying T7 phage strains were propagated in Escherichia coli (E. coli) hosts derived from the BL21 strain in 24-well blocks. E. coli were grown to logarithmic phase and infected with frozen stocks of T7 phage (multiplicity of infection = 0.4) and incubated at 32°C with shaking until lysis (90–150 min). The lysate was centrifuged (5000 × g) and filtered (0.2 μm) to remove cellular debris. Streptavidin-coated magnetic beads were treated with biotinylated small molecule or acetylated peptide ligands for 30 min at room temperature to generate affinity resins for bromodomain assays. Ligand-bound beads were blocked with excess biotin and washed with blocking buffer (SeaBlock (Pierce), 1% BSA, 0.05% Tween 20, 1 mM DTT) to remove unbound ligand and reduce nonspecific phage binding. Binding reactions were assembled by combining bromodomains, ligand-binding affinity beads, and test compounds in 1x binding buffer (17% SeaBlock, 0.33x PBS, 0.04% Tween 20, 0.02% BSA, 0.004% sodium azide, 7.4mM DTT). Test compounds were prepared as 1000x stocks in 100% DMSO. Kd was determined using an 11-point, 3-fold compound dilution series with one DMSO control point. All compounds for Kd measurements were dispensed by acoustic transfer (non-contact dispensing) in 100% DMSO. Compounds were then diluted directly into the assay to a final DMSO concentration of 0.09%. All reactions were performed in a 384-well polypropylene plate. Each final volume was 0.02mL. The assay plate was incubated at room temperature with shaking for 1 hour, and the affinity beads were washed with wash buffer (1x PBS, 0.05% Tween 20). The beads were then resuspended in elution buffer (1x PBS, 0.05% Tween 20, 2 μM non-biotinylated affinity ligand) and incubated at room temperature with shaking for 30 minutes. The concentration of bromodomains in the eluate was measured by qPCR. Bromoscan analysis was performed at Eurofins (Figure 15).

[0547] siRNA analysis of BRD3: Accel siRNA (target-specific siRNA) against brd3 and control siRNA (non-targeting siRNA) were purchased from Dharmacon Horizon Discovery and prepared at 100 mM stock in the provided siRNA buffer. At the same time, 5,000 cells (WT RBL cells or GFP RBL cells) were seeded per well of a 48-well plate with 200 mL of Accell medium. From the prepared stock, siRNA was added to appropriately labeled wells at a final concentration of 1 μM. Plates were incubated at 37°C with 5% CO2 for 72 hours, at which point they were washed with FACS buffer (PBS containing 2% fetal bovine serum and 10 mM EDTA) and further incubated with live / dead markers (Thermofisher) in FACS buffer for 20 minutes on ice. Cells were washed again in FACS buffer and acquired using a flow cytometer (BD Fortessa). GFP fluorescence was analyzed using the FlowJo program (TreeStar). Repression of coronin 1 promoter activity was assessed as a measure of GFP reduction (Figure 14A).

[0548] The BRD3 gene is knocked into our RBL cells using the CRISPR / Cas9 approach: To generate a Brd3 knockout in RBL cells, a plasmid containing two gRNAs targeting the rat Brd3 gene was generated at VectorBuilder (Neu-Isenburg, Germany) using gRNA number 1 (TGGGATGCCAAGCCTTCCCG) (SEQ ID NO: 11) and gRNA number 6771 (AGGGCTTCGCTGCCGATATC) (SEQ ID NO: 12), targeting exon 2 and exon 7, respectively, followed by a protospacer adjacent motif (PAM) derived from Streptococcus pyogenes. RBL cells (2.5 × 10 cells) were transfected by electroporation at 1200 V, 20 ms, and two pulses in a 10 μL Neon Transfection System pipette using the Neon™ Transfection System (Invitrogen) according to the manufacturer's guidelines. 5 ) were transfected with 0.5 μg of the plasmid.

[0549] Transfected puromycin-resistant cells were selected, and single-cell clones were expanded in 96-well tissue culture plates and screened for BRD3 and coronin 1 expression by flow cytometry analysis of the median fluorescence intensity (MFI) of intracellularly stained cells (Fig. 14B).

[0550] Protein expression His6-BRD3 BD1 Plasmid and His6-BRD3 BD2Plasmids were kindly provided by Nicola Burgess-Brown (Addgene plasmid numbers 38940 and 38941). Plasmids were extracted from the delivered, transformed Mach1 cells according to the ZR Plasmid Miniprep Kit protocol (Zymo Research) and used to transform chemically competent Rosetta2(DE3) cells (Novagen). Rosetta2(DE3) colonies were grown at 37°C on agar plates prepared in lysogeny broth (LB; 10 g tryptone, 5 g yeast extract, 10 g NaCl) supplemented with 50 μg / mL kanamycin and 30 μg / mL chloramphenicol (LB-Kan-Cm). For protein expression, an appropriate volume of LB-Kan-Cm medium was inoculated with a 1% preculture of the transformed cells and incubated at 37°C. The grown culture was induced with 0.25 mM isopropyl 1-thio-β-D-galactopyranoside (IPTG) at an OD of 0.6-0.7. The incubation temperature was reduced to 28°C for overnight expression. Cells were harvested by centrifugation at 8,000 RCF for 10 minutes at 4°C.

[0551] Protein purification Purification was performed throughout at 4°C. Cell pellets were homogenized in lysis buffer containing immobilized metal affinity chromatography (IMAC) loading buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 10 mM imidazole, 5% glycerol, 0.5 mM TCEP) supplemented with 1 mM PMSF, 100 μg / mL lysozyme, 0.1% Triton X-100, and DNase. Mechanical lysis was performed using a microfluidizer set at 10,000 psi (approximately 680.5 atm). The lysate was centrifuged at 14,000 RCF for 1 hour to remove cell debris and suspended particles. The clear supernatant was applied to a 5 mL Ni-NTA column (Cytiva) pre-equilibrated with IMAC loading buffer. Bound proteins were eluted with a linear gradient of IMAC elution buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 500 mM imidazole, 5% glycerol, 0.5 mM TCEP) using an AKTA Pure system (Cytiva). Fractions containing the desired protein were pooled and mixed with 40 μg / mL TEV protease. The mixture was dialyzed overnight in dialysis buffer (50 mM HEPES, pH 7.5, 250 mM NaCl, 5% glycerol, 0.5 mM TCEP) using SnakeSkin dialysis tubing (Thermo Scientific) with a molecular weight cutoff of 3500 Da. The mixture was loaded onto a gravity-flow column packed with 2.5 mL of Ni Sepharose resin (Cytiva) pre-equilibrated with IMAC loading buffer. The cleaved protein was collected from the flow-through fraction and concentrated to a volume of 3 mL or less using an Amicon Ultra-15 centrifugal filter with a molecular weight cutoff of 3,000 Da. The concentrated sample was loaded onto a HiLoad 16 / 600 Superdex 200 pg gel filtration column (Cytiva) pre-equilibrated with SEC buffer (10 mM HEPES, pH 7.5, 200 mM NaCl, 5% glycerol). Fractions containing the desired protein were pooled and stored at -80°C.

[0552] Protein crystallization BRD3 solubilized in SEC buffer BD1 and BRD3 BD2 was co-crystallized with SOD2E1 using the sitting drop vapor diffusion method. A set of 3-drop MRC plates was prepared using a Gryphon robot (Art Robbins Instruments). BRD3 was co-crystallized in the presence of compound 13a dissolved in PEG 400 (molar ratio 1:1.5) in a mother liquor (Crystal Screen HT C12, Hampton Research) consisting of 0.1 M Tris, pH 8.5, and 8% w / v PEG 8,000. BD1 was crystallized at 20°C at an initial concentration of 11 mg / mL. BRD3 was crystallized in the presence of compound 13a dissolved in PEG 400 (molar ratio 1:1.5) in a mother liquor (Morpheus HT-96 H1, Molecular Dimensions) consisting of 0.1 M MES / imidazole, pH 6.5, 0.02 M of each amino acid, 10% w / v PEG 20,000, and 20% v / v PEG MME 550. BD2 was crystallized at an initial concentration of 17 mg / mL at 20° C. After 9.5 days of growth, the crystals were harvested and flash-frozen in LN2.

[0553] X-ray data collection and structure determination X-ray diffraction data were collected at the Swiss Light Source (SLS; Paul Scherrer Institute, Villigen, Switzerland). Data indexing, integration, scaling, and merging were performed using the XDS and CCP4i2 suites. BD1 and BRD3 BD2 The crystal structure of 13a was solved by molecular replacement in Phaser using existing structures (PDB codes 3S91 and 3S92) as initial search models. For both crystals, the structure, phase, and model were further improved through multiple cycles of refinement using REFMAC5 and manual modeling using Coot. A dictionary of the model and restraints for compound 13a was constructed using eLBOW. PyMOL version 2.4.2 (Schrodinger) was used to generate the diagram (Figure 16).

Claims

1. Formula (I): 【Chemical 1】 or pharmaceutically acceptable salts, stereoisomers, diastereoisomers, enantiomers, polymorphs, racemic mixtures, solvates or isomers and mixtures thereof, During the ceremony, R 1 is selected from phenyl and thienyl, and said phenyl is selected from -OH, -NO 2 , -halogen and -O-C 1 ~C 6 - optionally substituted with one or more optional substituents independently selected from alkyl; R 2 is selected from phenyl and thienyl, and said phenyl is selected from -OH, -NO 2 , -halogen and -O-C 1 ~C 6 - optionally substituted with one or more optional substituents independently selected from alkyl; R 3 But, -C 1 ~C 8 -alkyl, -(C 1 ~C 6 -alkylene)-S-C 1 ~C 6 -alkyl, -(C 1 ~C 6 -alkylene)-O-C 1 ~C 6 -alkyl, -(C 2 ~C 4 -alkylene-O) m -(C 1 ~C 6 -alkyl), wherein m is an integer of 1 to 10 (preferably 1 to 5, more preferably 2 to 3, and even more preferably 2), -C 1 ~C 6 -Alkylene-cycloalkyl, cycloalkyl, -C 1 ~C 6 -alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, 1 ~C 6 -cycloalkyl in alkylene-cycloalkyl, the -C 1 ~C 6 The oxygen-containing saturated heterocyclyl moiety in -alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl each have one or more C 1 ~C 6 - optionally substituted with alkyl, The compound or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof.

2. R 1 is selected from phenyl and thienyl, said phenyl having one or more —O—C 1 ~C 6 - optionally substituted with alkyl; R 2 is selected from phenyl and thienyl, and said phenyl is selected from -OH, -NO 2 and - optionally substituted with one or more optional substituents independently selected from halogen; and R 3 But, -C 1 ~C 6 -alkyl, -(C 1 ~C 6 -alkylene)-S-C 1 ~C 6 -alkyl, -(C 1 ~C 6 -alkylene)-O-C 1 ~C 6 -alkyl, -C 3 ~C 6 -cycloalkyl, -C 1 ~C 6 -alkylene-(oxygen-containing saturated heterocyclyl) and oxygen-containing saturated heterocyclyl, 1 ~C 6 The oxygen-containing saturated heterocyclyl moiety in -alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl each have one or more C 1 ~C 6 - optionally substituted with alkyl, The compound of claim 1.

3. R 1 3. The compound of claim 1 or 2, wherein is phenyl optionally substituted with methoxy.

4. R 1 The compound according to any one of claims 1 to 3, wherein is selected from 2-methoxyphenyl and phenyl.

5. R 2 But -OH, -NO 2 5. The compound of any one of claims 1 to 4, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from: and - halogen.

6. R 2 The compound according to any one of claims 1 to 5, wherein is 3-hydroxyphenyl.

7. R 3 But, -C 1 ~C 6 -alkylene-(oxygen-containing saturated heterocyclyl) or oxygen-containing saturated heterocyclyl, 1 ~C 6 The oxygen-containing saturated heterocyclyl moiety in -alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl each have one or more -C 1 ~C 6 The compound of any one of claims 1 to 6, optionally substituted with - alkyl.

8. R 3 But, -C 1 ~C 6 -alkylene-tetrahydro-2-furanyl, -C 1 ~C 6 -alkylene-tetrahydro-2H-pyran-4-yl, tetrahydrofuran-3-yltetrahydro-2H-pyran-4-yl, oxepan-4-yl and 8-oxabicyclo[3.2.1]octan-3-yl, wherein said -C 1 ~C 6 the tetrahydro-2-furanyl moiety in -alkylene-tetrahydro-2-furanyl, 1 ~C 6 The tetrahydro-2H-pyran-4-yl moiety in the -alkylene-tetrahydro-2H-pyran-4-yl, the tetrahydrofuran-3-yl, the tetrahydro-2H-pyran-4-yl, the oxepan-4-yl and the 8-oxabicyclo[3.2.1]octan-3-yl each have one or more -C 1 ~C 6 -alkyl, preferably -C 1 ~C 6 -alkylene-tetrahydro-2-furanyl, -C 1 ~C 6 -alkylene-tetrahydro-2H-pyran-4-yl and tetrahydro-2H-pyran-4-yl, wherein said -C 1 ~C 6 the tetrahydro-2-furanyl moiety in -alkylene-tetrahydro-2-furanyl, 1 ~C 6 The tetrahydro-2H-pyran-4-yl moiety in the -alkylene-tetrahydro-2H-pyran-4-yl and the tetrahydro-2H-pyran-4-yl each have one or more -C 1 ~C 6 8. The compound of claim 1, optionally substituted with - alkyl.

9. R 3 is selected from (tetrahydrofuran-2-yl)methyl, tetrahydrofuran-3-yl and tetrahydro-2H-pyran-4-yl, preferably R 3 The compound of any one of claims 1 to 7, wherein is tetrahydro-2H-pyran-4-yl.

10. Tetrahydro-2-furanylmethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1); Methyl-4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2); 2-(ethylthio)ethyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3); Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (4); Methyl-4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5); Tetrahydro-2-furanylmethyl-2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6); Tetrahydro-2-furanylmethyl-2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7); Methyl-4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8); Methyl-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9); Tetrahydro-2-furanylmethyl-4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10); Methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15); Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21); Methyl 7-(4-chlorophenyl)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (22); Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50); 4-methyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51); 2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (52); 8-oxabicyclo[3.2.1]octan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53); Oxepan-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54); Hexahydrofuro[2,3-b]furan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (55); Cyclopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (56); Cyclohexyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (57); Ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (58); Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (59); Neopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (60); 2-Ethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (61); 2,2-Dimethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (62); 4,4-dimethylpentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (63); 2-(2-ethoxyethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (64); 2-(2-(2-(hexyloxy)ethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (65); Tetrahydro-2H-pyran-4-yl 4-(4-fluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (66); and Tetrahydro-2H-pyran-4-yl 4-(2,4-difluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (67) 2. The compound of claim 1 selected from the group consisting of:

11. Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50); 4-methyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51); 8-oxabicyclo[3.2.1]octan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53) and Oxepan-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54) 2. The compound of claim 1 selected from the group consisting of:

12. Tetrahydro-2-furanylmethyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); and Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50) 2. The compound of claim 1 selected from the group consisting of:

13. The compound of formula (I) has the formula: 【Chemistry 2】 and having the absolute configuration of its stereogenic center as shown in In the formula, R 1 , R 2 and R 3 A compound according to any one of claims 1 to 12, wherein is as defined in any one of claims 1 to 12.

14. The compound has the formula: 【Chemistry 3】 having the absolute configuration of its stereogenic center as shown in R 1 is selected from phenyl and thienyl, and said phenyl is selected from -OH, -NO 2 , -halogen and -O-C 1 ~C 6 - optionally substituted with one or more optional substituents independently selected from alkyl; R 2 is selected from phenyl and thienyl, and the phenyl is selected from —OH, —NO 2 , -halogen and -O-C 1 ~C 6 - optionally substituted with one or more optional substituents independently selected from alkyl; and R 3 But, -C 1 ~C 6 -alkylene-(oxygen-containing saturated heterocyclyl) or oxygen-containing saturated heterocyclyl, 1 ~C 6 The oxygen-containing saturated heterocyclyl moiety in -alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl each have one or more -C 1 ~C 6 - optionally substituted with alkyl, The compound of claim 1.

15. The compound has the formula: 【Chemistry 4】 having the absolute configuration of its stereogenic center as shown in R 1 is selected from phenyl and thienyl, said phenyl having one or more —O—C 1 ~C 6 - optionally substituted with alkyl; R 2 is selected from phenyl and thienyl, and said phenyl is selected from -OH, -NO 2 and - optionally substituted with one or more optional substituents independently selected from halogen; and R 3 But, -C 1 ~C 6 -alkylene-(oxygen-containing saturated heterocyclyl) or oxygen-containing saturated heterocyclyl, 1 ~C 6 The oxygen-containing saturated heterocyclyl moiety in -alkylene-(oxygen-containing saturated heterocyclyl) and the oxygen-containing saturated heterocyclyl each have one or more -C 1 ~C 6 - optionally substituted with alkyl, The compound of claim 1.

16. The compound has the formula: 【Chemistry 5】 having the absolute configuration of its stereogenic center as shown in R 1 is selected from 2-methoxyphenyl and phenyl; R 2 is 3-hydroxyphenyl; and R 3 But, -C 1 ~C 8 -alkyl, -(C 1 ~C 6 -alkylene)-S-C 1 ~C 6 -alkyl, -(C 1 ~C 6 -alkylene)-O-C 1 ~C 6 -alkyl and -(C 2 ~C 4 -alkylene-O) m -(C 1 ~C 6 -alkyl), and m is an integer from 1 to 10, preferably from 1 to 5, more preferably from 2 to 3, and even more preferably 2; The compound of claim 1.

17. The compound is Methyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11c); 4-Methoxybutyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17a); tert-Butyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21a); ​​and 2-(2-ethoxyethoxy)ethyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (64a) 17. The compound of claim 16, selected from:

18. 18. A pharmaceutical composition comprising a compound according to any one of claims 1 to 17 or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, and a pharmaceutically acceptable carrier.

19. A compound according to any one of claims 1 to 17 or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, for use as a medicament, or a pharmaceutical composition according to claim 18.

20. 19. The compound according to any one of claims 1 to 17 or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, or the pharmaceutical composition according to claim 18, for use in inducing immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, an autoimmune disease, an inflammatory disease, an infectious disease and a lymphoproliferative disorder.

21. the autoimmune disease is selected from the group consisting of psoriasis, vitiligo, primary sclerosing cholangitis, multiple sclerosis, systemic lupus erythematosus, Hashimoto's thyroiditis, rheumatoid arthritis, myasthenia gravis, type I or II diabetes, disorders secondary to type I or II diabetes, vasculitis, pernicious anemia, Sjogren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis and allergic contact dermatitis; the transplant rejection is selected from the group consisting of acute or chronic rejection of cells, tissues, organs, allografts and xenografts, poor graft functional status, graft versus host disease; rejection of heart transplants, skin transplants, kidney transplants, liver transplants, pancreatic islet transplants, pancreas transplants, lung transplants, intestinal transplants, corneal transplants, blood vessel transplants, adrenal transplants, hair transplants, bone transplants, cartilage transplants and ligament transplants; the inflammatory disease is selected from the group consisting of inflammatory bowel disease, Crohn's disease, ulcerative colitis, intrinsic asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, prurigo nodularis, eosinophilic esophagitis, hidradenitis suppurativa, fibrotic disorders, cardiovascular diseases, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin manifestations of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome; the lymphoproliferative disorder is a T-cell lymphoma or a T-cell leukemia; the infection is selected from the group consisting of tuberculosis, preferably caused by mycobacteria, Salmonella spp. infections, Helicobacter spp. infections, retroviral infections, preferably HIV or HTLV, cytomegalovirus infections, Candida infections, Staphylococcus infections, lymphocytic choriomeningitis virus infections and viral hepatitis, 21. A compound for use or a pharmaceutical composition for use according to claim 20.

22. the disease or disorder is selected from the group consisting of infectious diseases and lymphoproliferative disorders; Preferably, the lymphoproliferative disorder is a T-cell lymphoma or a T-cell leukemia; Preferably, the infection is selected from the group consisting of tuberculosis caused by mycobacteria, Salmonella spp. infections, Helicobacter spp. infections, retroviral infections, preferably HIV or HTLV, cytomegalovirus infections, Candida infections, Staphylococcus infections, lymphocytic choriomeningitis virus infections and viral hepatitis, 22. A compound for use or a pharmaceutical composition for use according to claim 20 or 21.

23. A compound for use or a pharmaceutical composition for use according to any one of claims 20 to 22, wherein said compound of formula (I) inhibits coronin 1 expression.

24. A BRD3 selective bromodomain inhibitor for use in the treatment or prevention of diseases that may benefit from BRD3 inhibition directly, or indirectly via modulation of coronin 1 promoter activity or reduced expression of coronin 1.

25. 25. A BRD3 selective bromodomain inhibitor for use according to claim 24, wherein the disease that can benefit from BRD3 inhibition is suitable for therapeutic intervention by direct inhibition of BRD3 or via modulation of coronin 1 promoter activity or modulation of coronin 1 expression by BRD3 inhibition.

26. 26. A BRD3 selective bromodomain inhibitor for use according to claim 24 or 25, wherein the disease that can benefit from BRD3 inhibition is selected from transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders.

27. the transplant rejection is selected from the group consisting of acute or chronic rejection of cells, tissues, organs, allografts and xenografts, poor graft functional status, graft versus host disease; rejection of heart transplants, skin transplants, kidney transplants, liver transplants, pancreatic islet transplants, pancreas transplants, lung transplants, intestinal transplants, corneal transplants, blood vessel transplants, adrenal transplants, hair transplants, bone transplants, cartilage transplants and ligament transplants; the autoimmune disease is selected from the group consisting of psoriasis, vitiligo, primary sclerosing cholangitis, multiple sclerosis, systemic lupus erythematosus, Hashimoto's thyroiditis, rheumatoid arthritis, myasthenia gravis, type I or II diabetes, disorders secondary to type I or II diabetes, vasculitis, pernicious anemia, Sjogren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis and allergic contact dermatitis; the inflammatory disease is selected from the group consisting of inflammatory bowel disease, Crohn's disease, ulcerative colitis, intrinsic asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, prurigo nodularis, eosinophilic esophagitis, hidradenitis suppurativa, fibrotic disorders, cardiovascular diseases, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin manifestations of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome; the infection is selected from the group consisting of tuberculosis, preferably caused by mycobacteria, Salmonella spp. infections, Helicobacter spp. infections, retroviral infections, preferably HIV or HTLV, cytomegalovirus infections, candida infections, Staphylococcus infections, lymphocytic choriomeningitis virus infections and viral hepatitis, the lymphoproliferative disorder is a T-cell lymphoma or a T-cell leukemia; 27. A BRD3 selective bromodomain inhibitor for use according to claim 26.

28. 26. A BRD3 selective bromodomain inhibitor for use according to claim 24 or 25, wherein the disease that can benefit from BRD3 inhibition is a BRD3-driven malignancy such as NMC, OCCC, colorectal cancer or rhabdomyosarcoma, or metastasis thereof.

29. 29. The BRD3-selective bromodomain inhibitor for use according to any one of claims 24 to 28, wherein the BRD3-selective bromodomain inhibitor is a compound according to any one of claims 1 to 16 or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof.

30. A vector comprising a coronin 1 (coro1a) promoter element, wherein in a vertebrate genome, the coronin 1 promoter element begins immediately upstream of the transcription starting site (TSS) of the coronin 1 gene and spans a sequence region of at least about 700 bp within the genome.

31. 31. The vector of claim 30, further comprising a coronin 1 promoter reporter gene, wherein the coronin 1 promoter element is operably linked to the coronin 1 promoter reporter gene.

32. 32. A vector according to claim 30 or 31, wherein the coronin 1 promoter element spans at least about 700 bp to about 1500 bp of sequence within the genome, preferably wherein the coronin 1 promoter element spans a sequence region of at least about 700 bp within the genome.

33. 33. The vector of any one of claims 30 to 32, wherein the coronin 1 promoter element has at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, even more preferably at least 99% identity to the sequences of SEQ ID NOs: 1 to 6.

34. A cell comprising the vector according to any one of claims 30 to 33.

35. 1. A method for identifying a compound that modulates coronin 1 promoter activity, comprising: a. providing a host cell comprising the vector of any one of claims 30 to 33, wherein the host cell is capable of expressing the promoter reporter gene of the vector; b. exposing the host cells to a compound to be tested; c. measuring the expression of the coronin 1 promoter reporter gene in the host cells exposed to the test compound; A method comprising:

36. 14. A process for preparing a compound of formula (I) as defined in claim 13, comprising step (b) of asymmetric reduction of the pyridine motif by enantioselective partial transfer hydrogenation.

37. Compound XI by enantioselective partial transfer hydrogenation: and a step (b) of asymmetric reduction of the pyridine motif of 【Chemistry 6】 wherein R in compound XI 1 , R 2 and R 3 36. The method of claim 35, wherein is as defined in claim 1 for compounds of formula (I).