A biological method for the mass production of 164.88° triple helical collagen.

The Pichia yeast expression system facilitates large-scale production of recombinant human type III collagen with a 164.88° triple helix structure, solving issues of triple helix destruction and immunogenicity in animal-derived collagen, ensuring safety and efficacy.

JP2025534572AActive Publication Date: 2025-10-17SHANXI JINBO BIO PHARMACEUTICAL CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2025505593
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-09-28
Filing Date
2024-06-19
Publication Date
2025-10-17
Estimated Expiration
2044-06-19

AI Technical Summary

Technical Problem

Current methods for producing collagen with a natural triple helix structure face challenges such as destruction of the triple helix structure during extraction, heterogeneous molecular weights, poor processability, and potential immunogenicity due to animal-derived collagen, which are not meeting market demands for safety and efficacy.

Method used

The use of a Pichia yeast expression system to produce recombinant human type III collagen with a 164.88° triple helix structure, overcoming limitations of E. coli expression systems by improving the chassis strain for large-scale production without the need for endotoxin removal.

Benefits of technology

Enables mass production of recombinant humanized collagen with a stable triple helix structure, addressing safety and efficacy concerns, and meeting market demands for collagen-based biomaterials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025534572000005
    Figure 2025534572000005
  • Figure 2025534572000006
    Figure 2025534572000006
  • Figure 2025534572000007
    Figure 2025534572000007
Patent Text Reader

Abstract

The present invention provides a biological method for mass-producing collagen with a 164.88° triple helix structure. It also provides a method for constructing yeast cells that express collagen. The construction method includes the step of introducing a recombinant expression vector into yeast cells, where the recombinant expression vector contains a polynucleotide encoding collagen, and the collagen contains repeating units of the sequence shown in SEQ ID NO: 1, with the number of repeating units being 2 to 32, and the repeating units being directly linked. The collagen is recombinant type III humanized collagen, preferably collagen with a 164.88° triple helix structure. By improving a "chassis strain," the present invention enables mass production of recombinant humanized collagen with a 164.88° triple helix structure belonging to type A, which can meet market demand through mass production.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] cross reference This application claims priority to a Chinese patent application filed on September 28, 2023, with application number 202311272338.8, and titled "Biological method for mass-producing collagen with a 164.88° triple helix structure."

[0002] The present invention relates to the realization of a method for mass production of collagen having a 164.88° triple helix structure using biological fermentation, and belongs to the technical field of synthetic biology. [Background technology]

[0003] There are 28 types of collagen in humans, and collagen is the most abundant protein in humans and animals, accounting for 25-30% of the total body protein and approximately 6% of body weight. Collagen is an important structural protein found in skin, bones, teeth, cornea, tendons, ligaments, and various tissues and organs, supporting and protecting human tissues. Collagen is the main component of the extracellular matrix, and its biological activities are primarily expressed in promoting cell adhesion, growth and differentiation, cell signaling pathway responses, platelet aggregation, maintenance of cell and tissue / organ function, and injury repair. Collagen has a spatial structure that intertwines in a triple helix, with three independent collagen α-peptide chains intertwined by hydrogen bonds to form the helical structure. Collagen binds to tissues and cells in the body via its triple helix structure, exerting its biological effects; therefore, the biological activity of collagen is largely dependent on its natural triple helix structure. Due to its excellent biological activity, collagen has great application value and potential in fields such as biomedical materials, medicine, beauty, and cosmetics.

[0004] Currently, most collagen products on the market are extracted from animal tissues. However, this method destroys the natural triple helix structure during the extraction process, affecting the biological activity of collagen. Furthermore, collagen obtained through extraction processes using animal sources has heterogeneous molecular weights of peptide fragments and poor processability. Because animal collagen and human collagen have different amino acid sequences, they may cause potential immunogenicity in clinical settings, resulting in low safety. Furthermore, animal tissues are affected by their source, and potential safety issues such as animal viruses must be resolved before they can enter the market. As market demands for the safety and efficacy of collagen products increase, traditional methods of extracting collagen from animal tissues are no longer able to meet current market demand. Furthermore, the demand for collagen-based biomaterials in medical applications is also increasing, necessitating the need for alternative solutions to current market problems. Producing recombinant collagen with a natural triple helix structure using molecular biology techniques such as genetic engineering offers great promise for resolving the above-mentioned issues.

[0005] There are recombinant type III collagen products on the market, but achieving the triple helix structure is difficult, and using synthetic biology to ferment collagen with the correct triple helix structure poses significant technical hurdles.

[0006] There is a need in the art for methods that utilize synthetic biology to ferment collagen with the correct triple helix structure. Summary of the Invention

[0007] The inventors discovered human type III collagen, and structural studies confirmed that the core functional region of human type III collagen has a 164.88° triple helix structure (CN109593126A). The inventors successfully produced recombinant humanized type III collagen using an E. coli expression system through genetic engineering. However, the inventors discovered that the E. coli expression system has drawbacks, such as limited protein expression, limiting process scale-up. Therefore, the inventors attempted to express human type III collagen using a eukaryotic expression system. After extensive preliminary screening, the inventors discovered that expressing human type III collagen in Pichia yeast enabled the in vitro synthesis of large amounts of collagen with a 164.88° triple helix structure. Furthermore, the inventors discovered in a previous patent application that the presence of bacterial endotoxins in human type III collagen expressed in E. coli increased the complexity and difficulty of collagen purification. The inventors resolved this technical problem by expressing collagen in a yeast expression system.

[0008] By improving the "chassis strain," the present invention has made it possible to mass-produce recombinant humanized collagen belonging to type A and having a 164.88° triple helix structure, which can meet market demand through mass production.

[0009] In one aspect, a method for constructing a yeast cell that expresses collagen is provided, the method comprising the step of introducing a recombinant expression vector into the yeast cell, wherein the recombinant expression vector comprises a polynucleotide encoding a collagen, and the collagen is expressed by the yeast cell, the collagen comprising repeat units of the sequence set forth in SEQ ID NO: 1, the number of repeat units being 2 to 32, and the repeat units being directly linked. In one embodiment, the collagen is recombinant type III humanized collagen. In one embodiment, the collagen is collagen with a 164.88° triple helix structure.

[0010] In one embodiment, the collagen comprises the amino acid sequence set forth in SEQ ID NO: 2 or 3. In one embodiment, the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 4 or 5. The polynucleotides of the invention are capable of effectively expressing collagen in yeast host cells.

[0011] In one embodiment, the recombinant expression vector is a yeast expression vector, hi one embodiment, the yeast expression vector is a pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vector.

[0012] In one embodiment, the yeast is Pichia pastoris. In one embodiment, the Pichia pastoris is Pichia pastoris strain X33, GS115, SMD1168, KM71, or KM71H.

[0013] In one embodiment, the method of construction comprises: (1) inserting the polynucleotide into an expression vector, preferably between the NotI and XhoI enzyme sites of the pPiczalαA expression vector, to obtain a recombinant expression plasmid; (2) performing an enzymatic digestion of the recombinant expression plasmid, preferably with sac1; (3) purifying the recombinant expression plasmid after enzymatic cleavage; (4) introducing the enzymatically cleaved recombinant expression plasmid into yeast cells by electroporation.

[0014] In another aspect, there is provided a yeast cell expressing a collagen, wherein the collagen comprises repeating units of the sequence shown in SEQ ID NO: 1, the number of repeating units is 2 to 32, the repeating units are directly linked, and the yeast cell is Pichia pastoris.

[0015] In one embodiment, the Pichia pastoris is Pichia pastoris strain X33, GS115, SMD1168, KM71, or KM71H. In one embodiment, the collagen comprises the amino acid sequence set forth in SEQ ID NO: 2 or 3. In one embodiment, the collagen is recombinant humanized type III collagen. In one embodiment, the collagen is a 164.88° triple helix collagen.

[0016] In one embodiment, the yeast cell comprises a yeast expression vector. In one embodiment, the yeast expression vector is a pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vector. In one embodiment, the expression vector comprises a polynucleotide, wherein the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 2 or 3.

[0017] In another aspect, there is provided the use of the yeast cells described herein in the production of collagen.

[0018] In one embodiment, the collagen comprises repeating units of the sequence shown in SEQ ID NO: 1, the number of repeating units is 2 to 32, and the repeating units are directly linked. In one embodiment, the collagen comprises the amino acid sequence shown in SEQ ID NO: 2 or 3. In one embodiment, the collagen is recombinant humanized type III collagen. In one embodiment, the collagen is collagen with a 164.88° triple helix structure.

[0019] In another aspect, there is provided a method for producing collagen by fermentation, comprising culturing a yeast cell described herein under suitable conditions, adding methanol to the yeast cell to induce expression, and collecting the culture supernatant to obtain collagen.

[0020] In one embodiment, the medium is BMMY medium supplemented with amino acid-free yeast nitrogen base and biotin.

[0021] In one embodiment, the collagen comprises repeat units of the sequence shown in SEQ ID NO: 1, the number of repeat units is 2 to 32, and the repeat units are directly linked. In one embodiment, the collagen comprises the amino acid sequence shown in SEQ ID NO: 2 or 3. In one embodiment, the collagen is recombinant humanized type III collagen, preferably collagen with a 164.88° triple helix structure.

[0022] Advantages of the present invention include the following:

[0023] 1. The inventors have discovered yeast cells suitable for expressing recombinant humanized collagen type III, as well as methods for constructing and producing the same.

[0024] 2. The yeast cell of the present invention is Pichia pastoris, which has the advantages of higher expression levels and scalability compared to prokaryotic expression systems such as E. coli.

[0025] 3. The method of the present invention enables collagen with a 164.88° triple helix structure to be synthesized in vitro and mass-produced in tons, which is of great industrial significance.

[0026] 4. The present invention does not require a step to remove cellular endotoxins. [Brief explanation of the drawings]

[0027] [Figure 1] Electrophoresis diagram of the induction of high molecular weight P-012 expression. [Figure 2] Electrophoresis diagram of the induction of expression of medium molecular weight P-C3T8 is shown. [Figure 3] 1 shows the cell adhesion activity of high molecular weight P-012. [Figure 4] 1 shows the cell adhesion activity of medium molecular weight P-C3T8. [Figure 5] The results of the circular dichroism spectrum of the high molecular weight P-012 are shown. [Figure 6] 1 shows the results of circular dichroism spectra of medium molecular weight P-C3T8. DETAILED DESCRIPTION OF THE INVENTION

[0028] In order to clarify the purpose, technical means and advantages of the present invention, the following will clearly and completely describe the technical means in the embodiments of the present invention with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only some of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, any other embodiments that can be obtained by those skilled in the art without any creative efforts will fall within the scope of protection of the present invention.

[0029] As used herein, recombinant collagen refers to a novel biomaterial with an amino acid sequence identical or similar to that of human collagen, which is produced by screening using advanced structural biology, genetic engineering, and other technologies, using the genetic code of the functional region of a specific type of human collagen as a template.

[0030] As used herein, "human recombinant type III collagen" refers to a recombinant protein consisting of or consisting essentially of a sequence derived from human type III collagen. As used herein, human recombinant type III collagen consists of or consists essentially of a fragment or multiple repeats of a fragment derived from human type III collagen. As used herein, "yeast" includes ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts, and yeasts belonging to the Fungi Imperfecti (Blastomycetes).

[0031] As used herein, a yeast host cell refers to any yeast host cell that is readily transformed, transfected, transduced, etc. with a nucleic acid construct or recombinant expression vector comprising a polynucleotide of the invention. The yeast host cell may be a cell of the genera Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces or Yarrowia, such as Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces crivelii, The yeast cell is preferably a Pichia pastoris cell, more preferably a Pichia pastoris strain X33, GS115, SMD1168, KM71, or KM71H strain.

[0032] As used herein, the term "expression" includes all steps involved in producing a polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0033] As used herein, the term "expression vector" refers to a linear or circular DNA molecule that contains a polynucleotide encoding a polypeptide and is operably linked to a control sequence that provides for its expression. In this specification, the expression vector is a yeast expression vector, preferably a pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vector.

[0034] As used herein, the term "recombinant expression vector" refers to a single- or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene or that is modified to contain a segment of nucleic acid in a manner that is not naturally occurring, or that is synthetic, and that includes one or more regulatory sequences.

[0035] As used herein, the term "control sequence" refers to a nucleic acid sequence necessary for expression of a polynucleotide encoding a mature polypeptide of the present invention. Each control sequence may be native (i.e., derived from the same gene) or foreign (i.e., derived from different genes) to the polynucleotide encoding the polypeptide, or native or foreign to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. Control sequences include at least a promoter and transcription and translation termination signals. These control sequences may be provided with multiple linkers for the purpose of introducing specific restriction sites that facilitate ligation of the control sequences with the coding region of the polynucleotide encoding the polypeptide.

[0036] collagen The present invention provides collagen. The collagen may contain repeat units of the sequence shown in SEQ ID NO: 1 or a sequence having 80 to 100% sequence identity thereto (e.g., 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). The number of repeat units is 2 to 32, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32. Each repeat unit may be directly linked. The collagen is recombinant type III humanized collagen, preferably a collagen with a 164.88° triple helix structure. The collagen may comprise the amino acid sequence set forth in SEQ ID NO: 2 or 3, or an amino acid sequence having 80 to 100% sequence identity thereto (e.g., 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%). The collagen described herein may have a triple helix structure or three identical chains (i.e., a trimer form). The sequence of each chain may be a sequence described herein.

[0037] Recombinant Expression Vectors The present invention also relates to recombinant expression vectors comprising a nucleic acid of the present invention operably linked to one or more control sequences that direct expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. The vector may comprise a recombinant expression vector. The nucleic acid of the present invention may comprise the nucleotide sequence set forth in SEQ ID NO: 4 or 5.

[0038] Nucleic acids can be manipulated in a variety of ways to provide for expression of collagen. Depending on the expression vector, it may be desirable or necessary to manipulate the nucleic acid prior to its insertion into the vector. Techniques for modifying nucleic acids using recombinant DNA methods are well known in the art.

[0039] The control sequence may be a promoter, which is a polynucleotide recognized by a host cell for expression of a polynucleotide encoding a collagen or polypeptide of the present invention. The promoter comprises a transcriptional control sequence that mediates expression of the collagen or polypeptide. The promoter may be any nucleic acid that exhibits transcriptional activity in the host cell, including mutant, truncated, and hybrid promoters, and may be derived from genes encoding extracellular or intracellular collagen or polypeptides, either homologous or heterologous to the host cell.

[0040] Examples of suitable promoters for directing transcription of the vectors or recombinant expression vectors of the present invention in yeast host cells include, but are not limited to, promoters useful in yeast hosts derived from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2 / GAP), Saccharomyces cerevisiae triosephosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase.

[0041] The control sequence may be a transcription terminator recognized by the host cell to terminate transcription. The terminator is operably linked to the 3' end of the polynucleotide encoding the collagen or polypeptide. Any terminator that functions in the host cell may be used in the present invention. Preferred terminators in yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. The control sequence may also be an mRNA stabilizing region downstream of the promoter and upstream of the coding sequence of the gene, which increases expression of the gene.

[0042] Examples of suitable mRNA stabilization regions are obtained from the Bacillus thuringiensis cryIIIA gene (WO 94 / 25612) and the Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177:3465-3471).

[0043] The control sequence may also be a leader sequence, a nontranslated region of an mRNA that is important for translation in the host cell. The leader sequence is operably linked to the 5' end of the polynucleotide encoding the collagen or polypeptide. Any leader sequence that functions in the host cell may be used. Suitable leader sequences in yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae α-factor, and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP).

[0044] The control sequence may be a polyadenylation sequence, which is operably linked to the 3' end of a polynucleotide and is recognized by a host cell as a signal for the addition of polyadenosine residues to the transcribed mRNA during transcription. Any polyadenylation sequence that functions in the host cell may be used. Useful polyadenylation sequences for yeast host cells are described in Guo and Sherman, 1995, Mol. Cellular Biol. 15:5983-5990.

[0045] The control sequence may be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of collagen, directing the collagen into the cell's secretory pathway. The 5'-end of the coding sequence of the polynucleotide may inherently contain the signal peptide coding sequence originally linked in translation reading frame with the segment of coding sequence encoding collagen. Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding sequence foreign to the coding sequence. A foreign signal peptide coding sequence may be required when the coding sequence does not originally contain a signal peptide coding sequence. Alternatively, the foreign signal peptide coding sequence may simply replace the native signal peptide coding sequence to enhance collagen or polypeptide secretion. However, any signal peptide coding sequence that directs expressed collagen into the host cell's secretory pathway may be used. Useful signal peptides for yeast host cells are obtained from the Saccharomyces cerevisiae α-factor and Saccharomyces cerevisiae invertase genes. Yeast cells may be used to produce the collagen herein.

[0046] host cell The present invention also relates to recombinant host cells comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the production of a collagen of the present invention. By introducing a construct comprising the polynucleotide into a host cell, the construct is maintained as a chromosomal integrant or as a self-replicating extrachromosomal vector. The term "host cell" encompasses progeny of a parent cell that are not identical to the parent cell due to mutations that occur during replication. The choice of host cell will largely depend on the gene encoding the collagen or polypeptide and its source.

[0047] As used herein, the host cell may be a yeast cell, including ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts, and yeasts belonging to the Fungi Imperfecti (Blastomycetes). The yeast host cell may be a cell of the genera Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces or Yarrowia, such as Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces crivelii, The yeast cell may be a Pichia pastoris, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell. In particular, the inventors have discovered that Pichia pastoris is suitable for producing the collagen described herein. The yeast cell is capable of expressing the collagen described herein. Preferably, the collagen is recombinant type III humanized collagen, preferably a collagen with a 164.88° triple helix structure. The yeast cell is Pichia pastoris, preferably a Pichia pastoris strain X33, GS115, SMD1168, KM71, or KM71H. The yeast cell may contain a yeast-based expression vector, preferably a pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vector.The expression vector may comprise a polynucleotide, wherein the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:4 or SEQ ID NO:5.

[0048] How to build it The present invention provides a method for constructing a yeast cell that expresses collagen, the method comprising the step of introducing a recombinant expression vector into a yeast cell, the recombinant expression vector comprising a polynucleotide encoding the collagen of the present invention. The recombinant expression vector may comprise a polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO: 4 or 5. The recombinant expression vector may be a yeast-based expression vector, preferably pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P. The yeast may be Pichia pastoris, preferably Pichia pastoris strain X33, GS115, SMD1168, KM71, or KM71H.

[0049] The construction method comprises: (1) inserting the polynucleotide into an expression vector, preferably between the NotI and XhoI enzyme sites of the pPiczalαA expression vector, to obtain a recombinant expression plasmid; (2) performing an enzymatic digestion of the recombinant expression plasmid, preferably with sac1; (3) purifying the recombinant expression plasmid after enzymatic cleavage; (4) introducing the enzymatically cleaved recombinant expression plasmid into yeast cells by electroporation.

[0050] Fermentation method The present specification provides a method for fermentatively producing collagen. The method may include culturing the yeast cells described herein under appropriate conditions, adding methanol to the yeast cells to induce expression, and collecting the culture supernatant to obtain collagen. The conditions and medium for culturing yeast cells are known to those skilled in the art and are not particularly limited. For example, the medium may be BMMY medium supplemented with amino acid-free yeast nitrogen base and biotin.

[0051] The fermentation method may include: (1) a step of culturing a basal culture solution of yeast cells described in the present specification; (2) a fermentation culture step of inoculating the basal culture solution into a fermentation medium, culturing the yeast cells in a fermenter, and inducing expression by feeding methanol at an appropriate growth stage; and (3) a fermentation supernatant preparation step of terminating the culture at an appropriate time, obtaining a fermentation solution, removing the bacterial cells, and filtering the fermentation solution to obtain a fermentation supernatant.

[0052] The fermentation method may further include a step of purifying the collagen. The purification step is known to those skilled in the art and is not particularly limited. For example, the purification method may use the purification step described in CN109593126A.

[0053] The present invention is further described below by way of examples. It should be understood that the scope of the present invention is to be determined by the appended claims, and the examples should not be construed as limiting the scope of the present invention.

[0054] Example The present invention will be further described by the following examples, but any of the examples or combinations thereof should not be understood to limit the scope or embodiments of the present invention. The scope of the present invention is limited by the appended claims, and those skilled in the art can clearly understand the scope limited by the claims by combining this specification and general knowledge in the art. Without departing from the spirit and scope of the present invention, those skilled in the art can make any modifications or changes to the technical means of the present invention, and these modifications and changes are also included in the scope of the present invention.

[0055] General methods for PCR, cloning, ligation, etc. of nucleotides are well known to those skilled in the art and can be found, for example, in "Molecular cloning: A laboratory manual", Sambrook et al. (1989), Cold Spring Harbor lab., Cold Spring Harbor, NY, Ausubl, FM et al. (eds.); "Current protocols in Molecular Biology", John Wiley and Sons (1995), Harwood, CR and Cutting, SM et al. (eds.); "DNA Cloning: A Practical Approach, Volumes I and II", DN Glover (ed.) (1985); "Oligonucleotide Synthesis", MJ Gait (ed.) (1984); "Nucleic Acid Hybridization", BD Hames & SJ Higgins (eds.) (1985); "A Practical Guide To Molecular The method can be found in "A Practical Guide to Molecular Cloning," B. Perbal (1984).

[0056] Example 1: Construction, expression, and screening of protein fragments 1) Amino acid sequence of high molecular weight recombinant humanized type III collagen: gergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergap gfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpa gpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergap (SEQ ID NO: 2, the repeating unit is gergapgfrgpagpngipgekgpagergap, SEQ ID NO: 1).

[0057] Nucleotide sequence of high molecular weight recombinant humanized collagen type III: aggtgaaagaggtgcc ccaggtttta gaggtccagc aggtccaaat ggtattccag gagagaaagg tccagcagga gaagaggtg cccccggtga gagaggtgct cccggattca gaggtcctgc cggtccaaat ggtattcccg gtgaaaaggg acctgcagga gagagaggtg ccccaggaga gagaggagca ccaggattca gaggtccagc tggtccaaat ggtatccctg gagagaaggg acccgctgga gaagaggtg cccctggaga aagaggtgcc cccggtttta gaggacctgc tggacccaac ggaatcccag gagagaaggg tcccgcaggt gagagaggtg ctcctggaga gagaggagca cctggattca gaggacctgc aggacccaac ggaatacctg gtgaaaaagg tcctgccggt gaagaggtg ctccaggtga aagaggagca ccaggtttta gaggaccagc tggtcctaac ggtatccctg gtgaaaaagg acccgctggt gaagaggag ccccaggtga gagaggtgct cccggtttta gaggtccagc aggtccaaac ggaatacccg gtgaaaaagg acctgctgga gagagaggtg ctcctggaga aagaggtgct cctggtttca gaggtccagc aggacccaat ggaatcccag gagaaaagg acctgcaggt gaagaggag cccctggtga aagaggagca cctggtttta gaggaccagc aggtcctaat ggtattccag gagagaaggg acccgccgga gaagaggag cacccggtga aagaggagca ccaggtttca gaggaccagc tggaccaaac ggtattccg gtgaaaaagg accagctgga gagagaggtg caccaggagaaagaggtgct cccggtttca gaggtccagc cggaccaaat ggtatacctg gagaaaaggg tccagcagga gaaagaggtg cacccggtga aagaggtgca ccaggtttta gaggtcccgc cggtccaaat ggaatccctg gtgaaaaggg acccgctggt gaaagaggtg ctccaggaga gagaggagcc cccggtttta gaggtcccgc tggtccaaat ggaatacctg gagagaaggg tcctgctggt gagagaggtg cacctggaga gagaggtgcc ccaggtttca gaggacctgc cggtcccaat ggaatacccg gagaaaaagg tcccgcagga gagagaggtg ccccaggtga aagaggtgca cccggtttca gaggacccgc cggtcctaat ggtatacctg gagaaaaagg accagccggt gagagaggtg ctcccggaga gagaggagcc cctggtttca gaggtccagc aggaccaaac ggtattccag gagaaaaggg accagcagga gagagaggag ccccatg (SEQ ID NO: 4).

[0058] 2) Amino acid sequence of medium molecular weight recombinant humanized type III collagen: Gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergap (SEQ ID NO: 3).

[0059] Nucleotide sequence of recombinant medium molecular weight humanized collagen type III: (SEQ ID NO: 5).

[0060] The coding nucleotide sequence was commercially synthesized and inserted between the NotI and XhoI enzyme cleavage sites of the pPiczalαA expression vector, with the target gene following the signal cleavage site, to obtain recombinant expression plasmids P-012 (high molecular weight) and P-C3T8 (medium molecular weight).

[0061] Example 2: Yeast improvement of recombinant type III humanized collagen 1. Enzymatic cleavage of the plasmid 20-40 μg of each of the constructed expression plasmids P-012 and P-C3T8 is enzymatically digested with sac1 at the enzyme cleavage rate of the restriction enzyme for 2-3 hours at 37°C. After enzymatic digestion, nucleic acid gel electrophoresis is performed to detect the plasmid before and after enzymatic digestion, and it is confirmed whether all of the plasmid is enzymatically digested and whether the band position after enzymatic digestion is larger than that before enzymatic digestion.

[0062] 2. Plasmid purification After enzymatic digestion, the plasmid is purified using a plasmid purification kit to remove impurities such as ions, dissolved in 20-25 μl of sterile pure water, the plasmid concentration is detected, and the plasmid is left at 4°C for use.

[0063] 3. Improvement of yeast fungi For yeast competent cells (X33), perform the following operations in a biological safety cabinet.

[0064] a) Disinfect a 0.2 cm electroporation cup by immersing it in 75% alcohol for 10 minutes, then wash it three times with sterile water and dry it. b, Place the electroporation cup in an ice bath for 20 minutes, then turn on the electroporator. c. Add 80 μl of competent cells and 5-15 μg of enzyme-cleaved plasmid to a 1.5 ml sterile EP tube, and mix thoroughly with a pipette. d. Transfer 100 μl of the mixture into an electroporation cup, place it in an ice bath for 5 minutes, wipe the outside of the electroporation cup, transfer the electroporation cup into the electroporator tank, press the start button, and perform electroporation. e. After electroporation, 1 ml of 1 M sterile sorbitol solution was added to the electroporation cup, which was then sealed with a sealing film and incubated at 30°C for 2 hours. f. Transfer the mixture in the electroporation cup to a 10 ml sterile EP tube, then add 1 ml of YPD liquid medium (yeast peptone 0.2 g / L, yeast extract powder 0.1 g / L) to the EP tube and culture at 30°C, 300 rpm for 1 hour.

[0065] g. Plating: In a biological safety cabinet, take 200 μl of the transformed and incubated bacterial solution and place it on plates No. 1 to No. 3, and use plate No. 4 as a control. Use a sterile conical rod to evenly spread the solution on the plate, then culture the plate at 30°C for about 2 to 5 days.

[0066] h. Strain culture: Plate culture until plaques form, add 10 ml of anhydrous glucose solution to 40 ml of YPD liquid medium, wait for the medium to cool to room temperature, dispense 50 ml of medium into ten 50 ml bioreactor tubes at 5 ml per tube, add 2000 mg / L bleomycin solution accordingly, select 10 monoclonals from the plate, inoculate each into 10 small tubes, and culture overnight at 30°C and 300 rpm. Prepare 200 ml of BMGY medium. After sterilization, add 20 ml of 10x YNB stock solution and 20 μl of 500x biotin stock solution to a shaker flask and mix evenly. Dispense 200 ml of medium into ten 50 ml centrifuge tubes at 20 ml per tube. Then, inoculate 4 ml of the cultured bacterial solution into each of ten 20 ml centrifuge tubes and culture overnight until the OD value of the bacterial solution reaches 3 to 10.

[0067] i. Expression induction: Prepare 500 ml of BMMY medium. After sterilization, add 50 ml of 10x YNB stock solution and 500 μl of 500x biotin stock solution to a shake flask and mix evenly. Dispense 500 ml of medium into 10 250 ml shake flasks at 50 ml per tube. Centrifuge the cultured bacterial solution at 1500 rpm for 10 minutes, discard the supernatant, and precipitate and suspend the bacterial cells in the 10 centrifuge tubes in the medium in each of the 10 shake flasks. Transfer the suspension to each shake flask. The cells were cultured in shake flasks at 30°C and 300 rpm. Every 24 hours, 1 ml of sample was taken from 10 shake flasks, placed in 1.5 ml EP tubes, and stored at -20°C. 1% methanol was added to the shake flasks (filtered through a 0.22 μm filter) to induce expression. On the fifth day, the samples in the 1.5 ml EP tubes were centrifuged at 12,000 rpm for 5 minutes, and the supernatant was taken and subjected to electrophoresis detection to observe the expression status of each of the 10 clones.

[0068] 4. Electrophoretic detection The specific procedure is as follows: 40 μl of sample solution is taken, 10 μl of 5x protein loading buffer (250 mM Tris-HCl (pH 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol) is added, and the mixture is boiled in 100°C water for 10 minutes. After that, 10 μl of SDS-PAGE protein gel is added to each well and electrophoresed at 80V for 2 hours. The mixture is then stained with Coomassie Brilliant Blue staining solution (0.1% Coomassie Brilliant Blue R-250, 25% isopropanol, 10% glacial acetic acid) for 20 minutes, and then destained with protein destaining solution (10% acetic acid, 5% ethanol). The electrophoretic detection results are shown in Figures 1 and 2. The P-012 target protein has a theoretical molecular weight of 44.75 KD and an apparent molecular weight of 50 KD, while the P-C3T8 target protein has a theoretical molecular weight of 22.39 KD and an apparent molecular weight of 28 KD. The electrophoretic detection results demonstrate that the yeast strains were successfully improved.

[0069] Example 3: Mass spectrometric detection of recombinant humanized collagen type III 1. Laboratory equipment: 1) High-resolution mass spectrometer: XevoG2-XS QTof (Waters) 2) Ultra-high performance liquid chromatography: UPLC (Acquity UPLC I-Class) (Waters) 2. Materials and Reagents 1) Guanidine HCl (Sigma) 2) Urea (Bio-Rad) 3) Tris base (Bio-Rad) 4) DTT (Bio-Rad) 5) IAM (Sigma) 6) Zeba Spin Column (Pierce) 7) ACQUITY UPLC Peptide BEH C18 Column, 300 Å, 1.7 μm, 2.1 mm x 150 mm (Waters) 8) UNIFI (Waters) 9) Trypsin (Promega) 10) Chymotrypsin (Sigma) 11) Glu-C (Wako) 12) LysC (Wako) 3. Experimental method: 1) Enzymatic digestion with trypsin, chymotrypsin, and Glu-C: An appropriate amount of the test substance is taken and appropriately pretreated, and then trypsin, chymotrypsin, and Glu-C are added and the substance is digested at 37°C for 20 hours.

[0070] 2) High-performance liquid chromatography: After enzymatic hydrolysis, the test substance is separated using an ultra-high-performance liquid chromatography system, Acquity UPLC I-Class. Liquid phase A is a 0.1% FA aqueous solution, and liquid phase B is a 0.1% FA acetonitrile solution. The test substance is loaded onto the column using an autosampler and separated by the chromatography column. The column temperature is 55°C, the flow rate is 300 μl / min, and the wavelength of the TUV detector is 214 nm. The relevant liquid phase gradient is as follows: [Table 1]

[0071] 3) Mass spectrometry identification: The test substance was desalted and separated by ultra-high performance liquid chromatography, and analyzed by mass spectrometry detection using a XevoG2-XS QTof mass spectrometer (Waters). Analysis time: 63 minutes, detection method: positive ion, MS, scan range (m / z): 300-2000.

[0072] 4) Mass spectrometry data processing: Database queries were originally performed using UNIFI (1.8.2, Waters) software, with the following main parameters (Table 1): [Table 2]

[0073] 4. Experimental results and analysis The test substance is subjected to in-solution enzymatic digestion using trypsin, chymotrypsin, and Glu to obtain peptide fragment samples, which are then analyzed using an LC-MS / MS system. Database queries are then performed on the obtained raw data using UNIFI software.

[0074] 1) Detection of P-012 molecular weight and corresponding polypeptide by mass spectrometry [Table 3] The coverage of the polypeptide fragment is detected as 100%.

[0075] 2) Detection of P-C3T8 molecular weight and corresponding polypeptide by mass spectrometry [Table 4] The coverage of the polypeptide fragment is detected as 100%.

[0076] The samples after enzymatic digestion were analyzed by LC-MS / MS, a database query was performed, and the results were integrated. The coverage rate of the peptide fragments in the final sample was 100%, making the detection results highly reliable.

[0077] Example 4: Detection of cell adhesion activity of recombinant humanized type III collagen For a method of detecting collagen activity, see Juming Yao, Satoshi Yanagisawa, and Tetsuo Asakura, "Design, Expression, and Characterization of Collagen-Like Proteins Based on the Cell Adhesive and Crosslinking Sequences Derived from Native Collagens," J. Biochem. 136, 643-649 (2004). Specific implementation methods are as follows.

[0078] (1) Using ultraviolet absorption method, the concentration of the target protein sample containing bovine type I collagen (China Food and Drug Administration, No.: 380002) and the recombinant humanized protein of the present invention is detected.

[0079] Specifically, the UV absorption of the sample at 215 nm and 225 nm is measured, and the protein concentration is calculated according to the empirical formula C (μg / mL) = 144 × (A215 - A225), with the caveat that detection is required when A215 < 1.5. The principle of this method is as follows: It measures the characteristic absorption of peptide bonds in the far UV, is not affected by chromophore content, has few disturbing substances, is easy to operate, and is suitable for detecting human collagen and its analogs that do not react with Coomassie Brilliant Blue. (Reference: Walker JM. The Protein Protocols Handbook, second edition. Humana Press. pp. 43-45.) After protein concentration detection, the concentration of all target proteins is adjusted to 0.5 mg / mL with PBS.

[0080] (2) 100 μL of each protein solution and a blank PBS solution (control) are added to a 96-well plate and allowed to stand at room temperature for 60 minutes.

[0081] (3) 10 5 NIH / 3T3 cells in good culture condition were added to each well and incubated at 37°C for 60 minutes.

[0082] (4) Wash each well four times with PBS.

[0083] (5) Detect absorbance at OD492nm using an LDH detection kit (Roche, 04744926001). Based on the blank control value, the cell adhesion rate can be calculated. The calculation formula is cell adhesion rate = × 100%. The cell adhesion rate can reflect the activity of collagen. The more active the protein, the better the external environment it can provide for cells in a short period of time, helping cell adhesion. The detection results are shown in Figures 3 and 4 below.

[0084] Example 5: Circular dichroism spectral ultraviolet scanning analysis of recombinant type III humanized collagen Experimental Method (1) Setting the device parameters Band width: 1.0 nm Step: 1.0 nm Measurement range: 190-260nm (scanning in the far UV region) / 250-340nm (scanning in the near UV region) Time-per-point: 0.5s Repeats: 3 times Cell length: 10mm|0.5mm Temperature: room temperature (2) Far-UV and near-UV scans of standard products Set the scanning wavelength to 180 to 340 nm to perform a background test and a buffer solution blank test, and obtain the circular dichroism (far-ultraviolet, near-ultraviolet) absorbance of a 1 mg / mL CSA standard solution in the 180 to 340 nm range.

[0085] (3) Sample processing Protein samples of P-012 and P-C3T8 are concentrated using a 10 KD ultrafiltration filter (Millipore) until the protein concentration reaches 1 mg / ml.

[0086] (4) Far-UV scanning of the sample Soak the cuvette in 2M HNO3 overnight, wash with deionized water, dry, collect background, then collect blank buffer. Add an appropriate amount of test substance to the cuvette and perform a far-UV scan from 190 to 260 nm based on the above parameters to acquire data.

[0087] (5) Near-UV scanning of the sample Soak the cuvette in 2M HNO3 overnight, wash with deionized water, dry, collect background, then collect blank buffer. Add an appropriate amount of test substance to the cuvette and perform a near-UV scan from 250 to 340 nm based on the above parameters to acquire data.

[0088] (6) Scanning spectrum processing All spectra after scanning are subjected to baseline subtraction and smoothing using the software Pro-Data Viewer.

[0089] Experimental results and analysis The results showed that both P-012 and P-C3T8 exhibited positive peaks at 221 nm, indicating that these proteins both have triple helix structures. The results are shown in Figures 5 and 6.

Claims

1. A method for constructing a yeast cell that expresses collagen, the method comprising the step of introducing a recombinant expression vector into a yeast cell, wherein the recombinant expression vector comprises a polynucleotide encoding a collagen, the collagen comprising repeating units of the sequence shown in SEQ ID NO: 1, the number of repeating units being 2 to 32, the repeating units being directly linked, and the collagen is preferably recombinant type III humanized collagen, preferably collagen with a 164.88° triple helix structure.

2. The method of claim 1, wherein the collagen comprises the amino acid sequence shown in SEQ ID NO: 2 or 3, and preferably the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO: 4 or 5.

3. The method according to claim 1 or 2, wherein the recombinant expression vector is a yeast expression vector, preferably a pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P vector.

4. The method according to any one of claims 1 to 3, wherein the yeast is Pichia pastoris, preferably Pichia pastoris strain X33, GS115, SMD1168, KM71 or KM71H.

5. (1) inserting the polynucleotide into an expression vector, preferably between the NotI and XhoI enzyme sites of the pPiczalαA expression vector, to obtain a recombinant expression plasmid; (2) performing an enzymatic digestion of the recombinant expression plasmid, preferably with sac1; (3) purifying the recombinant expression plasmid after enzymatic cleavage; (4) introducing the enzymatically cleaved recombinant expression plasmid into yeast cells by electroporation; The method according to any one of claims 1 to 4, comprising one or more steps of:

6. 1. A yeast cell expressing collagen, wherein the collagen comprises repeating units of the sequence shown in SEQ ID NO: 1, the number of repeating units is 2 to 32, and the repeating units are directly linked; the yeast cell is Pichia pastoris, preferably Pichia pastoris X33, GS115, SMD1168, KM71 or KM71H strain; preferably, the collagen comprises the amino acid sequence shown in SEQ ID NO: 2 or 3; preferably, the collagen is recombinant type III humanized collagen, preferably a collagen with a 164.88° triple helix structure.

7. 7. The yeast cell of claim 6, comprising a yeast expression vector, preferably pPICZα A, pPIC9, pPIC9K, pHIL-S1, or pYAM75P, wherein the expression vector comprises a polynucleotide, and the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 4 or 5.

8. 8. Use of the yeast cell according to claim 6 or 7 in the production of collagen, wherein the collagen preferably comprises repeating units of the sequence shown in SEQ ID NO: 1, the number of repeating units being 2 to 32, and the repeating units being directly linked, preferably the collagen comprises the amino acid sequence shown in SEQ ID NO: 2 or 3, and preferably the collagen is recombinant type III humanized collagen, preferably collagen with a 164.88° triple helix structure.

9. 8. A method for producing collagen by fermentation, comprising the steps of culturing the yeast cell according to claim 6 or 7 under appropriate conditions, adding methanol to the yeast cell to induce expression, and collecting the culture supernatant to obtain collagen, wherein the medium is preferably a BMMY medium supplemented with an amino acid-free yeast nitrogen base and biotin.

10. (1) culturing a basal culture solution of yeast cells according to claim 6 or 7; (2) a fermentation culture step in which the basal culture broth is inoculated into a fermentation medium, cultured in a fermenter, and methanol is fed at an appropriate growth stage to induce expression; (3) a fermentation supernatant preparation step of terminating the culture at an appropriate time, obtaining a fermentation liquid, removing the bacterial cells, and filtering the liquid to obtain a fermentation supernatant; The method according to claim 9, wherein the collagen preferably comprises repeating units of the sequence shown in SEQ ID NO: 1, the number of repeating units being 2 to 32, and the repeating units being directly linked, preferably the collagen comprises the amino acid sequence shown in SEQ ID NO: 2 or 3, preferably the collagen is recombinant type III humanized collagen, preferably collagen with a 164.88° triple helix structure.

Citation Information

Patent Citations

  • Polypeptide, and production method and application thereof

    CN109593126A

  • Recombinant full-length III type humanized collagen yeast engineering strain and construction method thereof

    CN115558612A

  • Yeast recombinant XVII type humanized collagen and preparation method thereof

    CN116375847A

  • Production of recombinant human collagen

    US20080081353A1

  • Novel recombinant collagen polypeptides and molecules

    WO2023135300A1