Medical-grade recombinant three-type collagen and application thereof

By optimizing codons and constructing expression vectors in Pichia pastoris, a highly stable and pure medical-grade recombinant type III collagen was prepared, solving the industrialization difficulties and structural instability problems of collagen extraction in existing technologies, and achieving the effects of promoting cell proliferation and being non-cytotoxic.

CN121108312AActive Publication Date: 2025-12-12ZHEJIANG JIBEI BIOTECHNOLOGY CO LTD

Patent Information

Application Number
CN202511598770.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-04
Publication Date
2025-12-12
Estimated Expiration
2045-11-04

AI Technical Summary

Technical Problem

Existing technologies for collagen extraction suffer from problems such as cross-contamination, strong immunogenicity, low expression levels, or excessive secretion of proteases, leading to difficulties in industrialization. Furthermore, there is a lack of stable triple helix structures in commercially available collagen products.

Method used

By optimizing the codons of Pichia pastoris and removing the XhoI and NotI restriction sites, the expression vector pPIC9K-8-40 was constructed, which was transformed into Pichia pastoris strain GS115. The expression was induced by methanol and then centrifuged, concentrated by ultrafiltration, SP resin column chromatography and freeze-dried to prepare medical-grade recombinant type III collagen.

Benefits of technology

The prepared recombinant humanized type III collagen has high stability and a triple helix structure, high purity, significantly reducing the difficulty of downstream purification processes, and possesses the properties of promoting cell proliferation and being non-cytotoxic.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121108312A_ABST
    Figure CN121108312A_ABST
Patent Text Reader

Abstract

The invention provides a medical-grade recombinant three-type collagen and application thereof. The recombinant humanized three-type collagen has certain cell proliferation promoting capacity and is free of cytotoxicity. The medical-grade recombinant three-type collagen provided by the invention not only has the capability of promoting cell proliferation, is free of cytotoxicity and high in cell adhesion activity, but also has a three-helix structure characterized by the collagen and is extremely high in stability, the purity can reach about 85% after the collagen is induced for 120H in a 100L fermentation tank, the difficulty of a downstream purification process is greatly reduced, and the production cost is reduced. The effect in the aspect of cell activity is obvious.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering technology, in particular to a medical grade recombinant type III collagen and application thereof. BACKGROUND

[0002] The development history of collagen preparation and application is far-reaching, and there are traces of collagen products in ancient times. In 2000 AD, the ancient Egyptians had made leather from collagen-containing substances. There are scenes showing the manufacture and application of leather in Egyptian wall paintings, and even samples of leather have been found in the pyramids. With the development of natural science in the 20th century, the research on animal-derived collagen has taken off and developed into commercial application. In 1900, scientists successfully extracted collagen from mouse tail tendons using dilute organic acid; in 1950, type I collagen was discovered by the scientific community; in 1961, collagen solution was successfully extracted from animal dermal tissue, and in the same year, the first patent for purified collagen was produced, which greatly promoted the research on collagen structure; in 1962, United Shoe Machinary Company successfully developed a commercial collagen extraction process. In the 1960s, with the wide application of various proteases, collagen can be extracted on a larger scale, and the main source is still animal tissue. In 1997, the research on recombinant collagen made progress, and the Collagen Research Center of the University of Oulu in Finland expressed type III collagen in Pichia pastoris. In 1999, scientists used Hansen yeast and Pichia pastoris as host bacteria to express the alpha 1 peptide chain of human type I collagen.

[0003] Currently, the main method for obtaining collagen is extraction, but this method is prone to cross contamination and has strong immunity. Another method is gene recombination, one is to use E. coli for expression, but this method has low expression, which makes it difficult to industrialize, and two is to use a yeast expression system, which has high yield and is easy to industrialize, but has too many secreted proteases, which leads to degradation of foreign proteins, increases the difficulty of downstream purification process, and collagen needs triple helix structure to maintain stability. Currently on the market, most collagen lacks triple helix structure, resulting in inconsistent effects. SUMMARY

[0004] To solve the technical problems existing in the prior art, the present application provides the following technical solutions:

[0005] A medical grade recombinant type III collagen has an amino acid sequence shown in SEQ ID NO: 1.

[0006] Preferably, the coding gene of the amino acid sequence is codon-optimized by Pichia pastoris, and the XhoI and NotI enzyme cutting sites are removed.

[0007] An expression vector pPIC9K-8-40 comprising a gene sequence SEQ ID NO: 2 encoding the medical grade recombinant type III collagen.

[0008] A Pichia pastoris engineering bacterium obtained by transforming the Pichia pastoris GS115 strain with the expression vector.

[0009] A preparation method of the medical grade recombinant type III collagen, comprising the following steps:

[0010] S1. Constructing the expression vector described above;

[0011] S2. Transforming the expression vector into the Pichia pastoris GS115 to obtain the Pichia pastoris engineering bacterium;

[0012] S3. Culturing the Pichia pastoris engineering bacterium, and after methanol induction expression, isolating and purifying to obtain the medical grade recombinant type III collagen.

[0013] Preferably, the final concentration of methanol induction in step S3 is 1.0%, and the induction time is 96 hours.

[0014] Preferably, the isolating and purifying comprises the steps of centrifugation, ultrafiltration membrane concentration, SP resin column chromatography and freeze-drying.

[0015] The medical grade recombinant type III collagen is applied to cosmetics or medical and aesthetic materials.

[0016] The technical scheme provided by the embodiment of the present application brings at least the following beneficial effects:

[0017] The recombinant humanized type III collagen has certain cell proliferation promoting ability and no cytotoxicity. The medical grade recombinant type III collagen provided by the present application not only has the cell proliferation promoting ability and no cytotoxicity, high cell adhesion activity, but also has the triple helix structure characteristic of collagen, high stability, and the purity can reach about 85% after 120H induction in a 100L fermenter, greatly reducing the difficulty of downstream purification process, and the effect on cell activity is remarkable. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical scheme in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0019] Figure 1is a gene point position schematic diagram of a recombinant plasmid provided by an embodiment of the present application, wherein, "AmpR promoter" is a drug resistance promoter, "alpha-factor secretion signal" is an alpha factor secretion signal, "AOX1 termination" is an AOX1 terminator, and "AOX1 3' fragment" is an AOX1 3' fragment;

[0020] Figure 2 is a gene sequencing schematic diagram of a recombinant plasmid provided by an embodiment of the present application;

[0021] Figure 3 is a stability test diagram of a recombinant type III collagen provided by an embodiment of the present application;

[0022] Figure 4 is a two-color spectrum curve diagram provided by an embodiment of the present application;

[0023] Figure 5 is a cytotoxicity experiment column chart provided by an embodiment of the present application;

[0024] Figure 6 is a relative cell adhesion rate column chart provided by an embodiment of the present application;

[0025] Figure 7 is a cell relative proliferation rate column chart provided by an embodiment of the present application. DETAILED DESCRIPTION

[0026] The technical solutions in the present application will be described below with reference to the drawings.

[0027] In the embodiments of the present application, the words "for example", "for instance", "such as", and the like are used to indicate an example, an illustration, or an example of a specific implementation. Any embodiment or design solution described in the present application as "for example" should not be interpreted as more preferred or more advantageous than other embodiments or design solutions. Rather, the word "for example" is used to present the concept in a specific manner. In addition, in the embodiments of the present application, the meaning expressed by "and / or" can be both, or can be one of the two.

[0028] In the embodiments of the present application, "image" and "picture" can be used interchangeably at times. It should be pointed out that when the distinction is not emphasized, the meanings expressed are consistent. "Of", "corresponding", and "corresponding" can be used interchangeably at times. It should be pointed out that when the distinction is not emphasized, the meanings expressed are consistent.

[0029] In the embodiments of the present application, sometimes the subscript such as W1 may be mistakenly written in the form of non-subscript such as W1, and the meanings expressed thereby are consistent when the difference is not emphasized.

[0030] To make the technical problems, technical solutions and advantages to be solved by the present application clearer, the following will be described in detail with reference to the drawings and specific embodiments.

[0031] Example 1, construction of Pichia pastoris expression engineering bacteria

[0032] Taking pPIC9K (purchased from Invitrogen Company) as a skeleton, the optimized gene sequence is introduced into the multiple cloning site to obtain pPIC9K-8-40, and then the pPIC9K-8-40 is transformed into Pichia pastoris GS115, and the detailed steps are as follows:

[0033] S1, according to the human type III collagen mature peptide sequence published by the protein resource database UniProt (website https: / / www.uniprot.org / ), after screening and optimization, the amino acid sequence shown as SEQ ID NO: 1 (KRGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQ*). The last "*" of the sequence represents the translation termination). Specifically: by screening the high expression active site (which can be realized by artificial intelligence AI):

[0034] GPAGPNGIPGEKGPAGERGKNGERGGPGGPGPQGPAGPNGIPGEK, repeating 20 times to form the sequence, without any tag sequence, 100% human sequence, not only containing 40 GER and 20 GEK integrin binding sites but also containing multiple integrin-like sites, with a triple helix structure, stable structure, belonging to recombinant A-type humanized type III collagen.

[0035] And the technical solution of screening high expression active site by artificial intelligence AI can refer to the following technical description:

[0036] 1. Data collection and preprocessing

[0037] Data collection

[0038] Collect data related to amino acid sequences from multiple channels, including protein databases such as PDB, UniProt, etc. These databases contain a large amount of known protein structure and amino acid sequence information, providing a rich data basis for subsequent analysis. At the same time, data related to expression activity, such as gene expression profile data, can be collected, which can reflect the expression level of different amino acid sequences in cells.

[0039] Collect amino acid sequence data from different sources and different species to cover a wider range of sequence diversity and improve the accuracy and universality of screening.

[0040] Data preprocessing

[0041] Clean the collected amino acid sequence data to remove duplicate, incorrect or incomplete sequences. For example, some sequences may have sequencing errors or inaccurate annotations, which need to be corrected or removed through alignment and verification methods.

[0042] Encode the amino acid sequence and convert it into a digital vector form that can be processed by a computer. The commonly used encoding method is One-Hot Encoding, which represents each amino acid with a binary vector. The length of the vector is equal to the number of amino acid types, and only the corresponding amino acid position is 1, and the rest is 0. This encoding method is simple and intuitive, and can preserve the type information of amino acids.

[0043] Standardize the expression activity data to eliminate differences caused by different experimental conditions and measurement methods. For example, use Z-score standardization method to convert the expression activity data into standard normal distribution data with mean 0 and standard deviation 1, which is convenient for subsequent data analysis and model training.

[0044] 2. Feature extraction

[0045] Sequence features

[0046] Analyze the primary structure features of amino acid sequences, such as amino acid composition, amino acid frequency, dipeptide and tripeptide frequency, etc. Different amino acids have different chemical properties, and the differences in their composition and frequency may affect the expression activity of proteins. For example, sequences rich in certain hydrophilic amino acids may be more easily expressed in cells.

[0047] Extract the physical and chemical property characteristics of the sequence, such as isoelectric point, hydrophobicity, molecular weight, etc. These physical and chemical properties are closely related to the folding, stability, and solubility of the protein, which in turn affects its expression activity. For example, proteins with appropriate isoelectric points are more stable in cells and may have higher expression activity.

[0048] Structural characteristics

[0049] Use bioinformatics methods to predict the secondary structure (such as α-helix, β-sheet, random coil, etc.) and tertiary structure of the amino acid sequence. The structure of a protein determines its function, and different structural characteristics may be related to expression activity. For example, proteins with specific secondary structure patterns may be more likely to interact with expression machinery in cells, thereby increasing expression levels.

[0050] Analyze the domain information of the protein, which is a region of the protein with independent function and structure. Different domains may have different contributions to the expression activity of the protein, and identifying and analyzing these domains can help screen amino acid sequences with high expression activity.

[0051] 3. Construct an artificial intelligence model

[0052] Select the appropriate model

[0053] A variety of artificial intelligence models can be selected, such as machine learning models (such as support vector machines, random forests, neural networks, etc.) and deep learning models (such as convolutional neural networks, recurrent neural networks, etc.). Machine learning models are suitable for processing small-scale data sets and simple feature relationships, while deep learning models have stronger feature learning capabilities and can handle large-scale, complex sequence data.

[0054] For example, convolutional neural networks (CNN) have unique advantages in processing sequence data, as they can automatically extract local features in the sequence and gradually learn deep feature representations of the sequence through convolutional layers and pooling layers.

[0055] Model training

[0056] Divide the preprocessed data set into training set, validation set and test set. The training set is used for parameter learning of the model, the validation set is used to adjust the hyperparameters (such as learning rate, number of neurons, etc.) of the model, and the test set is used to evaluate the generalization ability of the model.

[0057] Use the training set to train the model, and use optimization algorithms (such as stochastic gradient descent, Adam, etc.) to continuously adjust the parameters of the model so that the error between the predicted results of the model and the true expression activity data is minimized. In the training process, regularization methods (such as L1 and L2 regularization) can also be used to prevent model overfitting.

[0058] 4. Model evaluation and optimization

[0059] Model evaluation

[0060] The performance of the model is evaluated using various metrics such as accuracy, recall, F1 score, mean squared error (MSE), etc. Accuracy reflects the proportion of correct predictions made by the model, recall measures the ability of the model to correctly identify highly active sequences, F1 score is the harmonic mean of accuracy and recall, and MSE is used to measure the average error between the predicted and true values.

[0061] The stability and generalization ability of the model are evaluated through methods such as cross-validation. Cross-validation divides the dataset into multiple subsets, and one subset is used as the test set while the remaining subsets are used as the training set. The model is trained and evaluated multiple times, and the average value is taken as the final evaluation result.

[0062] Model optimization

[0063] Based on the results of model evaluation, the model is optimized. If the model has overfitting problems, it can be solved by reducing the complexity of the model, increasing the amount of training data, or using regularization methods. If the performance of the model is not good, it can be tried to adjust the structure and hyperparameters of the model, or replace it with a more suitable model.

[0064] The method of ensemble learning can also be used to combine multiple different models to improve the performance and stability of the model. For example, the prediction results of support vector machines, random forests, and neural networks are weighted and averaged to obtain more accurate prediction results.

[0065] 5. Screening of amino acid sequences with high expression activity

[0066] Prediction of expression activity

[0067] The model that has been evaluated and optimized is used to predict the expression activity of new amino acid sequences. The amino acid sequences to be predicted are preprocessed and feature extracted, and then input into the trained model to obtain the predicted expression activity value of the sequence.

[0068] Setting of screening criteria

[0069] According to actual needs, set the screening criteria, such as setting an expression activity threshold, and screen out the amino acid sequences with predicted expression activity higher than the threshold as candidate sequences of high expression activity sites.

[0070] Other biological information and experimental verification results can also be combined to further optimize the screening criteria and improve the accuracy of screening. For example, preferentially select sequences with similar structure or function to known highly active proteins.

[0071] 6. Experimental verification

[0072] In vitro expression experiment

[0073] The amino acid sequences of the high-expression active sites obtained from the screening are constructed into expression vectors and introduced into appropriate host cells (such as E. coli, yeast, etc.) for in vitro expression experiments. The accuracy of the screening results is verified by detecting the yield and activity of the expression products.

[0074] Data analysis and feedback

[0075] Data analysis is performed on the experimental results, and the differences between the predicted results and the actual expression situation are compared. If inaccurate predictions are found, the reasons are analyzed and this information is fed back to the model for further optimization and improvement of the model to improve the accuracy and reliability of the screening.

[0076]

[0077] S3, the target gene shown in SEQ ID NO. 2 was introduced into Xhol and NotI double enzyme digestion sites, inserted into the expression vector pPIC9K to obtain a recombinant plasmid (schematic diagram see Figure 1 ), linearize the recombinant plasmid and respectively electrotransform it into Pichia pastoris GS115, identify by colony PCR and send to Beijing Qikexing Biotechnology Co., Ltd. for sequencing (schematic diagram see Figure 2 ) The identified primer F and R base sequence are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0078] SEQ ID NO: 3 tgttgctgttttgccattttccaac;

[0079] SEQ ID NO: 4 tcacgggggccccggtgggcccggc;

[0080] Finally, the recombinants with correct sequencing were screened.

[0081] The recombinants were respectively coated on YPD solid plates containing G418 concentrations of 0.5 mg / ml, 1 mg / ml, 2 mg / ml and 4 mg / ml, and placed in a 30°C incubator for 2-3 days. The growth state of the recombinants was observed, and the growth was best at a G418 concentration of 2 mg / ml. Positive strains were screened.

[0082] Example 2, preparation of recombinant humanized type III collagen

[0083] Take the positive strains identified in Example 1 (named 1#, 2#, 3#, 4#), 50 μl into a conical flask containing 10 ml BMGY, 30℃, 220r / min overnight culture, shake to OD600=2-6 (logarithmic growth, about 16-18h); centrifuged at room temperature 5000r / min for 5min, collect the cells, remove the supernatant, resuspend the cells with 10ml BMMY, and induce expression; every 24h from the culture medium 1ml, and add methanol to the final concentration of 1.0% to continue induction; the following time points 0, 24, 48, 72, 96h sample 10000 r / min centrifugation 2min to collect the supernatant, 96h SDS-PAGE running gel verification, fermentation broth centrifugal separation, collection of supernatant, supernatant filtration by filter membrane, gel column chromatography separation and purification, then freeze-drying to get finished product. The specific purification steps of the above human recombinant collagen are as follows: centrifugal separation of the fermentation broth, speed 4200 rpm, centrifugal time 30 min, collection of supernatant, concentration and washing of the supernatant with ultrafiltration membrane, desalting and removing pigment, taking an appropriate amount of the above collagen solution, chromatography separation and purification by SP resin column, collecting the eluate containing collagen, and washing and desalting the eluate with ultrafiltration membrane. The target protein is collected by freeze-drying machine, and verified by SDS-PAGE running gel.

[0084] Example 3, stability experiment of recombinant humanized type III collagen

[0085] The recombinant type III collagen was dissolved in water and subjected to simulated accelerated stability experiment, the temperature was 4℃, 30℃, 45℃, 60℃, 90℃, 115℃ and 121℃ respectively, and the treatment time was 30min. The results showed that the recombinant type III collagen was almost not degraded below 121℃, indicating that the stability was very high (schematic diagram see Figure 3 ).

[0086] Example 4, identification of triple helix structure of recombinant humanized type III collagen

[0087] Circular dichroism is a commonly used method for characterizing protein structure, and the positive peak near 225nm is a characteristic peak of collagen triple helix structure. The medical grade recombinant type III collagen prepared in the application was subjected to circular dichroism identification, and the results are shown in Figure 4 . The medical grade recombinant type III collagen prepared in the application has a positive peak at 225nm, indicating that the medical grade recombinant type III collagen prepared in the application has a triple helix structure. The characterization results of circular dichroism show that the medical grade recombinant type III collagen has a triple helix structure characteristic of collagen.

[0088] Example 5, cytotoxicity experiment of recombinant humanized type III collagen

[0089] Logarithmic growth phase HSF cells (human skin fibroblasts) were inoculated in a 96-well plate at a density of 1×10 5 5 The cells were divided into a control group and an experimental group, and were placed in a carbon dioxide cell culture box and cultured at 37°C and 5% CO2 for 24 hours. Recombinant humanized type III collagen sample solutions of different concentrations were prepared using serum-free culture solution, and the solutions were filtered and sterilized using a 0.22-micron filter. After the HSF cells were cultured for 24 hours, the old culture solution was discarded.

[0090] The blank group was added with 100 microliters of serum-free culture solution, and the blank group did not contain serum or collagen, serving as a negative control; the experimental group was added with 100 microliters of a recombinant humanized type III collagen sample solution of a different concentration,

[0091] Each group had three parallel samples. After 24 hours of continuous culture, the culture solution was discarded, 100 microliters of CCK-8 (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.) diluted 10 times with serum-free culture solution were added to each well, and the cells were incubated in a cell culture box for 2 hours. The relative proliferation rate of the cells was detected by the CCK-8 method, and the absorbance was measured at a wavelength of 450 nm using an enzyme label instrument. The relative proliferation rate (RGR) % of the cells was calculated as follows: experimental group absorbance value / normal control group absorbance value x 100% (as shown in the formula below). The results showed that the recombinant humanized type III collagen of the present application had a certain ability to promote cell proliferation and was non-toxic to cells within the selected concentration range. Figure 5

[0092] Example 6, Relative Proliferation Rate of Recombinant Humanized Type III Collagen Cells

[0093] Logarithmic growth phase HSF cells (human skin fibroblasts) were inoculated in a 96-well plate at a density of 1×10 5 The cells were divided into a control group and an experimental group, and were placed in a carbon dioxide cell culture box and cultured at 37°C and 5% CO2 for 24 hours. Recombinant humanized type III collagen sample solutions of different concentrations were prepared using serum-free culture solution, and the solutions were filtered and sterilized using a 0.22-micron filter. After the HSF cells were cultured for 24 hours, the old culture solution was discarded.

[0094] HSF cells were routinely cultured for 24 h, and then the old culture solution was discarded. The blank group was added with 100 μL of serum-free culture solution, and no serum or collagen was contained in the blank group as a negative control. The control group was added with 100 μL of a commercial collagen competitor solution. The experimental group was added with 100 μL of a recombinant humanized collagen type III sample solution, and each group had three parallel samples. After being continuously cultured for 24 h, the culture solution was discarded, 100 μL of CCK-8 (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.) diluted 10 times with serum-free culture solution was added to each well, and the cells were incubated in a cell incubator for 2 h. The absorbance was measured at 450 nm by using an enzyme-labeled instrument. The relative cell adhesion rate was calculated (see the schematic diagram Figure 6 ). The adhesion rate of the cells can reflect the activity of the collagen. The higher the activity of the protein, the better the external environment provided for the cells in a short time, and the better the cells are helped to adhere. The adhesion rate of the cells can reflect the activity of the collagen. The adhesion rate of the blank group was taken as 1, and the relative cell adhesion activity of the recombinant humanized collagen type III was calculated, which was 178% for the experimental group and only 121.3% for the control group.

[0095] Example 7, Relative Cell Proliferation Rate of Recombinant Humanized Collagen Type III

[0096] The logarithmic growth phase HSF cells (human skin fibroblasts) were inoculated in a 96-well plate at a density of 1×10 5 / mL, 100 μL per well, and were divided into a control group and an experimental group. The cells were placed in a carbon dioxide cell incubator and routinely cultured at 37°C and 5% CO2 for 24 h. A recombinant humanized collagen type III sample solution was prepared with a serum-free culture solution at a concentration of 0.5 mg / ml, and the solution was filtered with a 0.22 μm filter membrane to remove bacteria. A commercial collagen competitor was also prepared at a concentration of 0.5 mg / ml, and the solution was filtered with a 0.22 μm filter membrane to remove bacteria. After the HSF cells were routinely cultured for 24 h, the old culture solution was discarded,

[0097] The blank group was added with 100 μL of serum-free culture solution, and no serum or collagen was contained in the blank group as a negative control. The control group was added with 100 μL of a commercial collagen competitor solution. The experimental group was added with 100 μL of a triple-helix recombinant humanized collagen type III sample solution.

[0098] Each group had three parallel samples. After being continuously cultured for 24 h, the culture solution was discarded, 100 μL of CCK-8 (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.) diluted 10 times with serum-free culture solution was added to each well, and the cells were incubated in a cell incubator for 2 h. The relative cell proliferation rate was detected by using the CCK-8 method, and the absorbance was measured at 450 nm by using an enzyme-labeled instrument. The relative cell proliferation rate (RGR) % = experimental group absorbance value / normal control group absorbance value x 100% (for example Figure 7As shown in the figure, DMEM represents the blank group negative control, and 24 represents the experimental group, and the results show that the recombinant humanized type III collagen has certain cell proliferation promoting ability and no cytotoxicity in the selected concentration range.

[0099] From the above examples, it can be seen that the medical grade recombinant type III collagen provided by the present application not only has cell proliferation promoting ability and no cytotoxicity, high cell adhesion activity, but also has the triple helix structure characteristic of collagen.

[0100] The above is only a specific embodiment of the present application, but the protection scope of the present application is not limited thereto, any person skilled in the art can easily think of changes or replacements within the technical range disclosed by the present application, which should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. A medical-grade recombinant type III collagen, characterized in that, It has the amino acid sequence shown in SEQ ID NO:

1.

2. The medical-grade recombinant type III collagen according to claim 1, characterized in that, The gene encoding the amino acid sequence was optimized using Pichia pastoris codon selection, and the XhoI and NotI restriction sites were removed.

3. An expression vector pPIC9K-8-40, characterized in that, The gene sequence SEQ ID NO:2 encodes the medical-grade recombinant type III collagen of claim 1.

4. A Pichia pastoris engineered strain, characterized in that, It was obtained by transforming Pichia pastoris strain GS115 with the expression vector described in claim 3.

5. A method for preparing medical-grade recombinant type III collagen, characterized in that, Includes the following steps: S1. Construct the expression vector as described in claim 3; S2. The expression vector is transformed into Pichia pastoris GS115, and the engineered strain described in claim 4 is obtained by screening. S3. The engineered bacteria are cultured, and after methanol-induced expression, medical-grade recombinant type III collagen is obtained by separation and purification.

6. The preparation method according to claim 5, characterized in that, In step S3, the final concentration of methanol induced is 1.0%, and the induction time is 96 hours.

7. The preparation method according to claim 5, characterized in that, The separation and purification process includes centrifugation, ultrafiltration membrane concentration, SP resin column chromatography, and freeze drying.

8. The application of the medical-grade recombinant type III collagen as described in claim 1 in cosmetics or medical aesthetic materials.

Citation Information

Patent Citations

  • Polypeptides and uses thereof

    CN114920827A

  • Collagen peptide as well as preparation method and application thereof

    CN118146352A

  • Recombinant humanized III-type triple helix collagen as well as preparation method and application thereof

    CN118290567A

  • Repetitive sequence recombinant III type collagen and application thereof

    CN119101145A

  • Humanized III-type collagen as well as preparation method and application thereof

    CN120647749A

Cited By

  • Recombinant humanized three-type collagen with triple-helix structure as well as production method and application of recombinant humanized three-type collagen

    CN121005772A