Methods for treating insulin resistance and related disorders

Targeting neurofibrosis in the ARC with 4-epimerase inhibitors addresses the inadequacies of current treatments for insulin resistance and related disorders by improving insulin signaling and metabolic function.

JP2025535494APending Publication Date: 2025-10-24UNIVERSITY OF MELBOURNE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025524189
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-27
Filing Date
2023-10-27
Publication Date
2025-10-24

AI Technical Summary

Technical Problem

Current treatments for insulin resistance and related disorders, such as obesity and type 2 diabetes, are inadequate in controlling blood glucose levels and often require combination therapy due to progressive worsening, and are associated with increased risks of complications like retinopathy, nephropathy, neuropathy, and cardiovascular diseases.

Method used

Administering 4-epimerase inhibitors to target neurofibrosis in the arcuate nucleus (ARC) of the hypothalamus, which is identified as a novel mechanism underlying insulin resistance, to reduce or prevent neurofibrosis and improve insulin signaling.

Benefits of technology

The approach effectively reduces neurofibrosis, promoting weight loss, improving glycemic control, and enhancing insulin sensitivity, thereby addressing the underlying causes of insulin resistance and related disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025535494000022
    Figure 2025535494000022
  • Figure 2025535494000023
    Figure 2025535494000023
  • Figure 2025535494000024
    Figure 2025535494000024
Patent Text Reader

Abstract

The present invention relates to methods for treating or preventing insulin resistance and related disorders, particularly the use of 4-epimerase inhibitors to treat or prevent insulin resistance and related disorders, such as obesity and type 2 diabetes.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from Australian Provisional Patent Application No. 2022 / 903188, filed on 27 October 2022, the entire contents of which are incorporated herein by cross-reference.

[0002] The present invention relates generally to methods of treating or preventing insulin resistance and disorders associated with insulin resistance. Specifically, the present invention is directed to the use of 4-epimerase inhibitors to treat or prevent insulin resistance and related disorders, including metabolic disorders such as obesity and type 2 diabetes. [Background technology]

[0003] Metabolic diseases such as obesity and type 2 diabetes mellitus affect approximately 650 million people worldwide. The global prevalence of metabolic diseases has tripled since 1975, and if current trends continue without the advent of effective treatments, more than 51% of the world's population will be obese or have type 2 diabetes by 2030. A key feature of many metabolic diseases, including obesity and type 2 diabetes, is insulin resistance.

[0004] Insulin is a peptide hormone synthesized and secreted by beta cells in the pancreas. After secretion into the blood, insulin affects various cells expressed throughout the body and plays an important role in maintaining blood glucose levels within an optimal range. In this regard, insulin targets peripheral tissues, including skeletal muscle and adipose tissue, to promote glucose uptake from the blood circulation, and targets the liver to suppress gluconeogenesis and glycogenolysis. Insulin also signals the brain, where it plays an important role in how the brain controls whole-body glucose and energy homeostasis. Insulin resistance occurs when peripheral insulin target tissues become insensitive to the action of insulin.

[0005] Obesity is characterized by the excessive accumulation of adipose tissue, which is highly responsive to insulin and contributes significantly to both glucose and lipid metabolism. In obese individuals, adipose tissue releases greater amounts of nonesterified fatty acids, glycerol, hormones, and inflammatory cytokines, which contribute to the development of insulin resistance. Initially, beta cells compensate for insulin resistance by secreting more insulin, but over time, beta cells are unable to keep up with the body's demand for insulin, resulting in elevated blood glucose levels. Therefore, in addition to its own health complications, obesity-related insulin resistance is also a major risk factor for type 2 diabetes.

[0006] Type 2 diabetes can be a difficult disease to manage because it requires long-term maintenance of blood glucose levels. Current antidiabetic medications do not control blood glucose levels sufficiently to completely prevent the occurrence of hyperglycemia and hypoglycemia, which can lead to long-term complications such as retinopathy, nephropathy, neuropathy, and peripheral vascular disease. Many treatments currently available on the market for type 2 diabetes are only partially successful because they target reduced beta cell function or insulin resistance, reducing their effectiveness as the disease progressively worsens, meaning that additional or combination therapy is required over time. People with type 2 diabetes are also at increased risk of developing other conditions, such as obesity, hypertension, stroke, heart disease, and hyperlipidemia.

[0007] In addition to metabolic diseases such as obesity and type 2 diabetes, insulin resistance is associated with many other serious health problems, including metabolic syndrome, hypertension, dyslipidemia, atherosclerosis, nonalcoholic fatty liver disease (NAFLD), polycystic ovary syndrome (PCOS), and coagulation disorders.

[0008] Thus, there is a need for improved or alternative methods for treating or preventing insulin resistance and related disorders, including metabolic diseases such as obesity and type 2 diabetes. Summary of the Invention

[0009] The present invention is based, at least in part, on the discovery that neurofibrosis develops around metabolically relevant neurons in the arcuate nucleus (ARC) of the hypothalamus during the development of central insulin resistance and metabolic dysfunction, and that 4-epimerase inhibitors can reduce or prevent neurofibrosis in the ARC, thereby treating or preventing insulin resistance and related disorders.

[0010] Accordingly, in one aspect, the present invention provides a method for treating or preventing insulin resistance or a related disorder in a subject, the method comprising administering to the subject an effective amount of a 4-epimerase inhibitor.

[0011] In another aspect, the present invention provides the use of a 4-epimerase inhibitor in the manufacture of a medicament for treating or preventing insulin resistance or a related disorder in a subject.

[0012] In another aspect, the present invention provides a 4-epimerase inhibitor for use in treating or preventing insulin resistance or a related disorder in a subject. [Brief explanation of the drawings]

[0013] Embodiments of the present invention will now be described with reference to the following drawings, which are intended to be exemplary only.

[0014] [Figure 1]Obesity induces neurofibrosis within the ARC. Age-matched C57BL / 6J mice were fed a chow or HFHS diet for 12 weeks, and brains were processed for a-c) WFA or g-i) aggrecan immunostaining, quantifying b, h) area and c, i) intensity within the ARC. d) ARC homogenates from C57BL / 6J mice fed a 12-week obese or age-matched chow diet were subjected to ZIC-HILIC chromatography, and the abundance of CS-GAG and HA was quantified using 2-aminobenzamide fluorescently labeled disaccharides from enzymatically depolymerized GAG chains. C57BL / 6J mice were fed a HFHS diet for 0, 3 days, 1, 4, 8, or 12 weeks, and brains were processed for e, f) WFA or m, n) immunohistochemical monitoring of aggrecan expression within the ARC, quantifying f, n) stained area. Age-matched C57BL / 6J mice were fed a chow or HFHS diet for 12 weeks, and brains were processed for (g-i) WFA and aggrecan immunostaining, and (j, k) co-expression within the ARC was quantified. Results are mean ± standard error, and significance represents at least three independent experiments. Significance was determined using (b, c, d, h, i) t-test and (f, n) two-way ANOVA with Tukey's multiple comparisons. Scale bar, 100 μm. [Figure 2]Attenuated CSPG-ECM turnover in the ARC leads to neurofibrosis during the development of metabolic diseases. a) Schematic of the CSPG-ECM tracker technology. b, c) Eight-week-old C57BL6J mice were unilaterally injected with WFA-biotin or saline into the ARC. One day after injection, brains were extracted and processed for immunohistochemical monitoring of WFA-biotin and WFA-FITC. d) The stained area within the ARC was quantified. e) Twelve-week-old obese or age-matched chow-fed C57BL6J male mice were bilaterally injected with WFA-biotin into the ARC. At 0, 1, 3, 5, or 10 weeks after injection, brains were extracted and subjected to immunohistochemical monitoring for the presence of WFA-biotin and WFA-FITC. f, g) CSPG-ECM turnover within the ARC was quantified over time. h) Extracellular matrix-regulating enzyme or profibrotic factor gene expression was determined in the medial basal hypothalamus from 12-week obese or age-matched diet-fed C57BL6J male mice. Results are mean ± standard error, and significance is determined using g) simple linear regression. Scale bar, 100 μm. [Figure 3] Neurofibrosis occurs around AgRP neurons in the ARC. (a-c, g-i) Npy-GFP and (d-f) Pomc-EGP male mice were fed a HFHS diet for 0, 4, and 12 weeks. Brains were processed for a-f) WFA or g-i) aggrecan immunostaining, b, e, h) staining for surrounding cell number, and c, f, i) quantification of surrounding staining intensity. Whole-cell patch clamp electrophysiology was performed on NPY neurons in Npy-GFP mice on a HFHS diet for 12 weeks after vehicle or chABC administration into the ARC. Four days after injection, j) the percentage of spontaneously firing neurons, k, l) firing frequency, and m) resting membrane potential were determined. Results are means ± standard error, and significance is determined using b, c, h, i) one-way ANOVA with Tukey's multiple comparisons, g) ANCOVA, or k, m) unpaired t-test (two-tailed) or unpaired t-test (one-tailed), respectively. Electrophysiological recordings were performed from 17 (vehicle) and 18 (chABC) neurons, with four mice per treatment group. Scale bar, 100 μm. [Figure 4]Degradation of neurofibrosis within the ARC promotes the remission of metabolic disease. a) C57BL / 6J mice were fed a HFHS diet for 12 weeks and bilaterally injected with vehicle or chABC into the ARC to degrade CSPG-ECM. ARC targeting was confirmed by ARC WFA immunofluorescence analysis (insert in a). b) Body weight, c) Fat percentage, d) Food intake, g) Energy expenditure, h) WAT gross morphology, i) WAT histology and UCP-1 immunohistochemistry, j, k) Inguinal skin thermography, l) Glucose tolerance, and m) HOMA-IR were assessed. C57BL / 6J mice were fed a HFHS diet for 12 weeks and bilaterally injected with vehicle or chABC into the ARC. One day after intra-ARC injection, vehicle-treated mice were pair-fed, and their daily food availability was restricted to that of chABC-treated mice. e) Body weight and f) Fat mass were assessed. Hyperinsulinemic-hyperglycemic clamps were performed in conscious, unrestrained C57BL / 6J mice fed a HFHS diet for 12 weeks and bilaterally injected with vehicle or chABC into the ARC. Results are shown for n) GIR, o) basal and clamped EGP. p) Hyperinsulinemic-hyperglycemic clamped mice were administered a bolus of 2-DG, and tissue-specific insulin-stimulated uptake was determined in BAT, brain (hypothalamus), epiWAT, BAT and ingWAT, heart, and gastrocnemius muscle. 15-week-old db / db mice were bilaterally injected with vehicle or chABC into the ARC. q) Body weight, r) Fat mass, s) Glucose tolerance, and t) HOMA-IR were assessed. Results are means ± standard error, significance is determined using b, c, e, f, o, q, r) two-way ANOVA with repeated measures, d, g, k, l, m, p, s, t) t-test. Scale bar, 100 μm. [Figure 5]Neurofibrosis in obesity promotes ARC insulin resistance. a-c) C57BL / 6J mice were fed a chow or HFHS diet for 12 weeks and bilaterally injected into the ARC with vehicle or chABC. Two or 8 days after ARC injection, mice were administered vehicle or insulin, and brains were processed for immunohistochemical monitoring of insulin-induced p-AKT expression (b, c). d-h) C57BL / 6J mice were fed a HFHS diet for 12 weeks and bilaterally injected into the ARC with vehicle or chABC. Four days after intra-ARC injection, mice were administered insulin-FITC, and the area of ​​FITC expression, g) intensity, and h) insulin-FITC-induced AKT phosphorylation in the ARC were quantified. i, j) Insulin-FITC was incubated with CSPG-ECM components, and insulin binding was assessed in vitro. Results are means ± standard error, and significance is determined using c) two-way ANOVA with Tukey's multiple comparison test, and f-j) one-way ANOVA with Tukey's multiple comparison test. Scale bar, 100 μm. [Figure 6] The effect of systemic metabolic disorders on ARC neurofibrosis is caused by impaired AgRP-IR signaling. a) Schematic diagram of the AAV-gIR construct conditionally targeting the mouse IR. b) AgRP-Cas9 mice fed HFHS for 12 weeks were bilaterally injected into the ARC with AAV-gScrambled or AAV-gIR. ARC targeting was confirmed by analysis of GFP and mCherry immunofluorescence (insert in b). One week later, mice were bilaterally injected with vehicle or chABC to resolve neurofibrosis within the ARC. c) Body weight, d) Fat percentage, e) Food intake, f) Energy expenditure, g) Glucose tolerance, and h) HOMA-IR were assessed. Results are means ± standard error. Significance was determined using two-way ANOVA with repeated measures for c, d, and one-way ANOVA with Tukey's multiple comparison test for e, f, g, and h. Scale bar, 100 μm. [Figure 7]Pharmacological targeting of neurofibrosis promotes weight loss and improves glycemic control in obesity. a) Male mice fed a HFHS diet for 12 weeks received 10 days of daily ICV administration of vehicle or fluorosamine. b, c) CSPG-ECM expression in the ARC, d) body weight, e) percent adiposity, f) energy expenditure, g) food intake, and h) glucose tolerance were assessed. After 10 days of vehicle or fluorosamine treatment, mice were administered insulin, and brains were processed for i, j) immunohistochemical monitoring of insulin-induced p-AKT expression. A hyperinsulinemic-hyperglycemic clamp was performed in conscious, unrestrained C57BL / 6J mice fed a HFHS diet for 12 weeks and administered 3 days of daily ICV administration of fluorosamine, and k) GIR was assessed. C57BL / 6J mice fed a HFHS diet and treated with low-dose STZ to phenocopy characteristics of late-stage T2D were administered vehicle or fluorosamine via ICV daily for 14 days. l) Daily blood glucose and m) glucose tolerance were assessed. n) AgRP-Cas9 mice fed a HFHS diet for 12 weeks were injected bilaterally with AAV-gScrambled or AAV-gIR. One week later, mice received vehicle or fluorosamine via ICV daily for 10 days, and o) body weight, p) food intake, q) energy expenditure, and r) body weight, n) glucose tolerance were assessed. Results are means ± standard error. Significance was determined using d, e, k, l, o) two-way ANOVA with repeated measures and c, f, g, h, j, m, p, q, r) one-way ANOVA with multiple comparisons. Scale bar, 100 μm. [Figure 8]Intranasal drug administration delivered biotinylated fluorosamine (PZ6005) to the ARC. a) Schematic of intranasal administration of biotinylated PZ6005. Seven- to eight-week-old, chow-fed C57BL / 6J mice were administered vehicle or biotinylated PZ6005 (5 mg / animal / day) IN for three consecutive days. Mouse brains and lungs were then extracted for immunohistochemistry to detect the presence of the drug, and d-h) intensity was quantified. Scale bars: b) 500 μm or 100 μm, and f) 200 μm. Results are means ± standard error. Statistical significance was determined using an unpaired t-test. [Figure 9] Intranasal administration of fluorosamine (PZ6005) attenuates ARC neurofibrosis in diet-induced obesity. a) Schematic diagram of intranasal administration of PZ6005. a) C57BL / 6J mice fed a HFHS diet for 12 weeks were administered IN with vehicle or PZ6005 (1 or 5 mg / animal / day) for 14 consecutive days. b) Mouse brains were then extracted and processed for WFA immunohistochemistry to determine CSPG-ECM expression within the ARC, and c, d) area and e, f) intensity were quantified. Scale bar: 100 μm. Results are means ± standard error. Statistical significance was determined using one-way ANOVA with Tukey's multiple comparison test. [Figure 10] Pharmacological inhibition of ARC neurofibrosis using fluorosamine (PZ6005) induces weight loss in diet-induced obesity. C57BL / 6J mice fed a HFHS diet for 12 weeks were administered vehicle or PZ6005 (1 or 5 mg / animal / day) IN for 14 consecutive days. a, b) The effect on mouse body weight was measured daily during the 14-day treatment. Results are means ± standard error. Statistical significance was determined using two-way ANOVA with repeated measures and Tukey's multiple comparison test. [Figure 11]Pharmacological inhibition of ARC neurofibrosis using fluorosamine (PZ6005) reduces adiposity in diet-induced obesity. C57BL / 6J mice fed a HFHS diet for 12 weeks received IN delivery of vehicle or PZ6005 (1 mg or 5 mg / animal / day) for 14 consecutive days. a, b) Adipose tissue and liver were extracted and weighed to determine tissue-specific steatosis, and c, d) fat mass was assessed after 14 days of treatment. Results are means ± standard error. Statistical significance was determined using a, b, d) one-way ANOVA with Tukey's multiple comparison test, and c) two-way ANOVA with repeated measures and Sidak's multiple comparison test. [Figure 12] Pharmacological inhibition of ARC neurofibrosis using fluorosamine (PZ6005) reduces food intake and increases energy expenditure in diet-induced obesity. C57BL / 6J mice fed a HFHS diet for 12 weeks were administered vehicle or PZ6005 (1 or 5 mg / animal / day) IN for 14 days. A) 24-hour food intake, b) cumulative food intake, c, d) oxygen consumption, and e–g) energy expenditure were determined on days 8–11 of treatment. Results are means ± standard error. Statistical significance was determined using a, e) one-way ANOVA with Tukey's multiple comparison test, and c, f) two-way ANOVA with repeated measures and Sidak's multiple comparison test. [Figure 13] Pharmacological attenuation of ARC neurofibrosis using fluorosamine (PZ6005) attenuates ARC insulin resistance in diet-induced obesity. C57BL / 6J mice fed a HFHS diet for 12 weeks received daily IN delivery of vehicle or PZ6005 (1 or 5 mg / animal / day) for 14 days. After 14 days of treatment, mice received IP delivery of insulin (5 mg / g). 15 minutes after injection, brains were extracted and then processed for immunohistochemistry to detect insulin-induced p-AKT signaling. ARC pAKT-positive cells were quantified. Scale bar: 100 μm. Results are means ± standard error. Statistical significance was determined using one-way ANOVA with Tukey's multiple comparison test.

[0015] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0016] As used herein, the terms "composition" and "formulation" are used interchangeably and have the same meaning.

[0017] As used herein, the indefinite articles "a," "an," and "the" include plural references unless otherwise specified. Thus, for example, reference to an "agent" includes a single agent, as well as two or more agents, and reference to a "composition" or "formulation" includes a single composition or formulation, as well as two or more compositions or formulations.

[0018] As used herein, the term "about" means ±10% of the recited value.

[0019] Throughout this specification and the claims that follow, unless the context clearly indicates otherwise, the word "comprise" and variations such as "comprises" and "comprising" will be understood to imply the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of any other integer or step or group of integers or steps.

[0020] The term "consisting of" means "consisting only of", i.e., including and limited to an integer or step or group of integers or steps, and excluding any other integer or step or group of integers or steps.

[0021] The term "consisting essentially of" means including the stated integers or steps or group of integers or steps, but may also include other integers or steps or group of integers or steps that do not materially alter or contribute to the operation of the invention.

[0022] The reference to any prior art in this specification is not intended to be, and should not be construed as, an admission or any form of suggestion that that prior art forms part of the general general knowledge.

[0023] Other definitions are provided throughout the specification. DETAILED DESCRIPTION OF THE INVENTION

[0024] The present invention relates to a method for treating or preventing insulin resistance and related disorders, such as type 2 diabetes and obesity. Specifically, the inventors have identified neurofibrosis in the arcuate nucleus of the hypothalamus (ARC) as a novel disease mechanism underlying the development of central insulin resistance and metabolic diseases, and have found that administration of a 4-epimerase inhibitor can reduce or prevent neurofibrosis in the ARC. Therefore, a 4-epimerase inhibitor may be suitable for treating or preventing insulin resistance and related disorders, such as type 2 diabetes and obesity. The terms "type 2 diabetes mellitus," "type 2 diabetes," and "T2D" are used interchangeably herein and have the same meaning.

[0025] Excessive deposition and remodeling of extracellular matrix (ECM) is a well-established disease mechanism that promotes fibrosis and supports insulin resistance in muscle, adipose, and liver tissues. However, both insulin resistance and fibrosis have traditionally been viewed as peripheral tissue-centered phenomena, and the development and relevance of ECM in the brain to the development of metabolic diseases has not been previously investigated. A distinct species of ECM has recently been described in the ARC of humans and mice (Alonge et al., 2020; Mirzadeh et al., 2019), consisting of specialized perisynaptic aggregates of hyaluronic acid, chondroitin sulfate proteoglycans (CSPGs), and chondroitin sulfate glycosaminoglycan side chains. We have identified that the CSPG-ECM within the ARC is a unique multicellular aggregate concentrated proximal to the median eminence (ME), providing an extracellular junction between the nervous system and the peripheral endocrine system. Thus, the CSPG-ECM provides an interface connecting metabolically relevant ARC neurons, such as agouti-related peptide neurons (AgRP) and proopiomelanocortin (POMC) neurons, and circulating metabolic hormones that enter the ARC.

[0026] We have identified that the development of insulin resistance and related disorders, such as obesity and type 2 diabetes, is accentuated by CSPG-ECM remodeling at both the component and glycosaminoglycan levels, representing a previously unidentified feature of insulin resistance and related disorders, a phenomenon termed "neurofibrosis." Neurofibrosis within the ARC can impede circulating insulin penetration and cause neuronal insulin resistance. CSPG component remodeling, including changes to chondroitin sulfate-glycosaminoglycan (CS-GAG) sulfation patterns, can be mediated through elevated CS-0S, CS-4S, and CS-2S6S sulfation, which promotes a rigid CSPG-ECM structure that sequesters extracellular diffusion. CS-4S sulfation drives the activity of chondroitin sulfate N-acetylgalactosaminyltransferase-1 (CS-GalNAcT-1), promoting the expression of aggrecan, a key CSPG species underlying neurofibrosis in the ARC. CSPG-ECM remodeling, which accentuates neurofibrosis, occurs specifically around AgRP neurons, a key regulator of metabolism and essential for survival. Impaired ARC-insulin signaling can promote the development of obesity and diabetes through enhanced feeding behavior, attenuated energy expenditure, and abnormal glucose metabolism.

[0027] 4-Epimerase (also known as UDP-galactose 4-epimerase) is an essential enzyme for generating the nucleotide sugar substrate UDP-N-acetylgalactosamine, which is required for the assembly and elongation of CS-GAG chains on CSPGs, a fundamental feature of neurofibrosis in the ARC. Therefore, we hypothesized that 4-epimerase inhibitors could reduce or prevent neurofibrosis in the ARC, representing a novel treatment for insulin resistance and related disorders. As a non-limiting example, we demonstrated that fluorosamine (1; Ac-4-F-GlcNAc), a fluorinated N-acetyl-D-glucosamine analog previously identified to inhibit chondroitin sulfate proteoglycan (CSPG) synthesis (Keough et al., 2016; Stephenson et al., 2019), preferentially attenuates CSPG-ECM in the ARC. This effect may be mediated by the relatively rapid CSPG-ECM turnover observed in the ARC, which improves the functional availability of fluorosamines in the ARC compared with other brain regions with slower degradation rates. Because there is little CSPG-ECM expression in the amygdala, orbitofrontal cortex, and ventral striatum, targeting the brain ECM may limit off-target effects on depression and anxiety, which has undermined previous attempts to pharmacologically target the brain to treat metabolic diseases.

[0028] Thus, the present invention relates to the use of 4-epimerase inhibitors for the treatment or prevention of insulin resistance or related disorders. In one or more embodiments, the present invention relates to the use of fluorinated N-acetylglucosamine derivatives, such as fluorosamine (1), for the treatment or prevention of insulin resistance or related disorders, including metabolic diseases associated with insulin resistance, such as obesity and type 2 diabetes mellitus. Stephenson et al., 2019, previously identified that the fluorinated N-acetylglucosamine derivatives most effective at reducing chondroitin sulfate GAG ​​stubs attached to core proteins were substituted only at the anomeric carbon (C-1), such as a hydroxyl group, an O-acetyl group, or an O-propionyl group, and at least one fluorine at C-4. Thus, as used herein, the term fluorinated N-acetylglucosamine "derivative" specifically refers to derivatives of fluorinated N-acetylglucosamine with a hydroxyl group or -OC(O)C at C-1. 1-4 It may refer to an N-acetyl-glucosamine (preferably N-acetyl-D-glucosamine) core structure substituted with alkyl (preferably hydroxyl, O-acetyl, or O-propionyl groups) and substituted at C-4 with one or two fluoro groups. Stephenson et al., 2019, also identified that it may be advantageous to include removable acyl protecting groups at O4 and O6.

[0029] Thus, in one or more embodiments, the 4-epimerase inhibitors suitable for use in the present invention are compounds of formula (I): [ka] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof; During the ceremony, R 1 , R 3 , and R 5 are independently H or C(O)C 1-4 alkyl, R 4 and R 4’ is independently selected from H and fluoro; R 4and R 4’ At least one of is fluoro.

[0030] As used herein, the term "alkyl" refers to monovalent ("alkyl") and divalent ("alkylene") straight- or branched-chain saturated aliphatic groups. Alkyl groups include those having C 1-4 It may have 1 to 4 carbon atoms, designated alkyl, or C 1-3 It may have 1 to 3 carbon atoms, designated alkyl, or C 1-2 It may have 1 to 2 carbon atoms, designated as alkyl. Examples of suitable alkyl groups may include, but are not limited to, methyl, ethyl, 1-propyl, isopropyl, 1-butyl, 2-butyl, isobutyl, sec-butyl, and tert-butyl.

[0031] It will be recognized that the fluorinated N-acetyl-glucosamine derivatives (or other 4-epimerase inhibitors) disclosed herein may have asymmetric centers and therefore may exist in more than one stereoisomeric form. Therefore, the 4-epimerase inhibitors, such as the fluorinated N-acetyl-glucosamine derivatives disclosed herein, may exist as a single stereoisomer, a racemate, and / or a mixture of enantiomers and / or diastereomers. Therefore, unless otherwise specified, any reference herein to a fluorinated N-acetyl-glucosamine derivative includes its stereoisomers. As used herein, the term "stereoisomer" refers to any two or more isomers that have the same molecular constitution and differ only in the three-dimensional arrangement of their atoms in space. Stereoisomers may be diastereoisomers or enantiomers. In some embodiments, the fluorinated N-acetyl-glucosamine derivatives disclosed herein can be in a substantially pure isomeric form at one or more asymmetric centers (e.g., greater than about 90% ee, 95% ee, 97% ee, or 99% ee), or mixtures thereof (including racemic mixtures).

[0032] Preferably, the fluorinated N-acetyl-glucosamine derivative is an N-acetyl-D-glucosamine derivative compound of formula (IA): [ka] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof; During the ceremony, R 1 , R 3 , and R 5 are independently H or C(O)C 1-4 alkyl, R 4 and R 4’ is independently selected from H and fluoro; R 4 and R 4’ At least one of is fluoro.

[0033] In a preferred embodiment of the compounds of formula (I) and formula (IA), R 1 , R 3 , and R 5 are independently H or C(O)C 1-3 alkyl, more preferably R 1 , R 3 , and R 5 are independently H or H or C(O)C 1-2 alkyl.

[0034] In a preferred embodiment of the compounds of formula (I) and formula (IA), R 1 is H or C(O)C 1-2 alkyl, and R 3 and R 5 are both acyl groups.

[0035] In a preferred embodiment of the compounds of formula (I) and formula (IA), R 1 , R 3 , and R 5 are each an acyl group.

[0036] In a preferred embodiment of the compounds of formula (I) and formula (IA), R 4is fluoro and R 4’ is H or R 4 is H and R 4’ is fluoro or R 4 and R 4’ is both.

[0037] In one or more preferred embodiments, the compound of formula (IA) is [ka] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

[0038] In a preferred embodiment, the compound of formula (IA) is [ka] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

[0039] Suitable methods for preparing fluorinated N-acetyl-glucosamine derivatives are described in Keough et al., 2016 and Stephenson et al., 2019. Other methods for preparing N-acetyl-glucosamine derivatives will be apparent to those skilled in the art.

[0040] Other 4-epimerase inhibitors that may be suitable for use in the present invention have also been previously described, such as the xyloside Ac-bXyl-TEG (2) described by Stephenson et al., 2019, and the aminooxy- and hydrazide-functionalized uridine derivatives described by Winans and Bertozzi, 2002.

[0041] Thus, in one embodiment, the 4-epimerase inhibitor is [ka] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

[0042] In another embodiment, the 4-epimerase inhibitor is a compound of Formula (II), Formula (III), or Formula (IV): [ka] or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof; During the ceremony, R 6 but, [ka] is selected from R 7 but, [ka] is selected from R 8 but, [ka] [ka] is selected from.

[0043] It should be understood that the present invention is not intended to be limited to the specific 4-epimerase inhibitors described herein. Given the underlying mechanism of the present invention discovered by the inventors, it is contemplated that any compound that inhibits 4-epimerase may be suitable for use in the present invention. Preferably, the 4-epimerase inhibitor is a pharmaceutically acceptable compound. The ability of a compound to inhibit 4-epimerase can be easily determined by those skilled in the art, for example, using Western blot analysis of stab-chondroitin-4-sulfate bound to core protein, as described by Keough et al., 2016 and Stephenson et al., 2019, or using a coupled enzyme system with a spectrophotometric readout, as described by Winans and Bertozzi, 2002.

[0044] It should be understood that, according to the present invention, 4-epimerase inhibitors (including fluorosamine and other fluorinated N-acetyl-glucosamine derivatives disclosed herein) may be provided as pharmaceutical salts, hydrates, or solvates. The term "pharmaceutically acceptable salts" includes, where appropriate, pharmaceutically acceptable solvates and hydrates, as well as pharmaceutically acceptable addition salts of 4-epimerase inhibitors. The term "solvate" includes a molecular complex comprising a 4-epimerase inhibitor and one or more pharmaceutically acceptable solvent molecules, such as ethanol. The term "hydrate" is used when the solvent is water. It is also contemplated that 4-epimerase inhibitors may be suitable for use in the treatment or prevention of insulin resistance and related disorders in animals. Accordingly, the term "pharmaceutically acceptable salts" is also intended to include veterinarily acceptable solvates and hydrates, as well as veterinarily acceptable addition salts, of 4-epimerase inhibitors, including fluorinated N-acetyl-glucosamine derivatives disclosed herein.

[0045] In some embodiments, pharmaceutically acceptable salts may include acid addition salts and salts of quaternary amines. Pharmaceutically acceptable salts include the inclusion of another molecule, such as a chloride ion, acetate ion, sulfate ion, or other counterion, in the parent compound (i.e., the 4-epimerase inhibitor). A counterion may be any organic or inorganic moiety that stabilizes the charge on the parent compound. Furthermore, a pharmaceutically acceptable salt may have more than one charged atom in its structure. When multiple charged atoms are present in the parent compound, the pharmaceutically acceptable salt may have multiple counterions, which may be the same or different counterions. Thus, a pharmaceutically acceptable salt may have more than one charged atom and / or more than one counterion in the parent compound.

[0046] Acid addition salts suitable for use in the present invention can be formed from 4-epimerase inhibitors (e.g., fluorinated N-acetylglucosamine derivatives) and pharmaceutically acceptable inorganic or organic acids, including, but not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, toluenesulfonic acid, benzenesulfonic acid, acetic acid, propionic acid, ascorbic acid, citric acid, malonic acid, fumaric acid, maleic acid, lactic acid, salicylic acid, sulfamic acid, or tartaric acid. Counterions of quaternary amines include chloride, bromide, iodide, sulfate, phosphate, methanesulfonate, citrate, acetate, malonate, fumarate, sulfamate, and tartrate. Additionally, basic nitrogen-containing groups can be quaternized with lower alkyl halides, such as methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dialkyl sulfates, such as dimethyl sulfate and diethyl sulfate; and other agents. The preparation of the above pharmaceutically acceptable salts and other typical pharmaceutically acceptable salts is more fully described by Berge et al., "Pharmaceutical Salts," J. Pharm. Sci., 1977:66:1-19.

[0047] In some embodiments, salts of the 4-epimerase inhibitor can be prepared from the free form of the compound in a separate synthetic step before being incorporated into a formulation for administration to a subject according to the present invention. In yet other embodiments, salts of the 4-epimerase inhibitor can be prepared in situ during preparation of a formulation for administration. For example, the formulation for administration can further comprise a suitable acid that, upon contact with the free form of the 4-epimerase inhibitor, forms the desired pharmaceutical salt in situ for administration.

[0048] Furthermore, those skilled in the art will recognize that the 4-epimerase inhibitors, such as the fluorinated N-acetyl-glucosamine derivatives disclosed herein, may be provided in crystalline form, either as free compounds or as solvates (e.g., hydrates), and that both forms are intended to be within the scope of the present invention. Methods of solvation are generally known within the art.

[0049] The present invention also contemplates the use of pharmaceutically acceptable prodrugs of 4-epimerase inhibitors in the treatment or prevention of insulin resistance and related disorders. For example, a 4-epimerase inhibitor may be provided in the form of a prodrug, which, when administered to a subject, may be capable of producing (directly or indirectly) the desired 4-epimerase inhibitor or its active metabolite or residue. The term "prodrug" is used in its broadest sense and includes derivatives that are converted into active drugs in vivo. Such prodrugs will be readily apparent to those skilled in the art.

[0050] As mentioned above, the present invention encompasses the use of 4-epimerase inhibitors (e.g., fluorinated N-acetyl-glucosamine derivatives) in the free base form or as pharmaceutical salts or solvates thereof in the treatment of insulin resistance or related disorders (e.g., metabolic diseases). When a specific dosage or concentration of a 4-epimerase inhibitor is referred to herein, it should be understood that the specific dosage or concentration refers to the concentration of the free base of the 4-epimerase inhibitor or its equivalent. Thus, when a pharmaceutically acceptable salt of a 4-epimerase inhibitor is used, one skilled in the art will readily understand that the concentration or dosage of the salt refers to the equivalent concentration or dosage of the free base form of the 4-epimerase inhibitor.

[0051] According to the present invention, a 4-epimerase inhibitor, such as a fluorinated N-acetyl-glucosamine derivative disclosed herein, or a pharmaceutically acceptable salt thereof, can be administered together with one or more pharmaceutically acceptable carriers, diluents, adjuvants, and / or excipients. When a carrier, diluent, adjuvant, and / or excipient is used, it must be "pharmaceutically acceptable" in the sense of being compatible with the other components of the composition and not harmful to the subject. Such pharmaceutically acceptable carriers, diluents, adjuvants, or excipients will be apparent to those skilled in the art and may depend on the intended mode of administration. For example, the carrier, diluent, adjuvant, or excipient may vary depending on the formulation and / or mode of administration. In some embodiments, the 4-epimerase inhibitor can be provided in a sustained-release formulation.

[0052] Pharmaceutical compositions containing the 4-epimerase inhibitor used in the present invention can be prepared by any method known in the art of pharmacology. Generally, such preparation methods include bringing the 4-epimerase inhibitor into association with one or more carriers, diluents, adjuvants, excipients, or other accessory ingredients, and then, if necessary and / or desirable, shaping and / or packaging the product into a desired single or multiple dosage unit. In certain embodiments, a unit dosage composition contains a daily dose or unit, a daily sub-dose, or an appropriate fraction thereof, of the 4-epimerase inhibitor, as described hereinabove. As used herein, a "unit dosage" is a discrete amount of a pharmaceutical composition containing a predetermined amount of the active ingredient. The amount of the active ingredient (i.e., the 4-epimerase inhibitor) is generally equal to the dosage of the active ingredient administered to a subject, and / or a convenient fraction of such a dosage, for example, one-half or one-third of such a dosage.

[0053] General considerations in formulating and / or manufacturing pharmaceutical compositions can be found, for example, in Remington's Pharmaceutical Sciences, Sixteenth Edition, E. W. Martin (Mack Publishing Co., Easton, Pa., 1980), and Remington: The Science and Practice of Pharmacy, 21st Edition (Lippincott Williams & Wilkins, 2005).

[0054] In preferred embodiments, the 4-epimerase inhibitor may be formulated for intranasal administration. In some embodiments, the intranasal formulation may be prepared as a pharmaceutically acceptable emulsion, microemulsion, solution, or suspension. Specifically, the 4-epimerase inhibitor may be prepared as an aqueous solution or suspension. When the 4-epimerase inhibitor formulation is an aqueous solution or suspension, the formulation may comprise water in an amount greater than 50% by weight of the total composition, preferably greater than about 60% by weight of the total composition, more preferably greater than about 70% by weight of the total composition, and even more preferably greater than about 80% by weight of the total composition. In still other embodiments, when the formulations disclosed herein are aqueous solutions or suspensions, water may comprise from about 80% to about 99% by weight of the total composition, more preferably from about 85% to about 98% by weight of the total composition.

[0055] The intranasal compositions disclosed herein may further comprise a pharmaceutically acceptable cosolvent. Suitable cosolvents may include, but are not limited to, alcohol, polyvinyl alcohol, propylene glycol, polyethylene glycol and derivatives thereof, glycerol, sorbitol, polysorbates, ethanol, and mixtures thereof. Specifically, the cosolvent may be selected from glycerol, propylene glycol, and mixtures thereof. In yet other embodiments, the cosolvent may comprise from about 1% to about 60% by volume of the total composition, preferably from about 2% to about 50% by volume of the total composition, more preferably from about 3% to about 40% by volume, and even more preferably from about 5% to about 35% by volume.

[0056] The intranasal formulations described herein may contain a thickening agent. The use of a thickening agent may provide improved adhesion of the formulation to the nasal mucosa without adversely affecting ease of administration, particularly administration as an intranasal spray. Furthermore, a thickening agent may advantageously improve the nasal absorption of the active agent, increase the residence time of the formulation on the nasal mucosa, and / or reduce loss of the formulation via mucociliary clearance of the nasal passages. Thus, the use of a thickening agent may advantageously provide improved bioavailability and / or sustained release of the desired active agent. A thickening agent suitable for use in the present invention may be any pharmaceutically acceptable thickening agent tolerated by the nasal mucosa known to those skilled in the art. A thickening agent may advantageously contribute to the controlled release of the active ingredient on the mucosa. Suitable thickeners for use in the present invention include methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, polyacrylic acid polymers, polyhydroxyethylmethylacrylate, polyethylene oxide, polyvinylpyrrolidone, polyvinyl alcohol, tragacanth, sodium alginate, gum alaya, guar gum, xanthan gum, lectin, soluble starch, gelatin, pectin, and chitosan. The amount of thickener required to achieve a suitable balance between the adhesion of the formulation to the nasal mucosa and the sprayability of the formulation can vary depending on the nature of the thickener. The amount of a particular thickener required to achieve this balance can be determined by one of ordinary skill in the art. For example, the thickener may comprise from about 0.1% to about 2%, from about 0.25% to about 1.5%, or from about 0.5% to about 1% by weight of the total composition.

[0057] In some embodiments, the intranasal formulations suitable for use in the present invention may include one or more of the following: pH modifiers, sensates, antioxidants, surfactants, adhesives, stabilizers, osmolality regulators, preservatives, penetration enhancers, chelating agents, sweeteners, flavoring agents, taste masking agents, and coloring agents. Some agents or components of the intranasal formulation may have more than one function. For example, when ethanol is used as a sensate in the formulations disclosed herein, it may also function as a penetration enhancer and / or cosolvent.

[0058] Suitable additives and amounts thereof for use in intranasal formulations will be apparent to those skilled in the art. By way of example, suitable sensates may include C2-C4 alcohols (such as ethanol or isopropanol), menthol, terpenes, thymol, camphor, capsicum, phenol, carveol, menthol glucuronide, eucalyptus oil, benzyl alcohol, salicylic alcohol, clove bud oil, mint, spearmint, peppermint, eucalyptus, lavender, citrus fruits, lemon, lime, hexylresorcinol, ketals, diols, and mixtures thereof. Examples of suitable preservatives may include benzalkonium chloride, methylparaben, ethylparaben, propylparaben, butylparaben, benzyl alcohol, sodium benzoate, phenylethyl alcohol, and benzethonium.

[0059] therapeutic use According to the present invention, a 4-epimerase inhibitor or a composition comprising the same can be used to treat or prevent insulin resistance and related disorders. In the context of the present invention, disorders associated with insulin resistance can include disorders caused, at least in part, by insulin resistance (e.g., type 2 diabetes), as well as disorders that themselves, at least in part, cause or exacerbate insulin resistance (e.g., obesity). Such disorders can include, but are not limited to, prediabetes, type 2 diabetes mellitus, obesity, metabolic syndrome, hypertension, dyslipidemia, atherosclerosis, nonalcoholic fatty liver disease (NAFLD), polycystic ovary syndrome (PCOS), and coagulation disorders.

[0060] According to the present invention, a 4-epimerase inhibitor can be administered to a subject in need of treatment for insulin resistance or a related disorder, or can be administered prophylactically. Specifically, it is clear that the methods of the present invention can be used prophylactically as well as for the alleviation of symptoms of insulin resistance or a related disorder. Thus, references herein to "treatment" or the like can include such prophylactic treatment as well as therapeutic treatment of acute conditions or symptoms. Thus, in one or more embodiments, the present invention provides a 4-epimerase inhibitor for use in the therapeutic treatment of insulin resistance or a related disorder. In other embodiments, the present invention provides a 4-epimerase inhibitor for use in the prophylactic treatment of insulin resistance or a related disorder.

[0061] Accordingly, the present invention relates to a method for treating or preventing insulin resistance or a related disorder in a subject, comprising administering to the subject an effective amount of a 4-epimerase inhibitor.

[0062] The present invention also relates to the use of a 4-epimerase inhibitor in the manufacture of a medicament for treating or preventing insulin resistance or a related disorder in a subject.

[0063] The present invention further relates to a 4-epimerase inhibitor for use in treating or preventing insulin resistance or a related disorder in a subject.

[0064] The terms "treat," "treating," or "treatment," with respect to a condition (including a disease or disorder described herein), refer to reducing or eliminating the cause and / or effects of the condition. As used herein, the terms "treat," "treatment," and "treating" refer to the reduction or amelioration of the progression, severity, and / or duration of a condition, or the improvement of one or more symptoms (e.g., one or more discernible symptoms) of a condition (i.e., "managing" without "curing" the condition) resulting from the administration of one or more therapies (e.g., one or more therapeutic agents, such as a 4-epimerase inhibitor disclosed herein). In certain embodiments, the terms "treat," "treatment," and "treating" refer to the improvement of at least one measurable physical parameter of a condition described herein, such as insulin resistance or a related disorder. In other embodiments, the terms "treat," "treatment," and "treating" refer to the inhibition of the progression of a condition described herein, either physically, e.g., by stabilization of a discernible symptom, or physiologically, e.g., by stabilization of a physical parameter, or both.

[0065] As used herein, the terms "preventing" and "prevention" refer to administering a medication in advance to avoid or forestall the appearance of one or more symptoms of a condition. Those skilled in the art will recognize that the term "prevent" is not an absolute term. In the medical field, it is understood to refer to the prophylactic administration of a drug to substantially reduce the likelihood or severity of a condition or the symptoms of a condition, and this is the meaning intended in this disclosure. As used in standard texts in the field, such as the Physician's Package Insert, the terms "prevent," "preventing," and "prevention" with respect to a condition refer to avoiding the cause, effects, symptoms, or progression of a condition before the condition fully manifests.

[0066] In some embodiments, the subject in need of treatment or prevention of insulin resistance or related disorders is a mammal. As used herein, the term "mammal" includes humans, primates, livestock animals (e.g., horses, cows, sheep, pigs, donkeys), laboratory animals (e.g., mice, rats, guinea pigs), companion animals (e.g., dogs, cats), and captive wild animals (e.g., kangaroos, deer, foxes). Preferably, the mammal is a human.

[0067] According to the present invention, a 4-epimerase inhibitor is administered to a subject in need of treatment in a therapeutically effective amount. In some embodiments, the therapeutically effective amount is a therapeutically effective amount or a prophylactically effective amount. As used herein, the term "therapeutically effective amount" refers to an amount of a 4-epimerase inhibitor sufficient to treat or alleviate symptoms associated with insulin resistance or a related disorder. The therapeutically effective amount of the compound administered is governed by such considerations and is either the incremental maximum tolerated dose or the minimum amount necessary to alleviate, cure, or treat the condition or one or more of its symptoms. The term "prophylactically effective amount" refers to an amount effective to prevent or substantially reduce the likelihood of acquiring a disease or disorder, or to reduce the severity of a disease or disorder before it is acquired, or to reduce the severity of one or more of its symptoms before the symptoms develop. In general, preventive measures can be divided into primary prevention (to prevent the onset of a disease or condition) and secondary prevention (to protect patients from the worsening of the disease or condition once it has already developed).

[0068] As used herein, the term "effective amount" refers to the amount of a 4-epimerase inhibitor that, when administered according to a desired dosing regimen, provides the desired therapeutic activity. For example, an effective amount of a 4-epimerase inhibitor can be sufficient to inhibit, slow, interrupt, halt, prevent, or arrest insulin resistance. A suitable effective amount can depend on the patient's age, sex, weight, and general health and can be determined by the attending physician. A suitable dosage can range from about 0.1 ng / kg body weight to 100 g / kg body weight per dosage. The dosage can range from 1 μg / kg to 10 g / kg body weight per dosage, for example, from 1 mg / kg to 1000 mg / kg body weight per dosage. In one embodiment, the dosage can range from 1 mg / kg to 500 mg / kg body weight per dosage. In another embodiment, the dosage can range from 1 mg / kg to 250 mg / kg body weight per dosage. In yet another embodiment, dosages may range from 1 mg to 200 mg per kg of body weight per dosage, for example, up to 50 mg per kg of body weight per dosage.

[0069] The terms "administer," "administering," or "administration" with respect to a compound, composition, or formulation disclosed herein refer to the introduction of an active agent (i.e., a 4-epimerase inhibitor) into the system of a subject in need of treatment. When an active agent is provided in combination with one or more other active agents, "administration" and its variants are each understood to include simultaneous and / or sequential introduction of the 4-epimerase inhibitor and the other active agents.

[0070] In certain embodiments, an effective amount of a 4-epimerase inhibitor for administration to a 70 kg adult human one or more times per day may contain from about 0.0001 mg to about 4000 mg, from about 0.0001 mg to about 3000 mg, from about 0.0001 mg to about 200 mg, from about 0.001 mg to about 1500 mg, from about 0.01 mg to about 1000 mg, from about 0.1 mg to about 1000 mg, from about 1 mg to about 1000 mg, from about 1 mg to about 100 mg, from about 10 mg to about 1000 mg, or from about 100 mg to about 1000 mg of the 4-epimerase inhibitor per unit dosage form. In certain embodiments, formulations of the 4-epimerase inhibitor may be at a dosage level sufficient to deliver from about 0.001 mg / kg to about 100 mg / kg, from about 0.01 mg / kg to about 50 mg / kg, from about 0.1 mg / kg to about 40 mg / kg, from about 0.5 mg / kg to about 30 mg / kg, from about 0.01 mg / kg to about 10 mg / kg, from about 0.1 mg / kg to about 10 mg / kg, and from about 1 mg / kg to about 25 mg / kg of body weight of the subject per day, one or more times per day, to achieve the desired therapeutic effect. In certain embodiments, an effective amount of a 4-epimerase inhibitor for intranasal administration to a 70 kg adult human may contain about 0.0001 mg to about 4000 mg, about 0.0001 mg to about 3000 mg, about 0.0001 mg to about 200 mg, about 0.001 mg to about 1500 mg, about 0.01 mg to about 1000 mg, about 0.1 mg to about 1000 mg, about 1 mg to about 1000 mg, about 1 mg to about 100 mg, about 10 mg to about 1000 mg, or about 100 mg to about 1000 mg of the extract or compound per unit dosage form. In some embodiments, a single dose may be sufficient to treat or prevent insulin resistance and related disorders, which may be delivered in one or more aliquots (e.g., one or more sprays of intranasal formulation per nostril) to achieve the desired dose. In other embodiments, multiple doses may be required to treat or prevent insulin resistance and related disorders. Administration can occur at intervals of minutes, hours, days, weeks, months, or years, or continuously over any one of these periods. The amount administered can be sufficient to treat or alleviate symptoms associated with insulin resistance or a related disorder.

[0071] The intranasal formulations disclosed herein can be administered to a person in need thereof via any suitable intranasal delivery method. Suitable methods for intranasal administration will be well known to those skilled in the art. The intranasal formulations disclosed herein can be administered as a spray or drops. Accordingly, suitable commercial packages containing intranasal formulations can be in any spray container known in the art. In one or more embodiments, the formulations disclosed herein can be administered via a spray device or container. The spray device can be a single unit dose system or a multiple dose system, including, for example, a bottle, a pump, and / or an actuator. Such spray devices are commercially available from, for example, Nemera, Aptar, Bespak, and Becton-Dickinson. In yet other embodiments, the formulations disclosed herein can be administered via an electrostatic spray device, such as that described in U.S. Pat. No. 5,655,517. Other suitable means for administering a formulation intranasally, according to the present invention, include a dropper, a syringe, a squeeze bottle, and any other means known in the art for applying a liquid to the nasal mucosa in a precise and repeatable manner.

[0072] Spray devices used to administer intranasal formulations can range from single-use metered dose spray devices, multi-use metered dose nasal spray devices, and can be administered by, but not limited to, spraying the solution into each nostril, as a gentle stream of liquid from a plunger, syringe, or the like, or as drops from a unit-dose or multi-dose squeeze bottle, or other means well known in the art for applying a liquid to the nasal mucosa in a precise manner.

[0073] In one or more embodiments, spray devices suitable for use with the present invention can typically deliver liquid volumes ranging from 0.01 to 0.15 mL with a single spray actuation. Typical dosing regimens for nasal spray products can range from one spray into a single nostril (naris) to two sprays into each nostril (naris). Repeated doses into the same nostril (naris) can also be administered. It is recognized that dosing schedules, including repeat dosing schedules, can be modified to achieve a desired pharmacokinetic profile. Furthermore, dosing schedules can be modified to achieve a rapid reduction, preferably cessation, of the severity of symptoms of insulin resistance or related disorders. In some cases, incremental increases in repeat dosing may be required to achieve a reduction in the severity or cessation of symptoms of a viral infection. For example, each repeat dose may require an increase of 25%, 50%, 75%, 100%, 150%, or 200% to achieve a reduction in the severity or cessation of symptoms of insulin resistance or a related disorder.

[0074] The amount of 4-epimerase inhibitor administered per dose or the total volume of the composition administered will depend on factors such as the nature and severity of the symptoms, the patient's age, weight, and general health, and the mode of administration. It is recognized that the relative amounts of excipients, solvents, diluents, salts, thickeners, sensates, buffers, and / or any additional components in the pharmaceutical compositions disclosed herein may also depend on the identity, size, and / or condition of the subject being treated and the mode of administration. For example, in some embodiments, the dosage of the 4-epimerase inhibitor required to achieve a therapeutically equivalent effect may be higher compared to other dosage forms. As used herein, the term "therapeutic equivalence" or "therapeutically equivalent" refers to different compositions containing the same active agent that produce the same clinical efficacy and safety profile and / or are pharmacologic equivalents of each other.

[0075] The formulation containing the 4-epimerase inhibitor can be administered in a single dose or in a series of doses. The appropriate dosage and administration schedule can be determined by the attending physician and may depend on the specific condition being treated, the severity of the condition, and the general age, health, and weight of the subject. It should be understood that the dosage ranges described herein provide guidance for administering the provided pharmaceutical compositions to adults. The amount to be administered can be determined by a physician or a person skilled in the art.

[0076] In certain embodiments, it is contemplated that a 4-epimerase inhibitor, such as a fluorinated N-acetyl-glucosamine derivative disclosed herein, can be administered to a subject in need thereof as an alternative or replacement for other conventional drugs for the treatment of insulin resistance or related disorders. In other embodiments, it is contemplated that a 4-epimerase inhibitor can be administered to a subject in need thereof as a supplement or adjunct to a conventional drug. In yet other embodiments, it is contemplated that a 4-epimerase inhibitor can be administered to a subject in need thereof in the absence of adjunctive therapy. Replacing conventional drugs for the treatment of metabolic disorders with a 4-epimerase inhibitor can be advantageous, particularly when the conventional drug is associated with one or more side effects.

[0077] In other embodiments, a 4-epimerase inhibitor may be administered to a subject in need thereof over separate periods with one or more additional therapeutic agents to address specific symptoms of insulin resistance or related disorders. In yet other embodiments, a subject in need thereof may be treated with a 4-epimerase inhibitor and one or more additional therapeutic agents (administered sequentially or in combination) during the treatment period. Such combination therapy may be particularly useful, for example, when an additive or synergistic therapeutic effect is desired. When the active agents are provided in separate dosage formulations, the active agents may be administered separately or in combination. In addition, administration of one active agent may be prior to, simultaneous with, or subsequent to administration of the other agent.

[0078] The phrase "combination therapy," as used herein, should be understood to refer to the administration of effective amounts, for example, using a first amount of a 4-epimerase inhibitor and a second amount of an additional suitable therapeutic agent. The "effective amount" of the second agent depends on the type of drug used. Suitable dosages are known for approved drugs and can be adjusted by those skilled in the art according to the subject's condition, the type of condition being treated, and the amount of compound or composition being used. In certain embodiments, the 4-epimerase inhibitor and the additional therapeutic agent are each administered in an effective amount (i.e., an amount that would be therapeutically effective if administered alone). In other embodiments, the 4-epimerase inhibitor and the additional therapeutic agent are each administered in an amount that does not produce a therapeutic effect alone (a subtherapeutic dose). In still other embodiments, the 4-epimerase inhibitor can be administered in an effective amount, while the additional therapeutic agent is administered in a subtherapeutic dose. In yet other embodiments, the 4-epimerase inhibitor can be administered in a subtherapeutic dose, while the additional therapeutic agent is administered in an effective amount.

[0079] As used herein, the terms "in combination" and "co-administration" can be used interchangeably to refer to the use of more than one therapy (e.g., one or more prophylactic and / or therapeutic agents). The use of the terms does not restrict the order in which the therapies (e.g., prophylactic and / or therapeutic agents) are administered to a person in need thereof. Co-administration encompasses the administration of a 4-epimerase inhibitor and one or more additional therapeutic agents essentially simultaneously, for example, in a single pharmaceutical composition having a fixed ratio of the first and second amounts, or as separate dosage forms. In addition, such co-administration also encompasses the sequential use of each compound in either order. When co-administration involves separate administration of a first amount of a 4-epimerase inhibitor and a second amount of an additional therapeutic agent, they are administered sufficiently close in time to have the desired therapeutic effect. For example, the duration of each administration capable of producing the desired therapeutic effect can range from several minutes to several hours and can be determined taking into account the characteristics of each compound, such as potency, solubility, bioavailability, plasma half-life, and kinetic profile.

[0080] In one or more embodiments in which a 4-epimerase inhibitor is administered in combination with an additional therapeutic agent, the additional therapeutic agent can be any therapeutic agent that provides the desired therapeutic result. Specifically, the additional therapeutic agent can be selected from known therapeutic agents for the treatment or prevention of insulin resistance or related disorders (including one or more symptoms thereof). Such therapeutic agents will be known to those skilled in the art. As non-limiting examples, known therapeutic agents for the treatment of obesity or type 2 diabetes may be suitable for use in combination with a 4-epimerase inhibitor in the present invention.

[0081] When a 4-epimerase inhibitor is administered in combination with an additional therapeutic agent, the additional agent may be administered in any "effective amount" that provides the desired therapeutic activity, as described above. The appropriate dosage and administration schedule of the additional therapeutic agent can be determined by the attending physician and may depend on the specific condition being treated, the severity of the condition, and the general age, health, and weight of the subject. Unless otherwise specified, it should be understood that the dosage ranges described herein provide guidance for administering the provided pharmaceutical composition to adults. The amount to be administered can be determined by a physician or person skilled in the art.

[0082] The 4-epimerase inhibitor and its formulation can be contained in a kit. The kit can include, for example, a 4-epimerase inhibitor and an additional agent, each packaged or formulated individually or packaged or formulated in combination. Thus, the 4-epimerase inhibitor can be present in a first container, and the kit can optionally include one or more agents in a second container. The container(s) can be disposed in a package, and the package can optionally include administration or dosing instructions. The kits disclosed herein can include the 4-epimerase inhibitor in a form suitable for intranasal administration. The kit can optionally include instructions describing how to use the pharmaceutical composition in one or more of the methods described herein (e.g., to prevent or treat a metabolic disease). The kit can optionally include a second pharmaceutical composition comprising one or more additional agents described herein for combination therapy, a pharmaceutically acceptable carrier, a diluent, an adjuvant, and / or an excipient. The pharmaceutical compositions comprising the 4-epimerase inhibitor and the second pharmaceutical composition included in the kit can optionally be combined in the same pharmaceutical composition.

[0083] Those skilled in the art will recognize that the invention described herein is subject to variations and modifications other than those specifically described. It is to be understood that the invention described herein includes all such variations and modifications. The invention also includes all such steps, features, methods, compositions, and compounds referred to or indicated herein, individually or collectively, and any and all combinations of any two or more of such steps or features.

[0084] Certain embodiments of the present invention will now be described with reference to the following examples, which are for illustrative purposes only and are not intended to limit the scope of the generality of the foregoing. [Example]

[0085] [Table 1]

[0086] General Procedure General Procedures A. Animals Mice were maintained on a 12-h light / dark cycle in a temperature-controlled, high-barrier facility with free access to food and water in accordance with the NHMRC Australian Code of Practice for the Care and Use of Animals. C57BL / 6J and Balb / C mice were obtained from the Australian Animal Resource Centre, while Agrp-IRES-Cre (strain no. 012899), db / db (strain no. 000697), Npy-GFP (strain no. 006417), Pomc-GFP (strain no. 009593), LSL-Cas9 (strain no. 028551), and NZO (strain no. 002105) mice were obtained from Jackson Laboratories, USA. To generate Agrp-IRES-Cre;LSL-Cas9-GFP (AgRP-Cas9) mice, hemizygous Agrp-IRES-Cre mice were mated with homozygous LSL-Cas9-GFP mice. Male Sprague-Dawley rats (ARC, Canning Vale, Australia) were housed individually with nesting / enrichment materials at a room temperature of 23 ± 2 °C, room humidity of 40%–70%, and a reverse 12-h light / dark cycle (lights off at 9:00 AM). Animals were fed either a standard chow diet (Barastoc, Ridley AgriProducts, Australia) or a high-fat, high-sugar diet (mice: 43% and 20% of total energy from fat and carbohydrate, respectively, SF04-001; Specialty Feeds, Australia; rats: 30% of total energy from fat, SF17-204; Specialty Feeds, Australia). To induce late-stage type 2 diabetes in mice, male C57Bl / 6J mice were fed a HFHS diet for 4 weeks, followed by six injections of streptozotocin (STZ, 40 mg / kg, ipSigma, in 50 mM sodium citrate buffer, pH 4.5) over a 2-week period. Blood glucose levels were monitored, and mice showing stable blood glucose levels above 15 mM were used for downstream experiments. Experiments were approved by the University of Melbourne Animal Ethics Committee (10323, 10324, 10352, 10385, 10427, 21712, 22282, 22404).

[0087] General Procedure B. Genotyping DNA extracted from tail biopsies using tissue extract-PCR buffer (MDX004, Meridian Bioscience, OH) and DNA was amplified by PCR using MyTaq™ HS Red Mix (BIO-25048, Meridian Bioscience, OH) with the following primers: Cre (forward: 5' GCG GTC TGG CAG TAA AAA CTA TC (SEQ ID NO: 1); reverse: 5' GTG AAA CAG CAT TGC TGT CAC TT (SEQ ID NO: 2)), LSL-Cas9 (wt forward: 5' AAG GGA GCT GCA GTG GAG TA (SEQ ID NO: 3); reverse: 5' CAG GAC AAC GCC CAC ACA (SEQ ID NO: 4), mt forward: 5' TCC CCA TCA AGC TGA TCC (SEQ ID NO: 5); mt reverse: 5' CTT CTT CTT TGG GGC CAT CT The following primers were used to detect mouse InsR (ΔInsr) alleles: Npy-GFP (common forward: 5' TAT GTG GAC GGG GCA GAA GAT CCA GG (SEQ ID NO: 7); wt reverse: 5' CCC AGC TCA CAT ATT TAT CTA GAG (SEQ ID NO: 8); mt reverse: 5' GGT GCG GTT GCC GTA CTG GA (SEQ ID NO: 9)); Pomc-GFP (forward: 5' AAG TTC ATC TGC ACC ACC G (SEQ ID NO: 10); reverse: 5' TGC TCA GGT AGT GGT TGT CG (SEQ ID NO: 11)). CRISPR ) was monitored for CRISPR-mediated loss: forward 5' GAG ATG GTC CAC CTG AAG GA '3 (SEQ ID NO: 12), reverse 5' GTG AAG GTC TTG GCA GAA GC '3 (SEQ ID NO: 13).

[0088] General Procedure C. Immunohistochemistry For immunohistochemistry in the brain, mice were anesthetized and transcardially perfused with heparinized saline (10,000 units / L porcine heparin) followed by 10% neutral buffered formalin. Brains were postfixed for 16 hours and cryoprotected by holding them in 30% sucrose in PBS at 4°C for 3 days before freezing on dry ice. 30 μm sections (120 mm apart) were cut in the coronal plane throughout the rostral to caudal extent of the hypothalamus. Sections were stored long-term at -20°C in cryoprotectant (30% ethylene glycol, 20% glycerol in PBS). For detection of HABP and versican alone, sections were subjected to heat-induced epitope retrieval using citrate buffer (10 mM sodium citrate, 0.05% Tween® 20, pH 6.0) at 95°C for 20 minutes.

[0089] For the detection of aggrecan, GFP, HABP, parvalbumin, mCherry, versican, tenascin-C, HAPLN1, neurocan, phosphacan, and brevican, WFA and WFA-FITC sections were washed with blocking buffer (0.3% The cells were incubated in Triton X-100, 5% normal goat serum (Gibco, ThermoFisher, MA, 0.02% sodium azide) for 1 h at room temperature, followed by incubation with rabbit anti-aggrecan (1:1000, AB1031, Millipore, MA), chicken anti-GFP (1:2000; ab13970, Abcam, Cambridge, UK), biotinylated HABP (1:100, 385911, Burlington, MA), sheep anti-parvalbumin (1:1000, in-house), rabbit anti-dsRed (1:2000, 600-401-379, Rockland, PA), rabbit anti-versican (1:1000, AB1033, Millipore, MA), tenascin-C (1:500, M1-B4, Developmental Studies Hybridoma) and IgG. Bank, Iowa), HAPLN1 (1:500, 9 / 30 / 8-A-4, Developmental Studies Hybridoma Bank, Iowa), neurocan (1:300, 1F6-S, Developmental Studies Hybridoma Bank, Iowa), phosphacan (1:300, 3F8, Developmental Studies Hybridoma Bank, Iowa), brevican (1:500, 610895, BD Transduction Laboratories), biotinylated WFA (1:2000, L1516; Sigma-Aldrich, MO), WFA-FITC (1:2000, FL-1351-2, Vector Biosciences) Laboratories, CA), rabbit anti-PGP9.5 (1:1000, 14730-1-AP, Proteintech, IL), or guinea pig anti-AgRP (1:500, AS506, Antibodies Australia, Melbourne, AUS) in 1% blocking buffer overnight at 4°C.After washing with PBS-T (0.3% Triton X-100 in PBS + 0.02% sodium azide), sections were incubated with goat anti-chicken Alexa Fluor 488 (ab150169, Abcam, Cambridge, UK), goat anti-rabbit Alexa Fluor-488, 595, 647 (ab150077, ab150080, ab150083, Cambridge, UK), donkey anti-sheep Alexa Fluor 594 (ab150180, Abcam, Cambridge, UK), and Alexa Fluor 594, 647 streptavidin-conjugated (405240, BioLegend, CA) secondary antibodies in 5% blocking buffer for 2 hours at room temperature. Sections were mounted with Mowiol 4-88 mounting medium and visualized under an Olympus BX61 microscope. Images were taken with an Olympus BX61 camera, acquired using Olympus cellSens Dimension software v2.1, and processed using ImageJ software (NIH, MA). Images for cellular internalization were taken with a Zeiss LSM880 Airyscan Fast confocal microscope, acquired using Zeiss ZEN software v2.1, and processed using ImageJ software (NIH, MA). The brightness and contrast of color-merged images were adjusted to aid in the analysis of match.

[0090] For ingWAT immunohistochemistry, ingWAT was immediately dissected and fixed in buffered formalin solution on a rocking platform for 48 hours. Tissues were embedded in paraffin at room temperature, and 5-μm sections were prepared 100 μm apart. For hematoxylin and eosin (H&E), tissue sections were incubated in hematoxylin for 3 minutes, followed by eosin for 30 seconds. For UCP-1 detection, sections were subjected to antigen retrieval in citrate buffer (10 mM sodium citrate, 0.05% Tween® 20, pH 6.0) at 95°C for 20 minutes. Sections were incubated in 5% blocking buffer at room temperature for 1 hour, followed by overnight incubation in rabbit anti-UCP-1 (1:1000; ab10983, Abcam, Cambridge, UK) in 1% blocking buffer at 4°C. After washing with PBS-T, sections were incubated with goat anti-rabbit Alexa Fluor 488 (ab150077, Abcam, Cambridge, UK) secondary antibody in 5% blocking buffer for 2 hours at room temperature. Sections were incubated in DAPI (20 ng / ml in PBS) for 10 minutes, then mounted with Mowiol 4-88 mounting medium and visualized under an Olympus BX61 microscope. Images were captured using an Olympus BX61 camera, acquired using Olympus cellSens Dimension software v2.1, and processed using ImageJ software (NIH, MA). The brightness and contrast of color-merged images were adjusted to aid in matching analysis.

[0091] General Procedure D. Functional p-AKT Immunohistochemistry Mice were injected intraperitoneally with vehicle (PBS) or insulin (3 mU / g, i.p., Actrapid, Nova Nordisk, Denmark), and then transcardially perfused with 10% neutral buffered formalin for 15 minutes (as described above). Brains were postfixed for 16 hours at room temperature on a rocking platform and then cryoprotected in 30% sucrose in PBS for 2 days before being frozen on dry ice. 30 μm sections were cut in the coronal plane throughout the rostral to caudal extent of the hypothalamus. Sections were pretreated in 0.3% glycine for 10 minutes, washed in PBS-T, and incubated in 0.03% SDS for 10 minutes. Sections were then blocked in 5% blocking buffer for 1 hour at room temperature and incubated with rabbit anti-p-AKT (Ser-473) (1:300; #4060, Cell Signaling Technology, Beverly, MA) in 1% blocking buffer for 48 hours. Sections were then incubated in 5% blocking buffer containing either goat anti-rabbit Alexa Fluor 647 (ab150083, Abcam, Cambridge, UK) or biotinylated goat anti-rabbit (BA-1000, Vector Laboratories, CA, without sodium azide in blocking buffer). Fluorescent sections were mounted with Mowiol 4-88 mounting medium and visualized using an Olympus BX61 microscope. Images were captured using an Olympus BX61 camera, acquired using Olympus cellSens Dimension software v2.1, and processed using ImageJ software (NIH, MA). For chromogenic detection, p-AKT signals were amplified using the VECTASTAIN® ABC-HRP kit (1;500, PK-4000, Vector Laboratories, CA) and visualized using a 0.1% H2O2DAB solution (3,30-diaminobenzidine, ICN980681, Thermo Fisher, MA) peroxidase substrate kit (Vector Laboratories, UK).p-STAT3 and p-AKT immunopositive cells were visualized using a Leica DM2000 LED brightfield microscope with a Leica DMC6200 camera and Leica Application Suite X software.

[0092] General Procedure for E.CSPG-ECM Immunofluorescence Analysis ARC CSPG-ECM was assessed stereologically throughout the rostral to caudal ARC. The ARC was divided into three regions: the rostral ARC (approximately -1.22 / -1.58 mm), the medial ARC (approximately -1.58 / -1.94 mm), and the caudal ARC (approximately -1.94 / -2.18 mm). CSPG-ECM was quantified in the VMH and RSG cortex (approximately -1.58 / -1.94 mm).

[0093] All image quantification was performed with Image J (NIH) software (NIH, MA). Raw images underwent background subtraction using the rolling ball algorithm to minimize any potential variance from background and tissue autofluorescence. To quantify the area and intensity of CSPG-ECM within each brain region (ARC, VMH, or RSG cortex), images were thresholded and binarized to create a CSPG-ECM-only region-of-interest (ROI) mask. For each brain region, the CSPG-ECM ROI area (μm 2 The area and intensity (sum of all pixel intensities within the ROI) were calculated. This process was automated to minimize bias and account for differences in brain nuclei size across multiple images. Brain nuclei were defined according to the Paxinos and Franklin mouse brain atlas (http: / / labs.gaidi.ca / mouse-brain-atlas / ). The area and intensity of CSPG-ECM within each region were normalized to their respective controls.

[0094] To determine the colocalization of ECM components (HA, HAPLN1, tenascin-C, aggrecan, versican, phosphacan, brevican, and neurocan) within CSPG-ECM (WFA-positive staining), two masks were generated per image: one for overall CSPG-ECM staining and one for component staining within the ARC. Overall area and intensity were calculated for the entire CSPG-ECM structure. The area and intensity of components within the CSPG-ECM were determined by quantifying expression only within the total CSPG-ECM mask. This allowed for characterization of ECM components specifically expressed within the ARC CSPG-ECM. The area and intensity of CSPG-ECM within each region were normalized to their respective controls. Conversely, to determine the colocalization of WFA-labeled ARC CSPG-ECM within ARC CSPG-ECM components, two masks were generated per image: one for overall CSPG-ECM staining and one for component staining within the ARC. Overall area and intensity were calculated for all component structures. The area and intensity of CSPG-ECM containing components were determined by quantifying only WFA expression within the total component mask. The area and intensity of CSPG-ECM within each region were normalized to their respective controls. This combined approach further characterizes the specificity of components to CSPG-ECM regions.

[0095] General Procedure F. Quantification of ARC Neurons within CSPG-ECM To determine which metabolically relevant ARC neurons are housed within CSPG-ECM during metabolically diseased brain development, Npy-GFP (to visualize AgRP / NPY neurons) and Pomc-GFP (to visualize POMC neurons) mice were analyzed from 0, 4, and 12 weeks of HFHS. ARC sections were stained for GFP and WFA as described for immunohistochemistry sections and analyzed using Image J (NIH) software. To determine the number of GFP-positive neurons housed within CSPG-ECM, two masks were generated. To define the CSPG-ECM structure in the ARC image, thresholding and binarization were performed to create a CSPG-ECM mask. To identify individual GFP-positive neurons, the image was thresholded and binarized to create a GFP mask. To define individual GFP-positive neurons, the GFP mask was segmented using a watershed separation algorithm. The total number of GFP-positive cells was counted within the entire ARC region and the CSPG-ECM mask. This quantified the percentage of GFP cells encompassed by CSPG-ECM in the ARC.

[0096] To determine the intensity of CSPG-ECM specifically surrounding individual GFP cells within the ARC, GFP images were thresholded and binarized. Using dilation, distance map, and Voronoi processes in ImageJ software, a 1.29 μm ROI (the average size of the ECM surrounding cortical neurons) was generated around each GFP cell. This generated a mask that allowed for specific analysis of the CSPG-ECM bordering individual GFP cells. This mask was used to determine the CSPG-ECM staining intensity surrounding GFP cells residing within the ARC CSPG-ECM.

[0097] General Procedure G. Behavioral Satiety Sequence Mice were fasted overnight and individually housed in transparent cages with free access to water. Two hours after the onset of the light cycle (9:00 AM), pre-weighed food was presented to the mice, who were then carefully observed for 90 minutes without disturbance. Momentary behaviors were scored every 30 seconds throughout the 90-minute observation period. Behaviors during each 30-second interval were recorded according to the following categories: feeding (animals biting, or gnawing at the hopper in an attempt to obtain food), drinking (animals licking the water spout), grooming (animals scratching, biting, or licking any part of their anatomy), resting (animals curled up with their eyes closed and resting their heads), active (animals exhibiting activity, including locomotion, sniffing, and rearing), or inactive (animals immobile while conscious or showing signs of sickness behavior). Data were collected every 5 minutes and several variables were assessed, including the average percentage of time the mice spent in each recorded behavior (% of all behaviors), food intake, the transition from feeding to resting, and the time to satiety (the time when the frequency of feeding behavior intersects with the frequency of resting behavior).

[0098] General Procedure H. Hyperinsulinemic-hyperglycemic clamp in conscious freely behaving mice For the hyperinsulinemic-hyperglycemic clamp, mice were anesthetized under isoflurane, and the right jugular vein was catheterized for infusion, as previously described by Dodd et al., 2018. The catheter was attached to an implant button (BMSW25, RWD Life Sciences, Shenzhen, China). The implant button was capped to allow group mouse placement, and the catheter was maintained patent by daily flushing with 40 μL of saline containing 200 units / mL heparin. On the day of the experiment, food was removed at 7:00 AM. After a 3.5-hour fast, a priming (1 min, 1.25 μCi / min) continuous infusion (0.05 μCi / min) of [3-3H]glucose (NET331A001MC, PerkinElmer, MA) was administered to measure whole-body glucose turnover, as previously described by Dodd et al., 2018. After 90 min, mice received a 40 mU / kg insulin bolus over 10 min, followed by a continuous insulin infusion (4 mU / kg / min with geloflurane). Hyperglycemia (blood glucose of approximately 8-10 mM) was maintained by a variable infusion of a 30% glucose solution.

[0099] Tail blood samples were collected during steady-state conditions (Ra = Rd) and at 80, 90, 100, 110, and 120 minutes to determine Rd and Ra, as described above. At 120 minutes, a 13 uCi bolus of [ 14 C]-2-deoxy-D-glucose (NEC495A250UC, PerkinElmer, MA) was infused into the jugular vein and blood was sampled at 122, 125, 135, 145, and 155 minutes. At the end of the experiment, tissues were extracted for determination of glucose uptake.

[0100] General Procedure I. Feeding C57BL / 6J mice fed HFHS for 12 weeks were bilaterally injected with vehicle or chABC in the ARC. 24-hour food intake was determined for mice treated with chABC in the ARC, and a cohort of vehicle-treated mice treated in the ARC was pair-fed, thereby limiting food availability to the average food consumed by mice treated with chABC in the ARC.

[0101] General Procedure J. Metabolic Assessment Metabolic measurements were performed at the Melbourne Mouse Metabolic Phenotyping Platform (The University of Melbourne, Australia). Glucose tolerance tests were performed in conscious mice fasted for 6 h by intraperitoneally injecting D-glucose (2 mg / g lean body mass and 1 mg / g lean body mass for db / db and HFHS+STZ mice) and measuring glucose in tail blood immediately before and 15, 30, 45, 60, 90, and 120 min after injection using an Accu-Check glucometer (Roche, Germany). The area under the glucose excursion curve was determined and expressed as mmol / l × min. Fasted (12-h fasting) plasma insulin or glucose levels were determined using a rat / mouse insulin ELISA (EZRMI-13K, Merck Millipore, CA) or an Accu-Check glucometer, respectively. HOMA-IR was calculated using the equation [(glucose × insulin) / 405]. Fat percentage was measured using a TD-NMR minispec (Bruker Optics Inc., Billerica, MA).

[0102] Mice were acclimated for 24 h and then monitored for 48 h in an environmentally controlled Promethion Metabolic Screening System (Sable Systems International, NV) equipped with indirect open-circuit calorimetry, food consumption, and activity monitors to measure activity, calorie intake, and energy expenditure. Respiratory index was calculated as the respiratory exchange ratio, the ratio of CO2 production to O2 consumption, and energy expenditure was calculated using the Weir formula (Kcal h-1 = 60 × (0.003941 × VO2 + 0.001106 × VCO2)). Energy expenditure was analyzed and adjusted using ANCOVA to account for differences in body weight / composition using scripts available on the National Mouse Metabolic Phenotyping Centers (MMPC, Nashville, TN, USA) Energy Expenditure Analysis Page (https: / / www.mmpc.org / shared / regression.aspx).

[0103] To provide an index of WAT and BAT thermogenesis, infrared thermography was used to measure temperature changes in the inguinal and interscapular regions, as previously described (Dodd et al., 2019). A FLIR T1010 thermal imaging camera (FLIR Systems Australia Pty Ltd, Victoria, Australia) was mounted on a tripod, and the animal was positioned at a standard distance of 70 cm from the camera. Animals were anesthetized, shaved in the areas of interest, and whole-body images were collected in both prone and supine positions. Temperatures were analyzed using the FLIR ResearchIT Max 4 program (FLIR Systems, OR, United States). Peak temperatures within WAT and BAT were determined.

[0104] K. General Procedures for Stereotaxic Surgery All stereotaxic injections were performed under isoflurane anesthesia using an ultraprecise stereotaxic instrument (963 Kopf, Munich, Germany) or an ultraprecise rotating stereotaxic instrument (69100, RWD Life Sciences, Shenzhen, China) together with a stereotaxic nanoinjector (788130, KD Scientific, Holliston, MA) equipped with a neurosyringe (Hamilton, NE).

[0105] To degrade CSPG-ECM within the ARC, mice received either 15 mU / side of active chABC (C3667, Sigma, St. Louis, MI, dissolved in 1 M trehalose) or heat-inactivated chABC protein as vehicle (chABC in 1 M trehalose was heat-inactivated at 85°C for 45 min as previously described by Alonge et al., 2020) in a total volume of 150 nl / side (unless otherwise stated). To pulse CSPG-ECM within the ARC or RSG, mice received biotinylated WFA (0.3 μg / side, in a volume of 150 nl) bilaterally (unless otherwise stated). To disrupt IR in AgRP neurons, AgRP-Cas9 mice fed HFHS for 12 weeks were stereotaxically injected with an AAV expressing a U6-driven guide RNA targeting the InsR gene or a scrambled sequence (5' GTG TAG TTC GAC CAT TCG TG' (SEQ ID NO: 14)) along with a CAG-driven mCherry FLEX switch. Unless otherwise noted, injections were performed bilaterally into the ARC (coordinates, bregma: anterior-posterior, -1.70 mm; dorsal-ventral, -5.85 mm; lateral, + / - 0.18 mm, 200 nL / side) or RSG (coordinates, bregma: anterior-posterior, -1.40 mm; dorsal-ventral, -1.80 mm; lateral, + / - 0.50 mm, 200 nL / side). WFA-biotin was injected unilaterally into the cc (coordinates, bregma: anterior-posterior, −1.40 mm; dorso-ventral, −5.80 mm; lateral, + / −0.20 mm, 200 nl / side).

[0106] General Procedure for L. Virus Production To generate the AAV-gScrambled (pAAV-U6>mScramble-GTGTAGTTCGACCATTCGTG (SEQ ID NO: 14))-CAG>LL:rev(mCherry):rev(LL):WPRE) and AAV-gIR (pAAV[-U6>mInsr[gRNA-TATCGACTGGTCCCGTATCC (SEQ ID NO: 15)]-U6>mInsr[gRNA-GTCTGTCCAGGCACCGCCAA (SEQ ID NO: 16)]-CAG>LL:rev(mCherry):rev(LL):WPRE) viral vectors, sgRNAs were first designed using online CRISPR tools (http: / / crispr.mit.edu and http: / / chopchop.cbu.uib.no / ). Potential off-target gRNA binding was computationally assessed using OffSpotter (https: / / cm.jefferson.edu / Off-Spotter / ), and guides showing three or more mismatches with nonspecific genomic regions were considered (Anderson, et al., 2015). For AAV-gScrambled, the pUp-U6>scrambled gRNA vector was generated using Gibson assembly of the pDONR P4-P1R backbone and primers 5' GGGGACAACTTTGTATAGAAAAGTTGGAGGGCCTATTTCCCATGATTC'3 (SEQ ID NO: 17) and 5' GGGGACTGCTTTTTTGTACAAACTTGAAAAAAGCACCGACTCGGTGCC'3 (SEQ ID NO: 18). For AAV-gIR, the pUp-U6>mInsr[gRNA-TATCGACTGGTCCCGTATCC (SEQ ID NO: 15)]-U6>mInsr[gRNA-GTCTGTCCAGGCACCGCCAA (SEQ ID NO: 16)] gRNA vector was generated using Gibson assembly of the AarI-digested pUp-U6-gRNA-AarI-Stuffer-AarI backbone and primers 5' ATATCTTGTGGAAAGGACGAAACACCGTATCGACTGGTCCCGTATCCG' (SEQ ID NO: 19) and 5' AACTTGCTATTTCTAGCTCTAAAACTTGGCGGTGCCTGGACAGAC' (SEQ ID NO: 20).For both AAV-gScrambled and AAV-gIR, the p-Up vector was cloned alongside pDown-CAG and pTail-LL:rev(mCherry):rev(LL) to generate the final vector by LR reaction using the Gateway method. AAV vectors were packaged into AAV-DJ / 8 stereotypes at titers of >2 10^13 GC / ml. All vector cloning and AAV packaging was performed by VectorBuilder (Chicago, IL).

[0107] General Procedures Insulin Leakage in M.ARC C57BL / 6J mice fed HFHS for 12 weeks or age-matched diet-fed controls were bilaterally infused with vehicle or chABC into the ARC. Three days after injection (before weight differences were observed), mice were fasted for 6 hours. To assess insulin leakage into the ARC, mice were administered insulin-FITC (50 μg / animal in a 100 μl volume, intravenous, I3661, Sigma, St. Louis, MI) or FITC (64.3 μmol / animal in a 100 μl volume, intravenous, F3651, Sigma, St. Louis, MI). Thirty minutes after injection, mice were perfused (as described above). To assess insulin leakage into the ARC despite the BBB, mice were administered insulin-FITC (1 μg / animal in a 2 μl volume) directly into the lateral ventricle. To do this, mice were anesthetized and stereotaxically injected (as described above) with insulin-FITC into the lateral ventricle (coordinates, bregma: anterior-posterior, -0.20 mm; dorso-ventral, -2.4 mm; lateral, +0.10 mm) at a rate of 200 nl / min. Twenty minutes after the start of the injection, mice were perfused (as described above). To assess insulin-FITC, brains were postfixed overnight and cryopreserved in 30% sucrose in PBS. To preserve spontaneous fluorescence signal, brains and sections were kept in the dark and mounted and imaged immediately after sectioning.

[0108] General Procedure N. Lateral Ventricular Cannulation Under isoflurane anesthesia, C57BL / 6J or AgRP-Cas9 mice fed HFHS for 12 weeks were stereotactically implanted into the right ventricle (0.2 mm posterior and 1.0 mm lateral to bregma) using a guide cannula. The guide cannula was positioned 1.3 mm above the injection site (1 mm ventral to the skull surface). AgRP-Cas9 mice were treated with either AAV-gScrambled or AAV-gIR, and the guide cannula was placed 7 days after AAV administration. Mice were delivered ICV vehicle (ddH2O), fluorosamine (100 μg / animal / day or 250 μg / animal / day) in a volume of 2 μl / animal, and all compounds approximately 1 hour before lights out (7:00 PM).

[0109] General Procedure O. Intranasal Drug Delivery Conscious mice were restrained by scruffing and held inverted parallel to the floor with their chin at an approximately 180-degree angle to their neck. Using a 10-μL tip, a pipettor was loaded with 5 μl of vehicle (ddH2O) or fluorosamine (20 μl of 1 mg / animal or 20 μl of 5 mg / animal). The loaded pipettor tip was positioned at a 45-degree angle near the left nostril, and the drug was expelled to form a small 5-μl droplet at the tip for the mouse to inhale. Immediately after the mouse inhaled the first droplet, the remaining solution was expelled to form another small droplet for the mouse to inhale through the same nostril. The mice were held in this position for 15 seconds before the procedure was repeated with the right nostril. The mice were returned to their cages for 2 minutes, and the process was repeated so that each mouse received four 5-μl droplets each, delivering a total of 20 μl of solution. All drugs were delivered approximately 1 hour before lights out (7 pm).

[0110] General Procedures: Validation and Quantification of P.CSPG-ECM Tracker To assess CSPG-ECM turnover in the ARC, RSG, or CC, mice underwent stereotaxic injection of biotinylated WFA (WFA-biotin) as described in the Stereotaxic Surgery section. At the experimental endpoint, mice were transcardially perfused, and assessment of pulse-labeled ARC CSPG-ECM was performed by immunofluorescence detection of WFA-biotin (pulse-labeled CSPG-ECM) and WFA-FITC (total CSPG-ECM) as described in the Immunohistochemistry section.

[0111] To track pulsed WFA-biotin within the ARC, sections were imaged and analyzed using Image J (NIH) software. Raw images underwent background subtraction using a rolling ball algorithm to minimize background and tissue autofluorescence. To quantify the stained area within the ARC, images were thresholded and binarized to create ROI masks for WFA-biotin and WFA-FITC. For each image, the stained ROI area (μm 2 ) and intensity (sum of all pixel intensities within the ROI) were calculated.

[0112] To validate the CSPG-ECM tracker technology, 8-week-old C57BL / 6J mice were stereotactically unilaterally injected with WFA (0.3 μg / side in a volume of 150 nL), followed by a pulse injection of CSPG-ECM into one side of the ARC and saline into the other side. One day later, mice were transcardially perfused, and ARC brain sections were stained and analyzed for CSPG-ECM tracker analysis. To determine how faithfully pulsed WFA-biotin represented the current CSPG-ECM, we quantified the percentage area where WFA-biotin (pulsed) colocalized with WFA-FITC (total current CSPG-ECM).

[0113] To verify that the tracked WFA-biotin signal represented authentic CSPG-ECM staining, WFA (0.3 μg / side in a volume of 150 nL) was injected bilaterally into the ARC of 8-week-old C57BL / 6J mice. Three days later, mice received a unilateral ARC injection of chABC (15 mU / side in a volume of 150 nL) or vehicle to degrade WFA-biotin-bound CSPG-ECM. To determine the specificity of pulsed WFA-biotin, the area and intensity of WFA-biotin staining were quantified and compared between the chABC- and ARC vehicle-treated sides.

[0114] To assess CSPG-ECM turnover in lean and obese mice, WFA-biotin (0.3 μg / side in a volume of 150 nL) was stereotactically injected bilaterally into the ARC of C57BL / 6J mice fed HFHS for 12 weeks or age-matched controls. Brains were extracted either the day after surgery (day 0) or 1, 3, 5, and 10 weeks after injection. Brain sections were stained for the presence of WFA-biotin and WFA-FITC, and the area of ​​WFA-biotin staining was quantified as described above. To assess CSPG-ECM turnover, the WFA-labeled CSPG-ECM present at the start of the experiment (day 0) was compared with the CSPG-ECM remaining at weeks 1, 3, 5, and 10. WFA-FITC labeling of CSPG-ECM was performed at each time point to verify the presence of ARC CSPG-ECM and ensure that changes in WFA-biotin labeling were not due to loss of CSPG-ECM over time. The same process was used to assess turnover in CC RSGs and blood vessels.

[0115] General Procedure Q.ARC CS-GAG and HA Quantification Microdissected ARC tissue from male mice fed a HFHS diet for 12 weeks, starting from day 0, was homogenized in an extraction buffer containing 8 M urea, 0.5% Triton® x-100, 5 mM Tris 2-carboxyethylphosphine, and cOmplete™ Mini ETDA-free protease inhibitor cocktail (Merck) for 30 minutes after gentle mixing. Samples were centrifuged at 5000 rpm for 30 minutes, and the supernatant was collected and buffer exchanged into PBS using an Amicon Ultracell-10k MWCO centrifuge tube. The protein concentration of each sample was estimated using a Bradford assay. 20 μg of each protein extract was reduced with 5 mM dithiothreitol for 30 minutes at 50°C and alkylated with 10 mM iodoacetamide for 1 hour at room temperature. The tissue was then blotted onto a 0.45 μm PVDF membrane (Millipore, catalog no. IPVH20200) and allowed to dry overnight. Each sample spot was transferred to a 96-well plate and blocked using a 1% (v / v) polyvinylpyrrolidone solution.

[0116] The disaccharide analysis procedure was adapted from Moh et al., 2022, with the following modifications: GAG disaccharides were released from PVDF sample spots using an enzyme mixture containing 5 mU of chondroitinase ABC (chABC, Sigma, catalog no. C3667), 50 ng of heparinase I / II / III (R&D Systems) in 100 mM ammonium acetate pH 7, 5 mM calcium chloride, and incubated overnight at 30°C. An additional mixture of purified GAG polysaccharides, each containing 1 μg of bovine kidney heparan sulfate (Sigma-Aldrich, H7640), 10 μg of shark chondroitin sulfate (Sigma-Aldrich, C4382), and 1 μg of Streptococcus equi HA (Sigma-Aldrich, 53747), was digested alongside the samples as an enzyme reaction control and retention time standard. The digested disaccharides were collected and dried under low pressure for labeling using 2-aminobenzamide (2-AB) according to a commercially available protocol (Ludger LT-KAB-VP24-Guide-v2.0). Samples were labeled with 2-AB alongside a standard mixture of eight common HS (Iduron, UK, HS mix) and eight common CS disaccharides (Iduron, UK, CS mix). The samples were washed twice with octanal to remove excess labeling reagent. The washed samples were dried in the aqueous phase and resuspended in 75% acetonitrile containing 10 mM ammonium acetate at pH 6.8.

[0117] The labeled disaccharides were separated by liquid chromatography using a SeQuant ZIC-HILIC column (3.5 μm, 1 mm x 150 mm) at 35 °C using an Agilent 1260 Infinity II with fluorescence detection. The mobile phase solvent A (10 mM NH4Ac, pH 6.8) and solvent B (90% acetonitrile in 10 mM NH4Ac pH 6.8) were run at a constant flow rate of 50 μl / min in microflow mode with the following gradient parameters: 0-3 min - 100% B, 4 min - 90% B, 20 min - 88% B, 35 min - 70% B, 36-40 min - 60% B, and 42-50 min - 100% B. Fluorescence detection was performed with excitation and emission wavelengths set at 320 nm and 420 nm, respectively. Peaks were identified using a standard panel and polysaccharide digestion controls as retention time standards, and abundance was manually quantified by peak area.

[0118] R. Patch Clamp Electrophysiology General Procedure Npy-GFP male mice were maintained on a HFHS diet for 12 weeks before stereotactic injection of either vehicle (n = 4) or chABC (n = 4) into the ARC 3 days prior to electrophysiological characterization. Mice were anesthetized with isofluorane prior to brain extraction, and brains were incubated in ice-cold aCSF of the following composition: 127 mM NaCl, 1.2 mM KH2PO4, 1.9 mM KCl, 26 mM NaHCO3, 3 mM D-glucose, 7 mM mannitol, 2.4 mM CaCl2, 1.3 mM MgCl2 (saturated with 95% O2 and 5% CO2, pH 7.4). Coronal sections (250 μm) of the ARC were cut using a vibrotome (Leica VTS1000S, Germany). Slices were heated at 34°C for 30 minutes and then allowed to cool to room temperature before recording. Slices were placed in a recording chamber and continuously perfused with room temperature aCSF.

[0119] Npy-GFP neurons within the ARC were visualized using an infrared video microscope (AxioCam MRm, Zeiss, Germany) and an upright microscope (BX51WI, Olympus, Germany) with fluorescence and differential interference contrast optics. For current-clamp recordings, patch pipettes (8-11 MΩ) were pulled from thin-walled borosilicate glass (Sutter Instruments, BF150-86-10) using a horizontal puller (Sutter Instruments, USA) and filled with an intracellular solution containing 140 mM K-gluconate, 10 mM HEPES, 10 mM KCl, 1 mM EGTA, 4 mM Na-ATP, 0.3 mM Na-GTP, and 10 mM biocytin (300 mOsm and pH 7.3, with osmolarity and pH adjusted with sucrose and KOH, as appropriate). For voltage-clamp recordings to examine K+ currents, patch pipettes (3–6 MΩ) were filled with an intracellular solution containing 130 mM K-gluconate, 6 mM NaCl, 4 mM NaOH, 11 mM EGTA, 1 mM CaCl2, 10 mM HEPES, 1 mM MgCl2, 2 mM Na-ATP, 0.2 mM Na-GTP, and 0.1% biocytin (295 mOsm and pH 7.3, with osmolarity and pH adjusted with sucrose and KOH as appropriate). Cells with series resistances greater than 20 MΩ were not included in the analysis. Recordings were performed in the presence of tetrodotoxin, with 11 depolarizing pulses from −40 mV to +60 mV applied for 500 ms in 10 mV increments from a holding potential of −80 mV. A 50 ms prepulse to 0 mV was used to inactivate any residual voltage-dependent Na+ currents. Whole-cell recordings were performed using a Double IPA integrated patch amplifier controlled by SutterPatch software (Sutter Instruments, USA), and all current-clamp data were filtered at 5 kHz. Data were analyzed using Sutterpatch (Sutter Instruments, USA) and Clampfit 10.7 (Axon Instruments).

[0120] General Procedure S. Immunoblotting The medial basal hypothalamus was microdissected and snap-frozen in liquid N2. Tissue was mechanically homogenized in 100 μl of ice-cold RIPA lysis buffer (ab156034, Abcam, UK, containing PhosStop phosphatase inhibitor, 1 tablet / 10 mL; Roche PHOSS-RO) and clarified by centrifugation (13,000 × rpm, 20 min at 4 °C). Tissue lysates were resolved by SDS-PAGE and immunoblotted as previously described (PMID: 31509751). The antibodies used were rabbit phosphoryl-IR (Tyr1162, Tyr1163) polyclonal antibody (1:1000, 44-804G, Invitrogen, MA), rabbit monoclonal anti-IR (1:1000, 3025x, Cell Signaling, MA), rabbit β-actin polyclonal antibody (1:2000, 4967, Cell Signaling Technology), mouse Gapdh monoclonal antibody (1:5000, 60004-1-Ig, Proteintech, IL), and mouse monoclonal anti-tubulin (1:2000, T5168, Sigma).

[0121] General Procedure T. Real-time PCR RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA), and the quality and quantity of total RNA was determined using a NanoDrop 3300 (Thermo Scientific, Wilmington, DE, USA). mRNA was reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) and processed for quantitative real-time PCR using SYBR Green PCR Master Mix (4309155, Applied Biosystems, MA). The following primers were used for the SYBR Green expression assay: Adamst4 (f-GAACGGTGGCAAGTATTGTGAGG (SEQ ID NO: 21), r-TTCGGTGGTTGTAGGCAGCACA (SEQ ID NO: 22)), Adamst5 (f-CTGCCTTCAAGGCAAATGTGTGG (SEQ ID NO: 23), r-CAATGGCGGTAGGCAAACTGCA (SEQ ID NO: 24)), Il-6 (f-GGTGCCCTGCCAGTATTCTC (SEQ ID NO: 25), r-GGCTCCCAACACAGGATGA (SEQ ID NO: 26)), Kcna4 (f-GCAGATTGCTGAATGACACCTCG (SEQ ID NO: 27), r-GGACAAGCAAAGCATCGAACCAC (SEQ ID NO: 28)), Kcnb1 (f-GAGGAGTTCGACAACACGTGCT (SEQ ID NO: 29), r-TGAGTGACAGGGCAATGGTGGA (SEQ ID NO: 30)), Kcnb2 (f-GCTGGAGAAACCTAACTCGTCC (SEQ ID NO: 31), r-CTCGTCGTTTTCTTGCAGCTCTG (SEQ ID NO: 32)), Kcnc3 (f-GAAGAGGTGATTGAAACCAACAGG (SEQ ID NO: 33), r-TGGGCTCTTGTCTTCTGGAGAC (SEQ ID NO: 34)), Kcnc4 (f-CCAGCTCGAATCGCCCATTTAC (SEQ ID NO: 35), r-AGCACCGCATTAGCATCGCCAT (SEQ ID NO: 36)), Kcnd2 (f-CCTACATGCAGAGCAAGCGGAA (SEQ ID NO: 37), r-GTGGTTTTCTCCAGGCAGTGAAG (SEQ ID NO: 38)), Kcnd3 (f-AGAAGAGGAGCAGATGGGCAAG (SEQ ID NO: 39), r-CTTGATGGTGGAGGTTCGTACAG (SEQ ID NO: 40)), Kcnj11 (f-TGCGTCACAAGCATCCACTCCT (SEQ ID NO: 41), r-GGACATTCCTCTGTCACCATGC (SEQ ID NO: 42)), Kcnj3 (f-CAGTTCGAGGTTGTCGTCATCC (SEQ ID NO: 43), r-CCCAAAGCACTTCGTCCTCTGT (SEQ ID NO: 44)), Kcnj6 (f-GGAACTGGAGATTGTGGTCATCC (SEQ ID NO: 45), r-TCTTCCAGCGTTAGGACAGGTG (SEQ ID NO: 46)), Kcnj9 (f-TCTCACCTCTCGTCATCAGCCA (SEQ ID NO: 47), r-GCTTCGAGCTTGGCACGTCATT (SEQ ID NO: 48)), Kcnma1 (f-CCTGAAGGACTTTCTGCACAAGG (SEQ ID NO: 49), r-ACTCCACCTGAGTGAAATGCCG (SEQ ID NO: 50)), Kcnn3 (f-TCCACCGTCATCCTGCTTGGTT (SEQ ID NO: 51), r-CAGGCTGATGTAGAGGATACGC (SEQ ID NO: 52)), Kcnq3 (f-AAGCCTACGCTTTCTGGCAGAG (SEQ ID NO: 53), r-ACAGCTCGGATGGCAGCCTTTA (SEQ ID NO: 54)), Mmp13 (f-AGCAGTTCCAAAGGCTACAACT (SEQ ID NO: 55), r-GGATGCTTAGGGTTGGGGTC (SEQ ID NO: 56)), Mmp14 (f-AGCACTGGGTGTTTGACGAA (SEQ ID NO: 57), r-CCGGTAGTACTTATTGCCCCG (SEQ ID NO: 58)), Mmp2 (f-GTCGCCCCTAAAACAGACAA (SEQ ID NO: 59), r-GGTCTCGATGGTGTTCTGGT (SEQ ID NO: 60)), Mmp9 (f-GCTGACTACGATAAGGACGGCA (SEQ ID NO: 61), r-TAGTGGTGCAGGCAGAGTAGGA (SEQ ID NO: 62)), r18s (f-CAGCTCCAAGCGTTCCTGG (SEQ ID NO: 63), r-GGCCTTCAATTACAGTCGTCTTC (SEQ ID NO: 64)), Tgfβ1 (f-GGATACCAACTATTGCTTCAG (SEQ ID NO: 65), r-TGTCCAGGCTCCAAATATAG (SEQ ID NO: 66)), Tgfβ2 (f-CTAATGTTGTTGCCCTCCTACAG (SEQ ID NO: 67), r-GCACAGAAGTTAGCATTGTACCC (SEQ ID NO: 68)), Tgfβr1 (f-GGACCATTGTGTTACAAGAAAGC (SEQ ID NO: 69), r-CATGGCGTAACATTACAGTCTGA (SEQ ID NO: 70)), Tgfβr2 (f-TCCTAGTGAAGAACGACTTGACC (SEQ ID NO: 71), r-TACCAGAGCCATGGAGTAGACAT (SEQ ID NO: 72)), Timp1 (f-TCTTGGTTCCCTGGCGTACTCT (SEQ ID NO: 73), r-GTGAGTGTCACTCTCCAGTTTGC (SEQ ID NO: 74)), Timp3 (f-GCTAGAAGTCAACAAATACCAG (SEQ ID NO: 75), r-TAGTAGCAGGACTTGATCTTG (SEQ ID NO: 76)), Tnfα (f-CTGTGAAGGGAATGGGTGTT (SEQ ID NO: 77), r-GGTCACTGTCCCAGCATCTT (SEQ ID NO: 78)).

[0122] Gene expression was normalized to r18s and relative quantification was achieved using the ΔΔC method. Reactions were performed using a BioRad CFX 384 touch (Bio-Rad, Hercules, CA).

[0123] General Procedure U.CSPG-ECM Binding Assay To assess the interaction of insulin with CSPG-ECM components in vitro, flat-bottom 96-well plates were first coated overnight with 10 μg / ml poly-L-lysine and then rinsed with water. A purified CSPG mix containing neurocan, phosphacan, versican, and aggrecan (CC117, Merck Millipore, MA), purified aggrecan (A1960, Merck Millipore, MA), or purified chondroitin 4-sulfate (S9004, Selleck Chemicals, TX) was coated onto the 96-well plates at a concentration of 10 μg / ml for 4 hours at room temperature, followed by rinsing with water. Insulin-FITC was incubated on the ECM-containing plates at concentrations ranging from 5 ng / ml to 1 mg / ml for 2 hours at room temperature, protected from light. Control wells contained no ECM, bovine serum albumin (10 μg / ml), or poly-L-lysine alone. Wells were washed three times with water and imaged at 495 nm using a SPECTROstar nanomicroplate reader (BMG Labtech, Germany). To digest the CSPG-ECM or to eliminate the negative charge of the CSPG-ECM, after ECM coating, wells were incubated with either chABC (0.5 U / ml) or poly- l -arginine (10 μg / ml, P7762, Merck Millipore, MA) for 1 h at 37°C, washed three times with water, and then incubated with insulin-FITC.

[0124] General Procedure Q. Statistical Analysis Statistical significance was determined by one-way or two-way ANOVA with multiple comparisons or repeated measures, or one- or two-tailed pairwise Student's t-test, or ANCOVA as appropriate, or simple linear regression. p<0.05 was considered significant: *p<0.05, **p<0.01, and ***p<0.001. Statistical details of individual experiments, including exact values ​​of n and exact statistical tests, can be found in the figures and legends.

[0125] result Example 1. Unique CSPG-ECM exists within the ARC To identify CSPG-ECM within the hypothalamus, immunostaining was performed using Wisteria floribunda agglutinin (WFA), a lectin that selectively binds to N-acetylgalactosamine residues on the chondroitin sulfate (CS) chains of CSPG-ECM. CSPG-ECM expression was detected throughout the rostral to caudal extent of the mouse medial basal hypothalamus (Figure 1a-c). Prominent CSPG-ECM expression was present within the ARC (Figure 1a-c), with notable but significantly lower expression in the adjacent ventromedial hypothalamus (VMH, -90.2 ± 2.2%). CSPG-ECM in the brain canonically surrounds and regulates parvalbumin cortical neurons. Within the retrogranular cortex (RSG), CSPG-ECM was observed to surround parvalbumin neurons by 89.5 ± 4.3%. However, cells surrounded by CSPG-ECM within the ARC are not parvalbumin positive, providing a striking distinction between the CSPG-ECM present within the ARC compared with conventional CSPG-ECM in other brain regions.

[0126] Example 2. Neurofibrosis associated with ARC develops during the progression of metabolic disease To examine the effects of obesity on ARC CSPG-ECM expression, expression was quantified in C57BL / 6J mice fed a high-fat, high-sugar (HFHS) diet for 12 weeks, thus rendering them diet-induced obese and insulin-resistant. There was a robust increase in the area and intensity of CSPG-ECM expression throughout the bony caudal extent of the ARC in obese mice compared with lean, age-matched mice (Figure 1a-c). This finding was highly robust (n = 45) and observed across several independent experiments. Enhancement of CSPG-ECM after the HFHS diet was not observed in the VMH (Figure 1g-i) or RSG, suggesting that obesity-driven CSPG-ECM remodeling occurs specifically within the ARC.

[0127] To investigate whether the glycan composition of the ARC CSPG-ECM is also remodeled, we used glycobiology to quantify chondroitin sulfate-glycosaminoglycan (CS-GAG) side chain sulfation. CS-GAG side chains are regulated by sulfotransferases, which add sulfate groups to CS-GAGs at distinct sites that regulate their biological function. CS-GAG sulfation occurs at either the C4 or C6 position of the N-acetylgalactosamine (CS-4S and CS-6S, respectively) or the C2 position of the glucuronic acid (CS-2S). CS-GAG chains can be unsulfated (CS-0S) or can exist with a combination of sulfation patterns. We identified CS-4S as the predominant CS-GAG sulfation within the ARC (Figure 1d). In the ARC of obese mice, significant changes in CS-GAG sulfation abundance were observed, with elevated ΔCS-4S, ΔCS-0S, and ΔCS-2S6S, but no effect on ΔCS-4S6S expression (Fig. 1d), consistent with the enhanced CSPG-ECM detected immunohistochemically.

[0128] To establish the validity of this phenomenon, CSPG-ECM expression was quantified in several independent dietary and genetic mouse models of obesity. Consistently elevated CSPG-ECM expression was observed within the ARC of obese Sprague-Dawley rats and in obese BALB / cJ mice fed a high-fat, high-cholesterol diet. Enhanced CSPG-ECM was also present in both monogenic (leptin receptor-deficient, db / db) and polygenic (New Zealand obese) mouse models of metabolic disease, indicating that CSPG-ECM remodeling is observed in multiple models of obesity and metabolic disease.

[0129] The onset of adverse metabolic adaptations that drive metabolic disease progression follows both acute and chronic HFHS dietary intake. Deficits in ARC neuronal signaling have been reported as early as 72 hours after ingestion of an obesogenic diet (Olofsson, et al., 2013), with loss of tissue-specific insulin resistance and increased adiposity occurring within 1–3 weeks, with the effects progressively worsening over time. To identify the temporal pattern of CSPG-ECM remodeling during metabolic disease progression, ARC CSPG-ECM content was assessed in mice fed an HFHS diet for 3 days, 1 week, 4 weeks, 8 weeks, and 12 weeks. Significant increases in CSPG-ECM expression occurred within 4 weeks of HFHS feeding and further enhanced at 8 and 12 weeks (Figure 1e, f). These effects were associated with key pathophysiological features of metabolic disease, such as increased body weight, increased adiposity, and impaired glycemic control. The excessive deposition and remodeling of CSPG-ECM observed within the ARC during the development of metabolic disease is a phenomenon we refer to as neurofibrosis.

[0130] Example 3. Aggrecan is a key CSPG species underlying neurofibrosis in the ARC CSPG-ECM is composed of four core components: 1) CS-GAG chains, 2) CSPG core proteins covalently linked to the CS-GAG chains, 3) a hyaluronic acid (HA) backbone, and 4) binding proteins and glycoproteins that stabilize CSPG aggregates. To examine how the composition of the ARC CSPG-ECM is remodeled during neurofibrosis, we first determined the extent of HA backbone changes. Using biotinylated HABP, we observed heterogeneous staining of HA throughout the brain parenchyma with nearly complete WFA colocalization in the ARC (96 ± 4.5%). Consistent with obesity promoting neurofibrosis within the ARC, the HA backbone showed an increase in both staining area and intensity, which is consistent with the increased HA abundance observed in the ARC GAG profile (Figure 1d). Notably, changes in ARC HA expression occurred in non-CSPG-ECM areas of the ARC, which may reflect the role of the HA backbone in supporting other ECM components.

[0131] The increase in HA scaffolding within the ARC of diet-induced obese mice was accompanied by a significant increase in the abundance of hyaluronan and proteoglycan binding protein (HAPLN1) within the ARC. These binding proteins, which play a role in linking CSPGs to the HA scaffold, were widely expressed throughout the hypothalamus, indicating functionality in the ECM outside of the ARC CSPG-ECM. Similarly, tenascin-C, a CSPG cross-linking glycoprotein, also showed increased staining intensity within the ARC of obese mice. While the increased staining intensity was attributed to the ARC CSPG-ECM, tenascin-C was also expressed throughout other hypothalamic regions, indicating non-ARC CSPG-ECM-specific expression.

[0132] To identify related CSPGs present in the ARC CSPG-ECM, versican, phosphocan, neurocan, brevican, and aggrecan, we next stained for the major CSPG components expressed in the CSPG-ECM elsewhere in the brain. While all CSPG components are present to some extent within the ARC, other CSPG components show a distinct spatial pattern from CSPG-ECM and labeled ARC WFA (Figure 1g,j,k), with aggrecan (91.5 ± 3.1% Figure 1g,j,k) colocalizing primarily with WFA within the ARC under both chow-fed and HFHS-fed conditions. Obesity also promoted enhanced versican, neurocan, brevican, and aggrecan expression within the ARC region (Figure 1g-i), whereas phosphacan expression remained unchanged. Furthermore, enhanced expression of aggrecan during the development of obesity occurred within a similar time frame as enhanced expression of WFA-labeled CSPG-ECM (Figure 1m,n). Taken together, these results demonstrate that although obesity promotes the enhancement of most major ECM components, aggrecan is a privileged CSPG species that supports neurofibrosis in the ARC.

[0133] Example 4. CSPG-ECM Tracker—A Novel Tool for Determining Site-Specific CSPG-ECM Turnover CSPG-ECM has been described to exhibit slow biological turnover and persist for months to years in adult tissues. Our results demonstrate relatively rapid remodeling and enhancement of CSPG composition in the ARC after exposure to an obesogenic diet (Figure 1). To explain this, we hypothesized that i) the rate of CSPG-ECM turnover in the ARC differs from that in other brain regions, and ii) the turnover rate of CSPG-ECM in the ARC is attenuated in obesity, resulting in enhanced CSPG-ECM deposition and neurofibrosis.

[0134] To experimentally determine CSPG-ECM turnover in vivo, we developed a novel technique called the "CSPG-ECM Tracker" (Figure 2a). The CSPG-ECM Tracker is a "pulse-chase" approach that utilizes stereotaxic injection of biotinylated WFA (WFA-biotin) to "pulse" and label CSPG-ECM within brain regions of interest. After an in vivo incubation period, brains were extracted and treated ex vivo for the presence of WFA-biotin to "chase" labeled CSPG-ECM remaining from the time of injection (day 0). Sections were simultaneously co-stained with WFA-FITC to reveal total CSPG-ECM expression at the time of the "chase." Areas of CSPG-ECM positive for WFA-biotin represent matrix still present from day 0, whereas areas expressing only WFA-FITC indicate new matrix synthesized after day 0 (Figure 2a).

[0135] To validate this approach as a bona fide tracker of CSPG-ECM turnover, we first determined how faithfully WFA-biotin injected into the ARC labeled CSPG-ECM within the ARC (Figure 2b-d). To do this, the ARC of chow-fed adult mice was unilaterally "pulsed" with either WFA-biotin or saline, and expression was tracked 1 day later (Figure 2b, c). Using this approach, we identified near-complete coexpression of pulsed WFA-biotin with WFA-FITC (total CSPG-ECM), suggesting faithful labeling of CSPG-ECM in vivo (Figure 2d). Punctuation of WFA-positive signal outside the ARC represents WFA-biotin leakage into the circulation and binding to CSPG-ECM expressed within blood vessels (Figure 2c).

[0136] To verify whether the "pulsed" WFA-biotin signal faithfully bound and labeled CSPG-ECM present only at the time of infusion, rather than rebinding of free WFA-biotin to newly synthesized CSPG-ECM, we pulsed the ARC of chow-fed adult mice bilaterally with WFA-biotin. Three days later, we digested the CSPG-ECM in the ARC with chondroitinase ABC (chABC), an enzyme that specifically digests CSPG-ECM. Enzymatic digestion of the "pulsed" WFA-biotin-bound CSPG-ECM completely disappeared after chABC treatment compared with vehicle, indicating that WFA-biotin bound to CSPG-ECM components present only at the time of pulse infusion. The CSPG-ECM tracker represents the first feasible method for assessing CSPG-ECM turnover in vivo in a brain region-specific manner.

[0137] Example 5. ARC CSPG-ECM exhibits dynamic and rapid turnover rates To determine basal CSPG-ECM turnover within the ARC, WFA-biotin was "pulsed" into the ARC of adult chow-fed mice and its expression was "tracked" at 0, 1, 3, 5, and 10 weeks after injection (Figure 2e). Using a CSPG-ECM tracker, we identified that CSPG-ECM within the ARC of chow-fed C57BL / J mice exhibited a 5-week turnover period characterized by a temporal decrease in CSPG expression at 1 and 3 weeks after injection (Figure 2f, g). To assess whether CSPG-ECM turnover is consistent in other brain regions, WFA-biotin was "pulsed" into the RSG of adult chow-fed mice and its expression was "tracked" at 0 and 5 weeks after injection. Unlike within the ARC, CSPG-ECM in the RSG was still present at 5 weeks, albeit with a 61% decrease. Significant CSPG-ECM expression was further identified within adjacent intracallosal vessels that showed no degradation within 5 weeks after injection. These results indicate that the ARC exhibits a uniquely rapid rate of CSPG-ECM degradation, establishing a precedent for differential ECM turnover throughout the brain.

[0138] Example 6. Attenuated CSPG-ECM turnover in obesity leads to neurofibrosis We hypothesized that neurofibrosis in the ARC was due to attenuated CSPG-ECM degradation. To test this, we pulsed WFA-biotin into the ARC of obese mice and tracked its expression at 0, 1, 2, 5, and 10 weeks after injection (Fig. 2e, f). As expected, higher CSPG-ECM expression was present in the ARC of obese mice compared with lean age-matched controls, recapitulating the above finding that obesity causes neurofibrosis in the ARC (Fig. 1). We determined that the rate of CSPG-ECM degradation in the ARC of obese mice was significantly reduced compared with that of lean mice (lean = 2.6% / day vs. obese = 0.1% / day, Fig. 2g). This attenuation of CSPG-ECM turnover resulted in the presence of WFA-biotin in the ARC up to 10 weeks after injection, which is double that seen in lean mice (5 weeks). These results identify that neurofibrosis is caused by attenuated CSPG-ECM degradation and demonstrate a pronounced deformation of the CSPG-ECM in the ARC during the development of metabolic disease.

[0139] To further elucidate the molecular mechanisms underlying obesity-driven changes in CSPG-ECM turnover, we quantified gene expression of established ECM synthesis / degradation enzymes in the medial basal hypothalamus of lean versus obese mice. ECM composition and remodeling are tightly controlled by the balance of matrix metalloproteinases (MMPs), proteolytic enzymes known to degrade ECM, and their inhibitors, tissue inhibitors of metalloproteinases (TIMPs). Significantly decreased expression of several key ECM proteases (Adamst4, Adamst5, Mmp2, Mmp9, Mmp13, and Mmp14) was observed in the medial basal hypothalamus of obese mice (Figure 2h). Conversely, elevated expression of TIMPs (Timp1 and Timp3) was also observed, which may promote neurofibrosis through inhibition of MMPs (Figure 2h). Elevated expression of the profibrotic inflammatory factors Tnfα, Tgfβ1, Tgfβ2, Tgfβr1, Tgfβr2, and Il6, which are established regulators of fibrosis in peripheral tissues, was further observed (Fig. 2h).

[0140] Example 7. Neurofibrosis occurs around AgRP neurons in the ARC The ARC contains two metabolically related neuronal populations, termed agouti-related peptide (AgRP) neurons and proopiomelanocortin (POMC) neurons. AgRP and POMC neurons are well-established neuronal populations within the ARC that are essential for regulating metabolism and play a central role in the development of metabolic diseases. Using Npy-GFP (to mark AgRP neurons) and Pomc-GFP mice, we identified that under chow-fed conditions, 44% ± 13% of AgRP neurons (Figure 3a, b) and 24% ± 9% of POMC neurons (Figure 3d, e) in the ARC were ensheathed within CSPG-ECM. After 4 weeks of HFHS feeding, we determined that significantly more AgRP neurons (60% ± 6%, Figure 3a, b) but not POMC neurons (23% ± 5%, Figure 3d-e) were ensheathed within CSPG-ECM. By 12 weeks of HFHS feeding, there was a further recruitment of AgRP neurons (78% ± 7%; Fig. 3a, b), along with an enhanced surrounding WFA staining (Fig. 3c), an effect that was absent around POMC neurons (Fig. 3f), and that was independent of changes in neuronal number.

[0141] Previously, we identified enhanced abundance of aggrecan as a compositional signature of neurofibrosis within the ARC (Figure 1g-m). Consistent with this, we detected aggrecan-positive CSPG-ECM surrounding AgRP neurons in chow-fed mice (Figure 3g-i). As expected, aggrecan-positive CSPG-ECM ensheathed AgRP neurons to a similar extent as WFA and showed similar recruitment of AgRP during the development of neurofibrosis (Figure 3g-i). Together, these results demonstrate that neurofibrosis develops around metabolically relevant AgRP neurons within the ARC during the development of metabolic disease.

[0142] Obesity affects the intrinsic excitability of AgRP neurons, as both firing rate and resting membrane potential increase after prolonged high-fat feeding. Furthermore, removal of CSPG-ECM expressed around cortical and brainstem neurons reduces membrane excitability, as evidenced by a decrease in firing frequency. Therefore, the effect of CSPG-ECM recruitment on AgRP neuronal function was investigated using whole-cell patch clamp electrophysiology. Upon HFHS feeding for 12 weeks, over 82% of AgRP neurons spontaneously fired (Figure 3j), whereas decomposition of CSPG-ECM within the ARC with chABC reduced spontaneous firing by 33% (Figure 3j). Consistent with this significant decrease in firing rate (Figure 3k, l), a trend toward a decrease in resting membrane potential was also observed (Figure 3m, p = 0.065), supporting the role of ARC CSPG-ECM in regulating the intrinsic electrophysiological properties of AgRP neurons.

[0143] Example 8. Eliminating ARC neurofibrosis prevents obesity Obesity is characterized by increased adiposity and the effects caused by impaired glycemic control, hyperphagia, reduced adaptive thermogenesis, and insulin resistance. The functional contribution of ARC neurofibrosis to the development of metabolic disease remains unclear. To address this, we selectively degraded CSPG-ECM within the ARC of HFHS-fed obese mice using chABC. Intra-ARC delivery of chABC significantly reduced CSPG-ECM expression within the ARC (Figure 4a). Notably, degradation of ARC CSPG-ECM in obese mice promoted progressive and substantial weight loss (Figure 4b), which was mediated by a marked reduction in adiposity (24 ± 16%, Figure 4c). The changes in body weight and composition were, in part, due to a significant reduction in caloric intake, as mice lacking CSPG-ECM within the ARC consumed significantly less food than HFHS-fed controls (Figure 4d). Elimination of nerve fibrosis regulates food intake by promoting satiety without inducing non-food-specific adverse behaviors such as gagging, excessive grooming, or sedation.

[0144] To examine the extent to which suppression of feeding contributes to weight loss, we pair-fed vehicle-treated mice so that they consumed the same amount of food as mice lacking CSPG-ECM in the ARC and assessed the effects on body weight and percent fat. Pair-feeding resulted in weight loss (Fig. 4e) and fat mass loss (Fig. 4f), albeit to a lesser extent than observed in mice ad libitum treated with chABC (Fig. 4e, f). This suggests that chABC-mediated suppression of food intake partially explains the effects on weight loss. Despite these effects, significant differences remained between pair-fed vehicle-treated mice compared with ad libitum fed chABC-treated mice, indicating that caloric intake alone cannot explain the difference in body weight and may include a contribution from energy expenditure (Fig. 4g). Energy expenditure was measured using indirect calorimetry, and mice lacking CSPG-ECM in the ARC showed increased whole-body energy and oxygen consumption, but no effects on substrate partitioning or locomotor activity.

[0145] Consistent with the elevated energy expenditure, a dramatic upregulation of adipose tissue thermogenesis after chABC treatment in the ARC was also observed in both inguinal white adipose tissue (ingWAT) and brown adipose tissue (BAT) depots (Figure 4h-k). Degradation of CSPG-ECM in the ARC of diet-induced obese mice was accompanied by increased browning of ingWAT, as assessed by (1) gross morphology (Figure 4h) and histology, monitoring the presence of multilocular lipid droplets (Figure 4i), (2) immunofluorescence, monitoring UCP-1-positive adipocytes (Figure 4i), and (3) improved in vivo skin ingWAT temperature (Figure 4j, k). Furthermore, chABC treatment also increased skin BAT temperature, indicating substantial activation of adaptive thermogenesis.

[0146] Elimination of ARC neurofibrosis was also associated with a significant improvement in glucose homeostasis, as assessed by a reduction in fasting blood glucose (Figure 4m), concomitant with a reduction in glucose excursion in a glucose tolerance test (Figure 4l), and a reduction in circulating insulin and the HOMA-IR (homeostasis model assessment of insulin resistance) index as a measure of whole-body insulin resistance. Importantly, these tests were performed 4 days after chABC, before there was a significant effect on body weight, demonstrating a direct effect of neurofibrosis elimination on glucose metabolism, independent of changes in body weight.

[0147] To further investigate the role of ARC neurofibrosis in the development of whole-body insulin resistance, whole-body insulin sensitivity and glycemic control were assessed using a hyperinsulinemic-hyperglycemic clamp in weight-matched mice. The glucose infusion rate (GIR) required to maintain euglycemia during the clamp was significantly increased in mice treated with intra-ARC chABC, consistent with the suppression of neurofibrosis within the ARC, improving whole-body insulin sensitivity (Figure 4n). Improved insulin sensitivity was driven by increased suppression of endogenous glucose production (Figure 4o) and increased glucose disappearance rates, measures of hepatic gluconeogenesis and skeletal glucose uptake, respectively. Enhanced glucose uptake was observed in skeletal muscle, but there was no effect in epididymal white adipose tissue, heart, or brain (Figure 4p). ARC neurons have previously been shown to regulate glucose metabolism through thermogenesis generated in ingested WAT and BAT. Consistent with this regulation, degradation of neurofibrosis within the ARC promoted glucose uptake in BAT and ingested WAT (Figure 4p). The beneficial effects of chABC intra-ARC infusion on body weight, fat mass, glycemic control, and insulin resistance were also replicated in genetically severely obese and type 2 diabetes mellitus db / db mice treated with chABC ( Figure 4 q–t), further demonstrating the causal role of ARC neurofibrosis in the development of metabolic disease.

[0148] Taken together, these results demonstrate a significant and unprecedented causal role for the brain ECM in the development of metabolic disease. These studies causally link the development of neurofibrosis within the ARC to the progression and maintenance of metabolic disease through hyperphagia, systemic insulin resistance, increased adiposity, and impaired adaptive thermogenesis. Remarkably, resolution of neurofibrosis within the ARC leads to weight loss and reversal of key metabolic disease phenotypes.

[0149] Example 9. Neurofibrosis prevents insulin from entering the ARC and promotes neuronal insulin resistance Given the link between fibrosis and insulin resistance in peripheral tissues, we hypothesized that accumulated CSPG-ECM may impede insulin delivery from the circulation to the ARC, which may represent a novel mechanism underlying insulin resistance. To investigate this, we administered vehicle or chABC bilaterally to the ARC of obese mice fed HFHS for 12 weeks and chow-fed mice, and assessed its effect on insulin receptor activation (Figure 5a). As expected, systemic insulin administration in chow-fed mice induced robust expression of AKT (p-AKT) phosphorylation within the ARC. This effect was significantly attenuated in obese mice, demonstrating that obesity triggers the development of insulin resistance within the ARC (Figure 5b,c). Degradation of ARC CSPG-ECM in obese mice rapidly ameliorated insulin resistance within ARC neurons 2 days (before any effects on body weight occurred) and 8 days after chABC injection, as indicated by the restoration of both p-AKT (Figure 5b,c) and insulin receptor phosphorylation within the ARC (Figure 5b,c).

[0150] The CSPG-ECM in the brain regulates neuronal function by physically preventing the access and interaction of extracellular molecules with target cells. Therefore, we speculated that obesity-induced neurofibrosis within the ARC CSPG-ECM may mechanistically promote insulin resistance by preventing insulin access to neurons within the ARC. To investigate this, we administered fluorescein isothiocyanate-labeled insulin (insulin-FITC) peripherally and quantified insulin entry and signaling within the ARC in lean versus obese mice (Figure 5d). We observed robust insulin-FITC appearance and internalization (Figure 5e-g) followed by p-AKT signaling in the ARC of lean mice, confirming that circulating insulin enters and directly signals cells within the ARC (Figure 5e-h). Insulin-FITC entry was impaired in obese mice (Figure 5e-g), and this effect was accompanied by a comparable decrease in insulin-induced p-AKT signaling (Figure 5e, h). Remarkably, degradation of CSPG-ECM in the ARC of obese mice reinstated insulin entry into the ARC (Fig. 5e–h), and then restored insulin-induced p-AKT signaling (Fig. 5e–h), similar to that observed in lean mice.

[0151] To investigate whether neurofibrillar impedance of insulin transport is mediated by CSPG-ECM surrounding the blood-brain barrier (BBB), insulin-FITC was infused into the cerebrospinal fluid, thus bypassing the BBB. Here, insulin-FITC entered the ARC of lean mice, an effect that was dramatically attenuated in obese mice and rescued after CSPG-ECM degradation. Taken together, these results demonstrate that neurofibrillar CSPG-ECM within the ARC, but not within the BBB, impedes insulin entry into the ARC to promote insulin resistance. CSPG-ECM regulation of insulin-FITC access to the ARC is an insulin-specific effect.

[0152] To gain mechanistic insight into how neurofibrosis impedes insulin infiltration and signaling within the ARC, we performed an in vitro binding assay to assess insulin-ECM interactions. Insulin-FITC was incubated for 2 hours on plates coated with either mixed CSPGs (aggrecan, neurocan, phosphatase, and versican) or specific core CSPG-ECM components (aggrecan or chondroitin 4-sulfate) that constitute neurofibrosis (Figure 5i). Specific dose-dependent binding of insulin-FITC to mixed CSPGs, aggrecan, and C4S was observed, and this effect was abolished in the presence of chABC (Figure 5j). To mechanistically explain the interaction between ECM and insulin, we hypothesized that the highly negative charge of sulfated GAGs bound to CSPGs impedes ligand-receptor binding. To investigate this, insulin-FITC was incubated with the CSPG mix in the presence of poly-arginine, a positively charged peptide that neutralizes the negative charge of CSPGs. It was found that insulin-ECM interaction was significantly reduced in the presence of poly-arginine, indicating that the negative charge of GAGs in CSPG-ECM also modulates insulin-ECM interaction (Fig. 5j).

[0153] Putative potassium (K+) currents were examined in AgRP neurons in the ARC. To determine whether improved insulin access and signaling capacity to ARC neurons underlies the modulation of AgRP membrane excitability by nerve fibrosis (Figure 3j-m), whole-cell electrophysiological studies were performed. Activation of K+ channels in AgRP neurons is known to hyperpolarize the resting membrane potential and reduce firing rate. To directly address the potential role of nerve fibrosis in regulating K+ currents in AgRP neurons, we examined the current-voltage relationship in the presence of tetrodotoxin. Consistent with the reduced firing rate and membrane potential in AgRP neurons from diet-induced obese mice after nerve fibrosis removal (Figure 3j-m), an upward shift in the current-voltage curve was observed, indicating improved K+ currents. To determine the contribution of improved insulin signaling after nerve fibrosis removal in regulating K+ currents, gene expression analysis of several K+ channels known to be present in AgRP / Npy neurons was performed in the medial basal hypothalamus. We demonstrated upregulation of several K+ channels after digestion of ARC CSPG-ECM in diet-induced obese mice. To determine whether these changes were due to improved ability of insulin to access these neurons and regulate K+ channel activity, we used an insulin receptor antagonist (S961). We showed that the upregulation of K+ channels after neurofibroma removal was attenuated by S961, revealing insulin receptor-dependent regulation of neuronal activity after digestion of ARC CSPG-ECM.

[0154] Overall, these findings demonstrate that the ARC CSPG-ECM directly interacts with insulin and that the development of neurofibrosis promotes insulin resistance and AgRP excitability through impaired insulin's ability to access and signal key ARC neuronal populations.

[0155] Example 10. ARC neurofibrosis promotes metabolic disease through dysfunctional AgRP-insulin signaling Because neurofibrosis occurs specifically around AgRP neurons (Figure 4), it was hypothesized that impaired insulin signaling within AgRP neurons is a likely cell type underlying these effects. To determine whether the development of neurofibrosis around AgRP neurons causes changes in the neural circuits governing metabolism, we examined AgRP peptide expression within ARC terminals projecting to the paraventricular nucleus of the hypothalamus (PVH). This ARC-AgRP-to-PVH circuit is a well-established output of AgRP neurons for regulating metabolic and glycemic control. We observed that AgRP peptide expression, which innervates the PVH, was significantly elevated in obese mice compared to lean mice, an effect that was reversed with attenuated neurofibrosis. This reduction in AgRP peptide expression and the subsequent reduction in AgRP inhibitory tone on the melanocortin circuit in the PVH may explain how neurofibrosis around AgRP neurons propagates metabolic dysfunction.

[0156] To define the causative role of AgRP in neurofibrosis leading to impaired insulin signaling, we generated a mouse model that allows conditional loss of AgRP-mediated neuronal insulin receptor expression in adult diet-induced obesity. Using CRISPR gene editing, we identified two guide RNAs (sgRNAs) targeting the proximal region of exon 2 of the mouse insulin receptor (InsR) gene. In the presence of Cas9 endonuclease, these sgRNAs excised a substantial 82-bp region of InsR exon 2, resulting in near-complete ablation of IR protein expression. An AAV was then constructed that expressed the two IR sgRNA sequences along with a Cre-dependent mCherry vector to report AAV-transduced neurons (gIR-AAV, Figure 6a). To target CRISPR-mediated ablation of the InsR in AgRP neurons, Agrp-IRES-Cre mice were crossed with Rosa26-LSL-Cas9-GFP knock-in mice to generate AgRP-Cas9 (Agrp-IRES-Cre;Rosa26-LSL-Cas9-GFP) mice, which express Cas9 and GFP specifically in AgRP neurons. To examine the efficacy of CRISPR-mediated disruption of the InsR in AgRP neurons in vivo, AAV-gIR or a scrambled sgRNA control AAV (AAV-gScrambled) was injected bilaterally into the ARC of 12-week-old adult AgRP-Cas9 mice. Successful CRISPR-mediated disruption of the InsR was confirmed by the expression of a 419-bp PCR product (ΔInsR) in the medial basal hypothalamus of AgRP-Cas9 mice. CRISPR , which is smaller than approximately 501 bp (approximately 82 bp). CRISPR-mediated disruption of the IR in AgRP neurons resulted in impaired insulin signaling, further validating effective AgRP-specific disruption of IR expression.

[0157] To define the contribution of AgRP-IR signaling to the attenuated effect of neurofibrosis on whole-body metabolism, AAV-gIR or AAV-Scrambled were injected bilaterally into the ARC of 12-week-old AgRP-Cas9 obese mice (Figure 6b). One week later, mice received bilateral intraARC administration of chABC or vehicle to disrupt neurofibrosis within the ARC. Summarizing previous findings, chABC treatment in the ARC of diet-induced control (AAV-gScrambled) AgRP-Cas9 mice promoted weight loss (Figure 6c), reduced fat mass (Figure 6d), decreased caloric intake (Figure 6e), improved energy expenditure (Figure 6f), and improved glycemic control (Figure 6g, h). Notably, all effects on whole-body metabolism were dependent on functional insulin receptor signaling in AgRP neurons, as they were significantly attenuated in chABC-treated AAV-IR AgRP-Cas9 mice (Figure 6c-h). Taken together, obesity-driven neurofibrosis promotes the development of metabolic disease through impaired insulin signaling in AgRP neurons. Furthermore, resolution of ARC neurofibrosis improves systemic metabolic and glycemic control, at least in part, through restoration of insulin receptor signaling in AgRP neurons.

[0158] Example 11. Pharmacological attenuation of neurofibrosis promotes weight loss in obesity Targeting the ECM surrounding metabolic neural circuits, instead of the cells themselves, offers a unique therapeutic strategy. A major therapeutic challenge in targeting the ECM lies in developing small-molecule inhibitors capable of reversing fibrotic ECM. The enzyme chABC is effective in digesting CSPG-ECM and ameliorating neurofibrosis when injected into distinct brain regions; however, its enzymatic activity is rapidly depleted at body temperature. Therefore, its therapeutic potential is limited. To investigate the pharmacological viability of targeting neurofibrosis in the brain, we used a recently characterized small-molecule inhibitor, fluorosamine (per-O-acetylated-4-FN-acetylglucosamine). Fluorosamine is a competitive inhibitor of 4-epimerase, an enzyme essential for creating the nucleotide sugar substrate UDP-N-acetylgalactosamine, which is required for the assembly and elongation of CS-GAG chains on CSPGs. To directly target the brain, fluorosamine was delivered intracerebroventricularly (ICV, avoiding effects on peripheral tissues) to obese mice for 10 days (Figure 7a). Using WFA immunostaining, we observed that fluorosamine treatment significantly attenuated neurofibrosis within the ARC (Figure 7b, c). Central administration of fluorosamine did not reduce CSPG-ECM expression in other brain regions, such as the RSG cortex, and even at the highest dose, only partially attenuated expression in the habenula. This effect may be explained by the rapid turnover of CSPGs in the ARC. Consistent with enzymatic CSPG-ECM degradation in the ARC, central fluorosamine treatment promoted weight loss (Figure 7d), reduced adiposity (Figure 7e), improved energy expenditure independently of locomotor activity (Figure 7f), suppressed food intake by improving satiety (Figure 7g), and improved glucose tolerance (Figure 7h). Furthermore, fluorosamine treatment improved insulin-induced p-AKT signaling in the ARC, indicating a significant restoration of ARC insulin sensitivity (Fig. 7i, j). Mechanistically, fluorosamine improved glycemic control by enhancing whole-body insulin sensitivity (Fig. 7k), hepatic glucose production, and tissue-specific glucose uptake, i.e., in skeletal muscle, BAT, and ingested WAT, as assessed using a hyperinsulinemic-hyperglycemic clamp in weight-matched obese mice.The utility and ability of fluorosamine treatment to promote remission of metabolic disease was also observed in a mouse model of late-stage type 2 diabetes (HFHS + low-dose streptozotocin treatment, Figure 7l, m), further demonstrating the utility of targeting neurofibrosis to treat different stages of T2D progression.

[0159] Although flurosamine and chABC are mechanistically distinct in how they degrade CSPG-ECM, flurosamine phenocopies the effects of chABC on metabolism. In this context, we investigated the extent to which flurosamine's metabolic effects are mediated through AgRP-insulin receptor signaling. To address this, we injected AAV-gIR or AAV-gScrambled bilaterally into the ARC of 12-week-old obese AgRP-Cas9 mice, followed 1 week later by daily delivery of vehicle or flurosamine (100 μg / animal ICV) for 10 days (Figure 7n). Summarizing previous findings, flurosamine treatment of control AAV-gScrambled AgRP-Cas9 mice promoted weight loss (Figure 7o), reduced fat mass, attenuated caloric intake (Figure 7p), improved energy expenditure independently of ambulatory activity (Figure 7q), and improved glycemic control (Figure 7r). These positive metabolic consequences of fluorosamine treatment were at least partially mitigated in AAV-IR AgRP-Cas9 mice, indicating that insulin receptor signaling in AgRP neurons is required to mediate the consequences of fluorosamine-induced metabolic effects (Figure 7o-r).

[0160] To facilitate therapeutic translation to humans, intranasal delivery of fluorosamine was investigated as a possible administration route to ensure targeted delivery of neurofibrosis inhibitors to the brain. To determine whether neurofibrosis inhibitors could be successfully delivered intranasally, biotin-conjugated fluorosamine molecules were intranasally administered to C57BL / 6J mice, and their biodistribution throughout the brain was determined (Figure 8a, b). Abundant fluorosamine accumulation was detected in the brain, with significant accumulation in the ARC (Figure 8b), demonstrating successful delivery of fluorosamine to sites of neurofibrosis. To determine the effectiveness of brain-targeted delivery of neurofibrosis inhibitors for the treatment of metabolic diseases, fluorosamine was intranasally delivered to diet-induced obese mice for 14 days (Figure 8c). Intranasal delivery of fluorosamine successfully attenuated ARC neurofibrosis (Figure 8d, e) and recapitulated the systemic metabolic improvement observed with intracerebroventricular delivery (Figure 8f-l). These effects are likely mediated by enhanced insulin signaling to neurons within the ARC (Fig. 8m, n).

[0161] Taken together, these results further demonstrate the role of neurofibrosis in the development of central insulin resistance and systemic metabolic dysfunction.

[0162] Example 12. Intranasal administration delivers fluorosamine (PZ6005) conjugated with biotin to the brain. PZ6005 conjugated with biotin (PZ6005-biotin) or unconjugated PZ6005 (Figure 8a) was intranasally delivered to mice for 3 days, after which the biotin-streptavidin signal was quantified. High biotin expression was observed in the ARC in PZ6005-biotin-treated mice compared to controls (Figure 8b-e). Significant biotin expression was also observed in the lungs of PZ6005-biotin-treated mice (Figure 8f-h). However, this was to a much smaller extent than that seen in the ARC (quantification). These results suggest that PZ6005-biotin had the potential to be delivered to the ARC and lungs via intranasal administration.

[0163] Example 13. Intranasal administration of fluorosamine (PZ6005) attenuates CSPG-ECM expression in the ARC. To determine whether intranasally administered PZ60005 suppresses ARC CSPG-ECM expression, obese mice fed a HFHS diet for 12 weeks were intranasally administered either vehicle or PZ6005 (1 or 5 mg / animal / day) for 14 days (Fig. 9a), and WFA immunostained CSPG-ECM expression was quantified within the ARC (Fig. 9b). Both doses of intranasal PZ6005 treatment robustly reduced the area and intensity of ARC CSPG-ECM. CSPG-ECM area in the 1 mg and 5 mg treatment groups was 13.54 ± 1.03% and 13.59 ± 4.09% lower than in controls (Fig. 9c, d). Intensity was reduced by 15.94 ± 7.17% with 1 mg treatment and further reduced by 30.16 ± 1.52% with the highest dose of intranasal PZ6005 treatment (Fig. 9e, f). These results demonstrate that intranasal administration of PZ60005 dose-dependently reduces ARC CSPG-ECM expression and attenuates obesity-induced ARC neurofibrosis.

[0164] Example 14. Therapeutic elimination of ARC neurofibrosis using intranasal fluorosamine (PZ6005) promotes weight loss with reduced adiposity Body weight change in 12-week obese mice fed a HFHS diet during 14 days of intranasal administration of either vehicle or PZ6005 (1 or 5 mg / animal / day). Intranasal PZ6005 treatment induces weight loss in a dose-dependent manner, as assessed by significant differences in weight change between groups. The 1 mg and 5 mg treatment groups robustly lost weight starting on days 7 and 3, respectively. The 5 mg treatment began to lose significantly more weight than the 1 mg treatment on day 9, which continued through day 14. At the end of the experiment, mice treated with the highest dose of PZ6005 lost 6.36 ± 0.88% of their body weight, and mice treated with 1 mg lost 16.32 ± 1.41%, while control littermates maintained 3.57 ± 1.28% of their body weight (Figure 10a).

[0165] To assess the effects of intranasal PZ6005-mediated attenuated neurofibrosis on tissue-specific adiposity and body composition, mice were weighed for peripheral tissue and adipose tissue mass after 14 days of treatment. While epiWAT, BAT, and liver mass were reduced with 1 mg treatment, the highest dose of intranasal PZ6005 significantly reduced tissue mass (Fig. 11a, b). Furthermore, the reduction in total adipose tissue mass was PZ6005 dose-dependent. Compared to pretreatment fat mass, posttreatment fat mass was reduced by 12.59 ± 2.29% with 1 mg treatment and further reduced by 23.21 ± 9.27% ​​with 5 mg treatment (Fig. 11c, d). These results suggest that intranasal delivery of PZ6005 is associated with dose-dependent weight loss accompanied by improved tissue-specific adiposity and reduced adipose tissue mass.

[0166] Example 15. Therapeutic ablation of ARC neurofibrosis using intranasal fluorosamine (PZ6005) dose-dependently improves glucose homeostasis with enhanced insulin sensitivity Obese mice intranasally administered either vehicle or PZ6005 (1 mg / animal / day or 5 mg / animal / day) underwent an IPGTT after a 6-hour fasting period and an IP insulin tolerance test (ITT) after a 4-hour fasting period. The reduced glucose excursion in both the GTT and ITT revealed that intranasal PZ6005-treated mice had better glucose tolerance than control littermates (Fig. 12a, b), along with improved insulin sensitivity (Fig. 12c, d). Furthermore, after 60 minutes of IP glucose infusion during the GTT and after 0 minutes of IP insulin infusion, 5 mg PZ6005 treatment demonstrated significantly higher glucose clearance rates than the 1 mg treatment group and the control group (Fig. 12a-d). The reduction in fasting (12 hours) glucose levels further demonstrated that both doses of intranasal PZ6005 treatment improved glycemic control (Fig. 12e).

[0167] These results demonstrate that intranasal delivery of PZ6005 improves whole-body insulin sensitivity to improve glucose homeostasis in a dose-dependent manner.

[0168] Example 16. Therapeutic elimination of ARC neurofibrosis using intranasal fluorosamine (PZ6005) improves insulin receptor signaling within the ARC ARC pAKT-positive cells in obese mice receiving intranasal administration of either vehicle or PZ6005 (1 or 5 mg / animal / day) for 14 days were examined to demonstrate the extent to which intranasal PZ6005-mediated attenuation of CSPG-ECM affects insulin receptor signaling within the ARC (Fig. 13a). ARC at both doses of intranasal PZ6005 treatment improved insulin receptor signaling, as assessed by a robust increase in ARC pAKT-positive cells (Fig. 13b). This result indicates that intranasally administered PZ6005, as a neurofibrosis inhibitor, improves insulin sensitivity in the ARC parenchyma.

[0169] References Alonge,KM,et al.,Hypothalamic perineuronal net assembly is required for sustained diabetes remission induced by fibroblast growth factor 1 in rats.Nat Metab,2020.2(10):p.1025-1033. Anderson,EM,et al.,Systematic analysis of CRISPR-Cas9 mismatch tolerance reveals low levels of off-target activity.J Biotechnol,2015.211:p.56-65. Dodd, GT, et al.,TCPTP Regulates Insulin Signaling in AgRP Neurons to Coordinate Glucose Metabolism With Feeding.Diabetes,2018.67(7):p.1246-1257. Dodd,G.T.,et al.,Intranasal Targeting of Hypothalamic PTP1B and TCPTP Reinstates Leptin and Insulin Sensitivity and Promotes Weight Loss in Obesity.Cell Rep,2019.28(11):p.2905-2922 e5. Keough,M.B.,et al.,An inhibitor of chondroitin sulfate proteoglycan synthesis promotes central nervous system remyelination.Nat Commun,2016.7:p.11312. Mirzadeh,Z.,et al.,Perineuronal Net Formation during the Critical Period for Neuronal Maturation in the Hypothalamic Arcuate Nucleus.Nat Metab,2019.1(2):p.212-221. Moh,E.S.X.,et al.,Long-term intrathecal administration of morphine vs.baclofen:Differences in CSF glycoconjugate profiles using multiglycomics.Glycobiology,2022.32(1):p.50-59. Olofsson,L.E.,et al.,Modulation of AgRP-neuronal function by SOCS3 as an initiating event in diet-induced hypothalamic leptin resistance.Proc Natl Acad Sci U S A,2013.110(8):p.E697-706. Stephenson,E.L.,et al.Targeting the Chondroitin Sulfate Proteoglycans:Evaluating Fluorinated Glucosamines and Xylosides in Screens Pertinent to Multiple Sclerosis.ACS Cent Sci.,2019.5(7):p.1223-1234. Winans,K.A.and Bertozzi,C.R.An Inhibitor of the Human UDP-GlcNAc 4-Epimerase Identified from a Uridine-Based Library:A Strategy to Inhibit O-Linked Glycosylation.Chemistry&Biology,2022.9(1):p.113-129.

Claims

1. A method for treating or preventing insulin resistance or a related disorder in a subject, comprising administering to the subject an effective amount of a 4-epimerase inhibitor.

2. 2. The method of claim 1, wherein the associated disorder is selected from prediabetes, type 2 diabetes mellitus, obesity, metabolic syndrome, hypertension, dyslipidemia, atherosclerosis, nonalcoholic fatty liver disease (NAFLD), polycystic ovary syndrome (PCOS), and coagulation disorders.

3. The method of claim 2 , wherein the associated disorder is a metabolic disease.

4. 4. The method of claim 3, wherein the metabolic disease is type 2 diabetes mellitus.

5. 3. The method of claim 2, wherein the associated disorder is obesity.

6. 6. The method of any one of claims 1 to 5, wherein the 4-epimerase inhibitor is a fluorinated N-acetyl-glucosamine derivative, or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

7. The 4-epimerase inhibitor is a compound of formula (I): 【Chemical 1】 or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof; During the ceremony, R 1 , R 3 , and R 5 are independently H or C(O)C 1-4 alkyl, R 4 and R 4’ is independently selected from H and fluoro; R 4 and R 4’ The method of claim 6 , wherein at least one of

8. The 4-epimerase inhibitor is a compound of formula (IA): 【Chemistry 2】 or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof; During the ceremony, R 1 , R 3 , and R 5 are independently H or C(O)C 1-4 alkyl, R 4 and R 4’ is independently selected from H and fluoro; R 4 and R 4’ The method of any one of claims 1 to 7, wherein at least one of is fluoro.

9. R 1 , R 3 , and R 5 are independently H or C(O)C 1-3 9. The method of claim 7 or 8, wherein the alkyl is selected from the group consisting of alkyl, methyl ...

10. R 1 , R 3 , and R 5 are independently H or C(O)C 1-2 The method of any one of claims 7 to 9, wherein the alkyl is selected from alkyl.

11. R 1 is H or C(O)C 1-2 alkyl, and R 3 and R 5 The method according to any one of claims 7 to 10, wherein both are acyl groups.

12. R 1 , R 3 , and R 5 The method of any one of claims 7 to 11, wherein each is an acyl group.

13. The 4-epimerase inhibitor is 【Chemistry 3】 or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

14. The 4-epimerase inhibitor is 【Chemistry 4】 or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

15. The 4-epimerase inhibitor is 【Chemistry 5】 or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof.

16. The 4-epimerase inhibitor is a compound of formula (II), formula (III), or formula (IV): 【Chemistry 6】 or a pharmaceutically acceptable salt, solvate or hydrate thereof, or a stereoisomer thereof; During the ceremony, R 6 but, 【Chemistry 7】 is selected from R 7 but, 【Chemistry 8】 is selected from R 8 but, 【Chemistry 9-1】 【Chemistry 9-2】 The method according to any one of claims 1 to 5, wherein the compound is selected from the group consisting of:

17. The method of any one of claims 1 to 16, wherein the 4-epimerase inhibitor is administered intranasally.

18. Use of a 4-epimerase inhibitor in the manufacture of a medicament for treating or preventing insulin resistance or a related disorder in a subject.

19. A 4-epimerase inhibitor for use in treating or preventing insulin resistance or a related disorder in a subject.