Transmembrane delivery systems and uses thereof

Transmembrane delivery systems with specific linkers and conjugates address the challenges of delivering therapeutic agents across cell membranes, enhancing gene therapy efficacy by improving delivery efficiency and safety.

JP2025536115APending Publication Date: 2025-10-31APOSENSE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025517535
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-01-02
Filing Date
2023-09-21
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

Existing gene therapy methods face challenges in delivering polymeric compounds, viral vectors, and oligonucleotides across cell membranes due to high energy costs and toxicity issues, limiting their clinical application.

Method used

Development of transmembrane delivery systems comprising compounds of general formula (I) with specific linkers and conjugates for polynucleic acids, allowing efficient and safe delivery across cell membranes.

Benefits of technology

The systems enable effective intracellular delivery of therapeutic agents, including siRNA and mRNA, with reduced toxicity and improved binding to plasma proteins, facilitating gene therapy applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025536115000001_ABST
    Figure 2025536115000001_ABST
Patent Text Reader

Abstract

The present invention is directed to oligonucleotide conjugates, pharmaceutical compositions containing same, and methods for using same, such as for the treatment and / or prevention of genetic or viral diseases in a subject.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Reference to the Electronic Sequence Listing The contents of the electronic sequence listing (APSN-P-012-PCT.xml; size: 125,321 bytes; created September 21, 2023) are incorporated herein by reference in their entirety.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 408,888, entitled "TRANS-MEMBRANE DELIVERY SYSTEMS AND USES THEREOF," filed September 22, 2022; U.S. Provisional Patent Application No. 63 / 436,644, entitled "TRANS-MEMBRANE DELIVERY SYSTEMS AND USES THEREOF," filed January 2, 2023; and U.S. Provisional Patent Application No. 63 / 436,642, entitled "TRANS-MEMBRANE DELIVERY SYSTEMS AND USES THEREOF," filed January 2, 2023, the contents of which are incorporated herein by reference in their entireties. [Background technology]

[0003] Major challenges in the implementation of polymeric compounds (including viral vectors, bacterial vectors, single- or double-stranded oligonucleotides, natural or modified RNA or DNA molecules, or combinations thereof), siRNAs (small interfering RNAs), siRNA substrates for the Dicer enzyme (dsiRNA), microRNAs (miRNAs), messenger RNA (mRNA) drugs, and DNA sequences designed to function as antisense oligonucleotides (ASOs) in clinical settings primarily concern intracellular delivery and optimization of their binding to plasma proteins, particularly albumin.

[0004] Although showing enormous potential for advancing medicine, these potential breakthrough gene drugs all share one major limitation: constructed from natural or modified oligonucleotides, and with their site of action located inside the cell (cytoplasm or nucleus), these therapeutic agents must all cross the hydrophobic barrier of the cell membrane. Indeed, to date, this rigid delivery barrier has stifled the entire field of gene therapy and prevented its implementation as a future medical procedure. Furthermore, oligonucleotide drugs are large molecules (e.g., siRNA has a molecular weight of approximately 15,000 daltons), and each molecule carries numerous negative charges (phosphates). Taken together, delivery of siRNA across the cell membrane is associated with a significant energy cost.

[0005] Currently, there are two major strategies for gene delivery across biological barriers: viral vectors and non-viral vectors. Each strategy poses its own substantial limitations: viral vector strategies are limited by the low transfection rate of viral particles, limited biodistribution, and poor safety / significant toxicity. Among non-viral approaches, cationic lipids and related liposomes used for siRNA delivery are also significantly limited by toxicity. Therefore, there is a significant unmet need for novel, efficient, and safe delivery modes of genetic material across cell membranes based on novel mechanisms of action with optimal binding to plasma proteins. Summary of the Invention

[0006] Thus, the present invention provides compounds of general formula (I): [ka]

[0007] and pharmaceutically acceptable salts, hydrates, solvates and metal chelates thereof, wherein

[0008] D is a compound selected from single-stranded or double-stranded DNA, RNA, siRNA, dsiRNA, DNAzyme, ASO, viral vector, bacterial vector, and any combination thereof;

[0009] each of y, z, and w is an integer independently selected from 0, 1, 2, 3, or 4, and at least one of y, z, or w is different from 0;

[0010] E, E', and E'' may be the same or different, and each independently represent a group represented by the general formula (II) [ka] (Wherein, X is [ka] , a salt thereof, or both, or X is absent; each of a, b, c, d, e, f, and g is an integer independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; R represents one or more substituents, each independently selected from H, F, Cl, Br, and I, with the proviso that at least one of the one or more substituents is F; R5 is H or a linear or branched C1-C5 alkyl; R6 is H, hydroxyalkyl, and —(CH2) n R'; n is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and R' is selected from a bond, H, and phosphate, or a salt thereof; L1 is a linker selected from -NH-C(=O)-, -C(=O)NH-, -SS-, and -SC(=O); L2 is a linker selected from -O-, -S-, -CH2-; * is an interaction / conjugation with D), including pharmaceutically acceptable salts, hydrates, solvates, and metal chelates thereof; Alternatively, E, E', or E'' may be the same or different and each independently represent a group of general formula (III): [ka] (In the formula, Each of h, i, j, and k is an integer independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; R is H, hydroxyalkyl, and —(CH) n R' is selected from: n is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and R' is selected from a bond, H, and phosphate, or a salt thereof; L3 is a linker selected from -NH-C(=O)-, -C(=O)NH-, -SS-, and -NH-C(=O); L4 is a linker selected from -O-, -S-, -CH2-; * is an interaction / conjugation with D; X is [ka] , a salt thereof, or both, or is absent), including pharmaceutically acceptable salts, hydrates, solvates, and metal chelates thereof.

[0011] In some embodiments, R1 through R4 are F. In some embodiments, R1, R2, and R3 are H and R4 is F. In some embodiments, R1, R2, and R4 are H and R3 is F. In some embodiments, R1, R3, and R4 are H and R2 is F. In some embodiments, R2, R3, and R4 are H and R1 is F. In some embodiments, R1 and R2 are H and R3 and R4 are F. In some embodiments, R3 and R4 are H and R1 and R2 are F. In some embodiments, R1, R2, and R3 are F and R4 is H. In some embodiments, R1, R2, and R4 are F and R3 is H. In some embodiments, R1, R3, and R4 are F and R2 is H. In some embodiments, R2, R3, and R4 are F and R1 is H.

[0012] In some embodiments, R5 is Me.

[0013] In some embodiments, R6 is -CH2OH. In some embodiments, R6 is H.

[0014] In some embodiments, L1 is -SS-. In some embodiments, L1 is -SC(=O).

[0015] In some embodiments, L3 is -SS-. In some embodiments, L3 is -NH-C(=O).

[0016] In some embodiments, R7 is -CH2OH. In some embodiments, R7 is H.

[0017] In some embodiments, y is 0. In some embodiments, z is 0. In some embodiments, w is 0. In some embodiments, y and z are 0.

[0018] In some embodiments, D is a macromolecular drug. In some embodiments, D is an oligonucleotide drug comprising a natural or modified oligonucleotide chain, and selected from siRNA, dsiRNA, mRNA, microRNA, DNAzyme, and ASO, and any combination thereof. In some embodiments, D is a viral vector. In some embodiments, D is a bacterial vector.

[0019] The present invention further provides pharmaceutical compositions comprising the conjugates disclosed hereinabove and below.

[0020] The present invention further provides the conjugates disclosed hereinabove and below for use in gene therapy.

[0021] The present invention further provides the conjugates disclosed hereinabove and below for use in the treatment of hearing loss.The present invention further provides the conjugates disclosed hereinabove and below for use in the treatment of CNS diseases and disorders.The present invention further provides the conjugates disclosed hereinabove and below for use in cell and gene therapy.The present invention further provides the conjugates disclosed hereinabove and below for use in the treatment of cancer.The present invention further provides the conjugates disclosed hereinabove and below for use in inflammatory bowel disease (IBD).

[0022] The present invention further provides precursors of the conjugates disclosed herein above and below having the general formula (II) where * is coupled to a protecting group.

[0023] The present invention further provides precursors to the conjugates disclosed herein above and below having the general formula (II) where OH is coupled to a protecting group.

[0024] In some embodiments, precursors of the present invention (i.e., one or more functional groups connected to protecting groups) have the following structure: [ka] is a compound of

[0025] In some embodiments, precursors of the present invention (i.e., one or more functional groups connected to protecting groups) are compounds of the following structures: Apo-Si-K170B, Apo-Si-K170C.

[0026] In some embodiments, precursors of the present invention (i.e., one or more functional groups connected to protecting groups) have the following structure: [ka] is a compound of

[0027] In some embodiments, precursors of the present invention (i.e., one or more functional groups connected to protecting groups) have the following structure: [ka] is a compound of

[0028] In some embodiments, precursors of the present invention (i.e., one or more functional groups connected to protecting groups) have the following structure: [ka] is a compound of

[0029] In some embodiments, precursors of the present invention (i.e., one or more functional groups connected to protecting groups) have the following structure: [ka] is a compound of

[0030] The subject matter which is regarded as the invention is particularly pointed out and distinctly claimed in the concluding portion of this specification. However, the invention, both as to organization and method of operation, together with objects, features, and advantages thereof, may best be understood by reference to the following detailed description when read in connection with the accompanying drawings. [Brief explanation of the drawings]

[0031] [Figure 1] FIG. 1 shows the protein-free fraction of an exemplary conjugate of the invention and a structurally similar analog (Apo-Si-S1) upon incubation with BSA. [Figure 2]Figure 2 shows that incubation of the Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C conjugates with glutathione (GSH) (5 mM, 37°C for 4 hours) resulted in robust cleavage of the conjugates in the following order: Apo-Si-K-170-C > Apo-Si-K-170-A > Apo-Si-K-170-B >> Apo-Si-K-93-A. [Figure 3] Figures 3A-3D show the EGFP silencing activity of Apo-Si-K-170-A, Apo-Si-K-170-B, Apo-Si-K-170-C, and Apo-Si-K 941 conjugates in the Hela-GFP cell line. Figure 3A: 600 nM of Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C conjugates reduced EGFP expression to 49.9%, 83.1%, and 70.8% of the untreated control, respectively, in the presence of complete medium and 10% serum in the Hela-GFP cell line. Figures 3B-3D: Dose-dependent EGFP silencing activity of Apo-Si-K-170-A, Apo-Si-K-170-B, Apo-Si-K-170-C and Apo-Si-K 941 in different cell lines (serum-free). [Figure 4] Figure 4 shows that the Apo-Si-K170A conjugate significantly reduced the mRNA expression of the epithelial sodium channel (ENaC) gene in the lungs of ICR mice upon intratracheal administration (100-200 μg / mouse / dose) in a dose-responsive manner. [Figure 5] Figure 5 shows that Apo-Si-K170A conjugated to ENaC dsiRNA reduces ENaC gene expression in mouse lung upon IT administration in mice, particularly compared to Apo-Si-K170A conjugated to a control sequence. [Figure 6] Figure 6 shows that upon IT administration to mice, Apo-Si-K170A conjugated to ENaC dsiRNA was local and had no effect on ENaC expression in the kidney and liver. [Figure 7]Figures 7A-7F show a comparison of Cy3 staining between the naked dsiRNA-treated group (Group 2) (Figures 7D-F) and the Apo-Si-K170A dsiRNA conjugate-treated group (Group 4) (Figures 7A-C) after intracochlear (IC) administration at T+30 h at the base of the cochlea. [Figure 8] Figures 8A-8C are bar graphs showing downregulation of PMP-22 target genes by the Apo-Si-K1000 construct. Cells were transfected with the Apo-Si-K1000 construct. RNA was then extracted from cells 48 and subjected to RT-qPCR analysis. 8A: 3T3-NIH cells (N = 5; n = 2-10). 8B: Schwann S16 cells (N = 2; n = 2-4). 8C: HeLa cells (N = 2; n = 2-4). [Figure 9] FIG. 9 shows the results of a plaque assay in a mouse model of RSV infection upon IT administration with the Apo-Si-K170A construct. [Figure 10] Figures 10A-10B show the results of qRT-PCR of oropharyngeal (10A) and BALF (10B) swabs in AGM. [Figure 11] Figures 11A-11C show the results of qRT-PCR of SARS-CoV2 genomes in AGM; nasal swabs (11A), oropharynx (11B), and BALF (11C) over time. [Figure 12] 12A-12B show that Apo-Si-K170A STAT6 down-regulates IL-4 (12A) and IL-13 (12B) cytokines in BALF of an asthma mouse model. [Figure 13] FIG. 13 shows the effect of Apo-Si-K170A STAT6 on total IgE in plasma of a mouse model of asthma. [Figure 14] FIG. 14 shows the in vitro SPARC silencing efficiency of Apo-Si-K-170A-SPARC (the primary conjugate) compared to an unrelated negative control (dsiDyn1i2#1). [Figure 15]FIG. 15 shows the downregulation of ENaC target genes in various concentrations of Apo-Si-K-170A-SPARC compared to an unrelated negative control (K170A-Dyn1i2). [Figure 16] Figures 16A-16D show dose-dependent inhibition of influenza A virus in MDCK cells by Apo-Si-K170A-dsiRNA constructs: Figure 16A: K170A-MF03-PB1, Figure 16B: K170A-MF43-PB2, Figure 16C: K170A-MF13-PB1, Figure 16D: K170A-MF45-PB2. DETAILED DESCRIPTION OF THE INVENTION

[0032] It will be understood that for simplicity and clarity of illustration, elements shown in the figures have not necessarily been drawn to scale. For example, the dimensions of some elements may be exaggerated relative to other elements for clarity. Further, where considered appropriate, reference numerals may be repeated among the figures to indicate corresponding or analogous elements.

[0033] In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. However, it will be understood by those skilled in the art that the present invention may be practiced without these specific details. In other instances, well-known methods, procedures, and components have not been described in detail so as not to obscure the present invention.

[0034] In one aspect of the present invention, a compound of general formula (I): [ka] and pharmaceutically acceptable salts, hydrates, solvates, and metal chelates thereof, wherein D is a polynucleic acid; each of y, z, and w is an integer independently selected from 0, 1, 2, 3, or 4, and at least one of y, z, or w is different from 0; E, E', or E'' may be the same or different, and each independently represents a conjugate of the general formula (II): [ka] (Wherein X is [ka] , a salt thereof, or both, or X is absent; each of a, b, c, d, e, f, and g is an integer independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, or is 1 to 10; R represents one or more substituents, each independently selected from H, F, Cl, Br, and I, with the proviso that at least one of the one or more substituents is F; R5 is H or a linear or branched C1-C5 alkyl; R6 is H, —(CH2) n OH, hydroxyalkyl, -(CH2) n R', and -(CH2) n and (ii) a linker selected from -NH-C(=O)-, -C(=O)NH-, -SC(=O)-, -SS-, and -SC(=O); L2 is absent or a linker selected from -O-, -S-, -CH2-; * represents a point of attachment or conjugation to D, including pharmaceutically acceptable salts, hydrates, solvates, and metal chelates thereof. In some embodiments, R represents at least two substituents, each independently selected from F, Cl, Br, and I. In some embodiments, R represents two or three substituents, each independently selected from F, Cl, Br, and I. In some embodiments, R represents two or three fluoro substituents.

[0035] In some embodiments, any one of E, E', and E" is independently attached to (i) a terminal portion of the sequence of D (e.g., 3' or 5' of one or more polynucleotides) or (ii) an internal portion of the sequence of D. In some embodiments, a conjugate of the invention has multiple E, E', or E" moieties attached to terminal portions of the sequence of D. In some embodiments, a conjugate of the invention further comprises at least one E, E', or E" attached to an internal portion of the sequence of D.

[0036] In some embodiments, the conjugates of the invention are represented by the general formula (I), wherein D is a polynucleotide; at least two of y, z, or w are different from 0; and at least one R of E, E', and E'' is -(CH) n O* (i.e., has two points of attachment to D). In some embodiments, the conjugates of the invention are described herein; wherein D is a polynucleotide; the conjugate includes two or more of E, E', and E" (e.g., 2, 3, or 4); and R6 of at least one of E, E', and E" is -(CH2) n O* (i.e., attached to the center of the sequence of D), and R6 of at least one additional E, E', or E'' is H, -(CH2) n OH, hydroxyalkyl, and -(CH2) n In some embodiments, a conjugate of the invention comprises two E, E', or E" moieties attached to D. In some embodiments, a conjugate of the invention comprises three E, E', or E" moieties attached to D. In some embodiments, a conjugate of the invention comprises four E, E', or E' moieties attached to D.

[0037] In some embodiments, each of E, E′, or E″ independently represents a group of formula (II1): [ka] wherein a, b, c, d, e, f, g, R, R5, and R6 are as defined above, including any salts thereof.

[0038] In some embodiments, each of E, E′, or E″ independently represents a group of formula (IIa): [ka] wherein each R1-R4 is independently selected from H, F, Cl, Br, and I; and at least one of R1-R4 is not H. In some embodiments, each of R1, R2, R3, and R4 is independently selected from H, F, Cl, Br, and I; and at least one of R1, R2, R3, and R4 is F.

[0039] In some embodiments, each of E, E′, or E″ independently represents a group of formula (IIa1): [ka] wherein each R1-R4 is independently selected from H, F, Cl, Br, and I, and at least one of R1-R4 is not H, and R5 is alkyl; X is absent, or [ka] , a salt thereof, or both; a is 3; b is 1 to 5; c is 1 to 3; each of d, e, f, and g is 1 to 10; and X, R6, and L1 are as defined above.

[0040] In some embodiments, each of E, E', or E" is independently represented by any one of formulas (II)-(IIa1), wherein L1 is -XC(=X)- and L2 is -O-, -S-, or absent. In some embodiments, each of E, E', or E" is independently represented by any one of formulas (II)-(IIa1), wherein L1 is -XC(=X)-; a is 3; b is 1; c is 1; each of d, e, f, and g is 1-10; and L2 is absent. In some embodiments, each of E, E', or E'' is independently represented by any one of formulas (II)-(IIa1), wherein L1 is selected from -NH-C(=O)-, -C(=O)NH-, SC(=O)-, and -SC(=O); a is 3; b is 1; c is 1; each of d, e, f, and g is 1-10; and L2 is absent.

[0041] In some embodiments, a conjugate of the invention comprises one or more E, E', or E" moieties, wherein each of E, E', and E" is independently represented by any one of formulas (II) through (IIa1), wherein L1 is selected from -NH-C(=O)-, -C(=O)NH-, SC(=O)-, and -SC(=O); a is 3; b is 1; c is 1; each of d, e, f, and g is 1 to 10; and L2 is absent; and the conjugate is for systemic administration (e.g., in the form of a pharmaceutical composition formulated for systemic administration). In some embodiments, a conjugate of the invention comprises at least two E, E', or E" moieties (e.g., two or three), each of E, E', and E" being independently represented by any one of formulas (II) through (IIa1), wherein L1 is selected from -NH-C(=O)-, -C(=O)NH-, SC(=O)-, and -SC(=O); a is 3; b is 1; c is 1; each of d, e, f, and g is 1 to 10; and L2 is absent.

[0042] The conjugates are for systemic administration (e.g., in the form of a pharmaceutical composition formulated for systemic administration). In some embodiments, each of E, E', or E" is independently represented by Formula (II), Formula (II1), Formula (IIa), or (IIa1), wherein L1 is -SS- and L2 is -O- or -S-.

[0043] In some embodiments, each of E, E′, or E″ independently represents a group of formula (IIb): [ka] wherein a is 1 to 5; b is 1 to 3; c is 1 to 3; and each of d, e, f, and g is 1 to 10. In some embodiments, each of a, b, and c is 1 to 3, and each of d, e, f, and g is 1 to 10.

[0044] In some embodiments, each of E, E′, or E″ independently represents a group of formula (IIb): wherein a is 3; b is 1; c is 1-3; and each of d, e, f, and g is 1-10. In some embodiments, the conjugates of the invention comprise one or more E, E', or E" moieties, each of E, E', and E" independently represented by formula (IIb), wherein a is 3; b is 1; c is 1; and each of d, e, f, and g is 1-10; and the conjugates are for topical administration (e.g., in the form of a pharmaceutical composition formulated for topical administration). In some embodiments, a conjugate of the invention comprises at least two E, E', or E" moieties (e.g., two or three), each of E, E', and E" being independently represented by formula (IIb), wherein a is 3; b is 1; c is 1; d, e, f, and g are each 1-10; and the conjugate is for topical administration (e.g., in the form of a pharmaceutical composition formulated for topical administration).

[0045] In some embodiments, R1 and R3 are F. In some embodiments, R1 and R3 are F. In some embodiments, R2 and R4 are F. In some embodiments, one of R1, R3, and R4 and R2 is F. In some embodiments, R1 and R4 are F. In some embodiments, R2 and R3 are F.

[0046] In some embodiments, each of E, E′, or E″ independently represents a group of formula (IIc): [ka] wherein a is 1-5; and each of d, e, f, and g is 1-10.

[0047] In some embodiments, each of E, E', or E'' independently represents a group of formula IId: [ka] , Formula IIe: [ka] or the expression IIf: [ka] wherein R1 to R4 are as defined above, and R5 is a C1 to C5 alkyl.

[0048] In some embodiments, each of E, E′, or E″ independently represents a group of formula (IIIa): [ka] and pharmaceutically acceptable salts, hydrates, solvates, and metal chelates thereof, wherein each of i, j, k, and l is an integer independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10; L3 is a linker selected from (i) -XC(=X)-, where each X independently represents N, NH, S, or O; and (ii) -NH-C(=O)-, -C(=O)NH-, SC(=O)-, -SS-, and -SC(=O); L4 is a linker selected from -O-, -S-, -CH2-, or is absent; a, R6, L1, and L2 are as described above; and * is the point of attachment or conjugation to D.

[0049] In some embodiments, each of E, E′, or E″ independently represents a group of formula IIIa1: [ka] and pharmaceutically acceptable salts, hydrates, solvates, and metal chelates thereof, wherein each of i, j, k, and l is an integer independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each L3 is independently a linker selected from -O-, -S-, -CH2-, -NH-C(=O)-, -C(=O)NH-, -SS-, SC(=O)-, and -SC(=O), and optionally one L3 is absent; a, R6, L1, and L2 are as described above; and * is the point of attachment or conjugation to D. The integers R6 and R7 are used interchangeably herein.

[0050] In some embodiments, each of E, E′, or E″ independently represents a group of formula (IIIb): [ka] or Formula IIIc: [ka] wherein i, j, k, l, a, R6, and L3 are as defined above. In some embodiments, each of E, E', or E" is independently represented by formula (IIIa-c), wherein each of a, i, j, and k is independently 1 to 5, or 1 to 3.

[0051] In some embodiments, each of E, E', or E" is independently represented by formula (IIIb), where i is 1, j and k are independently 1 to 5, and L4 is absent. In some embodiments, a conjugate of the invention comprises one or more E, E', or E" moieties, where each of E, E', and E" is independently represented by formula (IIIb), where i is 1; j and k are independently 1 to 5; L4 is absent; and the conjugate is for topical administration (e.g., in the form of a pharmaceutical composition formulated for topical administration). In some embodiments, a conjugate of the invention comprises at least two E, E', or E" moieties (e.g., two or three), each of E, E', and E" independently represented by formula (IIIb), where i is 1; j and k are independently 1 to 5; L4 is absent; and the conjugate is for topical administration (e.g., in the form of a pharmaceutical composition formulated for topical administration).

[0052] In some embodiments, each of E, E', or E" is independently represented by formula (IIIc), where i is 1; j and k are independently 1-5; and L3 is selected from -NH-C(=O)-, -C(=O)NH-, SC(=O)-, and -SC(=O). In some embodiments, a conjugate of the invention comprises one or more E, E', or E" moieties, where each of E, E', and E" is independently represented by formula (IIIc), where i is 1; j and k are independently 1-5; and L3 is selected from -NH-C(=O)-, -C(=O)NH-, SC(=O)-, and -SC(=O); and the conjugate is for systemic administration (e.g., in the form of a pharmaceutical composition formulated for systemic administration). In some embodiments, a conjugate of the invention comprises at least two E, E', or E" moieties (e.g., two or three), each of E, E', and E" independently represented by formula (IIIc), where i is 1; j and k are independently 1 to 5; L3 is selected from -NH-C(=O)-, -C(=O)NH-, -SC(=O)-, and -SC(=O); and the conjugate is for systemic administration (e.g., in the form of a pharmaceutical composition formulated for systemic administration).

[0053] In some embodiments, each of E, E′, or E″ independently represents a group of formula (IIId): [ka] wherein L3, L4, X and R6 are as defined above.

[0054] In some embodiments, each of E, E', or E'' is [ka] [ka] wherein R6' is OH, phosphate, or O*, and * is the point of attachment or conjugation to D.

[0055] In some embodiments, D is a polynucleic acid molecule (polynucleotide). In some embodiments, D is DNA. In some embodiments, D is RNA. In some embodiments, the polynucleic acid molecule is an oligonucleotide. In some embodiments, D is an aptamer. In some embodiments, D is a primer. In some embodiments, D is an antisense oligonucleotide. In some embodiments, D is a regulatory RNA. In some embodiments, D is a plasmid. In some embodiments, D is an expression vector. In some embodiments, the vector is configured for expression in a target cell. In some embodiments, D is gene therapy. In some embodiments, the polynucleic acid molecule comprises an open reading frame. In some embodiments, the open reading frame encodes a therapeutic protein. Methods for conjugating polynucleic acid molecules to chemical linkers and amino acid linkers are well known in the art, and any such method can be used. In some embodiments, the polynucleic acid molecule comprises a nuclear localization signal (NLS).

[0056] The term "polynucleic acid" is well known in the art. As used herein, "polynucleic acid" generally refers to a molecule (i.e., a chain) of DNA, RNA, or a derivative or analog thereof, comprising a plurality (e.g., at least two) nucleic acid bases. Nucleic acid bases include, for example, naturally occurring purine or pyrimidine bases found in DNA (e.g., adenine "A," guanine "G," thymine "T," or cytosine "C") or RNA (e.g., A, G, uracil "U," or C), and further encompass chemically modified nucleic acid bases or nucleotides, such as O-methylated nucleotides, N-methylated nucleotides, phosphorothioated nucleotides, backbone-modified nucleotides (LNA, morpholino), etc.

[0057] The term "polynucleic acid molecule" includes, but is not limited to, single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), small RNAs such as miRNA, siRNA and other short interfering nucleic acids, snoRNA, snRNA, tRNA, piRNA, tnRNA, small rRNA, hnRNA, lncRNA, circulating polynucleic acids, fragments of genomic DNA or RNA, degraded nucleic acids, ribozymes, viral RNA or DNA, polynucleic acids of infectious origin, amplification products, modified nucleic acids, plasmids or organelle nucleic acids, and artificial nucleic acids such as oligonucleotides.

[0058] As used herein, the term "oligonucleotide" refers to a short (e.g., 100 bases or less) chemically synthesized single-stranded DNA or RNA molecule. In some embodiments, the oligonucleotide is attached to the 5' or 3' end of a nucleic acid molecule, for example, by a ligation reaction.

[0059] In some embodiments, the polynucleotide comprises or consists of RNA. The polynucleotide comprises or consists of messenger RNA (mRNA). "Messenger RNA" (mRNA) refers to any polynucleotide that encodes (at least one) polypeptide (a polymer of naturally occurring, non-naturally occurring, or modified amino acids) and can be translated in vitro, in vivo, in situ, or ex vivo to produce the encoded polypeptide. The basic components of an mRNA molecule typically include at least one coding region, a 5' untranslated region (UTR), a 3' UTR, a 5' cap, and a polyA tail. Polynucleotides can function as mRNAs but can be distinguished from wild-type mRNAs in their functional and / or structural design features that help overcome existing problems in effective polypeptide expression using nucleic acid-based therapeutics.

[0060] mRNA, as provided herein, comprises at least one (one or more) ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one polypeptide of interest.

[0061] In some embodiments, the polynucleotide is or comprises a therapeutic polynucleotide. As used herein, the term "therapeutic polynucleotide" refers to a polynucleotide sequence that encodes a therapeutic protein or is complementary to a sequence of interest (mutant gene). A therapeutic polynucleotide having a sequence complementary to a mutant gene is also referred to herein as an "inhibitory nucleic acid."

[0062] Therapeutic proteins mediate various effects in host cells or subjects to treat disease or ameliorate the signs and symptoms of disease. For example, therapeutic proteins can replace missing or abnormal proteins, enhance the function of endogenous proteins, confer new functions to cells (e.g., inhibit or activate endogenous cellular activities, or act as delivery agents for another therapeutic compound (e.g., antibody-drug conjugates). Therapeutic polynucleotides can be useful in treating the following diseases and conditions: bacterial infections, viral infections, parasitic infections, cell proliferation disorders, genetic disorders, and autoimmune disorders.

[0063] Therefore, the polynucleotides of the present invention can be used as therapeutic or preventive agents. They are provided for use in medicine. For example, the polynucleotides described herein can be administered to a subject, and the polynucleotides are translated in vivo to produce therapeutic peptides.

[0064] In some embodiments, the therapeutic polynucleotide comprises an inhibitory nucleic acid, hi some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide.

[0065] As used herein, "antisense oligonucleotide" refers to a nucleic acid sequence that is reverse and complementary to a DNA or RNA sequence.

[0066] As used herein, a "reverse and complementary nucleic acid sequence" refers to a nucleic acid sequence that can hybridize to another nucleic acid sequence composed of complementary nucleotide bases. "Hybridizing" refers to the pairing of complementary nucleotide bases to form a double-stranded molecule under appropriate stringency conditions (e.g., adenine (A) base pairs with thymine (T) (or uracil (U) in the case of RNA), and guanine (G) base pairs with cytosine (C)). (See, e.g., Wahl, GM and SL Berger (1987) Methods Enzymol. 152:399; Kimmel, AR (1987) Methods Enzymol. 152:507). For purposes of the methods of the present invention, the inhibitory nucleic acid need not be complementary to the entire sequence, but only to an amount sufficient to provide specific inhibition; for example, in some embodiments, the sequence is 100% complementary to at least nucleotides (nt) 2-7 or 2-8 of the 5' end of the microRNA itself (e.g., the "seed sequence"), e.g., nt 2-7 or 20.

[0067] In some embodiments, the inhibitory nucleic acid has one or more chemical modifications to the backbone or side chains, hi some embodiments, the inhibitory nucleic acid has at least one locked nucleotide and / or has a phosphorothioate backbone.

[0068] Non-limiting examples of inhibitory nucleic acids useful in accordance with the invention disclosed herein include, but are not limited to, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds, such as siRNA compounds, modified base / locked nucleic acids (LNA), antagomirs, peptide nucleic acids (PNAs), ribozymes (catalytic RNA molecules capable of cleaving other specific sequences in an RNA molecule), and other oligomeric compounds or oligonucleotide mimics that hybridize to at least a portion of a target nucleic acid and modulate its function. In some embodiments, inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides containing modified linkages, interfering RNA (RNAi), small interfering RNA (siRNA); microRNA (miRNA); small RNA (stRNA, small, temporal RNA); or short hairpin RNA (shRNA); small RNA-induced gene activator (RNAa); small activating RNA (saRNA), or combinations thereof.

[0069] In some embodiments, the inhibitory nucleic acid is an RNA interference molecule (RNAi). In some embodiments, the RNAi is or comprises double-stranded RNA (dsRNA).

[0070] As used herein, "interfering RNA" refers to any double-stranded or single-stranded RNA sequence that can directly or indirectly (i.e., upon translation) inhibit or down-regulate gene expression by mediating RNA interference. Interfering RNA includes, but is not limited to, small interfering RNA ("siRNA") and small hairpin RNA ("shRNA"). "RNA interference" refers to the selective degradation of sequence-compatible messenger RNA transcripts.

[0071] In some embodiments, the polynucleotide is chemically modified. In some embodiments, the chemical modification is a modification of the backbone of the polynucleotide. In some embodiments, the chemical modification is a modification of the sugar of the polynucleotide. In some embodiments, the chemical modification is a modification of the nucleobase of the polynucleotide. In some embodiments, the chemical modification increases the stability of the polynucleotide within a cell. In some embodiments, the chemical modification increases the stability of the polynucleotide in vivo. In some embodiments, the chemical modification increases the stability of the polynucleotide in vitro, e.g., outdoors, in the open, on an air-exposed surface, etc. In some embodiments, the chemical modification increases the ability of the polynucleotide to induce silencing of a target gene or sequence, including, but not limited to, an RNA molecule derived from a pathogen or an RNA derived from a plant cell, as described herein. In some embodiments, the chemical modification is selected from a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a phosphorothioate-deoxyribose backbone, a 2'-O-methyl-phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, a constrained ethyl backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, an N3'-P5' phosphoramidate, a 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid, a cyclohexene nucleic acid backbone nucleic acid, a tricyclo-DNA (tcDNA) nucleic acid backbone, a ligand-conjugated antisense, and a combination thereof.

[0072] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to polymers / oligomers containing nucleotides as repeating units. Typically, oligonucleotides contain 2-100 bases. Typically, polynucleotides contain 2-1000 bases. In another embodiment, the term "polynucleotide" refers to a molecule containing 5-1000, 5-200, 5-300, 5-500, 5-700, 5-5000, 5-1000, 20-100, 20-1000, 50-200, 50-500, 50-1000, or 50-100 bases (including any range therebetween). In another embodiment, the term "oligonucleotide" refers to a molecule containing 5-100 bases. In another embodiment, the term "oligonucleotide" refers to a molecule containing 5-80 bases. In another embodiment, the term "oligonucleotide" refers to a molecule containing 5-40 bases. In another embodiment, the term "oligonucleotide" refers to a molecule containing 50-100 bases. In another embodiment, the term "oligonucleotide" refers to a molecule containing 20-70 bases. In another embodiment, the term "oligonucleotide" refers to a molecule containing 5-30 bases. In another embodiment, the term "oligonucleotide" refers to a molecule containing 5-25 bases. In another embodiment, the term "oligonucleotide" refers to a molecule containing 10-50 bases, 20-50 bases, 5-50 bases, or 10-100 bases (including any range therebetween).

[0073] The term "expression," as used herein, refers to the biosynthesis of a gene product, including transcription and / or translation of said gene product. Thus, expression of a nucleic acid molecule can refer to the transcription of a polynucleic acid fragment (e.g., transcription resulting in mRNA or other functional RNA) and / or the translation of RNA into a precursor or mature protein (polypeptide).

[0074] The expression of genes in cells is well known to those skilled in the art, and herein, its delivery can be carried out by the method of the present invention or using the composition of the present invention.In some embodiments, the gene is in an expression vector such as a plasmid or a viral vector.The vector can be a viral vector.The viral vector can be a retroviral vector, a herpes virus vector, an adenoviral vector, an adeno-associated virus vector, or a poxvirus vector.The promoter can be active in mammalian cells.The promoter can be a viral promoter.

[0075] In some embodiments, the gene or open reading frame is operably linked to a promoter or other regulatory element. The term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to one or more regulatory elements in a manner that allows the expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system, or in a host cell when the vector is introduced into the host cell by the method of the present invention). In some embodiments, the regulatory element or promoter is active in the target cell.

[0076] The term "promoter," as used herein, refers to a group of transcriptional control modules clustered around the initiation site for RNA polymerase, i.e., RNA polymerase II. Promoters are composed of individual functional modules, each consisting of approximately 7-20 bp of DNA and containing one or more recognition sites for transcriptional activator or repressor proteins.

[0077] In some embodiments, the nucleic acid sequence is transcribed by RNA polymerase II (RNAP II and Pol II). RNAP II is an enzyme found in eukaryotic cells. It catalyzes the transcription of DNA to synthesize precursors of mRNA and most snRNAs and microRNAs.

[0078] In some embodiments, mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(±), pGL3, pZeoSV2(±), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81 available from Invitrogen, pCI available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV available from Strategene, pTRES available from Clontech, and derivatives thereof.

[0079] In some embodiments, expression vectors containing regulatory elements derived from eukaryotic viruses, such as retroviruses, are used by the present invention. SV40 vectors include pSVT7 and pMT2. In some embodiments, vectors derived from bovine papillomavirus include pBV-1MTHA, and vectors derived from Epstein-Barr virus include pHEBO and p2O5. Other exemplary vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo-5, baculovirus pDSVE, and any other vector that allows protein expression under the direction of the SV-40 early promoter, SV-40 late promoter, metallothionein promoter, mouse mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown to be effective for expression in eukaryotic cells.

[0080] In some embodiments, recombinant viral vectors that offer advantages such as lateral infection and target specificity are used for in vivo expression. In one embodiment, lateral infection is inherent in the life cycle of, for example, retroviruses, where a single infected cell produces many progeny virions that bud and infect neighboring cells. In one embodiment, this results in the rapid infection of a large area, the majority of which were not initially infected by the original viral particle. In one embodiment, a viral vector that cannot spread laterally is produced. In one embodiment, this feature can be useful when the desired goal is to introduce a specific gene into only a localized number of target cells.

[0081] The term "bioactive" refers to a molecule or agent that has an effect on a cell or tissue. Representative examples of types of bioactive agents include therapeutic drugs, vitamins, electrolytes, amino acids, peptides, polypeptides, proteins, enzymes, carbohydrates, lipids, polysaccharides, nucleic acids, nucleotides, polynucleotides, glycoproteins, lipoproteins, glycolipids, glycosaminoglycans, proteoglycans, growth factors, differentiation factors, hormones, neurotransmitters, prostaglandins, immunoglobulins, cytokines, and antigens. Various combinations of these molecules can be used. Examples of cytokines include macrophage-derived chemokines, macrophage inflammatory proteins, interleukins, and tumor necrosis factors. Examples of proteins include fibrous proteins (e.g., collagen, elastin) and adhesion proteins (e.g., actin, fibrin, fibrinogen, fibronectin, vitronectin, laminin, cadherins, selectins, intracellular adhesion molecules, and integrins). In various cases, the bioactive agent may be selected from fibronectin, laminin, thrombospondin, tenascin-C, leptin, leukemia inhibitory factor, RGD peptide, anti-TNF, endostatin, angiostatin, thrombospondin, bone morphogenetic protein-1, bone morphogenetic protein, osteonectin, somatomedin-like peptide, osteocalcin, interferon, and interleukin. In some embodiments, the bioactive agent comprises a growth factor, a differentiation factor, or a combination thereof.

[0082] In some embodiments, the conjugates of the invention are characterized by any one of: increased gene expression modulating activity (e.g., gene down- or up-regulation) in a subject or cell; increased intracellular release of D (due to cleavage of the L1 or L3 moiety); increased free conjugate fraction (i.e., conjugate not bound to protein, or any other biopolymer) in blood, serum, or any other biological fluid; and restored serum protein binding. In some embodiments, the conjugates of the invention are characterized by increased gene expression modulating activity in vitro in the presence of serum. The terms "increased" and "decreased," including any grammatical forms thereof, encompass a decrease or increase of at least 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, at least 100%, at least 200%, at least 1000%, at least 10,000%, or 20-500%, 50-1000%, respectively, compared to the control. In some embodiments, the control is a conjugate according to general formula (I) comprising a scrambled sequence of D. In some embodiments, the control is a conjugate according to general formula (I) comprising the same sequence of D, where E, E', or E" is a structural analog of the E, E', or E" moieties disclosed herein; a structural analog does not conform to any one of the formulas or structures set forth herein. In some embodiments, the structural analog is Apo-Si-S1, or Apo-Si-K-93A. In some embodiments, the structural analog is Apo-K-160-A (see the Examples section).

[0083] In some embodiments, the conjugates of the present invention and / or pharmaceutically acceptable salts thereof are formulated in the form of a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises one or more conjugates of the present invention and a pharmaceutically acceptable carrier, excipient, or adjuvant. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of one or more conjugates of the present invention.

[0084] As used herein, the term "carrier," "excipient," or "adjuvant" refers to any component of a pharmaceutical composition that is not an active agent. As used herein, the term "pharmaceutically acceptable carrier" refers to a non-toxic inert solid, semi-solid liquid filler, diluent, encapsulating material, any type of formulation auxiliary, or simply a sterile aqueous medium, such as physiological saline. Some examples of materials that can function as pharmaceutically acceptable carriers include sugars such as lactose, glucose, and sucrose, glycols such as propylene glycol, polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate, pyrogen-free water; isotonic saline, Ringer's solution; ethyl alcohol, phosphate buffer, and other non-toxic, compatible substances used in pharmaceutical preparations. Some non-limiting examples of substances that can function as carriers herein include sugars, stearic acid, magnesium stearate, calcium sulfate, polyols, pyrogen-free water, isotonic saline, phosphate buffer, and other non-toxic, pharmaceutically compatible substances used in other pharmaceutical preparations. Wetting agents and lubricants, such as sodium lauryl sulfate, as well as excipients, stabilizers, antioxidants, and preservatives, may also be present. Any non-toxic, inert, and effective carrier may be used to formulate the compositions contemplated herein.

[0085] The carriers may comprise, in total, from about 0.1% to about 99.99999% by weight of the pharmaceutical compositions presented herein.

[0086] In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a conjugate of the present invention. In some embodiments, the composition of the present invention is administered in a therapeutically safe and effective amount. As used herein, the term "safe and effective amount," when used in the methods described herein, refers to an amount of an ingredient sufficient to produce a desired therapeutic response without undue adverse side effects, including, but not limited to, toxicities such as calcemic toxicity, irritation, or allergic response, commensurate with a reasonable benefit / risk ratio. The actual amount administered, as well as the rate and time course of administration, will depend on the nature and severity of the condition being treated. The determination of treatment prescription, e.g., dosage, timing, etc., is within the responsibility of a general practitioner or specialist and typically takes into account the disorder being treated, the condition of the individual patient, the delivery site, the method of administration, and other factors known to the practitioner. Examples of techniques and protocols can be found in Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott Williams & Wilkins, Philadelphia, Pa., (2005).

[0087] In some embodiments, the effective amount or dose of an active ingredient can be estimated initially from in vitro assays, hi one embodiment, a dose can be formulated in animal models and such information can be used to more accurately determine useful doses in humans.

[0088] In one embodiment, the toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures, or in experimental animals. In one embodiment, data obtained from these in vitro and cell culture assays and animal studies can be used to formulate a range of dosages for use in humans. In one embodiment, the dosage can vary depending on the dosage form employed and the route of administration utilized. In one embodiment, the exact formulation, route of administration, and dosage can be selected by the individual physician in consideration of the patient's condition. [See, e.g., Goodman and Gilman's *The Pharmacological Basis of Therapeutics*, 13th Ed., McGraw-Hill / Education, New York, NY (2017)]. The term "therapeutically effective amount" refers to an amount of drug effective to treat a disease or disorder in a mammal. The term "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result. The exact dosage form and regimen will be determined by the physician depending on the patient's condition.

[0089] In some embodiments, a method is provided for preventing or treating a genetic disease in a subject in need thereof and / or reducing at least one symptom of a disease associated with a mutant gene, comprising administering a therapeutically effective amount of a pharmaceutical composition of the present invention to the subject. In some embodiments, the therapeutically effective amount is sufficient to reduce at least one symptom, or to reduce the severity and / or inhibit the progression of the disease, disorder, or condition as described above. In some embodiments, the therapeutically effective amount is sufficient to inhibit translation of the mutant gene. In some embodiments, the therapeutically effective amount is sufficient to inhibit transcription of the mutant gene. In some embodiments, the genetic disease is associated with abnormal expression (e.g., increased expression) of a particular gene compared to a control. In some embodiments, the abnormal expression includes an increase in gene expression of at least 2-fold, at least 5-fold, at least 10-fold, or more (including any range therebetween) compared to a healthy individual with normal expression of the particular gene.

[0090] In some embodiments, "substantially reduce," including any grammatical form thereof, encompasses at least a 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 100%, at least 200%, at least 1000%, at least 10,000% reduction in transcription and / or translation of a mutant gene in a subject compared to a control.

[0091] In some embodiments, a therapeutically effective amount is sufficient to substantially reduce or completely inhibit any of the biological activities (e.g., cell proliferation, metabolism, etc.) of cells containing the mutant gene.

[0092] In some embodiments, a therapeutically effective amount is sufficient to substantially reduce or completely eliminate viral load in a subject, hi some embodiments, a therapeutically effective amount is sufficient to substantially reduce or completely eliminate viral replication in a subject.

[0093] In some embodiments, "substantially reduce," including any grammatical form thereof, encompasses a reduction of viral load in a subject by at least 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99% compared to a control.

[0094] In some embodiments, "substantially reduce," including any grammatical form thereof, includes at least a 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, at least 100%, at least 200%, at least 1000%, or at least 10,000% reduction in viral growth in a subject relative to a control. In some embodiments, "substantially reduce," including any grammatical form thereof, includes at least a 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 97%, at least 99%, at least 100%, at least 200%, at least 1000%, or at least 10,000% reduction in expression of at least one viral gene in a subject relative to a control.

[0095] In some embodiments, the control comprises an untreated subject suffering from a disease. In some embodiments, the control comprises an untreated subject having a mutant gene. In some embodiments, the control comprises an untreated subject suffering from a disease or disorder associated with a mutant gene. In some embodiments, the control comprises an untreated subject having abnormal expression of a particular gene.

[0096] In some embodiments, administering includes local administration or systemic administration. In some embodiments, administration includes intradermal, intravenous, intramuscular, intralesional, subcutaneous, parenteral, intracerebroventricular, intrathecal, and any other injection method known in the art. The route of administration of the pharmaceutical composition depends on the disease or condition being treated. Additional administration routes include, but are not limited to, buccal administration, oral administration, topical administration, rectal administration, vaginal administration, sublingual administration, intranasal administration, intraocular administration, transdermal administration, subcutaneous administration, intramuscular administration, intraperitoneal administration, intrathecal administration, and pulmonary administration.

[0097] In some embodiments, the method comprises administering a pharmaceutical composition of the present invention at least once, at least twice, at least three times, at least four times, at least five times, at least seven times, or at least ten times per day, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention. In some embodiments, the method comprises administering a composition or combination of the present invention 1-2 times per day, week, or month, 1-3 times per day, week, or month, 1-4 times per month, 1-5 times per day, week, or month, 1-7 times per day, week, or month, 2-3 times per day, week, or month, 2-4 times per day, week, or month, 2-5 times per day, week, or month, 3-4 times per day, week, or month, 3-5 times per day, week, or month, or 5-7 times per day, week, or month. Each possibility represents a separate embodiment of the present invention.

[0098] In some embodiments, the method comprises administering a pharmaceutical composition of the present invention at least once, at least twice, at least three times, at least four times, at least five times, at least seven times, or at least ten times per day, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention. In some embodiments, the method comprises administering a composition or combination of the present invention 1-2 times per day, week, or month, 1-3 times per day, week, or month, 1-4 times per month, 1-5 times per day, week, or month, 1-7 times per day, week, or month, 2-3 times per day, week, or month, 2-4 times per day, week, or month, 2-5 times per day, week, or month, 3-4 times per day, week, or month, 3-5 times per day, week, or month, or 5-7 times per day, week, or month. Each possibility represents a separate embodiment of the present invention.

[0099] In some embodiments, the methods comprise administering to a subject a pharmaceutical composition of the invention at a daily, weekly, or monthly dosage of 0.05-20 mg / kg, 0.05-0.1 mg / kg, 0.1-0.3 mg / kg, 0.3-0.5 mg / kg, 0.5-0.8 mg / kg, 0.8-1 mg / kg, 1-2 mg / kg, 2-5 mg / kg, 5-10 mg / kg, 10-15 mg / kg, 15-20 mg / kg (including any range or value therebetween).

[0100] In some embodiments, the method comprises administering a pharmaceutical composition of the invention to a subject (e.g., once, twice, or three times daily) at a daily dose of 0.05 to 50 mg / kg, 0.05 to 0.1 mg / kg, 0.1 to 0.3 mg / kg, 0.3 to 0.5 mg / kg, 0.5 to 0.8 mg / kg, 0.8 to 1 mg / kg, 0.8 to 25 mg / kg, 0.8 to 3 mg / kg, 0.8 to 10 mg / kg, 0.8 to 15 mg / kg, 0.8 to 5 mg / kg, 3 to 5 mg / kg, 3 to 10 mg / kg, 2 to 10 mg / kg, 1 to 2 mg / kg, 2 to 5 mg / kg, 5 to 10 mg / kg, 10 to 15 mg / kg, or 15 to 20 mg / kg (including any range or value therebetween). In some embodiments, the daily dose can be extrapolated from in vivo data, such as the results presented in the Examples section (eg, Example 4).

[0101] For example, it will be apparent to those skilled in the art that in vitro and in vivo assays can be used to identify optimal dosage ranges. The exact dosage to be used in the formulation also depends on the route of administration and the nature of the disease or disorder, and should be determined according to the judgment of the practitioner and each patient's circumstances. Effective doses can be estimated from dose-response curves obtained from in vitro or in vivo animal model test bioassays or systems.

[0102] In some embodiments, the subject is a mammal. In some embodiments, the subject is a laboratory animal. In some embodiments, the subject is a pet. In some embodiments, the subject is a rodent. In some embodiments, the subject is a livestock animal. In some embodiments, the subject is a human subject.

[0103] In some embodiments, the subject is suffering from a disease or disorder comprising a viral disease, cancer, a genetic disease, a CNS disease, an inflammatory disease, a pulmonary disease, or any combination thereof.

[0104] In some embodiments, the pharmaceutical composition is formulated for systemic administration. In some embodiments, the pharmaceutical composition is formulated for topical administration. In some embodiments, the pharmaceutical composition is formulated for intravenous administration. In some embodiments, the pharmaceutical composition is formulated for administration to a subject.

[0105] As used herein, the term "pharmaceutically acceptable salt" refers to any non-toxic salt of a conjugate of the present invention that, upon administration to a subject, e.g., a human, is capable of providing, directly or indirectly, a compound of the present invention or a therapeutically active metabolite or residue thereof. For example, the term "pharmaceutically acceptable" can mean approved by a federal or state regulatory agency or listed in the United States Pharmacopoeia or other generally recognized pharmacopoeias for use in animals, more particularly in humans.

[0106] Pharmaceutically acceptable salts are well known in the art.For example, S. M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19.The pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases.

[0107] Non-limiting examples of pharmaceutically acceptable salts include, but are not limited to, alkali metal salts, alkaline earth metal salts, acetate, aspartate, benzenesulfonate, benzoate, bicarbonate, carbonate, halide (e.g., bromide, chloride, iodide, fluoride), bitartrate, citrate, salicylate, stearate, succinate, sulfate, tartrate, decanoate, edetate, fumarate, gluconate, and lactate salts, or any combination thereof.

[0108] Further examples of pharmaceutically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric, hydrobromic, phosphoric, sulfuric, and perchloric acids, or organic acids such as acetic, oxalic, maleic, tartaric, citric, succinic, or malonic acid, or by using other methods used in the art, such as ion exchange.

[0109] Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, glycolate, gluconate, glycolate, hemisulfonate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxy-ethanesulfonate, and 2-hydroxy-ethanesulfonate. Examples of the salts include sulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, palmoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, salicylate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, and valerate.

[0110] In some embodiments, the conjugates of the invention are present in pharmaceutical compositions and are of pharmaceutical grade purity, i.e., characterized by a chemical purity of at least about 90%, at least about 95%, greater than 95%, or greater than 99%.

[0111] In some embodiments, the pharmaceutical composition is for use in treating a disease or disorder in a subject in need of such treatment. In some embodiments, the pharmaceutical composition is for use in reducing at least one symptom associated with a disease or disorder. In some embodiments, the disease or disorder is a genetic disease.

[0112] The term "genetic disease" encompasses diseases associated with any abnormal expression and / or mutation of one or more genes.

[0113] In some embodiments, non-limiting examples of genetic diseases include, but are not limited to, proliferative diseases (e.g., cancer), inflammatory diseases (e.g., IBD, rheumatoid arthritis), CF, hearing loss, and CMT1A. In some embodiments, the conjugates of the present invention and / or pharmaceutically acceptable salts thereof are formulated in the form of a pharmaceutical composition for treating or preventing a respiratory viral disease in a subject in need thereof. In some embodiments, the pharmaceutical composition comprises one or more conjugates of the present invention and a pharmaceutically acceptable carrier, excipient, or adjuvant. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of one or more conjugates of the present invention. In some embodiments, the pharmaceutical composition is for use in treating or preventing a disease or disorder associated with a respiratory viral infection in a subject in need thereof.

[0114] In some embodiments, the respiratory virus is a virus such as adenovirus, coronavirus HKU1, coronavirus NL63, coronavirus 229E, coronavirus OC43, severe acute respiratory syndrome coronavirus 2 (SARS CoV 2), human metapneumovirus, human rhinovirus / enterovirus, influenza A, influenza A / H1, influenza A / H3, influenza A / H1-2009, influenza B, parainfluenza virus 1-4, or respiratory syncytial virus.

[0115] In some embodiments, a method for preventing or treating a respiratory virus infection in a subject in need thereof and / or reducing at least one symptom of a disease associated with a respiratory virus infection is provided, comprising administering a therapeutically effective amount of a pharmaceutical composition of the present invention to the subject. In some embodiments, the therapeutically effective amount is sufficient to reduce at least one symptom, or to reduce the severity and / or inhibit the progression of the disease, disorder, or condition described above. In some embodiments, the therapeutically effective amount is sufficient to inhibit the pathogenicity of the respiratory virus. In some embodiments, the therapeutically effective amount is sufficient to substantially reduce or completely inhibit any biological activity of the respiratory virus, such as replication (e.g., RNA replication), transcription, translation, or proliferation.

[0116] In some embodiments, the therapeutically effective amount is sufficient to reduce the viral load or stop viral growth in a subject if the subject is suffering from a respiratory viral disease.

[0117] definition As used herein, the term "alkyl" describes an aliphatic hydrocarbon, including straight-chain and branched-chain groups. Preferably, an alkyl group has 21 to 100 carbon atoms, more preferably 21 to 50 carbon atoms. Whenever a numerical range, e.g., "21 to 100," is mentioned herein, it means that the group, in this case, the alkyl group, can contain up to 100 carbon atoms, such as 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, etc. In the context of the present invention, a "long-chain alkyl" is an alkyl having at least 20 carbon atoms in its backbone (the longest path of consecutive covalently bonded atoms). Thus, a short alkyl has 20 or fewer backbone carbon atoms. Alkyl can be substituted or unsubstituted, as defined herein.

[0118] The term "alkyl," as used herein, also encompasses saturated or unsaturated hydrocarbons, and thus, the term further encompasses alkenyl and alkynyl.

[0119] The term "alkenyl" describes an unsaturated alkyl, as defined herein, having at least two carbon atoms and at least one carbon-carbon double bond. The alkenyl may be unsubstituted or substituted with one or more substituents, as described above.

[0120] The term "alkynyl" refers to an unsaturated alkyl, as defined herein, having at least two carbon atoms and at least one carbon-carbon triple bond. The alkynyl may be unsubstituted or substituted with one or more substituents, as described above.

[0121] The term "cycloalkyl" describes an all-carbon monocyclic or fused ring (i.e., rings that share adjacent pairs of carbon atoms) group in which one or more rings do not have a fully conjugated pi-electron system. Cycloalkyl groups can be substituted or unsubstituted as indicated herein.

[0122] The term "aryl" describes an all-carbon monocyclic, polycyclic (bicyclic or tricyclic), mixed-ring, or fused-ring polycyclic (i.e., rings that share adjacent pairs of carbon atoms) group having a fully conjugated pi-electron system. Aryl groups can be substituted or unsubstituted as indicated herein. The term "aryl" further encompasses heteroaromatic rings, such as monocyclic, polycyclic (bicyclic or tricyclic), mixed-ring, or fused-ring polycyclic heteroaromatic rings.

[0123] The term "alkoxy" refers to both an --O-alkyl group and an --O-cycloalkyl group, as defined herein.

[0124] The term "aryloxy" describes --O-aryl, as defined herein.

[0125] Each of the alkyl, cycloalkyl, and aryl groups in the general formulas herein may be substituted with one or more substituents, whereby each substituent may independently be, for example, halide, alkyl, alkoxy, cycloalkyl, nitro, amino, hydroxyl, thiol, thioalkoxy, carboxy, amido, aryl, and aryloxy, depending on the substituent and its position in the molecule. Additional substituents are also contemplated.

[0126] The terms "halide," "halogen," or "halo" describe fluorine, chlorine, bromine, or iodine.

[0127] The term "haloalkyl" describes an alkyl group, as defined herein, that is further substituted with one or more halide groups.

[0128] The term "haloalkoxy" describes an alkoxy group, as defined herein, further substituted with one or more halide groups.

[0129] The terms "hydroxyl" or "hydroxy" describe an --OH group.

[0130] The terms "mercapto" or "thiol" describe a --SH group.

[0131] The term "thioalkoxy" describes both an --S-alkyl group, and an --S-cycloalkyl group, as defined herein.

[0132] The term "thioaryloxy" describes both an --S-aryl and an --S-heteroaryl group, as defined herein.

[0133] The term "amino" describes the group --NR'R'' where R' and R'' are described herein.

[0134] The term "heterocyclyl" describes a monocyclic or fused ring group containing one or more atoms, such as nitrogen, oxygen, and sulfur, in the ring. The ring may also contain one or more double bonds. However, the ring does not have a fully conjugated pi-electron system. Representative examples include piperidine, piperazine, tetrahydrofuran, tetrahydropyran, morpholino, and the like.

[0135] The term "carboxy" or "carboxylate" describes a -C(O)OR' group, where R' is hydrogen, alkyl, cycloalkyl, alkenyl, aryl, heteroaryl (bonded through a ring carbon), or heterocyclyl (bonded through a ring carbon), as defined herein.

[0136] The term "carbonyl" describes a -C(O)R' group, where R' is defined above.

[0137] The term also includes its thio derivatives (thiocarboxy and thiocarbonyl).

[0138] The term "thiocarbonyl" describes a -C(S)R' group, where R' is defined above.

[0139] A "thiocarboxy" group describes a -C(S)OR' group, where R' is defined herein.

[0140] A "sulfinyl" group describes a -S(O)R' group, where R' is defined herein.

[0141] A "sulfonyl" or "sulfonate" group refers to a -S(O)2R' group, where R' is defined herein.

[0142] A "carbamyl" or a "carbamate" group describes an --OC(O)NR'R" group, where R' is defined herein and R" is defined for R'.

[0143] A "nitro" group refers to a -NO2 group.

[0144] The term "amide" as used herein includes C-amide and N-amide.

[0145] The term "C-amido" describes a -C(O)NR'R'' terminal group or a -C(O)NR'- linking group, as these phrases are defined herein above, where R' and R'' are defined herein.

[0146] The term "N-amido" describes an -NR"C(O)R' terminal group or an -NR'C(O)- linking group, as these phrases are defined herein above, where R' and R" are defined herein.

[0147] The term "carboxylic acid derivatives" as used herein includes carboxy, amide, carbonyl, anhydride, carbonate ester, and carbamate.

[0148] A "cyano" or "nitrile" group refers to a -CN group.

[0149] The terms "azo" or "diazo" describe an -N=NR' terminal group or an -N=N- linking group, where these phrases are as defined hereinabove and R' is defined hereinabove.

[0150] The term "guanidine" describes an -R'NC(N)NR''R''' terminal group or an -R'NC(N)NR''- linking group, where these phrases are defined hereinabove and R', R'' and R''' are defined herein.

[0151] As used herein, the term "azido" refers to the group --N3.

[0152] The term "sulfonamide" refers to the group -S(O)2NR'R'' where R' and R'' are defined herein.

[0153] The term "phosphonyl" or "phosphonate" describes a -OP(O)-(OR')2 group, where R' is defined above.

[0154] The term "phosphinyl" describes a -PR'R'' group, where R' and R'' are defined above.

[0155] The term "alkylaryl" describes an alkyl substituted with an aryl, as defined herein. An exemplary alkylaryl is benzyl.

[0156] The term "heteroaryl" describes a monocyclic (e.g., a C5-C6 heteroaryl ring) or fused-ring (i.e., rings sharing adjacent pairs of atoms) group having one or more atoms, such as nitrogen, oxygen, and sulfur, within the ring and further having a fully conjugated pi-electron system. In some embodiments, the terms "heteroaryl" and "C5-C6 heteroaryl" are used interchangeably herein. Examples of heteroaryl groups include, but are not limited to, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, pyrazole, pyridine, pyrimidine, quinoline, isoquinoline, and purine. Heteroaryl groups can be substituted or unsubstituted with one or more substituents, as described above. Representative examples are thiadiazole, pyridine, pyrrole, oxazole, indole, purine, and the like.

[0157] As used herein, the terms "halo" and "halide," referred to interchangeably herein, describe an atom of the halogens, i.e., fluorine, chlorine, bromine, or iodine, and are also referred to herein as fluoride, chloride, bromide, and iodide.

[0158] The term "haloalkyl" describes an alkyl group, as defined above, that is further substituted with one or more halide groups.

[0159] As used herein, the term "treatment" or "treating" a disease, disorder, or condition includes alleviating at least one symptom thereof, reducing its severity, or inhibiting its progression. Treatment does not necessarily mean that the disease, disorder, or condition is completely cured. To be an effective treatment, a useful composition herein need only reduce the severity of the disease, disorder, or condition, reduce the severity of symptoms associated therewith, or improve the quality of life of the patient or subject.

[0160] As used herein, the term "prevention" of a disease, disorder, or condition encompasses delaying, preventing, suppressing, or inhibiting the onset of a disease, disorder, or condition. When used in accordance with the subject matter described herein, the term "prevention" refers to a preventative process in which a subject is exposed to an active ingredient described herein before the induction or onset of a disease / disorder process. This can be done when an individual has a genetic lineage that shows a predisposition to the occurrence of the disease / disorder to be prevented. For example, this may apply to an individual whose ancestors show a predisposition to a certain type of inflammatory disorder.

[0161] The term "suppression" is used to describe a state in which a disease / disorder process has already begun, but obvious symptoms of the condition have not yet been realized. Thus, an individual's cells may have the disease / disorder, but the external signs of the disease / disorder have not yet been clinically recognized. In either case, the term prophylaxis can be applied to encompass both prevention and suppression.

[0162] Conversely, the term "treatment" refers to the clinical application of an active agent to combat an existing condition where clinical symptoms have already been realized in a patient.

[0163] In the description, unless otherwise stated, adjectives such as "substantially" and "about" modifying a condition or relationship characteristic of one or more features of an embodiment of the present invention are understood to mean that the condition or characteristic is defined within a tolerance allowed for the operation of the embodiment for its intended use. Unless otherwise indicated, the word "or" in this specification and claims is considered to be an inclusive "or" rather than an exclusive or, indicating at least one, or any combination, of the items with which it is associated.

[0164] The terms "a" and "an," as used above and elsewhere in this specification, should be understood to refer to "one or more" of the listed components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless otherwise specified. Thus, the terms "a," "an," and "at least one" are used interchangeably in this application.

[0165] To better understand the present teachings, and not to limit the scope of the teachings in any way, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, as well as other numerical values ​​used in the specification and claims, should be understood to be modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and appended claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0166] In the specification and claims of this application, the verbs "comprise," "include," and "have," and their conjugations, are used to indicate that the object or objects of the verb are not necessarily the subject of the verb or an exhaustive list of components, elements, or parts of the subject.

[0167] Other terms, as used herein, are meant to be defined by their well-known meanings in the art.

[0168] As used herein, the term "or" is understood to be inclusive unless specifically stated otherwise or clear from the context.

[0169] Throughout this specification and claims, the word "comprise" or variations such as "comprises" or "comprising" refer to the inclusion of any recited integer or group of integers, but not the exclusion of any other integer or group of integers.

[0170] As used herein, the term "consists essentially of" or variations such as "consist essentially of" or "consisting essentially of" as used throughout this specification and claims indicates the inclusion of any enumerated integer or group of integers, and the optional inclusion of any enumerated integer or group of integers that does not materially alter the basic or novel characteristics of the specified method, structure, or composition.

[0171] As used herein, terms such as "comprises," "comprising," "containing," "having," and the like can mean "includes," "including," and the like; "consisting essentially of" or "consists essentially" similarly have the meanings set forth in U.S. patent law, where the term is open-ended, allowing for the presence of more than those recited, provided that the basic or novel characteristics of the recited items are not altered by the presence of more than those recited, but excluding prior art embodiments. In one embodiment, the terms "comprises," "comprising," and "having" are interchangeable with "consisting."

[0172] While the present invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications, and variations that fall within the spirit and broad scope of the appended claims.

[0173] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated herein by reference. Furthermore, citation or identification of any reference in this application should not be construed as an admission that such reference is available as prior art to the present invention. To the extent section headings are used, they should not be construed as necessarily limiting.

[0174] Example Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, and microbiological techniques, which are fully explained in the literature. [Example]

[0175] Synthesis procedure Non-limiting exemplary synthetic procedures for the conjugates of the present invention are provided below.

[0176] A typical synthesis is shown in Scheme 1, with well-established estrone protection and subsequent LiAlH4 / AlCl3 ring-opening. This crude material could be selectively alkylated on the phenol using 3,5-difluorobenzyl bromide 4. Purification and subsequent Mitsunobu to install the perfluorinated motif afforded compound 5 in good yield. Reaction with DMF and LDA introduced the hydroxymethyl to give the intermediate aldehyde, which was reduced in a one-pot procedure using sodium borohydride. Activation of the alcohol using mesyl chloride followed by treatment with methylaminohexanol gave alcohol 7. While intermediate workup is conceivable, the presence of a chloride salt could displace the mesylate with chloride to provide the much less active benzyl chloride. [ka]

[0177] The alcohol was converted to the thioacetate 8 using Mitsunobu conditions. [ka]

[0178] The synthesis of thiotosylate 18 began with the coupling of ethyl diazoacetate with 3-bromopropan-1-ol to give ether 9. Diethyl malonate was alkylated with bromide 9 to give triester 10. Reduction of the ester using LiAlH4 gave triol 11. The acetonide moiety was installed by treatment with dimethoxypropane to give acetonide 12. The alcohol was first converted to the mesylate, followed by the use of sodium iodide compound 13. Alternative methods based on triphenylphosphine and NBS generally resulted in numerous impurities and low yields. Finally, displacement of the halogen with potassium thiotosylate gave the desired building block thiotosylate 18. [ka]

[0179] Thioacetate 8 was deprotected in situ using basic conditions, which also allowed for nucleophilic attack on thiotosylate 18 to form disulfide 15. It should be noted that during exposure of the acetonide to silica, the acetonide may spontaneously shed, leaving the deprotected diol attached to the column. Further elution of the column with up to 100% acetone afforded the diol in reasonable purity and quantity. After purification, the material was subjected to acetonide removal using acidic proton conditions.

[0180] After crude workup, the material was directly suitable for selective dimethoxytrityl monoprotection to provide 17. Final installation of the phosphoramidate was again well-established chemistry, affording Apo-Si-K-170-A in good yield.

[0181] Thioacetate 8: Synthesis of (8R,9S,13S,14S)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxan]-3-ol (1)

[0182] To a suspension of estrone (252 grams, 0.93 moles) in toluene (1.5 L) was added trimethoxymethane (297 g, 350 mL, 2.80 moles), propane-1,3-diol (213 g, 250 mL, 2.80 moles), and pTsOH (2 g, 10 mmol). The mixture was warmed to 60°C and stirred for 16 hours. Triethylamine (6 mL) and water (600 mL) were added, and stirring was continued for an additional hour. The phases were separated, and the organic layer was washed with water (3 x 400 mL) and brine. The mixture was dried over NaSO and partially concentrated to approximately 1 L. The mixture was poured into heptane (4 L), and the white solid was filtered off, washed with heptane, and dried in vacuo. Compound 1 (271 grams, 825 mmol) was isolated as a white solid in 88.5% yield.

[0183] (8R,9S,13S,14S,17S)-17-(3-hydroxypropoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-ol (2)

[0184] To a solution of (13S)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxan]-3-ol (45 g, 140 mmol) in THF (1 L) was carefully added lithium aluminum hydride (6.2 g, 0.16 mol) at 0 °C, followed by an additional 1.5 L of THF. While still at 0 °C, aluminum chloride (73 g, 0.55 mol) was added (highly exothermic!). The mixture was stirred at 0 °C for 15 min and then warmed to 60 °C. The mixture was stirred at 60 °C for 2 h (be careful not to clog), then cooled to 0 °C and quenched by the dropwise addition of NH4Cl(aq) (500 mL). The mixture was stirred at room temperature for 16 h. The phases were separated and the organic layer was washed with brine and concentrated to give a white solid that was contaminated with estradiol (approximately 15%).

[0185] The reaction was repeated once more in the same manner using similar amounts. After NMR analysis, both portions were combined to give 95 grams of crude material.

[0186] 3-(((13S,17S)-3-((4-(2,2-dimethoxyethyl)-3,5-difluorobenzyl)oxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-17-yl)oxy)propan-1-ol (3)

[0187] To a suspension of crude phenol 7 (95 grams, assumed to be 0.22 mol) and potassium carbonate (76 g, 0.55 mol) in acetone (1.5 L) and MeOH (200 mL), 3,5-difluorobenzyl bromide (100 g, 0.49 mol) and TBAI (5.1 grams, 14 mmol) were added. The resulting mixture was stirred at 65°C for 16 hours. The mixture was cooled to room temperature, filtered, and the filtrate was concentrated. Water (500 mL) was added, and the mixture was extracted with EtOAc (3 x 500 mL). The combined organic layers were dried over sodium sulfate and concentrated.

[0188] The crude material was completely converted to the corresponding benzylphenol.

[0189] (13S,17S)-3-((4-(2,2-dimethoxyethyl)-3,5-difluorobenzyl)oxy)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthrene (5)

[0190] To a solution of crude alcohol 8 in THF (700 mL) was added triphenylphosphine (86 g, 0.33 mol) and 1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-ol (100 grams, 0.41 mol), followed by DIAD (59 mL, 0.3 mol), and the resulting mixture was stirred at room temperature for 1 hour. Heptane (0.5 L) was added to the mixture, and the mixture was partially concentrated. Additional heptane (0.3 L) was added, and the mixture was stirred for 5 minutes. The solid was filtered off, and all organics were washed with 5% aqueous hydrogen peroxide (3 × 100 mL), twice with brine, and concentrated. Further purification using column chromatography (gradient 5% to 10% EtOAc / heptane) afforded compound 5 (137 grams, 0.14 mol, 74% (4 steps)) as a white crystalline solid.

[0191] (2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)phenyl)methanol (6)

[0192] To a solution of (13S,17S)-3-((3,5-difluorobenzyl)oxy)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthrene (73 g, 0.11 mol) in THF (1.3 L anhydrous) at −78° C. was added nBuLi (45 mL, 2.5 mol, 0.11 mol). A dark color was observed, which became clear after 10 minutes. The resulting yellow / red mixture was stirred at −78° C. for 1.5 hours. DMF (25 mL, 0.32 mol) (anhydrous) was added dropwise and stirred for 30 minutes while warming to room temperature. MeOH (100 mL) was added, followed by sodium borohydride (6.1 g, 0.16 mol) (carefully) and continued stirring for 0.5 minutes. Water (100 mL) was added, stirring continued for 16 hours, and then partially concentrated in vacuo. EtOAc (1 L) was added, washed with brine, and concentrated. Further purification using flash chromatography (large column, 15% to 25% EtOAc in heptane) afforded the desired alcohol (23.6 grams, 33.5 mmol) as a clear oil in 31% yield. The remainder was unreacted starting material.

[0193] 6-((2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexan-1-ol (7)

[0194] To a solution of compound 10 (23.6 g, 33.5 mmol) and triethylamine (14.0 mL, 100 mmol) in DCM (250 mL) was added mesyl-Cl (3.0 mL, 38.5 mmol), and the resulting mixture was stirred for 1 h. 6-(methylamino)hexan-1-ol (9 g, 68.5 mmol) was added to the solution. The resulting mixture was stirred at room temperature for 16 h. The mixture was diluted with dichloromethane (200 mL), and the mixture was washed with saturated aqueous sodium bicarbonate and brine, dried over Na2SO4, and concentrated. The crude material was purified using column chromatography (10–20% acetone in heptane + 1% NEt3) to give alcohol 7 (15.5 g, 59.1%) as a white solid.

[0195] S-(6-((2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)ethanethioate (8)

[0196] Two batches were set up and ultimately combined before purification.

[0197] To a solution of alcohol 7 (23.9 g, 29.2 mmol) (15.5 g, 19.0 mmol) in THF (800 mL) was added triphenylphosphine (10.7 g, 40.9 mmol) (7.0 g, 26.5 mmol) and DIAD (7.4 mL, 38 mmol) (4.8 mL, 24.6 mmol), and the mixture was stirred for 5 min. Thioacetic acid (5.3 mL, 38.0 mmol) (3.4 mL, 47.4 mmol) was then added, and the mixture was stirred for 2 h. The mixture was combined and concentrated. The crude material was purified using column chromatography (gradient: 5% to 10% acetone in heptane + 1% EtN) to give thioacetate 8 (39.3 g, 93%).

[0198] Thiotosylate 18: Synthesis of ethyl 2-(3-bromopropoxy)acetate (9)

[0199] To a solution of ethyl 2-diazoacetate (100 g, 0.74 mol) and 3-bromopropan-1-ol (0.10 kg, 74 mL, 0.74 mol) in DCM (100 mL) was added BF3.OEt2 (1.1 g, 0.94 mL, 7.4 mmol) at 0 °C. The reaction was stirred at 0 °C for 15 min and at room temperature for 3 h until no further gas evolution was observed. The mixture was diluted with DCM (500 mL), washed with HO (500 mL) and brine (500 mL), and dried over Na2SO4. The solvent was removed in vacuo to give ethyl 2-(3-bromopropoxy)acetate (9,180 g, 0.80 mol, 110%) as a clear yellow oil.

[0200] Diethyl 2-(3-(2-ethoxy-2-oxoethoxy)propyl)malonate (10)

[0201] To an ice-cooled suspension of sodium hydride (8.9 g, 0.22 mol) in DMF (600 mL) was slowly added diethyl malonate (53 g, 51 mL, 0.33 mol). The resulting mixture was stirred at room temperature for 45 min. Bromide 9 (50 g, 0.22 mol) was added at 0 °C, and the mixture was stirred at 0 °C for 10 min and at room temperature overnight. The mixture was partially concentrated. Water (1 L) was then added, and the mixture was extracted with EtOAc / heptane (1:1, 3 × 500 mL). The combined organic layers were washed with brine, dried over Na SO , and concentrated. The crude material was purified by column chromatography (20% EtOAc / heptane) to give triester 10 (45 g, 0.15 mol, 67%) as a clear oil.

[0202] 2-(3-(2,2-dimethyl-1,3-dioxan-5-yl)propoxy)ethan-1-ol (12)

[0203] To an ice-cooled suspension of LiAlH (25 g, 0.66 mol) in THF (200 mL) was slowly added a solution of triester 10 (36 g, 118 mmol) in THF. The mixture was warmed to room temperature and stirred for 1 h. At 0 °C, KOH (20% aqueous solution, 106 mL (160 mL / mol of LiAlH)) was slowly added, and the resulting mixture was stirred at room temperature for 1 h. The mixture was filtered through Celite, dried over NaSO, and concentrated to give triol 11.

[0204] The material was dissolved in DCM (400 mL), 2,2-dimethoxypropane (15 g, 17 mL, 141 mmol) and 4-methylbenzenesulfonic acid hydrate (2.2 g, 12 mmol) were added, and the resulting mixture was stirred for 30 min. The mixture was partially concentrated. The residue was dissolved in EtOAc (550 mL), washed with NaHCO (300 mL) and brine (300 mL), dried over NaSO, and concentrated to give acetonide 12 (8.9 g, 41 mmol, 35%) as a clear yellow oil.

[0205] 5-(3-(2-bromoethoxy)propyl)-2,2-dimethyl-1,3-dioxane (18)

[0206] To a solution of alcohol 16 (32 g, 147 mmol) and triethylamine (30 mL, 220 mmol) in DCM (120 mL) was added MsCl (13.7 mL, 176 mmol), and the resulting mixture was stirred at room temperature for 30 minutes. The mixture was washed with NaHCO (300 mL), dried over NaSO, and concentrated. The crude intermediate was dissolved in acetone (600 mL), and sodium iodide (43.9 grams, 293 mmol) was added. The resulting mixture was refluxed for 16 hours. The mixture was cooled to room temperature and concentrated. The mixture was diluted with dichloromethane and washed with water to remove all salts. The organic layer was dried over sodium sulfate and concentrated. All material was dissolved in acetone (600 ml) and potassium 4-methylbenzenesulfonothioate (49.8 g, 220 mmol), and the resulting mixture was stirred at 60° C. for 16 hours. The mixture was cooled to room temperature, concentrated, diluted with EtOAc, washed with saturated aqueous sodium bicarbonate, brine, dried over sodium sulfate, and concentrated.

[0207] Synthesis of Apo-Si-K-170-A

[0208] N-(2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)-6-((2-(3-(2,2-dimethyl-1,3-dioxan-5-yl)propoxy)ethyl)disulfanayl)-N-methylhexan-1-amine (15)

[0209] This reaction was carried out in two batches:

[0210] To a solution of thioacetate 8 (19.6, 1 equiv., 22.6 mmol) and thiotosylate 18 (9.2 g, 1.5 equiv., 29.4 mmol) in DCM (500 mL) and MeOH (25 mL) was added 5.4 M sodium methoxide in MeOH (10.5 mL, 2 equiv., 56.5 mmol), and the resulting mixture was stirred at room temperature for 1 h. The mixture was diluted with DCM (200 mL), washed with NaHCO and brine, dried over NaSO, and concentrated.

[0211] The two portions were combined and further purified by column (gradient 10-40% EtOAc / heptane + 1% NEt3) to give disulfide 15 (29.6 g, 61%) as a yellowish oil.

[0212] The much more polar fraction contained acetal-free material as diol 16 (11.2 g, 10.9 mmol, 24%).

[0213] 2-(3-(2-((6-((2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)disulfanyl)ethoxy)propyl)propane-1,3-diol (16)

[0214] To a solution of disulfide 15 (21.2 g, 19.9 mmol) in DCM (40 mL) and MeOH (100 mL) was added p-TosOH (4.16 g, 1.2 equiv., 21.9 mmol), and the resulting mixture was stirred at room temperature for 16 h. The reaction was quenched by the addition of NEt (10 mL), and the mixture was washed with saturated aqueous sodium bicarbonate, dried over sodium sulfate, and concentrated to give diol 16 (18.0 g, 88%) as an off-white solid.

[0215] 2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(2-((6-((2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)disulfanyl)ethoxy)pentan-1-ol (17)

[0216] To a solution of diol 16 (18.0 g, 18.0 mmol), DMAP (0.21 g, 1.8 mmol), and triethylamine (3.2 mL, 23 mmol) in DCM (350 mL) was added 4,4'-(chloro(phenyl)methylene)bis(methoxybenzene) (5.9 g, 18.0 mmol), and the resulting mixture was stirred at room temperature for 16 h. The mixture was washed with saturated aqueous sodium bicarbonate, dried over sodium sulfate, and concentrated. The crude material was purified using column chromatography (12% acetone + 1% NEt in heptane, using silica deactivated by pretreatment with NEt) to give alcohol 17 (15.3 g, 66%) as a yellow oil.

[0217] 2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(2-((6-((2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)disulfanyl)ethoxy)pentyl(2-cyanoethyl)diisopropylphosphoramidite (Apo-Si-K-170-A)

[0218] To a solution of alcohol 17 (15.2 g, 11.5 mmol) in DCM (300 mL) was added 3-((bis(diisopropylamino)phosphaneyl)oxy)propanenitrile (5.5 mL, 18.0 mmol) and a solution of N-methylmorpholine (1.75 g, 17.3 mmol) and TFA (985 mg, 8.7 mmol) (0.5 M NMM and 0.25 M TFA) in DCM (34.5 mL), and the resulting mixture was stirred at room temperature for 1.5 h. The mixture was washed with saturated aqueous sodium bicarbonate, dried over sodium sulfate, and concentrated. The crude material was purified by column chromatography (10% acetone / heptane + 1% NEt, NEt-pretreated silica) to give Apo-Si-K-170-A (11.8 g, 67%) as a colorless oil.

[0219] Synthesis scheme of Apo-Si-K-170-B: [ka]

[0220] Synthesis scheme of Apo-Si-K-170-C: [ka]

[0221] Synthesis scheme of Apo-Si-K-941: [ka] Scheme 6: Synthesis of Apo-Si-K-941

[0222] Synthesis of Apo-Si-K-1014:

[0223] The initial synthetic route to Apo-Si-K-1014 focused on the formation of a thiol (i.e., compound 4) and further functionalization. This route began with chloride 2, an intermediate from the synthesis of Apo-Si-K-170A, which could be easily converted to thioacetate 3. In another Aposense project, the liberation of the thiol was required and investigated. While liberation can be easily achieved, sulfide oxidation is a serious problem. The disulfide was isolated only by post-treatment. The structure reveals that tertiary amines create a local basic environment, which greatly enhances sulfide oxidation. Using oxygen-free conditions for liberation and subsequent acidification allowed for further workup, yielding the free thiol 4 as the HCl salt, which proved to be very stable. (The HCl salt also creates a local acidic environment that could block sulfide oxidation.) Establishing condensation of the free thiol 4 with acid 5 proved to be a logical choice, but ultimately, such a bond proved to be too rigid. Activation of the acid with DCC or Pybop did not result in conversion, while acyl chlorides were found to give very low yields. [ka]

[0224] Results and Discussion

[0225] If thioester formation by condensation did not yield results, the idea was that the introduction of thioacetate was not lost. Instead of the laborious introduction of a thiol, the attachment of a thioacid (i.e., compound 7) should shorten the route and provide a thioester, as shown in Scheme 3. [ka]

[0226] Conversion of compound 5 to the corresponding thioacid 7 was achieved by treatment with CDI followed by NaSH. After acidic workup, compound 7 could be isolated in near quantitative yield and reasonable purity (1 (The lower purity indicated by H-NMR may be due to resonance structures.) Treatment of the crude material with sodium hydride was expected to form the sodium salt, which could be reacted with chloride 2 (which was pretreated with sodium hydride to remove the HCl salt). Coupling of 7 to 2 was successful, and the thioester proved to be more stable than expected. [ka]

[0227] With compound 6 in hand, the alcohol was liberated by treatment with TBAF, followed by coupling of the phosphimidate using diisopropyltetrazole. Purification afforded compound Apo-Si-K-1014.

[0228] 9-((tert-Butyldiphenylsilyl)oxy)nonanethio S-acid (7). A solution of 9-((tert-butyldiphenylsilyl)oxy)nonanoic acid (2.01 g, 4.87 mmol) in dichloromethane (125 mL) was treated with CDI (2.37 g, 14.6 mmol) at °C and stirring was continued for 1 h. Sodium hydrogen sulfide hydrate (1.08 g, 14.6 mmol) was then added in one portion and stirring was continued at room temperature for 16 h. The mixture was washed with 2 M HCl, dried over sodium sulfate, and concentrated.

[0229] Crude NMR revealed complete and relatively clean conversion and the material was used directly in the next step.

[0230] S-(6-((2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)9-((tert-butyldiphenylsilyl)oxy)nonanthioate (6). To a solution of compound 7 (1.95 g, 4.56 mmol) in DMF (10 mL) was added sodium hydride (326 mg, 60% Wt, 8.14 mmol). To a solution of compound 2 (2.84 g, 3.26 mmol) in DMF (1.5 mL) was added sodium hydride (163 mg, 60% Wt, 1.25 equivalents, 4.07 mmol). After 5 minutes, both solutions were combined. TBAI (10 mg) was added, and the mixture was heated to 80° C. and continued for 3 hours. After cooling to room temperature, heptane (350 mL) was added, washed with water (2×50 mL) and brine, dried over sodium sulfate, and concentrated. The crude material was used directly for deprotection.

[0231] S-(6-((2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)9-hydroxynonanthioate (6a). The entire crude material of compound 6 was dissolved in THF (75 mL) and a 1 M solution of TBAF (2.55 g, 9.77 mL, 1 mol, 9.77 mmol) in THF was added and stirring was continued for 16 h. The mixture was concentrated and further purified using gradient flash chromatography (25% to 40% EtOAc in heptane + 1% EtN). Compound 6a (925 mg, 0.75 mmol) was isolated as a sticky oil in 23% yield (trace amounts of TBDPS still present).

[0232] S-(6-((2,6-difluoro-4-((((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)methyl)benzyl)(methyl)amino)hexyl)9-(((2-cyanoethoxy)(diisopropylamino)phosphaneyl)oxy)nonanthioate (Apo-Si-K-1014) To a solution of compound 6a (925 mg, 0.94 mmol) in dichloromethane (50 mL) was added diisopropylammonium tetrazolide (241 mg, 1.5 To the resulting solution was added 3-((bis(diisopropylamino)phosphaneyl)oxy)propanenitrile (849 mg, 2.82 mmol). Stirring was continued at room temperature for 16 h. The mixture was concentrated by TLC and further purified using flash chromatography (20% to 40% ethyl acetate in heptane (very gentle gradient (+1% EtN overall)). Apo-Si-K-1014 (825 mg, 0.69 mmol) was isolated as a sticky oil in 73% yield.

[0233] Synthesis of Apo-Si-K-1007

[0234] The starting point would be the use of phenol 1, which has been synthesized several times. For clarity, its synthesis is included in Scheme 1. Initial benzylation of estradiol to the phenol was performed, followed by further functionalization of the C-17 alcohol with allyl bromide to give compound 4. The olefin was hydroborated, and alcohol 5 was isolated upon oxidative workup. Using Mitsunobo conditions, the alcohol was perfluorinated to give the highly nonpolar compound 6. This material could be easily purified by filtration over silica with heptane and further purified by recrystallization from acetonitrile. After hydrogenation and filtration, phenol 1 was obtained in significant yield. [ka]

[0235] Functionalization of the free phenol can be easily achieved using Mitsunobu conditions and an appropriate alcohol. We synthesized compound 7 by combining bromide 10 with functionalized piperazine 11, which gave compound 7. When Mitsunobu conditions were applied, compound 9 could be easily obtained. While the Mitsunobu reaction with phenol 1 was easily carried out, the piperazine-driven reaction of compound 7 was more difficult to achieve complete (and relatively clean) conversion. [ka] [ka]

[0236] With compound 9 in hand, liberation of the ester yielded a zwitterionic species (i.e., compound 12), which is virtually impossible to handle. Initially, we attempted to obtain the tert-butyl ester, which could be liberated using acidic conditions such as 4 M HCl in dioxane, but due to the highly basic piperazine drive, the ester appears to be shielded, preventing its liberation. Instead, we used the ethyl ester, which can be hydrolyzed using sodium hydroxide and concentrated as is. To say that compound 12 and its derivatives are extremely difficult to handle is an understatement. [ka]

[0237] The sodium salt of compound 12 could be used in subsequent peptide couplings. We successfully converted the material to its corresponding acyl chloride, but also successfully activated it using PyBOP and EDCI, the latter of which was easier to purify. With compound 13 in hand, removal of the acetyl clip in acidic media was performed accordingly, but the diol was still very polar and difficult to handle. Once the crude diol was protected with DMT, compound 15 became more convenient to handle.

[0238] At this stage, polarity issues and the very basic piperazine drive seemed to be the cause of all the problems. The cyclic bisamine may have some kind of intramolecular interaction with the amide, leading to some suspected zwitterionic behavior. Furthermore, for the final step, we typically use a buffer solution of N-methylmorpholine and TFA, believing that the piperazine is sufficiently basic to trap TFA indefinitely, thus making purification cumbersome. However, omitting the proton source prevents activation of the phosphimidate reagent, thereby allowing coupling to the alcohol. To resolve all these issues, we tested the use of tetrazole diisopropyl salt, which afforded Apo-Si-K-1007 in somewhat moderate yield but with good purity.

[0239] Intermediate 20 [ka]

[0240] Di-tert-butyl malonate was alkylated with ethyl 2-(3-bromopropoxy)acetate and NaH in DMF at room temperature for 16 hours. Compound 18 was isolated in 59% yield and 88.9% purity after purification by distillation. Amide formation was then carried out using 7N NH3 in methanol at room temperature. After 16 hours, the reaction was complete, and the mixture was concentrated. Compound 19 was isolated in nearly quantitative yield and 85.3% purity by GC-MS.

[0241] The reduction of compound 2 to compound 20 proved difficult. Initially, the reduction was tested with LiAlH (4.5 equiv.) in tetrahydrofuran at room temperature, but incomplete consumption of the starting material was observed. Raising the temperature to reflux resulted in complete consumption of the starting material. Further reduction of the amide to the amine was attempted, but the tert-butyl ester was unaffected. Increasing the amount of LiAlH (10 equiv.) did not resolve the problem. [ka]

[0242] Transesterification was then tested using 0.5 N HCl (10 equiv.) in methanol at room temperature for 16 h, yielding a mixture of starting material 19 and the methyl ester 21. The reaction was repeated with 2 N HCl (10 equiv.) in methanol, and after stirring at room temperature for 2 days, only the methyl ester 21 was isolated in quantitative yield. Reduction of 21 with LiAlH4 (>7 equiv.) in tetrahydrofuran at reflux or 2-methyltetrahydrofuran at room temperature did not result in the de-formation of 20. This was confirmed when the Boc protection failed and no reaction occurred. Reduction was then tested using borane-tetrahydrofuran (9.21 equiv.) at reflux, which showed complete consumption of the starting material and no product formation. Borane dimethyl sulfide complex (10 equiv.) was also used. [ka]

[0243] Meanwhile, other routes were explored to afford amine 20a. Phthalimide synthesis of the iodo starting material was successfully carried out using potassium phthalimide (1.5 equiv.) in DMF at 50 °C for 8 h, and compound 22 was isolated in quantitative yield. Deprotection with hydrazine hydrate in ethanol at reflux was complete after 16 h. After purification by column chromatography, amine 20a was isolated as a mixture in 91% yield. It was assumed that the amine was not stable and needed to be protected. [ka]

[0244] With access to a significant amount of the protected alcohol, attempts were made to convert the material to the azide. The protected alcohol was reacted with EtN (1.8 equiv.) and mesyl chloride (1.3 equiv.) in dichloromethane to give its corresponding mesylate. Subsequent reaction with sodium azide (5 equiv.) afforded azide 23 in 50% yield. Staudinger reduction with PPh in EtO and water at room temperature was unsuccessful, showing no conversion. While Staudinger reduction was unable to reduce the amine, Pd / C with H2 afforded complete and relatively clean conversion to amine 20a.

[0245] ((8R,9S,13S,14S,17S)-3-benzyloxy-17-hydroxyestra-1,3,5(10)-triene (3)

[0246] A mixture of estradiol (2,300 g, 1.1 mol), benzyl bromide (200 mL, 1.68 mol), and potassium carbonate (304 g, 2.2 mol) in acetone (2 L) and methanol (0.5 L) was heated under reflux for approximately 18 hours. After cooling at room temperature, the reaction mixture was filtered and concentrated in vacuo. The concentrate was dissolved in hot toluene and concentrated under reduced pressure. The crude material (508 g) was used directly in the next reaction.

[0247] (8R,9S,13S,14S,17S)-17-Allyloxy-3-benzyloxyestra-1,3,5(10)-triene (4).

[0248] Sodium hydride (110 g, 60% dispersion in mineral oil, 2.7 mol) was added portionwise to a solution of crude alcohol 3 (508 g, approximately 1.1 mol) in anhydrous tetrahydrofuran (4 L). After approximately 30 min, allyl bromide (240 mL, 2.7 mol) and tetrabutylammonium iodide (40 g, 108 mmol) were added, and the resulting mixture was heated at reflux for approximately 18 h. The reaction mixture was allowed to cool to room temperature, carefully quenched with water (1 L), and the mixture was partially concentrated. The mixture was dissolved in ethyl acetate (1.5 L) and washed with water (3 × 500 mL). The organic phase was washed with brine, dried over sodium sulfate, and concentrated to give crude compound 4 (550 g, 1.36 mol) in sufficient purity for the next step.

[0249] (8R,9S,13S,14S,17S)-3-benzyloxy-17-(3-hydroxypropoxy)estra-1,3,5(10)-triene (5).

[0250] 9-Borabicyclo[3.3.1]nonane (800 mL, 0.5 M solution in tetrahydrofuran, stabilized, 400 mmol) was added dropwise to a solution of crude alkene 4 (101.2 g, 251 mmol) in tetrahydrofuran (1 L) at 0 °C. Upon completion of the addition, the mixture was stirred at room temperature overnight. The solution was cooled to 0 °C, and 30% aqueous NaOH (150 mL, 1.3 mol) and 35% aqueous NaOH (120 mL, 1.3 mol) were added dropwise simultaneously. The resulting heterogeneous mixture was stirred vigorously at room temperature for approximately 1 h. The reaction mixture was then partitioned between ethyl acetate (2 L) and brine (500 mL). The organic phase was washed with an additional 500 mL of brine, dried over sodium sulfate, and concentrated in vacuo. This procedure was repeated in the same manner, and both portions were combined.

[0251] Further purification of the concentrate by flash chromatography (silica gel, gradient 25% to 35% ethyl acetate in heptane) afforded alcohol 5 (130 g, 310 mmol) as a white solid in 61% yield (3 steps).

[0252] (8R,9S,13S,14S,17S)-3-benzyloxy-17-[3-(perfluoro-tert-butyloxy)propoxy]estra-1,3,5(10)-triene (6).

[0253] Under a nitrogen atmosphere, diisopropyl azodicarboxylate (80 mL, 407 mmol) was added dropwise to a stirred mixture of alcohol 5 (130 g, 301 mmol), triphenylphosphine (162 g, 618 mmol), perfluoro-tert-butanol (70 mL, 497 mmol), and dry tetrahydrofuran (2). The mixture was stirred at room temperature for approximately 18 hours. The reaction mixture was partially concentrated, and heptane (1 L) was added. After complete removal of the tetrahydrofuran, precipitation began. The solid was removed using filtration, and the filtrate was concentrated. Acetonitrile (1.5 L) was added, and the mixture was stirred for 30 minutes while precipitation began. The solid was collected by filtration and dried in vacuo. Compound 6 (160 g, 251 mmol) was isolated as a white solid in 81% yield.

[0254] (8R,9S,13S,14S,17S)-3-Hydroxy-17-[3-(perfluoro-tert-butyloxy)propoxy]estra-1,3,5(10)-triene (phenol 1). Note: MIJ252385-2

[0255] A Parr vessel was charged with benzyl ether 6 (160 g, 251 mmol) in ethyl acetate (1 L) with 10% palladium on carbon (4 g). The mixture was stirred at room temperature under hydrogen pressure (5 bar). 1 The reaction mixture was monitored by H NMR. After approximately 72 h, the reaction mixture was filtered through a pad of Celite (flushed with ethyl acetate) and recharged with fresh 10% palladium on carbon (4 g) under a hydrogen atmosphere (5 bar). After approximately 16 h, the reaction mixture was filtered through a pad of Celite (flushed with ethyl acetate) and concentrated to give phenol 1 (125 g, 228 mmol) as an off-white solid in 91% yield.

[0256] Ethyl 4-(4-(3-hydroxypropyl)piperazin-1-yl)butanoate (7):

[0257] Ethyl 4-bromobutyrate (11.4 g, 8.34 mL, 58.2 mmol) and 3-(1-piperazinyl)-1-propanol (8.40 g, 58.2 mmol) in acetonitrile (10 mL) were stirred at room temperature for 16 hours. Potassium carbonate (8.05 g, 58.2 mmol) was added, stirred for 1 hour, added diethyl ether (200 mL), filtered through a glass filter, and concentrated. A clear oil was isolated and used as is.

[0258] Ethyl 4-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)butanoate (9)

[0259] To a solution of (13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-ol (8.64 g, 15.8 mmol), ethyl 4-(4-(3-hydroxypropyl)piperazin-1-yl)butanoate (5.7 g, 22 mmol), and triphenylphosphine (5.8 g, 22 mmol) in tetrahydrofuran (150 mL) was added DIAD (4.3 mL, 22 mmol). The mixture was stirred at room temperature for 16 hours and then concentrated. The mixture was dissolved in diethyl ether (200 mL) and treated with ethereal 2 M HCl (12 mL), resulting in a large amount of precipitate. The mixture was stirred for an additional 30 minutes and then filtered. The solid was washed with ethyl acetate. Further purification using flash (60% ethyl acetate in heptane to 60% ethyl acetate + 1% EtN to 100% ethyl acetate + 1% EtN) gave compound 9 (7.9 g, 10 mmol) as a clear oil in 64% yield.

[0260] 4-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)butanoic acid (12)

[0261] To a solution of ester 9 (6.93 g, 8.79 mmol) in tetrahydrofuran (40 mL) was added sodium hydroxide (0.44 g, 11.0 mmol) and water (40 mL). Stirring was continued for 18 h. The apparently oily mixture became a clear solution. The mixture was carefully concentrated in a 1 L flask (a lot of foaming occurred due to its soapy nature). Compound 12 (6.47 g, 8.5 mmol) was obtained as a solid and used directly in the next step.

[0262] 3-(3-(2,2-dimethyl-1,3-dioxan-5-yl)propoxy)-N-(3-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propyl)propenamide.

[0263] To a solution of compound 12 (3.06 g, 3.91 mmol), 2-(3-(2,2-dimethyl-1,3-dioxan-5-yl)propoxy)ethan-1-amine (1.19 g, 5.47 mmol), and triethylamine hydrochloride (538 mg, 3.91 mmol) in DMF (40 mL) was added DIPEA (2.1 mL, 11.7 mmol) and EDCI (900 mg, 4.69 mmol). The mixture was stirred at room temperature for 72 h. TLC and MS confirmed complete coupling. Ethyl acetate (50 mL) was added to the mixture, and the mixture was washed with saturated aqueous potassium carbonate. Heptane (40 mL) was then added, washed with water, and the mixture was concentrated. Further purification using flash chromatography (2% to 10% methanol (7 M NH) in dichloromethane) afforded compound 13 (1.7 g, 1.8 mmol) as a viscous oil.

[0264] N-(3-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propyl)-3-((5-hydroxy-4-(hydroxymethyl)pentyl)oxy)propanamide hydrochloride (14)

[0265] To a solution of compound 13 (1.7 g, 1 equivalent, 1.8 mmol) in dichloromethane (2 ml) and methanol (75 ml) was added 37% HCl (0.5 ml). Stirring was continued for 3 hours (a large amount of white precipitate formed). The mixture was concentrated and titrated with ethyl acetate. The white solid HCl salt 14 (1.7 g, 1.8 mmol) was used as is.

[0266] N-(2-((5-(bis(4-methoxyphenyl)(phenyl)methoxy)-4-(hydroxymethyl)pentyl)oxy)ethyl)-4-(4-(3-(((8R,9S,13S,14S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)butanamide (15)

[0267] Compound 14 (841 mg, 914 μmol) was dissolved in dichloromethane (100 mL) under a nitrogen atmosphere. Triethylamine (185 mg, 255 μL, 1.83 mmol) and 1-[chloro-(4-methoxyphenyl)-phenyl-methyl]-4-methoxy-benzene (294 mg, 868 μmol) were added and stirred at room temperature for 16 h. When TLC indicated nearly complete conversion, an additional amount of 1-[chloro-(4-methoxyphenyl)-phenyl-methyl]-4-methoxy-benzene (31.0 mg, 91.4 μmol) was added. Stirring was continued for 1 h, and then the mixture was washed with saturated aqueous sodium bicarbonate, dried over sodium sulfate, and concentrated. Further purification was carried out using flash chromatography (a gradient of 5% to 7% methanol (containing 7 M NH3) in dichloromethane) to give compound 15 (880 mg, 0.72 mmol) as a clear oil.

[0268] 2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-5-(2-(4-(4-(3-(((8R,9S,13S,14S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)butanamido)ethoxy)pentyl(2-cyanoethyl)diisopropylphosphoramidite (Apo-Si-K-1007)

[0269] To a solution of compound 15 (880 mg, 720 μmol) in dichloromethane (50 ml) and diisopropylammonium tetrazolide (194 mg, 1.13 mmol) at 0° C. was added 3-((bis(diisopropylamino)phosphaneyl)oxy)propanenitrile (620 mg, 2.06 mmol). The mixture was stirred at room temperature for 4 hours and then concentrated. Further purification using flash chromatography (gradient 100% ethyl acetate to 20% acetone in ethyl acetate (total + 1% EtN) gave Apo-Si-K-1007 (470 mg, 0.33 mmol) as a clear oil in 44% yield.

[0270] 5-(3-(2-Azidoethoxy)propyl)-2,2-dimethyl-1,3-dioxane (23). To a solution of 2-(3-(2,2-dimethyl-1,3-dioxan-5-yl)propoxy)ethan-1-ol (7.0 g, 32 mmol), dichloromethane (70 mL), and triethylamine (8.0 mL, 58 mmol) was added. The solution was cooled to 0 °C. Mesyl chloride (3.2 mL, 42 mmol) was added dropwise via an addition funnel, maintaining the temperature below 1 °C. The mixture was stirred at room temperature for 30 minutes, then quenched with saturated aqueous sodium bicarbonate, further diluted with dichloromethane, and the organic layer was collected. The organic layer was dried over sodium sulfate and concentrated.

[0271] The material was dissolved in acetone (700 mL), sodium azide (10 g, 160 mmol) and TBAI (200 mg) were added, and the material was heated to reflux. After 16 hours, the mixture was cooled to room temperature, filtered, and concentrated. The yellowish oil was purified using flash chromatography (30% to 60% ethyl acetate in heptane) to give compound 23 (3.0 g, 10 mmol).

[0272] 5-(3-(2-aminoethoxy)propyl)-2,2-dimethyl-1,3-dioxane Name (20a): To a solution of azide 23 (4 g, 0.02 mol) in tetrahydrofuran (50 mL) and ethanol (20 mL) was added palladium on carbon (250 mg, 2.35 mmol). Vacuum was applied and the atmosphere was purged with hydrogen (3 times). Stirred under hydrogen atmosphere at room temperature for 16 h. Filtered through a short path of Celite and concentrated. The crude material was found to be suitable for the next reaction.

[0273] The synthesis of key intermediate 7 is shown in the following scheme. Protection of estrone with a propyl acetal (i.e., compound 3) allows for selective ring-opening as a means to obtain the C3-ether. Typically, this ring-opening was achieved using 4 equivalents of AlCl3 and 1.2 equivalents of LiAlH4 at reflux for several hours, but this harsh reaction did not tolerate other functional groups. Recently, a milder method was developed using TMSOTF and BH3.DMS at -78 °C, but this did not tolerate the free phenol. Typically, the benzyl protecting group on the phenol is suitable for all purposes, but its removal by hydrogenation is quite tedious. With the desired C3-chloride (i.e., compound 4) in place, applying the ring-opening procedure afforded complete and relatively clean conversion to compound 5.

[0274] Synthesis of Apo-Si-K-1000

[0275] The synthesis of Apo-Si-K-1000 is shown in the following scheme: [ka] [ka]

[0276] Synthesis of Apo-Si-K-1013 Perfluorination-driven coupling using Mitsunobu conditions gave compound 6. For workup, dissolving all material in heptane allowed precipitation of most of the triphenyl phosphooxide, and further purification using filtration over silica essentially gave excellent purity, as all by-products and Mitsunobu reagent adhered to the silica. [ka]

[0277] Alkylation of piperazine to the chloride appears to be facile and selective. If an aqueous workup is used, excess piperazine is washed away. Further functionalization to provide compound 8 can be achieved by treating compound 7 with one equivalent of bromide. [ka]

[0278] Deprotection of Boc-protected amines is always difficult in the presence of bases such as piperazine. The piperazine is initially protonated, causing the material to precipitate, preventing acidic deprotection. However, the use of 4 M HCl in dioxane can render the material sufficiently soluble to allow complete deprotection. Subsequent peptide coupling with either PyBOP or DCC / DMAP allows for the attachment of the acid. However, purification appears to be cumbersome at this stage, likely due to the basic drive of the piperazine and the formed amide. Treatment with TBAF and phosphimidate attachment were the final steps to obtain Apo-Si-K-1013.

[0279] For the final coupling, we had to abandon our initial protocol (TFA, NMM) because we hypothesized that the basic piperazine prevented successful removal of TFA, making it difficult to obtain the final compound as a salt. However, removing TFA from the mixture failed to result in any conversion, and seemingly the phosphorimide reagent requires acid activation for successful coupling. Successful coupling was achieved using diisopropylamine-tetrazole as the base and a Lewis acid, but the Lewis acid was weak enough to be removed using further purification.

[0280] (8R,9S,13S,14S)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxan]-3-ol (3). Note: RVE21010102-01 To a suspension of (8R,9S,13S,14S)-3-hydroxy-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydro-17H-cyclopenta[a]phenanthren-17-one (250 g, 1.00 equiv., 924 mmol) in toluene (1.5 L) was added triethyl orthoformate (205 g, 231 mL, 1.5 equiv., 1.38 mol), propane-1,3-diol (105 g, 100 mL, 1.5 equiv., 1.38 mol), and pTsOH (1.75 g, 0.01 equiv., 9.24 mmol). The suspension was mechanically stirred. No exotherm was observed during the addition of the chemicals together. The mixture was warmed to 60°C (internal) and stirred for 2 hours. The mixture became a pale yellow solution. The reaction was stirred at 60°C (internal) overnight. Propane-1,3-diol (35.18 g, 33.41 mL, 0.5 equiv, 462.3 mmol) and triethyl orthoformate (68.5 g, 76.9 mL, 0.5 equiv, 462 mmol) were added at 60°C, and the reaction was stirred for 3 hours. The reaction was cooled to 40°C, and then triethylamine (4.67 g, 6.44 mL, 0.05 equiv, 46.2 mmol) and water (599 g, 599 mL, 36 equiv, 33.2 mol) were added, and the mixture was stirred for 10 minutes. The phases were separated, and the organic layer was concentrated to approximately 1 L and allowed to stand for 16 hours. A solid precipitated and the mixture was mechanically stirred for 4 hours, then filtered, washed with 300 mL of toluene and 200 mL of heptane, and sucked dry. The product was obtained as a white solid (235 g, 77.4%), which was crushed and analyzed by HNMR.

[0281] (13S)-3-(3-chloropropoxy)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxane] (4).

[0282] To a solution of (13S)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxan]-3-ol (34.50 g, 1 equiv., 105.0 mmol) in DMF (40 mL) was added cesium carbonate (51.34 g, 1.5 equiv., 157.6 mmol) and 1-bromo-3-chloropropane (33.07 g, 20.78 mL, 2 equiv., 210.1 mmol). Stirring was continued at room temperature for 16 h. The mixture was diluted with ethyl acetate (50 mL) and heptane (250 mL), washed with water (3 × 50 mL) and brine (50 mL), dried over sodium sulfate, and concentrated. The product was isolated as a clear oil in quantitative yield. The crude material was used directly in the next reaction.

[0283] 3-(((8R,9S,13S,14S,17S)-3-(3-chloropropoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-17-yl)oxy)propan-1-ol (5).

[0284] A 2 L reaction vessel was charged with a solution of crude (8R,9S,13S,14S)-3-(3-chloropropoxy)-13-methyl-6,7,8,9,11,12,13,14,15,16-decahydrospiro[cyclopenta[a]phenanthrene-17,2'-[1,3]dioxane] (104 mmol) in dichloromethane (anhydrous 1 L), and the solution was cooled to −78° C. (cooled with solid dry ice). Borane dimethyl sulfide complex (10.2 g, 12.8 mL, 1.3 equiv., 135 mmol) was added in one portion via syringe (dropwise until T reached −75° C., then returned to −78° C.). To the mixture was added trimethylsilyl trifluoromethanesulfonate (30.0 g, 24.4 mL, 1.3 equiv, 135 mmol) in a fast stream (approximately 1 min), and the reaction was stirred at -75 °C for 2 h. The reaction mixture as a solution was quenched by careful addition of brine (500 mL), and stirring was continued for 16 h. The layers were separated (clear). The organic layer was washed with water, brine, and concentrated. The product was isolated as a clear oil (42.2 g, 104 mmol).

[0285] (13S,17S)-3-(4-chlorobutoxy)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthrene (6)

[0286] 3-(((13S,17S)-3-(3-chloropropoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-17-yl)oxy)propan-1-ol (44 g, 1 equiv., 0.11 mol) was dissolved in THF (1 L) and cooled to 0 °C. To the solution was added triphenylphosphine (40 g, 1.4 equiv., 0.15 mol), 1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-ol (33 g, 20 mL, 1.3 equiv., 0.14 mol), and DIAD (27 g, 26 mL, 97% Wt, 1.2 equiv., 0.13 mol) was added dropwise. The reaction was stirred at room temperature for 1 h. The mixture was concentrated, treated with heptane (approximately 1 L), stirred for 16 hours, and allowed to settle. The solid was filtered off and washed with heptane. The organics were concentrated. Further purification using flash (5% EtOAc in heptane) afforded compound 6 (61.3 grams, 96 mmol) as a clear oil in 91% yield (3 steps).

[0287] 1-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazine (7)

[0288] A mixture of (13S,17S)-3-(3-chloropropoxy)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthrene (61.32 g, 1 equiv., 98.11 mmol), piperazinium dichloride (46.81 g, 3 equiv., 294.3 mmol), and potassium carbonate (47.46 g, 3.5 equiv., 343.4 mmol) in acetonitrile (1.5 L) was treated with 35% aqueous sodium hydroxide (34 g, 31 mL, 3 equiv., 294.3 mmol) and refluxed for 48 h. Intermediate analysis revealed partial conversion. Piperidine (8.4 g, 98 mmol) was added and heating continued for an additional 16 hours. The mixture was cooled to room temperature, filtered, and partially concentrated. Ethyl acetate (1 L) was added, and the mixture was washed with water (2 x 150 mL) and brine, dried over sodium sulfate, and concentrated. The crude material (68.0 grams) was isolated in quantitative yield and washed sufficiently for subsequent chemical reactions.

[0289] tert-Butyl (3-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propyl)carbamate (8).

[0290] A mixture of tert-butyl (3-bromopropyl)carbamate (1.2 g, 1.1 equivalents, 5.1 mmol), 1-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazine (3.1 g, 1 equivalent, 4.6 mmol) and potassium carbonate (1.3 g, 2 equivalents, 9.2 mmol) in acetonitrile (40 mL) was warmed to 60° C. for 16 hours. The mixture was concentrated and further purified using flash chromatography (gradient 50% to 80% EtOAc in heptane (+1% EtN)) to isolate compound 8 (3.2 g, 3.8 mmol) as an oil.

[0291] 3-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propan-1-amine (9)

[0292] A suspension of compound 9 (3.2 g, 1 equiv., 3.8 mmol) was treated with 4 M HCl in dioxane (50 mL), stirred for 3 h, and then concentrated to give the HCl salt in quantitative yield.

[0293] 9-((tert-butyldiphenylsilyl)oxy)-N-(3-(4-(3-(((13S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propyl)nonanamide (12)

[0294] To a suspension of compound 9 (3.2 g, 1 eq., 3.8 mmol) in dichloromethane (350 mL) was added DMAP (0.46 g, 1 eq., 3.8 mmol) and triethylamine (1.9 g, 2.7 mL, 5 eq., 19 mmol). After 5 min, a solution of 9-((tert-butyldiphenylsilyl)oxy)nonanoic acid (10, 1.9 g, 1.2 eq., 4.6 mmol) in dichloromethane (1 mL) and PyBOP was added. Stirring was continued for 5 h. The mixture was washed with 2 M NaOH (2 × 40 mL), then brine, dried over sodium sulfate, and concentrated. The crude material of compound 11 was used directly.

[0295] The material was dissolved in THF (50 ml), a 1 M solution of tetrabutylammonium fluoride in THF (5.7 mL, 1.5 equiv., 5.7 mmol) was added, and stirring was continued at room temperature for 16 h. The mixture was concentrated, dissolved in ethyl acetate (250 mL), and washed with water (3 × 50 mL), followed by brine. The organics were dried over sodium sulfate and concentrated. Purification using flash (gradient: 2% to 8% 7 M NH3 in MeOH in dichloromethane) gave compound 12 as an oil, still containing PyBOP residues. The material was dissolved in dichloromethane (50 mL), and 2 M HCl in diethyl ether (4 mL) was added and stirred for 30 min. The white solid was filtered and washed with dichloromethane and ethyl acetate. The white solid was collected and partitioned between ethyl acetate (150 ml) and 1 M aqueous sodium hydroxide solution. The organic layer was dried over sodium sulfate and concentrated. Compound 12 (1.38 grams, 1.6 mmol) was isolated as a viscous oil.

[0296] 2-cyanoethyl(9-((3-(4-(3-(((8R,9S,13S,14S,17S)-17-(3-((1,1,1,3,3,3-hexafluoro-2-(trifluoromethyl)propan-2-yl)oxy)propoxy)-13-methyl-7,8,9,11,12,13,14,15,16,17-decahydro-6H-cyclopenta[a]phenanthren-3-yl)oxy)propyl)piperazin-1-yl)propyl)amino)-9-oxononyl)diisopropylphosphoramidite (1):

[0297] To a solution of compound 12 (1.38 g, 1 equiv., 1.55 mmol) and diisopropylammonium tetrazolide (293 mg, 1.1 equiv., 1.71 mmol) in dichloromethane (50 mL) at 0 °C was added 3-((bis(diisopropylamino)phosphaneyl)oxy)propanenitrile (937 mg, 2 equiv., 3.11 mmol). The mixture was stirred at room temperature for 16 h and then concentrated. Further purification using flash chromatography (very gentle gradient of 30% to 60% acetone in heptane (total + 1% EtN)) afforded compound Apo-Si-K-1013 (830 mg, 0.76 mmol) and a less pure fraction (100 mg, 0.09 mmol) as a clear oil.

[0298] Oligoribonucleotide Synthesis Oligoribonucleotides were synthesized on the solid phase using the phosphoramidite technique on a Mermade 12 synthesizer (LGC Bioautomation) at a synthesis scale of approximately 2 × 55 μmol per sequence (two columns, 55 μmol). Synthesis was performed on solid supports made of controlled pore glass loaded with either N-benzoyldeoxycytidine (CPG, 679 Å, 84 μmol / g loading) or N-benzoyl-2'-O-methyl-adenosine (CPG, 497 Å, 85 μmol / g loading). Standard DNA and RNA phosphoramidites, as well as auxiliary reagents, were purchased from SAFC Proligo (Hamburg, Germany). Specifically, the following amidites were used: (5'-O-dimethoxytrityl-N6-(benzoyl)-2'-Ot-butyldimethylsilyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxytrityl-N4-(acetyl)-2'-Ot-butyldimethylsilyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5'-O-dimethoxytrityl-N2-(isobutyryl)-2'-Ot-butyldimethylsilyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxytrityl-2'-Ot-butyldimethylsilyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. -N,N-diisopropylamino)phosphoramidite, (5'-O-dimethoxytrityl-N6-(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxytrityl-N4-(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5'-O-dimethoxytrityl-N2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite.To introduce the 5'-monophosphate, we used Phosphat-On reagent available from ChemGenes (CLP-1544). The Apo-Si-K170A building block was dissolved in 70% anhydrous DCM in anhydrous acetonitrile (100 mM) containing molecular sieves (3 Å). All other building blocks were dissolved in anhydrous acetonitrile (100 mM) containing molecular sieves (3 Å), except for the 2'-O-methyl-uridine phosphoramidite, which was dissolved in 30% anhydrous DCM in anhydrous acetonitrile. Iodine (50 mM in pyridine:HO = 9:1) was used as the oxidizing reagent. 5-Ethylthiotetrazole (ETT, 500 mM in acetonitrile) was used as the activator solution. Unless otherwise noted, the coupling time was 5 min. Both the Apo-Si building block and the 5'-phosphate were incorporated into the sequence using double coupling steps with a coupling time of 11 min per coupling (total coupling time 22 min). The oxidant contact time for these two components was extended to 2.5 minutes, while the standard oxidant contact time was set at 1.5 minutes.

[0299] The sequence was synthesized without removing the final DMT group.

[0300] Cleavage and deprotection: After assembly of the oligoribonucleotide sequences, the cyanoethyl protecting groups were cleaved. The CPG from both columns for each sequence was combined and treated with NH3:EtOH = 3:1 (15 ml) at 45 °C for 18 hours. The resin was filtered off and washed with 20% ethanol (2 × 5 ml).

[0301] The TBDMS protecting group was subsequently removed at elevated temperature using triethylamine hydrogen fluoride complex. The deprotection reaction was quenched by the addition of HO. The crude mixture was then filtered (ZapCap Nylon 0.2 μm bottle-top filter) and the filter was thoroughly washed with HO. The crude mixture was adjusted to 100 mM triethylammonium acetate (TEAAc) and filled to 300 ml (X69346K2) and 400 ml (X69347K2).

[0302] purification: The crude oligomer was purified by RP HPLC using a 16 x 150 mm column (Dr. Maisch) packed with Source RPC resin (GE Healthcare) on an AKTA Pure instrument (GE Healthcare). Buffer A was 100 mM triethylammonium acetate (TEAAc, pH 7), and buffer B contained 95% acetonitrile in buffer A. A flow rate of 7.2 mL / min and a temperature of 60 °C were used. UV traces were recorded at 260 nm and 280 nm. A gradient of 20% B to 100% B was used within 48 column volumes. Appropriate fractions were pooled and precipitated in a freezer containing 3 M NaOAc, pH 5.2, and 85% ethanol. The pellet was isolated by centrifugation, redissolved in water (50 ml), treated with 10× PBS buffer pH 7.4 (3 ml), and desalted by size-exclusion HPLC on an Äkta Pure instrument using a 50 × 165 mm ECO column (YMC, Dinslaken, Germany) packed with Sephadex G25-Fine resin (GE Healthcare).

[0303] annealing: To generate the desired siRNA duplex, the two complementary strands were annealed by combining equimolar aqueous solutions of both strands. The mixture was placed in a 70°C water bath for 5 minutes and then cooled to ambient temperature within 2 hours. The required aliquots were lyophilized for 4 days and stored at -20°C.

[0304] Analysis method: The crude single strands were analyzed by analytical LC-MS on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system coupled with an LCQ Deca XP-plus Q-ESI-TOF mass spectrometer (Thermo Finnigan) with a 2.1 × 50 mm XBridge column (Waters).

[0305] Buffer A was 16.3 mM triethylamine in HO, 100 mM hexafluoroisopropanol (HFIP) in 1% MeOH, and buffer B contained 95% MeOH in buffer A. A flow rate of 250 μl mL / min and a temperature of 60 °C were used. UV traces were recorded at 260 nm and 280 nm. A gradient of 1 to 40% B within 0.5 min, followed by 40 to 100% B within 13 min, was used.

[0306] The final single strands were analyzed by analytical LC-MS with a 2.1 × 50 mm XBridge column (Waters) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system coupled to a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics).

[0307] Buffer A was 16.3 mM triethylamine in HO, 100 mM hexafluoroisopropanol (HFIP) in 1% MeOH, and buffer B contained 95% MeOH in buffer A. A flow rate of 250 μl mL / min and a temperature of 60 °C were used. UV traces were recorded at 260 nm and 280 nm. A gradient of 1 to 100% B within 31 min was used.

[0308] The final duplexes were analyzed by analytical LC-MS on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system coupled to a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics) with a 2.1 × 50 mm XBridge column (Waters).

[0309] Buffer A was 16.3 mM triethylamine in HO, 100 mM hexafluoroisopropanol (HFIP) in 1% MeOH, and buffer B contained 95% MeOH in buffer A. A flow rate of 250 μl mL / min and a temperature of 60 °C were used. UV traces were recorded at 260 nm and 280 nm. A gradient of 1 to 100% B within 31 min was used.

[0310] Prior to duplex analysis, disulfide bonds in both the duplex and each single-strand Apo-Si-K170A component were reduced in situ. To each analytical sample (50 μl of 50 μM in 100 mM TEAAc), 5 μl of a 100 mM solution of D,L-dithiothreitol (DTT) in 100 mM triethyl bicarbonate buffer (TEAB, pH 8.5) was added and allowed to stand at room temperature for at least 1 hour before analysis. [Example]

[0311] Cell-Free Silencing of EGFP Using Exemplary Conjugates of the Invention method dsiRNA Duplex: The siRNA Duplex was a Dicer substrate designed to silence the EGFP gene.

[0312] The nucleotide sequences of the Apo-Si-K-170-A, Apo-Si-K-170-B, Apo-Si-K-170-C, Apo-Si-K-941, Apo-Si-K-1000, Apo-Si-K-1007, Apo-Si-K-1013 and Apo-Si-K-1014 conjugates are as follows: Sense: 5'-phosphate (Apo-Si-K-170A)ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO: 1) Antisense: 5'-phosphate (Apo-Si-K-170A)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO: 2) Sense: 5'-phosphate (Apo-Si-K-170B)ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO: 1) Antisense: 5'-phosphate (Apo-Si-K-170B)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO: 2) Sense: 5'-phosphate(Apo-Si-K-170C)ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO: 1) Antisense: 5'-phosphate (Apo-Si-K-170C)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO: 2) Sense: 5'-phosphate (Apo-Si-K-941)ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO: 1) Antisense: 5'-phosphate (Apo-Si-K-941)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO: 2) Sense: 5'-phosphate (Apo-Si-K-1000)ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO: 1) Antisense: 5'-phosphate (Apo-Si-K-1000)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO: 2) Sense: 5'-phosphate(Apo-Si-K-1007)ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO: 1) Antisense: 5'-phosphate (Apo-Si-K-1007)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO: 2) Sense: 5'-(Apo-Si-K-1013)ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO: 1) Antisense: 5'-(Apo-Si-K-1013)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO: 2) Sense: 5'-(Apo-Si-K-1014)ACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO: 1) Antisense: 5'-(Apo-Si-K-1014)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO: 2)

[0313] Protein-free fraction by incubation with BSA To achieve systemic administration into the blood, it is beneficial for the drug to have both a fraction bound to serum / plasma proteins and a free fraction that freely migrates through the extracellular space into cells. To investigate this aspect for the Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C conjugates, gel electrophoresis was used: 20 pmoles of Apo-siRNA construct samples were diluted in Tris buffer, pH 7.4, and bovine serum albumin (BSA) was added to final concentrations of 2 mg / ml and 5 mg / ml. All samples were incubated overnight at 37°C. These samples were then loaded onto a 12% native polyacrylamide gel and migrated in an electric field at 5 V / cm (Bio-Rad Mini Protean) for 1 hour. Control samples included dsi-RNA construct samples diluted with water instead of BSA. A structurally similar Apo-Si conjugate, Apo-Si-S1, which binds with high affinity to BSA, was used as a positive control. The chemical structure of Apo-Si-S1 is shown below: [ka] where * represents the point of attachment to the oligonucleotide.

[0314] Results: Figure 1 shows the protein-free fraction upon incubation with BSA. In contrast to Apo-Si-S1, which interacted almost completely with BSA (>95% bound), substantial free fractions were observed for the tested conjugates, with Apo-Si-K-170-A showing a higher free fraction compared to Apo-Si-K-170-B and Apo-Si-K-170-C.

[0315] Furthermore, the present inventors have identified Apo-K-160-A, a close structural analogue of Apo-Si-K-170-A. [ka] was found to be inactive in the presence of serum (GFP inhibition in HeLa-GFP cells was not observed upon incubation with Apo-K-160-A even at a concentration of 600 nM in the presence of serum).

[0316] Therefore, the inventors concluded that the conjugates of the present invention have significantly lower binding affinity to serum proteins (e.g., BSA) compared to structurally similar analogs not according to the present invention.

[0317] Therefore, the conjugates of the present invention are predicted to have greater potency in vivo (compared to structurally similar conjugates) due to lower non-specific binding to serum proteins, especially when administered iv.

[0318] -Cleavage of the disulfide moiety of the Apo conjugate by incubation with glutathione (GSH) One of the salient features in the design of the Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C moieties was the incorporation of a disulfide bond, which is intended to undergo selective cleavage under reductive conditions prevailing in the cytoplasm, thus releasing the cargo gene drug to interact with the cytoplasmic gene silencing complexes Dicer and RISC. To demonstrate this feature, 20 pmoles of RNA sample was diluted with 30 mM Tris buffer, pH 7.4, supplemented with 5 mM glutathione (GSH, Sigma). All samples were incubated at 37°C for 4 hours. Control samples were diluted with water. The samples were then loaded onto a 12% native polyacrylamide gel and migrated in an electric field at 5 V / cm (Bio-Rad MiniProtean) for 1 hour.

[0319] Results: Figure 2 shows that incubation of the Apo-Si-K-170-A, Apo-Si-K-170-B and Apo-Si-K-170-C conjugates with glutathione (5 mM, 37°C for 4 hours) resulted in robust cleavage of the conjugates in the following order: Apo-Si-K-170-C>Apo-Si-K-170-A>Apo-Si-K-170-B>>Apo-Si-K-93-A.

[0320] Apo-Si-K-93-A (chemical structure shown below) is a structurally similar conjugate with a disulfide bond. Therefore, based on the results shown in Figure 2, the inventors concluded that the conjugates of the present invention are characterized by a superior ability to undergo cytoplasmic disulfide cleavage compared to structurally similar conjugates.

[0321] Apo-Si-K-93-A: [ka] where * is the point of attachment to the oligonucleotide, H or phosphate residue. [Example]

[0322] In vitro silencing of EGFP using exemplary conjugates of the invention cell culture In vitro studies: Hela-GFP and 3T3-GFP cell lines were obtained from Cell Biolabs. Cells were grown in Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% FBS (Gibco), 100 U / ml penicillin, 100 mg / ml streptomycin (Biological Industries, Israel), and 10 μg / ml blasticidin. Cells were maintained in a 37°C incubator containing 5% CO2 humidified air. One day before transfection, cells were plated (40,000 cells / well) on 24-well black glass-bottom plates. The next day, cells were exposed to Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C conjugated to EGFP-dsiRNA in the presence of complete medium containing 10% serum (see above). For serum-free transfection conditions, the medium was aspirated, cells were washed with Hank's Balanced Salt Solution (HBSS), and then the medium was replaced with serum-free Opti-MEM (Thermo Fisher Scientific) for 24 hours, followed by the addition of complete medium for an additional 48 hours of incubation. Downregulation of protein expression was measured 72 hours after transfection. For this purpose, the medium was aspirated and cells were washed with HBSS. EGFP fluorescence intensity was quantified using an Infinite M200-Pro Multimode Reader (Tecan) at an excitation wavelength of 488 nm and an emission wavelength of 535 nm. Untreated cells served as a control. Experiments were performed in triplicate; results are presented as the mean + SD.

[0323] Results: In the presence of complete medium (10%) serum in the Hela-GFP cell line, 600 nM of conjugates Apo-Si-K-170-A, Apo-Si-K-170-B, and Apo-Si-K-170-C reduced EGFP expression to 49.9%, 83.1%, and 70.8% of the control, respectively (see Figure 3A).

[0324] In serum-free conditions, robust EGFP knockdown was induced by the Apo-Si-K-170-A conjugate in a dose-dependent manner, with EGFP expression reduced to 57.1% and 30.0% of the control when cells were treated with 10 nM and 40 nM of the conjugate, respectively. The same trend could be observed for the Apo-Si-K-170-B and Apo-Si-K-170-C conjugates (see Figure 3B).

[0325] In 3T3-GFP cell lines under serum-free conditions, significant EGFP knockdown was induced by the Apo-Si-K-170-A conjugate in a dose-dependent manner, with EGFP expression reduced to 71.0% and 45.5% of the untreated control when cells were treated with 10 nM and 40 nM of the conjugate, respectively. The same trend could be observed for the Apo-Si-K-170-B and Apo-Si-K-170-C conjugates (see Figure 3C).

[0326] Conclusion: The Apo-Si-K-170-A conjugate has improved silencing ability than the Apo-Si-K-170-B and Apo-Si-K-170-C conjugates in the Hela-GFP cell line in the presence of serum.

[0327] Results: Robust EGFP knockdown was induced by the Apo-Si-K-941 conjugate in a dose-dependent manner in the 3T3-GFP cell line under serum-free conditions, with EGFP expression reduced to 53.87% and 23.99% of the untreated control when cells were treated with 40 nM and 150 nM of the conjugate, respectively. The same trend was observed for the Apo-Si-K-170A conjugate (see Figure 3D).

[0328] Conclusion: Apo-Si-K-170-A conjugate has enhanced silencing ability than Apo-Si-K-491 conjugate in 3T3-GFP cell line under serum-free conditions.

[0329] Furthermore, Apo-Si-K-1013-based conjugates showed robust downregulation of EGFP in vivo (data not shown). [Example]

[0330] In vivo CF efficacy Cystic fibrosis (CF) is a genetic disease that causes frequent lung infections (over 70,000 cases worldwide, 1,000 new cases each year), limiting the ability to breathe in and exhale mucus. Mutations in the CF Transmembrane Conductance Regulator (CFTR) gene cause the CFTR protein to malfunction, and ions cannot leave the cell due to a blocked channel. Chloride (Cl), which attracts water to the cell surface, is released from the CFTR protein, which then passes through the CFTR protein. - ), mucus in various organs becomes thick and sticky. Epithelial sodium channels (ENaC) transport Na + ENaC is a membrane-bound ion channel selectively permeable to CFTR. It is composed of three homologous subunits (a, b, and g) encoded by four genes: SCNN1A / B / G / D. In the absence of functional CFTR, the ENaC channel is upregulated, further reducing salt and water secretion by reabsorbing sodium ions. Thus, respiratory complications in CF are not simply caused by a lack of chloride secretion, but by increased sodium and water reabsorption; the aENaC subunit is required for full channel function, while the b and g subunits are regulators of ENaC activity, and residual ENaC activity can be measured in their absence. An exemplary inhaled conjugate of the present invention (K170A-ENaC conjugate) is designed to block sodium absorption, which can keep the airway surface hydrated, which may help reduce mucus viscosity and make it easier to keep the airways clear in CF patients. Furthermore, ENaC inhibition may act synergistically with CFTR modulators.

[0331] The sequence of the K170A-ENaC conjugate is as follows:

[0332] Sense: 5'-Phosphate-(Apo-Si-K170A)TGTGCAACCAGAACAAATCAGACTG-3' (SEQ ID NO: 3)

[0333] Antisense: 5'-Phosphate-(Apo-Si-K170A)CAGTCTGATTTGTTCTGGTTGCACAGT-3' (SEQ ID NO: 4).

[0334] CF efficacy evaluation in mouse models: The use of K170A-ENaC conjugates with Dicer substrate siRNA (K170A-ENaC conjugate, 400 nM) resulted in 63% knockdown (KD) of the SCN1A gene in adenocarcinoma human alveolar basal epithelial cells (A549) and HeLa-transfected cells (75%) after dexamethasone induction. Next, naive female ICR mice were treated IT with microspores containing 100-200 μg of the substance in 50 μL of 5% glucose on days 1, 2, and 5, with knockdown evaluation by real-time PCR analysis completed on day 7. Notably, only 50% KD of ENaC is required in CF patients. In vivo experiments demonstrate a high KD using the K170A-ENaC conjugate in a dose-dependent manner (100 μg - 46%, 150 μg - 58%, 200 μg - 76%), whereas 200 μg of siRNA alone or 200 μg of K170A-ENaC conjugate to the Dicer substrate siRNA-GFP as a control unrelated sequence results in only a 15% KD. These results demonstrate the high selectivity and potential of the K170A-ENaC conjugate as a treatment for CF. As seen in Figure 6, upon local delivery, there is no systemic exposure, as seen in the liver and kidneys for MNM-siRNA, and ENaC KD is specific to the target tissue. Once inside the cell, the reducing environment of the cytoplasm causes MNM detachment, trapping the siRNA intracellularly. While the MNM is metabolized and excreted, the RNA is trimmed by Dicer, and the single-stranded RNA strand enters the RNA-induced silencing complex (RISC) and leads to cleavage of the complementary mRNA. [Example]

[0335] In vivo HL efficacy Hearing loss (HL) is an underestimated condition that affects over 1.5 billion people worldwide. There are various types of HL, but the most common (90%) is sensorineural HL (SNHL). SNHL typically occurs after damage or dysfunction of hair cells in the inner ear; primary auditory neurons (synaptopathy) or their synapses with the vestibulocochlear nerve; or the stria vascularis, or central processing center of the brain. The cochlear distribution of the Cy3-labeled dsiRNA conjugate of the present invention was evaluated in comparison with naked Cy3-labeled dsiRNA after intracochlear (IC) delivery in guinea pigs (GP).

[0336] The in vivo study consisted of five groups of GPs: one sham group (no treatment), one group (one ear) treated with Cy3-naked dsiRNA by IC administration route, and two groups treated with Apo-Si-K170A Cy3-dsiRNA conjugate by IC administration route and sampled at different time points): Group 1: Sham group (n=3) - both ears were tested Group 2: Cy3-naked dsiRNA treatment group (IC route) - T +30時間 (14.4 μg / ear) (n=6) Group 3: Apo-Si-K170A Cy3-dsiRNA conjugate treatment group (IC route) - T +25時間 (14.4 μg / ear) (n=6) Group 4: Apo-Si-K170A Cy3-dsiRNA treatment (IC route) - T +30時間 (14.4 μg / ear) (n=6)

[0337] The sequence of the Apo-Si-K170A Cy3-dsiRNA conjugate is as follows:

[0338] Sense: 5'-phosphate(Apo-si-K170A)(Cy3)TTACCCTGAAGTTCATCTGCACCACCG-3' (SEQ ID NO: 5).

[0339] Antisense:

[0340] 5'-phosphate(Apo-si-K170A)CGGTGGTGCAGATGAACTTCAGGGTCA-3' (SEQ ID NO: 2).

[0341] dsiRNA was delivered by IC infusion for 24 hours using an Alzet osmotic pump connected to a catheter inserted at the base of the cochlea. +25時間 or T +30時間 The mice were sacrificed 1 or 6 hours after the end of the infusion (corresponding to 1 or 6 hours after 24-hour continuous infusion). The distribution of the Cy3-labeled MNM-dsiRNA conjugate was qualitatively assessed (presence or absence) in the cochlear tissue at two time points after the end of delivery (1 or 6 hours) using two different histological techniques: flat surface preparation and cochlear cross-sections. For flat surface preparations, the distribution of the Cy3-labeled MNM-dsiRNA conjugate and Cy3-naked dsiRNA was documented in hair cells, supporting cells, and auditory fibers for three sections along the cochlear septum (apex, middle, and base of the cochlea). For cochlear cross-sections, the distribution of the Cy3-labeled MNM-dsiRNA and Cy3-dsiRNA was documented in hair cells, supporting cells, auditory fibers, and spiral ganglion neurons for three sections of the cochlea (apex, middle, and base of the cochlea).

[0342] As can be seen in Figures 7A-C, enhanced Cy3 signals were observed in inner hair cells (IHCs), outer hair cells (OHCs), supporting cells (SCs), auditory nerve fibers (ANFs), and spiral ganglion cells (indicated by arrows) at the base, median, and apex of the cochlea in the Apo-Si-K170A dsiRNA conjugate-treated group (IC) T+30 hours (Group 4) compared with the naked dsiRNA-treated group (IC) T+30 hours (Group 2) as shown in Figures 7D-F. [Example]

[0343] CMT1A efficacy in vitro material and method In vitro studies were performed using 3T3-NIH cells in 6-well plates (200,000 cells / well, 2 ml wells). Test substances (Apo-Si-K1000-PMP22 or Apo-Si-K1000-nonspecific dsiRNA sequences) were diluted (10–400 nM) in OptiMEM medium from a 20 μM stock solution and incubated for 48 h at 37°C / 5% CO2 in a humidified incubator. For serum-free conditions, prior to transfection with Apo-Si-MNM constructs, the medium was removed, the cell monolayer was washed once with a large volume of HEPES-buffered saline, and replaced with OptiMEM.

[0344] The sequence of Apo-Si-K1000-PMP22 is as follows:

[0345] Sense: 5'-p(Apo-Si-K1000)GAAATGGTGCTATAGATTTACCATT-3 (SEQ ID NO: 6).

[0346] Antisense: 5'-p(Apo-Si-K1000)AATGGTAAATCTATAGCACCATTTCAC-3' (SEQ ID NO: 7).

[0347] Twenty-four hours after transfection, fresh complete DMEM medium (10% FBS) containing penicillin / streptomycin antibiotics was added. RNA was extracted using a Pure Conjugate RNA Extraction Mini Kit and dissolved in 1 ml of TRIzol reagent according to the manufacturer's protocol. The concentration was measured using a Nanodrop™ for cDNA preparation. RT-PCR was performed using the Fast SYBR Green Master Mix protocol with specific probes for the target gene and beta-actin as an endogenous control.

[0348] Similar assays were performed in HeLa cells (40,000 cells / well, 2 ml wells) with test substance concentrations ranging from 100 to 400 nM, and in S16-Schwann cells (350,000 cells / well, 2 ml wells) with test substance concentrations ranging from 50 to 200 nM.

[0349] Charcot-Marie-Tooth type 1A (CMT1A) disease is thought to be caused by a duplication of a region of chromosome 17 that encodes peripheral myelin protein 22 (PMP22 protein). PMP22 is an integral membrane protein, a hydrophobic glycoprotein, highly expressed primarily in Schwann cells. It is a major component of compact myelin in the peripheral nervous system, accounting for 2–5% of the total protein content. It has been reported to play an important role in maintaining cholesterol homeostasis in Schwann cells. Therefore, dsiRNA targeting the PMP22 gene delivered directly to the cytoplasm of Schwann cells using MNM could prove a breakthrough in efforts to develop a treatment for this disorder.

[0350] We developed a dsiRNA targeting PMP22 (MNM-PMP22) designed to be administered systemically or intrathecally.

[0351] Initial in vitro studies conducted by the present inventors revealed that Apo-Si-K1000-PMP22 was successful in silencing the expression of the PMP22 gene in 3T3-NIH cells in a concentration-dependent manner (see Figure 8A). The IC 50 The concentration of dsiRNA in the Apo-Si K1000-PMP22 dsiRNA conjugate was approximately 50 nM. Similar results were obtained in HeLa cells (see Figure 8B) and S16-Schwann cells (see Figure 8C). These studies further demonstrated that the Apo-Si K1000-PMP22 dsiRNA conjugate did not alter the expression of unrelated genes, demonstrating the specificity of this approach. Collectively, these results highlight the great potential of the Apo-Si dsiRNA delivery approach in the treatment of CMT1A. [Example]

[0352] In vivo antiviral activity RSV: Apo-Si-K170A-V20 in a RSV mouse infection model. Female BALB / c mice infected with RSV were treated with vehicle, a positive control compound (ribavirin, 50 mpk), or test article at the indicated regimens and doses. Lung tissue was harvested on day 5 to determine viral titers and assess efficacy of RSV inhibition.

[0353] The chemical structure of Apo-Si-K170A-V20 is as follows:

[0354] Sense: 5'-p(Apo-Si-K170A)GGCTCTTAGCAAAGTCAAGTTGAAT-3' (SEQ ID NO: 8)

[0355] Antisense: 5'-p(Apo-Si-K170A)ATTCAACTTGACTTTGCTAAGAGCCAT-3' (SEQ ID NO: 9)

[0356] The results of the experiment are summarized in Figure 9.

[0357] The positive control, ribavirin (50 mg / kg), significantly reduced lung virus titers by 0.869 Log (plaques / g lung tissue) compared to the vehicle group, which was within expectations and consistent with previous data. The test article, Apo-Si-K170A-V20, reduced lung virus titers by 0.563, 1.324, 1.966, and 1.549 Log when administered at 40, 80, and 120 μg / dose, respectively (as shown in Figure 9), suggesting optimal efficacy against RSV and a clear dose-response under the established conditions. In conclusion, Apo-Si-K170A is highly effective against RSV infection in a mouse model.

[0358] SARS-CoV-2: Two studies tested the efficacy of Apo-Si-MNM-dsiRNA (also used herein as "drug") administered by intranasal and intratracheal instillation against SARS-CoV-2 virus infection in African green monkeys (AGMs). In the first study, AGMs (n = 10) were divided into two groups: Apo-Si-MNM-dsiRNA (n = 5) versus vehicle control (n = 5). Mice were infected with SARS-associated CoV-2, Isolate USA-WA1 / 2020 (BEI Resources), by intranasal and intratracheal delivery of virus on day 0 (total load of 3 × 10e5). As a prophylactic treatment, the drug was administered in three consecutive doses daily on days -3, -2, and -1 pre-infection. The total drug dose was 10 mg; 2.5 mg was delivered to each nostril and 5 mg intratracheally. Animals were followed daily for clinical observations, body weight, and temperature.

[0359] The chemical structure of Apo-Si-MNMs-dsiRNA is as follows:

[0360] Sense: 5' p-(Apo-Si-K170A)CTAAAGGACCTCACGAATTTTGCTC 3' (SEQ ID NO: 10)

[0361] Antisense: 5' p-(Apo-si-K170A)GAGCAAAATTCGTGAGGTCCTTTAGTA 3' (SEQ ID NO: 11)

[0362] No clinical signs were observed during drug administration. No test article-related changes in body weight or temperature were observed. At scheduled necropsy on day 7, animals were significantly unremarkable for gross pathology. Terminal body weight-to-lung weight ratios were calculated and showed no differences between groups. Viral load was assessed by qRT-PCR.

[0363] The results of the experiment are summarized in Figures 10A-B.

[0364] As shown in Figure 10A, viral load in oropharyngeal tissue on day 2 was statistically significant (p=0.04) at approximately a 2-log reduction in viral load, reflecting 98% gene knockdown. In bronchoalveolar lavage (BALF), approximately a 1-log reduction in viral load was observed on day 2, reflecting 86% gene knockdown (Figure 10B).

[0365] The second efficacy evaluation of SARS-CoV-2 in AGMs involved therapeutic treatment and nebulization using an intranasal device. On day 0, animals were infected with SARS-associated CoV-2, Isolate USA-WA1 / 2020 (BEI Resources). Treatment groups received treatment on days 0, 1, 2, and 4. Animals were followed daily for clinical observations, weight, and temperature. As with the first AGM efficacy study, no clinical signs were observed. As shown in Figure 11A-C, qRT-PCR results demonstrated a roughly 2-log reduction in viral load in oropharyngeal tissue, a roughly 2-log reduction in BALF and nares, and a potent and sustained inhibitory effect on viral load, resulting in a roughly 3-log reduction in viral load.

[0366] Conclusion: Apo-Si-K170A is highly effective against SARS-CoV-2 infection in the AGM model. [Example]

[0367] Asthma assessment in mouse models The present inventors tested the in vivo efficacy of an exemplary conjugate of the present invention (Apo-Si-K170A-MNM) in a mouse OVA-induced asthma model. Asthma is a chronic airway inflammatory disease characterized by airway hyperresponsiveness (AHR), airway inflammation, and remodeling. OVA-induced allergic asthma is a classic model and is often used to establish the anti-asthmatic effect of test articles. The purpose of the experiments disclosed below was to evaluate the therapeutic efficacy of Apo-Si-K170A-MNM for targeting the STAT6 gene in a mouse OVA-induced asthma model.

[0368] Apo-Si-K170A STAT6 contains the following sequence:

[0369] Sense strand 5'-phosphate (Apo-si-K170A)AGATGCTTTCTGTTACAACATGGCC-3' (SEQ ID NO: 12); and

[0370] Antisense strand 5'-phosphate / (Apo-si-K170A)GGCCATGTTGTAACAGAAAGCTCTGA-3' (SEQ ID NO: 13)

[0371] Ova mouse model Female Balb / C mice were randomly divided into five groups based on body weight. Mice in the treatment group were intraperitoneally (IP) injected with 100 μL of OVA / alum solution (0.30 mg / mL) on days 0, 7, and 14, respectively. Sham groups were appropriately injected with 100 μL of 1× PBS. On days 27–29, mice were challenged with 1% OVA solution (treatment group) or PBS (sham control group) by nebulization and administered by DSI Buxco Mass for 30 minutes.

[0372] Mice were treated with 200 μg–250 μg of the Apo-Si-K170A STAT6 construct by intratracheal injection (IT) on days 26 and 27 (6 h before the first OVA challenge). Sham and vehicle control mice received 5% glucose.

[0373] On day 29, mice were euthanized by exsanguination under deep anesthesia (a single dose of Zoletil 50 (50 mg / kg, 10 ml / kg) and Xylazine (5 mg / kg, 2 ml / kg) via IP injection).

[0374] Cytokine evaluation in BALF On day 29, mice were euthanized, the trachea surgically exposed, and the right lung was lavaged three times with 0.5 mL of 1x PBS to collect bronchoalveolar lavage fluid (BALF). The collected BALF samples were centrifuged at 1500 rpm for 10 minutes at 4°C. The supernatant was stored at -80°C for subsequent cytokine testing.

[0375] The levels of cytokines IL-4 and IL-13 in BALF supernatants were tested by Quantikine ELISA Kit (R&D systems M4000B, M1300CB).

[0376] Total IgE assay in plasma Blood was collected (on day 29) into EDTA-K2 tubes and immediately centrifuged at 3000 g for 10 minutes at 4°C. Plasma was collected and flash-frozen in liquid nitrogen. Total IgE levels in plasma were quantitatively analyzed using an ELISA kit (Abcam GR3377142-1).

[0377] Surprisingly, the present inventors observed that exemplary conjugates of the present invention induced downregulation of Th2 cytokine markers (IL-4 and IL-13) in BALF of asthma mouse models. As shown in Figure 12A, treatment with Apo-Si-K170A STAT6 significantly reduced IL-4 levels, similar to sham treatment. As shown in Figure 12B, IL-13 levels were significantly increased in the vehicle group compared to the sham group (p<0.01) and decreased after treatment with Apo-Si-K170A STAT6 (mean ± SEM, N=1, n=6-12, **P<0.01, ***P<0.001 T-test).

[0378] To this end, the Apo-Si-K170A STAT6 construct inhibits IgE levels (see FIG. 13) and significantly inhibits Th2 cytokine marker production compared to control mice. [Example]

[0379] In vivo and in vitro experiments in idiopathic pulmonary fibrosis models The present inventors aimed to utilize the exemplary conjugate of the present invention (Apo-Si-Apo-Si-K-170A-SPARC) for the treatment of IPF and other obstructive pulmonary diseases (e.g., COPD). The present inventors proposed pulmonary administration of the conjugate to deliver it directly to the target site, thus preventing systemic exposure and potentially increasing drug efficacy.

[0380] Secreted Protein Acidic and Cysteine ​​Rich (SPARC) is a key mediator of cell-matrix interactions and has been shown to play a key role in tissue fibrosis due to its high expression levels in fibrotic diseases and stimulation of TGF-beta signaling. It is a secreted, acidic extracellular matrix glycoprotein that plays a key role in promoting collagen fibrillogenesis, which is deposited in the extracellular matrix and leads to fibrosis. In vitro and in vivo studies using siRNA-targeted knockdown of this gene have shown promising potential for its ability to not only prevent collagen accumulation by lung cells but also reduce chronic inflammation and fibrosis in a bleomycin (BLM)-induced IPF mouse model.

[0381] Apo-Si-K-170A-SPARC was designed to downregulate SPARC expression in the lung, thus resulting in a significant reduction in collagen fibril production and collagen accumulation in affected lungs. We hypothesize that Apo-Si-K-170A-SPARC may be effective in preventing the progression of alveolar wall thickening, as well as in inducing repair processes and clearance of fibrotic tissue.

[0382] Apo-Si-K-170A-SPARC consists of dsiRNA conjugated on each strand to a selected Apo-Si-K-170A MNM moiety at the 5' end, which upon annealing forms a duplex with the following general structure:

[0383] Sense strand (5'-phosphate / (Apo-Si-MNM-SPARC)CCACTTGAAACCTTCTACTAATCAA-3' (SEQ ID NO: 14)

[0384] Antisense strand (5'-phosphate / (Apo-Si-MNM-SPARC)TTGATTAGTAGAAGGTTTCAAGTGGCA-3' (SEQ ID NO: 15).

[0385] In vitro evaluation of various Apo-Si-K-170A constructs To select SPARC gene target sequences, several commercially available sequences were aligned (IDT trifecta product). The selected sequences were structurally modified and extended according to MA Behlke's publication and the IDT design manual to create 25 / 27 base pair long Dicer substrate small interfering RNA (dsiRNA) sequences and modifications (Scott D. Rose and Mark A. Behlke. Chapter 2 Synthetic Dicer-Substrate siRNAs as Triggers of RNA Interference; 2012). Unrelated negative control dsiRNA sequences were selected from the literature or from non-targeting related genes. Based on in vitro efficacy evaluation using the Lipofectamine RNAiMax delivery system in several cell lines, the dsiRNA sequence (Apo-Si-K-170A-SPARC) that showed the best in vitro performance was selected for further development (Figure 14). Additional sequences tested also demonstrated robust SPARC downregulation (not shown).

[0386] To evaluate the ability of the Apo-Si-MNM construct to downregulate the SPARC gene in cell lines, 3T3 / NIH cells were transfected with the Apo-Si-MNM construct. Two days after transfection, the inhibitory effect of Apo-Si-MNM was assessed by RNA extraction subjected to qPCR analysis. The lead candidate construct containing the most potent dsiRNA sequence (Apo-Si-K-170A-SPARC) demonstrated significant and specific downregulation of the SPARC gene in a dose-dependent manner (Figure 15). In contrast, the negative control sequence (Apo-Si-K170A conjugate targeting a control gene, designated K170A-Dyn1i2) had no effect on SPARC expression levels (Figure 15).

[0387] In vivo evaluation of Apo-Si-K-170A-SPARC To evaluate the in vivo efficacy of Apo-Si-K-170A-SPARC, we established a bleomycin-induced IPF model in C57BL mice. In this well-characterized model, bleomycin (BLM) is administered intranasally (40 μL / mouse, 0.6 UI / kg). BLM induces a strong inflammatory response in the lungs over a period of approximately 10 days, characterized by significant weight loss, elevated leukocyte counts in lung exudates, and elevated levels of inflammatory cytokines, particularly those associated with TGF-β signaling. Toward the end of this period, the fibrotic phase of the disease occurs. While weight often recovers, soluble collagen concentrations in lung exudates increase, and fibrotic tissue begins to form. Various inflammatory and collagenogenic genes are significantly upregulated in lung tissue mRNA.

[0388] To evaluate the therapeutic effect of Apo-Si-K-170A-SPARC on disease, we devised a treatment regimen beginning on day 4 after BLM administration. Apo-Si-K-170A-SPARC was administered by intratracheal (IT) injection, compared with a sham treatment with vehicle, which served as a control.

[0389] In these studies, Apo-Si-K-170A-SPARC was found to result in significant knockdown of SPARC mRNA expression in diseased mice, which was even lower than SPARC expression in naive mice, demonstrating the great potency of exemplary conjugates of the present invention. [Example]

[0390] In vitro experiments with influenza A virus models We aimed to estimate the inhibitory activity of an exemplary conjugate of the present invention (Apo-Si-K170A-InfA construct) targeting influenza A genes, PB1 and PB2, against influenza virus in vitro in an MDCK cell-based cytopathic effect (CPE) assay.

[0391] material and method:

[0392] Using bioinformatics tools, we generated 30 siRNA sequences (15 sequences per gene) for the influenza A PB1 and PB2 genes. The siRNAs were selected based on the gene sequences of the influenza A / California / 07 / 2009 (H1N1) and influenza A / Perth / 16 / 2009 (H3N2) virus strains. The inhibitory effects of each siRNA were evaluated in a series of assays using 3T3 / NIH cells transfected with plasmids for the expression of PB1 or PB2, respectively, for the evaluated siRNA and its source. The top sequences of each gene were also cross-tested with plasmids from other virus strains. Finally, the top sequences were modified according to Bhelke's method and conjugated to the Apo-Si-K170A molecular nanomotor to generate the four final Apo-Si-K170A-InfA constructs.

[0393] The Apo-Si-K170A-InfA construct contains:

[0394] 1. K170A-MF03-PB1 Sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0395] GATACTGAATCTTGGACAAAAGAAA-3' (SEQ ID NO: 16)

[0396] Antisense strand sequence: 5'-phosphate (Apo-Si-K170A)

[0397] TTTCTTTTGTCCAAGATTCAGTATCGA-3' (SEQ ID NO: 17)

[0398] 2. K170A-MF13-PB1 sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0399] TGAGAAAGATGATGACTAATTCACA-3' (SEQ ID NO: 18)

[0400] Antisense strand sequence: 5'-phosphate (Apo-Si-K170A)

[0401] TGTGAATTAGTCATCATCTTTCTCACA-3' (SEQ ID NO: 19)

[0402] 3. K170A-MF43-PB2 Sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0403] GCAATAGGGTTGAGGATTAGCTCAT-3' (SEQ ID NO: 20)

[0404] Antisense strand sequence: 5'-phosphate (Apo-Si-K170A)

[0405] ATGAGCTAATCCTCAACCCTATTGCTG-3' (SEQ ID NO: 21)

[0406] 4. K170A-MF45-PB2 Sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0407] GGATGATGGCAATGAGATACCCAAT-3' (SEQ ID NO: 22)

[0408] Antisense strand sequence: 5'-phosphate (Apo-Si-K170A)

[0409] ATTGGGTATCTCATTGCCATCATCCAC-3' (SEQ ID NO: 23)

[0410] Further Apo-Si-K170A-InfA constructs with early signs of biological activity.

[0411] 5. K170A-MF44-PB2 Sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0412] GGAACAAGCCGTAGACATATGCAAG-3' (SEQ ID NO: 24)

[0413] Antisense strand sequence: 5'-phosphate (Apo-Si-K170A)

[0414] CTTGCATATGTCTACGGCTTGTTCCTC-3' (SEQ ID NO: 25)

[0415] 6. K170A-MF33-PB2 Sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0416] GCAGAAGAGTAGACATAAACCCTGG-3' (SEQ ID NO: 26) Antisense strand sequence 5'-phosphate (Apo-Si-K170A)

[0417] CCAGGGTTTATGTCTACTCTTCTGCGT-3' (SEQ ID NO: 27)

[0418] 7. K170A-MF31-PB2 Sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0419] CACAAGAAGATTGCATGATAAAAGC-3' (SEQ ID NO: 28)

[0420] Antisense strand sequence: 5'-phosphate (Apo-Si-K170A)

[0421] GCTTTTATCATGCAATCTTCTTGTGAA-3' (SEQ ID NO: 29)

[0422] 8. K170A-MF01-PB1 Sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0423] GAATCAACAAGGAAGAAAATTGAGA-3' (SEQ ID NO: 30)

[0424] Antisense strand sequence: 5'-phosphate (Apo-Si-K170A)

[0425] TCTCAATTTTCTTCCTTGTTGATTCAT-3' (SEQ ID NO: 31)

[0426] K170A-MF02-PB1 Sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0427] GCATTGACCTGAAGTATTTCAATGA-3' (SEQ ID NO: 32)

[0428] Antisense strand sequence: 5'-phosphate (Apo-Si-K170A)

[0429] TCATTGRAAATACTTCAGGTCAATGCTT-3' (SEQ ID NO: 33)

[0430] 10. K170A-MF03-PB1 Sense strand sequence 5'-phosphate (Apo-Si-K170A)

[0431] GATACTGAATCTTGGACAAAAGAAA-3' (SEQ ID NO: 34)

[0432] Antisense strand sequence: 5'-phosphate (Apo-Si-K170A)

[0433] TTTCTTTTGTCCAAGATTCAGTATCGA-3' (SEQ ID NO: 35)

[0434] Virus and cell strains

[0435] In this assay, we used influenza A / California / 07 / 2009(H1N1)pdm09 (VR-1894) and A / California / 2 / 2014(H3N2)(VR-1938) strains infecting MDCK cells (CCL-34). All virus strains and cells were obtained from ATCC. The A / California / 2 / 2014(H3N2)(VR-1938) strain PB1 and PB2 genes were compared to those of influenza A / Perth / 16 / 2009(H3N2) to ensure there were no significant mismatches that could prevent siRNA compatibility with the strains.

[0436] Assay solution OptiPRO serum-free medium supplemented with 2 mM L-glutamine, 1% non-essential amino acids (all from Gibco) and 1% penicillin-streptomycin (HyClone) was used as the assay medium.

[0437] Constructs were obtained as lyophilized dry powders and resuspended in RNase- and DNase-free Molecular Water to a stock concentration of 0.3 mM prior to the start of the study. Dilutions of constructs into working solutions were performed in OptiPRO Assay Medium (described). Each test construct was assayed in triplicate at eight concentrations, two-fold serial dilutions, starting at 30 μM.

[0438] Antiviral assay MDCK cells were seeded into 96-well plates at a density of 15,000 cells / well (96-well plate) in 100 μL / well of assay medium and cultured at 37°C and 5% CO2 for 5 hours. Test articles prepared according to their respective serial dilutions were added to the cells in a final volume of 150 μL / well. The resulting cell cultures were further incubated for 24 hours.

[0439] After 24 hours, the supernatant was removed, and the cells were then infected with influenza at an MOI of 0.012 for the H1N1 strain and 0.005 for the H3N2 strain. Infection was carried out in assay medium containing trypsin. Assay medium was added to the test article test wells. The final volume of cell culture was 200 μl / well. The final concentration of trypsin was 2.5 μg / mL. The resulting cell cultures were incubated at 35°C and 5% CO2 for an additional 5 days until the virus infection in the virus control (cells infected with virus without compound treatment) showed significant CPE. Finally, on D7, CPE was measured by CCK8 (Life-iLab) according to the manufacturer's manual. The plates were read 2 and 3 hours after CCK8 treatment, respectively. The antiviral activity of the compounds was calculated based on the protection of virus-induced CPE at each concentration normalized by the virus control.

[0440] The results of this experiment (shown in Figure 16A-D) show that the Apo-Si-MNM-dsiRNA constructs inhibited the 50% effective concentrations (EC of 1.47 μM to 0.5 μM). 50 ) and showed a good dose response between concentrations of 0.3 and 1.6 μM.

[0441] Based on the results of Examples 10 and 7, it is predicted that the conjugates of the present invention can be implemented for the treatment of viral infections, such as respiratory viral infections.

[0442] While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will occur to those skilled in the art. It is therefore to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.

Claims

1. General formula (I): 【Chemistry 1】 and pharmaceutically acceptable salts, hydrates, solvates and metal chelates thereof, wherein D is a polynucleic acid; each of y, z, and w is an integer independently selected from 0, 1, 2, 3, or 4, and at least one of y, z, or w is different from 0; E, E', or E'' may be the same or different, and each independently represents a group represented by the general formula (II): Formula (II): 【Chemistry 2】 (In the formula, X is absent, or 【Transformation 3】 , a salt thereof, or both; each of a, b, c, d, e, f, and g is an integer independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; R represents one or more substituents, each independently selected from H, F, Cl, Br, and I, with the proviso that at least one of said one or more substituents is F; R5 is H or linear or branched C1-C5 alkyl; R6 is H, hydroxyalkyl, and —(CH 2 ) n R'; n is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and R' is selected from a bond, H, and phosphate; L1 is a linker selected from -NH-C(=O)-, -C(=O)NH-, -C(=O)-S, -S-S-, and -S-C(=O); L2 is —O—, —S—, —CH 2 - a linker selected from - or absent; * is the point of attachment to D) and pharmaceutically acceptable salts, hydrates, solvates, and metal chelates thereof; Alternatively, E, E', or E'' may be the same or different and each independently represent a group of general formula (III): Formula (III): 【Chemistry 4】 (In the formula, Each of h, i, j, and k is an integer independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; R7 is H, hydroxyalkyl, and —(CH 2 ) n R'; n is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and R' is selected from a bond, H, and phosphate; L3 is a linker selected from -NH-C(=O)-, -C(=O)NH-, -S-S-, and -NH-C(=O); L4 is —O—, —S—, —CH 2 - a linker selected from - or absent; * is the point of attachment to D) and pharmaceutically acceptable salts, hydrates, solvates and metal chelates thereof. Conjugates.

2. The conjugate of claim 1, wherein L1 is S--S and L2 is --O-- or --S--.

3. E, E', or E'' may be the same or different and each independently represent a group of the general formula (IIa): 【Transformation 5】 wherein each R1-R4 is independently selected from H, F, Cl, Br, and I, with the proviso that at least one of R1-R4 is F.

3. The conjugate of claim 1 or 2, having the structure:

4. The conjugate of claim 3, wherein R1, R2, and R4 are H and R3 is F.

5. The conjugate of claim 3 or 4, wherein R1, R3, R4 are H and R2 is F.

6. 6. The conjugate of claim 3, wherein R2, R3, R4 are H and R1 is F.

7. 7. The conjugate of claim 3, wherein R1 and R2 are H and R3 and R4 are F.

8. 8. The conjugate of claim 3, wherein R3 and R4 are H and R1 and R2 are F.

9. 9. The conjugate of claim 3, wherein R1, R2, R3 are F and R4 is H.

10. 10. The conjugate of claim 3, wherein R1, R2, R4 are F and R3 is H.

11. 11. The conjugate of claim 3, wherein R1, R3, R4 are F and R2 is H.

12. 12. The conjugate of claim 3, wherein R2, R3, R4 are F and R1 is H.

13. 13. The conjugate of any one of claims 1 to 12, wherein R5 is Me.

14. R6 is -CH 2 OH, or 【Transformation 6】 and any salts thereof, A conjugate according to any one of claims 1 to 13.

15. R6 is H or —CH 2 14. The conjugate of claim 1, wherein the hydroxyl group is OH.

16. 16. The conjugate of any one of claims 1 to 15, wherein L3 is -S-S- and L4 is -O-; or L3 is selected from -S-C(=O), -C(=O)S-, -NH-C(=O), and -C(=O)NH-, and L4 is absent.

17. 17. The conjugate of any one of claims 1 to 16, wherein L1 is selected from -S-C(=O), -C(=O)S-, -NH-C(=O), and -C(=O)NH-, and L2 is -O- or absent.

18. R7 is -CH 2 OH, or 【Transformation 7】 18. The conjugate of any one of claims 1 to 17, wherein:

19. 19. The conjugate of any one of claims 1 to 18, wherein R7 is H.

20. 20. The conjugate of any one of claims 1 to 19, wherein one of y, z and w is 0.

21. 20. The conjugate of any one of claims 1 to 19, wherein y and z are 0.

22. 22. The conjugate of any one of claims 1 to 21, wherein the sum of y, z, and w is 2; (i) each of E, E', or E'' is independently represented by Formula (II) or Formula (IIa), a is 3, and b is 1; or (ii) each of E, E', or E'' is independently represented by Formula (III), and h is 3.

23. 22. The conjugate of any one of claims 1 to 21, wherein the sum of y, z, and w is 3; (i) each of E, E', or E'' is independently represented by Formula (II) or Formula (IIa), a is 3, and b is 1; or (ii) each of E, E', or E'' is independently represented by Formula (III), and h is 3.

24. 24. The conjugate of any one of claims 1 to 23, wherein D is an oligonucleotide drug.

25. 25. The conjugate of any one of claims 1 to 24, wherein D is a viral vector or a bacterial vector.

26. E, E', or E'' is 【Transformation 8】 Apo-Si-K-1014, 【Chemistry 9】 Apo-Si-K-170-A, 【Chemistry 10】 Apo-Si-K-170-B, 【Chemistry 11】 Apo-Si-K-170-C, 【Chemistry 12】 Apo-Si-K-1000, 【Chemistry 13】 Apo-Si-K-1013, 【Chemistry 14】 Apo-Si-K-1014, and 【Chemistry 15】 Apo-Si-K-1007, wherein W is H or *; 26. A conjugate according to any one of claims 1 to 25.

27. A precursor to the conjugate of formula II according to any one of claims 1 to 26, Formula (IV): 【Chemistry 16】 is represented by wherein R″ is a phosphoramidite, and each of R6′ and R7′ is independently H, —OX′, or —(CH 2 ) n OX', n is an integer from 1 to 10, and X' is H or a hydroxy protecting group; Precursor.

28. 27. A precursor of the conjugate of formula III according to any one of claims 1 to 26, Formula (V): 【Chemistry 17】 is represented by wherein R″ is a phosphoramidite, and each of R6′ and R7′ is independently H, —OX′, or —(CH 2 ) n OX', n is an integer from 1 to 10, and X' is H or a hydroxy protecting group; Precursor.

29. 27. A pharmaceutical composition comprising one or more conjugates according to any one of claims 1 to 26 and a pharmaceutically acceptable carrier.

30. 30. The pharmaceutical composition of claim 29, comprising a therapeutically effective amount of the one or more conjugates.

31. 31. A pharmaceutical composition according to claim 29 or 30 for use in the treatment of a disease in a subject in need thereof.

32. 32. The pharmaceutical composition of claim 31, wherein the disease comprises a genetic disease, a viral disease, a cancer, a CNS disease, an inflammatory disease, a pulmonary disease, or any combination thereof.

33. 33. The pharmaceutical composition of claim 32, wherein the genetic disease comprises cystic fibrosis, hereditary hearing loss, IBD, and CMT1A.

34. 33. The pharmaceutical composition of claim 32, wherein the viral disease comprises a respiratory viral disease.

35. 35. The pharmaceutical composition of claim 34, wherein the respiratory viral disease is caused by an infection selected from a coronavirus infection, an RSV infection, an influenza infection, or any combination thereof.

36. 33. The pharmaceutical composition of claim 32, wherein the pulmonary disease comprises asthma and idiopathic pulmonary fibrosis (IPF).

37. 31. A method for delivering a polynucleic acid to cells of a subject, comprising administering to the subject a conjugate described in any one of claims 1 to 27 or a pharmaceutical composition described in claim 29 or 30.

38. 31. A method for treating or preventing a disease in a subject, comprising administering to the subject a therapeutically effective amount of a conjugate of any one of claims 1 to 26 or a pharmaceutical composition of claim 29 or 30, thereby treating or preventing the disease.

39. 39. The method of claim 38, wherein the administering comprises systemic administration, local administration, intravenous administration, topical administration, pulmonary administration, or any combination thereof.

40. 40. The method of claim 38 or 39, wherein the disease comprises a genetic disease, a viral disease, a cancer, a CNS disease, an inflammatory disease, a pulmonary disease, or any combination thereof.