Methods for RNA detection and molecular analysis in thick tissue sections
The method of tissue permeabilization, DNA degradation, and hydrogel formation in thick tissue sections addresses the limitations of 2D characterization, enhancing RNA detection efficiency and enabling 3D molecular profiling.
Patent Information
- Application Number
- JP2025526688
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-05-08
- Filing Date
- 2023-11-10
- Publication Date
- 2025-11-14
AI Technical Summary
In situ transcriptome techniques are limited to 2D characterization of tissues and lack depth for molecular profiling of thick tissue sections.
A method involving tissue permeabilization, DNA degradation, and introduction of primers or probes to detect RNA targets, along with hydrogel formation within the tissue sample, enabling 3D molecular profiling.
Enhances RNA detection efficiency in thick tissue sections by reducing genomic DNA interference and improving molecular diffusion, allowing for high-resolution 3D analysis.
Smart Images

Figure 2025537264000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application Nos. 63 / 424,214, filed November 10, 2022, and 63 / 500,803, filed May 8, 2023, the contents of which previously filed applications are incorporated herein by reference in their entirety.
[0002] Statement Regarding Federally Sponsored Research This invention was made with government support under Grant No. RO1HG012357 awarded by the National Institutes of Health. The government has certain rights in this invention.
[0003] Sequence Listing Reference This application contains a Sequence Listing filed concurrently with the filing of this application, filed on November 8, 2023, and containing the filename "36406_0031P1_SL.xml", which is 69,632 bytes in size and is incorporated herein by reference in its entirety. [Background technology]
[0004] In situ transcriptome techniques are limited to 2D characterization of tissues and have limited depth. Methods capable of molecular profiling deep tissue sections in 3D are needed. Summary of the Invention
[0005] Disclosed herein is a method for detecting a target of interest in a tissue sample, the method comprising: a) obtaining or having obtained a tissue sample, the tissue sample comprising DNA, non-RNA molecules, and RNA, wherein the RNA comprises the target of interest; b) permeabilizing the tissue sample; c) substantially degrading DNA in the tissue sample; d) introducing primers or probes specific for the target of interest to the tissue sample, wherein the primers or probes bind to the target of interest; and e) detecting the target of interest in the tissue sample by detecting the primers or probes bound to the target of interest.
[0006] Disclosed herein is a method for creating a hydrogel within a tissue sample, the method comprising: a) obtaining or having obtained a fixed tissue sample, the tissue sample comprising DNA, non-RNA molecules, and RNA, the RNA comprising a target of interest; b) permeabilizing the tissue sample; and c) substantially degrading the DNA within the tissue sample, whereby a hydrogel is formed within the tissue sample. [Brief explanation of the drawings]
[0007] [Figure 1] Schematic of tissue clearing method and subsequent amplification using padlock probes and rolling circle amplification of RNA targets present in tissue. [Figure 2]A: ACTB mRNA signal detection in a 400-micron-thick mouse liver sample. 400-micron-thick tissue slices from mouse liver were processed using the methods described herein. ACTB mRNA was targeted, and RCA amplicons were detected with a Cy5 dye-modified probe. The sample was measured using a spinning-desk confocal microscope. A 3D view (10x magnification) of a sample containing RCA amplicons from Actb mRNA is shown. The number of RCA amplicons was quantified using Fiji. B: ACTB mRNA signal detection in a 400-micron-thick mouse liver sample. 400-micron-thick tissue slices from mouse liver were processed using the methods described herein. ACTB mRNA was targeted, and RCA amplicons were detected with a Cy5 dye-modified probe. The sample was measured using a spinning-desk confocal microscope. A side view of Figure 2A is shown. The number of RCA amplicons was quantified using Fiji. C: ACTB mRNA signal detection in a 400-micron-thick mouse liver sample. Four hundred micrometer-thick tissue slices from mouse liver were processed using the method described herein. ACTB mRNA was targeted, and RCA amplicons were detected with a Cy5 dye-modified probe. Samples were analyzed using a spinning-desk confocal microscope. Figure 2A shows the number of RCA amplicons counted from the sample shown. The number of RCA amplicons was quantified using Fiji. [Figure 3]A: The method described herein demonstrates high RNA detection efficiency compared to other RNA detection methods for thick tissues. Fifty-micrometer-thick tissue slices from mouse liver were processed as described herein. Using the method described herein (Figure 3A) compared to the Melpha-X-based method (Figure 3C), ACTB mRNA was targeted, and RCA amplicons were detected with a Cy5 dye-modified probe. Samples were analyzed using a spinning-desk confocal microscope. In Figures 3C and 3D, the Melpha-X RNA detection method (MelphaX, Wang, Y. et al., 2021, Cell, in which hybridization chain reaction was used) was performed on thick slices for side-by-side comparison. The same padlock oligos and enzymes were used in Figures 3A and 3C for comparison. A 3D view (20x magnification) of a sample containing RCA amplicons from Actb mRNA amplified using the method described herein is shown. B: The method described herein demonstrates high RNA detection efficiency compared to other RNA detection methods for thick tissues. Fifty micrometer-thick tissue slices from mouse liver were processed as described herein. ACTB mRNA was targeted using the method described herein (Figure 3A) compared to a Melpha-X-based method (Figure 3C), and RCA amplicons were detected with a Cy5 dye-modified probe. The samples were analyzed using a spinning-desk confocal microscope. Figure 3A shows the counted RCA amplicons. Figure C shows that the method described herein has higher RNA detection efficiency compared to other RNA detection methods for thick tissues. Fifty micrometer-thick tissue slices from mouse liver were processed as described herein. ACTB mRNA was targeted using the method described herein (Figure 3A) compared to a Melpha-X-based method (Figure 3C), and RCA amplicons were detected with a Cy5 dye-modified probe. The samples were analyzed using a spinning-desk confocal microscope. In Figures 3C and 3D, the Melpha-X RNA detection method (MelphaX, Wang, Y. et al., 2021, Cell, in which hybridization chain reaction was used) was performed on thick slices for side-by-side comparison.The same padlock oligos and enzymes were used in Figures 3A and 3C for comparison. A 3D view (20x magnification) of a sample containing RCA amplicons from Actb mRNA detected by the MelphaX-based method is shown. Figure D demonstrates that the method described herein has high RNA detection efficiency compared to other RNA detection methods for thick tissues. Fifty-micrometer-thick tissue slices from mouse liver were processed as described herein. Using the method described herein (Figure 3A) compared to the Melpha-X-based method (Figure 3C), ACTB mRNA was targeted, and RCA amplicons were detected with a Cy5 dye-modified probe. The samples were analyzed with a spinning-desk confocal microscope. In Figures 3C and 3D, the Melpha-X RNA detection method (MelphaX, Wang, Y. et al., 2021, Cell, in which hybridization chain reaction was used) was performed on the thick slices for side-by-side comparison. The same padlock oligos and enzymes were used in Figures 3A and 3C for comparison. The number of RCA amplicons counted is shown in Figure 3C. [Figure 4]A: Genomic DNA suppresses in situ RNA detection in thick tissue slices. 400-micron tissue slices from mouse liver were processed without DNase I treatment. ACTB mRNA was targeted, and RCA amplicons were detected with a Cy5 dye-modified probe. The sample was analyzed using a spinning-desk confocal microscope. A 3D view (10x magnification) of a 400-micron sample stained with DAPI is shown. Distinct genomic DNA morphology was observed. B: Genomic DNA suppresses in situ RNA detection in thick tissue slices. 400-micron tissue slices from mouse liver were processed without DNase I treatment. ACTB mRNA was targeted, and RCA amplicons were detected with a Cy5 dye-modified probe. The sample was analyzed using a spinning-desk confocal microscope. A side view (10x magnification) of a 400-micron sample containing RCA amplicons is shown. Red: RCA amplicon; blue: DAPI. RCA amplicons are confined to the surface. C: Genomic DNA suppressed in situ RNA detection in thick tissue slices. 400-micron tissue slices from mouse liver were processed without DNase I treatment. ACTB mRNA was targeted, and RCA amplicons were detected with a Cy5 dye-modified probe. The samples were analyzed using a spinning-desk confocal microscope. A 3D view (10x magnification) of the 400-micron sample after DNase I treatment is shown. The shape of the genomic DNA was completely lost. After DNase I treatment, the uniformity of the reaction improved dramatically, as shown in Figure 2. [Figure 5] 1 shows an outline of the tissue clearing method and amplification of targets of interest with mutations present in RNA. [Figure 6]This demonstrates that the method disclosed herein selectively differentiated single nucleotide variations (SNVs) between C57BL / 6J and BALB / cJ. Three sets of two iLock padlock oligos, one for each gene, were added to 50-micron liver slices from C57BL / 6J and one for BALB / cJ. The liver slices were processed as described in Figure 5. RCA amplicons from iLock padlock oligos targeting C57BL / 6J SNVs were detected using a Cy5 probe (red). RCA amplicons from iLock padlock oligos targeting BALB / cJ SNVs were detected using a Cy3 probe (blue). Selectivity was assessed based on the ratio of the number of amplicons from C57BL / 6J and BALB / cJ padlock oligos. Samples were analyzed using a spinning-desk confocal microscope. [Figure 7] A: DNase I treatment improved detection efficiency in brain slices. The excitatory neuron marker Slc17a7 was detected using two iLock padlock oligos in 30-micron brain slices from C57BL / 6J mice. The RCA amplicon from the iLock padlock oligos was detected using a Cy5 probe (red). Genomic DNA was visualized with DAPI (blue). Samples were analyzed using a spinning desk confocal microscope. B: DNase I treatment improved detection efficiency in brain slices. The excitatory neuron marker Slc17a7 was detected using two iLock padlock oligos in 30-micron brain slices from C57BL / 6J mice. The RCA amplicon from the iLock padlock oligos was detected using a Cy5 probe (red). Genomic DNA was visualized with DAPI (blue). Samples were analyzed using a spinning desk confocal microscope. DETAILED DESCRIPTION OF THE INVENTION
[0008] The present disclosure may be understood more readily by reference to the detailed description, figures, and examples included below.
[0009] Before the present methods and compositions are disclosed and described, it is to be understood that they are not limited to particular synthetic methods, unless otherwise specified, and are not limited to particular reagents (which, of course, may vary), unless otherwise specified. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, exemplary methods and materials are now described.
[0010] Furthermore, unless expressly stated otherwise, it should be understood that in no way is it intended that any method set forth herein be construed as requiring that its steps be performed in a particular order. Thus, unless a method claim actually recites the order in which its steps are to be followed, or specifically states in the claim or description that the steps are to be limited to a particular order, no order is intended to be inferred in any respect. This holds for any possible implicit basis for interpretation, including the obvious meaning derived from the arrangement of steps or operational flow, grammatical construction or punctuation, and logical matters regarding the number or type of aspects described in the specification.
[0011] All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided herein may be different from the actual publication dates, which may be independently confirmed.
[0012] definition As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.
[0013] As used herein, the term "or" means any one member of a particular list and also includes any combination of members of that list.
[0014] Ranges may be expressed herein as from "about" or "approximately" one particular value and / or to "about" or "approximately" another particular value. When such a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about" or "approximately," it is understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are several values disclosed herein, and that each value is herein disclosed as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that each unit between two specified units is disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0015] As used herein, the term "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and the description is meant to include cases where the event or circumstance occurs and cases where it does not occur.
[0016] As used herein, the term "tissue sample" refers to a tissue or organ from a subject, or a solution containing one or more molecules derived from tissue material (e.g., nucleic acids), that is analyzed by the methods described herein. A tissue sample can be obtained through a biopsy, such as a needle biopsy or a surgical biopsy. In some embodiments, a "tissue sample" can include, for example, a specimen from diseased tissue (e.g., cancer, parts of cancer, and whole cancer masses, and / or tissue from a subject suspected of having a disease).
[0017] As used herein, the term "comprising" can include the aspects "consisting of" and "consisting essentially of." The term "comprising" can also mean "including but not limited to."
[0018] The phrase "at least" preceding a series of elements should be understood to refer to every element in the series, e.g., "at least one" includes 1, 2, 3, 4 or more.
[0019] As used herein, the term "target of interest" refers to a nucleic acid. A target of interest can be a nucleic acid molecule, such as a portion of a gene, a regulatory sequence, genomic DNA, cDNA, or RNA, including mRNA and rRNA. As described herein, a target of interest can be a target nucleic acid molecule from a tissue sample or a secondary target, such as the product of an amplification reaction. It can be of any length. In some embodiments, the target of interest can be RNA.
[0020] The term "nucleic acid" or "oligonucleotide" or grammatical equivalents herein refers to at least two nucleotides covalently linked. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acid. "Nucleic acid" generally contains phosphodiester bonds, but in some cases (e.g., in the construction of primers and probes, such as label probes) includes nucleic acid analogs that may have alternative backbones, such as phosphate amides (Beaucage et al., Tetrahedron 49(10):1925(1993) and references therein; Letsinger, J. Org. Chem. 35:3800(1970); Sprinzl et al., Eur. J. Biochem. 81:579(1977); Letsinger et al., Nucl. Acids Res. 14:3487(1986); Sawai et al., Chem. Lett. 805(1984), Letsinger et al., J. Am. Chem. Soc. 110:4470(1988); and Pauwels et al., Chemica Scripta 26:141 91986), phosphorothioates (Mag et al., Nucleic Acids Res. 19:1437 (1991); and U.S. Pat. No. 5,644,048), dithiophosphates (Briu et al., J. Am. Chem. Soc. 111:2321 (1989), O-methylphosphoramidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press), and linkages to the backbone of peptide nucleic acids (Egholm, J. Am. Chem. Soc. 114:1895 (1992); Meier et al., Chem. Int. Ed. Engl. 31:1008 (1992); Nielsen, Nature, 365:566 (1993); Carlsson et al., Nature 380:207 (1996), all of which are incorporated by reference).Other analog nucleic acids include those with bicyclic structures, including locked nucleic acids (Koshkin et al., J. Am. Chem. Soc. 120:13252 3(1998)), cationic backbones (Denpcy et al., Proc. Natl. Acad. Sci. USA 92:6097(1995)), and nonionic backbones (U.S. Patent Nos. 5,386,023, 5,637,684, 5,602,240, 5,216,141, and 4,469,863; Kiedrowshi et al., Angew. Chem. Int. Ed. English 30:423(1991); Letsinger et al., J. Am. Chem. Soc. 110:4470(1988); Letsinger et al., Nucleoside & Nucleotide 13:1597 (1994); Chapters 2 and 3, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research," Ed. Y. S. Sanghui and P. Dan Cook; Mesmaeker et al., Bioorganic & Medicinal Chem. Lett. 4:395 (1994); Jeffs et al., J. Biomolecular NMR 34:17 (1994); Tetrahedron Lett. 37:743 (1996)) and U.S. Patent Nos. 5,235,033 and 5,034,506, and ASC Symposium Series 580, Chapters 6 and 7, "Sugar Modifications in Antisense Research," Ed. Y. S. Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acid (Jenkins et al., J. Biomolecular NMR 34:17 (1994); Tetrahedron Lett. 37:743 (1996)) and U.S. Patent Nos. 5,235,033 and 5,034,506. (See, e.g., J. Am. Chem. Soc. Rev. (1995) pp. 169-176). Several nucleic acid analogs are described in Rawls, C&E News, June 2, 1997, p. 35. All of these references are expressly incorporated herein. These modifications of the ribose-phosphate backbone can be made to increase the stability and half-life of such molecules in physiological environments.For example, PNA:DNA hybrids exhibit high stability and therefore may be used in some embodiments.
[0021] Nucleic acids, as specified, can be either single-stranded or double-stranded, or contain portions of both double-stranded and single-stranded sequence. Nucleic acids can be DNA, both genomic and cDNA, RNA, or hybrids, where the nucleic acid can contain any combination of deoxyribonucleotides and ribonucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc.
[0022] As used herein, "concatamer" refers to a form of a target polynucleotide that includes multiple copies (e.g., monomers) of a target polynucleotide or fragments of a target nucleotide. In some embodiments, the concatemer contains a sequence of interest. The concatemer can be partially double-stranded. In some embodiments, multiple concatemers can serve as target nucleic acid molecules for sequencing. In some embodiments, the concatemer includes a single-stranded RNA portion and a double-stranded RNA portion.
[0023] Nucleotide bases are abbreviated as follows: adenine (A), cytosine (C), guanine (G), thymine (T), and uracil.
[0024] As used herein, "substantially degrades the DNA of a tissue sample" refers to the degradation of greater than 95%, 96%, 97%, 98%, or 99% of the DNA typically contained in a tissue sample.
[0025] As used herein, "substantially removing lipids from a tissue sample" refers to the removal of greater than 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the DNA typically found in a tissue sample.
[0026] All publications and patent applications mentioned in this specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0027] Although the foregoing disclosure has been set forth in some detail by way of illustration and example for purposes of clarity of understanding, certain changes and modifications may be practiced within the scope of the appended claims.
[0028] method Disclosed herein are methods for detecting a target of interest in a tissue sample. Also disclosed herein are methods for detecting RNA in a tissue sample. In some embodiments, the methods include obtaining or having previously obtained a tissue sample. In some embodiments, the methods can include permeabilizing the tissue sample. In some embodiments, the methods can include substantially degrading DNA in the tissue sample. In some embodiments, the methods can include introducing primers or probes specific for the target of interest to the tissue sample. In some embodiments, the primers or probes bind to the target of interest. In some embodiments, the methods can include detecting the target of interest in the tissue sample by detecting the primers or probes bound to the target of interest. In some embodiments, the target of interest can be RNA.
[0029] In some embodiments, these methods further include amplifying the probe bound to the target of interest using a polymerase. In such embodiments, DNA is degraded or removed from the tissue sample so that the tissue sample is originally free of DNA that could serve as a template for the polymerase. For example, methods are disclosed herein that involve hybridizing a padlock probe to a target of interest, circularizing the padlock probe, and then amplifying the circularized padlock probe with a DNA polymerase, such as phi29 polymerase, by degrading or removing DNA from the tissue sample before hybridizing the padlock probe to the target of interest so that the tissue sample is originally free of DNA that could serve as a template for the polymerase.
[0030] Also disclosed herein are methods for creating a hydrogel in a tissue sample. In some embodiments, the method can include obtaining or having previously obtained a fixed tissue sample, permeabilizing the tissue sample, and substantially degrading DNA in the tissue sample, thereby forming a hydrogel in the tissue sample. In some embodiments, the tissue sample can include DNA, non-RNA molecules, and RNA. In some embodiments, the RNA can include a target of interest. In some embodiments, the non-RNA molecule can be a protein. In some embodiments, the non-RNA molecule can be a lipid. In some embodiments, proteins present in the tissue sample can be crosslinked. In some embodiments, the tissue sample can be stored prior to the step of obtaining or having previously obtained the tissue sample. In some embodiments, the method can include storing the tissue sample using a chemical crosslinker.In some embodiments, the crosslinker is formaldehyde, glutaraldehyde, dimethylsuberimidate, SM(PEG)12 (PEGylated long-chain SMCC crosslinker), SM(PEG)6 (PEGylated long-chain SMCC crosslinker), SM(PEG)2 (PEGylated SMCC crosslinker), SIAB (succinimidyl (4-iodoacetyl) aminobenzoate), BMH (bismaleimidohexane), SBAP (succinimidyl 3-(bromoacetate)), (sulfosuccinimidyl)propionate), SMPT (4-succinimidyloxycarbonyl-α-methyl-α(2-pyridyldithio)toluene), DTSSP (3,3'-dithiobis(sulfosuccinimidyl propionate)), EMCH (N-ε-maleimidocaproic acid hydrazide), SM(PEG)24 (PEGylated long-chain SMCC crosslinker), BMPH (N-β-maleimidopropionic acid hydrazide), DTME (dithiobismaleimidoethane) ), BMOE (bismaleimidoethane), SMPB (succinimidyl 4-(p-maleimidophenyl)butyrate), EMCS (N-ε-maleimidocaproyl-oxysuccinimide ester), MBS (m-maleimidobenzoyl-N-hydroxysuccinimide ester), Sulfo-EMCS (N-ε-maleimidocaproyl-oxysulfosuccinimide ester), BS (PEG)9 (PEGylated bis(sulfosuccinimidyl)suberate), Sulfo-EGS (ethylene glycol bis(sulfosuccinimidyl succinate), LC-SPDP (succinimidyl 6-(3(2-pyridyldithio)propionamido)hexanoate), PEG12-SPDP (PEGylated long-chain SPDP crosslinker), or derivatives or combinations thereof. In some embodiments, the tissue sample can have a thickness of about 20 μm to 800 μm.
[0031] Tissue sample. As disclosed herein, the tissue sample can be any 3D cellular structure. In some embodiments, the tissue sample can comprise DNA, non-RNA molecules, and RNA. In some embodiments, the tissue can comprise lipids. In some embodiments, the non-RNA molecules can be lipids. In some embodiments, the non-RNA molecules can be proteins. In some embodiments, the RNA can comprise a target of interest. In some embodiments, the tissue sample can be from a mammal (e.g., a mammalian tissue sample). In some embodiments, the tissue sample can be from a eukaryotic organism. In some embodiments, the tissue sample can be a human tissue sample. In some embodiments, the tissue sample can be a liver tissue sample. In some embodiments, the tissue sample can be a brain tissue sample. In some embodiments, the tissue sample can be a skin sample. In some embodiments, the tissue sample can be an organoid. In some embodiments, the tissue sample can be fixed before or after the tissue sample permeabilization step. In some embodiments, the tissue sample can be fixed by contacting with a chemical crosslinker.In some embodiments, the chemical crosslinker is formaldehyde, glutaraldehyde, dimethylsuberimidate, SM(PEG)12 (a PEGylated long-chain SMCC crosslinker), SM(PEG)6 (a PEGylated long-chain SMCC crosslinker), SM(PEG)2 (a PEGylated SMCC crosslinker), SIAB (succinimidyl (4-iodoacetyl) aminobenzoate), BMH (bismaleimidohexane), SBAP (succinimidyl 3-(bromoacetamido) propionate), methyl ester), SMPT (4-succinimidyloxycarbonyl-α-methyl-α(2-pyridyldithio)toluene), DTSSP (3,3'-dithiobis(sulfosuccinimidyl propionate)), EMCH (N-ε-maleimidocaproic acid hydrazide), SM(PEG)24 (PEGylated long-chain SMCC crosslinker), BMPH (N-β-maleimidopropionic acid hydrazide), DTME (dithiobismaleimidoethane), BMOE (bismaleimidoethane), SMPB (succinimidyl 4-(p-maleimidophenyl)butyrate), EMCS (N-ε-maleimidocaproyl-oxysuccinimide ester), MBS (m-maleimidobenzoyl-N-hydroxysuccinimide ester), Sulfo-EMCS (N-ε-maleimidocaproyl-oxysulfosuccinimide ester), BS(PEG)9 (PEGylated bis(sulfosuccinimidyl)suberate), Sulfo-EGS (ethylene glycol bis(sulfosuccinimidyl succinate), LC-SPDP (succinimidyl 6-(3(2-pyridyldithio)propionamido)hexanoate), PEG12-SPDP (PEGylated long-chain SPDP crosslinker), or derivatives or combinations thereof. In some embodiments, crosslinking reagents containing reactive end groups that respond to the presence of specific functional groups by forming bonds between polymer chains can be used as crosslinkers in the methods disclosed herein.
[0032] In some embodiments, the tissue sample can have a thickness of about 20 μm to 400 μm, hi some embodiments, the tissue sample can have a thickness of about 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 μm, or any thickness therebetween. In some embodiments, the tissue sample is about 20 μm to 30 μm, 30 μm to 40 μm, 40 μm to 50 μm, 50 μm to 60 μm, 60 μm to 70 μm, 70 μm to 80 μm, 80 μm to 90 μm, 90 μm to 100 μm, 100 μm to 125 μm, 125 μm to 150 μm, 150 μm to 175 μm, 175 μm to 200 μm, 200 μm to 225 μm, 225 μm to 250 μm, 250 μm to 275 μm, 275 μm to 300 μm, 300 μm to 325 μm, 325 μm to 350 μm, 350 μm to It can have a thickness of 375 μm, 375 μm to 400 μm, 400 μm to 425 μm, 425 μm to 450 μm, 450 μm to 475 μm, 475 μm to 500 μm, 500 μm to 525 μm, 525 μm to 550 μm, 550 μm to 575 μm, 575 μm to 600 μm, 600 μm to 625 μm, 625 μm to 650 μm, 650 μm to 675 μm, 675 μm to 700 μm, 700 μm to 725 μm, 725 μm to 750 μm, 750 μm to 775 μm, or 775 μm to 800 μm.
[0033] In some embodiments, the tissue sample can have improved molecular diffusion after the step of substantially degrading DNA within the tissue sample, compared to the tissue sample after the step of permeabilizing the tissue sample, hi some embodiments, molecular diffusion can be confirmed by confirming uniformity of RCA amplicons between tissue samples.
[0034] Target of interest. In some embodiments, the target of interest can be a nucleic acid molecule. In some embodiments, the target of interest can be present in a tissue sample. In some embodiments, the target of interest can be present in a single region of a nucleic acid molecule. In some embodiments, the target nucleic acid molecule can be present in any nucleic acid sample of interest. The source, identity, and preparation of many such nucleic acid samples are known. Preferably, nucleic acid samples known or identified for use in amplification or detection methods are used in the methods described herein.
[0035] As disclosed herein, the disclosed methods can include utilizing RNA or RNA fragments comprising one or more targets of interest in a tissue sample. In some embodiments, the target of interest can be an RNA nucleic acid sequence. In some embodiments, the target of interest can be single-stranded. Hybridization and amplification regions within the target nucleic acid molecule can be defined based on the relationship between the target nucleic acid molecule and the primers in a set of primers. The primers can be designed to match (e.g., be complementary to) the selected target of interest. In some embodiments, the hybridization site of the primer with the nucleic acid sequence to be amplified can be isolated, allowing for amplification of sequences within and surrounding the site where the primer hybridizes.
[0036] In some embodiments, the target of interest can include a mutation.
[0037] In some embodiments, the nucleic acid sample can be, for example, a nucleic acid sample from one or more cells, tissues, or other biological samples such as tissue culture cells, tissue slices, and archaeological samples such as bone or mummified tissue. The tissue sample can be obtained from any source, including, but not limited to, eukaryotes, plants, animals, vertebrates, fish, mammals, humans, non-humans, needle aspiration biopsies, cancers, tumors, tissues, cells, stool, mummified tissues, forensic sources, autopsies, archaeological sources, infections, nosocomial infections, manufacturing sources, drug preparations, biomolecule manufacturing, or protein preparations. Useful tissue sample types include a eukaryotic sample, a plant sample, an animal sample, a vertebrate sample, a fish sample, a mammalian sample, a human sample, a non-human sample, a biological sample, a biopsy sample, a needle aspiration biopsy sample, a cancer sample, a tumor sample, a tissue sample, a cell sample, a cell lysate sample, a live cell lysate sample, a tissue lysate sample, a stool sample, a mummified tissue sample, a forensic sample, an autopsy sample, an archaeological sample, an infection sample, a hospital-acquired infection sample, or a protein preparation sample.
[0038] In some embodiments, the target nucleic acid molecule can be damaged RNA from a damaged RNA tissue sample. For example, preparation of a genomic sample can sometimes cause damage (e.g., degradation or fragmentation) of genomic RNA. This can make amplification of sequences therein more difficult (e.g., by causing amplification of many partial and fragmented genomic sequences) and can lead to unreliable results. Thus, damaged RNA and damaged RNA in tissue samples are useful for the disclosed methods. Any degraded, fragmented, or otherwise damaged RNA or tissue samples containing such RNA can be used in the disclosed methods.
[0039] The disclosed methods can include sequencing a nucleic acid (e.g., a target of interest comprising a target nucleic acid molecule). In some embodiments, the target nucleic acid molecule is RNA.
[0040] In some embodiments, the target nucleic acid molecule comprises an amplification region and a hybridization region. The hybridization region can comprise a sequence that can be complementary to a primer in a set of primers. The amplification region can be a portion of the amplification region that can be amplified. In some embodiments, the amplification region can be downstream of or sandwiched between the hybridization region.
[0041] Permeabilizing the tissue sample. In some embodiments, the methods disclosed herein include permeabilizing the tissue sample. In some embodiments, the step of permeabilizing the tissue sample can be performed after the tissue sample is obtained. In some embodiments, lipids can be removed or partially removed from the tissue sample. In some embodiments, the step of removing or partially removing lipids can be optional. In some embodiments, lipids can be partially, substantially, or completely removed from the tissue sample. In some embodiments, the "permeabilization" step of the disclosed methods can include lipid removal or partial lipid removal and DNA degradation. In some embodiments, the step of reducing or removing lipids from the tissue sample can be performed after the tissue sample permeabilization step. In some embodiments, the tissue sample can be permeabilized by contacting it with a tissue permeabilizing agent. In some embodiments, the tissue permeabilizing agent can be a detergent or sodium dodecyl sulfate (SDS). In some embodiments, the detergent can be an ionic detergent. Further, examples of surfactants include, but are not limited to, Triton™-X100, NP-40, and Tween™-20. In some embodiments, the tissue permeabilizing agent can be any alcohol. In some embodiments, the alcohol can be methanol or ethanol.
[0042] Degrading DNA in a tissue sample. In some embodiments, the methods disclosed herein include degrading DNA in a tissue sample. In some embodiments, degrading or removing DNA in a tissue sample can allow for better hydrogel formation. In some embodiments, degrading or removing DNA in a tissue sample can allow for better hybridization of primers or probes to targets of interest in the tissue sample because DNA is not present as a target. In some embodiments, degrading or removing DNA in a tissue sample can allow for better diffusion of molecules within the tissue. In some embodiments, DNA can be degraded or removed, or substantially degraded or removed, by contacting the tissue sample with a DNase (e.g., DNase I). In some embodiments, DNA can be degraded or removed, or substantially degraded or removed, by contacting the tissue sample with an exonuclease enzyme. In some embodiments, the exonuclease enzyme can be DNase I. In some embodiments, the exonuclease enzyme can be any double-stranded DNA degrading enzyme (eg, lambda exonuclease, exonuclease V, and T5 exonuclease).
[0043] In some embodiments, the step of substantially degrading DNA in the tissue sample can be performed or carried out before embedding the tissue sample in the hydrogel, hi some embodiments, the step of substantially degrading DNA in the tissue sample can be performed or carried out after embedding the tissue sample in the hydrogel.
[0044] Degrading non-RNA molecules in a tissue sample. In some embodiments, the methods disclosed herein can further include substantially degrading non-RNA molecules in a tissue sample. In some embodiments, the non-RNA molecules can be proteins or protein molecules. In some embodiments, the non-RNA molecules can be lipids. In some embodiments, the methods disclosed herein can further include degrading proteins or protein molecules in a tissue sample. In some embodiments, the proteins or protein molecules can be substantially degraded by contacting the tissue sample with proteinase K. In some embodiments, the step of substantially degrading non-RNA molecules in a tissue sample can be performed at least prior to the step of detecting primers or probes bound to the target of interest.
[0045] In some embodiments, the protein or protein molecule diffuses out of the hydrogel without actively removing the protein or protein molecule from the polymerized tissue.
[0046] Hydrogels and Matrices. Hydrogels are three-dimensional (3D) networks of hydrophilic polymers that maintain their structure through chemical or physical crosslinking of individual polymer chains. Hydrogels are composed of crosslinkable hydrophilic polymers. While hydrogels can retain water, the hydrogels described herein maintain a defined structure.
[0047] In some aspects, the hydrogels described herein can be chemical hydrogels or physical hydrogels. In some aspects, chemical hydrogels can be formed by covalent crosslinking. In some aspects, physical hydrogels can have non-covalent bonds.
[0048] In some embodiments, the methods disclosed herein can further include forming a matrix within the tissue sample. In some embodiments, the matrix can be formed within the tissue sample at any point during the method. In some embodiments, the point at which the matrix is formed can depend on the type of detection of the target of interest being performed. For example, if a hybridization chain reaction is being performed, a hydrogel may not be necessary. In this case, a protein matrix can be formed by chemical fixation. In the case of padlock detection, a hydrogel matrix can be useful. In some embodiments, the matrix can be formed or introduced after obtaining the tissue sample. In some embodiments, the matrix can be formed or introduced after permeabilizing the tissue sample. In some embodiments, the matrix can be formed or introduced after substantially degrading DNA within the tissue sample. In some embodiments, the matrix can be formed or introduced after introducing primers or probes specific to the target of interest into the tissue sample. In some embodiments, the protein lattice formed by chemical crosslinking during fixation can be a matrix that maintains inter-molecular spacing. In some embodiments, the matrix can be replaced with a chemical hydrogel. In some embodiments, a chemical hydrogel matrix can be generated by introducing acrylamide monomers into a tissue slice and activating a polymer reaction.
[0049] In some embodiments of the disclosed methods, the tissue sample can be embedded in a hydrogel before or after introducing a primer or probe specific to the target of interest into the tissue sample, where the primer or probe binds to the target of interest. In some embodiments, the hydrogel comprises acrylamide and bisacrylamide monomers. Other monomers that can be used include, but are not limited to, acrylic acid, HEMA, and NVP. In some embodiments of the disclosed methods, the tissue sample can be embedded in a hydrogel by diffusing acrylamide monomers into the tissue sample and crosslinking them to form a polyacrylamide gel.
[0050] In some embodiments of the disclosed methods, the tissue sample can be embedded in a hydrogel after the step of permeabilizing the tissue sample. In some embodiments of the disclosed methods, the tissue sample can be embedded in a hydrogel after the step of substantially degrading DNA in the tissue sample.
[0051] In some aspects, the matrix formed within the tissue sample can be the crosslinking of proteins present in the tissue sample. In some aspects of the disclosed methods, the matrix or hydrogel can be formed at any time after obtaining or already obtaining the tissue sample.
[0052] Primers and Probes. In some aspects of the disclosed methods, the methods include introducing a primer or probe specific to a target of interest into a tissue sample, where the primer or probe binds to the target of interest. In some aspects, the probe can be an oligonucleotide probe. In some aspects, the oligonucleotide probe can be bound to a hydrogel. In some aspects, the oligonucleotide probe can be covalently bound to a hydrogel. In some aspects, the oligonucleotide probe can be modified with an acrydite moiety.
[0053] In some aspects, the probe specific to the target of interest can be a padlock probe. In some aspects, the padlock probe can be circularized after introducing the probe specific to the target of interest into a tissue sample, where the probe binds to the target of interest. In some aspects, the padlock probe can be circularized after hybridizing to the target of interest by contacting the polymerized tissue with a ligase.
[0054] In some embodiments, the disclosed methods further comprise contacting the circularized padlock probe with a primer complementary to the padlock probe. In some embodiments, the primer complementary to the padlock probe can be covalently attached to a hydrogel. In some embodiments, the methods can further comprise subjecting the circularized padlock probe to rolling circle amplification (RCA) to generate an amplicon using the circularized padlock probe as a template and the oligonucleotide primer as a primer. In some embodiments, the amplicon comprises concatemerized repeat sequences corresponding to the target of interest. In some embodiments, the methods further comprise detecting the concatemerized repeat sequences corresponding to the target of interest.
[0055] In some embodiments, padlock probes used in the disclosed methods can include end regions that are complementary to a target of interest.
[0056] In some embodiments of the disclosed methods, oligonucleotide primers can be used. The oligonucleotide primers can be complementary to the target of interest or to a portion of a padlock oligo included by contacting the primer with a tissue sample. In some embodiments, the method can further include subjecting the circularized padlock probe to rolling circle amplification (RCA) to generate an amplicon using the circularized padlock probe as a template and the oligonucleotide primer as a primer, where the amplicon includes concatemerized repeat sequences corresponding to the RNA of interest. In some embodiments, the oligonucleotide primers can be covalently attached to a hydrogel. In some embodiments, the oligonucleotide primers can be modified with an acrydite moiety and incorporated into the hydrogel during the polymerization or permeabilization step. In some embodiments, the padlock probe and oligonucleotide primers can be covalently incorporated into the polymerized or permeabilized tissue. In some embodiments, the oligonucleotide primers can be modified. In some embodiments, the oligonucleotides can be modified with an acrydite moiety. In some embodiments, the amplification of the padlock probe can be rolling circle amplification.
[0057] Any sequence present in the target of interest can function as a primer binding site to which a primer or probe can hybridize. Generally, primer binding sites are about 3 to about 30 nucleotides in length, and can be about 15 to about 25 nucleotides in length. Primer oligonucleotides are typically 6 to 25 bases in length.
[0058] The sequence within a primer can hybridize to another nucleic acid molecule and can be referred to as the complementary portion of the primer. The complementary portion of the primer can be any length that supports specific and stable hybridization between the primer and the nucleic acid molecule (e.g., the target of interest) under the reaction conditions.
[0059] A primer can have a length of, for example, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, or 40 nucleotides.
[0060] In some embodiments, a primer can have a length of, e.g., less than 4 nucleotides, less than 5 nucleotides, less than 6 nucleotides, less than 7 nucleotides, less than 8 nucleotides, less than 9 nucleotides, less than 10 nucleotides, less than 11 nucleotides, less than 12 nucleotides, less than 13 nucleotides, less than 14 nucleotides, less than 15 nucleotides, less than 16 nucleotides, less than 17 nucleotides, less than 18 nucleotides, less than 19 nucleotides, less than 20 nucleotides, less than 21 nucleotides, less than 22 nucleotides, less than 23 nucleotides, less than 24 nucleotides, less than 25 nucleotides, less than 26 nucleotides, less than 27 nucleotides, less than 28 nucleotides, less than 29 nucleotides, less than 30 nucleotides, less than 31 nucleotides, less than 32 nucleotides, less than 33 nucleotides, less than 34 nucleotides, less than 35 nucleotides, less than 36 nucleotides, less than 37 nucleotides, less than 38 nucleotides, less than 39 nucleotides, or less than 40 nucleotides.
[0061] As used herein, "probe" refers to an oligonucleotide used in hybridization. In some embodiments, the probe can be a labeled oligonucleotide having a sequence complementary to a detection tag or other sequence on the amplified nucleic acid. The complementary portion of the probe can be any length that supports specific and stable hybridization between the probe and the complementary sequence on the amplified RNA. In some embodiments, the probe can be a padlock probe.
[0062] In some embodiments, the length of the probe can vary. In some embodiments, the probe can have a few specific bases and many degenerate bases. In some embodiments, the length of the probe is between 10 and 35 nucleotides, with the complementary portion of the probe being about 16 to 20 nucleotides in length.
[0063] The probes described herein can be labeled in a variety of ways, including, but not limited to, direct or indirect attachment of radioactive moieties, fluorescent moieties, colorimetric moieties, chemiluminescent moieties, and the like. The probes can include any detection label described herein. Examples of detection labels include, but are not limited to, biotin, fluorescent molecules, and molecular bicons. Molecular bicons are probes labeled with fluorescent moieties that fluoresce only when the detection probe is hybridized (Tyagi and Kramer, Nature Biotechnol. 14:303-309 (1995)). Use of such probes eliminates the need to remove unhybridized probes prior to label detection, since unhybridized detection probes do not generate a signal.
[0064] Detection. The methods disclosed herein can include a detection step. For example, the disclosed methods can include detecting primers or probes bound to the target of interest. The methods described herein can be used to prepare tissue samples for detecting the target of interest. In some embodiments, the detection method can be RCA detection. In some embodiments, the detection method can be hybridization chain reaction (HCR). In some embodiments, reverse transcription of the target RNA can be performed, followed by other detection modes.
[0065] In some embodiments, amplification of the padlock probes can form RNA concatemers. In some embodiments, the RNA concatemers can be detected. In some embodiments, the RNA concatemers can be detected by fluorescent probes or in situ sequencing.
[0066] In some aspects, the detecting step is performed or can be carried out using a confocal microscope.
[0067] Amplicon. In some embodiments of the disclosed methods, a target of interest can be amplified or a probe that binds to the target of interest can be amplified to form an amplicon. The amplicon can be a fragment of RNA containing the target of interest or a sequence of interest, reverse-transcribed DNA from an RNA target of interest, or a DNA sequence of a probe that specifically binds to the target of interest. In some embodiments, the amplicon can be double-stranded. In some embodiments, the amplicon includes a sequence of interest. In some embodiments, the amplicon includes the target of interest. In some embodiments, the amplicon can include a first strand and a second strand. In some embodiments, the amplicon can be amplified and contacted with a primer or a probe.
[0068] In some embodiments, multiple amplicons can be immobilized on a surface. In some embodiments, amplicons can be generated for disposal on an array.
[0069] In some embodiments, the amplicons produced herein may comprise two or more concatemers.
[0070] Rolling Circle Amplification. The methods disclosed herein can further include rolling circle amplification (RCA). In RCA, amplification is performed with each rolling circle amplification primer, thereby forming a concatemer of tandem repeats (i.e., TS-DNA) of fragments complementary to the first-stage amplification target circle (ATC) replicated by each primer. Bipolar primers can be used as second-stage primers. Because bipolar primers have a 3'-OH at each end, they are automatically oriented appropriately as primers for additional amplification stages. Furthermore, the 3'-OH at each end of bipolar primers also serves to suppress strand displacement that might otherwise occur. Furthermore, the presence of a 3'-OH at each end of the bipolar primer allows the complementary sequences of TS-DNA and second-stage or higher ATCs (such as second-stage ATC, third-stage ATC, and fourth-stage ATC) to be arranged in any configuration within the primer sequence.
[0071] Detection Label. To aid in the detection and quantification of targets of interest using the disclosed methods, a detection label can be incorporated directly into the primers or probes described herein, directly into the amplified nucleic acid, or attached to a detection molecule such as a probe. As used herein, a detection label is any molecule that directly or indirectly associates with the amplified nucleic acid and directly or indirectly produces a measurable and detectable signal. Many such labels for incorporation into nucleic acids or attachment to nucleic acid or antibody probes are known to those skilled in the art. Examples of detection labels suitable for use in RCA include radioisotopes, fluorescent molecules, phosphorescent molecules, enzymes, antibodies, ligands, and the like.
[0072] Examples of suitable fluorescent labels include fluorescein (FITC), 5,6-carboxymethylfluorescein, Texas Red, nitrobenzene-2-oxa-1,3-diazol-4-yl (NBD), coumarin, dansul chloride, rhodamine, 4'-6-diamidino-2-phenylindole (DAPI), and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5, and Cy7. Preferred fluorescent labels are fluorescein (5-carboxyfluorescein-N-hydroxysuccinimide ester) and rhodamine (5,6-tetramethylrhodamine). Preferred fluorescent labels for combined multicolor coding are FITC and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5, and Cy7. The absorption and emission maxima of these fluorescent dyes are FITC (490 nM, 520 nM), Cy3 (554 nM, 568 nM), Cy3.5 (581 nM, 588 nM), Cy5 (652 nM, 672 nM), Cy5.5 (682 nM, 703 nM), and Cy7 (755 nM, 778 nM), respectively, allowing for their simultaneous detection. Fluorescent labels are available from a variety of commercial sources, including Molecular Probes, Eugene, Oregon, and Research Organics, Cleveland, Ohio.
[0073] Labeled nucleotides can be directly incorporated into the RCA product during synthesis and can therefore be used as a form of detection label. Examples of detection labels that can be incorporated into amplified DNA or RNA include nucleotide analogs such as BrdUrd (Hoy and Schimke, Mutation Research 290:217-230 (1993)), BrUTP (Wansick et al., J. Cell Biology 122:283-293 (1993)), and nucleotides modified with suitable haptens, such as biotin (Langer et al., Proc. Natl. Acad. Sci. USA 78:6633 (1981)), or digoxin (Kerkhof, Anal. Biochem. 205:359-364 (1992)). Suitable fluorescently labeled nucleotides include fluorescein isothiocyanate-dUTP, cyanine-3-dUTP, and cyanine-5-dUTP (Yu et al., Nucleic Acids Res., 22:3226-3232 (1994)). A preferred nucleotide analog detection label for DNA is BrdUrd (BUDR triphosphate, Sigma), and a preferred nucleotide analog detection label for RNA is biotin-16-uridine-5'-triphosphate (biotin-16-dUTP, Boehringher Mannheim). Fluorescein, Cy3, and Cy5 can be attached to dUTP for direct labeling. Cy3.5 and Cy7 can be used as avidin or anti-digoxigenin conjugates for secondary detection of biotin- or digoxigenin-labeled probes.
[0074] Detection labels incorporated into the amplified nucleic acids, such as biotin, can then be detected using sensitive methods known in the art. For example, biotin can be detected using streptavidin-alkaline phosphatase complex (Tropix, Inc.), which binds to biotin and is then detected by the chemiluminescence of an appropriate substrate (e.g., the chemiluminescent substrate CSPD: disodium, 3(4-methoxyspiro-[1,2-dioxetane-3-2'-(5'-chloro)tricyclo[3.3.1.13,7]decane]-4-yl)phenyl phosphate, CDP). -Star.RTM. (disodium 2-chloro-5-(4-methoxyspiro{1,2-dioxetane-3-2'-(5'-chloro)tricyclo[3.3.1.13,7]decan}-4-yl)phenyl phosphate) and AMPPD.RTM. (disodium 3-(4-methoxyspiro{1,2-dioxetane-3-2'-tricyclo[3.3.1.13,7]phenyl phosphate) (all available from Tropix, Inc.).
[0075] A preferred detection label used to detect amplified RNA is an acridinium ester-labeled DNA probe (GenProbe, Inc., described by Arnold et al., Clinical Chemistry 35:1588-1594 (1989)). Acridinium ester-labeled detection probes allow detection of amplified RNA without washing, since unhybridized probes can be destroyed with alkali (Arnold et al. (1989)).
[0076] Molecules that combine two or more detection labels are also considered detection labels. Any known detection label can be used in combination with the disclosed probes, tags, and methods to label and detect amplified nucleic acids using the disclosed methods. Methods for detecting and measuring signals generated by detection labels are also known to those skilled in the art. For example, radioisotopes can be detected by scintillation counting or direct visualization, fluorescent molecules can be detected with a fluorescence spectrophotometer, phosphorescent molecules can be detected with a scanner or spectrophotometer, or directly visualized with a camera, enzymes can be detected by detecting or visualizing the product of the reaction catalyzed by the enzyme, and antibodies can be detected by detecting a secondary detection label bound to the antibody. Such methods can be directly used in the disclosed amplification and detection methods. As used herein, a detection molecule is a molecule that interacts with amplified nucleic acid and has one or more detection labels attached to it.
[0077] The methods disclosed herein can be used to sequence or genotype unknown or known nucleic acids. [Example]
[0078] Example 1: Methods for clearing and molecular analysis in thick tissue sections In situ transcriptomics (also known as spatial transcriptomics) techniques enable molecular characterization of tissues with subcellular spatial resolution and are currently used in molecular diagnostic approaches. These approaches are generally limited to thin tissue slices (e.g., 15 microns) due to inefficient molecular diffusion and / or tissue opacity, making them 2D in nature. Attempts to combine spatial transcriptomics with tissue-clearing approaches to improve molecular diffusion and light penetration, enabling more 3D characterization of tissues, have been made. However, the performance (sensitivity) of these approaches rapidly decreases with increasing tissue thickness, and no effective approaches exist for tissues thicker than 400 microns.
[0079] Disclosed herein is a method for tissue clearing and molecular amplification procedures that can be used to detect RNA in tissues up to 400 microns thick. The disclosed method outperforms existing in situ RNA detection methods by more than 10 times. The disclosed method can further be used as a molecular diagnostic approach.
[0080] Disclosed herein is a method that combines complementary tissue clearing and molecular detection approaches in thick tissue sections.
[0081] In some embodiments, the method involves replacing the entire tissue lattice with a polyacrylamide hydrogel, removing non-RNA molecules (e.g., proteins, DNA, lipids), and generating detectable amplicons from RNA molecules covalently bound to the hydrogel. A schematic of this method is shown in Figure 1. In some embodiments, SDS and DNase I can be used to permeabilize tissue and remove lipids and genomic DNA from thick, fixed tissue sections, improving optical clarity and significantly facilitating molecular diffusion. In some embodiments, tissue clarity can be measured visually. For example, molecular diffusion can be confirmed as a result of uniform reaction throughout the tissue sample.
[0082] In some embodiments, a padlock probe targeting the target RNA can be applied along with a rolling circle amplification (RCA) primer that hybridizes to the padlock probe. In some embodiments, the RCA primer can be modified with an acrydite moiety. Then, in some embodiments, a hydrogel can be introduced by diffusing acrylamide monomers into the tissue section and inducing their polymerization. In some embodiments, the RCA primers can be covalently incorporated into the polyacrylamide hydrogel, retaining their spatial location as well as the spatial location of their hybridized padlock oligo or RNA molecules.
[0083] In some embodiments, proteinase K can be used to remove proteins immediately after polymerization. These two steps (hydrogel polymerization and proteinase treatment) can be effectively performed to replace the protein lattice of fixed tissue with a hydrogel lattice. Importantly, protein lattices are not uniform because their physical and chemical properties (e.g., hydrophobicity, density, charge, etc.) vary at different locations within the tissue. In contrast, hydrogel lattices are uniform, porous, and possess a molecular composition known to be highly permissive to molecular and enzymatic reactions. Finally, in some embodiments, a ligase enzyme is used to circularize the padlock probes, and a polymerase is used to perform RCA, resulting in the local amplification of the padlocks as DNA concatemers that can subsequently be identified using fluorescent probes or in situ sequencing chemistry. The presence of padlock-derived RCA amplicons at each location indicates the location of specific RNA molecules within the tissue lattice.
[0084] The methods described herein improve the efficiency of oligonucleotide hybridization and enzymatic reactions, thereby achieving uniform and sensitive RNA detection in thick tissues. For example, as described herein, Actb transcripts were targeted using padlock probes in 400-micron-thick mouse liver tissue sections (Figure 2). Results showed uniform amplification from this target transcript throughout the tissue (Figures 2A and 2B), with a field area of 2.4 mm. 2 There were at least 1,000 amplicons per sample. This sensitivity and efficiency far exceeds that of the most recent method (MelphaX) that claims efficient detection in thick tissues [Wang, Y. et al., (2021), Cell, 184(26)]. A side-by-side comparison of the disclosed method was performed with a MelphaX-based method on 50-micron-thick mouse liver tissue sections (Figure 3). The results show that the disclosed method detects Actb transcripts in tissues on average 24-fold more efficiently than MelphaX, demonstrating superior sensitivity. The disclosed method could be easily parallelized to hundreds of different targets.
[0085] The improved performance of the disclosed method is the result of the following DNase treatment: genomic DNA inhibits hybridization and subsequent enzymatic reactions in situ (Figure 4A, Figure 4B). For example, DNase treatment of thick tissues before hybridization completely degrades genomic DNA (Figure 4C), improving RNA detection uniformly throughout the thick tissue. Tissue clearing: Diffusion of oligonucleotides and other molecules is the rate-limiting step in in situ applications. For example, the 8% SDS solution during hybridization removes lipids, clearing the tissue and improving diffusion. Hydrogel embedding and proteinase treatment: Enzymatic reactions within tissues are inefficient due to limited enzyme diffusion and the physical and chemical heterogeneity of the endogenous tissue lattice (composed of cross-linked proteins). As a result, many in situ transcriptome methods are limited to the tissue surface in thin slices (approximately 15 microns). Hydrogels are highly porous, allowing enzymes to diffuse efficiently within the gel. Furthermore, its chemically homogeneous and inert nature provides an excellent microenvironment for enzymatic reactions. Oligo design: Padlock oligos can be used to target RNA, and primers with acrydite moieties can be used to bind to the padlock backbone. After these oligos hybridize to the target transcripts, the sample is embedded in a polyacrylamide gel, which chemically captures the oligo-RNA complex in its original cellular location. Because the hybridization rate directly determines RNA retention, RNA is highly retained. Other in situ transcriptome methods for thick tissues require multiple chemical and hybridization steps, resulting in reduced RNA retention.
[0086] The tissue clearing and molecular amplification strategies described herein can each be used in thin tissue settings. Furthermore, the tissue clearing aspect is adaptable to other molecular amplification strategies, including de novo and targeted in situ sequencing. Furthermore, the methods disclosed herein are also compatible with tissue expansion.
[0087] The methods disclosed herein can also be used to better understand biological systems and to diagnose disorders. For example, in a clinical setting, these methods can be applied to molecular histology for detailed diagnosis of disorders such as cancer.
[0088] An example of the disclosed method is described herein.
[0089] Step-by-step procedure: The tissue was fixed (4% FA) for 1 day at 4°C and then sliced (400 μm) using a vibrotome. These steps were followed by a 0.5% SDS pretreatment, overnight incubation, DNase digestion in 2% Triton-X100, and DNase quenching with 8% SDS (Figures 4B-4C are omitted). Hybridization (padlock and RCA primers + acrydite, 8% SDS) was performed for 3 days, followed by hybridization (padlock and RCA primers + acrydite, 0.3% SDS) for 1 day, followed by gelation to capture the primer-padlock-RNA complex. Tissue cleansing (1.5 ml tube, 100 μl PK + 0.9 ml digestion buffer) was performed twice, followed by washing. Next, padlock ligation was performed on the RNA, followed by rolling circle amplification and image analysis in Fiji.
[0090] procedure First, 40 ml of 4% w / v PFA was prepared using 26 ml of water, 4 ml of 10x PBS, and 10 ml of 16% w / v PFA and cooled to 4°C before use. The liver (any tissue can be used) was dissected from the mouse and washed with PBS. The tissue was incubated overnight in the solution at 4°C. A vibrotome was used to create slices (e.g., 400 μm thick). Other slicing techniques can also be used (e.g., cryostat). The tissue was stored at -20°C in 100% methanol; 70% EtOH can also be used (this step can be omitted). The fixed slices were washed four times in 2x saline-sodium citrate (SSC) on ice (1x SSC also works, as do other buffered aqueous solutions). Next, the samples were washed overnight at 37°C with 1x DNA digestion buffer + 0.5% SDS (shaking at 1000 rpm). This step removes lipids and permeabilizes the tissue. High concentrations of SDS can inactivate DNase in later steps. Next, the samples were washed for 2 hours at 37°C with 1x DNA digestion buffer + 2% Triton-X 100 + 0.4 U / µl RNase inhibitor (shaking at 1000 rpm). This was done to remove SDS micelles, which would otherwise inactivate DNase (this concentration was used for DNase Hi-C).
[0091] DNase solution was prepared as described in Table 1, and the samples were incubated in the DNase solution at 37°C and shaken at 1000 rpm. [Table 1]
[0092] To stop the DNase reaction, samples were placed in 2xSSC, 8% SDS solution at 37°C for 1 hour with shaking at 1000 rpm. In some embodiments, the SDS concentration can be lowered. In Figures 4B-4C, samples omitted the DNA digestion step. In Figures 4A and 4C, tissue slices were stained with DAPI and examined by confocal microscopy.
[0093] The samples were then incubated in hybridization buffer in 1.5 ml tubes at 37°C for 1 h and shaken at 1000 rpm. [Table 2]
[0094] Next, incubate the samples in hybridization buffer + oligos in a 1.5 ml tube (shaking at 1000 rpm). For these experiments, three different oligos were used, and incubated with the samples overnight in an 8% SDS solution with 20% formamide (although the concentration of formamide is optional). [Table 3]
[0095] The SDS concentration was reduced to 0.3% and the samples were incubated overnight at 37°C and shaken at 1000 rpm. [Table 4]
[0096] Next, the samples were washed twice with 1 ml of 0.5x SSC / 0.3% SDS solution at 37°C, shaking at 1000 rpm for 1 hour each. This step is done to remove nonspecific binding. A 0.2x SSC SDS solution also works.
[0097] Table 5 shows the process for preparing the gel solution. [Table 5]
[0098] Tissue slices (samples) were washed with 100 μl of gel solution without ammonium persulfate (APS) or tetramethylethylenediamine (TEMED). The gel solution was degassed with argon bubbles. Next, the tissue slices were washed with 400 μl of degassed gel solution without APS or TEMED and incubated at room temperature for 15 minutes at 1000 rpm. A Frame-Seal slide chamber (Frame-Seal™ in situ PCR and hybridization slide chamber, 17 x 28 mm, 125 μl #SLF1201) was attached to the slide. To the 200 μl of gel solution, 2 μl of 40 U / μl RNase inhibitor, 4 μl of 5% TEMED, and 5% APS were added. The tissue slices were placed on a glass slide, and the activated gel solution was added. A plastic cover was used to seal the Frame-Seal slide chamber (Frame-Seal™ in situ PCR and hybridization slide chamber, 17x28mM, 125µl #SLF1201) and then incubated at 37°C for 5 hours. The sample was then treated with proteinase K in digestion buffer (100µl + 900µl) overnight at 37°C with shaking at 1000 rpm. The sample was briefly washed with 2xSSC using digestion buffer (50mM Tris-HCl pH 7.0, 1mM EDTA, 6xSSC, 0.3% SDS), followed by six washes with 2xSSC at room temperature for 30 minutes each, shaking at 1000 rpm. For the first wash, 2x phenylmethylsulfonyl fluoride (PMSF) (originally 200x in DMSO (200mM)) was added. If the incubation was too short, the SDS could not be removed, inhibiting the subsequent enzymatic reaction. It is also important not to cool during this step because the SDS will precipitate and become difficult to remove.
[0099] Next, the tissue samples were washed once with 1xSSC, followed by two washes with 1X Splint® Ligase Buffer at 4°C. The tissue samples were incubated with 1.25U / μl Splint® Ligase (NEB, Catalog No. M0375L) in 1X Splint® Ligase Buffer for 1 hour at 4°C. [Table 6]
[0100] The tissue samples were incubated overnight at 37°C, after which they were washed twice with 1x RCA buffer (New England Biolabs). [Table 7]
[0101] 200 μl of RCA solution was added to the sample in a 1.5 ml tube and incubated at 4°C for 1 hour with shaking at 1000 rpm. Then, the tissue was incubated at 30°C for another 6 hours with shaking at 1000 rpm. The solution was replaced with fresh solution, and the tissue sample was again incubated overnight at 30°C with shaking at 1000 rpm. The tissue sample was then washed with 2x SSC (1 ml) and then washed again with 2x SSC / 10% formamide (1 ml) at room temperature. 500 nM Cy5 probe corresponding to the padlock oligo in 2x SSC / 20% formamide was then added, and the tissue sample was incubated at room temperature for 1 hour. The tissue sample was then washed twice with 1x SSC at room temperature for 30 minutes. Measurements were performed using a confocal microscope. Images were acquired and analyzed using Fiji and converted to 8-bit format. An arbitrary threshold was applied to the images to remove background. Circular objects were detected by applying arbitrary circularity and diameter values.
[0102] A padlock oligo targeting ACTB: gcagcgatatcgtcatCATAACAACAAAACAACCTCATTATCTCTCCACACACACTCCTCTCACTgttgtcgacgaccagc (SEQ ID NO: 1) was used with the RCA primer: AGTGAGAGGAGGTGTGTGTG + 5' Acrydite (SEQ ID NO: 2), and detection probe: CATAACAACAAAACAACCTCATTATCTCTC + 5' Cy5 (SEQ ID NO: 3).
[0103] Example 2: Methods for clearing and molecular analysis and in situ mutation detection in thick tissue sections Described herein are methods that can be used for in situ mutation detection. Currently available commercial in situ mutation detection technologies utilize thermodynamic differences to distinguish between mutations. While these techniques have been validated for several recurrent mutations in the clinic (e.g., KRAS, BRAF, EGFR), these methods require optimization on a case-by-case basis.
[0104] A wide variety of techniques are available for in vitro SNP genotyping and can be used for in situ mutation detection. However, some key enzymatic steps may not be performed in situ, as in a tube. The method disclosed herein uses a hydrogel embedding strategy (described herein) to achieve efficient enzymatic reactions in situ. Taking advantage of this strategy, the method disclosed herein can effectively distinguish mutations / SNVs in situ. This method can be used for molecular diagnostics. Described herein is a method using a novel oligo design, a hydrogel embedding strategy, and the Invader assay (also known as iLock padlock oligos), which, when combined, enable selective mutation / SNV detection in situ.
[0105] An overview of this procedure is shown in Figure 5. An iLock padlock oligo was designed with two strands that compete with each other at the target mutation / SNV RNA base (shown as the yellow strand in Figure 5). After hybridization of the iLock oligo, the tissue slice was immersed in an acrydite monomer solution, which was subsequently activated to form a hydrogel lattice within the tissue. Here, an acrydite-modified primer bridges the hydrogel and the iLock padlock oligo, preserving the spatial information of the RNA. After the hydrogel was formed, proteinase K was used to digest the proteins, enhancing optical clarity and significantly improving molecular diffusion for the enzymatic reaction. Taq polymerase cleaves the flap DNA strand once the invasive structure is formed on the RNA template, allowing for clear differentiation of the mutation / SNV from the wild-type genotype. Finally, a ligase enzyme was used to circularize the cleaved iLock padlock oligo, and polymerase was used to perform RCA, resulting in localized amplification of the padlock, which can later be identified using fluorescent probes or in situ sequencing chemistry.
[0106] Results: SNVs in three genes (Apcs, Apoa2, and Rbp4) from C57BL / 6J and BALB / cJ mice were used. Six iLock padlock oligos (two mouse strains x three SNVs) were designed, and these iLock padlock oligos selectively distinguished SNVs in 50-micron liver slices (Figure 6). iLock padlock oligos have been reported to have limited in situ efficiency [Krzywkowski, T. et al., (2019), RNA, 25(82-89)], which may be explained by low diffusibility and / or activity of the enzyme within cells / tissues. It is noteworthy that the authors used a cultured cell line, which is advantageous for in situ reactions due to its low amount of extracellular matrix; however, they observed sparse amplification from the cells. The method disclosed herein can adequately detect SNVs even in liver tissue with a relatively abundant extracellular matrix and complex tissue lattice. This advancement is attributed to a novel oligo design with acrydite-modified primers and a hydrogel-embedding strategy, which significantly accelerates the enzymatic reaction while preserving the RNA spatial information.
[0107] Figure 7 shows that DNase I treatment improved detection efficiency in brain slices. The excitatory neuron marker Slc17a7 was detected using two iLock padlock oligos in 30-micron brain slices of C57BL / 6J mice. Brain slices were processed as described in Figure 5, except for the slice shown in Figure 7A, which underwent DNase I treatment before iLock padlock hybridization. RCA amplicons from the iLock padlock oligos were detected using a Cy5 probe (red). Genomic DNA was visualized with DAPI (blue). Samples were analyzed using a spinning-desk confocal microscope.
[0108] The procedure involves the following steps: Tissues are fixed in 4% PFA solution overnight at 4°C. Crosslinked tissue is then cut into 50 μm slices. Prior to analysis, slices are stored in 100% methanol at -20°C to remove lipids and preserve RNA integrity. The slices are then washed four times with 1x SSC solution to remove the methanol. The slices are then incubated with iLock padlock oligos targeting the SNVs of interest at 37°C. Here, primers bearing acrydite modifications are simultaneously hybridized to the padlock backbone. After hybridization, the slices are thoroughly washed to remove nonspecific binding of the padlock probes. Acrylamide monomers then diffuse into the slices and polymerize at 37°C for 2–8 hours, thus introducing a polyacrylamide hydrogel into the tissue section. The acrydite moieties on the primers covalently bond to the hydrogel, holding the target RNA in place during the process. Proteins and lipids are then degraded and removed using proteinase K treatment at 37°C. After slice transparency is observed, 2x PMSF (2 mM) is added to the slice to inhibit proteinase K. Then, the slice is incubated with Taq polymerase to cleave the flap structure of the target SNV. The cleaved iLock padlock oligos are circularized by ligase, and an RCA reaction is performed on these circularized templates using phi29 DNA polymerase.
[0109] The methods described herein can be used to provide accurate molecular diagnostics in oncology (e.g., drug response, prognosis, metastasis prediction), and because the method can distinguish single-base differences between RNAs, it can be integrated into any in situ transcriptome technology to improve its accuracy.
[0110] Example 3: Simultaneous detection of 16 genes in whole dorsal mouse skin Sixteen genes (Table 8) were simultaneously detected in the dorsal skin of all P0 mice. The observed field of view was 749 μm × 749 μm × 250 μm, encompassing the epidermis, dermis, subcutaneous fat, and hair follicles. A total of 121,797 transcripts were detected in the area. A mask image covering each hair follicle was generated from the raw image, which was then used to computationally extract hair follicles. Histologically, hair follicle stages are determined by their length. Immature hair follicles are short, while mature hair follicles are significantly longer. According to reports, the dorsal skin of P0 mice contains hair follicles at stages 1 to 6, each with distinct molecular compartments. The computationally extracted hair follicle lengths ranged from 50 μm to 350 μm, indicating successful isolation of single hair follicles of different stages. In some cases, the size of the tissue samples ranged from 4 to 400 μm. The presence of heterogeneous cells in the developing skin hindered detailed analysis. However, using the methods disclosed herein, results showed successful computational differentiation and isolation of single hair follicles. The results indicate that the methods disclosed herein can be used for precise spatial characterization of molecular events and for improved and accurate diagnosis, providing a deeper understanding of biology. [Table 8]
[0111] Methods: A 4% w / v paraformaldehyde (PFA) solution was prepared (40 ml) and cooled to 4°C before use. The dorsal skin of P0 mice was dissected and washed with PBS. The tissue was incubated in PFA solution overnight at 4°C and then stored in 100% methanol at -20°C until use. The fixed samples were washed twice with 2x SSC / 8% SDS solution for 30 minutes at 37°C. Next, the samples were incubated overnight at 37°C with 2x SSC / 8% SDS / 1% b-mercaptoethanol. The samples were then washed twice with 1x DNA digestion buffer + 2% Triton™-X100 for 1 hour at 37°C.
[0112] A DNase solution was made and the samples were incubated in the DNase solution overnight at 37°C. [Table 9]
[0113] The DNase reaction was stopped by incubating the samples in 2xSSC / 8% SDS solution for 2 hours at 37°C. After this step, the samples were incubated in hybridization buffer in 1.5 ml tubes for 1 hour at 37°C. [Table 10]
[0114] The samples were then incubated in hybridization buffer + oligos for 6 days at 37°C, with the solution changed daily. [Table 11]
[0115] The samples were then washed twice with 1xSSC / 0.5% SDS solution for 1 hour at 37°C. Next, the gel solution was prepared. [Table 12]
[0116] The sample (e.g., slice) was then washed with 500 μl of gel solution without APS or TEMED and incubated at room temperature for 30 minutes. The gel solution was degassed with argon bubbles. Next, 200 μl of gel solution was supplemented with 40 U / μl RNase inhibitor (2 μl), 5% TEMED, and 5% APS (4 μl). The sample was placed on a glass slide, and the activated gel solution was added. A coverslip was placed on the glass slide and then incubated at 37°C for 1 hour. The sample was then treated overnight at 37°C with proteinase K (100 μl + 900 μl) in digestion buffer. The digestion buffer contained 50 mM Tris-HCl pH 7.0, 1 mM EDTA, 2x SSC, and 2% SDS. Samples were washed with 2xSSC / 2xPMSF / 0.1% Triton X100 for 30 minutes at room temperature, then washed five times with 2xSSC for 30 minutes at room temperature, followed by two washes with 1X Splint® Ligase Buffer. Samples were then incubated overnight at 37°C with 1.25 U / μl Splint® Ligase (NEB, Cat. No. M0375L) in 1X Splint® Ligase Buffer. [Table 13]
[0117] Samples were washed twice with 1x RCA buffer (New England Biolabs). [Table 14]
[0118] 200 μl RCA solution was added to the sample in a 1.5 ml tube, followed by incubation at 30°C for 8 hours with shaking at 1000 rpm. The RCA solution was replaced, and the sample was incubated overnight at 30°C, washed with 2x SSC, and incubated in 20 mM Acryloyl-X / 2x SSC for 2 hours. [Table 15]
[0119] Samples (e.g., slices) were washed with 200 μl of monomer solution (2.5% acrylamide / 0.125% bisacrylamide / 2xSSC solution) without APS or TEMED. The monomer solution was degassed using argon bubbles. Tissue samples were washed twice with 400 μl of degassed monomer solution without APS or TEMED and incubated at room temperature for 10 minutes. Next, 4 μl of 5% TEMED and 4 μl of 5% APS were added to the 200 μl of monomer solution. Each tissue sample (e.g., slice) was placed on a cover glass with activated monomer solution. A slip solution (e.g., Lonza® Gel It is important to pretreat the coverslips with Slick™ Solution (which helps to remove the coverslip from the sample). The coverslips were applied to glass slides pretreated with Bind-Silane. The tissue samples were then incubated at 37°C for 30 minutes. The tissue samples were then washed with PBS, the coverslips were removed, and then washed with 2xSSC / 20% formamide. A solution containing bridge probes and dye probes was added: 2xSSC, 20% formamide, 50nM / bridge probe (800nM in total), 200nM / dye probe (AF488, AF546, Cy5, AF750, 800nM in total) and incubated for 2 hours at room temperature. The tissue samples were then incubated in 2xSS at room temperature. The tissue samples were then washed with 70% formamide / 0.1x SSC for 10 minutes at 60°C, followed by six washes with PBS for 5 minutes each at 37°C. Illumina® scanning solution was added. Images were taken with a Nikon® spinning disk confocal microscope. The samples were washed with PBS. The probes were stripped six times with 70% formamide / 0.1x SSC for 10 minutes at 60°C. The tissue samples were then washed with PBS. The hybridization and imaging steps were repeated using different sets of bridge probes and staining probes. The resulting images were processed as follows: background subtraction, image registration, puncta extraction, ID calling, mask image generation for each hair follicle, and hair follicle extraction using the generated mask image.
[0120] Padlock oligos were specifically designed for the 16 genes listed in Tables 16-18. Other probes used are listed in Table 19. Whole dorsal C57BL / 6J mouse skin was fixed, processed with padlock oligos, and scanned in a dorsal-to-ventral direction using a confocal microscope. Corresponding transcripts were identified using HybISS. Results showed the spatial distribution of the 16 genes throughout the sample. The developing skin sample consisted of numerous hair follicles at various stages, from stages 2 to 6. Hair follicles were computationally separated using manually curated mask images. Results also showed that the extracted hair follicles exhibited different lengths, reflecting the follicle stages. [Table 16-1] [Table 16-2] [Table 16-3] [Table 16-4] [Table 16-5] [Table 17-1] [Table 17-2] [Table 18-1] [Table 18-2] [Table 19]
Claims
1. 1. A method for detecting a target of interest in a tissue sample, comprising: a) obtaining or having obtained a tissue sample, said tissue sample comprising DNA, non-RNA molecules, and RNA, said RNA comprising a target of interest; b) permeabilizing the tissue sample; c) substantially degrading the DNA in the tissue sample; and d) introducing a primer or probe specific to the target of interest into the tissue sample, wherein the primer or probe binds to the target of interest; e) detecting the target of interest in the tissue sample by detecting the primer or the probe bound to the target of interest.
2. The method of claim 1 , wherein the method further comprises forming a matrix within the tissue sample.
3. The method according to any one of claims 1 to 2, wherein the tissue sample is embedded in a hydrogel before or after step d).
4. The method of any one of claims 1 to 3, wherein the tissue sample is embedded in a hydrogel after step a), b), c), or d).
5. The method of any one of claims 3 to 4, wherein the hydrogel comprises acrylamide monomers.
6. 6. The method of any one of claims 3 to 5, wherein the tissue sample is embedded in the hydrogel by diffusing acrylamide monomers into the tissue sample and cross-linking them to form a polyacrylamide gel.
7. The method of any one of claims 3 to 6, wherein the probe is an oligonucleotide probe, and the oligonucleotide probe is bound to the hydrogel.
8. The method of claim 7 , wherein the oligonucleotide probe is covalently attached to the hydrogel.
9. The method of claim 8 , wherein the oligonucleotide probe is modified with an acrydite moiety.
10. The method of any one of claims 1 to 9, wherein the tissue sample of step a) comprises lipids.
11. 11. The method of claim 10, further comprising reducing or removing lipids from the tissue sample.
12. The method of any one of claims 10 to 11, wherein lipids are partially, substantially or completely removed from the tissue sample.
13. The method of any one of claims 1 to 12, further comprising degrading the non-RNA molecules in the tissue sample, wherein the non-RNA molecules are protein molecules.
14. 14. The method of claim 13, wherein the protein molecules are substantially degraded by contacting the tissue sample with proteinase K.
15. The method of any one of claims 1 to 14, wherein the tissue sample is permeabilized by contacting the tissue sample with a tissue permeabilizing agent.
16. 16. The method of claim 15, wherein the tissue permeabilization agent is sodium lauryl sulfate, Triton-X100, Tween-20, methanol, or ethanol.
17. The method of any one of claims 1 to 16, wherein the tissue sample is fixed prior to step b).
18. 18. The method of claim 17, wherein the tissue sample is fixed by contacting the tissue sample with a chemical crosslinking agent.
19. The chemical crosslinkers include formaldehyde, glutaraldehyde, dimethyl suberimidate, SM(PEG)12 (PEGylated long-chain SMCC crosslinker), SM(PEG)6 (PEGylated long-chain SMCC crosslinker), SM(PEG)2 (PEGylated SMCC crosslinker), SIAB (succinimidyl (4-iodoacetyl) aminobenzoate), BMH (bismaleimidohexane), SBAP (succinimidyl 3-(butyl ether)), (4-succinimidyloxycarbonyl-α-methyl-α(2-pyridyldithio)toluene), DTSSP (3,3'-dithiobis(sulfosuccinimidyl propionate)), EMCH (N-ε-maleimidocaproic acid hydrazide), SM(PEG)24 (PEGylated long-chain SMCC crosslinker), BMPH (N-β-maleimidopropionic acid hydrazide), DTM 19. The method of claim 18, wherein the crosslinker is PEG-E (dithiobismaleimidoethane), BMOE (bismaleimidoethane), SMPB (succinimidyl 4-(p-maleimidophenyl)butyrate), EMCS (N-ε-maleimidocaproyl-oxysuccinimide ester), MBS (m-maleimidobenzoyl-N-hydroxysuccinimide ester), Sulfo-EMCS (N-ε-maleimidocaproyl-oxysulfosuccinimide ester), BS(PEG)9 (PEGylated bis(sulfosuccinimidyl)suberate), Sulfo-EGS (ethylene glycol bis(sulfosuccinimidyl succinate), LC-SPDP (succinimidyl 6-(3(2-pyridyldithio)propionamido)hexanoate), PEG12-SPDP (PEGylated long-chain SPDP crosslinker), or a derivative or combination thereof.
20. The method of any one of claims 1 to 19, wherein the probe specific to the target of interest is a padlock probe.
21. 21. The method of claim 20, wherein the padlock probe is circularized after step d).
22. 22. The method of claim 21, wherein the padlock probe is circularized by contacting the polymerized assembly with a ligase.
23. 23. The method of claim 22, further comprising contacting the circularized padlock probe with a primer complementary to the padlock probe.
24. 24. The method of claim 23, wherein the primer complementary to the padlock probe is covalently attached to the hydrogel.
25. 25. The method of any one of claims 23-24, further comprising subjecting the circularized padlock probe to rolling circle amplification (RCA) to generate an amplicon using the circularized padlock probe as a template and oligonucleotide primers as the primers, wherein the amplicon comprises concatemerized repeat sequences corresponding to the target of interest.
26. 26. The method of claim 25, further comprising detecting the concatemerized repeat sequence corresponding to the target of interest.
27. The method of any one of claims 1 to 26, wherein the tissue sample has a thickness of about 20 μm to 800 μm.
28. The method of any one of claims 1 to 27, wherein the method further comprises substantially degrading the non-RNA molecules in the tissue sample.
29. 29. The method of any one of claims 1 to 28, wherein the target of interest comprises a mutation.
30. 30. The method of any one of claims 1 to 29, wherein the tissue sample after step (c) has improved optical clarity and enhanced molecular diffusion compared to the tissue sample in step (b).
31. 1. A method of producing a hydrogel in a tissue sample, comprising: a) obtaining or having obtained a fixed tissue sample, said tissue sample comprising DNA, non-RNA molecules, and RNA, said RNA comprising a target of interest; b) permeabilizing the tissue sample; c) substantially degrading the DNA within the tissue sample, thereby forming a hydrogel within the tissue sample.
32. 32. The method of claim 31, wherein the non-RNA molecule is a protein and the protein present in the tissue sample is cross-linked.
33. 32. The method of claim 31 , wherein the tissue sample is preserved prior to step a).
34. 34. The method of claim 33, wherein the method comprises preserving the tissue sample using a chemical crosslinking agent.
35. 35. The method of claim 34, wherein the cross-linking agent is formaldehyde, glutaraldehyde, or a combination thereof.
36. 32. The method of claim 31, wherein the tissue sample has a thickness of about 20 μm to 800 μm.