Compositions of dry powder formulations of messenger RNA and methods of use thereof

JP2025538523APending Publication Date: 2025-11-28TRANSLATE BIO INC
View PDF -1 Cites -1 Cited by

Patent Information

Application Number
JP2025529222
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-21
Filing Date
2023-11-20
Publication Date
2025-11-28
Patent Text Reader

Abstract

The present disclosure provides stable dry powder messenger RNA formulations for therapeutic use and methods of making and using same.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 384,553, filed November 21, 2022, the entire contents of which are incorporated herein by reference in their entirety.

[0002] Submission of sequence listing The Sequence Listing associated with this application has been submitted electronically as an XML file and is incorporated herein by reference in its entirety. The name of the XML file containing the Sequence Listing is 0171_0103_PCT_SL.xml, and the size of the XML file is 3,985 bytes. [Background technology]

[0003] Messenger RNA therapy (MRT) is becoming an increasingly important approach for the treatment of various diseases. Lipid-encapsulated mRNA formulations, such as lipid nanoparticle (LNP) compositions, demonstrate high cellular uptake and protein expression. However, currently, these formulations are typically in liquid form and usually need to be administered in the form of an injection or via a nebulizer. These modes of administration are less desirable for patients than some less invasive routes, such as metered-dose inhalers. Lyophilized formulations may not provide reliable particle uniformity in the dry state or ease of handling and dispensing. Lyophilized powders must be dissolved in an appropriate solvent before dispensing to patients and can undergo degradation within hours. Repeated freeze-thawing of mRNA preparations is not recommended due to the potential instability of the mRNA and / or LNPs. Summary of the Invention [Means for solving the problem]

[0004] The present disclosure provides, among other things, dry powder (e.g., spray-dried) formulations of mRNA encapsulated in lipid-based nanoparticles for more efficient mRNA delivery and more effective mRNA therapeutics. The particle size of mRNA-LNP formulations can be important for dry powder-based delivery of mRNA formulations. mRNA-LNP formulations produced by spray drying often produce particles larger than 10 μm, which are not conducive to delivery to some tissues, such as the lungs. By optimizing processing parameters and LNP composition and using different solvent and excipient combinations, spray drying techniques can be used to produce mRNA-LNP dry powder products with ideal particle size ranges and desired surface properties. Provided herein are compositions containing specific ratios of hydrophobic amino acids and / or sugar alcohols in mRNA-LNP formulations that can provide fine dry powder particles containing mRNA-loaded lipid nanoparticles. Such particles may be suitable for several delivery methods, such as inhalation, without significantly affecting the yield or stability of the mRNA. Furthermore, the present disclosure relates to the desired in vitro and in vivo efficacy of dry powder products with minimal inflammatory response.

[0005] In some aspects, the present disclosure relates to a dry powder formulation comprising messenger RNA encapsulated in lipid nanoparticles (LNPs), wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids, wherein the dry powder formulation comprises leucine and mannitol in a weight ratio of 1:1 to 1:10, and wherein the dry powder formulation has an average particle size of 1 to 8 μm. In some embodiments, the average particle size is 2 μm. In some embodiments, the average particle size is 3 μm. In some embodiments, the average particle size is 4 μm. In some embodiments, the average particle size is 5 μm. In some embodiments, the average particle size is 6 μm. In some embodiments, the average particle size is 7 μm.

[0006] In some embodiments, the dry powder formulation comprises leucine and mannitol in a 1:2 weight ratio. In some embodiments, the dry powder formulation comprises leucine and mannitol in a 1:3 weight ratio. In some embodiments, the dry powder formulation comprises leucine and mannitol in a 1:4 weight ratio. In some embodiments, the dry powder formulation comprises leucine and mannitol in a 1:5 weight ratio. In some embodiments, the dry powder formulation comprises leucine and mannitol in a 1:6 weight ratio. In some embodiments, the dry powder formulation comprises leucine and mannitol in a 1:7 weight ratio. In some embodiments, the dry powder formulation comprises leucine and mannitol in a 1:8 weight ratio. In some embodiments, the dry powder formulation comprises leucine and mannitol in a 1:9 weight ratio.

[0007] In some embodiments, the weight ratio of leucine to mannitol is 1:8.

[0008] In some embodiments, the weight ratio of leucine to mannitol is 1:4.

[0009] In some aspects, the disclosure relates to messenger RNA encapsulated in lipid nanoparticles (LNPs), the LNPs comprising one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids, wherein the dry powder formulation comprises a hydrophobic amino acid at a concentration of 4-65%, and the dry powder formulation has an average particle size of 1-8 μm. In some embodiments, the dry powder formulation comprises a hydrophobic amino acid at a concentration of 10%-50%. In some embodiments, the dry powder formulation has an average particle size of 2-6 μm. In some embodiments, the average particle size of the dry powder formulation is 2 μm. In some embodiments, the average particle size of the dry powder formulation is 3 μm. In some embodiments, the average particle size of the dry powder formulation is 4 μm. In some embodiments, the average particle size of the dry powder formulation is 5 μm. In some embodiments, the average particle size of the dry powder formulation is 6 μm.

[0010] In some embodiments, the hydrophobic amino acid is leucine, isoleucine, trileucine, proleucine, glycine, valine, phenylalanine, methionine, proline, or tryptophan, hi some embodiments, the hydrophobic amino acid is leucine.

[0011] In some embodiments, the dry powder formulation comprises lipid nanoparticles encapsulating mRNA, and the N / P ratio is between 2 and 6. In some embodiments, the dry powder formulation comprises lipid nanoparticles encapsulating mRNA, and the N / P ratio is between 3 and 4. In some embodiments, the dry powder formulation comprises lipid nanoparticles encapsulating mRNA, and the N / P ratio is 3.

[0012] In some embodiments, the dry powder formulation comprises one or more cholesterol-based lipids. In some embodiments, the dry powder formulation comprises a cationic lipid that comprises about 30-70% by mole of the total lipids in the LNP. In some embodiments, the dry powder formulation comprises a PEG-modified lipid that comprises about 1-15% by mole of the total lipids in the LNP. In some embodiments, the dry powder formulation comprises a non-cationic lipid that comprises about 10-40% by mole of the total lipids in the LNP. In some embodiments, the dry powder formulation comprises one or more cholesterol-based lipids that comprise about 5-40% by mole of the total lipids in the LNP.

[0013] In some embodiments, the dry powder formulation has a molar ratio of cationic lipid to non-cationic lipid to cholesterol-based lipid to PEG-modified lipid in the lipid nanoparticle of about 60:25:10:5, hi some embodiments, a molar ratio of cationic lipid to non-cationic lipid to cholesterol-based lipid to PEG-modified lipid in the lipid nanoparticle of about 40:25:30:5.

[0014] In some embodiments, the dry powder formulation comprises an average particle size of 1-5 μm, hi some embodiments, the dry powder formulation comprises an average particle size of 1-3 μm.

[0015] In some embodiments, the dry powder formulation comprises mRNA that constitutes more than 2% by weight of the dry powder formulation. In some embodiments, the dry powder formulation comprises mRNA that constitutes more than 3% by weight of the dry powder formulation. In some embodiments, the dry powder formulation comprises mRNA that constitutes more than 4% by weight of the dry powder formulation.

[0016] In some embodiments, the dry powder formulation has an encapsulation rate of greater than 60% lipid nanoparticles, in some embodiments, the dry powder formulation has an encapsulation rate of greater than 70% lipid nanoparticles, in some embodiments, the dry powder formulation has an encapsulation rate of greater than 80% lipid nanoparticles.

[0017] In some embodiments, the mRNA in the dry powder formulation maintains 80% or more integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains 90% or more integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains 95% or more integrity after spray drying.

[0018] In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at room temperature for 6 months or more. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at room temperature for 6 months or more. In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at 4°C for 6 months or more. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at 4°C for 6 months or more. In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at 25°C for 4 weeks or more. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at 25°C for 4 weeks or more. In some embodiments, the dry powder formulation maintains 95% or greater mRNA integrity after storage at 25°C for 4 weeks or more.

[0019] In some embodiments, the dry powder formulation has a moisture content of less than 0.5%. In some embodiments, the dry powder formulation has a moisture content of less than 0.4%. In some embodiments, the dry powder formulation has a moisture content of less than 0.3%. In some embodiments, the dry powder formulation has a moisture content of less than 0.2%. In some embodiments, the dry powder formulation has a moisture content of less than 0.1%.

[0020] In some embodiments, the dry powder formulation comprises mRNA encoding a therapeutic protein. In some embodiments, the mRNA encodes an antigen. In some embodiments, the mRNA encodes a vaccine. In some embodiments, the dry powder formulation is inhalable. In some embodiments, the dry powder formulation is nebulizable upon reconstitution.

[0021] In some aspects, the present disclosure includes a method of delivering mRNA in vivo, comprising administering to a subject in need thereof a dry powder formulation according to any of the embodiments disclosed herein. In some embodiments, the present disclosure includes a method of administering a dry powder formulation by inhalation. In some embodiments, the present disclosure includes a method of administering any of the dry powder formulations disclosed herein by intranasal spray. In some embodiments, the present disclosure provides a method of administering any of the dry powder formulations disclosed herein by inhaler.

[0022] In some aspects, the disclosure includes methods of preparing a dry powder formulation, the methods comprising: a) providing a mixture comprising lipid nanoparticles encapsulating mRNA; b) adding leucine and mannitol to the mixture in a weight ratio of 1:1 to 1:10; c) spray-drying the mixture; and d) obtaining a dry powder formulation having an average particle size of 1 to 8 μm, wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the weight ratio of leucine to mannitol is 1:8. In some embodiments, the weight ratio of leucine to mannitol is 1:7. In some embodiments, the weight ratio of leucine to mannitol is 1:6. In some embodiments, the weight ratio of leucine to mannitol is 1:5. In some embodiments, the weight ratio of leucine to mannitol is 1:4.

[0023] In some aspects, the present disclosure includes a method for preparing a dry powder formulation, the method comprising: a) providing a mixture containing lipid nanoparticles encapsulating mRNA; b) adding a hydrophobic amino acid to the mixture at a concentration of 4.0-65%; c) spray-drying the mixture; and d) obtaining the dry powder formulation having an average particle size of 1-8 μm, wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the hydrophobic amino acid is leucine, isoleucine, valine, phenylalanine, methionine, proline, or tryptophan. In some embodiments, the hydrophobic amino acid is leucine. In some embodiments, the method further comprises adding 20% ​​ethanol to the mixture.

[0024] In some embodiments, the spray drying process is carried out at a temperature of less than 90° C. In some embodiments, the spray drying process is carried out at a temperature of 20-70° C.

[0025] In some embodiments, lipid nanoparticles encapsulating mRNA have an N / P ratio of 2 to 6. In some embodiments, lipid nanoparticles encapsulating mRNA have an N / P ratio of 3 to 4. In some embodiments, lipid nanoparticles encapsulating mRNA have an N / P ratio of 2. In some embodiments, lipid nanoparticles encapsulating mRNA have an N / P ratio of 3. In some embodiments, lipid nanoparticles encapsulating mRNA have an N / P ratio of 4. In some embodiments, lipid nanoparticles encapsulating mRNA have an N / P ratio of 5. In some embodiments, lipid nanoparticles encapsulating mRNA have an N / P ratio of 6.

[0026] In some embodiments, the lipid nanoparticles further comprise one or more cholesterol-based lipids. In some embodiments, the lipid nanoparticles further comprise one or more cationic lipids that comprise about 30-70% by mole of the total lipids in the LNP. In some embodiments, the lipid nanoparticles further comprise one or more PEG-modified lipids that comprise about 1-15% by mole of the total lipids in the LNP. In some embodiments, the lipid nanoparticles further comprise one or more non-cationic lipids that comprise about 10-40% by mole of the total lipids in the LNP. In some embodiments, the lipid nanoparticles further comprise one or more cholesterol-based lipids that comprise about 5-40% by mole of the total lipids in the LNP.

[0027] In some embodiments, the method comprises providing a molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids in the lipid nanoparticles of about 60:25:10:5, hi some embodiments, the method comprises providing a molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids in the lipid nanoparticles of about 40:25:30:5.

[0028] In some embodiments, the average particle size is 1-5 μm. In some embodiments, the average particle size is 1-3 μm. In some embodiments, the average particle size is 3 μm. In some embodiments, the average particle size is 2 μm.

[0029] In some embodiments, the mRNA comprises more than 2% by weight of the dry powder formulation. In some embodiments, the mRNA comprises more than 3% by weight of the dry powder formulation. In some embodiments, the mRNA comprises more than 4% by weight of the dry powder formulation.

[0030] In some embodiments, the encapsulation rate of the lipid nanoparticles is greater than 50%. In some embodiments, the encapsulation rate of the lipid nanoparticles is greater than 60%. In some embodiments, the encapsulation rate of the lipid nanoparticles is greater than 70%. In some embodiments, the encapsulation rate of the lipid nanoparticles is greater than 80%. In some embodiments, the encapsulation rate of the lipid nanoparticles is greater than 90%.

[0031] In some embodiments, the mRNA in the dry powder formulation maintains 80% or more integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains 90% or more integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains 95% or more integrity after spray drying.

[0032] In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at room temperature for 6 months or more. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at room temperature for 6 months or more. In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at 4°C for 6 months or more. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at 4°C for 6 months or more. In some embodiments, the dry powder formulation maintains 80% or greater mRNA integrity after storage at 25°C for 4 weeks or more. In some embodiments, the dry powder formulation maintains 90% or greater mRNA integrity after storage at 25°C for 4 weeks or more. In some embodiments, the dry powder formulation maintains 95% or greater mRNA integrity after storage at 25°C for 4 weeks or more.

[0033] In some embodiments, the dry powder formulation has a moisture content of less than 0.5%. In some embodiments, the dry powder formulation has a moisture content of less than 0.4%. In some embodiments, the dry powder formulation has a moisture content of less than 0.3%. In some embodiments, the dry powder formulation has a moisture content of less than 0.2%. In some embodiments, the dry powder formulation has a moisture content of less than 0.1%.

[0034] In some embodiments, the dry powder formulation comprises mRNA encoding a therapeutic protein. In some embodiments, the mRNA encodes an antigen. In some embodiments, the mRNA encodes a vaccine. [Brief explanation of the drawings]

[0035] [Figure 1] FIG. 1 is a schematic diagram of the spray drying process in a typical spray drying chamber. [Figure 2A-2B] 2A and 2B are bar graphs showing mRNA weight percent (FIG. 2A), mRNA powder yield (FIG. 2B), mRNA encapsulation efficiency (FIG. 2C), and powder size (FIG. 2D) after spray drying at different leucine and / or mannitol concentrations with lipid 1. [Figures 2C-2D] 2A and 2B are bar graphs showing mRNA weight percent (FIG. 2A), mRNA powder yield (FIG. 2B), mRNA encapsulation efficiency (FIG. 2C), and powder size (FIG. 2D) after spray drying at different leucine and / or mannitol concentrations with lipid 1. [Figure 3A-3B] 3A-3D are bar graphs showing mRNA weight percent (FIG. 3A), mRNA powder yield (FIG. 3B), mRNA efficiency (FIG. 3C), and powder size (FIG. 3D) after spray-drying encapsulation with lipid 3 at different leucine and / or mannitol concentrations. [Figure 3C-3D] 3A-3D are bar graphs showing mRNA weight percent (FIG. 3A), mRNA powder yield (FIG. 3B), mRNA efficiency (FIG. 3C), and powder size (FIG. 3D) after spray-drying encapsulation with lipid 3 at different leucine and / or mannitol concentrations. [Figure 4A-4B]The effect of lipid content on dry powder product properties: yield in the collection vessel (Figure 4A), mean particle size of the dry powder product (Figure 4B), mRNA encapsulation (Figure 4C), and percent mRNA by weight in the dry powder product (Figure 4D) are shown. [Figure 4C-4D] The effect of lipid content on dry powder product properties: yield in the collection vessel (Figure 4A), mean particle size of the dry powder product (Figure 4B), mRNA encapsulation (Figure 4C), and percent mRNA by weight in the dry powder product (Figure 4D) are shown. [Figure 5A-5B] Figure 5A shows several SEM images of representative dry powder products produced using the lipid l-mannitol with only the N / P4 regular LNP composition (Figure 5A), leucine with only the N / P4 regular LNP composition (Figure 5B), leucine with only the N / P3 regular LNP composition (Figure 5C), leucine with only the N / P4 modified LNP composition (Figure 5D), a mannitol / leucine combination with the N / P4 regular LNP composition (Figure 5E), a mannitol / leucine combination with the N / P4 regular LNP composition after prolonged exposure (Figure 5F), and a cross-section of DPP containing a mannitol / leucine combination with the N / P4 regular LNP composition (Figure 5G). [Figure 5C-5D] Figure 5A shows several SEM images of representative dry powder products produced using the lipid l-mannitol with only the N / P4 regular LNP composition (Figure 5A), leucine with only the N / P4 regular LNP composition (Figure 5B), leucine with only the N / P3 regular LNP composition (Figure 5C), leucine with only the N / P4 modified LNP composition (Figure 5D), a mannitol / leucine combination with the N / P4 regular LNP composition (Figure 5E), a mannitol / leucine combination with the N / P4 regular LNP composition after prolonged exposure (Figure 5F), and a cross-section of DPP containing a mannitol / leucine combination with the N / P4 regular LNP composition (Figure 5G). [Figures 5E-5F]Figure 5A shows several SEM images of representative dry powder products produced using the lipid l-mannitol with only the N / P4 regular LNP composition (Figure 5A), leucine with only the N / P4 regular LNP composition (Figure 5B), leucine with only the N / P3 regular LNP composition (Figure 5C), leucine with only the N / P4 modified LNP composition (Figure 5D), a mannitol / leucine combination with the N / P4 regular LNP composition (Figure 5E), a mannitol / leucine combination with the N / P4 regular LNP composition after prolonged exposure (Figure 5F), and a cross-section of DPP containing a mannitol / leucine combination with the N / P4 regular LNP composition (Figure 5G). [Figure 5G] Figure 5A shows several SEM images of representative dry powder products produced using the lipid l-mannitol with only the N / P4 regular LNP composition (Figure 5A), leucine with only the N / P4 regular LNP composition (Figure 5B), leucine with only the N / P3 regular LNP composition (Figure 5C), leucine with only the N / P4 modified LNP composition (Figure 5D), a mannitol / leucine combination with the N / P4 regular LNP composition (Figure 5E), a mannitol / leucine combination with the N / P4 regular LNP composition after prolonged exposure (Figure 5F), and a cross-section of DPP containing a mannitol / leucine combination with the N / P4 regular LNP composition (Figure 5G). [Figure 6A] Figure 6 shows the in vitro transfection characteristics of the dry powder products. Figure 6A shows the normalized relative luminescence units of HEK293 cells transfected with mRNA encapsulated in lipids 1, 2, and 3 in the presence of leucine, mannitol, or both at various N / P ratios. Figure 6B shows the normalized relative luminescence units of in vitro FFL expression in HEK-293 cells for various dry powder product samples from independent experiments. Figure 6C shows the dose-dependent efficacy of the number of cells expressing mCherry, and Figure 6D shows the amount of mCherry expressed by the cells. [Figure 6B]Figure 6 shows the in vitro transfection characteristics of the dry powder products. Figure 6A shows the normalized relative luminescence units of HEK293 cells transfected with mRNA encapsulated in lipids 1, 2, and 3 in the presence of leucine, mannitol, or both at various N / P ratios. Figure 6B shows the normalized relative luminescence units of in vitro FFL expression in HEK-293 cells for various dry powder product samples from independent experiments. Figure 6C shows the dose-dependent efficacy of the number of cells expressing mCherry, and Figure 6D shows the amount of mCherry expressed by the cells. [Figure 6C-6D] Figure 6 shows the in vitro transfection characteristics of the dry powder products. Figure 6A shows the normalized relative luminescence units of HEK293 cells transfected with mRNA encapsulated in lipids 1, 2, and 3 in the presence of leucine, mannitol, or both at various N / P ratios. Figure 6B shows the normalized relative luminescence units of in vitro FFL expression in HEK-293 cells for various dry powder product samples from independent experiments. Figure 6C shows the dose-dependent efficacy of the number of cells expressing mCherry, and Figure 6D shows the amount of mCherry expressed by the cells. [Figure 7A] Chromatograms assessing the integrity of mRNA extracted from dry powder (FIG. 7A) and mRNA standards (FIG. 7B). [Figure 7B] Chromatograms assessing the integrity of mRNA extracted from dry powder (FIG. 7A) and mRNA standards (FIG. 7B). [Figure 8A] Figure 8 shows transfection of the respiratory system in mice with the dry powder product after 24 hours. Figure 8A shows luminescence after IVIS imaging of the trachea and lungs showing FFL bioluminescence. Figure 8B shows a plot of the mean radiance of FFL bioluminescence measured from the trachea and lungs. Figure 8C shows TNF-α levels. [Figure 8B]Figure 8 shows transfection of the respiratory system in mice with the dry powder product after 24 hours. Figure 8A shows luminescence after IVIS imaging of the trachea and lungs showing FFL bioluminescence. Figure 8B shows a plot of the mean radiance of FFL bioluminescence measured from the trachea and lungs. Figure 8C shows TNF-α levels. [Figure 8C] Figure 8 shows transfection of the respiratory system in mice with the dry powder product after 24 hours. Figure 8A shows luminescence after IVIS imaging of the trachea and lungs showing FFL bioluminescence. Figure 8B shows a plot of the mean radiance of FFL bioluminescence measured from the trachea and lungs. Figure 8C shows TNF-α levels. [Figure 9] 1 shows the change in mRNA integrity of the dry powder formulation compared to the liquid formulation at accelerated thermal stability at 25° C. DETAILED DESCRIPTION OF THE INVENTION

[0036] definition In order that this disclosure may be more readily understood, certain terms are first defined below. Further definitions for these terms and other terms are set forth throughout the specification. Publications and other reference materials mentioned herein to describe the background of the disclosure and to provide additional details regarding its practice are incorporated herein by reference.

[0037] Approximately or About: As used herein, the term "approximately" or "about" as applied to one or more values ​​of interest refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction of (greater than or less than) the stated reference value, unless otherwise specified or clear from the context (except where such number exceeds 100% of a possible value).

[0038] Delivery: As used herein, the term "delivery" encompasses both local and systemic delivery. For example, delivery of mRNA encompasses situations in which the mRNA is delivered to a target tissue, the encoded protein is expressed, and the protein is retained within the target tissue (also referred to as "local distribution" or "local delivery"), and situations in which the mRNA is delivered to a target tissue, the encoded protein is expressed, secreted into the patient's circulatory system (e.g., serum), distributed systemically, and absorbed by other tissues (also referred to as "systemic distribution" or "systemic delivery"). In some embodiments, delivery is pulmonary delivery, including, for example, nebulization.

[0039] Embodiments: As used herein, the terms "in some embodiments," "in certain embodiments," "in other embodiments," "in some other embodiments," and the like refer to embodiments of all aspects of the present disclosure unless the context clearly dictates otherwise.

[0040] Encapsulation: As used herein, the term "encapsulation" or its grammatical equivalents refers to the process of confining nucleic acid molecules within nanoparticles.

[0041] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into a polypeptide, the assembly of multiple polypeptides (e.g., antibody heavy or light chains) into an intact protein (e.g., an antibody), and / or the post-translational modification of a polypeptide or fully assembled protein (e.g., an antibody). In this disclosure, the terms "expression" and "production" and their grammatical equivalents are used interchangeably.

[0042] Functional: As used herein, a "functional" biomolecule is a biomolecule in a form in which it exhibits a property and / or activity by which it is characterized.

[0043] Half-life: As used herein, the term "half-life" is the time required for a quantity, such as the concentration or activity of a nucleic acid or protein, to fall to half of its initially measured value over a period of time.

[0044] Improve, increase, or decrease: As used herein, the terms "improve," "increase," or "reduce," or grammatical equivalents, refer to a value relative to a baseline measurement, such as a measurement in the same individual prior to the initiation of a treatment described herein, or a measurement in a control subject (or subjects) not receiving a treatment described herein. A "control subject" is a subject suffering from the same form of disease as the subject under treatment, and who is approximately the same age as the subject under treatment.

[0045] In vitro: As used herein, the term "in vitro" refers to events that take place not inside a multicellular organism, but rather in an artificial environment, such as in a test tube or reaction vessel, in cell culture, etc.

[0046] In vivo: As used herein, the term "in vivo" refers to events that occur within multicellular organisms, such as humans and non-human animals. In the context of cell-based systems, the term may be used to refer to events that occur within living cells (as opposed to, e.g., in vitro systems).

[0047] Isolated: As used herein, the term "isolated" refers to substances and / or entities that (1) have been separated from at least some of the components with which they are associated when originally produced (whether in nature and / or in an experimental setting), and / or (2) have been produced, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities can be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they are originally associated. In some embodiments, the isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, calculations of percent purity of an isolated substance and / or entity should not include excipients (e.g., buffers, solvents, water, etc.).

[0048] Median Mass Aerodynamic Diameter: As used herein, the term "median mass aerodynamic diameter" or "MMAD" or "aerodynamic diameter" refers to half of the total aerosol mass. In some embodiments, the MMAD of a particle is about 1 μm to about 5 μm, or any subrange therebetween. In some embodiments, the MMAD of a particle is about 2 μm. In some embodiments, the MMAD of a particle is about 3 μm. In some embodiments, the MMAD of a particle is about 4 μm. In some embodiments, the MMAD of a particle is about 5 μm. Experimentally, aerodynamic diameter can be determined using gravitational settling, whereby the settling time of a set of particles over a specific distance is used to directly estimate the aerodynamic diameter of the particles. An indirect method for measuring median mass aerodynamic diameter (MMA) is the multi-stage liquid impactor (MSLI). Aerodynamic diameter d aer can be calculated from the following formula: d aer =d g ×√ρTAP where dg where ρ is the geometric diameter, e.g., MMGD, and ρ is the tapped bulk density. Particles having a tapped density of less than about 0.4 g / cm, a median diameter of at least about 1 μm, e.g., at least about 5 μm, and an aerodynamic diameter of about 2 μm to about 4 μm, preferably less than about 5 μm, can escape inertial and gravitational deposition in the oropharyngeal region and target the airways, particularly the deep lung.

[0049] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA can contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems, optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, mRNA can include nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, etc. The mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated.

[0050] N / P ratio: As used herein, the term "N / P ratio" refers to the molar ratio of the positively charged molecular units in the cationic lipids in lipid nanoparticles to the negatively charged molecular units in the mRNA encapsulated in lipid nanoparticles.Therefore, N / P ratio is usually calculated as the mole ratio of the amine groups in the cationic lipids in lipid nanoparticles to the moles of phosphate groups in the mRNA encapsulated in lipid nanoparticles.

[0051] Nucleic Acid: As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, "nucleic acid" encompasses RNA and single- and / or double-stranded DNA and / or cDNA. Furthermore, the terms "nucleic acid," "DNA," "RNA," and / or similar terms include nucleic acid analogs, i.e., analogs having other than a phosphodiester backbone. For example, so-called "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present disclosure. The term "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and / or encode the same amino acid sequence. Nucleotide sequences encoding proteins and / or RNA may contain introns. Nucleic acids can be purified from natural sources, produced using recombinant expression systems, optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can include nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, etc. Unless otherwise specified, nucleic acid sequences are presented in the 5' to 3' direction.In some embodiments, nucleic acids are selected from natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5 The nucleic acid may be or contain: -propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages). In some embodiments, the present disclosure relates to "unmodified nucleic acids," which specifically refer to nucleic acids (e.g., polynucleotides and residues comprising nucleotides and / or nucleosides) that have not been chemically modified to facilitate or achieve delivery. In some embodiments, the nucleotides T and U are used interchangeably in describing sequences.

[0052] Patient: As used herein, the term "patient" or "subject" refers to any organism to which provided compositions can be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In certain embodiments, the patient is a human. Human includes prenatal and postnatal forms.

[0053] Pharmaceutically acceptable: The term "pharmaceutically acceptable," as used herein, refers to a material that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable risk / benefit ratio.

[0054] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., a mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In some embodiments, a subject is a human. A subject may be a patient, which refers to a human who visits a health care provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may be one who is suffering from or susceptible to a disease or disorder, which may or may not be symptomatic.

[0055] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting the entire or nearly full extent or degree of a desired characteristic or property. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, proceed to completion and / or perfection or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of integrity inherent in many biological and chemical phenomena.

[0056] Treating: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment may be administered to a subject who does not exhibit signs of the disease and / or who exhibits only early signs of the disease, with the intent of reducing the risk of developing morbidity associated with the disease.

[0057] The present disclosure provides, inter alia, dry powder (e.g., spray-dried) formulations of mRNA encapsulated in lipid-based nanoparticles. The dry powder formulations described herein may contain a certain amount of hydrophobic amino acids (e.g., mannitol and / or leucine) and may be useful for improving mRNA delivery and mRNA therapy. For example, the dry powder formulations described herein may have useful powder sizes, mRNA encapsulation efficiencies, and powder yields. The present disclosure also provides methods of using the formulations described herein and kits containing the formulations described herein.

[0058] Various exemplary aspects and embodiments of the present disclosure are described in detail in the following sections. The use of sections is not meant to limit the disclosure. Each section may be applicable to any aspect of the present disclosure. As used herein, the use of "or" means "and / or" unless otherwise stated.

[0059] In some aspects, the disclosure features a dry powder formulation including messenger RNA encapsulated in lipid nanoparticles (LNPs), where the lipid nanoparticles include one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the formulation includes a hydrophobic amino acid (e.g., leucine) at a concentration of 4-65% w / w. In some embodiments, the formulation includes a hydrophobic amino acid (e.g., leucine) and a sugar (e.g., a sugar alcohol such as mannitol) at a weight ratio of 1:1 to 1:10. In some embodiments, the dry powder formulation has an average particle size of 1-8 μm.

[0060] In another aspect, the disclosure features a method for preparing the dry powder formulation described herein. In some embodiments, the method includes providing a mixture containing lipid nanoparticles encapsulating mRNA, adding a hydrophobic amino acid (e.g., leucine) to the mixture at a concentration of 4-65% w / w, and spray-drying the mixture. In some embodiments, a dry powder formulation having an average particle size of 1-8 μm is obtained. In some embodiments, the lipid nanoparticles include one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.

[0061] A dry powder formulation comprising an amino acid and / or a sugar. The present disclosure provides stable dry powder formulations containing mRNA-loaded lipid nanoparticles (mRNA-LNPs) for therapeutic use. In some embodiments, the dry powders include excipients to enhance yield, optimal powder size, and / or optimal N:P ratio. In some embodiments, the dry powder formulations described herein include specific compounds such as amino acids, e.g., tryptophan, lysine, methionine, trileucine, proleucine, phenylalanine, threonine, valine, leucine, isoleucine, arginine, tyrosine, glycine, serine, glutamic acid, aspartic acid, taurine, cysteine, histidine, proline, alanine, and creatinine. In some embodiments, the dry powder formulations described herein include specific compounds, such as amino acids (e.g., hydrophobic amino acids such as leucine, trileucine, and proleucine) and / or sugars (e.g., sugar alcohols such as mannitol), which may be useful for increasing yield, reducing powder size, and / or improving the N:P ratio of the mRNA-lipid nanoparticle product formulation. In certain embodiments, the dry powder formulation comprises a combination of an amino acid (eg, leucine, trileucine, proleucine) and a sugar (eg, mannitol).

[0062] In some embodiments, the lipid nanoparticles described herein comprise one or more of cationic lipids, PEGylated lipids, non-cationic lipids, and cholesterol-based lipids. Non-limiting exemplary lipids are described herein.

[0063] In some embodiments, the dry powder formulation comprises lipid nanoparticles (LNPs) comprising leucine and mannitol in a weight-to-weight ratio of 0.1 to 3.0.

[0064] In some embodiments, the dry powder formulations described herein comprise one or more hydrophobic amino acids.

[0065] In some embodiments, the dry powder formulations described herein comprise at least one sugar.

[0066] In some embodiments, the sugar is selected from the group consisting of monosaccharides, disaccharides, polysaccharides, sugar alcohols, glucose, fructose, galactose, mannose, sorbose, lactose, sucrose, cellobiose, trehalose, raffinose, starch, dextran, maltodextrin, cyclodextrin, inulin, xylitol, sorbitol, lactitol, and mannitol, and combinations thereof. In some embodiments, the sugar is mannitol. In some embodiments, the sugar is trehalose. In some embodiments, the sugar is sorbitol.

[0067] In some embodiments, sugars comprise less than 30%, 25%, 20%, 15%, 10%, or 5% of the total weight, including any value and subrange therebetween.

[0068] In some embodiments, the hydrophobic amino acid is selected from the group consisting of leucine, trileucine, proleucine, isoleucine, valine, phenylalanine, methionine, proline, and tryptophan, and combinations thereof. In some embodiments, the hydrophobic amino acid is leucine. In some embodiments, the hydrophobic amino acid is isoleucine, trileucine, or proleucine. In some embodiments, the hydrophobic amino acid is valine. In some embodiments, the hydrophobic amino acid is phenylalanine. In some embodiments, the hydrophobic amino acid is methionine. In some embodiments, the hydrophobic amino acid is proline.

[0069] In some embodiments, the dry powder formulations described herein comprise (1) one or more hydrophobic amino acids and (2) at least one sugar.

[0070] In some embodiments, the dry powder formulation comprises an amino acid that is leucine and a sugar that is mannitol.

[0071] In some embodiments, the dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) in a weight ratio ranging from 1:1 to 1:10. In some embodiments, the dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) in a weight ratio ranging from 1:1 to 1:20. In some embodiments, the dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) in a weight ratio ranging from 1:3 to 1:9. In some embodiments, the dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) in a weight ratio ranging from 10:1 to 1:1. In some embodiments, the dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) in a weight ratio ranging from 20:1 to 1:1.

[0072] In some embodiments, the dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) in a weight ratio ranging from 1:3 to 1:9, hi some embodiments, the dry powder formulation comprises an amino acid (e.g., leucine) and a sugar (e.g., mannitol) in a weight ratio ranging from 1:4 to 1:8.

[0073] For example, in some embodiments, the weight ratio of amino acids to sugars (e.g., leucine and mannitol) is 1:4. In some embodiments, the weight ratio of amino acids to sugars (e.g., leucine and mannitol) is 1:8.

[0074] In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:1. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:0.5. In some embodiments, the dry powder formulation comprises leucine and mannitol in a weight ratio of about 1:2. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:3. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:4. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:5. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:6. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:7. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:8. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:9. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio of about 1:10. In some embodiments, the dry powder formulation comprises an amino acid and a sugar (e.g., leucine and mannitol) in a weight ratio greater than 1:10. In some embodiments, the amino acid is leucine and the sugar is mannitol.

[0075] N / P ratio of lipid nanoparticles In some embodiments, preparation of LNPs involves encapsulating mRNA lipids, which are added to an aqueous buffer containing mRNA at a specific nitrogen (lipid) to phosphate (nucleic acid) ratio (N / P ratio).

[0076] In some embodiments, the mRNA and lipids are combined with a pump system that maintains a constant lipid / mRNA (N / P) ratio throughout the process and also allows for easy scale-up.

[0077] In some embodiments, one or more LNPs encapsulating mRNA (also referred to as mRNA-loaded LNPs) have a lipid:mRNA (N / P) ratio ranging from 1 to 20, 1 to 15, 1 to 10, 2 to 8, 2 to 6, or 2 to 4. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 20. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 18. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 16. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 14. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 12. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 10. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 8. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 1 to 6. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 20. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 16. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 12. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 8. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 6. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 2 to 4. In some embodiments, the one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio in the range of 4-20.In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 16. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 14. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 12. In some embodiments, one or more mRNA-loaded lipid nanoparticles have a lipid:mRNA (N / P) ratio ranging from 4 to 10. In some embodiments, one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 2 or 4. In some embodiments, one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 2. In some embodiments, one or more mRNA-loaded LNPs have a lipid:mRNA (N / P) ratio of 4.

[0078] In some embodiments, the lipid nanoparticles encapsulating the mRNA have an N / P ratio of 2 to 6. In some embodiments, the N / P ratio is 3 to 4. In some embodiments, the N / P ratio is 3.

[0079] In some embodiments, the dry powder formulation comprises lipid nanoparticles added to the mRNA at an N:P ratio of about 1. In some embodiments, the dry powder formulation comprises lipid nanoparticles added to the mRNA at an N:P ratio of about 2. In some embodiments, the dry powder formulation comprises lipid nanoparticles added to the mRNA at an N:P ratio of about 3. In some embodiments, the dry powder formulation comprises lipid nanoparticles added to the mRNA at an N:P ratio of about 4. In some embodiments, the dry powder formulation comprises lipid nanoparticles added to the mRNA at an N:P ratio of about 5. In some embodiments, the dry powder formulation comprises lipid nanoparticles added to the mRNA at an N:P ratio of about 6. In some embodiments, the dry powder formulation comprises lipid nanoparticles added to the mRNA at an N:P ratio of about 7. In some embodiments, the dry powder formulation comprises lipid nanoparticles added to the mRNA at an N:P ratio of about 8.

[0080] Mass median aerodynamic diameter of dry powder particles In some embodiments, the median mass aerodynamic diameter is defined as the particle diameter at which half of the aerosol mass is contained in smaller particles and half is contained in larger particle diameters. Respirable dry particles or dry powders can be delivered by inhalation to the desired region of the respiratory tract as needed. It is known that particles with an aerodynamic diameter of about 1 micron to about 3 microns can be delivered to the deep lung. Larger aerodynamic diameters, for example, about 3 microns to about 5 microns, can be delivered to the central and upper respiratory tract. If the MMAD of individual particles is too large, for example, greater than 5 μm, the rate at which the powder deposits in the oral cavity increases.

[0081] In some embodiments, dry powder product particles in the 1-3 μm range exhibit the highest deposition in the central and peripheral airways, resulting in sedimentation and subsequent absorption, while particles below 1 μm and above 5 μm are exhaled and swallowed, respectively. In some embodiments, properties such as bulk and tapped density, moisture content, rate of water absorption, flowability, and particle surface area also play a role in the flow of dry powder products in the respiratory tract.

[0082] Encapsulation efficiency In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 98% or greater (including any value and subrange therebetween). In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 70% or greater. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 75% or greater. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 80% or greater. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 85% or greater. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 90% or greater. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 92% or greater. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 94% or greater. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 96% or greater. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 95% or greater. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 96% or greater. In some embodiments, one or more mRNA-loaded lipid nanoparticles have an encapsulation efficiency of 98% or greater.

[0083] LNP size and size adjustment before spray drying Suitable mRNA-loaded lipid nanoparticles can be produced in a variety of sizes. In some embodiments, the size of the mRNA-loaded lipid nanoparticles before spray drying is determined by the length of the largest diameter of the lipid nanoparticles.

[0084] In some embodiments, the mRNA-loaded lipid nanoparticles have a pre-spray dried size of about 250 nm or less (e.g., about 250 nm, about 225 nm, about 200 nm, about 175 nm, about 150 nm, about 125 nm, about 100 nm, about 90 nm, about 80 nm, about 75 nm, about 70 nm, about 60 nm, about 50 nm, about 40 nm, about 30 nm, about 25 nm, about 20 nm, or about 10 nm or less (including any value and subrange therebetween)). In some embodiments, suitable liposomes have a size range of about 10 nm to about 250 nm (e.g., about 10 nm to about 225 nm, about 10 nm to about 200 nm, about 10 nm to about 175 nm, about 10 nm to about 150 nm, about 10 nm to about 125 nm, about 10 nm to about 100 nm, about 10 nm to about 75 nm, or about 10 nm to about 50 nm). In some embodiments, mRNA-loaded lipid nanoparticles have a pre-dry size range of about 100 nm to about 250 nm (e.g., about 100 nm to about 225 nm, about 100 nm to about 200 nm, about 100 nm to about 175 nm, or about 100 nm to about 150 nm). In some embodiments, the mRNA-loaded lipid nanoparticles have a pre-spray dry size in the range of about 10 nm to about 100 nm (e.g., in the range of about 10 nm to about 90 nm, about 10 nm to about 80 nm, about 10 nm to about 70 nm, about 10 nm to about 60 nm, or about 10 nm to about 50 nm). In certain embodiments, the mRNA-loaded lipid nanoparticles have a pre-spray dry size of less than about 100 nm.

[0085] Various alternative methods known in the art are available for sizing liposome populations. One such sizing method is described in U.S. Pat. No. 4,737,323, incorporated herein by reference. Sonication of a liposome suspension, either by bath sonication or probe sonication, results in a gradual size reduction down to small ULVs with diameters of less than about 0.05 microns. Homogenization is another method that relies on shearing energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, MLVs are recirculated through a standard emulsion homogenizer until a selected liposome size, typically about 0.1 to 0.5 microns, is observed. Liposome size can be determined by quasi-electric light scattering (QELS), as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981), incorporated herein by reference. The average liposome diameter can be reduced by sonication of the formed liposomes. Intermittent sonication cycles can be alternated with QELS assessment to guide efficient liposome synthesis.

[0086] Spray Drying Process Spray drying is a commonly used, economical, and well-established technique for producing dry powder products for various modalities, including small molecules, peptides, and proteins. This technique is continuous, scalable, suitable for heat-sensitive materials, capable of producing consistent dry powder products, and can be automated. Various sugars, such as lactose and mannitol, are commonly used as carrier excipients to facilitate the spray drying process. For example, in the compositions and processes described herein, the beneficial properties of mannitol as an excipient for spray drying of mRNA formulations include (i) its altering effect on the viscoelastic properties associated with sputum, (ii) its increased moisture content driven by an osmotic pressure gradient, (iii) its low hygroscopicity compared to some other sugars, such as lactose, and (iv) its lack of an aldehyde group as a non-reducing sugar. However, amino acids such as leucine, isoleucine, and trileucine have been utilized to enhance the dispersibility and reduce the MMAD of dry powder products. Although spray drying is continuous, scalable, suitable for heat-sensitive materials, and can produce consistent DPPs, there are minimal reports of excipient screening and optimization of the formulation properties and aerosol performance of spray-dried mRNA LNPs.

[0087] A variety of spray drying processes can be used to practice the present disclosure.

[0088] This process generally involves removing moisture from a liquid composition by passing it through an apparatus. A simplified schematic diagram is provided in Figure 1. Briefly, a liquid formulation containing the desired composition passes through a narrow inlet spray "atomizer" nozzle into the first chamber, a drying chamber. Typically, the liquid formulation passes through in a steady stream. The liquid formulation is sprayed into the drying chamber as small droplets. A stream of heated air or gas is also introduced into the drying chamber, forming an airflow. Passing the formulation through this heated current disperses the incoming droplets and dries them into solid particle form. This product is then introduced into the second chamber by flow through a connector or pipe. The second chamber is a cyclone powder collector. Here, air circulation generates a cyclone, and the powder particles are collected via a vortex flow in a collector attached to the outlet end. The cyclone chamber is attached to an exhaust fan, which helps cool the components. The inlet and outlet temperatures are operator adjustable. The respective inlet and outlet temperatures, chamber temperature, liquid feed flow rate (aspirator %), pressure, nature of the heated air stream and most importantly the composition of the liquid feed are adjusted appropriately for optimum drying of any particulate material.

[0089] In some embodiments, the inlet temperature is adjustable within a range of 40°C to 200°C. In some embodiments, the outlet temperature is in a range of 20°C to 70°C. The relative pressure of the pump and aspirator is also adjustable by the operator. In some embodiments, the inlet temperature was adjusted to 55°C. In some embodiments, the inlet temperature was adjusted to 60°C. In some embodiments, the intermediate temperature was adjusted to 61°C. In some embodiments, the intermediate temperature was adjusted to 62°C. In some embodiments, the intermediate temperature was adjusted to 63°C. In some embodiments, the intermediate temperature was adjusted to 64°C. In some embodiments, the intermediate temperature was adjusted to 65°C. In some embodiments, the intermediate temperature was adjusted to 70°C. In some embodiments, for spray drying of mRNA-lipid nanoparticles, the inlet temperature is adjusted to 70°C to 200°C. In some embodiments, the inlet temperature is adjusted to a range of 80°C to 200°C. In some embodiments, the inlet temperature is adjusted to a range of 90°C to 200°C. In some embodiments, the inlet temperature is adjusted to a range of 95°C to 180°C. In some embodiments, the inlet temperature is adjusted to a range of 95°C to 160°C. In some embodiments, the inlet temperature is adjusted to a range of 90°C to 150°C. In some embodiments, the inlet temperature is adjusted to a range of 90°C to 120°C. In some embodiments, the inlet temperature is adjusted to a range of 90°C to 100°C. In some embodiments, the inlet temperature is 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, or 100°C, including any value and subrange therebetween.

[0090] In some embodiments, the outlet temperature ranges from 20°C to 70°C. In some embodiments, the outlet temperature is from 30°C to 60°C. In some embodiments, the outlet temperature is from 20°C to 50°C. In some embodiments, the outlet temperature is from 30°C to 50°C. In some embodiments, the outlet temperature is from 40°C to 50°C. In some embodiments, the outlet temperature is from 45°C to 50°C.

[0091] Spray drying can be carried out using any suitable spray drying equipment. As known to those skilled in the art, a variety of spray drying equipment is commercially available and can be used to practice the present disclosure. Exemplary commercially available devices suitable for the present disclosure include, but are not limited to, the Mini Spray Dryer B-290; Nano Spray Dryer B-90 (manufactured by Buchi); Anhydro MicraSpray Dryer GMP; Anhydro MicraSpray Dryer Aseptic series (manufactured by SPX FLOW); MDL-50 and MDL-015 (manufactured by Fujisaki Electric); Versatile Mini Sprayer Dryer GAS410 (manufactured by Yamato Scientific America); LSD-1500 Mini spray dryer, MSD-8 Multi-functional laboratory spray dryer; PSD-12 Precision pharmacy spray dryer (manufactured by Changzhou Xiandao Drying Equipment Co. Ltd); TALL FORM DRYER™; Multi-Stage Dryer; COMPACT DRYER™; FILTERMAT™ Spray Dryer; VERSATILE-SD™; Fluidized Spray Dryer; MOBILE MINOR™; SDMICRO™; PRODUCTION MINOR™ (GEA Process Engineering) and many other products. Convenient scale-up from laboratory to industrial manufacturing scale is also available from some of these manufacturers.

[0092] dry powder The dry powders prepared according to the present disclosure contain a plurality of spray-dried particles. Residual moisture content, aerosol performance, and physiochemical stability are important parameters for spray-dried pharmaceuticals. This is determined by the sample weight loss after heating and drying using the following formula:

number

[0093] Generally, an acceptable particle size distribution is maintained to ensure uniformity of administration of the active pharmaceutical ingredient in the formulation. For example, therapeutic treatments for liver and lung diseases have been developed by delivering synthetic mRNA encoding defective and / or non-functional proteins to the corresponding organ cells via intravenous and inhalation routes, respectively. Particularly in the case of pulmonary delivery, the particles of dry powder formulations affect the distribution and deposition of aerosols within the respiratory system. In many cases, particle deposition in large conductive airways is preferred for effective absorption and distribution of therapeutic ingredients. Aerosols of very fine particles, e.g., particles with diameters less than 1 micrometer, can be deposited in the periphery for effective absorption by specific cells in the lungs, such as smooth muscle, for the active pharmaceutical ingredient to function as a bronchodilator.

[0094] In some embodiments, the dry powder formulation has an average particle size of 0.5 to 10 μm. In some embodiments, the dry powder formulation has an average particle size of 1 to 8 μm. In some embodiments, the dry powder formulation has an average particle size of 1 to 7 μm. In some embodiments, the dry powder formulation has an average particle size of 1 to 6 μm. In some embodiments, the dry powder formulation has an average particle size of 1 to 5 μm. In some embodiments, the dry powder formulation has an average particle size of 1 to 4 μm. In some embodiments, the dry powder formulation has an average particle size of 1 to 3 μm. In some embodiments, the dry powder formulation has an average particle size of 1 to 2 μm. In some embodiments, the dry powder formulation has an average particle size of 2 μm. In some embodiments, the dry powder formulation has an average particle size of 3 μm. In some embodiments, the dry powder formulation has an average particle size of 5 μm. In some embodiments, the dry powder formulation has an average particle size of 8 μm. In some embodiments, the dry powder formulation has an average particle size of 9 μm. In some embodiments, the dry powder formulation has an average particle size of 10 μm.

[0095] The primary particle size distribution of spray-dried particles is measured by dynamic light scattering and is expressed as the Z-average, also known as the cumulant size, calculated from the intensity-weighted distribution of particle sizes and is given by the following equation:

number

[0096] Polydispersity index (PDI), on the other hand, is a measure of the molecular weight distribution of a given microparticle sample. In some embodiments, the polydispersity index of glycerol and propylene glycol-based LNPs is less than 0.2. In some embodiments, the polydispersity index of glycerol and propylene glycol-based LNPs is about 0.1. In some embodiments, the polydispersity index of glycerol and propylene glycol-based LNPs is less than about 0.1.

[0097] mRNA In some embodiments, the mRNA comprises more than about 2% by weight of the dry powder formulation. In some embodiments, the mRNA comprises more than about 3% by weight of the dry powder formulation. In some embodiments, the mRNA comprises more than about 3% by weight of the dry powder formulation. In some embodiments, the mRNA comprises more than about 4% by weight of the dry powder formulation.

[0098] Dry powder formulations of mRNA of the present disclosure have been observed to have high stability even after short-term exposure of the LNPs to heat and stress during spray drying. In some embodiments, the mRNA in the dry powder formulation maintains greater than about 80% integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains greater than about 85% integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains greater than about 90% integrity after spray drying. In some embodiments, the mRNA in the dry powder formulation maintains greater than about 95% integrity after spray drying.

[0099] It is desirable that the integrity of the mRNA be maintained after multiple freeze-thaw cycles and / or over extended periods of time to maintain therapeutic benefit. In some embodiments, the mRNA maintains 80% or greater integrity after storage at room temperature for 6 months or more. In some embodiments, the mRNA maintains 80% or greater integrity after storage at room temperature for 3 months or more. In some embodiments, the mRNA maintains 80% or greater integrity after storage at room temperature for 1 year or more. In some embodiments, the mRNA maintains 90% or greater integrity after storage at room temperature for 6 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after storage at room temperature for 3 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after storage at room temperature for 1 year or more.

[0100] In some embodiments, the mRNA maintains 80% or greater integrity after storage at 25°C for 4 weeks or more. In some embodiments, the mRNA maintains 80% or greater integrity after storage at 25°C for 3 months or more. In some embodiments, the mRNA maintains 80% or greater integrity after storage at 25°C for 6 months or more. In some embodiments, the mRNA maintains 80% or greater integrity after storage at 25°C for 1 year or more. In some embodiments, the mRNA maintains 85% or greater integrity after storage at 25°C for 4 weeks or more. In some embodiments, the mRNA maintains 85% or greater integrity after storage at 25°C for 3 months or more. In some embodiments, the mRNA maintains 85% or greater integrity after storage at 25°C for 6 months or more. In some embodiments, the mRNA maintains 85% or greater integrity after storage at 25°C for 1 year or more. In some embodiments, the mRNA maintains 90% or greater integrity after storage at 25°C for 4 weeks or more. In some embodiments, the mRNA maintains 90% or greater integrity after storage at 25°C for 3 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after storage at 25°C for 6 months or more. In some embodiments, the mRNA maintains 90% or greater integrity after storage at 25°C for 1 year or more. In some embodiments, the mRNA maintains 95% or greater integrity after storage at 25°C for 4 weeks or more. In some embodiments, the mRNA maintains 95% or greater integrity after storage at 25°C for 3 months or more. In some embodiments, the mRNA maintains 95% or greater integrity after storage at 25°C for 6 months or more. In some embodiments, the mRNA maintains 95% or greater integrity after storage at 25°C for 1 year or more.

[0101] In some embodiments, the mRNA maintains 80% or greater integrity after three freeze-thaw cycles and storage at -80° C. In some embodiments, the mRNA maintains 90% or greater integrity after three freeze-thaw cycles and storage at -80° C.

[0102] As used herein, the phrase "mRNA maintains at least x% integrity after storage" means that the integrity of the mRNA does not decrease by more than (100x)% after storage.

[0103] mRNA synthesis mRNA according to the present disclosure can be synthesized according to any of a variety of known methods. Various methods are described in published U.S. Patent Application Publication No. 2018 / 0258423, all of which are incorporated herein by reference, and can be used to practice the present invention. For example, mRNA according to the present disclosure can be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed on a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or an RNAse inhibitor. The exact conditions will vary depending on the specific application.

[0104] In some embodiments, a suitable mRNA sequence is an mRNA sequence that encodes a protein or peptide. In some embodiments, a suitable mRNA sequence is codon-optimized for efficient expression in human cells. In some embodiments, a suitable mRNA sequence is a naturally occurring or wild-type sequence. In some embodiments, a suitable mRNA sequence encodes a protein or peptide that contains one or more mutations in the amino acid sequence. Exemplary mRNA coding sequences and corresponding amino acid sequences are provided below. Exemplary construct designs for mRNA X-mRNA coding region-Y 5' and 3' UTR sequences X(5'UTR sequence) = [ka] Y(3'UTR sequence)= CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 2), or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 3)

[0105] The present disclosure can be used to deliver mRNAs of various lengths, in some embodiments, the present disclosure can be used to deliver in vitro synthesized mRNAs of about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, 20 kb, 30 kb, 40 kb, or 50 kb or more in length, including any value and subrange therebetween. In some embodiments, the present disclosure may be used to deliver in vitro synthesized mRNA ranging in length from about 1 to 20 kb, about 1 to 15 kb, about 1 to 10 kb, about 5 to 20 kb, about 5 to 15 kb, about 5 to 12 kb, about 5 to 10 kb, about 8 to 20 kb, or about 8 to 50 kb.

[0106] In some embodiments, for preparation of mRNA according to the present disclosure, a DNA template is transcribed in vitro. A suitable DNA template typically has a promoter for in vitro transcription, such as a T3, T7, or SP6 promoter, followed by the desired nucleotide sequence for the desired mRNA and a termination signal.

[0107] nucleotide Various naturally occurring or modified nucleotides can be used to generate mRNA according to the present disclosure. In some embodiments, mRNA is prepared using naturally occurring nucleosides (or unmodified nucleotides; e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deoxyuridine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-ur ... C-5 propynyl-uridine, C-5 propynyl-uridine, C-5 propynyl-uridine, C-5 propynyl-uridine, C-5 propynyl-uridine, C-5 propynyl-uridine, C-5 propynyl-uridine, C-5 propynyl-uridine The base may be or contain azaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine (e.g., N-1-methyl-pseudouridine), 2-thiouridine, and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).

[0108] In some embodiments, suitable mRNAs may contain backbone, sugar, and / or base modifications, such as modified nucleotides, modified purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), and modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, N6-isopenten ... 1-Adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl These may include, but are not limited to, N-uracil-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, beta-D-mannosyl-queosine, wybutoxosine, as well as phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine.The preparation of such analogs is known to those skilled in the art from, for example, U.S. Pat. Nos. 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530, and 5,700,642, the disclosures of which are incorporated by reference in their entirety.

[0109] In some embodiments, the mRNA comprises one or more non-standard nucleotide residues. Non-standard nucleotide residues may include, for example, 5-methyl-cytidine ("5mC"), pseudouridine ("yU"), and / or 2-thio-uridine ("2sU"). See, for example, U.S. Pat. No. 8,278,036 or WO 2011 / 012316 for a discussion of such residues and their incorporation into mRNA. The mRNA may be RNA, defined as RNA in which 25% of U residues are 2-thio-uridine and 25% of C residues are 5-methylcytidine. Teachings regarding the use of RNA are disclosed in U.S. Pat. App. Pub. No. 2012 / 0195936 and WO 2011 / 012316, both of which are incorporated herein by reference in their entireties. The presence of non-standard nucleotide residues may render the mRNA more stable and / or less immunogenic than a control mRNA having the same sequence but containing only standard residues. In further embodiments, the mRNA may contain one or more non-standard nucleotide residues selected from isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine cytosine, as well as combinations of these and other nucleobase modifications. Some embodiments may further include additional modifications to the furanose ring or nucleobase. Additional modifications may include, for example, sugar modifications or substitutions (e.g., one or more of 2'-O-alkyl modifications, locked nucleic acids (LNAs)). In some embodiments, the RNA may be complexed or hybridized with additional polynucleotides and / or peptide polynucleotides (PNAs). In some embodiments where the sugar modification is a 2'-O-alkyl modification, such modifications can include, but are not limited to, a 2'-deoxy-2'-fluoro modification, a 2'-O-methyl modification, a 2'-O-methoxyethyl modification, and a 2'-deoxy modification.In some embodiments, any of these modifications may be present in 0-100% of the nucleotides, for example, individually or in combination, greater than 0%, greater than 1%, greater than 10%, greater than 25%, greater than 50%, greater than 75%, greater than 85%, greater than 90%, greater than 95%, or greater than 100% of the component nucleotides.

[0110] In some embodiments, mRNA may contain RNA backbone modification.Normally, backbone modification is chemical modification of the backbone phosphate of the nucleotide contained in RNA.Exemplary backbone modifications generally include, but are not limited to, modifications from the group consisting of methyl phosphonate, methyl phosphoramidate, phosphoramidate, phosphorothioate (for example, cytidine 5'-O-(1-thiophosphate)), boranophosphate, positively charged guanidinium group, etc., which means that phosphodiester bond is replaced with other anionic group, cationic group or neutral group.

[0111] In some embodiments, the mRNA may contain sugar modifications. Typical sugar modifications are chemical modifications of the sugar of the nucleotide, such as 2'-deoxy-2'-fluoro-oligoribonucleotide (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotide (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyloligoribonucleotide, 2'-deoxy-2'- The oligoribonucleotides may contain a sugar modification selected from the group consisting of, but not limited to, C-alkyl oligoribonucleotides (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-C-alkyl oligoribonucleotides and their isomers (2'-aracytidine 5'-triphosphate, 2'-arauidine 5'-triphosphate), or azidotriphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate).

[0112] Post-Synthesis Processing Typically, a 5' cap and / or 3' tail can be added post-synthetically. The presence of a cap is important to provide resistance to nucleases found in most eukaryotic cells. The presence of a "tail" helps protect the mRNA from exonuclease degradation.

[0113] A 5' cap is typically added as follows: First, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; subsequently, guanosine triphosphate (GTP) is added to the terminal phosphate by a guanylyltransferase to generate a 5'5'5 triphosphate linkage; subsequently, the 7-nitrogen of guanine is methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp(5'(A, G(5')ppp(5')A, and G(5')ppp(5')G. Additional cap structures are described in published U.S. Patent Application Publication Nos. 2016 / 0032356 and 2018 / 0125989, which are incorporated herein by reference.

[0114] Typically, the tail structure comprises a poly(A) and / or poly(C) tail. The poly-A or poly-C tail on the 3' end of the mRNA typically comprises at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 550 adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, at least 10 ... adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb of adenosine or cytosine nucleotides, including any value and subrange therebetween.In some embodiments, the polyA or polyC tail comprises about 10 to 800 adenosine or cytosine nucleotides, respectively (e.g., about 10 to 200 adenosine or cytosine nucleotides, about 10 to 300 adenosine or cytosine nucleotides, about 10 to 400 adenosine or cytosine nucleotides, about 10 to 500 adenosine or cytosine nucleotides, about 10 to 550 adenosine or cytosine nucleotides, about 10 to 600 adenosine or cytosine nucleotides, about 50 to 600 adenosine or cytosine nucleotides, about 100 to 600 adenosine or cytosine nucleotides, about 150 to 600 adenosine or cytosine nucleotides, about 20 The poly(A) tail structure may be 0-600 adenosine or cytosine nucleotides, about 250-600 adenosine or cytosine nucleotides, about 300-600 adenosine or cytosine nucleotides, about 350-600 adenosine or cytosine nucleotides, about 400-600 adenosine or cytosine nucleotides, about 450-600 adenosine or cytosine nucleotides, about 500-600 adenosine or cytosine nucleotides, about 10-150 adenosine or cytosine nucleotides, about 10-100 adenosine or cytosine nucleotides, about 20-70 adenosine or cytosine nucleotides, or about 20-60 adenosine or cytosine nucleotides. In some embodiments, the tail structure comprises a combination of poly(A) and poly(C) tails of various lengths as described herein. In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides, including any value and subrange therebetween. In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides, including any value and subrange therebetween.

[0115] As described herein, the addition of a 5' cap and / or a 3' tail facilitates the detection of aborted transcripts generated during in vitro synthesis, since, in the absence of capping and / or tailing, these aborted mRNA transcripts may be too small to be detected. Thus, in some embodiments, a 5' cap and / or a 3' tail is added to synthesized mRNA before the mRNA is tested for purity (e.g., the level of aborted transcript present in the mRNA). In some embodiments, a 5' cap and / or a 3' tail is added to synthesized mRNA before the mRNA is purified as described herein. In other embodiments, a 5' cap and / or a 3' tail is added to synthesized mRNA after the mRNA is purified as described herein.

[0116] mRNA synthesized according to the present disclosure may be used without further purification. In particular, mRNA synthesized according to the present disclosure may be used without a step of removing shortmers. In some embodiments, mRNA synthesized according to the present disclosure may be further purified. Various methods may be used to purify mRNA synthesized according to the present disclosure. For example, purification of mRNA may be carried out using centrifugation, filtration, and / or chromatography. In some embodiments, synthesized mRNA is purified by ethanol precipitation, filtration, chromatography, gel purification, or any other suitable means. In some embodiments, mRNA is purified by HPLC. In some embodiments, mRNA is extracted in a standard phenol:chloroform:isoamyl alcohol solution familiar to those skilled in the art. In some embodiments, mRNA is purified using tangential flow filtration. Suitable purification methods include those described in U.S. Patent Application Publication Nos. 2016 / 0040154, 2015 / 0376220, 2018 / 0251755, 2018 / 0251754, U.S. Provisional Patent Application Nos. 62 / 757,612 filed November 8, 2018, and 62 / 891,781 filed August 26, 2019, all of which are incorporated by reference herein and may be used to practice the present disclosure.

[0117] In some embodiments, the mRNA is purified before capping and tailing. In some embodiments, the mRNA is purified after capping and tailing. In some embodiments, the mRNA is purified both before and after capping and tailing.

[0118] In some embodiments, the mRNA is purified either before or after, or both, capping and tailing by centrifugation. In some embodiments, the mRNA is purified either before or after, or both, capping and tailing by filtration. In some embodiments, the mRNA is purified either before or after, or both, capping and tailing by tangential flow filtration (TFF). In some embodiments, the mRNA is purified either before or after, or both, capping and tailing by chromatography.

[0119] Additional fats In some embodiments, the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In some embodiments, the lipid nanoparticles further comprise one or more cholesterol-based lipids. In some embodiments, the one or more cationic lipids comprise about 30-70% by mole of the total lipids in the LNP. In some embodiments, the one or more PEG-modified lipids comprise about 1-15% by mole of the total lipids in the LNP. In some embodiments, the one or more non-cationic lipids comprise about 10-40% by mole of the total lipids in the LNP. In some embodiments, the one or more cholesterol-based lipids comprise about 5-40% by mole of the total lipids in the LNP.

[0120] In some embodiments, the molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids in the lipid nanoparticles is about 60:25:10:5, hi some embodiments, the molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids in the lipid nanoparticles is about 40:25:30:5.

[0121] Exemplary lipids are described herein.

[0122] cationic lipids As used herein, the phrase "cationic lipid" refers to any of several lipid species that have a net positive charge at a selected pH, such as physiological pH.

[0123] Suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in WO 2010 / 144740, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure comprise: [ka] and pharmaceutically acceptable salts thereof.

[0124] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include ionizable cationic lipids such as those described in WO 2013 / 149140, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise ionizable cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein R1 and R2 are each independently hydrogen, an optionally substituted undefined saturated or unsaturated C1-C 20 Alkyl and optionally substituted undefined saturated or unsaturated C6-C 20 acyl; L1 and L2 are each independently selected from the group consisting of hydrogen, optionally substituted C1-C 30 Alkyl, optionally substituted and unsaturated C1-C 30 Alkenyl and optionally substituted C1-C 30alkynyl, m and o are each independently selected from the group consisting of 0 and any positive integer (e.g., m is 3), and n is 0 or any positive integer (e.g., n is 1). In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12dien-1-yl)tetracosa-15,18dien-1-amine ("HGT5000") having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12dien-1-yl)tetracosa-4,15,18trien-1-amine ("HGT5001") having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure comprise a cationic lipid having the following compound structure and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12dien-1-yl)tetracosa-5,15,18trien-1-amine ("HGT5002"): [ka] and pharmaceutically acceptable salts thereof.

[0125] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids described as amino alcohol lipidoids in WO 2010 / 053572, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0126] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in WO 2016 / 118725, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0127] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in WO 2016 / 118724, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0128] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cationic lipids having the formula 14,25-ditridecyl 15,18,21,24-tetraaza-octatriacontane, and pharmaceutically acceptable salts thereof.

[0129] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those as described in WO 2013 / 063468 and WO 2016 / 205691, each of which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof (wherein RL Each example of is independently an optionally substituted C-C 40 In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0130] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in WO 2015 / 184256, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof (wherein each X is independently O or S, each Y is independently O or S, each m is independently 0 to 20, each n is independently 1 to 6, and each R Aare independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl or halogen, and each R B are independently hydrogen, optionally substituted C1-50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted C3-10 carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C6-14 aryl, optionally substituted 5-14 membered heteroaryl, or halogen. In certain embodiments, the compositions and methods of the present disclosure comprise [ka] and pharmaceutically acceptable salts thereof.

[0131] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in WO 2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise a cationic lipid having the compound structure: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure comprise a cationic lipid having the compound structure: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure comprise a cationic lipid having the compound structure: [ka] or a pharmaceutically acceptable salt thereof.

[0132] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in U.S. Provisional Patent Application No. 62 / 758,179, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof (wherein each R 1 and R 2 is independently H or a C1-C6 aliphatic group, each m is independently an integer having a value of 1 to 4, each A is independently a covalent bond or arylene, and each L 1 are independently an ester, thioester, disulfide, or anhydride group, and each L 2 are independently C2 to C 10 is aliphatic, and each X 1 is independently H or OH, and each R 3 are independently C6 to C 20 In some embodiments, the compositions and methods of the present disclosure include a cyclic alkyl group having the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof.

[0133] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those described in J. McClellan, MCKing, Cell 2010, 141, 210-217 and Whitehead et al., Nature Communications (2014) 5:4277, which are incorporated herein by reference. In certain embodiments, the cationic lipids of the compositions and methods of the present disclosure have the compound structure: [ka] or a pharmaceutically acceptable salt thereof.

[0134] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in WO 2015 / 199952, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise a cationic lipid having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0135] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in WO 2017 / 004143, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise a cationic lipid having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0136] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in WO 2017 / 075531, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof (wherein L 1 or L 2 One of the is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -or-NR a C(=O)O-, and L 1or L 2 The other is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -or-NR a C(=O)O- or a direct bond, and G 1 and G 2 are each independently an unsubstituted C-C 12 Alkylene or C1-C 12 alkenylene, G 3 is C1~C 24 Alkylene, C1-C 24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene, and R a is H or C1~C 12 alkyl, and R 1 and R 2 are independently C6 to C 24 Alkyl or C6-C 24 alkenyl, and R 3 H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 or -NR 5 C(=O)R 4 and R 4 is C1~C 12 alkyl, and R 5 is H or C1-C6 alkyl, and x is 0, 1, or 2).

[0137] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in WO 2017 / 117528, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise a cationic lipid having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] In some embodiments, the compositions and methods of the present disclosure include cationic lipids having the compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0138] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those cationic lipids as described in WO 2017 / 049245, which is incorporated herein by reference. In some embodiments, the cationic lipids of the compositions and methods of the present disclosure include those having the following formula: [ka] and pharmaceutically acceptable salts thereof. For any one of these four formulas, R4 is -(CH2) n Q and -(CH2) n CHQR, where Q is -OR, -OH, -O(CH2) n In certain embodiments, the compositions and methods of the present disclosure provide a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0139] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those as described in WO 2017 / 173054 and WO 2015 / 095340, each of which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present disclosure include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0140] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include cleavable cationic lipids as described in WO 2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise a cleavable cationic lipid having the following formula: [ka] wherein R1 is selected from the group consisting of imidazole, guanidium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; and R2 is selected from the group consisting of the following two formulae: [ka] and R3 and R4 are each independently selected from the group consisting of any optionally substituted saturated or unsaturated C6-C 20 Alkyl and optionally substituted undefined saturated or unsaturated C6-C 20 acyl, and n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more). In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid of [ka] In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid "HGT4001" having the structure: [ka] In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid "HGT4002" having the structure: [ka] In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid "HGT4003" having the structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid "HGT4004" having the structure: [ka] The present invention includes a cationic lipid "HGT4005" having the structure: and pharmaceutically acceptable salts thereof.

[0141] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include HEPES-based disulfide cationic lipids with a piperazine core, as described in WO 2022 / 221688, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise cationic lipids of the following formula: [ka] (GL-HEPES-E3-E10-DS-3-E18-1: (2-(4-(2-((3-(bis((Z)-2-hydroxyoctadec-9-en-1-yl)amino)propyl)disulfanayl)ethyl)piperazin-1-yl)ethyl 4-(bis(2-hydroxydecyl)amino)butanoate)) and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula: [ka] (GL-HEPES-E3-E12-DS-4-E10: (2-(4-(2-((3-(bis(2-hydroxydecyl)amino)butyl)disulfanayl)ethyl)piperazin-1-yl)ethyl 4-(bis(2-hydroxydodecyl)amino)butanoate)) and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present disclosure include a cationic lipid of the following formula: [ka] (GL-HEPES-E3-E12-DS-3-E14: (2-(4-(2-((3-(bis(2-hydroxytetradecyl)amino)propyl)disulfanayl)ethyl)piperazin-1-yl)ethyl 4-(bis(2-hydroxydodecyl)amino)butanoate)) and pharmaceutically acceptable salts thereof.

[0142] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include those described in Dong et al., PNAS, 2014, 111(11):3955-3960 and U.S. Patent No. 9,512,073, which are incorporated herein by reference. In some embodiments, the compositions and methods of the present disclosure comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present disclosure comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof.

[0143] Other suitable cationic lipids for use in the compositions and methods of the present disclosure include the cleavable cationic lipids described in U.S. Provisional Patent Application No. 62 / 672,194, filed May 16, 2018, and incorporated herein by reference. In certain embodiments, the compositions and methods of the present disclosure comprise a cationic lipid having any of the general formulas or structures (1a)-(21a) and (1b)-(21b) and (22)-(237) described in U.S. Provisional Patent Application No. 62 / 672,194. In certain embodiments, the compositions and methods of the present disclosure comprise a cationic lipid having formula (I') [ka] (In the formula, R X are independently -H, -L 1 -R 1 or -L 5A -L 5B -B', L 1 , L 2 and L 3 are each independently a covalent bond, —C(O)—, —C(O)O—, —C(O)S—, or —C(O)NR L - and Each L 4A and L 5A are independently —C(O)—, —C(O)O—, or —C(O)NR L - and Each L 4B and L 5B are independently C1 to C 20 Alkylene, C2-C 20 Alkenylene or C 2~C20 is alkynylene, Each B and B' is NR 4 R 5 or a 5- to 10-membered nitrogen-containing heteroaryl; Each R 1 , R 2 and R 3 are independently C6 to C 30 Alkyl, C6-C 30 Alkenyl or C6-C 30 is alkynyl, Each R 4 and R 5 are independently hydrogen, C1 to C 10 Alkyl, C2-C 10 Alkenyl or C2-C 10 is alkynyl, and Each R L are independently hydrogen, C1 to C 20 Alkyl, C2-C 20 Alkenyl or C2-C 20 alkynyl) The cationic lipids include those having the structure:

[0144] In certain embodiments, the compositions and methods of the present disclosure include a cationic lipid that is compound (139) of U.S. Patent Application No. 62 / 672,194, having the following compound structure: [ka]

[0145] In some embodiments, the compositions and methods of the present disclosure comprise the cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (“DOTMA”) (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355, which is incorporated herein by reference). Other cationic lipids suitable for the compositions and methods of the present disclosure include, for example, 5-carboxyspermylglycine dioctadecylamide (“DOGS”); 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium (“DOSPA”) (Behr et al. Proc. Nat'l Acad. Sci. 86, 6982 (1989), U.S. Pat. No. 5,171,678; U.S. Pat. No. 5,334,761); 1,2-dioleoyl-3-dimethylammonium-propane ("DODAP"); 1,2-dioleoyl-3-trimethylammonium-propane ("DOTAP").

[0146] Additional exemplary cationic lipids suitable for the compositions and methods of the present disclosure include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane ("DSDMA"); 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane ("DODMA"); 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane ("DLinDMA"); 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane ("DLenDMA"); N-dioleyl-N,N-dimethylammonium N,N-distearyl-N,N-dimethylammonium bromide ("DDAB"); N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide ("DMRIE"); 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutan-4-oxy)-I-(cis,cis-9,12-octadecadienoxy)propane ("CLinDMA"); 2-[5'-(cholest-5-ene-3-beta- (oxy)-3'-oxapentoxy)-3-dimethyl ll-(cis,cis-9',l-2'-octadecadienoxy)propane ("CpLinDMA"); N,N-dimethyl-3,4-dioleyloxybenzylamine ("DMOBA"); 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); 2,3-dilinoleoyloxy-N,N-dimethylpropylamine ("DLinDAP"); 1,2-N,N'-dilinoleylcarbamyl-3-dimethyl Aminopropane ("DLincarbDAP"); l,2-Dilinoleoylcarbamyl-3-dimethylaminopropane ("DLinCDAP"); 2,2-Dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane ("DLin-K-DMA"); 2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA");(2R)-2-((8-[(3beta)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA(2R)"); (2S)-2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,fsl-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propane 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane ("DLin-K-XTC2-DMA"); and 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine ("DLin-KC2-DMA") (WO 2010 / 042877, incorporated herein by reference; Semple et al., Nature Biotech. 28:172-176 (2010)) (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); see WO 2005 / 121348). In some embodiments, one or more of the cationic lipids comprises at least one imidazole, dialkylamino, or guanidinium moiety.

[0147] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present disclosure include 2,2-dilinoleyl 1-4-dimethylaminoethyl-1[1,3]-dioxolane ("XTC"); (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine ("ALNY-100") and / or 4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide ("NC98-5").

[0148] In some embodiments, the compositions and methods of the disclosure comprise a cationic lipid known as ALC-0315 ([(4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl)bis(2-hexyldecanoate), which is a synthetic lipid having the following chemical structure: [ka] and pharmaceutically acceptable salts thereof.

[0149] In some embodiments, the compositions of the present disclosure comprise one or more cationic lipids that account for at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., as measured by weight of lipid nanoparticles, including any value and subrange therebetween. In some embodiments, the compositions of the present disclosure comprise one or more cationic lipids that account for at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., as measured by mol% of lipid nanoparticles, including any value and subrange therebetween. In some embodiments, compositions of the present disclosure comprise one or more cationic lipids that comprise about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35%-40%) of the total lipid content in the composition, e.g., as measured by weight of the lipid nanoparticles, including any value and subrange therebetween. In some embodiments, compositions of the present disclosure comprise one or more cationic lipids that comprise about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35%-40%) of the total lipid content in the composition, e.g., as measured by mol% of lipid nanoparticles, including any value and subrange therebetween.

[0150] Non-cationic / Helper Lipids In some embodiments, provided liposomes contain one or more non-cationic ("helper") lipids. As used herein, the phrase "non-cationic lipid" refers to any neutral, zwitterionic, or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of several lipid species that have a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleic acid ... The lipids include, but are not limited to, 16-O-monomethyl-2-oleoyl-2-phosphatidylethanolamine (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), or mixtures thereof.

[0151] In some embodiments, the non-cationic lipid is DPPC. In some embodiments, the non-cationic lipid is DOPE. In some embodiments, the non-cationic lipid is DEPE.

[0152] In some embodiments, such non-cationic lipids can be used alone, but are preferably used in combination with other lipids, such as cationic lipids. In some embodiments, the non-cationic lipids can comprise a molar ratio of about 5% to about 90% or about 10% to about 70% of the total lipids present in the liposome. In some embodiments, the non-cationic lipids are neutral lipids, i.e., lipids that have no net charge under the conditions in which the composition is formulated and / or administered. In some embodiments, the percentage of non-cationic lipids in the liposomes can be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0153] Cholesterol-based lipids In some embodiments, the provided liposomes comprise one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al., Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al., BioTechniques 23, 139 (1997); U.S. Patent No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid may comprise a molar ratio of about 2% to about 30% or about 5% to about 20% of the total lipids present in the liposome. In some embodiments, the proportion of cholesterol-based lipids in the lipid nanoparticles may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0154] PEG modified lipid The use of polyethylene glycol (PEG)-modified phospholipids and derivatized lipids, such as derivatized ceramides (PEG-CER), including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), alone or preferably in combination with other lipid formulations, including delivery vehicles (e.g., lipid nanoparticles), is also contemplated by the present disclosure. Contemplated PEG-modified lipids include those having C6-C 20These include, but are not limited to, polyethylene glycol chains of up to 5 kDa in length covalently attached to lipids with long alkyl chains. The addition of such components may prevent complex aggregation and may also provide a means for increasing circulation lifetime and delivery of lipid-nucleic acid compositions to target tissues (Klibanov et al. (1990) FEBS Letters, 268(1):235-237), or they may be selected to rapidly exchange from the formulation in vivo (see U.S. Pat. No. 5,885,613). Particularly useful exchangeable lipids are PEG-ceramides with shorter acyl chains (e.g., C14 or C18). The PEG-modified phospholipids and derivatized lipids of the present disclosure may comprise a molar ratio of about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipids present in the liposome delivery vehicle. In some embodiments, one or more PEG-modified lipids account for about 4% of total lipids by molar ratio.In some embodiments, one or more PEG-modified lipids account for about 5% of total lipids by molar ratio.In some embodiments, one or more PEG-modified lipids account for about 6% of total lipids by molar ratio.

[0155] polymer In some embodiments, suitable delivery vehicles are formulated using polymers as carriers, either alone or in combination with other carriers, including various lipids, as described herein. Thus, in some embodiments, liposome delivery vehicles, as used herein, also encompass nanoparticles comprising polymers. Suitable polymers may include, for example, polyacrylate, polyalkoxyacrylate, polylactide, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is present, it may be branched PEI with a molecular weight ranging from 10 to 40 kDa, for example, 25 kDa branched PEI (Sigma #408727).

[0156] The exemplary combination of cationic lipid, non-cationic lipid, cholesterol-based lipid and PEG-modified lipid is described in the Examples section.For example, suitable lipid solution includes CKK-E10, DOPE, cholesterol and DMG-PEG2K; CKK-E12, DOPE, cholesterol, DMG-PEG2K; C12-200, DOPE, cholesterol and DMG-PEG2K; HGT5000, DOPE, cholesterol, DMG-PEG2K; HGT5001, DOPE, cholesterol, DMG-PEG2K; OF-02, DOPE, cholesterol, DMG-PEG2K; GL-HEPES-E3-E12-DS-4-E10, DOPE, cholesterol and DMG- The lipid mixture may include PEG2K; CKK-E10, DPPC, cholesterol, DMG-PEG2K; CKK-E12, DPPC, cholesterol, DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000, DPPC, cholesterol, DMG-PEG2K; HGT5001, DPPC, cholesterol, DMG-PEG2K; OF-02, DPPC, cholesterol, DMG-PEG2K; or GL-HEPES-E3-E12-DS-4-E10, cholesterol, and DMG-PEG2K. The selection of cationic lipids, non-cationic lipids, and / or PEG-modified lipids comprising the lipid mixture and the relative molar ratios of such lipids to each other are based on the characteristics of the selected lipids and the properties and characteristics of the mRNA to be encapsulated. Further considerations include, for example, the saturation of the alkyl chain and the size, charge, pH, pKa, membrane fusion activity, and toxicity of the selected lipid. Therefore, the molar ratio can be adjusted accordingly.

[0157] In some embodiments, LNPs are produced with specific molar ratios of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids. In some embodiments, the lipid nanoparticles have a molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids of 60:25:10:5. In some embodiments, the lipid nanoparticles have a molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids of 40:25:30:5.

[0158] Therapeutic uses In some embodiments, the dry powder formulations described herein comprise any full-length mRNA. In some embodiments, the dry powder formulations described herein comprise mRNA encoding a drug or peptide or protein therapeutic suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA encoding any peptide or polypeptide suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA encoding any antibody suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA encoding any therapeutic protein suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA encoding any naturally occurring peptide suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA encoding any modified or non-natural peptide suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA encoding any peptide drug suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise full-length mRNA encoding any peptide or polypeptide suitable for delivery to or use in treating the lung or lung cells of a subject suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding any peptide or polypeptide suitable for delivery to or use in treating the liver or liver cells of a subject, suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding a protein associated with a urea cycle disorder suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding a protein associated with a lysosomal storage disease suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding a protein associated with a glycogen storage disease suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding a protein associated with amino acid metabolism suitable for the present disclosure.In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding a protein associated with lipid metabolism or a fibrotic disorder suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding a protein associated with methylmalonic acidemia suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding a peptide or polypeptide for delivery to or treatment of the cardiovascular structure of a subject or cardiovascular cells suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding any peptide or polypeptide for delivery to or treatment of muscle or muscle cells of a subject suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding any peptide or polypeptide for delivery to or treatment of the nervous system of a subject or nervous system cells suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding any peptide or polypeptide for delivery to or treatment of the eye or ocular cells of a subject suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding a peptide or polypeptide for delivery to or treatment of a vaccine in a subject or a subject's cells suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding an antigen from an infectious agent (e.g., a virus) suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding an immunomodulatory agent suitable for the present disclosure. In some embodiments, the dry powder formulations described herein comprise a full-length mRNA encoding an endonuclease suitable for the present disclosure.

[0159] The pharmaceutical formulations of the present disclosure can be administered locally rather than systemically, for example, by injecting the pharmaceutical formulation directly into the target tissue, preferably in a sustained release formulation.

[0160] Local delivery can be achieved in a variety of ways depending on the tissue being targeted. Exemplary tissues to which the delivered mRNA may be delivered and / or expressed include, but are not limited to, the lung, liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid. In some embodiments, the tissue is targeted in the liver. For example, aerosol-containing compositions of the present disclosure can be inhaled (for nasal, tracheal, or bronchial delivery). In some embodiments, compositions of the present disclosure can be delivered using a metered-dose inhaler. In some embodiments, compositions of the present disclosure can be reconstituted and nebulized for delivery. In some embodiments, compositions of the present disclosure can be injected at the site of injury, disease manifestation, or pain. In some embodiments, compositions of the present disclosure can be provided in a lozenge for oral, tracheal, or esophageal use. In some embodiments, compositions of the present disclosure can be provided in liquid, tablet, or capsule form for gastric or intestinal administration. In some embodiments, compositions of the present disclosure can be provided in suppository form for rectal or vaginal application. In some embodiments, the compositions of the present disclosure may be delivered to the eye through the use of creams, drops, or injections.

[0161] In some embodiments, the dry powder formulations of the present disclosure are reconstituted into a liquid solution and nebulized for delivery. Nebulization can be achieved by any nebulizer known in the art. A nebulizer converts liquid into a mist that can be more easily inhaled into the lungs. Nebulizers are effective for infants, children, and adults. Nebulizers can nebulize large amounts of inhaled medication. Typically, nebulizers for use with the present disclosure include a removable mouthpiece.

[0162] In some embodiments, the dry powder formulations described herein can be used to deliver therapeutically effective amounts of mRNA for treating various diseases or disorders. In some embodiments, the mRNA encodes a therapeutic protein. For example, dry powder formulations prepared by spray drying according to the present disclosure can be administered orally, nasally, through the trachea or lungs, or via other routes, for the treatment of lung-related disorders such as cystic fibrosis. In some embodiments, the dry powder formulation is administered by inhalation. In some embodiments, the formulation is administered by a metered-dose inhaler. In some embodiments, the dry powder formulation is administered by intranasal spray. In some embodiments, the dry powder formulation is rehydrated and administered as intravenous infusion, injection, oral drops, nasal spray, or any other application readily conceivable to one of skill in the art. The present disclosure can be used to treat a variety of other lung-related diseases, disorders, and conditions. In some embodiments, the present disclosure of stable dry powder formulations is useful for treating one or more of asthma; COPD; emphysema; primary ciliary dyskinesia with or without visceral inversion (CILD1) or Kartagener's syndrome; pulmonary fibrosis; Birt-Hogg-Dube syndrome; hereditary hemorrhagic telangiectasia; alpha 1 antitrypsin deficiency; cytochrome b positive granulomatous disease (CGD, radiological); cytochrome b positive granulomatous disease, autosomal recessive; surfactant deficiency, pulmonary surfactant metabolic dysregulation 1, pulmonary surfactant metabolic dysregulation 2, pulmonary surfactant metabolic dysregulation 3; respiratory distress syndrome of prematurity; tuberculosis; pulmonary viral diseases including influenza and respiratory syncytial virus (RSV).

[0163] In some embodiments, the present disclosure of stable dry powder formulations is useful for treating one or more of acute respiratory distress syndrome (ARDS), cystic fibrosis (CF), lung cancer, pulmonary alveolar proteinosis (PAP), pulmonary arterial hypertension (PAH), and primary ciliary dyskinesia (PCD).

[0164] In some embodiments, the present disclosure provides a dry powder composition comprising a full-length mRNA encoding a therapeutic protein. In some embodiments, the therapeutic protein is CFTR. In some embodiments, the therapeutic protein is DNAI1. In some embodiments, the present disclosure provides a dry powder composition comprising a full-length mRNA encoding a secreted protein. In some embodiments, the present disclosure provides a dry powder composition comprising a full-length mRNA encoding a nuclear protein. In some embodiments, the present disclosure provides a dry powder composition comprising a full-length mRNA encoding a metabolic protein. In some embodiments, the present disclosure provides a dry powder composition comprising a full-length mRNA encoding a cytoplasmic protein. In some embodiments, the present disclosure provides a dry powder composition comprising a full-length mRNA encoding a membrane protein. In some embodiments, the present disclosure provides a dry powder composition comprising a full-length mRNA encoding a mitochondrial protein. In some embodiments, the present disclosure provides a dry powder composition comprising a full-length mRNA encoding a lysosomal protein. In some embodiments, the mRNA encodes a cytosolic protein. In some embodiments, the mRNA encodes a protein associated with the actin cytoskeleton. In some embodiments, the mRNA encodes a protein associated with the plasma membrane.

[0165] In some embodiments, the mRNA encodes one or more naturally occurring peptides, hi some embodiments, the mRNA encodes one or more modified or non-naturally occurring peptides.

[0166] In some embodiments, the peptide drug comprises a glucose-dependent insulinotropic polypeptide. A further example of a peptide drug is elamipretide. A further example of a peptide drug is a cyclotide (which is a peptide characterized by their head-to-tail cyclized peptide backbone and their disulfide bond interlocking sequence), including, for example, a cyclotide with at least two disulfide bonds (and preferably a cyclotide with three disulfide bonds).

[0167] In some embodiments, the peptide agent is selected from the group consisting of GLP-1, amylin, amylin analogs, pramlintide, somatostatin analogs (e.g., octreotide, lanreotide, or pasireotide), goserelin (e.g., goserelin acetate), buserelin, peptide YY (PYY), PYY analogs, glatiramer (e.g., glatiramer acetate), leuprolide (e.g., leuprolide acetate), desmopressin (e.g., desmopressin acetate, particularly desmopressin monoacetate trihydrate), teicoplanin, telavancin, bleomycin, ramoplanin, decaplanin, bortezomib, cosyntropin, sermorelin, luteinizing agent, and luteinizing agent. The peptide drug is preferably selected from growth hormone-releasing hormone (LHRH), calcitonin (e.g., calcitonin-salmon), pentagastrin, neseritide, enfuvirtide, eptifibatide, cyclosporine, glucagon, viomycin, thyrotropin-releasing hormone (TRH), leucine-enphalin, methionine-enkephalin, substance P, parathyroid hormone (PTH) fragments (e.g., teriparatide (PTH(1-34)), PTH(1-31) or PTH(2-34)), carfilzomib, icatiban, cilengitide, prostaglandin F2α receptor modulators (e.g., PDC31), and pharmaceutically acceptable salts thereof. Particularly preferably, the peptide drug is selected from semaglutide, liraglutide, teriparatide (PTH(1-34)), octreotide, leuprolide, and pharmaceutically acceptable salts thereof.

[0168] Thus, in certain embodiments, the present disclosure provides methods for producing dry powder compositions containing full-length mRNA encoding a peptide or polypeptide for use in pulmonary delivery or treatment of a subject or lung cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the cystic fibrosis transmembrane conductance regulator (CFTR) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the ATP-binding cassette subfamily A member 3 protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the dynein axon terminal intermediate chain 1 protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the dynein axon heavy chain 5 (DNAH5) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the alpha-1-antitrypsin protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding the forkhead box P3 (FOXP3) protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding one or more surfactant proteins, e.g., one or more of surfactant A protein, surfactant B protein, surfactant C protein, and surfactant D protein.

[0169] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding peptides or polypeptides for delivery to the liver of a subject or hepatocytes or for use in treating liver cells. Such peptides and polypeptides may include those associated with urea cycle disorders, lysosomal storage disorders, glycogen storage disorders, amino acid metabolism disorders, lipid metabolism or fibrotic disorders, methylmalonic acidemia, or any other metabolic disorder for which delivery to the liver or liver cells or treatment of liver cells with enriched full-length mRNA provides benefit from a dry powder.

[0170] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a protein associated with a urea cycle disorder. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an ornithine transcarbamylase (OTC) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an argininosuccinate synthetase 1 protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a carbamoyl phosphate synthetase 1 protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an argininosuccinate lyase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an arginase protein.

[0171] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a protein associated with a lysosomal storage disease. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an α-galactosidase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a glucocerebrosidase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an iduronate-2-sulfatase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an iduronidase protein. In certain embodiments, the present disclosure provides a method for producing a therapeutic composition having a full-length mRNA encoding an N-acetyl-α-D-glucosaminidase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a heparan N-sulfatase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a galactosamine-6 ​​sulfatase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a β-galactosidase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a lysosomal lipase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an arylsulfatase B (N-acetylgalactosamine-4-sulfatase) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding transcription factor EB (TFEB).

[0172] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a protein associated with a glycogen storage disorder. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an acid α-glucosidase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a glucose-6-phosphatase (G6PC) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a liver glycogen phosphorylase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a muscle phosphoglycerate mutase protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a glycogen debranching enzyme.

[0173] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a protein related to amino acid metabolism. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a phenylalanine hydroxylase enzyme. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a glutaryl-CoA dehydrogenase enzyme. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a propionyl-CoA carboxylase enzyme. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an oxalase alanine-glyoxylate aminotransferase enzyme.

[0174] In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a protein associated with lipid metabolism or a fibrotic disorder. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an mTOR inhibitor. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding an ATPase phospholipid transport 8B1 (ATP8B1) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding one or more NF-kappa B inhibitors, such as one or more of I-κBα, interferon-related developmental regulator 1 (IFRD1), and sirtuin 1 (SIRT1). In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding a PPAR-γ protein or active variant.

[0175] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having a full-length mRNA encoding a protein associated with methylmalonic acidemia. For example, in certain embodiments, the present disclosure provides methods for producing dry powder compositions having a full-length mRNA encoding a methylmalonyl-CoA mutase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having a full-length mRNA encoding a methylmalonyl-CoA epimerase protein.

[0176] In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA. In some embodiments, the present disclosure provides methods for delivery to the liver or for treating a liver-related condition. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding the ATP7B protein, also known as Wilson's disease protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a porphobilinogen deaminase enzyme. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding one or more of a clotting enzyme, such as Factor VIII, Factor IX, Factor VII, and Factor X. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a human hemochromatosis (HFE) protein.

[0177] In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a peptide or polypeptide for use in delivery to or treatment of cardiovascular tissue in a subject or cardiovascular cells. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a vascular endothelial growth factor A protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a relaxin protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a bone morphogenetic protein-9 protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a bone morphogenetic protein-2 receptor protein.

[0178] In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a peptide or polypeptide for delivery to the muscle of a subject or muscle cells or for use in treating muscle cells. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a dystrophin protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a frataxin protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a peptide or polypeptide for delivery to the myocardium of a subject or cardiomyocytes or for use in treating cardiomyocytes. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a protein that regulates one or both of potassium and sodium channels in muscle tissue or muscle cells. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a protein that regulates Kv7.1 channels in muscle tissue or muscle cells. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a protein that regulates Nav1.5 channels in muscle tissue or muscle cells.

[0179] In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a peptide or polypeptide for use in delivering to the nervous system of a subject or treating nervous system cells. For example, in certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding survival motor neuron 1 protein. For example, in certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding survival motor neuron 2 protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding frataxin protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding ATP-binding cassette subfamily D member 1 (ABCD1) protein. In certain embodiments, the present disclosure provides a method for producing a dry powder composition having a full-length mRNA encoding CLN3 protein.

[0180] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for use in delivery to or treatment of the blood or bone marrow of a subject or blood or bone marrow cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a beta-globin protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a Bruton's tyrosine kinase protein. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding one or more clotting enzymes, such as Factor VIII, Factor IX, Factor VII, and Factor X.

[0181] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for use in delivering or treating kidney cells to a subject or kidney. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding type IV collagen alpha 5 chain (COL4A5) protein.

[0182] In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a peptide or polypeptide for use in ocular delivery or treatment of a subject or ocular cells. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an ATP-binding cassette subfamily A member 4 (ABCA4) protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a retinoschisin protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a retinal pigment epithelium-specific 65 kDa (RPE65) protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a 290 kDa centrosomal protein (CEP290).

[0183] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding a peptide or polypeptide for use in vaccine delivery or vaccine therapy for a subject or cells of a subject. For example, in certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from an infectious agent, such as a virus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from influenza virus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from respiratory syncytial virus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from rabies virus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from cytomegalovirus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from rotavirus. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen from a hepatitis virus, such as hepatitis A virus, hepatitis B virus, or hepatitis C virus. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an antigen from a human papillomavirus. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an antigen from a herpes simplex virus, such as herpes simplex virus 1 or herpes simplex virus 2. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an antigen from a human immunodeficiency virus, such as human immunodeficiency virus type 1 or human immunodeficiency virus type 2. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an antigen from a human metapneumovirus.In certain embodiments, the present disclosure provides methods of making a dry powder composition having a full-length mRNA encoding an antigen from a human parainfluenza virus, such as human parainfluenza virus type 1, human parainfluenza virus type 2, or human parainfluenza virus type 3. In certain embodiments, the present disclosure provides methods of making a dry powder composition having a full-length mRNA encoding an antigen from a malaria virus. In certain embodiments, the present disclosure provides methods of making a dry powder composition having a full-length mRNA encoding an antigen from a Zika virus. In certain embodiments, the present disclosure provides methods of making a dry powder composition having a full-length mRNA encoding an antigen from a Chikungunya virus.

[0184] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen associated with a subject's cancer or identified from the subject's cancer cells. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen determined from a subject's own cancer cells, i.e., methods for providing personalized cancer vaccines. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an antigen expressed from a mutant KRAS gene.

[0185] In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an antibody. In certain embodiments, the antibody can be a bispecific antibody. In certain embodiments, the antibody can be part of a fusion protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an antibody against OX40. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an antibody against VEGF. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an antibody against tissue necrosis factor alpha. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an antibody against CD3. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an antibody against CD19.

[0186] In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding an immunomodulatory agent. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding interleukin-12. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding interleukin-23. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding interleukin-36γ. In certain embodiments, the present disclosure provides methods for producing dry powder compositions having full-length mRNA encoding constitutively active variants of one or more stimulator of interferon genes (STING) proteins.

[0187] In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an endonuclease. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding an RNA-guided DNA endonuclease protein, such as a Cas9 protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a meganuclease protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a transcription activator-like effector nuclease protein. In certain embodiments, the present disclosure provides methods for producing a dry powder composition having a full-length mRNA encoding a zinc finger nuclease protein.

[0188] The present disclosure can be used to treat various other diseases, disorders and conditions that require sustained release of mRNA formulations. Examples include diseases in which mRNA delivery in the gastrointestinal tract is useful. Such diseases include, but are not limited to, apolipoprotein E deficiency; inflammatory bowel disease or Crohn's disease; adhesion G protein-coupled receptor VI deficiency; von Willebrand's disease type 2; nephrolithiasis, calcium oxalate CAON-associated; juvenile-onset diabetes, type 8.

[0189] messenger RNA (mRNA) vaccine mRNA vaccines are novel and offer many advantages over current cell-based vaccines that use live, attenuated, or killed pathogens or toxoid vaccines. In addition to safety, mRNA vaccines offer a cost-effective and flexible design platform. Antigen-encoding mRNA can be directed to induce specific immune responses and thus can be applied to the development of a wide range of therapeutic and prophylactic mRNA vaccines for a wide variety of diseases, including infectious diseases and cancer.

[0190] Vaccines against infection Vaccine candidates are well established for many infectious pathogens. Typically, vaccines are agents that at least partially mimic disease-causing agents, thereby eliciting an immune response by a mammalian host. Vaccines are generally biological agents, such as heat-killed, irradiated, or otherwise attenuated pathogens, live attenuated microorganisms, protein or peptide antigens, conjugated antigens, toxins, or microbial surface proteins or fragments thereof. However, mRNA encoding a protein or peptide antigen is a safe and effective method for inducing an immune response against disease. As discussed above, mRNA can be effectively delivered for in vivo expression by encapsulating it in liposomes containing appropriate lipids, as discussed in a later section. This mRNA encoding an antigenic peptide or protein can therefore be used to generate a vaccine in vivo. The immune response generated by a mammalian host against the vaccine components is then intended to protect the host from subsequent attack by the pathogen, as the host's immune system is primed for attack by the pathogen. In other words, the host system has immunological memory of the pathogen (a component of the adaptive immune response). This process is known as prophylactic vaccination. Furthermore, vaccines can enhance the host's immune system in existing infections, for example, by redirecting the immune response to new, less-recognized microbial antigens (subdominant antigens), which induce a strong immune response that leads to pathogen elimination. This type of vaccine response can be classified as therapeutic vaccination.

[0191] The immune response to pathogens can be divided into several stages. First, encounter of the human body (or mammalian system) with a new pathogen, particularly through contact with exposed surfaces such as the skin or internal mucosal surfaces of the respiratory, gastrointestinal, and genitourinary tracts, leads to a nonspecific innate immune response via the activation of pattern recognition molecules. Pattern recognition molecules include various germline-encoded receptors specialized for distinguishing between microbial and host cell surfaces or between infected and normal cells. Phagocytes (monocytes, macrophages, and dendritic cells) express pattern recognition molecules on their surface and are primarily responsible for the recognition, killing, and elimination of pathogens in the innate immune response. Phagocytes then process and present antigens to circulating lymphocytes for the generation of more specific, antigen-targeted immune responses, also known as adaptive immune responses. At this stage, activated lymphocytes mature into antigen-specific T cells in lymph nodes that express receptors for antigen recognition, allowing effector cytotoxic T cells to recognize and kill cells expressing the antigen when presented in association with a second set of cell surface molecules, major histocompatibility complex molecules or MHC. Helper T cells activate the system to generate T cell memory and humoral immune responses. The humoral immune response involves antibody-secreting B cells generated by clonal expression and differentiation over several days, during which time innate immunity continues to function. Clonal expansion of cytotoxic T cells also occurs rapidly in lymphoid organs such as lymph nodes and is enhanced by exposure to antigen. Activated T cells produce several cytokines, including interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α), which are considered hallmarks of T cell activation. Finally, antigen-specific T cells, followed by antibodies, are released into the bloodstream and recruited to the site of infection. A successful vaccine generates rapid and robust cytotoxic T cell responses, strong antibody responses, and long-lasting immunological memory.

[0192] Cancer vaccines Cancer is considered an immune disease, and cancer immunotherapy is currently at the center of research and development. Cancer immunotherapy involves the development of vaccines that enhance the immune system against cancer antigens and eliminate tumors through antigen-specific activation of cytotoxic T cells. One class of cancer antigens is viral antigens associated with cancer-causing viruses, such as Epstein-Barr virus (EBV) antigens, such as EBV1 and EBV2, which are associated with lymphoma and nasopharyngeal carcinoma; human papillomavirus (HPV) antigens, such as HPV16, which are associated with cervical cancer (CC); hepatitis B virus (HBV) antigens and hepatitis C virus (HCV) antigens, which are associated with hepatocellular carcinoma (HCC); human T-lymphotropic virus type 1 (HTLV-1), which is associated with adult T-cell leukemia / lymphoma; and human herpesvirus 8 (HHV-8), which is associated with Kaposi's sarcoma, to name a few.

[0193] On the other hand, cancerous cells express antigens that are not generally expressed by non-cancerous cells or tissues, such antigens include, but are not limited to, epithelial tumor antigen (ETA) found in breast cancer, RAS family member p-53 and other activated RAS antigens, ovarian cancer antigens BRCA1 and BRCA2, melanoma-associated antigen (MAGE) found in malignant melanoma cells, BCR-ABL fusion gene product found in myeloid leukemia, BRAF antigen found in acute lymphoblastic leukemia, acute myeloid leukemia, cutaneous melanoma, and colorectal cancer, epidermal growth factor receptor (EGFR) in non-small cell lung cancer, KRAS found in colorectal and non-small cell lung cancer, neuron-specific enolase found in neuroblastoma and non-small cell lung cancer, and NY-ESO found in neuroblastoma. Melanoma-associated antigen (MART-1), recognized by T cells in melanoma, programmed death-ligand 1 (PD-L1), found in non-small cell lung cancer, prostate-specific antigen (PSA), urokinase activator (UPA), and plasminogen activator inhibitor (PAI-1), found in breast cancer, are almost all mutated endogenous proteins. These endogenous cancer antigens are not presented by antigen-presenting cells (APCs) in the same manner as viral antigens, i.e., in association with MHC-1 molecules that classify them as foreign antigens. However, cytotoxic T cells have the unique ability to differentiate and identify mutated self-antigens and seek out and destroy cells bearing these mutated antigens. Therefore, the current goal of cancer immunotherapy is to achieve optimal activation of cytotoxic T cells against mutated antigens. Patient-specific mutations associated with a patient's cancer can be mapped and used to generate vaccines that can induce the patient's own cytotoxic T cells to generate the immune response necessary to destroy tumor cells. mRNA vaccines could be a safe and cost-effective alternative to peptide vaccines to enable such personalized medicine. Using pan-genome scanning and analysis of mutations present in cancer patients, mRNA encoding antigens or epitopes containing mutations can be specifically designed, which, when administered in vivo, will produce translation products on the cell surface, leading to an immune response against the mutated antigen. In this process, cytotoxic T cells attack tumor cells that inherently express the mutated antigen.The methods and protocols involved in performing pan-genome sequencing analysis, mutation analysis, epitope mapping and analysis, and designing peptides suitable for vaccination are known to those skilled in the art.

[0194] This approach can also be utilized to identify dominant and subdominant antigens in patients. In both chronic infections and cancer, it has been observed that certain antigens play a dominant role in generating an initial immune response. However, soon thereafter, tolerance to such dominant antigens is established, thereby causing a decline in the immune response. Genomic analysis and identification of antigens that did not initially elicit a dominant antigenic response (often referred to as subdominant antigens) can now be used to generate new, reinvigorated immune responses.

[0195] One advantage of mRNA vaccines over peptide vaccines is that mRNA vaccines bypass the HLA matching of the recipient host.

[0196] In a synthetic approach to mRNA vaccine design, pathogen proteomes can be scanned for potential vaccine antigen signatures. (Proteome databases can be accessed using the Uniprot Consortium, http: / / www.uniprot.org / ). This could be effective for new pathogens such as Zika virus. This type of reverse vaccinology has been used to identify numerous novel peptide vaccine candidates. By combining genomics and proteomics, new peptide vaccines have also been identified from Helicobacter pylori and Mycobacterium tuberculosis (see, e.g., Etz et al., PNAS. 2002, 99(10)6573-6578). The ability of potential antigen candidates to generate a successful immune response can be verified by appropriately expressing a library of potential antigens using various forms of cell surface display and subjecting them to opsonization and antibody binding tests. Exemplary useful databases for vaccine antigen development include: ImMunoGeneTics Information System (URL: imgt.org); Epitome Database, (URL: rostlab.org / services / epitome), Immune Epitope Database and Analysis Resource, iedb.org; Immunity Database, immune.cn / ced / index.php; HIV Database: hiv.lanl.gov / content / immunology for immunogenetics and immunoinformatics.

[0197] Therefore, from the above discussion, it is clear that concentrating mRNA vaccine delivery to lymph nodes can provide vaccine access to both activated and naive lymphocytes for lymphoproliferation and antigen-specific T and B cell generation. This localization of antigen activation, in contrast to broad immune activation, also results in less toxicity. [Example]

[0198] While certain compounds, compositions and methods of the present disclosure have been described with specificity according to particular embodiments, the following examples serve only to illustrate the present disclosure and are not intended to limit the disclosure.

[0199] The lipids studied in this example include: (1) Lipid 1 (also known as lipid A), (2) lipid 2 (also called lipid B), and (3) Fat 3.

[0200] Example 1: Effect of mannitol and solvent on processing temperature and powder size This example describes the effect of temperature and the effect of solvent on the dry powder product. Although it was possible to produce DPP at an inlet temperature of 90°C using water as the solvent, the process temperature was reduced to prevent potential mRNA degradation and increase yield by minimizing adhesion to the cyclone separator. Dry powder formulations of LNP-encapsulated mRNA prepared in the presence of mannitol were evaluated for spray-drying efficiency and powder size. The use of a hydroalcoholic solution also helped reduce the particle size of the DPP. Using 5% mannitol in 20% ethanol was observed to reduce the processing temperature and powder size.

[0201] Two LNP-encapsulated mRNA formulations were prepared: one with a 5% mannitol solution in water and the other with a 4% mannitol solution in 20% ethanol. To prepare the LNP formulations, mRNA was first mixed with the LNPs using a gear pump for spray drying. This process encapsulated the mRNA within the LNPs. Different solutions of mannitol were added to the mRNA LNP formulations. These mixtures were then subjected to spray drying. The inlet and subsequent outlet temperatures were optimized for each mannitol formulation. Table 1 summarizes the powder sizes of the different mannitol formulations and the LNP-mRNA.

[0202] Results: It was observed that a powder size of 12 micrometers was obtained using a 5% mannitol in 20% ethanol solution. This is in stark contrast to the formulation of 5% mannitol in water, where the powder size was much larger. Furthermore, the inlet and outlet temperatures used for spray drying were much lower for the solution containing 4% mannitol in 20% ethanol.

[0203] [Table 1]

[0204] Example 2: Effect of different helper lipids on encapsulation efficiency. This example describes the determination of the lipid that yields the most desirable values ​​for pre-encapsulation efficiency and powder size. Lipid 2, with DEPE or DPPC helper lipids, was observed to provide the least efficient encapsulation efficiency.

[0205] LNP-encapsulated mRNA formulations were prepared using two different ionizable lipids and three different helper lipids in the presence of mannitol. To prepare the LNP formulations, an acidic buffered aqueous solution of mRNA was first mixed with a lipid solution in ethanol using a gear pump for spray drying. This process encapsulated the mRNA within the LNPs. The LNPs were then buffer-exchanged with 4% w / v mannitol in a 20% ethanol solution and subjected to spray drying. The pre-spray drying encapsulation efficiency and reconstitution encapsulation efficiency were calculated. The results are summarized in Table 2.

[0206] Results: No significant changes in size, encapsulation efficiency, and powder size were observed using different helper lipids for lipid 1. There were no significant differences in yield, LNP size, encapsulation, and DP size using DPPC and DEPE compared to DOPE for lipid 1. Lower encapsulation with DPPC and DEPE was observed for lipid 2. Therefore, it can be assumed that the helper lipids DPPC and DEPE were not compatible with ionizable lipid 2 in the formation of LNPs. The feed amount did not significantly affect process or product properties.

[0207] [Table 2]

[0208] The same analysis was repeated using lipid 1 with different lipid:mRNA ratios. Figures 2A-2D summarize the mRNA loading efficiency, yield, encapsulation efficiency, and powder size. It was observed that increasing mRNA loading was achieved by decreasing the N / P ratio or changing the LNP composition. The LNP composition could be altered while keeping the yield the same. No change in encapsulation after spray drying was observed. All combinations yielded the desired powder size. The best composition was 375 mg leucine with an N / P ratio of 3 (5:60:25:10 LNP composition).

[0209] Example 3: Determination of leucine and mannitol concentrations on yield, powder size and encapsulation efficiency. This example describes the determination of mannitol and leucine concentrations to determine the most desirable yield, encapsulation efficiency, and powder size. Amino acid excipients such as leucine and trileucine have shown improved powder properties and can increase yield by minimizing adhesion to the cyclone separator. Higher feed volumes were required to include amino acid excipients due to their low solubility in 20% ethanol. Therefore, the impact of increasing feed volume was first evaluated in formulations without amino acids. There were no significant differences in yield, LNP size, encapsulation, and average particle size for lipid 1-based dry powders at feed volumes of 50, 100, 150, and 250 ml produced using 2 g mannitol, 50 mg mRNA, and equivalent lipid amounts.

[0210] LNP-encapsulated mRNA formulations were prepared with different masses of leucine or mannitol, or different ratios of the combination of leucine and mannitol. To prepare the LNP formulations, an acidic buffered aqueous solution of mRNA was first mixed with a lipid solution in ethanol using a gear pump for spray drying. This process encapsulated the mRNA within the LNPs. The final LNP formulations were then buffer-exchanged into a 20% ethanol solution. Different solutions of mannitol, leucine, or a combination of leucine and mannitol were prepared in 20% ethanol and then added to the final mRNA LNP formulation. These mixtures were then subjected to spray drying. The inlet and outlet temperatures were optimized for each mannitol formulation. Figures 2A–2D summarize the different parameters analyzed. Dry powders were produced using LNPs with a constant lipid content of N / P = 4 and a lipid molar ratio of DMG-PEG-2000:lipid 1:cholesterol:DOPE (5:40:25:30) for this screening. The size of the LNP product used for spray drying was 60-80 nm. The use of leucine significantly improved the yield. For example, most of the dried powder adhered to the cyclone separator, and despite using 2000 mg of mannitol, only a 10% yield was obtained with dried powder without leucine. On the other hand, a maximum of 50% product was obtained in the collection vessel using only 1500 mg of leucine. A significant increase in yield was also detected with increasing amounts of leucine. The highest yield, up to 60%, was obtained using a 4:1 mixture of mannitol and leucine (500 mg leucine combined with 2000 mg mannitol). Furthermore, leucine alone and in combination with mannitol showed a significant decrease in the average particle size of the dried powder (Figure 2D). Dry powders produced using only mannitol exhibited a much higher average particle size.

[0211] In some embodiments, the increased yield and decreased average particle size of DPP may be due to the lower solubility of leucine in the aqueous alcoholic solvent and its higher surface activity. The low solubility of leucine may have promoted rapid coating of the newly formed DPP, preventing adhesion and resulting in a higher yield. Furthermore, the higher surface activity may have reduced aggregation, which may have resulted in the formation of DPP with a smaller average particle size.

[0212] Lipid 1 containing 750 mg leucine or 500 mg leucine + 200 mg mannitol was observed to provide the best mRNA loading efficiency and yield. Other properties, such as encapsulation efficiency and powder yield, were also desirable (Figures 2B and 2C). Experimental mRNA weight percent decreased with increasing excipient amounts, as expected (Figure 2A).

[0213] Results: The introduction of leucine was observed to decrease powder size and increase yield and mRNA loading. No significant changes were observed in encapsulation and powder size after spray drying at leucine or leucine / mannitol concentrations. Therefore, the best compositions were observed to be 750 mg leucine or 2500 mg leucine / mannitol (1:2.3) combinations. In independent experiments, the mannitol / leucine (1000 mg / 500) combination was also observed to be optimal for yield, powder size, encapsulation efficiency, and mRNA weight percent.

[0214] The same analysis was repeated using lipid 3 with a combination of leucine, mannitol, or a combination of leucine and mannitol. Figures 3A-3D summarize the different parameters analyzed. No changes in the required composition or lipid-to-mRNA (N / P) ratio were observed. It was observed that 250 mg of leucine provided a reasonable dry powder yield, resulting in 5% mRNA loading.

[0215] Example 4: Effect of reducing lipid concentration on dry powder properties. After assessing the effect of excipient amount at a constant lipid content, the effect of lowering the lipid amount was evaluated. To reduce the total lipid content of the LNPs, the LNP composition was altered by decreasing the N / P ratio (ratio of ionizable lipid to mRNA) and / or increasing the molar percentage of ionizable lipid.

[0216] The effect of lowering the lipid content on DPPs produced using leucine alone or in combination with mannitol is shown in Figure 4. The yield of dry powder improved due to the lower lipid content of LNPs (Figure 4A). For example, 15 mg of leucine per mg of mRNA resulted in a yield of over 30% for dry powders produced using LNPs with an N / P ratio of 7 and a modified lipid composition of DMG-PEG-2000:lipid 1:cholesterol:DOPE (5:50:30:15). In contrast, the same amount of leucine resulted in a yield of less than 20% for dry powders produced using LNPs with an N / P ratio of 7 and a standard lipid composition of DMG-PEG-2000:lipid A:cholesterol:DOPE (5:40:25:30). Similarly, for LNPs with an N / P ratio of 7 and a modified lipid composition of DMG-PEG-2000:lipid 1:cholesterol:DOPE (5:50:30:15), a yield of over 50% was observed for dry powders produced using a 1000 / 500 mg mannitol / leucine combination. On the other hand, for LNPs with an N / P ratio of 10 and a standard lipid composition of DMG-PEG-2000:lipid 1:cholesterol:DOPE (5:40:25:30), a yield of approximately 30% was detected using the same amount of mannitol / leucine. Reducing the lipid amount by decreasing the N / P and modifying the composition may have resulted in a decreased melting point and therefore a decreased tendency for adhesion, which led to increased yields. For the majority of formulations produced with lower lipid amounts, there was no significant difference in encapsulation efficiency (Figure 4C). The DP mean particle size was less than 3 μm for all DP formulations (Figure 4D). The experimental mRNA wt% increased slightly with decreasing lipid amounts (Figure 4D).

[0217] Although not shown here, lipid 2-based dry powders produced results similar to lipid 1, increasing yield and decreasing mean dry powder particle size with leucine alone or in combination with mannitol. Furthermore, there was no significant difference in mean particle size of the encapsulated and dry powder products, and decreasing the amount of lipid increased mRNA weight percent and yield.

[0218] DPP was visualized using a scanning electron microscope (SEM). Powder samples were sprinkled onto carbon adhesive tape attached to an SEM stub. Excess powder was removed by blowing with clean compressed air. Prior to imaging, the powder samples were sputter-coated with approximately 11 nm of gold-palladium alloy in two cycles to avoid overheating.

[0219] Several scanning electron microscope (SEM) images of representative dry powder products produced using lipid 1 are shown in Figures 5A-5G. Although not shown here, similar surface characteristics were observed for the lipid 2 dry powder. Dry powders produced using mannitol alone exhibited large spherical aggregates (Figure 5A), whereas small, protuberant-like particles were obtained using leucine alone (Figure 5B). These leucine-only particles exhibited a wrinkled, collapsed appearance and possessed significant porosity. Decreasing the lipid content of the LNPs of these particles did not significantly alter their surface properties. As shown in Figures 5C and 5D, rachis-like particles were obtained for both the N / P3 and modified LNP compositions, respectively. Dry powder particles obtained using the leucine-mannitol combination appeared smoother and more spherical (Figure 5E). The surfaces of these particles began to show slight pitting, wrinkles, and depressions due to beam damage with longer exposure to the electron beam, as shown in Figure 5F. These particles also appeared solid-like internally when viewed in cross section (Figure 5G). The spherical morphology of the mannitol / leucine combination DPP may be due to the higher excipient content and the presence of mannitol, which may have provided more material to form the matrix.

[0220] Example 5: In vitro efficacy of dry powders formulated with leucine and / or mannitol. This example describes the in vitro efficacy of different mRNA encapsulation formulations. All formulations were observed to exhibit reasonable efficacy.

[0221] HEK cells were plated in 12-well plates for 24 h, and then 0.5 × 10 6 Cells were transfected using dry powder at 1000 cells / well. Cells were transfected with mRNA encapsulated in lipids 1, 2, and 3 in the presence of various N / P ratios of leucine, mannitol, or both, and monitored for firefly luciferase (FFL) expression. Dry powder samples were reconstituted in OPTIMEM medium at 0.5 mg / ml mRNA concentration to generate a stock solution. The reconstituted dry powder was then diluted to the required mRNA concentration and used to transfect HEK cells. Protein expression was measured using ELISA after 24 hours. Cells expressing mCherry mRNA were counted using FACS analysis. Figure 6A summarizes the normalized relative luminescence units of all formulations. All categories were observed to demonstrate potency. However, mRNA encapsulated in lipid 3 showed lower potency compared to the other lipids.

[0222] In independent experiments, all DPPs formulated with FFL mRNA demonstrated successful in vitro transfection. As shown in Figure 6B, DPPs formulated with various excipient combinations and varying lipid contents demonstrated luminescence in transfected HEK293 cells, with a good correlation between dose and mCherry expression. Figures 6C and 6D demonstrate dose-response activity, with both the number of cells showing mCherry signal and the amount of mCherry protein expressed using this DPP increasing with increasing mRNA levels. These initial experiments, showing no significant loss of mRNA integrity due to the spray-drying process and successful in vitro transfection, suggested the feasibility of the DPP for in vivo evaluation. Based on these promising results, several lead DPPs formulated with various excipient and lipid combinations were selected for in vivo evaluation.

[0223] These experiments, showing no degradation of mRNA integrity due to the spray drying process and in vitro transfection efficiency, suggested the initial feasibility of DPP.

[0224] Example 6: Assessment of mRNA integrity. This example describes the evaluation of the integrity of spray-dried mRNA formulations. It was observed that the integrity of the mRNA was maintained.

[0225] Given the short exposure of LNPs to heat and stress during spray drying, the integrity of mRNA after spray drying was evaluated for DPPs. As shown in Figure 5. As shown in Figure 7A-7B, mRNA extracted from DPPs (Figure 7A) exhibits superimposable peaks compared to the control mRNA standard (Figure 7B), and there is no significant difference in mRNA integrity measured using capillary electrophoresis (CE). mRNA encapsulated in lipid 1 and lipid 3 was subjected to gel filtration, and the peak shape and elution volume were used to determine the mRNA integrity. Figures 7A and 7B summarize the mRNA elution profiles.

[0226] No change in mRNA integrity was observed after spray drying, and similar results were obtained for all FFL mRNA DPPs as well as the mCherry DPP used in Example 5.

[0227] Example 7: In vivo efficacy of dry powders formulated with leucine and / or mannitol. This example describes the evaluation of the in vivo efficacy of dry powder formulations.

[0228] Dry powders (2 mg each) were administered intratracheally using a dry powder injector to 6-8 week-old CD-1 male mice. For efficacy and inflammatory responses, saline was used as a negative control, and LPS dissolved in saline was used as a positive control for TNF-α measurements. Saline and LPS solutions were administered intratracheally using a catheter. 24 hours after intratracheal administration, all animals received 15 mg / mL D-luciferin at 3 mg / animal via subcutaneous (SC) injection at 0.2 mL / animal. After euthanasia, the animals were then euthanized, and BALF was collected for inflammatory responses, and lungs and tracheas were collected in Petri dishes for IVIS imaging.

[0229] As shown in Figure 8A, all FFL dry powder products using both lipid 1 and lipid 2 exhibited bioluminescence in the trachea and lungs of mice, suggesting successful delivery with sufficient deposition, sedimentation, and subsequent absorption of functional DPP with the desired mean particle size (<4 μm) in the lung parenchyma. Saline and lipopolysaccharide (LPS) controls did not exhibit bioluminescence. Overall, all dry powder products exhibited good distribution of bioluminescence in the trachea and both lungs, suggesting sufficient deposition, sedimentation, and subsequent absorption of the dry powder products in the lung parenchyma. Overall, protein expression of lipid 1 DPP was significantly increased by using mannitol and leucine in combination, rather than leucine alone, or by reducing the lipid content.

[0230] Furthermore, the lower solubility of leucine in the hydroalcoholic solvent and its higher surface activity may have resulted in the formation of low-density, corrugated dry powder product particles with improved aerosol performance. A comparison of the mean radiance of the dry powder products of both Lipid 1 and Lipid 2 is shown in Figure 8B. In general, all dry powder products with ionizable Lipid 2 showed higher mean radiance compared to those with Lipid 1, likely due to the inherent higher potency of ionizable Lipid 2. The potency of the dry powder products with Lipid 1 was found to be governed by the LNP composition, rather than the excipients, lipid content, or mRNA weight percent. As an example, no significant difference in mean radiance was detected at two different higher lipid A to mRNA weight ratios prepared using leucine alone. Similarly, changes in LNP composition did not significantly affect mean radiance for the mannitol-leucine combination. Meanwhile, the cumulative mean radiance of both mannitol-leucine DPPs was higher than that of both leucine-based DPPs (p-value 0.0224). This higher expression with the mannitol-leucine combination relative to lipid A DPP may be due to its spherical morphology, better aerosolization, dispersibility, and deposition in lung tissue. Cumulatively, DPP made using ionizable lipid 2 LNPs exhibited significantly higher mean radiance compared to lipid 1 (p-value 0.0082), likely due to the inherently higher activity of ionizable lipid 2 compared to lipid 1 (Figures 8B and 8C). No statistically significant differences in mean radiance were detected by varying the excipient or lipid amount in lipid B DPP, likely due to the higher intrinsic activity (potency) of lipid 2. In summary, beneficial conditions for mRNA LNP-DPP were achieved, resulting in significant improvements in formulation properties and delivery efficiency.

[0231] Example 8: Assessment of mRNA integrity with accelerated thermostability at 25°C This example evaluates whether there is a thermostability advantage associated with changing the formulation type by comparing the mRNA degradation profiles between dry powder and liquid formulations under accelerated thermostability conditions. The dry powder formulation was observed to have better mRNA integrity after 4 weeks of storage at 25°C compared to the liquid formulation.

[0232] Briefly, a dry powder formulation containing LNP-encapsulated mRNA was prepared using mannitol and leucine as excipients, as previously described. This dry powder formulation was stored at -80°C for approximately one year before being used in this accelerated study. A liquid control formulation was prepared with the same mRNA using a similar composition as the dry powder formulation, but was not spray-dried. This liquid LNP formulation was stored in a final buffer of 10% trehalose. Both formulations were then stored in an incubator at 25°C, and the change in mRNA integrity was analyzed weekly over a four-week period.

[0233] As shown in Figure 9, the % mRNA integrity in the dry powder formulation decreased by less than 10% after 4 weeks of storage at 25°C, while the % mRNA integrity in the liquid control formulation decreased by more than 30% after 4 weeks of storage at 25°C. The results demonstrate that the dry powder formulation maintains improved mRNA integrity compared to the liquid formulation under 25°C accelerated thermal stability conditions.

Claims

1. A dry powder formulation comprising messenger RNA (mRNA) encapsulated in lipid nanoparticles (LNPs), The LNPs comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids; the dry powder formulation comprising leucine and mannitol in a weight ratio of 1:1 to 1:10; The dry powder formulation has an average particle size of 1 to 8 μm.

2. 2. The dry powder formulation of claim 1, wherein the weight ratio of leucine to mannitol is 1:

8.

3. 2. The dry powder formulation of claim 1, wherein the weight ratio of leucine to mannitol is 1:

4.

4. A dry powder formulation comprising messenger RNA (mRNA) encapsulated in lipid nanoparticles (LNPs), The LNPs comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids; the dry powder formulation comprises a hydrophobic amino acid at a concentration of 4-65%; The dry powder formulation has an average particle size of 1 to 8 μm.

5. 5. The dry powder formulation of claim 4, wherein the hydrophobic amino acid is leucine, isoleucine, trileucine, proleucine, glycine, valine, phenylalanine, methionine, proline, or tryptophan.

6. 6. The dry powder formulation of claim 5, wherein the hydrophobic amino acid is leucine.

7. 7. The dry powder formulation of claim 1, wherein the lipid nanoparticles encapsulating the mRNA have an N / P ratio of 2 to 6.

8. 8. The dry powder formulation of claim 7, wherein the N / P ratio is 3-4.

9. 9. The dry powder formulation of claim 8, wherein the N / P ratio is 3.

10. The dry powder formulation of any one of claims 1 to 9, wherein the LNP further comprises one or more cholesterol-based lipids.

11. 11. The dry powder formulation of claim 1, wherein the one or more cationic lipids comprise approximately 30-70% by mole of the total lipids in the LNP.

12. 12. The dry powder formulation of claim 1, wherein the one or more PEG-modified lipids comprise approximately 1-15% by mole of the total lipids in the LNP.

13. 13. The dry powder formulation of any one of claims 1 to 12, wherein the one or more non-cationic lipids comprise about 10-40% by mole of the total lipids in the LNP.

14. 14. The dry powder formulation of any one of claims 10 to 13, wherein the one or more cholesterol-based lipids comprise approximately 5-40% by mole of the total lipids in the LNP.

15. 15. The dry powder formulation of any one of claims 10 to 14, wherein the molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids in the LNP is about 60:25:10:

5.

16. 15. The dry powder formulation of any one of claims 10 to 14, wherein the molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids in the LNP is about 40:25:30:

5.

17. 17. The dry powder formulation of any one of claims 1 to 16, wherein the average particle size is 1 to 5 μm.

18. 18. The dry powder formulation of any one of claims 1 to 17, wherein the average particle size is 1 to 3 μm.

19. 19. The dry powder formulation of any one of claims 1-18, wherein the mRNA comprises more than 2% by weight of the dry powder formulation.

20. 20. The dry powder formulation of any one of claims 1-19, wherein the mRNA comprises more than 3% by weight of the dry powder formulation.

21. 21. The dry powder formulation of any one of claims 1-20, wherein the mRNA comprises more than 4% by weight of the dry powder formulation.

22. The dry powder formulation of any one of claims 1 to 21, wherein the encapsulation rate of the LNP is greater than 60%.

23. 23. The dry powder formulation of any one of claims 1 to 22, wherein the encapsulation rate of the LNP is greater than 70%.

24. 24. The dry powder formulation of any one of claims 1 to 23, wherein the encapsulation rate of the LNP is greater than 80%.

25. 25. The dry powder formulation of any one of claims 1 to 24, wherein the mRNA maintains 80% or more integrity after spray drying.

26. 26. The dry powder formulation of any one of claims 1 to 25, wherein the mRNA maintains greater than or equal to 90% integrity after spray drying.

27. 27. The dry powder formulation of any one of claims 1 to 26, wherein the mRNA maintains greater than or equal to 95% integrity after spray drying.

28. 28. The dry powder formulation of any one of claims 1 to 27, wherein the mRNA maintains 80% or more of said integrity after storage at room temperature for 6 months or more.

29. 29. The dry powder formulation of any one of claims 1 to 28, wherein the mRNA maintains 90% or more of said integrity after storage at room temperature for 6 months or more.

30. 30. The dry powder formulation of any one of claims 1 to 29, wherein the mRNA maintains 80% or more of said integrity after storage at 4°C for 6 months or more.

31. 31. The dry powder formulation of any one of claims 1 to 30, wherein the mRNA maintains 90% or more of its integrity after storage at 4°C for 6 months or more.

32. 32. The dry powder formulation of any one of claims 1 to 31, wherein the mRNA maintains 80% or more of said integrity after storage at 25°C for 4 weeks or more.

33. 33. The dry powder formulation of any one of claims 1 to 32, wherein the mRNA maintains 90% or more of said integrity after storage at 25°C for 4 weeks or more.

34. 34. The dry powder formulation of any one of claims 1 to 33, wherein the mRNA maintains 95% or more of said integrity after storage at 25°C for 4 weeks or more.

35. 35. The dry powder formulation of any one of claims 1 to 34, having a moisture content of less than 0.5%.

36. 36. The dry powder formulation of any one of claims 1 to 35, having a moisture content of less than 0.1%.

37. 37. The dry powder formulation of any one of claims 1 to 36, wherein the mRNA encodes a therapeutic protein.

38. 38. The dry powder formulation of any one of claims 1 to 37, wherein the mRNA encodes an antigen.

39. 39. The dry powder formulation of any one of claims 1 to 38, wherein the mRNA encodes a vaccine.

40. 40. The dry powder formulation of any one of claims 1 to 39, which is inhalable.

41. 41. The dry powder formulation of any one of claims 1 to 40, which is nebulizable upon reconstitution.

42. 42. A method for in vivo delivery of mRNA, comprising administering to a subject in need thereof the dry powder formulation of any one of claims 1 to 41.

43. 42. A method of treating a disease or disorder in a patient by administering to the patient the dry powder formulation of any one of claims 1 to 41.

44. 44. The method of claim 42 or 43, wherein the dry powder formulation is administered by inhalation.

45. 44. The method of claim 42 or 43, wherein the dry powder formulation is administered by intranasal spray.

46. 44. The method of claim 42 or 43, wherein the dry powder formulation is administered by inhaler.

47. 1. A method of preparing a dry powder formulation, comprising: a) providing a mixture comprising lipid nanoparticles encapsulating mRNA; b) adding leucine and mannitol to the mixture in a weight ratio of 1:1 to 1:10; c) spray drying the mixture; d) obtaining said dry powder formulation having an average particle size of 1 to 8 μm. wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.

48. 48. The method of claim 47, wherein the weight ratio of leucine to mannitol is 1:

8.

49. 48. The method of claim 47, wherein the weight ratio of leucine to mannitol is 1:

4.

50. 1. A method of preparing a dry powder formulation, comprising: a) providing a mixture comprising lipid nanoparticles (LNPs) encapsulating mRNA; b) adding a hydrophobic amino acid to the mixture at a concentration of 4.0-65%; c) spray drying the mixture; d) obtaining said dry powder formulation having an average particle size of 1 to 8 μm. wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.

51. 51. The method of claim 50, wherein the hydrophobic amino acid is leucine, isoleucine, trileucine, proleucine, glycine, valine, phenylalanine, methionine, proline, or tryptophan.

52. 52. The method of claim 51, wherein the hydrophobic amino acid is leucine.

53. 53. The method of any one of claims 47 to 52, further comprising adding 20% ​​ethanol to the mixture.

54. 54. The method of any one of claims 47 to 53, wherein the spray drying step is carried out at a temperature below 90°C.

55. 55. The method of any one of claims 47 to 54, wherein the spray drying step is carried out at a temperature of from 20 to 70°C.

56. 56. The method of any one of claims 47 to 55, wherein the LNPs encapsulating the mRNA have an N / P ratio of 2 to 6.

57. 57. The method of any one of claims 47 to 56, wherein the N / P ratio is between 3 and 4.

58. 58. The method of any one of claims 47 to 57, wherein the N / P ratio is 3.

59. The method of any one of claims 47 to 58, wherein the LNP further comprises one or more cholesterol-based lipids.

60. 60. The method of any one of claims 47 to 59, wherein the one or more cationic lipids constitute approximately 30-70% by mole of the total lipids in the LNP.

61. The method of any one of claims 47 to 60, wherein the one or more PEG-modified lipids constitute approximately 1-15% by mole of the total lipids in the LNP.

62. 62. The method of any one of claims 47 to 61, wherein the one or more non-cationic lipids comprise about 10-40% by mole of the total lipids in the LNP.

63. 63. The method of any one of claims 59 to 62, wherein the one or more cholesterol-based lipids comprise about 5-40% by mole of the total lipids in the LNP.

64. 64. The method of any one of claims 59 to 63, wherein the molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids in the lipid nanoparticles is about 60:25:10:

5.

65. 64. The method of any one of claims 59 to 63, wherein the molar ratio of cationic lipids to non-cationic lipids to cholesterol-based lipids to PEG-modified lipids in the lipid nanoparticles is about 40:25:30:

5.

66. 66. The method of any one of claims 47 to 65, wherein the average particle size is 1 to 5 μm.

67. 67. The method of any one of claims 47 to 66, wherein the average particle size is 1 to 3 μm.

68. 68. The method of any one of claims 47-67, wherein the mRNA comprises more than 2% by weight of the dry powder formulation.

69. 69. The method of any one of claims 47-68, wherein the mRNA comprises more than 3% by weight of the dry powder formulation.

70. 70. The method of any one of claims 47-69, wherein the mRNA comprises more than 4% by weight of the dry powder formulation.

71. The method of any one of claims 47 to 70, wherein the encapsulation rate of the LNP is greater than 60%.

72. 72. The method of any one of claims 47 to 71, wherein the encapsulation rate of the LNP is greater than 70%.

73. 73. The method of any one of claims 47 to 72, wherein the encapsulation rate of the LNP is greater than 80%.

74. 74. The method of any one of claims 47 to 73, wherein the mRNA maintains 80% or more integrity after spray drying.

75. 75. The method of any one of claims 47 to 74, wherein the mRNA maintains 90% or more integrity after spray drying.

76. 76. The method of any one of claims 47 to 75, wherein the mRNA maintains 95% or more integrity after spray drying.

77. 77. The method of any one of claims 47 to 76, wherein the mRNA maintains 80% or more of said integrity after storage at room temperature for 6 months or more.

78. 78. The method of any one of claims 47 to 77, wherein the mRNA maintains 90% or more of said integrity after storage at room temperature for 6 months or more.

79. 79. The method of any one of claims 47 to 78, wherein the mRNA maintains 80% or more of said integrity after storage at 4°C for 6 months or more.

80. 80. The method of any one of claims 47 to 79, wherein the mRNA maintains 90% or more of said integrity after storage at 4°C for 6 months or more.

81. 81. The method of any one of claims 47 to 80, wherein the mRNA maintains 80% or more of said integrity after storage at 25°C for 4 weeks or more.

82. 82. The method of any one of claims 47 to 81, wherein the mRNA maintains 90% or more of said integrity after storage at 25°C for 4 weeks or more.

83. 83. The method of any one of claims 47 to 82, wherein the mRNA maintains 95% or more of said integrity after storage at 25°C for 4 weeks or more.

84. 84. The method of any one of claims 47 to 83, wherein the dry powder formulation has a moisture content of less than 0.5%.

85. 85. The method of any one of claims 47 to 84, wherein the dry powder formulation has a moisture content of less than 0.1%.

86. 86. The method of any one of claims 47 to 85, wherein the mRNA encodes a therapeutic protein.

87. The method of any one of claims 47 to 86, wherein the mRNA encodes an antigen.

88. 88. The method of any one of claims 47 to 87, wherein the mRNA encodes a vaccine.

89. 89. The method of any one of claims 47 to 88, wherein the dry powder formulation is inhalable.

90. 90. The method of any one of claims 47 to 89, wherein the dry powder formulation is nebulizable upon reconstitution.