Flow cell with removable coating

Incorporating independently removable coatings in reaction zones of biological and chemical vessels addresses inefficiencies by enabling controlled access and isolation of reactions, improving reaction specificity and efficiency.

JP2025541047APending Publication Date: 2025-12-18ILLUMINA INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024571875
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-21
Filing Date
2023-12-15
Publication Date
2025-12-18

AI Technical Summary

Technical Problem

Existing biological and chemical vessels with multiple reaction areas face challenges in controlling and isolating reactions efficiently, as they often require simultaneous interaction with multiple samples or pooled reactions, leading to interference and inefficiencies.

Method used

The introduction of independently removable protective coatings, such as gas-soluble or thermally responsive coatings, allows for controlled access to reaction zones, enabling selective activation and passivation of reaction zones, thereby isolating and managing reactions independently.

Benefits of technology

This approach enables precise control over reaction zones, allowing for efficient and controlled interactions in biological and chemical vessels, enhancing reaction specificity and reducing interference.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025541047000001_ABST
    Figure 2025541047000001_ABST
Patent Text Reader

Abstract

An example flow cell includes a substrate, a plurality of reaction regions spatially separated from one another across the substrate, and a plurality of independently removable coatings disposed on each of the plurality of reaction regions, each of the plurality of reaction regions including a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer, and at least one of the independently removable coatings is a gas-soluble coating.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 601,655, filed November 21, 2023, U.S. Provisional Patent Application No. 63 / 586,716, filed September 29, 2023, and U.S. Provisional Patent Application No. 63 / 387,874, filed December 16, 2022, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing Reference The Sequence Listing submitted herewith is incorporated by reference in its entirety. The file is named "ILI251B3PCT_IP-2712-PCT_Sequence_Listing.xml", the file size is 17,871 bytes, and the file creation date is December 11, 2023. [Background technology]

[0003] Some biological and / or chemical vessels, such as assay plates and flow cells, contain designated reaction areas in which surface chemistry that enables a desired interaction or reaction is localized. When a reactive species is introduced into the vessel, the reactive species interacts or reacts with the surface chemistry to generate a detectable signal (e.g., an electrical or optical signal). Many vessels are configured with multiple reaction areas in fluid communication with a single flow channel. In these vessels, a single sample can be introduced into the flow channel and its associated reaction area, or multiple samples can be pooled and introduced into the flow channel and its associated reaction area. Summary of the Invention

[0004] The biological and / or chemical reservoirs disclosed herein include multiple reaction regions spatially separated from one another across a substrate, each containing a respective reactive entity, which may be the same or different.

[0005] Each reaction zone can be coated with an independently removable protective coating, which can be a gas-soluble coating or a thermally responsive coating. These independently removable coatings allow controlled access to the reaction zones. For example, one or more coatings can be removed by exposure to heat generated by a heating mechanism, while one or more other coatings remain intact. As another example, one or more coatings can be removed by exposure to a reactive gas, while one or more other coatings remain intact. The reaction zones exposed by coating removal become active and can thereby participate in the designated reaction. The reaction zones whose coating(s) remain intact remain passivated or protected, and therefore inactive. [Brief explanation of the drawings]

[0006] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numbers correspond to similar, if not identical, components, and for the sake of brevity, reference numbers or features having a previously mentioned function may or may not be described with reference to other drawings in which they appear. [Figure 1A] FIG. 2 is a top view of the flow cell. [Figure 1B] FIG. 1B is a semi-schematic, partially cross-sectional and partially perspective view of an exemplary construction of the flow cell of FIG. 1A. [Figure 1C] 1B is a semi-schematic, partially cross-sectional and partially perspective view of another exemplary construction of the flow cell of FIG. 1A. [Figure 2A] FIG. 1 illustrates the chemical structure of an exemplary gas-soluble protective coating and reactions involving the gas-soluble protective coating. [Figure 2B] FIG. 2 shows the chemical structure of another example gas-soluble protective coating and reactions involving the gas-soluble protective coating. [Figure 3] FIG. 1 shows the chemical structure of an example thermally responsive protective coating and the reactions involving the thermally responsive protective coating. [Figure 4] FIG. 1 is a schematic diagram of a flow cell including a complementary metal oxide semiconductor (CMOS) imager bonded to a substrate. [Figure 5] FIG. 1 is a schematic diagram illustrating two exemplary methods (A., B., C., D., E. or A., ​​B., F., G., E.) utilizing gas-solubility or thermal-responsive protective coatings, where A. shows exposure to conditions for removal of one gas-solubility or thermal-responsive protective coating, B. shows introduction of a first library template strand, C. shows seeding of the first library template strand and exposure to conditions for removal of another gas-solubility or thermal-responsive coating, D. shows introduction of a second library template strand, and E. shows amplified template strands; where A. shows exposure to conditions for removal of one gas-solubility or thermal-responsive coating, B. shows introduction of the first library template strand, F. shows seeding and amplification of the first library template strand and exposure to conditions for removal of another gas-solubility or thermal-responsive protective coating, G. shows introduction of the second library template strand, and E. shows amplified template strands. [Figure 6A] 1 is a schematic cross-sectional view of reaction areas defined on protrusions and coated with different removable coatings, some of which include multiple sublayers. [Figure 6B] 1A-1C are schematic cross-sectional views of reaction areas defined on protrusions and coated with the same removable coating having different thicknesses.

[0007] definition Terms used herein should be understood to have their ordinary meaning in the relevant art unless otherwise specified. Some terms used herein and their meanings are described below.

[0008] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0009] The terms comprising, including, containing, and the various forms of these terms are synonymous and intended to be equally broad.

[0010] Terms such as top, bottom, lower, upper, on, etc. are used herein to describe the flow cell and / or various components of the flow cell. It should be understood that these directional terms are not meant to indicate a specific orientation, but are used to designate the relative orientation between components. The use of directional terms should not be construed to limit the examples disclosed herein to any specific orientation.

[0011] The terms first, second, etc. are also not meant to indicate a particular orientation or order, but rather are used to distinguish one component from another.

[0012] Ranges provided herein should be understood to include the stated range and any value or subrange within that stated range, as if such value or subrange were explicitly recited. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted to include not only the explicitly recited limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and subranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. Furthermore, when "about" and / or "substantially" are used to describe values, these are meant to encompass small variations (up to ±10%) of the stated value.

[0013] "Acrylamide monomer" has the structure

[0014] [ka] or a monomer containing an acrylamide group. An example of a monomer containing an acrylamide group is azidoacetamidopentyl acrylamide:

[0015] [ka] and N-isopropylacrylamide:

[0016] [ka] Other acrylamide monomers may also be used.

[0017] As used herein, the term "activation" refers to a process of generating reactive groups on the surface of a substrate. Activation can be achieved using silanization or plasma ashing. While the figures do not show a separate silanized layer or hydroxyl (-OH) groups from plasma ashing, it is understood that activation generates a silanized layer or -OH groups on the surface of the activated substrate or layer for covalently attaching the functionalized layer to the underlying substrate or layer.

[0018] An aldehyde, as used herein, is an organic compound containing a functional group having the structure -CHO, which includes a carbonyl center (i.e., a carbon double-bonded to oxygen) with a carbon atom also bonded to a hydrogen and an R group, such as an alkyl or other side chain. The general structure of an aldehyde is:

[0019] [ka] is.

[0020] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). The alkyl group can have 1 to 20 carbon atoms. Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an example, the designation "C1-4 alkyl" indicates that there are 1 to 4 carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and t-butyl.

[0021] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. Alkenyl groups can have 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0022] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. Alkynyl groups can have 2 to 20 carbon atoms.

[0023] As used herein, "aryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent carbon atoms) containing only carbon in the ring backbone. When aryl is a ring system, all rings in the system are aromatic. Aryl groups can have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.

[0024] An "amine" or "amino" functional group is -NR a R b refers to a group, wherein R a and R b are each, as defined herein, hydrogen (e.g.,

[0025] [ka] ), C1-6 (or C1-C6) alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle.

[0026] As used herein, the term "attached" refers to the state in which two things are joined, fastened, adhered, connected, or bonded to each other, either directly or indirectly. For example, nucleic acids can be attached to a polymer hydrogel layer by covalent or non-covalent bonds. Covalent bonds are characterized by the sharing of electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve the sharing of electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0027] An "azide" or "azido" functional group refers to an -N3.

[0028] As used herein, a "bonding region" refers to a region of a patterned structure that is bonded to another material, which may be, by way of example, a spacer layer, a lid, another patterned structure, etc., or a combination thereof (e.g., a spacer layer and a lid, or a spacer layer and another patterned structure). The bond formed in the bonding region may be a chemical bond or a mechanical bond (e.g., using fasteners, etc.).

[0029] As used herein, "carbocycle" refers to a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When a carbocycle is a ring system, two or more rings can be joined together in a fused, bridged, or spiro-connected manner. Carbocycles can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Thus, carbocycles include cycloalkyl, cycloalkenyl, and cycloalkynyl. Carbocyclic groups can have 3 to 20 carbon atoms. Examples of carbocyclic rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl.

[0030] As used herein, the term "carboxylic acid" or "carboxyl" refers to --COOH.

[0031] As used herein, "cycloalkylene" means a fully saturated carbocyclic ring or ring system attached to the rest of the molecule through two points of attachment.

[0032] As used herein, "cycloalkenyl" or "cycloalkene" means a carbocyclic ring or ring system having at least one double bond, wherein none of the rings within the ring system are aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also, as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbocyclic ring or ring system having at least one double bond and at least one heteroatom within the ring backbone, wherein none of the rings within the ring system are aromatic.

[0033] As used herein, "cycloalkynyl" or "cycloalkyne" means a carbocyclic ring or ring system having at least one triple bond, wherein none of the rings in the ring system is aromatic. An example is cyclooctyne. Another example is biclononyne. As used herein, "heterocycloalkynyl" or "heterocycloalkyne" means a carbocyclic ring or ring system having at least one heteroatom in the ring backbone, wherein the ring has at least one triple bond, wherein none of the rings in the ring system is aromatic.

[0034] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and which, in some cases, results in the modification of surface properties. Generally, deposition may be carried out using evaporation techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, etc.

[0035] As used herein, the term "recess" refers to a discrete concave feature defined in a substrate and having a surface opening at least partially surrounded by a void region(s) of the substrate. The recess can take a variety of shapes at the surface opening, such as, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross section of the recess taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0036] The term "each," when used in reference to a collection of items, is intended to identify each individual item in the set, but does not necessarily refer to every item in the set. Exceptions may occur where express disclosure or context clearly dictates otherwise.

[0037] As used herein, the term "epoxy" (also referred to as a glycidyl group or an oxirane group) refers to

[0038] [ka] Refers to...

[0039] As used herein, the term "flow cell" is intended to mean a vessel having a closed or open flow channel in which a reaction may be carried out. A flow cell having a closed channel also includes an inlet for delivering a reagent(s) to the flow channel and an outlet for removing a reagent(s) from the flow channel. In some examples, the flow cell allows for detection of a reaction occurring therein. For example, a flow cell may include one or more transparent surfaces that allow for optical detection of arrays, optically labeled molecules, etc. in designated reaction regions. As another example, a flow cell may include optics and electronics that facilitate electrical detection of a reaction occurring therein.

[0040] As used herein, a "flow channel" or "channel" can be (i) a region defined between two bonded components or (ii) a recessed region or lane defined within a single substrate. In either case, the "flow channel" or "channel" can selectively receive a liquid sample, reagent, or the like. In some examples, a flow channel can be defined between two patterned structures, thereby allowing the flow channel to be in fluid communication with the surface chemistry of each of the patterned structures. In other examples, a flow channel can be defined between a patterned structure and a lid, thereby allowing the flow channel to be in fluid communication with the surface chemistry of one patterned structure. In yet other examples, a flow channel can be defined by a recessed region formed in the surface of a substrate, thereby allowing the flow channel to be in fluid communication with the surface chemistry within the recessed region.

[0041] As used herein, the terms "gas-soluble layer," "gas-soluble coating," and "gas-soluble protective coating" refer to a (protective) coating capable of changing solubility when exposed to a reactive gas. The terms may refer to a material capable of preventing reactive entities from chemically reacting prior to removal of the gas-soluble layer. In some examples disclosed herein, after the gas-soluble coating is exposed to a reactive gas, the coating can be cleaned using an aqueous solvent.

[0042] As used herein, the term "gas-generating species" refers to a material that can generate or be converted into a reactive gas when exposed to a predetermined temperature change or when exposed to an acid or another pH-lowering agent (which results in a decrease in pH). The generated reactive gas can be used to remove a gas-soluble protective coating (as defined herein). In some examples described herein, the gas-generating species is contained in a recess defined in the flow cell substrate.

[0043] As used herein, the terms "thermally responsive layer," "thermally responsive coating," and "thermally responsive protective coating" refer to a (protective) coating (within a recess or covering a protrusion, as defined herein) that can undergo a phase transition (e.g., melting, transitioning from a hydrophobic state to a hydrophilic state, transitioning from a hydrophilic state to a hydrophobic state, etc.) when exposed to a specific temperature change. The temperature change can be generated by a heating mechanism included in a complementary metal oxide semiconductor chip coupled to a flow cell substrate (as described herein), by a heating mechanism included as part of the lid of the flow cell, by a heating mechanism included / embedded in the flow cell substrate, or by a heating mechanism disposed within a recess defined in the flow cell substrate.

[0044] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent atoms) that contains one or more heteroatoms, i.e., elements other than carbon, including, but not limited to, nitrogen, oxygen, and / or sulfur, in the ring backbone. When a heteroaryl is a ring system, all rings in the system are aromatic. Heteroaryl groups can have 5 to 18 ring members.

[0045] As used herein, "heterocycle" refers to a non-aromatic ring or ring system containing at least one heteroatom in the ring backbone. Heterocycles may be joined together in fused, bridged, or spiro-linked configurations. Heterocycles may have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Within the ring system, the heteroatom may be present in either the non-aromatic or aromatic ring. Heterocyclic groups may have 3 to 20 ring members (i.e., the number of atoms forming the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom is O, N, or S.

[0046] As used herein, the term "hydrazine" or "hydrazinyl" refers to the group -NHNH2.

[0047] As used herein, the term "hydrazone" or "hydrazonyl" means

[0048] [ka] refers to a group, wherein R a and R b are each independently selected from hydrogen, C alkyl, C alkenyl, C alkynyl, C carbocycle, C aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle, as defined herein.

[0049] As used herein, "hydroxy" or "hydroxyl" refers to an --OH group.

[0050] As used herein, the term "gap region" refers to a region of, for example, a substrate, that separates recesses or protrusions. For example, a gap region can separate one recess or protrusion of an array from another recess or protrusion of an array. Two recesses or protrusions that are separated from each other can be distinct, i.e., lack physical contact with each other. In many instances, the gap region is continuous, but the recesses or protrusions are discontinuous, as in the case of, for example, multiple recesses defined in an otherwise continuous surface or multiple protrusions defined in an otherwise continuous surface. The gap region can have a surface material that is different from the surface material of the recesses or protrusions. For example, the recesses can have a polymer hydrogel layer and a primer therein, while the gap region can be free of the polymer hydrogel layer and primer.

[0051] As used herein, "nitrile oxide" refers to

[0052] [ka] means a group, wherein R a is defined herein. Examples of the preparation of nitrile oxides include in situ generation from aldoximes by treatment with chloramide-T, or by the action of base on imidoyl chloride [RC(Cl)=NOH], or by reaction of hydroxylamine with an aldehyde.

[0053] As used herein, "nitrone" refers to

[0054] [ka] means a group, wherein R 3 except that it is not hydrogen (H). 1 , R 2 , and R 3 is R as defined herein a and R b It can be any of the groups.

[0055] As used herein, a "nucleotide" comprises a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of nucleic acid sequences. In RNA, the sugar is ribose, and in DNA, the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group at the 2' position of the ribose. The nitrogen-containing heterocyclic base (i.e., nucleobase) can be a purine or pyrimidine base. Purine bases include adenine (A) and guanine (G), as well as modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), as well as modified derivatives or analogs thereof. The C-1 atom of deoxyribose is linked to the N-1 atom of a pyrimidine or the N-9 atom of a purine. Nucleic acid analogs may have alterations in the phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include universal base or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNAs).

[0056] In some instances, the term "over" can mean that one component or material is positioned directly on top of another component or material. When one is directly on top of the other, the two are in contact with each other. For example, in FIG. 1B, when multi-layer substrate 18 is used, layer 28 is positioned directly on base support 26.

[0057] In other examples, the term "over" can mean that one component or material is indirectly positioned on another component or material. Indirectly means that a gap or additional component or material can be positioned between the two components or materials. For example, in FIG. 1B, when a multi-layer substrate 18 is used, polymer hydrogel 32 is indirectly positioned on base support 26. Layer 28 is positioned therebetween.

[0058] A "patterned structure" refers to a substrate that includes surface chemistry in a pattern, e.g., in recesses or as protrusions, across the substrate. The surface chemistry may include a polymeric hydrogel layer and a primer (e.g., used for capture and amplification of library templates). In some examples, the substrate has been exposed to a patterning technique (e.g., etching, lithography, etc.) to generate a pattern for the surface chemistry. However, the term "patterned structure" is not intended to imply that the pattern must be generated using such a patterning technique. Patterned structures may be generated via any of the methods disclosed herein.

[0059] As used herein, the term "polyhedral oligomeric silsesquioxane" refers to a hybrid intermediate between silica (SiO) and silicone (RSiO) (e.g., RSiO 1.5 An example of a polyhedral oligomeric silsesquioxane may be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-78, which is incorporated by reference in its entirety. In one example, the composition may have the chemical formula [RSiO 3 / 2 ] n where the R groups can be the same or different. Exemplary R groups of the polyhedral oligomeric silsesquioxanes include epoxy, azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate, and / or methacrylate, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups.

[0060] As used herein, "polymer hydrogel" refers to a gel material that is applied onto at least a portion of a substrate. The gel material includes functional groups that can attach to reactive entities, such as primers of a primer set. The polymer hydrogel layer can be disposed within a portion of a recess defined in the substrate, or can define a protrusion on the substrate.

[0061] As used herein, a "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers, referred to herein as amplification primers, function as initiation points for template amplification and cluster generation. Other primers, referred to herein as sequencing primers, function as initiation points for DNA synthesis. The 5' end of the primer may be modified to allow for coupling reactions with a polymer functional group. Primers can be any number of bases in length and can contain a variety of non-naturally occurring nucleotides. In one example, sequencing primers are short, ranging from 10 to 60 bases, or 20 to 40 bases.

[0062] As used herein, the term "protrusion" refers to a discrete convex feature defined on a substrate and surrounded by a void region(s) of the substrate. A protrusion can have any of a variety of shapes at the opening of the surface, including, by way of example, circular, elliptical, square, polygonal, star-shaped (having any number of vertices), etc. A cross-section of a protrusion taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc.

[0063] As used herein, the term "reactive entity" refers to the flow cell surface chemistry that allows for a desired interaction or reaction. By way of example, a reactive entity can be a primer that serves as the initiation point for template amplification and cluster generation, or an enzyme tag such as a transposome complex used in tagmentation, or a reactive functional group such as dibenzocyclooctyne (DBCO), a strained alkyne or azide, or biotin.

[0064] "Reactive region," as used herein, refers to a discrete region on or within a substrate that contains a polymeric hydrogel and a reactive entity.

[0065] A "removable coating," "protective coating," "protective layer," or "independently removable coating" is a layer disposed on a reaction area that can be removed from the reaction area without adversely affecting the polymeric hydrogel layer of the reactive entity in the reaction area. These terms can refer to an independently removable thermally responsive coating or a gas-soluble coating (as each of these terms is defined herein).

[0066] As used herein, a "spacer layer" refers to a material that bonds two components together. In some examples, the spacer layer can be or be in contact with a radiation absorbing material that aids in bonding.

[0067] The term "substrate" refers to a single layer or multilayer structure (including a base support and additional layers disposed thereon) into which a reaction region is incorporated.

[0068] A "thiol" functional group refers to -SH.

[0069] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine can be optionally substituted.

[0070] As used herein, "tetrazole" refers to a five-membered heterocyclic group containing four nitrogen atoms. The tetrazole can be optionally substituted.

[0071] Flow cell Some examples of flow cells disclosed herein include: i) a substrate; ii) a plurality of reaction regions spatially separated from one another across the substrate, each of the plurality of reaction regions comprising a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer; and iii) a plurality of independently removable coatings respectively disposed on each of the plurality of reaction regions, at least one of the plurality of independently removable coatings being a gas-soluble coating.

[0072] Another example of a flow cell disclosed herein includes: i) a substrate; ii) a plurality of reaction regions spatially separated from one another across the substrate, each of the plurality of reaction regions comprising a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer; iii) a heating mechanism aligned with at least one of the plurality of reaction regions; and iv) a plurality of independently removable coatings respectively disposed on each of the plurality of reaction regions, at least one of the plurality of independently removable coatings being a thermally responsive coating.

[0073] A top view of flow cell 10 is shown in Figure 1A, and two different examples of structures within flow channel 12 of flow cell 10 are shown in Figures 1B and 1C. Although not shown in Figures 1A-1C, a closed version of flow cell 10 can include one patterned structure 14, 14' bonded to a lid, or two patterned structures 14 or 14' bonded to each other. The examples shown in Figures 1B and 1C are open-wafer versions of flow cell 10 that include a single patterned structure 14 or 14' that is open to the ambient environment.

[0074] 1A includes eight flow channels 12. While eight flow channels 12 are shown, it should be understood that any number of flow channels 12 may be included in the flow cell 10 (e.g., a single flow channel 12, four flow channels 12, etc.). When multiple flow channels 12 are included, each flow channel 12 may be isolated from the other flow channels 12 such that fluid introduced into a flow channel 12 does not flow into adjacent flow channel(s) 12.

[0075] Each flow channel 12 may include an inlet and an outlet (not shown). The inlet and outlet of each flow channel 12 may be located at opposite ends of the flow cell 10. Alternatively, the inlet and outlet of each flow channel 12 may be positioned anywhere along the length and width of the flow channel 12 that allows for the desired fluid flow.

[0076] The inlets allow fluids to be introduced into the flow channel 12, and the outlets allow fluids to be withdrawn from the flow channel 12. Each of the inlets and outlets is connected to a fluid control system (e.g., including reservoirs, pumps, valves, waste containers, etc.) that controls the introduction and removal of fluids. Some examples of fluids introduced into the flow channel 12 may introduce reaction components (e.g., DNA sample(s), polymerase, sequencing primers, nucleotides, etc.), wash solutions, deblocking agents, etc.

[0077] The flow channel 12 can have any desired shape. In one example, the flow channel 12 has a substantially rectangular configuration with curved ends (as shown in FIG. 1A). The length of the flow channel 12 depends in part on the size of the substrate (e.g., 16 or 18, see FIGS. 1B and 1C) used to form the patterned structures 14, 14′. The width of the flow channel 12 depends in part on the size of the substrate 16 or 18 used to form the patterned structures 14, 14′, the desired number of flow channels 12, the desired spacing between adjacent channels 12, and the desired spacing around the patterned structures 14, 14′. The spacing between and around the flow channels 12 can be sufficient to attach the patterned structures 14, 14′ to a lid (not shown in FIGS. 1A-1C) or another patterned structure (also not shown).

[0078] The flow channel(s) 12 in a closed version of the flow cell 10 are defined between one patterned structure 14, 14' and a lid, or between a first patterned structure 14, 14' and a second patterned structure, which are joined together via a spacer layer (not shown). Thus, the flow channel(s) 12 in the closed configuration of the flow cell 10 are defined by (i) the patterned structure 14, 14', (ii) the spacer layer, and (iii) either the lid or the second patterned structure. Alternatively, if a single patterned structure 14 is used (e.g., as an open wafer substrate), the flow channel 12 may be defined by lanes (not shown) patterned (e.g., by nanolithography) into the substrate 14, defining recessed or protruding portions.

[0079] The depth of the flow channel 12 in a closed version of the flow cell 10 can be as small as a monolayer thickness if microcontact printing, aerosol printing, or inkjet printing is used to deposit a separate material (e.g., a spacer layer (not shown)) that defines at least a portion of the sidewalls of the flow channel 12. This depth can be greater if the spacer layer is preformed or applied by another technique. The depth of the flow channel 12 in an open wafer version of the flow cell 10 is approximately equal to the depth of the lanes (but is deeper in areas where recesses are formed). In any example disclosed herein, the depth of the flow channel 12 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In one example, the depth can range from about 10 μm to about 400 μm. In another example, the depth can range from about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or less. It should be understood that the depth of the flow channel 12 may be greater than, less than, or in between the values ​​specified above.

[0080] The spacer layer used to attach the patterned structures 14, 14′ and the lid (or to attach the first patterned structure 14, 14′ and the second patterned structure) can be any material that seals portions of the patterned structures 14, 14′ and the lid, or seals portions of two patterned structures together. By way of example, the spacer layer can be an adhesive, a radiation-absorbing material that aids in bonding, or the like. In some examples, the spacer layer is a radiation-absorbing material, such as KAPTON® Black.

[0081] The patterned structures 14, 14' and the lid (or the first patterned structures 14, 14' and the second patterned structure) may be bonded using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, glass frit bonding, or other methods known in the art.

[0082] If used, the lid can be any material transparent to the excitation light directed toward the flow cell 10. In optical detection systems, the lid can also be transparent to radiation generated from the reaction(s) occurring within the flow cell 10. By way of example, the lid can include glass (e.g., borosilicate, fused silica, etc.) or a transparent polymer. A commercially available example of a suitable borosilicate glass is D263® available from Schott North America Inc. Commercially available examples of suitable polymeric materials, i.e., cycloolefin polymers, are ZEONOR® products available from Zeon Chemicals LP. In some cases, the lid is molded to form the top of the flow cell 10; in other cases, the lid is molded to form both the top of the flow cell and the sidewalls of the flow channel 12. If used, the lid can include material for a heating mechanism (e.g., electrode material) that aligns with the reaction regions 29A, 29B of the flow cell 10. Examples of suitable electrode materials are described in more detail herein.

[0083] The patterned structures 14, 14' may include a bonding region 20 that can seal to a lid or a second patterned structure. The bonding region 20 may be located around each flow channel 12 (as shown in FIGS. 1B and 1C) and around the periphery of the flow cell 10. In an open wafer version of the flow cell 10, this region 20 outlines the periphery of the lane.

[0084] The patterned structures 14, 14' include a substrate 16 or 18, as shown in Figures 1B and 1C. The substrate 16 is a single-layer structure, while the substrate 18 is a multi-layer structure including a base support 26 and a layer 28 disposed on the base support 26. The substrate 16 may include a single material having recesses 22 defined therein or protrusions 24 defined thereon. The substrate 18 includes a base support 26 and a layer 28 disposed on the base support 26, with the other layer 28 having recesses 22 defined therein or protrusions 24 defined thereon.

[0085] Examples of materials suitable for the substrate 16 include siloxanes (e.g., epoxy siloxanes), glass, modified or functionalized glass, polymeric materials (such as acrylics, polystyrene and copolymers of styrene with other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (e.g., TEFLON® from Chemours), polyethylene terephthalate (PET), polycarbonate, cyclic olefins / cyclic olefin polymers (COP) (e.g., ZEONOR® from Zeon), polyimides, nylons (polyamides), etc.), ceramics / ceramic oxides, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), carbon, metals, resins, etc. Examples of suitable inorganic resins include inorganic oxides such as tantalum pentoxide (e.g., Ta2O5) or other tantalum oxides (Ta x O y ), aluminum oxide (e.g., Al2O3), silica (i.e., silicon dioxide (SiO2)), fused silica or silica-based materials, hafnium oxide (e.g., HfO2), indium tin oxide, titanium dioxide, etc. Examples of suitable polymer resins include polyhedral oligomeric silsesquioxane-based resins (e.g., POSS® from Hybrid Plastics), non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof.

[0086] As discussed above, an example of a multi-layer structure (i.e., substrate 18) includes a base support 26 and at least one other layer 28 thereon. Any of the examples of single-layer substrate 16 materials can be used as the base support 26. In the example of a flow cell 10 that includes a substrate 18, the other layer 28 can be any material that can be etched or imprinted to form the recesses 22. Examples of layer 28 include inorganic oxides such as tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon dioxide (e.g., SiO2), or hafnium oxide (e.g., HfO2), or polymeric resins such as polyhedral oligomeric silsesquioxane-based resins (e.g., POSS® from Hybrid Plastics), non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof.

[0087] Although not shown in FIGS. 1A-1C , in some examples, layer 28 of substrate 16 or substrate 18 includes a heating mechanism material aligned with the reaction region of substrate 16, 18. An example of a heating mechanism 74 or electrode 76 is shown in FIGS. 1B and 1C , where heating mechanism 74 or electrode 76 is embedded within substrate 16, 18. In other examples, heating mechanism 74 or electrode 76 is disposed at the bottom of each recess 22 (as shown in FIG. 5 ). In yet other examples, heating mechanism 74 or electrode 76 is affixed to the lid or at least partially embedded (as shown in phantom in FIG. 5 , where the lid is referenced as 116). As described with reference to FIG. 5 , heating mechanism 74 is generally used to remove thermally responsive coatings 36B-1, 36B-2, and electrode 76 is generally used to remove gas-soluble coatings 36A-1, 36A-2. However, it should be understood that some heating mechanism materials can also function as electrodes (i.e., the material is both a heating mechanism and an electrode). It should also be understood that the material selected for electrode 76 can be a low resistance material to minimize heat generation.

[0088] If the heating mechanism 74 or electrode 76 is embedded within the substrate 18, the heating mechanism material can be patterned on the base support 26 before other layers 28 are applied thereon. The pattern of the heating mechanism material is identical to the pattern of the reaction areas 29A, 29B to be formed. If the heating mechanism 74 or electrode 76 is embedded within the substrate 16 or lid 116, the heating mechanism material is completely surrounded by the substrate 16 or lid 116. In these examples, a panel of a suitable material for the substrate 16 or lid 116 can be etched or imprinted to form a recessed area into which the heating mechanism material will be introduced, and then additional substrate or lid material can be applied thereon to complete the substrate 16 or lid 116 with the heating mechanism 74 or electrode 76 embedded therein. If the heating mechanism 74 or electrode 76 is partially embedded within the lid 116, the heating mechanism material is partially surrounded by the lid 116. In these examples, a panel of a suitable material for the lid 116 can be etched or imprinted to form a recessed area into which the heating mechanism material will be introduced. In these examples, one side of the heating mechanism 74 or electrode 76 may be exposed on one side of the lid 116 .

[0089] In any of the examples described herein, the substrate 16 or base support 26 of the substrate 18 may be a circular sheet, panel, wafer, die, etc. having a diameter ranging from about 2 mm to about 300 mm, e.g., from about 200 mm to about 300 mm, or may be a rectangular sheet, panel, wafer, die, etc. having a maximum dimension of up to about 10 feet (about 3 meters). By way of example, the die may have a width ranging from about 0.1 mm to about 10 mm. While exemplary dimensions are provided, it should be understood that the substrate 16 or base support 26 may have any suitable dimensions.

[0090] Various examples of structures within flow channel 12 of flow cell 10 are shown in Figures 1B and 1C, respectively. In Figure 1B, recesses 22 are defined in substrate 16 or layer 28 of substrate 18 (to form patterned structure 14). In Figure 1C, protrusions 24 are defined on substrate 16 or layer 28 of substrate 18 (to form patterned structure 14').

[0091] Many different layouts of the recesses 22 or protrusions 24 are contemplated, including regular, repeating, and irregular patterns. In one example, the recesses 22 or protrusions 24 are arranged in a hexagonal lattice for close packing and increased density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be in an xy format with rows and columns. In some other examples, the layout or pattern may be a repeating arrangement of the recesses 22 or protrusions 24 and void regions 30. In yet other examples, the layout or pattern may be a random arrangement of the recesses 22 or protrusions 24 and void regions 30.

[0092] The layout or pattern may be characterized in terms of the density (number) of depressions 22 or protrusions 24 within a defined area. For example, the depressions 22 or protrusions 24 may be spaced apart by 1 mm 2 They may be present at a density of about 2 million per mm. 2 Approximately 100, 1mm per 2 Approximately 1,000 per 1mm 2 Approximately 100,000 per 1mm 2 Approximately 1 million per 1mm 2 Approximately 2 million per 1mm 2 Approximately 5 million per 1mm 2 Approximately 10 million per mm 2 The density can be adjusted to different densities, including densities of about 50 million per unit area, or higher or lower. It should be further understood that the density can be between one of the lower limit values ​​and one of the upper limit values ​​selected from the ranges above, or other densities (outside of the given ranges) can be used. By way of example, a high-density array can be characterized as having depressions 22 or protrusions 24 separated by less than about 100 nm, a medium-density array can be characterized as having depressions 22 or protrusions 24 separated by about 400 nm to about 1 μm, and a low-density array can be characterized as having depressions 22 or protrusions 24 separated by more than about 1 μm.

[0093] The layout or pattern of the depressions 22 or protrusions 24 may also, or alternatively, be characterized in terms of the average pitch, or the spacing from the center of one depression 22 or protrusion 24 to the center of an adjacent depression 22 or protrusion 24 (center-to-center spacing), or the spacing from the right edge of one depression 22 or protrusion 24 to the left edge of an adjacent depression 22 or protrusion 24. The pattern may be regular so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.15 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, or about 100 μm, or more or less. The average pitch of a particular pattern of depressions 22 or protrusions 24 may be between one of the lower values ​​and one of the upper values ​​selected from the ranges herein. In one example, the depressions 22 or protrusions 24 have a pitch (center-to-center spacing) of about 1.5 μm. Although examples of average pitch values ​​have been provided, it should be understood that other average pitch values ​​may also be used.

[0094] The size of each recess 22 may be characterized by its volume, opening area, depth, and / or diameter or length and width. For example, the volume may be about 1×10 -3 μm 3 ~about 100μm 3 ranges from about 1 × 10 -2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3 In another example, the opening area is about 1×10 -3 μm 2 ~about 100μm 2 ranges from about 1 × 10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2In yet another example, the depth may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less. In another example, the depth may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less. In yet another example, the diameter or each of the length and width may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less.

[0095] The size of each protrusion 24 can be characterized by its upper surface area, height, and / or diameter or length and width. The upper surface area is about 1×10 -3 μm 2 ~about 100μm 2 ranges from about 1 × 10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 The height may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less. The diameter or each of the length and width may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or more or less.

[0096] The flow cell 10 also includes reaction regions 29A and / or 29B. In the example shown in Figure 1B, the reaction regions 29A, 29B include a polymer hydrogel 32 coated within the recess 22 and further include a reactive entity 34 attached to the polymer hydrogel 32. In the example shown in Figure 1C, the reaction regions 29A, 29B include a polymer hydrogel 32 coated on the substrate 16 or layer 28 in the form of a protrusion 24 and further include a reactive entity 34 attached to the polymer hydrogel 32.

[0097] The polymer hydrogel 32 contained in the reaction areas 29A, 29B can be any gel material that can swell when a liquid is taken up and shrink when the liquid is removed, for example, by drying. In one example, the gel material is an acrylamide copolymer. Some examples of acrylamide copolymers are represented by the following structure (I):

[0098] [ka] During the ceremony, R A is selected from the group consisting of azide, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; R B is H or optionally substituted alkyl; R C , R D , and R E are each independently selected from the group consisting of H and optionally substituted alkyl; -(CH2) p - may be optionally substituted, p is an integer ranging from 1 to 50; n is an integer ranging from 1 to 50,000, and m is an integer ranging from 1 to 100,000.

[0099] One specific example of an acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide), PAZAM.

[0100] Those skilled in the art will recognize that the arrangement of the "n" and "m" repeating features in structure (I) is representative, and that the monomer subunits can be present in any order in the polymer structure (e.g., random, block, patterned, or combinations thereof). The molecular weight of the acrylamide copolymer can range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 1000 kDa, or in a specific example, can be about 312 kDa.

[0101] In some instances, the acrylamide copolymer is a linear polymer. In other instances, the acrylamide copolymer is a lightly crosslinked polymer.

[0102] In another example, the gel material can be a variation of structure (I). In one example, the acrylamide unit is N,N-dimethylacrylamide.

[0103] [ka] In this example, the acrylamide unit of structure (I) can be replaced by

[0104] [ka] where R D , R E , and R F are each H or C1-C6 alkyl, and R G and R H are each C1-C6 alkyl (rather than H as in acrylamide). In this example, q may be an integer ranging from 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide may be used. In this example, structure (I) contains, in addition to the repeated "n" and "m" features,

[0105] [ka] wherein RD , R E , and R F are each H or C1-C6 alkyl, and R G and R H are each C1-C6 alkyl. In this example, q can be an integer ranging from 1 to 100,000.

[0106] As another example of a gel material, the repeating "n" feature in structure (I) can be replaced with a heterocyclic azide group-containing monomer having structure (II):

[0107] [ka] In the formula, R 1 is H or C1-C6 alkyl, R2 is H or C1-C6 alkyl, L is a linker comprising a linear chain of 2-20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including 10 optional substituents on the carbon and any nitrogen atoms in the chain, E is a linear chain of 1-4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including optional substituents on the carbon and any nitrogen atoms in the chain, A is an N-substituted amide with H or C1-C4 alkyl attached to the N, and Z is a nitrogen-containing heterocycle. Examples of Z include 5-10 carbon-containing ring members present as single ring structures or fused structures. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0108] As yet another example, the gel material may include repeat units of each of structures (III) and (IV):

[0109] [ka] In the formula, R 1a , R 2a , R 1b and R 2b each independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl; R 3a and R3b each is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl, or optionally substituted C7-C14 aralkyl; 1 and L 2 are each independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0110] In further examples, the polymer hydrogel 32 is an alginate, acrylamide, or PEG-based material disclosed herein. In some examples, the polymer hydrogel 32 is a PEG-based material having an acrylate-dithiol or epoxide-amine reaction chemistry. In some examples, the polymer hydrogel 32 includes PEG-maleimide / dithiol oil, PEG-epoxide / amine oil, PEG-epoxide / PEG-amine, or PEG-dithiol / PEG-acrylate.

[0111] Further examples of suitable polymeric materials for the hydrogel 32 include functionalized polysilanes, such as norbornene silanes, azido silanes, alkyne-functionalized silanes, amine-functionalized silanes, maleimide silanes, or any other polysilanes with functional groups that can attach to the reactive entity 34. Other examples of suitable hydrogel materials for the hydrogel 32 include those with colloidal structures, such as agarose, or polymer mesh structures, such as gelatin, or those with cross-linked polymer structures, such as polyacrylamide polymers and copolymers, silane-free acrylamide (SFA), or azide-degraded versions of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or vinyl-containing acrylic acid, or from monomers that form a [2+2] photocycloaddition reaction. Still other examples of suitable polymeric hydrogels include mixed copolymers of acrylamide and acrylate. Various polymeric structures containing acrylic monomers (e.g., acrylamide, acrylates, etc.) may be utilized in the examples disclosed herein, including highly branched polymers such as dendrimers. For example, monomers (e.g., acrylamide, etc.) may be incorporated into the branches (arms) of the dendrimer, either randomly or in blocks.

[0112] An example of a dendritic polymer hydrogel material includes a dendritic core having repeating units of formulas (III) and (IV) in arms extending from the dendritic core, which may have anywhere from 3 to 30 arms.

[0113] The dendritic core may be any multifunctional entity that allows for a controlled polymerization mechanism, resulting in defined arm lengths in the polymer structure and at least substantially uniform arm lengths between polymer structures. In one example, the arms of the dendritic core are identical to each other.

[0114] The central molecule / compound of the dendritic core may be any polyfunctional molecule, such as a macrocycle (e.g., cyclodextrin, porphyrin, etc.), an extended π system (e.g., perylene, fullerene, etc.), a metal-ligand complex, a polymer core, etc. Some specific examples of the central molecule / compound of the dendritic core include a phenyl group, benzoic acid, pentraerythritol, a phosphazene group, etc.

[0115] The dendritic core comprises arms extending from a central molecule / compound. Each arm may comprise a group that allows for the incorporation of monomers of formulas (III) and (IV). In one example, a thiocarbonylthio group is contained in each arm, thus comprising a reversible addition-fragmentation chain transfer agent (RAFT agent). In another example, the dendritic core comprises an atom transfer radical polymerization (ATRP) initiator in each arm. In yet another example, the dendritic core comprises a nitroxide (aminooxyl)-mediated polymerization (NMP) initiator in each arm.

[0116] Functional groups within one or more repeat units of the hydrogel material of hydrogel 32 allow for the attachment of reactive entities 34. These functional groups (e.g., R 2 , NH2, N3, etc.) can be located on the side chains of linear or branched polymeric hydrogel materials. As mentioned above, one example of a branched polymeric hydrogel material is a dendrimer, and in one example, the primer grafting functional groups are located on each arm of the dendrimer. These functional groups may be introduced as part of the monomer(s) used in copolymerization. To control the number of anchoring points for the reactive entity 34, the amount of monomers bearing the functional groups can be increased or decreased. These functional groups may also be introduced after copolymerization.

[0117] It should be understood that other molecules may be used to form the polymeric hydrogel 32, as long as they can be functionalized with the desired chemistry, for example, to graft reactive entities 34.

[0118] The gel material of the polymer hydrogel 32 may be formed using any suitable copolymerization process, such as nitroxide-mediated polymerization (NMP), reversible addition-fragmentation chain transfer (RAFT) polymerization, or the like.

[0119] Attachment of the polymer hydrogel 32 to the underlying component (e.g., substrate 16 or layer 28) can be by covalent bonding. In some cases, the underlying substrate 16 or layer 28 may first be activated, for example, by silanization or plasma ashing, before attaching the polymer hydrogel 32 thereto. The covalent bonding helps maintain the polymer hydrogel 32 (and thus the reactive entity 34) in the desired area throughout the life of the flow cell 10 during various uses.

[0120] In each example, the polymer hydrogel 32 has a reactive entity 34 attached thereto. In some examples of the flow cell 10, the reactive entity 34 in each of the plurality of reaction regions 29A, 29B is a primer set. In one of these examples, the primer set is the same in each of the plurality of reaction regions 29A, 29B. In another of these examples, the primer set in at least one of the plurality of reaction regions 29A, 29B is different from the primer set in at least one other of the plurality of reaction regions 29B, 29A.

[0121] A primer set that can be used as reactive entity 34 includes two different primers used in continuous paired-end sequencing. In another example, reactive entity 34 is an enzyme tag, such as a transposome complex.

[0122] Thus, in one example, the reactive entities 34 in each of the plurality of reaction regions 29A, 29B are independently selected from the group consisting of primer sets and enzyme tags.

[0123] As described above, the reactive entity 34 can be a primer set. When used, the primer set includes two different primers used in continuous paired-end sequencing. For example, the primer set can include P5 and P7 primers, P15 and P7 primers, or any combination of PA primers, PB primers, PC primers, and PD primers described herein. For example, the primer set can include any two PA primers, PB primers, PC primers, and PD primers, or any combination of one PA primer and one PB primer, PC primer, or PD primer, or any combination of one PB primer and one PC primer or PD primer, or any combination of one PC primer and one PD primer.

[0124] Exemplary P5 and P7 primers are used on the surface of commercially available flow cells sold by Illumina Inc. for sequencing on, for example, HiSeq™, HiSeqX™, MiSeq™, MiSeqDX™, MiNISeq™, NextSeq™, NextSeqDX™, NovaSeq™, iSEQ™, Genome Analyzer™ and other instrument platforms.

[0125] The P5 primer (denoted as a cleavable primer due to the cleavable nucleobase uracil or "n") P5#1:5'→3' AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO: 1), P5#2:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 2) where "n" is inosine in SEQ ID NO: 2, or number 2, or P5#3:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 3), where "n" is the alkene-thymidine (i.e., alkene-dT) in SEQ ID NO: 3. The P7 primer (shown as a cleavable primer) may be either: P7#1:5'→3' CAAGCAGAAGACGGCATACGAnAT (SEQ ID NO: 4) wherein "n" is 8-oxoguanine in SEQ ID NO: 4; P7#2:5'→3' CAAGCAGAAGACGGCATACnAGAT (SEQ ID NO: 5), wherein "n" is 8-oxoguanine in SEQ ID NO:5. P7#3:5'→3' CAAGCAGAAGACGGCATACnAnAT (SEQ ID NO: 6) wherein "n" in both cases is 8-oxoguanine in SEQ ID NO:6; P7#4:5'→3' CAAGCAGAAGACGGCATACGAUAT (SEQ ID NO: 7), or P7#5:5'→3' CAAGCAGAAGACGGCATACUAGAT (SEQ ID NO: 8). The P15 primer (shown as the cleavable primer) is as follows: P15:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 9) where "n" is allyl-T (i.e., a thymine nucleotide analogue bearing an allyl functional group). Other primers mentioned above (PA-PD, shown as non-cleavable primers) include: PA 5'→3' GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ ID NO: 10) PB 5'→3' CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ ID NO: 11) PC 5'→3' ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ ID NO: 12), and PD 5'→3' GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ ID NO: 13).

[0126] Complementary versions of the exemplary PA-PD primers described herein can also be used. Although not shown in the exemplary sequences for PA-PD, it should be understood that any of these primers can contain a cleavage site (e.g., uracil, 8-oxoguanine, allyl-T, etc.) at any point in the strand.

[0127] Each of the primers disclosed herein may also include a poly-T sequence at the 5' end of the primer sequence. In some examples, the poly-T region includes 2 to 20 T bases. As specific examples, the poly-T region may include 3, 4, 5, 6, 7, or 10 T bases.

[0128] The 5' end of each primer may also include a linker. Any linker containing a terminal alkyne group, an internal alkyne group, or another suitable terminal functional group that can attach to the surface functional group of the polymer hydrogel 32 may be used. In one example, the primer is terminated with a hexynyl functional group. In another example, the 5' terminal functional group of the primer includes an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN) or dibenzocyclooctyne (DBCO)).

[0129] As described, in some examples, the same reactive entity 34 (e.g., a primer set) is attached to the polymer hydrogel 32 present in each of the recesses 22 or to the polymer hydrogel 32 forming each of the protrusions 24. For example, if a primer set is used as the reactive entity 34, the primer set can be the same in each of the plurality of reaction regions 29A, 29B. In other examples, one reactive entity 34 (e.g., a primer set including P5 primers and P7 primers) is attached to a subset of the recesses 22 or a subset of the protrusions 24, and a different reactive entity 34 (e.g., another primer set including PA primers and PB primers) is attached to a subset of the recesses 22 or a subset of the protrusions 24. Thus, in some examples (and as described herein), the primer set in at least one of the plurality of reaction regions 29A, 29B is different from the primer set in at least one other of the plurality of reaction regions 29A, 29B.

[0130] The construct shown in FIG. 1B can be produced by forming recesses 22 in layer 28 of substrate 16 or substrate 18, introducing polymer hydrogel 32 into recesses 22, and attaching reactive entities 34 (e.g., primers of a primer set) to polymer hydrogel 32.

[0131] The recesses 22 may be formed (in the layer 28 of the substrate 16 or substrate 18) using etching or nanoimprint lithography.

[0132] A mixture of polymer hydrogels 32 may be produced. In one example, the polymer hydrogel 32 may be in a mixture (e.g., with water, or with ethanol and water). The polymer hydrogel 32 may be blanket deposited on the substrate 16 or on the layer 28 of the substrate 18 and then removed from the interstitial regions 30 using abrasive techniques.

[0133] The reactive entity 34 may then be attached to the polymer hydrogel 32. As one example, a primer may be grafted to the polymer hydrogel 32. Grafting may be accomplished by flow-through deposition (e.g., using a temporarily attached lid), dunk coating, spray coating, droplet dispensing, or another suitable method. Each of these exemplary techniques may utilize a solution or mixture of reactive entities, which may include the reactive entity 34, water, a buffer, and a catalyst. With either grafting method, the reactive entity 34 attaches to reactive groups on the polymer hydrogel 32 and does not react with the interstitial regions 30. As another example, an enzyme tag may be attached via oligonucleotide hybridization or via biotin / streptavidin interaction. In oligonucleotide hybridization, the enzyme tag may include an oligonucleotide sequence that can hybridize to the polymer hydrogel-bound primer. In biotin / streptavidin interaction, the polymer hydrogel 32 may be biotinylated, and the enzyme tag may include streptavidin or streptavidin-biotin.

[0134] If a single type of reactive entity 34 is used, the reactive entity 34 may alternatively be pre-grafted to the polymeric hydrogel 32, and the pre-grafted hydrogel may be deposited and polished, or may be selectively deposited.

[0135] When multiple reactive entities 34 are used, some recesses 22 can be masked (e.g., with a photoresist or other suitable mask) and other recesses 22 can be grafted with one type of reactive entity 34. Alternatively, the reactive entities 34 can be pre-grafted to different instances of polymeric hydrogel 32, and the pre-grafted hydrogels can be individually and selectively deposited into the desired recesses 22.

[0136] 1C can be produced by forming protrusions 24 on a layer 28 of substrate 16 or substrate 18 using polymer hydrogel 32 and attaching reactive entities 34 to polymer hydrogel 32. The polymer hydrogel 32 mixture can be produced as described herein.

[0137] In one example, photoresist may first be deposited on substrate 16 or layer 28 and developed to remove the soluble photoresist portions desired to form protrusions 24 and leave the insoluble photoresist portions desired to form gap regions 30. A mixture including polymer hydrogel 32 may be blanket deposited and cured over the insoluble photoresist portions and exposed portions of substrate 16 or layer 28. The polymer hydrogel 32 applied to the exposed portions of substrate 16 or layer 28 becomes protrusions 24. The insoluble photoresist portions and the polymer hydrogel 32 thereon may be removed using an appropriate photoresist remover to expose gap regions 30.

[0138] Alternatively, a mixture containing polymer hydrogel 32 may be selectively deposited (using a mask that covers the gap regions 30, controlled printing techniques, etc.) to specifically deposit polymer hydrogel 32 in areas where it is desired to form protrusions 24.

[0139] The reactive entities 34 may then be grafted onto the protrusions 24. By way of example, grafting may be accomplished by flow-through deposition (e.g., using a temporarily bonded lid), dunk coating, spray coating, droplet dispensing, or another suitable method. Each of these exemplary techniques may utilize a solution or mixture of the reactive entities 34, which may include the reactive entities 34, water, a buffer, and / or a catalyst. With either grafting method, the reactive entities 34 attach to reactive groups on the polymer hydrogel 32 / protrusions 24 and do not react with the interstitial regions 30.

[0140] If a single reactive entity 34 is used, the reactive entity 34 may be pre-grafted onto the polymeric hydrogel 32, and the pre-grafted hydrogel may be deposited to form the protrusions 24 according to the examples described herein.

[0141] When multiple reactive entities 34 are used, some of the protrusions 24 can be masked (e.g., with a photoresist or other suitable mask) and other protrusions 24 have one type of reactive entity 34 grafted thereto. Alternatively, the reactive entities 34 can be pre-grafted to different samples of polymer hydrogel 32, and the pre-grafted hydrogels can be individually and selectively deposited to form the protrusions 24.

[0142] 1B and 1C, each of the flow cell constructs also includes independently removable coating(s) 36 disposed over the reaction areas 29A, 29B (thus, the coating(s) 36 are disposed over the polymer hydrogel 32 and over the reactive entities 34). The independently removable coating(s) 36 render the reaction areas 29A, 29B inactive (e.g., unable to participate in a designated chemical reaction) until the independently removable coating(s) 36 covering the particular reaction areas 29A, 29B are removed to expose the reaction areas 29A, 29B. Thus, the coating(s) 36 can be designed so that the particular reaction areas 29A, 29B are exposed for analysis or for a designated reaction at a specific time.

[0143] In some examples, substrate 16, 18 includes a plurality of recesses 22, each of a plurality of reaction regions 29A, 29B is disposed within a respective one of the plurality of recesses 22, and each of a plurality of independently removable coatings 36 covers a respective one of the plurality of reaction regions 29A, 29B. One of these examples is shown in FIG. 1B.

[0144] In some other examples, the substrate 16, 18 includes a plurality of protrusions 24, each of the plurality of reaction regions 29A, 29B is disposed on a respective one of the plurality of protrusions 24, and each of the plurality of independently removable coatings 36 covers a respective one of the plurality of protrusions 24. One of these examples is shown in FIG. 1C.

[0145] Each of the plurality of independently removable coatings 36 may have a thickness ranging from about 10 nm to about 1000 nm.

[0146] Next, different examples of materials and removal characteristics of the independently removable coating 36 are described.

[0147] In some examples of the flow cell 10, at least one of the multiple independently removable coatings 36 is a gas soluble coating 36A-1 or 36A-2 (shown in FIG. 5). Methods of using the gas soluble coating 36A-1 or 36A-2 are described in more detail herein with respect to FIG. 5. The gas soluble coatings 36A-1, 36A-2 comprise a material that can dissolve or undergo a physical and chemical change (e.g., in terms of solubility) when exposed to a reactive gas (e.g., carbon dioxide, oxygen, or reactive oxygen species). As described in more detail herein, the gas soluble coatings 36A-1, 36A-2 may also be removable from the reaction regions 29A, 29B by exposure to water (or another suitable aqueous solvent) and an inert gas (e.g., N) during the removal process.

[0148] Individual gas soluble coatings 36A-1, 36A-2 may be separately disposed on each of the recesses 22, or on each of the protrusions 24, or on a subset of the recesses 22 or protrusions 24, or one gas soluble coating 36A-1, 36A-2 may be in the form of a single layer extending over all of the reaction regions 29A, 29B (including over the gap region 30).

[0149] An example of the chemical structure of a suitable gas-soluble coating 36A-1, 36A-2 is shown in FIG. 2A. As shown in FIG. 2A, when the amines of the gas-soluble coating 36A-1, 36A-2 are exposed to water and CO gas in the presence of an inert gas (e.g., nitrogen gas N2, argon gas, etc.), the nitrogen atoms of the gas-soluble coating 36A-1, 36A-2 are protonated, making the coating structure more hydrophilic (and therefore removable using aqueous solvents). Another example of the chemical structure of a suitable gas-soluble coating 36A-1, 36A-2 is shown in FIG. 2B. As shown in FIG. 2B, when the structure is exposed to water and CO gas from a gas source in the presence of an inert gas (e.g., N2), the outer terminal nitrogen atoms of the triazole are protonated, making the coating structure more hydrophilic (and therefore removable using aqueous solvents).

[0150] Further examples of suitable gas soluble coatings 36A-1, 36A-2 chemical structures include:

[0151] [ka] Examples include:

[0152] Another example of a suitable gas-soluble coating 36A-1, 36A-2 is a thioether copolymer that transitions from a hydrophobic state to a hydrophilic state (e.g., converts to a sulfoxide or sulfone) upon exposure to oxygen or reactive oxygen species (e.g., hydrogen peroxide). Yet another example of a suitable gas-soluble coating 36A-1, 36A-2 is a phenylboronic acid pinacol ester that transitions from a hydrophobic state to a hydrophilic (e.g., phenolic) state upon exposure to reactive oxygen species such as hydrogen peroxide. Yet another example of a suitable gas-soluble coating 36A-1, 36A-2 is a trifluoroethyl methacrylate copolymer that becomes clear upon exposure to oxygen or reactive oxygen species and becomes cloudy upon exposure to an N2 purge.

[0153] In examples, the gas-soluble coatings 36A-1, 36A-2 may be selected from the group consisting of amine-based coatings, amidine-based coatings, guanidine-based coatings, oxygen-responsive copolymers, oxidation-responsive copolymers, and combinations thereof.

[0154] In some cases, two different gas-soluble protective coatings 36A-1, 36A-2 are included in the flow cell 10, with one gas-soluble coating 36A-1, 36A-2 covering the reaction region 29A and a different gas-soluble coating 36A-2, 36A-1 covering the reaction region 29B. In these examples, the removal conditions(s) (e.g., reactive gas) used to remove the first gas-soluble coating 36A-1, 36A-2 (e.g., covering the reaction region 29A or 29B) are insufficient to remove the other gas-soluble coating 36A-2, 36A-1 (e.g., covering the reaction region 29B or 29A). In other examples, the same gas-soluble coating 36A-1, 36A-2 is used for each of the reaction regions 29A, 29B.

[0155] 1B or 1C (and as described in more detail herein in connection with FIG. 5), when gas soluble coatings 36A-1, 36A-2 are used in flow cell 10, each of reaction regions 29A, 29B can include a gas-generating species capable of undergoing a chemical reaction to produce a reactive gas. Alternatively, when gas soluble coatings 36A-1, 36A-2 are used in flow cell 10, each of reaction regions 29A, 29B can be aligned with an electrode 76 capable of producing a reactive gas (e.g., a carbon anode that generates carbon dioxide gas, or a water electrolysis electrode that generates oxygen gas, e.g., a platinum anode, nickel anode, titanium anode, etc.).

[0156] In another example of the flow cell 10, at least one of the multiple independently removable coatings 36 is a thermally responsive coating 36B-1 or 36B-2 (also shown in FIG. 5). Methods for using the thermally responsive coatings 36B-1 and 36B-2 are described in more detail herein with respect to FIG. 5. Examples of suitable thermally responsive coatings 36B-1 and 36B-2 include polymeric materials that can undergo a phase change upon reaching a specific temperature. As one example, the thermally responsive polymer (of the thermally responsive coatings 36B-1 and 36B-2) can be a polymer that melts upon reaching a specific temperature. As another example, the thermally responsive polymer can be a polymer that transitions from a hydrophobic state to a hydrophilic state upon reaching a specific temperature, e.g., a UCST (upper critical solution temperature) polymer such as poly(acrylamide-co-acrylonitrile). As yet another example, the thermoresponsive polymer can be a polymer that transitions from a hydrophilic state to a hydrophobic state upon reaching a specific temperature, for example, an LCST (lower critical solution temperature) polymer such as poly(N-isopropylacrylamide) or PNIPAAm, which has a transition temperature of approximately 32°C to 44°C.

[0157] In examples, the thermo-responsive coatings 36B-1 and 36B-2 may comprise a polymer selected from the group consisting of polylactic acid, lactic acid-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof. An example of a wax that can be used as the thermo-responsive coatings 36B-1 and 36B-2 is paraffin, which melts at a temperature ranging from about 53°C to about 55°C. Another example of a wax that can be used as the thermo-responsive coatings 36B-1 and 36B-2 is gel-type wax, some examples of which melt at a temperature ranging from about 75°C to about 85°C. Further examples of waxes that can be used as the thermally responsive coatings 36B-1, 36B-2 include spermaceti (melting at a temperature ranging from about 41°C to about 49°C), beeswax (melting at a temperature ranging from about 61°C to about 63°C), and candelilla wax (melting at a temperature ranging from about 53°C to about 55°C).

[0158] Further specific examples of materials suitable for thermo-responsive coatings 36B-1 and 36B-2 and some corresponding transition temperatures include natural polymers such as gelatin (approximately 40° C.), hydroxypropyl cellulose (45° C. to 55° C.), and methyl cellulose (approximately 80° C.). Further examples include synthetic polymers such as poly(N-isopropylmethacrylamide) (38° C. to 44° C.), poly(N,N-diethylacrylamide) (32° C. to 34° C.), poly(methyl vinyl ether) (approximately 37° C.), polyvinyl alcohol (PVA) (approximately 125° C.), polyvinylpyrrolidone (PVP) (approximately 160° C.), poly(methacrylic) acid (approximately 75° C.), and poly(N-vinylcaprolactam) (approximately 30° C. to 50° C.). Further examples include copolymers such as poly(N-isopropylmethacrylamide)-co-acrylamide (approximately 33°C to 35°C), chitosan-grafted poly(N-isopropylmethacrylamide)-co-N,N-dimethylacrylamide (approximately 38°C), poly(N-isopropylmethacrylamide)-co-N-hydroxymethylacrylamide (approximately 34°C to 38°C), poly(N,N-dimethylaminoethyl) methacrylate-co-ethylene glycol diacrylate (approximately 32°C to 50°C), and block copolymers of polyethylene oxide and polypropylene oxide (PEO-b-PPO copolymers) (range of 20°C to 85°C). Further examples include polymers modified with magnetic nanoparticles, such as poly(N-isopropylmethacrylamide) with 18 wt% iron oxide nanoparticles embedded (approximately 32°C to 40°C) or poly(N-isopropylmethacrylamide) with 38 wt% iron oxide nanoparticles embedded (above 50°C). Further examples of materials suitable for thermoresponsive coatings 36B-1, 36B-2 and some corresponding LCST temperatures (in degrees Celsius) include PEG-based polymers and copolymers (range 20°C to 85°C), hydroxypropyl cellulose (approximately 40°C to 45°C), hydroxypropyl methylcellulose (approximately 69°C), ethylhydroxyethyl cellulose (approximately 35°C), and poly(asparagine) derivatives (approximately 28°C to 78°C).

[0159] An example of the chemical structure of the thermo-responsive coatings 36B-1 and 36B-2 is shown in FIG. 3, which represents the structure of a PNIPAAm polymer (where "Pr i (The " component represents an isopropyl group.) As shown in FIG. 3, heating the polymer results in the restructuring of hydrogen bonds within the polymer's chemical structure, resulting in a physical phase change within the polymer that facilitates removal of the polymer from flow cell 10.

[0160] Individual thermally responsive coatings 36B-1, 36B-2 may be separately disposed on each of the recesses 22 or on each of the protrusions 24, or one removable thermally responsive coating 36B-1, 36B-2 may be in the form of a single layer extending over all of the reaction regions 29A, 29B (including over the gap region 30).

[0161] In some cases, two different thermally responsive protective coatings 36B-1, 36B-2 are utilized, with one thermally responsive coating 36B-1, 36B-2 covering reaction area 29A and a different thermally responsive coating 36B-2, 36B-1 covering reaction area 29B. In these instances, the heating conditions used to remove one of the thermally responsive coatings 36B-1, 36B-2 (e.g., covering reaction area 29A or 29B) are insufficient to remove the other of the thermally responsive coatings 36B-2, 36B-1 (e.g., covering reaction area 29B or 29A). In other instances, the same thermally responsive protective coating 36B-1, 36B-2 is used to cover both reaction areas 29A, 29B.

[0162] 5, the thermally responsive coating(s) 36B-1, 36B-2 may be capable of being removed using heat generated by a heating mechanism 74, which may be included in the lid 116 of the flow cell 10 (when a lid 116 is utilized), or disposed within a recess 22 defined in the flow cell 10, or embedded in a layer 28 of the substrate 16 or substrate 18 of the flow cell 10, or as a component of a complementary metal oxide semiconductor chip bonded to the substrate 16, 26 of the flow cell 10. Examples of flow cells (e.g., flow cell 10′) including a complementary metal oxide semiconductor chip will now be described.

[0163] In addition to the components described herein for flow cell 10, flow cell 10' further includes a complementary metal oxide semiconductor (CMOS) chip 94 attached to the bottom of substrate 16 or attached to the bottom of base support 26 (e.g., of substrate 18). This flow cell 10' is shown in FIG.

[0164] In addition to the CMOS chip 94, this exemplary flow cell 10′ includes: i) a substrate 16 or 26; ii) a plurality of reaction regions 29A, 29B spatially separated from one another across the substrate 16 or 26, each of the plurality of reaction regions 29A, 29B including a polymer hydrogel layer 32 and a reactive entity 34 attached to the polymer hydrogel layer 32; iii) a heating mechanism 74 (not shown in FIG. 4 ) aligned with at least one of the plurality of reaction regions 29A, 29B; and iv) a plurality of independently removable coatings 36 disposed on each of the plurality of reaction regions 29A, 29B, respectively, at least one of the plurality of independently removable coatings 36 being a thermally responsive coating 36B-1, 36B-2 described herein. It should be understood that the examples of gas-soluble coatings 36A-1, 36A-2 described herein can be used as the removable coating(s) 36 of the flow cell 10′. In these examples, the heating mechanism 74 may be replaced with an electrode 76 capable of generating reactive gases.

[0165] The flow cell 10' includes reactive entities 34 within reaction regions 29A, 29B. The reactive entities 34 in each of the plurality of reaction regions 29A, 29B can be primer sets. In some examples, the primer sets are the same in each of the plurality of reaction regions 29A, 29B. In other examples, the primer set in at least one of the plurality of reaction regions 29A, 29B is different from the primer set in at least one other of the plurality of reaction regions 29B, 29A.

[0166] In some examples, the substrate 16, 26 of the flow cell 10′ includes a plurality of recesses 22, each of the plurality of reaction regions 29A, 29B is disposed within a respective one of the plurality of recesses 22, and each of the plurality of independently removable coatings 36 covers a respective one of the plurality of reaction regions 29A, 29B. This is shown in FIG.

[0167] Although not shown in FIG. 4, in some other examples of the flow cell 10′, the substrate 16, 26 includes a plurality of protrusions 24, each of the plurality of reaction regions 29A, 29B is disposed on a respective one of the plurality of protrusions 24, and each of the plurality of independently removable coatings 36 covers a respective one of the plurality of protrusions 24.

[0168] Each of the multiple independently removable coatings 36 may be a gas-soluble coating 36A-1, 36A-2 or a thermally responsive coating 36B-1, 36B-2 as described herein. When a thermally responsive coating 36B-1, 36B-2 is used, the coating 36B-1, 36B-2 may be selected from the group consisting of polylactic acid, lactic-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof. When used, the wax may be any suitable example of the wax provided herein.

[0169] The substrates 16, 26 may be directly attached to the CMOS chip 94 via one or more fastening mechanisms (e.g., adhesives, bonds, fasteners, etc.), thereby making physical contact with the CMOS chip 94. It should be understood that the substrates 16, 26 may be removably coupled to the CMOS chip 94.

[0170] The CMOS chip 94 includes multiple stacked layers 96, such as, for example, silicon layer(s), dielectric layer(s), metal-dielectric layer(s), metal layer(s), etc. The stacked layers 96 make up the device circuitry, including the detection circuitry.

[0171] The CMOS chip 94 includes optical components, such as optical sensor(s) 98 and optical waveguide(s) 100. The optical components are arranged such that each optical sensor 98 is at least substantially aligned with, and thereby operatively associated with, a single optical waveguide 100 and a single reaction region 29A or 29B of the flow cell 10′. However, in other examples, a single optical sensor 98 may receive photons via two or more optical waveguides 100 and / or from two or more reaction regions 29A, 29B. In these other examples, a single optical sensor 98 is operatively associated with two or more optical waveguides 100 and / or two or more reaction regions 29A, 29B.

[0172] As used herein, a single optical sensor 98 can be an optical sensor having one pixel or two or more pixels. By way of example, each optical sensor 98 has a pixel size of about 50 μm. 2 As another example, the detection area may be less than about 10 μm 2 As yet another example, the detection area may be less than about 2 μm 2In the latter example, the optical sensor 98 may comprise a single pixel. The average read noise of each pixel of the optical sensor 98 may be, for example, less than about 150 electrons. In other examples, the read noise may be less than about 5 electrons. The resolution of the optical sensor(s) 98 may be greater than about 0.5 megapixels (Mpixels). In other examples, the resolution may be greater than about 5 Mpixels or greater than about 10 Mpixels.

[0173] Also, as used herein, a single optical waveguide 100 may be an optical waveguide including a cured filter material that i) filters excitation light 104 (propagating from outside the flow cell 10′ into the flow channel 12) and ii) allows optical radiation (resulting from reactions in the reaction region(s) 29A, 29B, not shown) to propagate therethrough toward the corresponding optical sensor(s) 98. In one example, the optical waveguide 100 may be, for example, an organic absorption filter. As a specific example, the organic absorption filter may filter excitation light 104 at a wavelength of approximately 532 nm and allow optical radiation at wavelengths of approximately 570 nm or greater. The optical waveguide 100 may be formed by first forming a waveguide cavity in the dielectric layer 106 and then filling the waveguide cavity with an appropriate filter material.

[0174] The light guide 100 can be configured relative to the dielectric material 106 to form a light guiding structure. For example, the light guide 100 can have a refractive index of approximately 2.0 such that optical radiation is substantially reflected at the interface between the light guide 100 and the surrounding dielectric material 106. In a particular example, the light guide 100 is selected so that the optical density (OD) or absorbance of the excitation light 104 is at least approximately 4 OD. More specifically, the filter material can be selected and the light guide 100 can be dimensioned to achieve at least 4 OD. In other examples, the light guide 100 can be configured to achieve at least approximately 5 OD or at least approximately 6 OD.

[0175] In this example, the substrates 16, 26 function as passivation layers. At least a portion of the passivation substrates 16, 26 is in contact with the first buried metal layer 112 of the CMOS chip 94 and also in contact with the input region 110 of the optical waveguide 100. The contact between the passivation substrates 16, 26 and the first buried metal layer 112 can be direct contact or indirect contact via the shielding layer 114.

[0176] The substrates 16, 26 (passivation layers) may provide a level of corrosion protection for the buried metal layer 112 of the CMOS chip 94, which is closest to the substrates 16, 26. In this example, the substrates 16, 26 may include a passivation material that is transparent to optical radiation (e.g., visible light) resulting from reactions in the reaction regions 29A, 29B and is at least initially resistant to the fluid environment and moisture that may be introduced or present within the flow channel 12. The at least initially resistant material acts as an etch barrier to high pH reagents (e.g., pH in the range of 8-14) and as a moisture barrier. Examples of suitable materials for the substrates 16, 26 of the flow cell 10' include silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (TaO5), hafnium oxide (HfO2), boron-doped p+ silicon, etc. The thickness of the substrates 16, 26 may vary depending in part on the dimensions of the sensor. In one example, the thickness of the substrates 16, 26 is in the range of about 100 nm to about 500 nm.

[0177] The flow cell 10′ also includes a lid 116 operably connected to the substrates 16, 26 and partially defining the flow channel 12 between the substrates 16, 26 (and reaction region(s) 29A, 29B therein or thereon) and the lid 116. The lid 116 may be any material transparent to the excitation light 104 directed toward the reaction region(s) 29A, 29B. By way of example, as described with respect to the flow cell 10 of FIGS. 1A-1C, the lid 116 may include glass (e.g., borosilicate glass, fused silica, etc.), plastic, etc. A commercially available example of a suitable borosilicate glass is D263® available from Schott North America, Inc. A commercially available example of a suitable plastic material, i.e., a cycloolefin polymer, is the ZEONOR® product available from Zeon Chemicals LP.

[0178] In one example, the lid 116 of the flow cell 10′ can be a substantially rectangular block having at least a substantially flat outer surface 118 and at least a substantially flat inner surface 120 that defines a portion of the flow channel 12. The block can be placed on the material 64. Alternatively, the block can be etched such that the lid 116 defines both the top and side walls of the channel 12. In these examples, a thin layer of material 64 can bond the lid 116 to the substrate 16, 18. In one example, a recess can be etched into a transparent block. When the etched block is placed on the substrate 16, 26, the recess can become the flow channel 12.

[0179] The lid 116 may include an inlet port 122 and an outlet port 124 configured to fluidly engage with other ports (not shown) to direct fluid(s) into the flow channel 12 (e.g., from a reagent cartridge or other fluid storage system component) and out of the flow channel 12 (e.g., to a waste removal system).

[0180] As described above, the lid 116 may be physically connected to the substrate 16, 26 via the material 64. The material 64 is bonded to a portion of the surface of the substrate 16, 26 and extends between that portion of the lid 116 that contacts the substrate 16, 26. In some examples, the material 64 includes a curable adhesive layer that adheres the lid 116 to the substrate 16, 26 (over a portion of its surface).

[0181] The flow cell 10' also includes heating mechanism(s) 74 or electrode(s) 76 (again, both not shown in FIG. 4). The selection of heating mechanism(s) 74 or electrode(s) 76 and their positioning within the flow cell 10' depends on the removable coating used.

[0182] When the removable coating is a thermally responsive coating 36B-1, 36B-2, a heating mechanism(s) 74 is used, and the heating mechanism(s) 74 may be incorporated into the lid 116, the recess 22, the substrate 16, 18, or the CMOS chip 94. In one example, each of the multiple reaction regions 29A, 29B may be aligned with one or more heating mechanisms 74 included in the CMOS chip 94 itself (e.g., sandwiched between the optical waveguide 100 and the substrate 16 or 26).

[0183] The one or more heating mechanisms 74 may include one or more electrode materials capable of converting electricity into an appropriate amount of thermal energy to heat the thermally responsive coatings 36B-1 and 36B-2. When used, the one or more electrode materials have a thickness ranging from about 1 nm to about 20 nm, and therefore are transparent to wavelengths that may be used during sequencing operations. Suitable electrode materials for the heating mechanism 74 may include any suitable conductive material or alloy, such as copper, graphite, titanium, silver, platinum, or tungsten.

[0184] When the removable coating is a gas-soluble coating 36A-1, 36A-2, an electrode(s) 76 is used, and the electrode(s) 76 may be incorporated into the lid 116 or the recess 22. In one example, the electrode(s) 76 are carbon anodes.

[0185] It should be understood that because light emitted from reactions occurring in reaction regions 29A, 29B within flow cell 10' is directed toward optical waveguide 100, any heating mechanism 74 or electrode 76 within recess 22 or substrate 16, 18 should either i) be optically transparent if positioned between optical waveguide 100 and substrate 16, 18 or at the bottom of recess 22, or ii) be integrated along the sidewall of recess 22.

[0186] When used, each heating mechanism 74 or electrode 76 is spatially aligned with at least one reaction region 29A, 29B. In one example, each reaction region 29A, 29B is aligned with one heating mechanism 74 or electrode 76, thereby allowing each reaction region 29A, 29B to be independently addressable. Thus, the heating mechanism 74 or electrode 76 aligned with one reaction region 29A or 29B can be activated, while the heating mechanism 74 or electrode 76 aligned with the other reaction region 29A or 29B remains inactivated. In another example, a subset of reaction regions 29A, 29B (relative to all reaction regions in flow cell 10′) is aligned with one heating mechanism 74 or electrode 76, thereby allowing the reaction regions 29A, 29B in the subset to be addressed together. As an example, each of the two heating mechanisms 74 may individually address several, hundreds, thousands, or millions of reaction regions 29A, 29B, depending on the number of reaction regions 29A, 29B utilized, the spacing between the individual reaction regions 29A, 29B, and the size / number / layout of the heating mechanisms 74 or electrodes 76.

[0187] In one example of a flow cell 10' including multiple heating mechanisms 74 for heating multiple reaction regions 29A, 29B, a gap may desirably be included separating each heating mechanism 74 from the other heating mechanisms 74. The gap may help prevent thermal runaway and, therefore, undesired heating of the non-activated regions 29A or 29B. In one example, the gap ranges from about 1 mm to about 5 mm. The total space between adjacent heating mechanisms 74 may also be characterized in terms of the relative ratio of the total surface area occupied by the heating mechanisms 74 to the total surface area occupied by the gaps between the heating mechanisms 74, based on the total surface area of ​​the lid 116, or substrate 16, 18, or CMOS chip 94 on which the heating mechanisms 74 are disposed. In one example, the ratio of heating mechanisms 74 to gaps ranges from about 1:3 to about 3:1. In another example, the ratio of heating mechanisms 74 to gaps is about 2:1.

[0188] The flow channel 12 of the flow cell 10' can be sized and shaped to direct fluid along the reaction region(s) 29A, 29B. The height of the flow channel 12 and other dimensions of the flow channel 12 can be configured to maintain a substantially uniform flow of fluid along the reaction region(s) 29A, 29B. The dimensions of the flow channel 12 can also be configured to control bubble formation. In one example, the height (or depth) of the flow channel 12 can range from about 50 μm to about 400 μm. In another example, the height of the flow channel 12 can range from about 80 μm to about 200 μm. It should be understood that the height of the flow channel 12 can vary and can be greatest when the reaction regions 29A, 29B are located in reaction chambers (e.g., recesses 22) defined in the surface of the substrate 16, 26. In these examples, the recesses 22 increase the height of the flow channel 12 in this particular region.

[0189] In one example, reaction region 29A or 29B is at least substantially aligned with input region 110 of a single optical waveguide 100. Thus, optical radiation in reaction region 29A, 29B can be directed through waveguide 100 into input region 110 and to an associated optical sensor 98. In another example, one reaction region 29A, 29B can be aligned with multiple input regions 110 of multiple optical waveguides 100. In yet another example, multiple reaction regions 29A, 29B can be aligned with a single input region 110 of a single optical waveguide 100.

[0190] The buried metal layer 112 may be any suitable CMOS metal, such as aluminum (Al), aluminum chloride (AlCl), tungsten (W), nickel (Ni), or copper (Cu). The buried metal layer 112 is a functional part of the CMOS chip 94 and is also electrically connected to the optical sensor 98 through the stacked layers 96. Thus, the buried metal layer 112 participates in the detection / sensing operation. The buried metal layer 112 may also be configured to function as the heating mechanism 74.

[0191] It should be understood that the other optical sensors 98 and associated components may be configured in the same or similar manner. However, it should also be understood that the CMOS chip 94 need not be manufactured identically or uniformly throughout. Instead, one or more optical sensors 98 and / or associated components may be manufactured differently or have different relationships with respect to one another.

[0192] The stacked layers 96 may include interconnected conductive elements (e.g., conductors, traces, vias, interconnects, etc.) capable of conducting electrical current. The circuitry may be configured to selectively transmit a data signal based on the detected photons. The circuitry may also be configured for signal amplification, digitization, storage, and / or processing. The circuitry may collect and analyze the detected optical radiation and generate a data signal for communicating the detection data to a bioassay system. The circuitry may also perform additional analog and / or digital signal processing within the CMOS chip 94.

[0193] The CMOS chip 94 may be fabricated using an integrated circuit fabrication process. The CMOS chip 94 may include multiple layers, such as a sensor base / layer (e.g., a silicon layer or wafer). The sensor base may include an optical sensor 98. Once the CMOS chip 94 is fully formed, the optical sensor 98 may be electrically coupled to the rest of the circuitry in the stack layer 96 via gate(s), transistor(s), etc. As described, the CMOS chip 94 may further include a heating mechanism material that aligns with the reaction regions 29A, 29B of the flow cell 10′.

[0194] The CMOS chip 94 may have a thickness in the range of about 10 μm to about 200 μm. In one specific example, the CMOS chip 94 has a thickness of about 100 μm.

[0195] 4, the term "layer" is not limited to a single contiguous body of material unless otherwise specified. For example, a sensor base / layer may include multiple sublayers that are different materials and / or may include coatings, adhesives, etc. Furthermore, one or more layers (or sublayers) may be modified (e.g., etched, deposited with material, etc.) to provide the features described herein.

[0196] The stacked layers 96 also include a plurality of metal-dielectric layers, each of which includes a metal element (e.g., M1-M5, which may be, for example, W (tungsten), Cu (copper), Al (aluminum), or any other suitable CMOS conductive material) and a dielectric material 106 (e.g., SiO2). A variety of metal elements M1-M5 and dielectric materials 106 may be used, such as those suitable for integrated circuit fabrication.

[0197] In the example shown in FIG. 4, each of the multiple metal-dielectric layers L1-L6 includes both metal elements M1, M2, M3, M4, and M5 and a dielectric material 106. In each of layers L1-L6, the metal elements M1, M2, M3, M4, and M5 are interconnected and embedded within the dielectric material 106. Some of the metal-dielectric layers L1-L6 may also include additional metal elements. Some of these additional metal elements may be used to address individual pixels via row and column selectors. The voltages on these elements vary depending on which pixel the device is reading and may switch between approximately −1.4 V and approximately 4.4 V.

[0198] It should be understood that the configuration of metal elements M1, M2, M3, M4, M5 and dielectric layer 106 in FIG. 4 is an example of a circuit, and other examples may include fewer layers or additional layers and / or have different configurations of metal elements M1-M5.

[0199] 4, the shielding layer 114 is in contact with at least a portion of the base support 26 of the substrate 16 or substrate 18. The shielding layer 114 has an opening at least partially adjacent to the input region 110 of the optical waveguide 100. The opening allows the reaction regions 29A, 29B (and at least a portion of the optical emission therefrom) to be optically coupled to the waveguide 100. It should be understood that the shielding layer 114 may have an opening at least partially adjacent to the input region 110 of each optical waveguide 100. The shielding layer 114 may extend continuously between adjacent openings.

[0200] Shielding layer 114 may include any material capable of blocking, reflecting, and / or significantly attenuating optical signals propagating through flow channel 12. The optical signals may be excitation light 104 and / or optical emissions from reaction region(s) 29A, 29B. By way of example, shielding layer 114 may be tungsten (W).

[0201] It should be understood that the flow cell 10' can also be used for optical detection.

[0202] Any of the exemplary coatings 36 described herein can be used in combination to obtain a multi-layer coating. Several example multi-layer removable coatings 38A, 38B are shown in Figure 6A. In this example, at least one of the multiple independently removable coatings includes multiple sub-layers (i.e., is a multi-layer removable coating 38A, 38B), and the multiple sub-layers define the removal characteristics of at least one of the multiple independently removable coatings.

[0203] In this example, the multilayer removable coatings 38A and 38B require sequential heat or gas treatments to expose the underlying reaction regions 29A and 29B. The sequential treatments depend on the sublayers, e.g., coatings 361, 362, and 363, included in the stack. The sublayers in each of the multilayer removable coatings 38A and 38B can be selected so that a portion of the reaction regions 29A and 29B remains coated with at least some sublayers of the multilayer removable coating 38A or 38B, even when other sublayers of the multilayer removable coating 38A or 38B are removed, or when another multilayer removable coating 38B or 38A is completely removed. In the example shown in FIG. 6A , removal of the multilayer coating 38A involves sequential heating or gas exposure of coating 362 and then coating 361, while removal of the multilayer coating 38B involves sequential heating or gas exposure of coatings 363, 362, and then 361.

[0204] Any of the exemplary coatings described herein can have variable thicknesses to alter the removal characteristics of the independently removable coating 36. An example is shown in FIG. 6B. In this example, each of the coatings 364, 365, and 366 is composed of the same heat-responsive or gas-soluble coating, but has different thicknesses T1, T2, and T3. Thus, although the coatings 364, 365, and 366 are susceptible to the same removal characteristics (heat or gas), the rates at which the coatings 364, 365, and 366 dissolve or melt are different due to the different thicknesses T1, T2, and T3. In one example, thickness T1 < thickness T2 < thickness T3, where T1 ranges from about 10 nm to about 500 nm, T2 ranges from about 100 nm to about 500 nm, and T3 ranges from about 500 nm to about 1000 nm.

[0205] Although exemplary coatings 361, 362, 363, 364, 365, 366 are shown on the protrusions 24, it should be understood that these coatings 361, 362, 363, 364, 365, 366 may be used in the recesses 22 as well.

[0206] How to use the flow cell Two examples of methods for using flow cells 10, 10' including gas-soluble coatings 36A-1, 36A-2 are shown in Figures 5A, 5B, 5C, 5D, and 5E, respectively. These exemplary methods generally include: i) selectively removing at least one of a plurality of independently removable coatings 36 disposed on each of a plurality of spatially separated reaction regions 29A, 29B across the substrate 16, 18, thereby exposing at least one of the plurality of reaction regions 29A, 29B and a reactive entity 34 in at least one of the plurality of reaction regions 29A, 29B, wherein each of the plurality of reaction regions 29A, 29B includes a polymer hydrogel layer 32 and a reactive entity 34 attached to the polymer hydrogel layer 32, and at least one of the plurality of independently removable coatings 36 is a gas-soluble coating 36A-1, 36A-2; and ii) initiating a reaction involving the reactive entity 34.

[0207] 5A, a first gas soluble coating 36A-1 is shown applied over reaction region 29A of one of recesses 22, and a second gas soluble coating 36A-2 is shown applied over reaction region 29B of another of recesses 22. Gas soluble coating 36A-1 disposed over reaction region 29A may be the same as gas soluble coating 36A-2 disposed over reaction region 29B, or the two gas soluble coatings 36A-1, 36A-2 may be different (e.g., may be susceptible to removal under different gas conditions).

[0208] The gas-soluble coating(s) 36A-1, 36A-2 used in these exemplary methods may include any of the suitable materials described herein.

[0209] In step A, a reactive gas is used to selectively remove the gas-soluble coating 36A-1 covering the reactive entity 34A in the reaction region 29A. The reactive gas used to remove the gas-soluble coating 36A-1 depends on the material used for the coating 36A-1. The reactive gas used to remove the coating 36A-1 covering the reactive entity 34A can be carbon dioxide gas, oxygen gas, or activated oxygen species.

[0210] In some examples, the reactive gas used to remove coating 36A-1 at A is generated using electrode 76, which may be aligned with reaction region 29A as shown. Electrode 76 may be any electrode material included in lid 116 forming part of flow cell 10 (if used), any electrode material included / embedded in layer 28 of substrate 16 or substrate 18 of flow cell 10, any electrode material included in CMOS chip 94 coupled to the flow cell (thereby forming flow cell 10′), or any electrode material deposited within recess(es) 22 defined in flow cell 10 such that the electrode covers the bottom surface of recess(es) 22.

[0211] In some examples, a gas-generating species (not shown) may be embedded within reaction region 29A. In one of these examples, localized heating (induced by heating mechanism 74) may be used to decompose the gas-generating species, thereby generating a reactive gas when the gas-generating species reaches a predetermined temperature. In this example, the gas-generating species may be baking soda (sodium bicarbonate, NaHCO), which decomposes into carbon dioxide gas at approximately 80° C. and can then be used to remove coating 36A-1 on reaction region 29A. Alternatively, in this example, the gas-generating species may be sodium chlorate or lithium perchlorate, either of which may decompose at temperatures of approximately 300° C. or higher to generate oxygen gas. Additionally, in this example, heating mechanism 74 may also function as electrode 76.

[0212] In some other examples where the gas-generating species is embedded within the reaction region 29A, the gas-generating species can be converted to a gas by lowering the pH of the gas-generating species (e.g., by exposure to a suitable acid). In these examples, acid (or another source of pH-lowering H+ ions) is generated near the anode, and the acid or pH-lowering source of H+ ions deprotects the gas-generating species, liberating gaseous byproducts that can be used to remove the coating 36A-1. In certain examples, the gas-generating species includes a carbamate moiety (e.g., tert-butyl carbamate), and exposing the gas-generating species to an acid (HCl, trifluoroacetic acid (TFA), etc.) deprotects the carbamate and generates a gas (CO2). In some cases, the carbamate moiety is included in a gas-soluble coating 36A-1, and deprotection of the tert-butyl carbamate group renders the coating 36A-1 more hydrophilic (and therefore soluble).

[0213] As another example, the reactive gas used to remove the coating 36A-1 covering the reactive entity 34A is generated using a carbon anode, which in this example may be contained within the recess 22 (containing the reactive entity 34A) or within the lid 116 forming part of the flow cell 10, 10′.

[0214] In yet another example, gas initially trapped within recess 22 (e.g., within recess 22 containing reactive entity 34A) may be locally ruptured using locally applied acoustics or using heat generated by heating mechanism 74.

[0215] In yet another example, a controlled flow of reactive gas from an external source can be directed at a gas-soluble coating 36A-1 covering reaction region 29A.

[0216] Thus, the gas used to remove coating 36A-1 from reaction region 29A may be generated by (the decomposition of) a gas-generating species within reaction region 29A, from an electrode 76 (such as a carbon anode) aligned with reaction region 29A, or using a directed gas flow from an external source.

[0217] 2A and 2B, selectively removing the independently removable coating 36A-1 (e.g., from within reaction region 29A) includes exposing the independently removable coating 36A-1 to a reactive gas and then to water in the presence of an inert gas, thereby dissolving at least one of the independently removable coatings 36A-1. The removal process used to remove coating 36A-1 from over reaction region 29A may leave other coatings 36A-2 from over reaction region 29B substantially intact.

[0218] At B, template strands 40 of a first library of template strands are introduced and seeded onto reactive entities 34A exposed by removal of coating 36A-1 from reaction region 29A.

[0219] In some examples, the reactive entity 34 in each of the plurality of reaction regions 29A, 29B is a primer set. As explained, the primer set can be the same in each of the plurality of reaction regions 29A, 29B, or the primer set in at least one of the plurality of reaction regions 29A, 29B can be different from the primer set in at least one other of the plurality of reaction regions 29B, 29A. In the example shown in FIG. 5, the reactive entity 34A in reaction region 29A is shown as being different from the reactive entity 34B in reaction region 29B. As an example, the reactive entities 34A, 34B in two adjacent recesses 22 can be two different primer sets. However, in other examples, the same reactive entity 34A or 34B can be applied to each of the two adjacent recesses 22.

[0220] As the method continues at C, the seeded template strands 40 occupy a constant density of reactive entities 34A. Once seeding has occurred, additional reactive gas is used to selectively remove gas-soluble coating 36A-2 over reactive entities 34B. Gas-soluble coating 36A-2 over reactive entities 34B may be removed by any of the methods described herein for coating 36A-1 over reactive entities 34A.

[0221] At D, another template strand 40' of the second library of template strands is introduced and seeded onto reactive entity 34B (exposed by removal of gas-soluble coating 36A-2 from reaction region 29B). In one example, template strand 40' does not contain an adapter for hybridizing to reactive entity 34A and therefore is not seeded into recess(es) 22 containing reactive entity 34A. In this example, different recesses 22 may individually contain different reactive entities 34A, 34B (e.g., different primer sets). In another example, the recesses 22 exposed during seeding of template strand 40 may be smaller than the recesses 22 exposed during seeding of template strand 40'. In these examples, template strand 40' may be sterically blocked from seeding into recesses 22 containing template strand 40.

[0222] Each of the seeded template strands 40, 40' is then amplified and clustered across a respective reactive entity 34A, 34B, as shown in E. This produces a first library template amplicon 42 in at least one of the recesses 22 (e.g., in reaction region 29A) and a second library template amplicon 42' in at least one other of the recesses 22 (e.g., in reaction region 29B).

[0223] As the method continues from B. to F., the seeded template strands 40 are amplified and clustered across each reactive entity 34A to generate first library template amplicons 42. Once clusters of amplicons 42 have been generated using reactive entities 34A, additional reactive gas is used to selectively remove the gas-soluble coating 36A-2 covering reactive entities 34B. Any of the removal processes described for coating 36A-2 covering reactive entities 34B (in C) can also be used to remove coating 36A-2 covering reactive entities 34B (in F). In G., another template strand 40' of a second library of template strands is introduced and seeded onto reactive entities 34B. The seeded template strands 40' are then amplified and clustered across reactive entities 34B, as shown in E. This generates second library template amplicons 42' in the recesses 22 containing reactive entities 34B.

[0224] Two examples of methods for using flow cells 10, 10' including thermally responsive coatings 36B-1, 36B-2 are also shown in Figures 5A-E, and A, B, F, G, and E. These exemplary methods generally include: i) selectively removing at least one of a plurality of independently removable coatings 36 disposed on each of a plurality of spatially separated reaction regions 29A, 29B across the substrate 16, 18 by activating one or more heating mechanisms 74, thereby exposing at least one of the plurality of reaction regions 29A, 29B and a reactive entity 34 in at least one of the plurality of reaction regions 29A, 29B, wherein each of the plurality of reaction regions 29A, 29B includes a polymer hydrogel layer 32 and a reactive entity 34 attached to the polymer hydrogel layer 32, at least one of the plurality of independently removable coatings 36 is a thermally responsive coating 36B-1, 36B-2, and each of the plurality of reaction regions 29A, 29B is aligned with the one or more heating mechanisms 74; and ii) initiating a reaction involving the reactive entity 34.

[0225] In each of these methods, a first thermally responsive coating 36B-1 is shown applied over reaction region 29A in each of recesses 22, and a second thermally responsive coating 36B-2 is shown applied over reaction region 29B in each of recesses 22. The thermally responsive coating 36B-1 disposed over reaction region 29A can be identical to the thermally responsive coating 36B-2 disposed over reaction region 29B, or the two thermally responsive coatings 36B-1, 36B-2 can be different (e.g., susceptible to removal under different conditions). In the example shown in FIG. 5, the reactive entity 34A in one of the recesses 22 (e.g., in reaction region 29A) is shown as different from the reactive entity 34B in another one of the recesses 22 (e.g., in reaction region 29B). As an example, the reactive entities 34A, 34B in two adjacent recesses 22 can be two different primer sets. However, in other examples, the same reactive entity 34A or 34B may be applied to two adjacent recesses 22, respectively.

[0226] The thermally responsive coating(s) 36B-1, 36B-2 used in these exemplary methods may include any of the suitable materials described herein.

[0227] In Figure 1A, heating mechanism 74 is used to generate heat that selectively removes thermally responsive coating 36B-1 covering reactive entity 34A in reaction region 29A. As explained, heating mechanism 74 may be any heating mechanism material included in lid 116 (if used) forming part of flow cell 10, any heating mechanism material included / embedded in layer 28 of substrate 16 or substrate 18 of flow cell 10, any heating mechanism material included in CMOS chip 94 coupled to the flow cell (thereby forming flow cell 10'), or any heating mechanism material deposited within recess(es) 22 defined in flow cell 10 such that the heating mechanism material covers the bottom surface of recess(es) 22 or is embedded in the sidewalls of recess(es) 22.

[0228] The total amount of heat used by heating mechanism 74 to remove coating 36B-1 overlying reactive entity 34A may depend, in part, on the materials included in thermally responsive coating 36B-1 overlying reaction region 29A and the type / configuration of heating mechanism 74. Thus, in some cases, the heat generated by heating mechanism 74 may be adjusted (in magnitude) to facilitate removal of thermally responsive coating 36B-1 overlying reaction region 29A.

[0229] In some examples, selectively removing at least one (e.g., 36B-1) of the plurality of independently removable coatings 36 includes exposing at least one of the plurality of independently removable coatings 36 to heat generated by one or more heating mechanisms 74, thereby rendering at least one of the plurality of independently removable coatings 36 more soluble in an aqueous solvent.

[0230] At B, template strands 40 of a first library of template strands are introduced and seeded onto reactive entities 34A that have been exposed by removal of coating 36B-1 from reaction region 29A.

[0231] As the method continues at C, the seeded template strands 40 occupy a constant density of reactive entities 34A. Once seeding has occurred, additional heat (e.g., generated by heating mechanism 74) is used to selectively remove the thermally responsive coating 36B-2 covering reactive entities 34B. The heat generated by heating mechanism 74 can be adjusted (in magnitude) to facilitate removal of the thermally responsive coating 36B-2 covering reaction region 29B.

[0232] The thermally responsive coating 36B-2 covering the reactive entity 34B can be removed either by the same or a different heating mechanism 74 as the heating mechanism 74 used to remove the thermally responsive coating 36B-1. In a particular example, the thermally responsive coating 36B-2 covering the reactive entity 34B is removed using a heating mechanism 74 that is separate from the heating mechanism 74 used to remove the thermally responsive coating 36B-1 covering the reactive entity 34A. In this example, the two heating mechanisms 74 can be separated from each other by a gap ranging from about 0.5 mm to about 5 mm.

[0233] At D, another template strand 40' of the second library of template strands is introduced and seeded onto reactive entity 34B (exposed by removal of thermo-responsive coating 36B-2 from reaction region 29B). In one example, template strand 40' does not contain an adapter for hybridizing to reactive entity 34A and therefore is not seeded into recess(es) 22 containing reactive entity 34A. In this example, different recesses 22 may individually contain different reactive entities 34A, 34B (e.g., different primer sets). In another example, the recesses 22 exposed during seeding of template strand 40 may be smaller than the recesses 22 exposed during seeding of template strand 40'. In these examples, template strand 40' may be sterically blocked from seeding into recesses 22 containing template strand 40.

[0234] Each of the seeded template strands 40, 40' is then amplified and clustered across a respective reactive entity 34A, 34B, as shown in E. This produces a first library template amplicon 42 in at least one of the recesses 22 (e.g., in reaction region 29A) and a second library template amplicon 42' in at least one other of the recesses 22 (e.g., in reaction region 29B).

[0235] As the method continues (B. through F.), the seeded template strands 40 are amplified and clustered across each reactive entity 34A to generate first library template amplicons 42. Once clusters of amplicons 42 have been generated using reactive entities 34A, additional heat is used to selectively remove the thermo-responsive coating 36B-2 covering reactive entities 34B. At G., another template strand 40' of a second library of template strands is introduced and seeded onto reactive entities 34B. The seeded template strands 40' are then amplified and clustered across reactive entities 34B, as shown in E. This generates second library template amplicons 42' in at least one other recess 22.

[0236] 5 shows a specific example of the type of reaction performed, it should be understood that different reactions may be performed when a different reactive entity 34 is utilized. As an example, tagmentation may be performed when the reactive entity 34 is a transposome complex.

[0237] Terms 1. A flow cell comprising: A substrate; a plurality of reaction regions spatially separated from one another across the substrate, each of the plurality of reaction regions comprising: a polymer hydrogel layer, and a plurality of reactive regions comprising reactive entities attached to the polymeric hydrogel layer; a plurality of independently removable coatings respectively disposed on each of the plurality of reaction regions; A flow cell wherein at least one of the plurality of independently removable coatings is a gas-soluble coating. 2. The flow cell of clause 1, wherein the reactive entities in each of the plurality of reaction regions are primer sets. 3. The flow cell of clause 2, wherein the primer set is identical in each of the multiple reaction regions. 4. The flow cell of clause 2, wherein the primer set of at least one of the plurality of reaction regions is different from the primer set of at least one other of the plurality of reaction regions. 5. A flow cell according to any one of clauses 1 to 4, the substrate has a plurality of recesses; each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; A flow cell, wherein each of a plurality of independently removable coatings covers a respective one of a plurality of reaction regions. 6. A flow cell according to any one of clauses 1 to 4, The substrate has a plurality of protrusions, Each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; A flow cell, wherein each of a plurality of independently removable coatings covers a respective one of a plurality of protrusions. 7. The flow cell of any one of clauses 1-6, wherein the gas-soluble coating is selected from the group consisting of an amine-based coating, an amidine-based coating, a guanidine-based coating, an oxygen-responsive copolymer, an oxidation-responsive copolymer, and combinations thereof. 8. A method comprising: selectively removing at least one of a plurality of independently removable coatings respectively disposed on each of a plurality of reaction regions spatially separated from one another across the substrate, thereby exposing at least one of the plurality of reaction regions and a reactive entity in at least one of the plurality of reaction regions; each of the plurality of reaction regions includes a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer; at least one of the plurality of independently removable coatings is a gas soluble coating; and initiating a reaction involving the reactive entity. 9. The method of clause 8, wherein selectively removing at least one of the plurality of independently removable coatings comprises exposing at least one of the plurality of independently removable coatings to a reactive gas and water in the presence of an inert gas, thereby dissolving at least one of the plurality of independently removable coatings. 10. The method according to clause 8 or 9, the substrate has a plurality of recesses; each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; The method, wherein each of a plurality of independently removable coatings covers a respective one of a plurality of reaction regions. 11. The method according to clause 8 or 9, The substrate has a plurality of protrusions, Each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; The method, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of protrusions. 12. The method of any one of clauses 8 to 11, wherein the reactive entity in each of the plurality of reactive regions is a primer set. 13. The method of clause 12, wherein the primer set is identical in each of the multiple reaction regions. 14. The method of clause 12, wherein the primer set of at least one of the plurality of reaction regions is different from the primer set of at least one other of the plurality of reaction regions. 15. The method of any one of clauses 8-14, wherein the gas-soluble coating is selected from the group consisting of an amine-based coating, an amidine-based coating, a guanidine-based coating, an oxygen-responsive copolymer, an oxidation-responsive copolymer, and combinations thereof. 16. A flow cell comprising: A substrate; a plurality of reaction regions spatially separated from one another across the substrate, each of the plurality of reaction regions comprising: a polymer hydrogel layer, and a plurality of reactive regions comprising reactive entities attached to the polymer hydrogel layer; a heating mechanism aligned with at least one of the plurality of reaction regions; a plurality of independently removable coatings respectively disposed on each of the plurality of reaction regions; A flow cell, wherein at least one of the plurality of independently removable coatings is a thermally responsive coating. 17. The flow cell of clause 16, wherein the reactive entities in each of the plurality of reaction regions are primer sets. 18. The flow cell of clause 17, wherein the primer set is identical in each of the multiple reaction regions. 19. The flow cell of clause 17, wherein the primer set of at least one of the plurality of reaction regions is different from the primer set of at least one other of the plurality of reaction regions. 20. A flow cell according to any one of clauses 16 to 19, the substrate has a plurality of recesses; each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; A flow cell, wherein each of a plurality of independently removable coatings covers a respective one of a plurality of reaction regions. 21. A flow cell according to any one of clauses 16 to 19, The substrate has a plurality of protrusions, Each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; A flow cell, wherein each of a plurality of independently removable coatings covers a respective one of a plurality of protrusions. 22. The flow cell of any one of clauses 16 to 21, wherein the thermoresponsive coating is selected from the group consisting of polylactic acid, lactic-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof. 23. A method comprising: selectively removing at least one of a plurality of independently removable coatings respectively disposed on each of a plurality of spatially separated reaction regions across the substrate by actuating at least one heating mechanism, thereby exposing at least one of the plurality of reaction regions and reactive entities in at least one of the plurality of reaction regions; each of the plurality of reaction regions includes a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer; at least one of the plurality of independently removable coatings is a thermally responsive coating; at least one of the plurality of reaction zones aligned with at least one heating mechanism; and initiating a reaction involving the reactive entity. 24. The method of clause 23, wherein selectively removing at least one of the plurality of independently removable coatings comprises exposing at least one of the plurality of independently removable coatings to heat generated by at least one heating mechanism, thereby rendering at least one of the plurality of independently removable coatings soluble in an aqueous solvent. 25. A method according to clause 23 or 24, comprising: the substrate has a plurality of recesses; each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; The method, wherein each of a plurality of independently removable coatings covers a respective one of a plurality of reaction regions. 26. A method according to clause 23 or 24, comprising: The substrate has a plurality of protrusions, Each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; The method, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of protrusions. 27. The method of any one of clauses 23 to 26, wherein the reactive entity in each of the plurality of reactive regions is a primer set. 28. The method of clause 27, wherein the primer set is identical in each of the multiple reaction regions. 29. The method of clause 27, wherein the primer set of at least one of the plurality of reaction regions is different from the primer set of at least one other of the plurality of reaction regions. 30. The method of clause 23, wherein the thermoresponsive coating is selected from the group consisting of polylactic acid, lactic-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof.

[0238] Additional Notes It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (unless such concepts are mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms used expressly herein, and which may also appear in any disclosures incorporated by reference, should be given the meaning most consistent with the particular concepts disclosed herein.

[0239] References throughout this specification to "one example," "another example," "an example," etc. mean that particular elements (e.g., features, structures, and / or characteristics) described in connection with an example are included in at least one example described herein and may or may not be present in other examples. Additionally, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0240] Although several embodiments have been described in detail, it should be understood that the disclosed examples may be modified, and therefore the foregoing description should be considered non-limiting.

Claims

1. A flow cell, A substrate; a plurality of reaction regions spatially separated from one another across the substrate, each of the plurality of reaction regions comprising: a polymer hydrogel layer, and a plurality of reactive regions comprising reactive entities attached to the polymer hydrogel layer; a plurality of independently removable coatings respectively disposed on each of the plurality of reaction regions; A flow cell wherein at least one of the plurality of independently removable coatings is a gas-soluble coating.

2. 2. The flow cell of claim 1, wherein the reactive entities in each of the plurality of reaction regions are primer sets.

3. The flow cell of claim 2 , wherein the primer set is the same in each of the plurality of reaction regions.

4. 3. The flow cell of claim 2, wherein the primer set in at least one of the plurality of reaction regions is different from the primer set in at least one other of the plurality of reaction regions.

5. 10. The flow cell of claim 1, the substrate has a plurality of recesses, each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; A flow cell, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of reaction areas.

6. 10. The flow cell of claim 1, the substrate has a plurality of protrusions, each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; A flow cell, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of protrusions.

7. 10. The flow cell of claim 1, wherein the gas-soluble coating is selected from the group consisting of an amine-based coating, an amidine-based coating, a guanidine-based coating, an oxygen-responsive copolymer, an oxidation-responsive copolymer, and combinations thereof.

8. 1. A method comprising: selectively removing at least one of a plurality of independently removable coatings respectively disposed on each of a plurality of reaction regions spatially separated from one another across the substrate, thereby exposing at least one of the plurality of reaction regions and a reactive entity in the at least one of the plurality of reaction regions; each of the plurality of reaction regions includes a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer; at least one of the plurality of independently removable coatings is a gas soluble coating; and initiating a reaction involving said reactive entity.

9. 9. The method of claim 8, wherein selectively removing the at least one of the plurality of independently removable coatings comprises exposing the at least one of the plurality of independently removable coatings to a reactive gas and water in the presence of an inert gas, thereby dissolving the at least one of the plurality of independently removable coatings.

10. 9. The method of claim 8, the substrate has a plurality of recesses, each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; The method, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of reaction regions.

11. 9. The method of claim 8, the substrate has a plurality of protrusions, each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; The method, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of protrusions.

12. 9. The method of claim 8, wherein the reactive entity in each of the plurality of reaction regions is a primer set.

13. The method of claim 12, wherein the primer set is the same in each of the plurality of reaction regions.

14. 13. The method of claim 12, wherein the primer set in at least one of the plurality of reaction zones is different from the primer set in at least one other of the plurality of reaction zones.

15. 9. The method of claim 8, wherein the gas-soluble coating is selected from the group consisting of an amine-based coating, an amidine-based coating, a guanidine-based coating, an oxygen-responsive copolymer, an oxidation-responsive copolymer, and combinations thereof.

16. A flow cell, A substrate; a plurality of reaction regions spatially separated from one another across the substrate, each of the plurality of reaction regions comprising: a polymer hydrogel layer, and a plurality of reactive regions comprising reactive entities attached to the polymer hydrogel layer; a heating mechanism aligned with at least one of the plurality of reaction regions; a plurality of independently removable coatings respectively disposed on each of the plurality of reaction regions; A flow cell, wherein at least one of the plurality of independently removable coatings is a thermally responsive coating.

17. 17. The flow cell of claim 16, wherein the reactive entities in each of the plurality of reaction regions are primer sets.

18. 18. The flow cell of claim 17, wherein the primer set is the same in each of the plurality of reaction regions.

19. 18. The flow cell of claim 17, wherein the primer set in at least one of the plurality of reaction regions is different from the primer set in at least one other of the plurality of reaction regions.

20. 17. The flow cell of claim 16, the substrate has a plurality of recesses, each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; A flow cell, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of reaction areas.

21. 17. The flow cell of claim 16, the substrate has a plurality of protrusions, each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; A flow cell, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of protrusions.

22. 17. The flow cell of claim 16, wherein the thermo-responsive coating is selected from the group consisting of polylactic acid, lactic-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof.

23. 1. A method comprising: selectively removing at least one of a plurality of independently removable coatings respectively disposed on each of a plurality of spatially separated reaction regions across the substrate by actuating at least one heating mechanism, thereby exposing at least one of the plurality of reaction regions and a reactive entity in the at least one of the plurality of reaction regions; each of the plurality of reaction regions comprises a polymer hydrogel layer and a reactive entity attached to the polymer hydrogel layer; at least one of the plurality of independently removable coatings is a thermally responsive coating; at least one of the plurality of reaction regions aligned with the at least one heating mechanism; and initiating a reaction involving said reactive entity.

24. 24. The method of claim 23, wherein selectively removing the at least one of the plurality of independently removable coatings comprises exposing the at least one of the plurality of independently removable coatings to heat generated by the at least one heating mechanism, thereby rendering the at least one of the plurality of independently removable coatings soluble in an aqueous solvent.

25. 24. The method of claim 23, the substrate has a plurality of recesses, each of the plurality of reaction regions is disposed within a respective one of the plurality of recesses; The method, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of reaction regions.

26. 24. The method of claim 23, the substrate has a plurality of protrusions, each of the plurality of reaction regions is disposed on a respective one of the plurality of protrusions; The method, wherein each of the plurality of independently removable coatings covers a respective one of the plurality of protrusions.

27. 24. The method of claim 23, wherein the reactive entity in each of the plurality of reaction regions is a primer set.

28. 28. The method of claim 27, wherein the primer set is identical in each of the plurality of reaction regions.

29. 28. The method of claim 27, wherein the primer set in at least one of the plurality of reaction zones is different from the primer set in at least one other of the plurality of reaction zones.

30. 24. The method of claim 23, wherein the thermo-responsive coating is selected from the group consisting of polylactic acid, lactic-co-glycolic acid copolymer, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof.