A spatial rearrangement-based RNA sequencing library preparation method

Abstract

An RNA sequencing library preparation process utilizing template-switched oligonucleotide transposition to create libraries with UMI and spatial barcode information, as well as a method for improving RNA library preparation from tissue samples using template-switching and thermal amplification to improve RNA library quality.

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 477,103, filed December 23, 2022, U.S. Provisional Patent Application No. 63 / 586,872, filed September 29, 2023, and U.S. Provisional Patent Application No. 63 / 604,667, filed November 30, 2023, each of which is incorporated by reference in its entirety.

[0002] (Incorporation by reference of sequence disclosure) A sequence listing, which is part of this disclosure, is submitted herewith as a computer-readable file. The file containing the sequence listing is named "IP-2528-PC_SeqListing.xml," created on December 15, 2023, and is 19,146 bytes in size. The subject matter of the sequence listing is incorporated herein by reference in its entirety.

[0003] FIELD OF THE INVENTION The present disclosure relates to spatial rearrangement-based methods for preparing RNA-seq libraries, and in particular to methods for preparing RNA-seq libraries using spatial rearrangement-based methods, both with and without template-switch oligonucleotides. [Background technology]

[0004] Spatial transcriptomics enables highly multiplexed, spatially arranged gene expression analysis from fresh-frozen and formalin-fixed, paraffin-embedded (FFPE) tissue samples. To create a spatial sequencing library, transcripts must be spatially captured and barcoded from the tissue sample using a surface-based library preparation method. The sequencing library must also contain a unique molecular identifier (UMI) and sample index while maintaining an optimal length for sequencing. Current spatial workflows require fragmentation to create libraries of optimal fragment size for sequencing, containing UMI information on a barcoded surface. Current commercially available spatial workflows capture and convert less than 1% of the mRNA within a tissue section. Summary of the Invention

[0005] Presented herein are methods that result in higher capture and spatial library conversion from preserved tissue samples, such as frozen or FFPE tissue samples. In situ polyadenylation can enable capture of fragmented FFPE RNA on oligo-dT surfaces. Also provided herein are improved methods for synthesizing cDNA from isolated RNA transcripts to improve the overall synthesis and alignment quality of RNA sequences and spatial transcriptomics library preparation.

[0006] A method for preparing an RNA-seq library according to the present disclosure, comprising: loading a tissue sample onto a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise one or more gene-specific capture sequences and library barcode information comprising a spatial barcode sequence (SBC); capturing mRNA transcripts on the substrate using the capture oligonucleotides; and generating a first strand comprising a first cDNA complementary to the mRNA transcript and a TSO complement hybridized to the 5' end of the first cDNA under conditions. contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase and a template switch oligonucleotide (TSO), wherein the reverse transcriptase incorporates a non-templated cytosine nucleotide at the 5' end of the first cDNA, the TSO comprising a sequence that hybridizes to the non-templated cytosine nucleotide, and the reverse transcriptase extends to generate a TSO complement at the 5' end of the first cDNA that is the complement of the TSO; eluting the mRNA transcript from the substrate; and separating the first strand into a second strand synthesis mixture comprising a TSO primer. contacting the first strand with a synthesis mixture comprising a TSO primer and extending the TSO primer using the first strand as a template to generate a second strand complementary to the first strand, wherein the second strand comprises the TSO, a second cDNA complementary to the first cDNA, and second strand barcode information comprising a spatial barcode sequence complement (SBC') that is complementary to the spatial barcode sequence (SBC); eluting the second strand; and contacting the second strand with an extension mixture comprising an extension primer, while maintaining the single-stranded 3' region containing the library barcode information. Provided herein are methods that may include extending an extension primer using the second strand as a template to generate double-stranded products, wherein the extension primer hybridizes to a region of the second strand that does not contain second-strand barcode information; contacting the double-stranded products with transposomes under conditions that tag the double-stranded products to form tagged products that include unique molecular identifiers (UMIs) and PCR adapters; and amplifying the tagged products using index PCR to create a library.In some embodiments, the TSO comprises 2-5 guanosines that hybridize to non-templated cytosine nucleotides. In some embodiments, the 2-5 guanosines are riboguanosines. In some embodiments, the TSO comprises rGrGrG. In some embodiments, the TSO comprises a locked nucleic acid (LNA).

[0007] A method for preparing an RNA-seq library according to the present disclosure includes: loading a tissue sample onto a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise one or more gene-specific capture sequences and library barcode information comprising a spatial barcode sequence (SBC); capturing mRNA transcripts on the substrate using the capture oligonucleotides; contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase and a template switch oligo (TSO) under conditions that produce a first strand comprising a first cDNA complementary to the mRNA transcript and a TSO complement hybridized to the 5' end of the first cDNA; eluting the mRNA transcripts from the substrate; and contacting the first strand with a blocker oligonucleotide and the TSO to hybridize the blocker oligonucleotide and the TSO to the first strand, wherein a gap exists between the blocker oligonucleotide and the TSO. contacting the hybridized first strand with a non-strand-displacing polymerase to gap-fill the gap and generate a second cDNA; removing the blocker oligonucleotide to form a blocker-free first strand; contacting the blocker-free first strand with a transposome under conditions to tag the blocker-free first strand to form a tagged product comprising a unique molecular identifier (UMI) and a PCR adaptor; contacting the tagged product with an extension mixture to generate a second strand complementary to the first strand, wherein the second strand comprises second-strand barcode information having a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence, a second cDNA, a unique molecular identifier, and a PCR adaptor; eluting the second strand; and amplifying the second strand using index PCR to generate a library.

[0008] A method for preparing an RNA-seq library according to the present disclosure includes: loading a tissue sample onto a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise one or more gene-specific capture sequences and library barcode information comprising a spatial barcode sequence (SBC); capturing mRNA transcripts on the substrate using the capture oligonucleotides; contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase under conditions that produce a first strand comprising a first cDNA complementary to the mRNA transcript; eluting the mRNA transcripts from the substrate; and The method may include contacting the strand with a second strand synthesis mixture containing a random primer and extending the random primer to generate a second strand containing a second cDNA and a unique molecular identifier (UMI); eluting the second strand; amplifying the second strand to generate double-stranded products; contacting the double-stranded products with transposomes under conditions to form tagged products; and creating a library by amplifying the tagged products in a first index PCR to determine the SBC and amplifying the tagged products in a second index PCR to determine the UMI.

[0009] A method for preparing an RNA-seq library according to the present disclosure includes: loading a tissue sample onto a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a poly-T sequence and library barcode information comprising a spatial barcode sequence (SBC); capturing polyadenylated mRNA transcripts on the substrate using the capture oligonucleotides; and generating a first strand comprising a first cDNA complementary to the polyadenylated mRNA transcript and a TSO complement hybridized to the 5' end of the first cDNA. contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase and a template switch oligonucleotide (TSO), wherein the reverse transcriptase incorporates a non-templated cytosine nucleotide at the 5' end of the first cDNA, the TSO comprising a sequence that hybridizes to the non-templated cytosine nucleotide, and the reverse transcriptase extends to generate a complement of the TSO (TSO complement) at the 5' end of the first cDNA; eluting the polyadenylated mRNA transcript from the substrate; and contacting the first strand with a second strand synthesis mixture comprising a TSO primer. contacting the first strand with a synthesis mixture of the first strand and extending the TSO primer using the first strand as a template to generate a second strand complementary to the first strand, wherein the second strand comprises the TSO, a second cDNA complementary to the first cDNA, and second strand barcode information comprising a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence (SBC); eluting the second strand; and eluting the second strand with a poly-TVN primer (e.g., a poly(T) primer with a VN anchor at the 3' end, where V is G, A, or C). and N is any nucleotide), and extending the poly-TVN primer using the second strand as a template to generate double-stranded products while maintaining the single-stranded 3' region containing the library barcode information; contacting the double-stranded products with transposomes under conditions that tag the double-stranded products to form tagged products that include a unique molecular identifier (UMI) and a PCR adapter; and amplifying the tagged products using index PCR to create the library.Second strand extension, in some embodiments, can involve an incubation time with the poly-TVN extension mixture of less than 2 hours, e.g., 15 to 60 minutes. In some embodiments, the TSO comprises 2 to 5 guanosines that hybridize to non-templated cytosine nucleotides. In some embodiments, the 2 to 5 guanosines are riboguanosines. In some embodiments, the TSO comprises rGrGrG, and in some embodiments, the TSO comprises a locked nucleic acid (LNA).

[0010] A method for preparing an RNA-seq library according to the present disclosure includes: loading a tissue sample onto a substrate comprising a plurality of capture oligonucleotides, the capture oligonucleotides comprising a poly-T sequence and library barcode information comprising a spatial barcode sequence (SBC); capturing polyadenylated mRNA transcripts on the substrate using the capture oligonucleotides; contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase and a template switch oligo (TSO) under conditions that produce a first strand comprising a first cDNA complementary to the polyadenylated mRNA transcript and a TSO complement hybridized to the 5' end of the first cDNA; eluting the polyadenylated mRNA transcript from the substrate; and contacting the first strand with a blocker oligonucleotide and the TSO to hybridize the blocker oligonucleotide and the TSO to the first strand, wherein the blocker oligonucleotide and the TSO are spaced apart by a gap between the blocker oligonucleotide and the TSO. contacting the hybridized first strand with a non-strand-displacing polymerase to gap-fill the gap and generate a second cDNA; removing the blocker oligonucleotide to form a blocker-free first strand; contacting the blocker-free first strand with a transposome under conditions to tag the blocker-free first strand to form a tagged product comprising a unique molecular identifier (UMI) and a PCR adaptor; contacting the tagged product with an extension mixture to generate a second strand complementary to the first strand, wherein the second strand comprises second-strand barcode information having a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence, a second cDNA, a unique molecular identifier, and a PCR adaptor; eluting the second strand; and amplifying the second strand using index PCR to generate a library. In embodiments, the blocker oligonucleotide may be a 3' blocked SBS12'-polyA oligonucleotide.

[0011] A method for preparing an RNA-seq library according to the present disclosure includes: loading a tissue sample onto a substrate comprising a plurality of capture oligonucleotides, the capture oligonucleotides comprising a poly-T sequence and library barcode information comprising a spatial barcode sequence (SBC); capturing polyadenylated mRNA transcripts on the substrate using the capture oligonucleotides; contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase under conditions that produce a first strand comprising a first cDNA complementary to the polyadenylated mRNA transcripts; and transferring the polyadenylated mRNA transcripts to the substrate. contacting the first strand with a second strand synthesis mixture comprising a random primer to generate a second strand comprising a second cDNA and a unique molecular identifier (UMI); eluting the second strand; amplifying the second strand to generate double-stranded products; contacting the double-stranded products with transposomes under conditions to form tagged products; and creating a library by amplifying the tagged products in a first index PCR to determine the SBC and amplifying the tagged products in a second index PCR to determine the UMI.

[0012] In one aspect, the present disclosure provides a method for preparing a spatially barcoded RNA library from a tissue sample, comprising: a) contacting a tissue sample with a plurality of capture oligonucleotides immobilized on a solid substrate and capable of hybridizing to RNA in the tissue sample, wherein the capture oligonucleotides comprise a capture nucleotide sequence, a spatial barcode sequence (SBC), and an adapter sequence, and wherein the RNA transcripts are captured by the capture nucleotide sequences of the plurality of capture oligonucleotides; b) contacting the RNA transcript with a first strand synthesis mixture comprising a reverse transcriptase (RT) and a template switch oligonucleotide (TSO) encoding a first adapter sequence under conditions to produce a first strand cDNA complementary to the RNA transcript and a first strand cDNA comprising a TSO hybridized to the 3' end of the first strand cDNA, wherein the reverse transcriptase incorporates a non-templated cytosine nucleotide at the 3' end of the first strand cDNA, a TSO comprising the first adapter sequence is added to the 3' end of the first strand cDNA, and the reverse transcriptase extends to produce a TSO complement; wherein the contacting produces a mixture of template switch molecules and non-template switch molecules, wherein the non-template switch molecules lack a complement to the first adapter sequence; c) contacting the mixture with a plurality of oligo ligation blockers that comprise a first adapter sequence and are capable of hybridizing to a 3' end of a template switch molecule that comprises a complement to the first adapter sequence; d) performing a single-stranded ligation step comprising hybridizing a splint adapter to the non-template switch molecule, wherein the splint adapter comprises i) a single-stranded splint sequence comprising a random base sequence (N-X), and ii) a double-stranded first adapter sequence comprising a hybridized first adapter and a complement to the first adapter sequence, wherein the complement to the 5' end of the first adapter sequence contains a phosphate group for ligation to the 3' OH terminus of the captured non-template switch molecule, and ligating the 5' end of the splint adapter complement to the 3' OH terminus of the non-template switch molecule; e) removing the ligation blocker, the splint sequence, and the first adaptor from the ligated molecule.

[0013] In another aspect, the present disclosure provides a method for preparing a spatially barcoded RNA library from a tissue sample, comprising: a) contacting a tissue sample with a plurality of capture oligonucleotides immobilized on a solid substrate and capable of hybridizing to RNA in the tissue sample, wherein the capture oligonucleotides comprise a capture nucleotide sequence, a spatial barcode sequence (SBC), and an adapter sequence, and wherein the RNA transcripts are captured by the capture nucleotide sequences of the plurality of capture oligonucleotides; b) contacting the RNA transcript with a first strand synthesis mixture comprising a reverse transcriptase (RT) and a template switch oligonucleotide (TSO) encoding a first adapter sequence under conditions to produce a first strand cDNA complementary to the RNA transcript and a first strand cDNA comprising a TSO attached to the 3' end of the first strand cDNA, wherein the reverse transcriptase incorporates a non-templated cytosine nucleotide at the 3' end of the first strand cDNA, a TSO comprising the first adapter sequence is attached to the 3' end of the first strand cDNA, and the reverse transcriptase extends to produce a TSO complement; wherein the contacting produces a mixture of template switch molecules and non-template switch molecules, wherein the non-template switch molecules lack a complement to the first adapter sequence; c) contacting the mixture with a plurality of oligo ligation blockers that comprise a first adapter sequence and are capable of hybridizing to a 3' end of the template switch molecule that comprises a complement to the first adapter sequence, and a plurality of complementary oligo blockers that comprise a nucleotide sequence complementary to all or a portion of the capture nucleotide sequence and a fixed sequence in the capture oligonucleotide to generate a double-stranded 3' end of the capture oligonucleotide; d) performing a single-stranded ligation step comprising hybridizing a splint adapter to the non-template switch molecule, wherein the splint adapter comprises i) a single-stranded splint sequence comprising a random base sequence (NX), and ii) a double-stranded partial first adapter sequence comprising a hybridized first adapter and a complement to the first adapter sequence, wherein the complement to the 5' end of the first adapter sequence contains a phosphate group for ligation to the 3' OH terminus of the captured non-template switch molecule, and ligating the 5' end of the splint adapter complement to the 3' OH terminus of the non-template switch molecule; f) removing the ligation blocker and the splint strand of the adapter.

[0014] Oligo ligation blockers are contemplated to block the template switch molecule and / or the capture nucleotide, for example, as depicted in FIG. 12.

[0015] In various embodiments, the mixture of template switch molecules and non-template switch molecules is contacted with an exonuclease. In various embodiments, the exonuclease is DNA exonuclease I or RNAse H.

[0016] In various embodiments, the NX sequence has a blocking group at the 5' end of the NX sequence. In various embodiments, the hybridized first adaptor and complement to the first adaptor sequence comprise a blocking group at the end of both the first adaptor and the complement to the first adaptor sequence that is furthest from the splint sequence.

[0017] In various embodiments, the method further comprises contacting the mixture with an alkaline solution after the exonuclease.

[0018] In various embodiments, the method further includes, after the removing step, amplifying the templated switch molecule and the non-templated switch molecule by contacting the mixture with a second-strand synthesis mixture comprising a single first adapter primer and extending the first adapter primer using the first-strand cDNA or its complement as a template to generate a second-strand cDNA complementary to the first strand or its complement, wherein the second-strand cDNA comprises a second cDNA complementary to the first-strand cDNA and second-strand barcode information comprising a spatial barcode sequence complement (SBC') that is complementary to the spatial barcode sequence (SBC) in the capture oligonucleotide.

[0019] In various embodiments, the first adapter primer comprises a molecular identifier (SMI) sequence. In various embodiments, the molecular identifier of the first adapter primer is incorporated during second-strand cDNA synthesis. In various embodiments, the SMI is a UMI. In various embodiments, it is contemplated that when the first-strand cDNA comprises an SMI, the SMI on the first adapter primer is not the same as the SMI in the first-strand cDNA. See also Figure 22.

[0020] In various embodiments, the first adaptor primer is a full-length primer or a partial primer.

[0021] In various embodiments, the method further includes eluting the amplified first-strand and / or second-strand cDNA molecules from the substrate and generating a spatially barcoded RNA library from the eluted molecules using a library preparation kit.

[0022] In various embodiments, the ligated molecule of step (d) further comprises a cleavage sequence. In various embodiments, the capture oligo further comprises a cleavage site. In various embodiments, the cleavage site is 5' to the clustered sequence (e.g., P7).

[0023] In various embodiments, removing the ligation blocker, splint sequence, and first adaptor from the ligated molecules is performed away from the substrate, hi various embodiments, removing the ligation blocker is performed away from the substrate, and amplifying the templated switch molecules and non-templated switch molecules, eluting the second strand cDNA, and creating the spatially barcoded library are performed in solution.

[0024] In various embodiments, the amplifying step is performed on a substrate. In various embodiments, the amplified first strand and / or second strand further comprise a cleavage sequence. In various embodiments, the amplified molecule contains the cleavage sequence, and the amplified molecule is released from the substrate via the cleavage sequence.

[0025] In various embodiments, when the amplified molecules are cleaved from the substrate, eluting the second strand cDNA and creating the spatially barcoded library is performed in solution.

[0026] In various embodiments, the method optionally includes placing the tissue sample on a substrate containing a plurality of capture oligonucleotides before contacting the tissue with the plurality of capture oligonucleotides. In various embodiments, the capture nucleotide sequence is a poly-T sequence, a poly-A sequence, a gene-specific capture sequence, or a universal capture sequence. In various embodiments, the universal capture sequence is a random nucleotide sequence or a non-self-complementary semi-random sequence.

[0027] In various embodiments, the capture oligonucleotide comprises a 5' clustered sequence, a randomized spatial barcode (SBC), a full-length second adapter sequence (2 FL), a molecular identifier (MI), a fixed sequence (FS), and a polyT capture sequence (polyTVN) with a 3' VN terminus.

[0028] In various embodiments, the first adapter sequence is a Read 1 (Rd1) sequence. In various embodiments, the first adapter sequence is a Read 1 (Rd1) sequence and the second adapter is a Read 2 (Rd2) sequence. In various embodiments, the first adapter is a partial adapter sequence.

[0029] In various embodiments, the molecular identifier is a unique molecular identifier, an endogenous molecular identifier, an exogenous molecular identifier, or a virtual molecular identifier.

[0030] In various embodiments, the ligation step comprises enzymatic ligation of the splint adapter to the non-templated switch molecule, hi various embodiments, the enzymatic ligation is by T4 ligase, other DNA ligase, or thermostable 5'App DNA / RNA ligase-mediated ligation with a synthetic pre-adenylated single-stranded oligo adapter.

[0031] In various embodiments, the ligation step involves chemical ligation of a splint adapter to the non-template switch molecule. In various embodiments, chemical ligation is performed using click chemistry-mediated ligation (a 3' azido end is joined to a synthesized 5' alkyne single-stranded oligo) or 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC)-mediated ligation (a cDNA bearing a 3' phosphate group is ligated to a splint adapter bearing a 5' hydroxyl end). In various embodiments, 3' azido-ddNTP or 3' Phos-dATP is incorporated onto the Rd1 adapter during first-strand cDNA synthesis.

[0032] In various embodiments, the splint adapter random sequence comprises 6 to 10 nucleotides. In various embodiments, the splint adapter random sequence comprises 6, 7, 8, 9, or 10 nucleotides. In various embodiments, the splint adapter random sequence comprises 7 nucleotides.

[0033] In various embodiments, the splint adapter comprises blocking groups at both the 3' and 5' ends of the splint and a ligation blocking group at the 5' end of the adapter strand that is complementary to the splint strand. In various embodiments, the ligation blocker group is a phosphate, a 3' dideoxyC, a 3' inverted dT, a 3' carbon spacer, a 3' amino, or a 3' biotin. In various embodiments, the ligation blocker group is a phosphate.

[0034] In various embodiments, the ligation blocker and splint adapter are removed by alkaline treatment, which in various embodiments comprises either 0.08 M KOH or 0.1 N NaOH for 5 minutes at room temperature.

[0035] In various embodiments, the 5' clustered sequence comprises a P7 sequence.

[0036] In various embodiments, the capture oligonucleotide further comprises a randomer, a semi-random sequence, or a target-specific probe.

[0037] In various embodiments, the sequence that hybridizes to the non-templated cytosine nucleotide comprises 2-5 guanosines. In various embodiments, the guanosines are riboguanosines, modified nucleic acids, or locked nucleic acids (LNAs). In various embodiments, the sequence is rGrGrG.

[0038] In various embodiments, the poly-T sequence is 20-30 nucleotides.

[0039] In various embodiments, the SBC is a randomer. In various embodiments, the SBC is 20-30 nucleotides.

[0040] In various embodiments, the capture oligonucleotide comprises at least 8 deoxythymidine residues, hi various embodiments, the capture oligonucleotide is 8-80 nucleotides.

[0041] In various embodiments, the capture oligonucleotides comprise a plurality of different target-specific RNA capture probe sequences. In various embodiments, the target-specific probes comprise at least 8 nucleotides complementary to the nucleotide sequence of the target RNA. In various embodiments, the RNA capture oligonucleotides are 8 to 80 nucleotides, 10 to 70 nucleotides, 10 to 60 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, 10 to 20 nucleotides, 20 to 80 nucleotides, 20 to 70 nucleotides, 20 to 60 nucleotides, 20 to 50 nucleotides, 20 to 40 nucleotides, or 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, or 80 nucleotides long.

[0042] In various embodiments, the capture oligonucleotide comprises a P7 anchor sequence, a spatial barcode, and a sequence that hybridizes to the splint oligonucleotide.

[0043] In various embodiments, one or more of the first clustering sequence, index sequence, and / or read 2 sequence are added during or before second strand synthesis.

[0044] In various embodiments, the method further comprises performing end repair of RNA using polynucleotide kinase before capturing RNA from the tissue sample. In various embodiments, the method further comprises performing in situ polyadenylation using polyadenylate polymerase before capturing RNA from the tissue sample. In various embodiments, the method further comprises performing end repair of RNA using polynucleotide kinase, followed by in situ polyadenylation using polyadenylate polymerase before capturing RNA from the tissue sample.

[0045] In various embodiments, the RNA comprises ribosomal RNA (rRNA), messenger RNA (mRNA), non-coding RNA (ncRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), and / or microRNA (miRNA).

[0046] In various embodiments, the tissue sample is formalin-fixed paraffin-embedded (FFPE) tissue or fresh-frozen (FF) tissue.

[0047] In various embodiments, removing the RNA is accomplished by melting the RNA or by digestion with an RNase.

[0048] In various embodiments, the tissue sample is permeabilized before contacting the tissue sample with the plurality of capture oligonucleotides. In various embodiments, the tissue sample is treated with one or more blocking reagents before contacting the tissue sample with the plurality of capture oligonucleotides. In various embodiments, the tissue sample is permeabilized and treated with one or more blocking reagents before contacting the tissue sample with the plurality of capture oligonucleotides.

[0049] In various embodiments, the tissue is removed from the sample by enzymatic digestion. In various embodiments, tissue removal is performed before RNA is removed from the tissue. In various embodiments, the tissue is removed via digestion with proteinase K, for example, at 37° C. for 40 minutes.

[0050] In various embodiments, the substrate is a bead, a bead array, a spot array, a substrate containing multiple wells, a flow cell, clustered particles disposed on the surface of a chip, a film, or a plate. In various embodiments, the substrate comprises multiple nanowells or microwells.

[0051] In various embodiments, the substrate or substrate surface comprises a material selected from glass, silicon, poly-L-lysine coated material, nitrocellulose, polystyrene, cyclic olefin copolymer (COC), cyclic olefin polymer (COP), polyacrylamide, polypropylene, polyethylene, or polycarbonate.

[0052] In various embodiments, the RNA library is an mRNA library.

[0053] In various embodiments, the method comprises: performing PCR on the second strand cDNA to obtain PCR templates representing one or more RNA transcripts in the tissue sample; Eluting the PCR template; performing index PCR to generate a double-stranded PCR product comprising a first strand PCR product and a second strand complementary to the first strand PCR product; and indexing and sequencing the second strand cDNA comprising:

[0054] In various embodiments, the method further comprises sequencing the PCR product and determining the location of the RNA transcript in the tissue based on the spatial barcode.

[0055] In various embodiments, the double-stranded PCR products comprise a second clustered sequence on the second strand that is complementary to the first-strand PCR product, and optionally an index sequence. In various embodiments, the double-stranded PCR products are further processed by tagging to create a spatial transcriptomics library.

[0056] In various embodiments, tagging comprises tagging onto a substrate.

[0057] In various embodiments, tagging comprises contacting the double-stranded product with a transposome and a carrier genomic DNA (gDNA).

[0058] In various embodiments, the method further comprises determining the spatial location of the spatial barcodes of the plurality of capture oligonucleotide molecules prior to the step of contacting the tissue with the substrate.

[0059] In various embodiments, the method further comprises sequencing at least a portion of the spatially barcoded first strand cDNA or a copy thereof to determine the spatial barcode sequence of each molecule. In various embodiments, the spatially barcoded first strand cDNA is sequenced in situ.

[0060] In various embodiments, the method further includes determining the spatial location of one or more of the spatially barcoded first strand cDNAs or copies thereof by correlating the spatial barcode sequence of the spatially barcoded first strand cDNAs or copies thereof with the spatial location of capture oligonucleotide molecules on the substrate containing the corresponding spatial barcode sequence. In various embodiments, the method further includes recovering the spatially barcoded first strand cDNAs and amplifying the first strand cDNAs to create a cDNA library.

[0061] In various embodiments, the spatially barcoded first strand cDNA is recovered by contacting the spatially barcoded first strand cDNA on the substrate with a DNA polymerase and one or more primers to generate a spatially barcoded second strand cDNA that is complementary to the spatially barcoded first strand cDNA, and removing the spatially barcoded second strand cDNA from the substrate. In various embodiments, the one or more primers each comprise a random priming sequence. In various embodiments, the random priming sequence comprises 9 random nucleotides.

[0062] In various embodiments, each spatially barcoded second strand cDNA comprises a unique molecular identifier (UMI), wherein the UMI comprises an endogenous sequence and an exogenous sequence, wherein the exogenous sequence is a sequence complementary to a random priming sequence used to generate the second strand cDNA, and the endogenous sequence is a sequence complementary to a first strand cDNA template sequence used to generate the second strand cDNA.

[0063] In various embodiments, the one or more primers each comprise a molecular identifier barcode. In various embodiments, the one or more primers each comprise a UMI barcode.

[0064] In various embodiments, the spatially barcoded second strand cDNA is removed from the substrate by chemical or physical dehybridization.

[0065] In various embodiments, the capture oligonucleotide comprises an anchor sequence comprising a cleavage site that anchors the capture oligonucleotide to a substrate, and the spatially barcoded first-strand cDNA and second-strand cDNA hybrids are removed from the substrate by enzymatic cleavage at the cleavage site, which in various embodiments is a binding site for a restriction endonuclease.

[0066] In various embodiments, the method further comprises sequencing at least a portion of the cDNA library to determine the spatial barcode sequence of each molecule.

[0067] In various embodiments, the method further includes determining the spatial location of one or more cDNA molecules by correlating the spatial barcode sequences of the one or more cDNA molecules with the spatial location of surface oligonucleotide molecules on the substrate that contain corresponding spatial barcode sequences.

[0068] In various embodiments, RNA expression is determined in a single cell within a tissue. In various embodiments, RNA expression is determined in a subcellular component within a single cell. In various embodiments, the subcellular component is a nucleus, mitochondria, ribosome, or cytoplasm.

[0069] The present disclosure also provides a kit, comprising: a) a solid substrate comprising a capture oligonucleotide immobilized thereon, wherein the capture oligonucleotide comprises a capture nucleotide sequence, a spatial barcode sequence (SBC), and an adapter sequence; b) a template switch oligonucleotide (TSO) encoding a reverse transcriptase (RT) and a first adapter sequence; and c) a splint adapter, the splint adapter comprising: i) a single-stranded splint sequence comprising a random base sequence (NX) with a blocking group at the 5' end of the NX sequence; and ii) a double-stranded first adaptor sequence comprising a hybridized first adaptor sequence and a sequence complementary to the first adaptor sequence, wherein, optionally, the hybridized first adaptor sequence and the sequence complementary to the first adaptor sequence comprise blocking groups at the 5' end of the first adaptor and the 3' end of the complement to the first adaptor sequence; Includes a splint adapter Also contemplated is a kit comprising:

[0070] The present disclosure also provides, in various aspects, methods of RNA-seq library preparation that utilize on-surface enzymatic extension and chain termination to normalize library size. In various embodiments, transcripts are captured on a barcoded surface, and reverse transcriptase is primed with nucleotides such as dUTP or ddNTP to allow for fragment size reduction. Such methods can be applied to a variety of library preparation methods in which shorter library fragments are desired.

[0071] Thus, in some aspects, the present disclosure provides a method for preparing an immobilized library of target nucleic acids of a biological sample, the method comprising: (a) providing a surface having a plurality of immobilized capture oligonucleotides, wherein one or more of the plurality of capture oligonucleotides comprise, from 5' to 3', (i) a first clustered primer sequence; (ii) a spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) a capture nucleotide sequence; (b) contacting the biological sample with the surface, whereby the target nucleic acids of the biological sample hybridize to the capture nucleotide sequences of the plurality of capture oligonucleotides to form hybridized capture oligonucleotides; and (c) extending the capture nucleotide sequence of the hybridized capture oligonucleotide to form a first complementary strand of the target nucleic acid, wherein the extension is performed in the presence of an extension terminating moiety, and the extension terminating moiety is allyl-T or deoxyuridine triphosphate (dUTP), thereby preparing an immobilized library of target nucleic acids. In some embodiments, the method further comprises: (d) contacting the surface with an exonuclease; (e) hybridizing a plurality of oligonucleotide primers to the first complementary strands, each of the plurality of oligonucleotide primers comprising, from 5' to 3', (i) an adapter nucleotide sequence and (ii) a random nucleotide sequence; and (f) extending the plurality of oligonucleotide primers, thereby generating one or more second complementary strands comprising the adapter nucleotide sequence at their termini. In further embodiments, the method further comprises (g) removing one or more second complementary strands from the surface and amplifying one or more second complementary strands. In some embodiments, step (g) is performed in the presence of an exclusion amplification (ExAmp) mixture, wherein the ExAmp mixture comprises primers comprising clustered primer sequences. In some embodiments, one or more of the plurality of capture oligonucleotides is immobilized on the surface via a cleavage site. In further embodiments, the cleavage site is an enzyme cleavage site.In various embodiments, the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In some embodiments, the cleavage site is a chemical cleavage site. In some embodiments, the cleavage site is cleaved after step (c). In further embodiments, one or more of the plurality of capture oligonucleotides is immobilized on the surface via the cleavage site. In some embodiments, the cleavage site is an enzyme cleavage site. In further embodiments, the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In some embodiments, the cleavage site is a chemical cleavage site. In further embodiments, the cleavage site is cleaved after step (f). In various embodiments, the extension terminating moiety is deoxyuridine triphosphate (dUTP), and the method further comprises contacting the surface with uracil-DNA glycosylase (UDG). In some embodiments, the extension terminating moiety is allyl-T, and wherein the method further comprises contacting the surface with a universal cleavage mixture (UCM). In some embodiments, the extension terminating moiety is deoxyuridine triphosphate (dUTP) and the method further comprises contacting the surface with uracil-DNA glycosylase (UDG). In some embodiments, the extension terminating moiety is allyl-T and the method further comprises contacting the surface with a universal cleavage mixture (UCM) prior to step (e).

[0072] In some aspects, the present disclosure provides a method for preparing an immobilized library of target nucleic acids of a biological sample, the method comprising: (a) providing a surface having a plurality of immobilized capture oligonucleotides, wherein one or more of the plurality of capture oligonucleotides comprise, from 5' to 3', (i) a first clustered primer sequence; (ii) a spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) a capture nucleotide sequence; (b) contacting the biological sample with the surface, whereby the target nucleic acids of the biological sample hybridize to the capture nucleotide sequences of the plurality of capture oligonucleotides to form hybridized capture oligonucleotides; and (c) extending the capture nucleotide sequence of the hybridized capture oligonucleotide to form a first complementary strand of the target nucleic acid, wherein the extension is performed in the presence of an extension terminating moiety, wherein the extension terminating moiety is a dideoxynucleoside triphosphate (ddNTP), thereby preparing an immobilized library of target nucleic acids. In some embodiments, the method further comprises: (d) contacting the surface with an exonuclease; (e) hybridizing a plurality of oligonucleotide primers to the first complementary strands, each of the plurality of oligonucleotide primers comprising, from 5' to 3', (i) an adapter nucleotide sequence and (ii) a random nucleotide sequence; and (f) extending the plurality of oligonucleotide primers, thereby generating one or more second complementary strands comprising the adapter nucleotide sequence at their termini. In some embodiments, the method further comprises (g) removing one or more second complementary strands from the surface and amplifying one or more second complementary strands. In some embodiments, step (g) is performed in the presence of an exclusion amplification (ExAmp) mixture, wherein the ExAmp mixture comprises primers comprising the first clustered primer sequence. In some embodiments, one or more of the plurality of capture oligonucleotides is immobilized on the surface via a cleavage site. In further embodiments, the cleavage site is an enzyme cleavage site.In some embodiments, the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In further embodiments, the cleavage site is a chemical cleavage site. In some embodiments, the cleavage site is cleaved after step (c). In various embodiments, one or more of the plurality of capture oligonucleotides are immobilized on the surface via the cleavage site. In some embodiments, the cleavage site is an enzyme cleavage site. In further embodiments, the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In further embodiments, the cleavage site is a chemical cleavage site. In some embodiments, the cleavage site is cleaved after step (f). In some embodiments, the ddNTP comprises a first click chemistry handle. In some embodiments, the method further comprises, after step (c), contacting the surface with an adapter oligonucleotide comprising a second click chemistry handle capable of crosslinking to the first click chemistry handle, thereby ligating the adapter oligonucleotide to the first complementary strand. In some embodiments, the adapter oligonucleotide further comprises a second sequencing primer sequence. In further embodiments, the first click chemistry handle is an azide, tetrazine, strained alkene, or alkyne. In yet further embodiments, the second click chemistry handle is an azide, tetrazine, strained alkene, or alkyne.

[0073] In a further aspect, the disclosure provides a method for preparing an immobilized library of target nucleic acids of a biological sample, the method comprising: (a) providing a surface to which a plurality of capture oligonucleotides are immobilized, wherein one or more of the plurality of capture oligonucleotides are arranged, from 5' to 3', as follows: (i) a first clustered primer sequence; (ii) a spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) a capture nucleotide sequence; (b) contacting the biological sample with the surface, whereby the target nucleic acid of the biological sample hybridizes to the capture nucleotide sequence of the plurality of capture oligonucleotides to form hybridized capture oligonucleotides; and (c) extending the capture nucleotide sequence of the hybridized capture oligonucleotide to form a first complementary strand of the target nucleic acid, wherein the extension is performed in the presence of an extension terminating moiety, and the extension terminating moiety is a deoxynucleoside triphosphate (dNTP) comprising a 3' phosphate, thereby preparing an immobilized library of target nucleic acids. In some embodiments, the method further comprises (d) contacting the surface with an exonuclease; and (e) contacting the surface with a ligase enzyme, thereby ligating an adapter oligonucleotide to the first complementary strand, wherein the adapter oligonucleotide comprises, from 5' to 3', (i) an adapter nucleotide sequence; and (ii) a random nucleotide sequence, and the adapter oligonucleotide further comprises a second oligonucleotide that hybridizes to the adapter nucleotide sequence. In some embodiments, the adapter nucleotide sequence comprises a second sequencing primer sequence. In further embodiments, the ligation occurs via splint ligation of the adapter oligonucleotide to the first complementary strand. In further embodiments, the ligase enzyme is T4 DNA ligase. In some embodiments, the method further comprises (f) extending the adapter oligonucleotide, thereby generating one or more second complementary strands.In some embodiments, the method further comprises (d) contacting the surface with an exonuclease; and (e) contacting the surface with a ligase enzyme, thereby ligating an adapter oligonucleotide to the first complementary strand, wherein the adapter oligonucleotide comprises, from 5' to 3', (i) a random nucleotide sequence; and (ii) an adapter nucleotide sequence. In some embodiments, the adapter nucleotide sequence comprises a second sequencing primer sequence. In some embodiments, ligation occurs via single-stranded DNA ligation of the adapter oligonucleotide to the first complementary strand. In further embodiments, the ligase enzyme is a DNA / RNA ligase. In some embodiments, the method further comprises (f) extending the adapter oligonucleotide, thereby generating one or more second complementary strands. In further embodiments, the method further comprises (g) removing one or more second complementary strands from the surface and amplifying the one or more second complementary strands. In some embodiments, step (g) is performed in the presence of an exclusion amplification (ExAmp) mixture. In further embodiments, one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site. In some embodiments, the cleavage site is an enzymatic cleavage site. In further embodiments, the enzymatic cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In some embodiments, the cleavage site is a chemical cleavage site. In further embodiments, the cleavage site is cleaved after step (c). In some embodiments, one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site. In further embodiments, the cleavage site is an enzymatic cleavage site. In various embodiments, the enzymatic cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In some embodiments, the cleavage site is a chemical cleavage site. In further embodiments, the cleavage site is cleaved after step (e).

[0074] In a further aspect, the disclosure provides a method for preparing an immobilized library of target nucleic acids of a biological sample, comprising: (a) providing a surface having immobilized thereon a plurality of capture oligonucleotides, wherein one or more of the plurality of capture oligonucleotides comprise, from 5' to 3', (i) a first clustered primer sequence; (ii) a spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) a capture nucleotide sequence; and (b) contacting the biological sample with the surface, wherein the contacting causes the target nucleic acids of the biological sample to be immobilized to the capture nucleotides of the plurality of capture oligonucleotides. (c) extending the capture nucleotide sequence of the hybridized capture oligonucleotide to form a first complementary strand of the target nucleic acid, wherein the extending is performed in the presence of an extension terminating moiety, and the extension terminating moiety is a deoxynucleoside triphosphate (dNTP) with a 3' phosphate or a dideoxynucleoside triphosphate (ddNTP) with a first click chemistry handle, thereby preparing an immobilized library of target nucleic acids. In some embodiments, the extension terminating moiety is a deoxynucleoside triphosphate (dNTP) with a 3' phosphate. In some embodiments, the method further includes (d) chemically ligating an adapter oligonucleotide to the first complementary strand via a bridging group, wherein the adapter oligonucleotide comprises, from 5' to 3', (i) an adapter nucleotide sequence; and (ii) a random nucleotide sequence, and the adapter oligonucleotide further comprises a second oligonucleotide that hybridizes to the adapter nucleotide sequence. In some embodiments, the adapter nucleotide sequence comprises a second sequencing primer sequence. In various embodiments, the crosslinking group is a carboxyl-amine reactive group, a BCN-azide reactive group, a DBCO-azide reactive group, a tetrazine-TCO reactive group, or a combination thereof. In some embodiments, the extension terminating moiety is a dideoxynucleoside triphosphate (ddNTP) comprising a first click chemistry handle.In some embodiments, the method further comprises (d) ligating an adapter oligonucleotide to the first complementary strand via click chemistry, wherein the adapter oligonucleotide comprises, from 5' to 3', (i) an adapter nucleotide sequence; and (ii) a random nucleotide sequence, and the adapter oligonucleotide further comprises a second oligonucleotide that hybridizes to a sequencing primer sequence, wherein the second oligonucleotide comprises a second click chemistry handle. In some embodiments, the adapter nucleotide sequence comprises the second sequencing primer sequence. In various embodiments, the first click chemistry handle is an azide, tetrazine, strained alkene, or alkyne. In some embodiments, the second click chemistry handle is an azide, tetrazine, strained alkene, or alkyne. In some embodiments, the method further comprises (e) extending the adapter oligonucleotide, thereby generating one or more second complementary strands. In some embodiments, the method further comprises (f) removing one or more second complementary strands from the surface and amplifying the one or more second complementary strands. In some embodiments, step (f) is performed in the presence of an exclusion amplification (ExAmp) mixture. In some embodiments, one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site. In some embodiments, the cleavage site is an enzymatic cleavage site. In various embodiments, the enzymatic cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In some embodiments, the cleavage site is a chemical cleavage site. In further embodiments, the cleavage site is cleaved after step (c). In some embodiments, one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site. In some embodiments, the cleavage site is an enzymatic cleavage site. In various embodiments, the enzymatic cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In some embodiments, the cleavage site is a chemical cleavage site. In some embodiments, the cleavage site is cleaved after step (d).

[0075] In some embodiments, the disclosed method further comprises removing the target nucleic acid from the surface after step (c). In some embodiments, the disclosed method further comprises removing the biological sample from the surface after step (d). In various embodiments, each of the plurality of capture oligonucleotides comprises the same capture nucleotide sequence. In some embodiments, the plurality of capture oligonucleotides comprises a plurality of different capture nucleotide sequences. In further embodiments, the plurality of different capture nucleotide sequences comprises one or more gene-specific capture sequences, one or more universal capture sequences, or a combination thereof. In various embodiments, the capture nucleotide sequence is a poly-T sequence, a poly-A sequence, a gene-specific capture sequence, or a universal capture sequence. In some embodiments, the universal capture sequence is a random nucleotide sequence or a non-self-complementary semi-random sequence. In various embodiments, the target nucleic acid is mRNA, gDNA, rRNA, tRNA, or a combination thereof. In some embodiments, the target nucleic acid is RNA, mRNA, or a combination thereof. In some embodiments, the target nucleic acid is cDNA generated from RNA by reverse transcription, wherein a homopolymeric capture sequence (e.g., a polyA sequence) is added to the 3' end of the cDNA (e.g., by ligation or by a terminal transferase enzyme such as terminal deoxynucleotidyl transferase (TdT)). In some embodiments, the extension of the capture nucleotide sequence in step (c) is carried out using a reverse transcriptase. In some embodiments, the target nucleic acid is polyadenylated prior to hybridization of the target nucleic acid to the capture nucleotide sequence. In various embodiments, the target nucleic acid is polyadenylated using poly(A) polymerase. In further embodiments, the target nucleic acid is polyadenylated using chemical ligation or enzymatic ligation. In some embodiments, the amplifying comprises adding a second clustered primer sequence to one or more second complementary strands. In some embodiments, the amplifying further comprises adding an index sequence.In some embodiments, the amplifying comprises index PCR, during which a first primer hybridizes to a first clustered primer sequence and a second primer hybridizes to an adapter nucleotide sequence, wherein the second primer comprises a second clustered primer sequence. In some embodiments, the second primer further comprises an index sequence.

[0076] It is understood that each feature or embodiment, or combination, described herein is a non-limiting illustrative example of one of the aspects of the invention and is therefore meant to be combinable with any other feature, embodiment, or combination described herein. For example, when a feature is described with words such as "one embodiment," "various embodiments," "some embodiments," "an embodiment," "further embodiment," "particular exemplary embodiment," and / or "another embodiment," each of these types of embodiments is a non-limiting example of the feature that is intended to be combined with any other feature or combination of features described herein, without necessarily listing every possible combination.

[0077] Any such feature or combination of features applies to any of the aspects of the invention. When example values ​​falling within ranges are disclosed, any of those examples are contemplated as possible endpoints of the range, and any and all values ​​between such endpoints are contemplated, with any and all combinations of upper and lower limits envisioned. [Brief explanation of the drawings]

[0078] [Figure 1A] FIG. 1 is a schematic diagram of a method for preparing an RNA-seq library according to the present disclosure. [Figure 1B]1 is a schematic diagram of the addition of TSO complements during first strand synthesis in a method according to the present disclosure. The figure is adapted from the Integrated DNA Technologies "Use of Template Switching Oligos (TS Oligos, TSOs) for efficient cDNA library construction" Education webpage. [Figure 2] FIG. 2 is a schematic diagram of the lead sequence of the method of FIG. 1. [Figure 3] FIG. 1 is a process flow diagram for a method of preparing an RNA-seq library according to the present disclosure. [Figure 4A] 1 is a graph showing Tapestation data for a method of the disclosure comparing purified starting input 2.5× SPRI purification with 0.7× SPRI purification. [Figure 4B] Graph showing Tapestation data showing fragment sizes for two tagmentation dilutions: high input P7 / TSO amplicon (2.5 ng) versus low input amplicon (100 pg). [Figure 5A] FIG. 1 is a schematic diagram of tagging on beads testing 500 pg, 100 pg, and 10 pg of P7 / TSO amplicon in a method according to the present disclosure. [Figure 5B] FIG. 5B is a graph showing library fragment sizes for the test in FIG. 5A. [Figure 6] FIG. 1 is a schematic diagram of test conditions for assessing the effect of transposase amount and purification versus no purification. [Figure 7] 1 is a graph showing the alignment distribution of the method according to the present disclosure compared to the commercially available Visium method. [Figure 8] 1 is a graph showing transcript coverage for methods according to the present disclosure. [Figure 9A] FIG. 1 is a schematic diagram of an in-solution method according to the present disclosure (A). [Figure 9B] (B) Schematic of the on-surface method according to the present disclosure. [Figure 10]FIG. 1 is a schematic diagram comparing a method according to the present disclosure with and without a template switch oligonucleotide. [Figure 11A] A schematic diagram for generating a transposition-amplified TSO library is shown. [Figure 11B] 1 shows a base composition plot of read 1 in a sample from a TSP library. [Figure 11C] Library concentrations determined by Screentape analysis are shown. [Figure 11D] The number of UMIs per 5M input raw reads is shown. [Figure 12] Figure 1 is a workflow showing steps in single-stranded RNA library preparation that combines on-surface template switching with single-stranded enzymatic ligation (TSO-LIG) to convert tissue RNA into a spatially barcoded library. [Figure 13] Workflow showing both enzymatic and chemical methods for converting second-strand adapter-containing synthetic cDNA into a library via single-stranded ligation of a first adapter sequence to the 3' end of the first-strand cDNA. [Figure 14] Sensitivity is shown for template switching (TSO), single-strand splint ligation (LIG), and a combination of both methods (TSO+LIG). Results are shown as sensitivity UMI per bin of 100 adapters, i.e., fold change relative to TSO. Sensitivity was calculated as the median UMI detected per 100 x 100 um and then normalized to the TSO condition. Error bars are the standard deviation from four tissue sections. [Figure 15A] Figure 15 shows the relative Rd1 adaptor addition efficiency for template switching (TSO), single-strand splint ligation (LIG), and a combination of both methods (TSO+LIG). Figure 15A shows the assay workflow. Results are presented as fold change in Rd1 adaptor addition efficiency relative to TSO (Figure 15B). Efficiency was calculated as 2 - (Cq inner - Cq outer) and then normalized to the TSO condition. Error bars are the STDEV from four tissue sections. [Figure 15B] Figure 15 shows the relative Rd1 adaptor addition efficiency for template switching (TSO), single-strand splint ligation (LIG), and a combination of both methods (TSO+LIG). Figure 15A shows the assay workflow. Results are presented as fold change in Rd1 adaptor addition efficiency relative to TSO (Figure 15B). Efficiency was calculated as 2 - (Cq inner - Cq outer) and then normalized to the TSO condition. Error bars are the STDEV from four tissue sections. [Figure 16] FIG. 1 shows a schematic diagram of library fragment size normalization using dUTP in the reverse transcription reaction. [Figure 17] The structure of a sequencing read is shown. [Figure 18] FIG. 1 shows a schematic of library fragment size normalization by dUTP / allyl-T with in-tube second strand synthesis. [Figure 19] Normalization of library size by ddNTPs in reverse transcription reactions is shown. [Figure 20] We demonstrate that ExAMP functions as a cDNA elution reagent and constructs redundant pre-sequencing. [Figure 21] It is demonstrated that cDNA fragments can be shortened with 3'phos dNTPs or azido-ddNTPs. [Figure 22] An example of how an SMI (eg, UMI) sequence is added during second strand cDNA synthesis in the TSO ligation method is shown. DETAILED DESCRIPTION OF THE INVENTION

[0079] Isolating RNA from preserved tissue samples and converting the RNA to cDNA on a flat surface presents several challenges, including low-quality RNA transcripts isolated from the tissue samples, shorter synthetic cDNA fragments (less than 450 bp) in the library preparation products, and the presence of a high proportion of polyA fragments in the cDNA regions in the final sequencing products. These challenges result in subsequent low mapping rates of exons to mRNA transcript regions in RNA-seq alignments.

[0080] To solve this problem, we hypothesized that improved methods are needed to provide improved capture and spatial library conversion from FFPE tissue samples.

[0081] The disclosed methods provide spatial RNA sequencing library preparation methods that can be used with fresh-frozen and formalin-fixed, paraffin-embedded tissues. The disclosed methods utilize translocation-based methods to ensure that spatial barcodes remain intact during the library preparation process.

[0082] In one aspect, the disclosed template switch-tagging-based method (TSO-TAG) utilizes second-strand priming and a template switch oligonucleotide (TSO) process in conjunction with tagging to fragment and add UMIs and adapters to library fragments. Extension, i.e., pre-transposition, with an extension primer such as a poly-TVN primer can allow the 3' region of the fragment to remain single-stranded, avoiding transposition on the spatial barcode. The disclosed TSO-TAG method can advantageously provide a simplified workflow for library preparation, reducing second-strand synthesis time to less than two hours, e.g., from 10 minutes to about 60 minutes, or from about 15 minutes to about 30 minutes. Because the TSO is added to the 5' end of the transcript, the resulting library fragments are full-length. Transposition adds UMIs while fragmenting the library into the desired sequences, and the barcode region remains single-stranded during transposition.

[0083] In another embodiment, a method based on spatial barcode-tagging and UMI-tagging utilizes random second-strand priming along with global PCR to build redundancy: tagging is used to fragment, while randomer second-strand priming adds UMIs and adapters.

[0084] Referring to Figures 1 and 3, according to one embodiment, a method for preparing an RNA-seq library can include loading a tissue sample onto a substrate containing a plurality of capture oligonucleotides. The capture oligonucleotides can include one or more gene-specific capture sequences for capturing mRNA transcripts from the tissue. For example, the capture oligonucleotides can include a poly-T sequence for capturing polyadenylated mRNA from the tissue. For example, fresh-frozen tissue can be sectioned and fixed. The substrate can be, for example, part of a solid support. The solid support can be, for example, a flow cell. For example, an Illumina poly-T barcoded capture flow cell can be used. The flow cell can be assembled into a gasket that creates individual sample wells on the tissue section, with the substrate defining the bottom of the well. In methods using formalin-fixed, paraffin-embedded tissue, the method can first include treating the tissue to polyadenylate the formalin-fixed, paraffin-embedded RNA transcripts to improve capture and library conversion, for example, when using a poly-T capture surface. Other pretreatments of the tissue to improve capture by one or more gene-specific sequences of the capture oligonucleotides can also be used.

[0085] The disclosed methods may include coating the substrate with an RNase inhibitor, such as 0.01×SSC / RNase inhibitor, and the solution may be removed. The tissue may then be permeabilized by contacting the tissue and substrate with a permeabilization mixture and incubating the tissue in the mixture. For example, the permeabilization mixture may include 0.1% pepsin, 0.1 N HCl, and may be preheated. The tissue may be incubated, for example, at 37° C. for about 7 minutes. The permeabilization mixture may then be removed, and the wells may be washed with buffer and an RNase inhibitor.

[0086] The capture oligonucleotides may contain one or more gene-specific capture sequences or library barcode information including a poly-T sequence and a space bar sequence (SBC). mRNA transcripts from tissues are captured or immobilized on a substrate by the capture oligonucleotides.

[0087] Reverse transcriptase is performed using a template switch oligonucleotide that adds a TSO complement to the 5' end of the transcript. Specifically, a substrate is contacted with a first strand synthesis mixture containing reverse transcriptase and a template switch oligonucleotide (TSO) under conditions that produce a first cDNA complementary to the mRNA transcript and a first strand containing a TSO complement hybridized to the 5' end of the first cDNA. The reverse transcriptase incorporates a non-templated cytosine nucleotide at the 5' end of the first cDNA. The TSO contains a sequence that hybridizes to the non-templated cytosine nucleotide. The TSO hybridizes to the non-templated cytosine nucleotide, and the reverse transcriptase is extended to generate a complement of the TSO attached to the 5' end of the cDNA (referred to herein as the TSO complement). For example, the non-templated cytosine nucleotide can be CCC. For example, the sequence that hybridizes to the non-templated cytosine nucleotide can be 2 to 5 guanosines. For example, the two to five guanosines can be riboguanosines. For example, the sequence that hybridizes to a non-templated cytosine nucleotide can be rGrGrG.

[0088] The first strand synthesis mixture includes a reverse transcriptase and a TSO. The mixture may further include a reducing agent, a reverse transcriptase reagent, and water. The components of the first strand synthesis mixture may be premixed and added to the substrate, or one or more of the components may be added to the substrate in a stepwise manner.

[0089] The substrate may be incubated in the first strand synthesis mixture for any desired period of time. For example, incubation may be for about 1 hour at 53° C. The first strand synthesis mixture may then be discarded from the substrate, and the substrate may be washed with water.

[0090] After the first strand is generated, the mRNA transcripts are eluted from the substrate. For example, elution may be performed using formamide. The substrate may be incubated in 100% formamide, for example, at 80°C for 10 minutes. The mRNA eluate may be stored at -80°C if desired, for example, for use in reverse transcription qPCR quality control checks.

[0091] After elution, the substrate may be washed. For example, the substrate may be washed three times with water. KOH may be added to the substrate. The substrate may be incubated in KOH for, for example, 5 minutes at room temperature. The KOH solution may be discarded, and the substrate may be washed with a buffer, for example, buffer EB (Qiagen).

[0092] Second-strand synthesis is then carried out using a TSO primer. Specifically, the substrate having the first strand is contacted with a second-strand synthesis mixture containing a TSO primer, and the TSO primer is extended using the first strand as a template to generate a second strand that is complementary to the first strand and has a second cDNA that is complementary to the first cDNA. The second strand further contains second-strand barcode information having a spatial barcode sequence complement that is complementary to the barcode sequence (also referred to herein as a library barcode sequence) present on the first strand. The second-strand synthesis mixture may include a TSO primer, second-strand reagents, and a second-strand enzyme. The disclosed method advantageously provides a process that can significantly reduce the time required for second-strand synthesis compared to conventional processes. For example, second-strand synthesis may include incubating the first strand with the second-strand synthesis mixture for less than two hours. For example, the incubation time may be about 10 minutes to about 15 minutes, about 15 minutes to about 60 minutes, about 30 minutes to about 90 minutes, about 15 minutes to about 30 minutes, or about 45 minutes to about 2 hours. Other suitable times may be about 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 35, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 minutes, as well as any range defined by such values ​​and any value therebetween. For example, the substrate may be incubated in the second strand synthesis mixture at 65°C for 15 minutes. The solution may be discarded, and the substrate may be washed with a buffer, such as buffer EB.

[0093] The second strand is then eluted from the substrate. For example, elution can be performed by incubating the substrate in KOH at room temperature. For example, the substrate can be incubated in 0.08 M KOH for about 10 minutes to elute the second strand. The second strand eluted in KOH can be transferred to a different reaction vessel. For example, a strip tube can be used. The second strand eluted in KOH can be neutralized before further extension. For example, Tris buffer can be used to neutralize the eluted second strand.

[0094] Extension with an extension primer is then performed to create a double-stranded library while maintaining the single-stranded 3' region containing the barcode information. In processes utilizing poly-T capture oligonucleotides, poly-TVN primers can be used as extension primers. For example, the second strand is contacted with a poly-TVN extension mixture containing a poly-TVN primer, and extension is performed to generate a double-stranded product while maintaining the single-stranded 3' region containing the barcode information. In processes using gene-specific capture oligonucleotides, the extension primer can be a primer that hybridizes to the second strand in a region of the second strand that does not contain the barcode information. Extension can be achieved by mixing the second strand with an extension primer mixture and thermocycling. An extension primer mixture, such as an Illumina AMS Strand Displacement Extension Mix, can be used. Thermocycling can be performed, for example, at a first temperature and a first time period, a second temperature and a second time period, and a second holding temperature. The second temperature can be higher than the first temperature. The first temperature can be, for example, about 25°C to about 37°C. The first time period may be about 10 minutes to about 30 minutes. The second temperature may be about 60°C to 65°C. The second time period may be about 10 minutes. For example, thermocycling conditions may be 37°C for 10 minutes, 60°C for 10 minutes, and a hold at 4°C.

[0095] The double-stranded product can be purified using known purification methods, for example, SPRI purification can be used and the double-stranded product can be eluted in water.

[0096] The double-stranded product is contacted with a transposome under conditions that tag the double-stranded product to form a tagged product with a specific molecule and PCR adapter. For example, transposition can be performed using Illumina's Sourcecell B15 Tn5 transposome. For example, the transposome may be an A14 or B15 transposome. For example, the transposome may have a custom transposon. The transposome may be provided as transposome-modified beads. The tagging process can include contacting the double-stranded product with the transposome and a carrier gDNA. The concentration of the carrier gDNA can be about 1 ng to about 10 nM. Tagging can be performed using diluted transposomes and tagging buffer. For example, a 5- to 20-fold dilution of the transposome can be used. The specific dilution can be easily determined based on the amount of product captured from the tissue. The double-stranded product can be incubated in the transposome for 5 minutes, for example, at 55°C. Tagging can be stopped using tagging stop buffer. The double-stranded product can be incubated with tagmentation stop buffer for, for example, 5 minutes at room temperature.

[0097] Transposition can be performed as a tagging in solution, such as Tn5 tagging. Alternatively, transposition can be performed on beads. For example, A14 transpososome beads can be generated and used to transpose the double-stranded product.

[0098] The tagged products are amplified using index PCR to create a library. Index PCR can be performed using a tagging PCR mixture, a P7 primer, and a transposome-index-P5 primer. For example, tagged products can be amplified using primers containing P7, B15-ME, a sample index, and P5. For transposition performed using the A14 transposome, amplification can be performed using a P7 / PA14 short chain. The index PCR process can include 10 to 24 cycles. Each cycle can include, for example, a first hold time at a first temperature, a second hold time at a second temperature, and a third hold time at a third temperature, where the first temperature is higher than the second and third temperatures, and the third temperature is higher than the second temperature. Each cycle can last approximately 15 to 50 minutes. For example, a cycle can include holds at 95°C for 10 seconds, 60°C for 45 seconds, and 72°C for 60 seconds. A hold at the first temperature can precede the cycle. After all of the cycles are complete, a final extension can be performed by holding at a third temperature. For example, the final extension can be held for about 5-10 minutes. For example, the initial hold before cycling can be at 95°C for 30 seconds, the final extension can be at 72°C for 5 minutes, and the hold can be at 4°C.

[0099] The resulting library can be purified and sequenced. For example, the library can be purified by 1× SPRI.

[0100] Figure 2 shows the sequencing read structure for TAG-TSO. Read 1 reads the cDNA region. Read 2 reads the spatial barcode. Read 3 reads the sample index. See poly-TVN and the four reads to the cDNA region. In an embodiment of the process that does not utilize poly-TVN, the extension primer sequence will be at the position of the poly-TVN.

[0101] 9A and 9B are schematic diagrams of the TSO-TAG method according to the present disclosure. In FIG. 9A, the process is shown to be performed in a continuous one-pot process. One-pot synthesis can be achieved by using a biotinylated TSO primer in the second-strand synthesis step to generate a second strand with a biotinylated TSO. After elution and neutralization of the second-strand cDNA, the product can be hybridized to beads, and subsequent steps of the method can be performed on the beads with a washing step on a magnet. For example, streptavidin beads can be used.

[0102] Figure 9B shows the surface process for carrying out the TAG-TSO method of the present disclosure. After RNA removal, a blocker oligonucleotide and a TSO are hybridized to the first strand such that a gap exists between the blocker oligonucleotide and the TSO. The blocker oligonucleotide may be, for example, a 3'-blocked SBS12'-polyA. A TSO-complementary oligonucleotide then fills the gap up to the 5' region of the blocker oligonucleotide using a non-strand-displacing polymerase.

[0103] The blocker is then melted away to form a blocker-free first strand. On-surface tagging is performed, for example, using A14 transposomes to introduce UMIs and adapters. The tagged product with UMIs and PCR adapters is then extended. An extension mixture is added to form the second strand. The second strand contains second-strand barcode information, UMIs, and PCR adapters, with a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence and a second cDNA complementary to the first cDNA. The second-strand product is eluted from the surface and amplified using index PCR;

[0104] Referring to Figure 10, the SBC-TAG UMI-TAG method is shown in comparison with the TSO-TAG method. The SBC-TAG and UMI-TAG methods for preparing an RNA sequence library can include placing a tissue sample on a substrate having multiple capture oligonucleotides. The substrate can be, for example, a flow cell or part of a flow cell. The capture oligonucleotides contain barcode information including a poly-T sequence or one or more gene-specific capture sequences and a spatial barcode sequence (SBC). mRNA transcripts from the tissue are captured on the substrate by the capture oligonucleotides. The capture oligonucleotides with the poly-T sequence capture polyadenylated mRNA.

[0105] Reverse transcription is performed using a first strand synthesis mixture with reverse transcriptase to generate a first strand containing cDNA that is complementary to the mRNA transcript.

[0106] After the first strand is generated, the mRNA transcripts are eluted from the substrate. For example, elution may be performed using formamide. The substrate may be incubated in 100% formamide, for example, at 80°C for 10 minutes. The mRNA eluate may be stored at -80°C if desired, for example, for use in reverse transcription qPCR quality control checks.

[0107] Second strand synthesis is performed using random primers to generate a second strand having a second cDNA, a UMI, and an adapter, e.g., the first strand is contacted with a second strand synthesis mixture having random primers and incubated to generate the second strand.

[0108] Alternatively, second strand synthesis can be performed without elution of the mRNA. For example, after the first strand is generated, the second strand can be generated using a second strand synthesis mix containing DNA pol 1 and RNase H without elution of the mRNA transcript. For example, the second strand can be generated using an Illumina second strand master mix. The first strand can be incubated with the second strand master mix, for example, at 16°C for 1 hour, to generate the second strand.

[0109] The second strand is then eluted.

[0110] The second strand product is then amplified to generate a double-stranded product, and the double-stranded product is tagged to form a tagged product.

[0111] The tagged product is amplified by a first index PCR to determine the SBC and a second index PCR to determine the UMI.

[0112] term As used in this specification and enumerated paragraphs herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0113] "About" and "approximately" generally refer to an acceptable degree of error for the quantity measured, given the nature or precision of the measurement. Exemplary degrees of error are within 20-25 percent (%) of the stated value or range of values, e.g., within 20 percent, 10 percent, 5 percent, 4 percent, 3 percent, 2 percent, or 1 percent.

[0114] In this method, the capture oligonucleotide is immobilized on the substrate via one or more polynucleotides, such as a polynucleotide. When referring to the immobilization of a molecule (e.g., a nucleic acid) to a solid support, the terms "immobilized" and "attached" are used interchangeably herein, and both terms are intended to encompass direct or indirect, covalent or non-covalent attachment, unless otherwise indicated, either explicitly or by context. In some embodiments, covalent attachment may be used, but generally, what is required is that the molecule (e.g., a nucleic acid) remains immobilized or attached to the support under the conditions intended for use of the support, for example, in applications requiring nucleic acid amplification and / or nucleic acid sequencing. Oligonucleotides used as capture primers or amplification primers can be immobilized so that their 3' ends are available for enzymatic extension and at least a portion of their sequence can hybridize to a complementary sequence.

[0115] Immobilization can occur via hybridization to surface-attached oligonucleotides, in which case the immobilized oligonucleotide or polynucleotide can be in a 3' to 5' orientation. Alternatively, immobilization can occur by means other than base-pairing hybridization, such as covalent attachment as described above.

[0116] As used herein, the term "immobilized" refers to a state in which two things are joined, fastened, adhered, attached, connected, or bound to each other. For example, an analyte, such as a nucleic acid, may be immobilized on a material, such as a bead, gel, or surface, by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of electron pairs between atoms. A non-covalent bond is a chemical bond that does not involve the sharing of electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions. In various embodiments, covalent attachment can be used, but what is required is that the oligonucleotides remain immobilized or attached to the surface under the conditions under which the surface is intended to be used, for example, in applications requiring nucleic acid capture, amplification, and / or sequencing.

[0117] Exemplary covalent linkages include, for example, those resulting from the use of click chemistry techniques. Exemplary non-covalent linkages include, but are not limited to, non-specific interactions (e.g., hydrogen bonds, ionic bonds, van der Waals interactions, etc.) or specific interactions (e.g., affinity interactions, receptor-ligand interactions, antibody-epitope interactions, avidin-biotin interactions, streptavidin-biotin interactions, lectin-carbohydrate interactions, etc.). Exemplary linkages are described in U.S. Patent Nos. 6,737,236, 7,259,258, 7,375,234, and 7,427,678, and U.S. Patent Publication No. 2011 / 0059865(A1), each of which is incorporated herein by reference.

[0118] The terms "solid surface," "solid support," and other grammatical equivalents herein refer to any material suitable for attachment of capture oligonucleotides, or that can be modified to be suitable. As will be understood by those skilled in the art, the number of possible substrates is numerous. Possible substrates include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylics, polystyrene, and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, Teflon®, etc.), polysaccharides, nylon or nitrocellulose, ceramics, resins, silica or silica-based materials, including silicon and modified silicon, carbon, metals, inorganic glass, plastics, fiber optic bundles, and various other polymers. In some embodiments, particularly useful solid supports and solid surfaces are disposed within a flow cell device. Further non-limiting examples of solid supports and solid surfaces include bead arrays, spot arrays, clustered particles disposed on the surface of a chip, and multiwell plates.

[0119] As used herein, the term "substrate" is intended to mean a solid support or support structure. This term includes any material that can serve as a solid or semi-solid base for generating features such as wells for the deposition of biopolymers, including nucleic acids, polypeptides, and / or other polymers (including attachment of capture oligonucleotides). Non-limiting examples of substrates include bead arrays, spot arrays, clustered particles arranged on the surface of a chip, films, multiwell plates, beads, and flow cells. The substrates provided herein can be modified, for example, or adapted for biopolymer attachment by various methods well known to those of skill in the art. Exemplary types of substrate materials include glass, modified glass, functionalized glass, inorganic glass, microspheres containing inert and / or magnetic particles, plastics, polysaccharides, nylon, nitrocellulose, ceramics, resins, silica, silica-based materials, carbon, metals, optical fibers or fiber optic bundles, various polymers other than those exemplified above, and multiwell microtiter plates. Specific types of exemplary plastics include acrylics, polystyrene, copolymers of styrene with other materials, polypropylene, polyethylene, polybutylene, polyurethane, and Teflon. Specific types of exemplary silica-based materials include silicon and various forms of modified silicon.

[0120] As used herein, a "surface" may refer to a portion of a substrate or support structure that is accessible for contact with a reagent, bead, or analyte. A surface may be substantially flat or planar. Alternatively, a surface may be rounded or contoured. Exemplary contours that may be included on a surface include wells (e.g., microwells or nanowells), depressions, posts, ridges, channels, and the like. Exemplary materials that can be used as a substrate or support structure include glass, such as modified or functionalized glass; plastics, such as acrylic, polystyrene, or copolymers of styrene with another material, polypropylene, polyethylene, polybutylene, polyurethane, or TEFLON®; polysaccharides or cross-linked polysaccharides, such as agarose or Sepharose; nylon; nitrocellulose; resins; silica or silica-based materials, including silicon and modified silicon, carbon fiber; metals; inorganic glass; fiber optic bundles, or various other polymers. A single material or a mixture of several different materials can form a surface useful in the present invention. In some examples, the surface includes a well (e.g., a microwell or nanowell). In some aspects, the surface comprises an array of wells (e.g., microwells or nanowells) on a glass, silicon, plastic, or other suitable solid support comprising a patterned, covalently linked gel, such as poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide) (PAZAM, see, e.g., U.S. Patent Application Publication No. 2014 / 0079923 A1, incorporated herein by reference). In some embodiments, each nanowell contains a unique oligonucleotide (e.g., an oligonucleotide with a unique spatial barcode). In some examples, the support structure can comprise one or more layers. Non-limiting examples of surfaces include bead arrays, spot arrays, clustered particles disposed on the surface of a chip, films, multiwell plates, and flow cells.In various embodiments, the substrate or substrate surface comprises a material selected from glass, silicon, poly-L-lysine coated material, nitrocellulose, polystyrene, cyclic olefin copolymer (COC), cyclic olefin polymer (COP), polyacrylamide, polypropylene, polyethylene, or polycarbonate.

[0121] Exemplary flow cells include, but are not limited to, those used in nucleic acid sequencing devices, such as the Genome Analyzer®, MiSeq®, NextSeq®, or HiSeq® platforms marketed by Illumina, Inc. (San Diego, Calif.), or the SOLiD™ or Ion Torrent™ sequencing platforms marketed by Life Technologies (Carlsbad, Calif.). Exemplary flow cells and methods for their manufacture and use are also described, for example, in International Publication No. 2014 / 142841 (A1); U.S. Patent Application Publication No. 2010 / 0111768 (A1); and U.S. Patent No. 8,951,781, each of which is incorporated herein by reference.

[0122] Those skilled in the art will know or understand that the composition and shape of the substrates provided herein can vary depending on the intended use and user preference. Thus, while planar substrates such as slides, chips, wafers, or beads are useful for microarrays, those skilled in the art will understand that a wide variety of other substrates exemplified herein or known in the art can also be used in the methods and / or compositions herein.

[0123] In some embodiments, a solid support comprises one or more surfaces accessible to reagents, beads, or analytes. The surface may be substantially flat or planar. Alternatively, the surface may be rounded or contoured. Exemplary contours that may be included on the surface include wells (e.g., microwells or nanowells), depressions, posts, ridges, channels, and the like. Examples of materials that can be used as surfaces include glass, such as modified or functionalized glass; plastics, such as acrylic, polystyrene, or copolymers of styrene with another material, polypropylene, polyethylene, polybutylene, polyurethane, or TEFLON®; polysaccharides or cross-linked polysaccharides, such as agarose or Sepharose; nylon; nitrocellulose; resins; silica or silica-based materials, including silicon and modified silicon, carbon fiber; metals; inorganic glass; fiber optic bundles, or various other polymers. A single material or a mixture of several different materials can form a surface useful in the present invention. In some examples, the surface comprises a well (e.g., a microwell or nanowell). In some embodiments, the surface comprises wells in an array of wells (e.g., microwells or nanowells) on a glass, silicon, plastic, or other suitable solid support comprising a patterned, covalently linked gel such as poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide) (PAZAM, see, e.g., U.S. Patent Application Publication No. 2014 / 0079923 A1, incorporated herein by reference). In some examples, the support structure can comprise one or more layers.

[0124] Certain embodiments may utilize solid supports comprised of an inert substrate or matrix (e.g., glass slides, polymeric beads, etc.) functionalized by the application of a layer or coating of an intermediate material containing reactive groups that allow for covalent attachment of biomolecules, such as polynucleotides. Examples of such supports include, but are not limited to, polyacrylamide hydrogels supported on an inert substrate such as glass, particularly the polyacrylamide hydrogels described in International Publication No. WO 2005 / 065814 and U.S. Patent Application Publication No. 2008 / 0280773, the contents of which are incorporated herein by reference in their entireties. In such embodiments, the biomolecule (e.g., polynucleotide) may be covalently attached directly to the intermediate material (e.g., hydrogel), or the intermediate material may itself be noncovalently attached to the substrate or matrix (e.g., glass substrate). The term "covalently attached to a solid support" should be interpreted accordingly to encompass this type of array.

[0125] In some embodiments, the solid support comprises a patterned surface suitable for immobilizing capture oligonucleotides in a regular pattern. A "patterned surface" refers to an arrangement of distinct regions within or on an exposed layer of a solid support. For example, one or more of the regions can be features in which one or more capture oligonucleotides are present. The features can be separated by interstitial regions in which no capture oligonucleotides are present. In some embodiments, the pattern can be an xy format of features in rows and columns. In some embodiments, the pattern can be a repetitive arrangement of features and / or interstitial regions. In some embodiments, the pattern can be a random arrangement of features and / or interstitial regions. In some embodiments, the capture oligonucleotides are randomly distributed on the solid support. In some embodiments, the capture oligonucleotides are distributed on a patterned surface. Exemplary patterned surfaces that can be used in the methods and compositions provided herein are described in U.S. Application No. 13 / 661524 or U.S. Patent Application Publication No. 2012 / 0316086 A1, each of which is incorporated herein by reference.

[0126] In some embodiments, the solid support comprises an array of wells (e.g., microwells or nanowells) or depressions on its surface, which can be fabricated using a variety of techniques, including, but not limited to, photolithography, stamping, molding, and microetching, as is commonly known in the art. In some aspects, the solid support comprises an array of wells (e.g., microwells or nanowells) on a glass, silicon, plastic, or other suitable solid support comprising a patterned, covalently linked gel, such as poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide) (PAZAM; see, e.g., U.S. Patent Application Publication No. 2014 / 0079923 A1, incorporated herein by reference). In some examples, the solid support can comprise one or more layers. As understood in the art, the technique used will depend on the composition and shape of the array substrate.

[0127] The composition and geometry of the solid support may vary depending on its use. In some embodiments, the solid support is a planar structure such as a slide, chip, microchip, and / or array. Thus, the surface of the substrate may be in the form of a planar layer. In some embodiments, the solid support comprises one or more surfaces of a flow cell.

[0128] In some embodiments, the solid support or its surface is non-planar, such as the interior or exterior surface of a tube or container, hi some embodiments, the solid support comprises a microsphere or bead.

[0129] The binding of nucleic acids to supports, whether rigid or semi-rigid, can occur via covalent or non-covalent bonds. Exemplary linkages are described in U.S. Patent Nos. 6,737,236, 7,259,258, 7,375,234, and 7,427,678, and U.S. Patent Publication No. 2011 / 0059865(A1), each of which is incorporated herein by reference. In some embodiments, nucleic acids or other reaction components can be bound to a gel or other semi-solid support, which is then bound or attached to a solid-phase support. In such embodiments, nucleic acids or other reaction components are considered to be solid phases.

[0130] In some embodiments, the solid support comprises a microparticle, a bead, a planar support, a patterned surface, or a well. In some embodiments, the planar support is the interior or exterior surface of a tube.

[0131] The term "bead" refers to a small object made of a rigid or semi-rigid material. The object can have a shape characterized as, for example, a sphere, an ellipsoid, a microsphere, or other recognized particle shape, whether with regular or irregular dimensions. Examples of materials useful for beads include, but are not limited to, glass; plastics, such as acrylic, polystyrene, or copolymers of styrene with another material, polypropylene, polyethylene, polybutylene, polyurethane, or polytetrafluoroethylene (TEFLON® from Chemours); polysaccharides or cross-linked polysaccharides, such as agarose or Sepharose; nylon; nitrocellulose; resins; silica or silica-based materials, including silicon and modified silicon; carbon fiber; metals; inorganic glass; fiber optic bundles; or various other polymers. Examples of beads include, but are not limited to, controlled-pore glass beads, paramagnetic beads, triazoles, Sepharose beads, nanocrystals, and others known in the art, such as those described in the Microsphere Detection Guide from Bangs Laboratories, Fishers Ind. Beads may also be coated with a polymer having functional groups to which oligonucleotides can be attached. As used herein, the term "solid support" refers to a rigid substrate that is insoluble in aqueous liquids. The substrate may be non-porous or porous. The substrate can optionally incorporate liquid (e.g., through porosity), but will typically be sufficiently rigid so that it does not significantly swell when incorporating liquid and does not significantly shrink when the liquid is removed by drying. Non-porous solid supports are generally impermeable to liquids or gases. Exemplary solid support materials include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene with other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon®, cyclic olefins, polyimides, etc.), nylon, ceramics, resins, Zeonor, silica or silica-based materials, including silicon and modified silicon, carbon, metals, inorganic glass, fiber optic bundles, and polymers.A particularly useful material is glass. Other suitable substrate materials include polymeric materials, plastics, silicon, quartz (fused silica), borofloat glass, silica, silica-based materials, carbon, metals including gold, optical fibers or fiber optic bundles, sapphire, or plastic materials such as COC and epoxy. A particular material can be selected based on the properties desired for a particular use. For example, a material that is transparent to radiation of a desired wavelength is useful for analytical techniques that will utilize radiation of a desired wavelength, such as one or more of the techniques described herein. Conversely, it may be desirable to select a material that does not transmit radiation of a certain wavelength (e.g., opaque, absorbing, or reflective). This can be useful for forming masks used during the fabrication of structured substrates or for chemical reactions or analytical detection performed using the structured substrates. Other properties of materials that can be utilized include inertness or reactivity to certain reagents used in downstream processes, or ease or low cost of manipulation during the manufacturing process. Further examples of materials that can be used in the structured substrates or methods of the present disclosure are described in U.S. Patent Application Publication Nos. 2012 / 0316086(A1) and 2013 / 0116153, the contents of each of which are incorporated by reference in their entirety. In some embodiments, the solid support is a flow cell.

[0132] The beads need not be spherical; irregular particles may be used. Alternatively or additionally, the beads may be porous. Bead sizes range from nanometers, i.e., 100 nm, to millimeters, i.e., 1 mm, with beads ranging from about 0.2 microns to about 200 microns, or from about 0.5 to about 5 microns, although smaller or larger beads may be used in some embodiments.

[0133] As used herein, the term "flow cell" is intended to mean a container having a chamber in which a reaction can occur, an inlet for delivering reagents to the chamber, and an outlet for removing reagents from the chamber. In some embodiments, a flow cell is a chamber that includes a solid surface through which one or more fluidic reagents can flow. In some embodiments, a solid support comprises one or more surfaces of a flow cell. As used herein, the term "flow cell" includes a chamber that includes a solid surface through which one or more fluidic reagents can flow. A flow cell can be an ordered or random flow cell.

[0134] Examples of flow cells and associated fluidic systems and detection platforms that can be readily used in the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008), International Publication No. WO 04 / 018497, U.S. Patent No. 7,057,026, International Publication No. WO 91 / 06678, International Publication No. WO 07 / 123744, U.S. Patent No. 7,329,492, U.S. Patent No. 7,211,414, U.S. Patent No. 7,315,019, U.S. Patent No. 7,405,281, and U.S. Patent Application Publication No. 2008 / 0108082, each of which is incorporated herein by reference. In some embodiments, the chamber is configured for detection of a reaction occurring within the chamber. For example, the chamber may include one or more transparent surfaces that allow for optical detection of a biological specimen, optically labeled molecules, or the like within the chamber. Exemplary flow cells include, but are not limited to, those used in nucleic acid sequencing devices, such as the Genome Analyzer®, MiSeq®, NextSeq®, or HiSeq® platforms marketed by Illumina, Inc. (San Diego, Calif.), or the SOLiD™ or Ion Torrent™ sequencing platforms marketed by Life Technologies (Carlsbad, Calif.). Exemplary flow cells and methods for their manufacture and use are also described, for example, in International Publication No. 2014 / 142841 (A1); U.S. Patent Application Publication No. 2010 / 0111768 (A1); and U.S. Patent No. 8,951,781, each of which is incorporated herein by reference.

[0135] As used herein, the term "different" when used in reference to nucleic acids means that the nucleic acids have nucleotide sequences that are not the same as each other. Two or more nucleic acids may have different nucleotide sequences along their entire length. Alternatively, two or more nucleic acids may have different nucleotide sequences along a substantial portion of their length. For example, two or more nucleic acids may have different target nucleotide sequence portions for two or more molecules, but may also have universal sequence portions that are the same on two or more molecules. This term can also be applied to proteins that can be distinguished as different from each other based on differences in amino acid sequence.

[0136] "Complementary" means that an oligonucleotide contains a sequence of nucleotides that can form a double-stranded structure by base pairing with another oligonucleotide or a portion thereof. "Substantially complementary" means that the oligonucleotide has at least 85%, 90%, 95%, 98%, 99%, or 100% overall sequence identity to the complementary sequence. In various embodiments, "complementary" oligonucleotides are 100% complementary to each other, while in other embodiments, a first oligonucleotide sequence is at least about 95% (meaning greater than or equal to) complementary to a second oligonucleotide sequence over the length of the first oligonucleotide, and is at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, or at least about 50% complementary to a second oligonucleotide over the length of the first oligonucleotide, to the extent that the oligonucleotides can hybridize to each other under the conditions utilized. The percent complementarity is determined over the length of the oligonucleotide. For example, consider a first oligonucleotide in which 18 of the 20 nucleotides of the first oligonucleotide are complementary to a 20 nucleotide region in a second oligonucleotide of total length 100 nucleotides, the oligonucleotides are 90 percent complementary. In this example, the remaining non-complementary nucleotides may be clustered or interspersed with complementary nucleobases and need not be adjacent to each other or to complementary nucleotides.

[0137] As used herein, a "primer" is a nucleic acid molecule that can hybridize to a target sequence, such as an adapter attached to a library fragment. As an example, an amplification primer can serve as a starting point for template amplification and cluster generation. In another example, a synthesized nucleic acid (template) strand may contain a site to which a primer (e.g., a sequencing primer) can hybridize to prime the synthesis of a new strand complementary to the synthesized nucleic acid strand. Any primer can contain any combination of nucleotides or their analogs. In some examples, a primer is a single-stranded oligonucleotide or polynucleotide. The primer can be any number of bases long and can contain a variety of non-naturally occurring nucleotides. In various embodiments, the sequencing primer is a short strand ranging from 5-60 bases, 10-60 bases, 10-20 bases, 10-30 bases, 10-40 bases, 10-50 bases, or 20-40 bases.

[0138] As used herein, the term "molecular identifier," "single molecular identifier," or "SMI" refers to a sequence of nucleotides applied or specified in a nucleic acid molecule that can be used to distinguish individual nucleic acid molecules or groups of nucleic acid molecules from one another. When incorporated into a nucleic acid, single molecular identifiers (SMIs) can be used to correct for subsequent amplification bias by directly counting SMIs that are sequenced after amplification. SMIs (e.g., UMIs) can be attached to similar nucleic acids, e.g., adapters, making each nucleic acid unique. SMIs (e.g., UMIs) can also be used to uniquely tag individual molecules (e.g., individual mRNA molecules) in a sample (e.g., individual mRNA molecules in a tissue sample, cell sample, or sample library). In some embodiments, the UMI is a random nucleotide sequence (e.g., N9).

[0139] As used herein, the term "unique molecular identifier" or "UMI" refers to a sequence of nucleotides applied or identified in a nucleic acid molecule that can be used to distinguish individual nucleic acid molecules from one another. UMIs can be sequenced along with the nucleic acid molecule to which they are associated to determine whether the read sequence is from one source nucleic acid molecule or another. The term "UMI" can be used herein to refer to both the sequence information of a polynucleotide and the physical polynucleotide itself. When used in reference to a capture probe or other nucleic acid, the term "unique molecular index," "unique molecular identifier," or "UMI" is intended to refer to a portion of the probe that is useful as a molecular barcode for uniquely tagging each molecule in a sample library. A UMI may be represented as "NNNN..." in a string of nucleic acid to designate that portion of the oligonucleotide as a UMI. A UMI may be 6 to 20 nucleotides or longer in length. UMIs are similar to barcodes commonly used to distinguish reads from one sample from reads from other samples, but UMIs are instead used to distinguish one nucleic acid template fragment from another when many fragments from individual samples are sequenced together. The UMI can be defined in many ways, as described in WO 2019 / 108972 and WO 2018 / 136248, which are incorporated herein by reference. In some embodiments, the UMI comprises a spatial barcode.

[0140] As used herein, the term "universal sequence" refers to a sequence of nucleotides common to two or more nucleic acid molecules, even if the molecules also have regions of different sequence. A universal sequence present in different members of a population of molecules allows for the capture of multiple different nucleic acids using a population of universal capture nucleic acids that are complementary to the universal sequence. Similarly, a universal sequence present in different members of a population of molecules allows for the replication or amplification of multiple different nucleic acids using a population of universal primers that are complementary to the universal sequence. Thus, a universal capture nucleic acid or universal primer comprises a sequence that can specifically hybridize to a universal sequence. Target nucleic acid molecules may be modified, for example, to attach universal adapters to one or both ends of different target sequences. Universal capture oligonucleotides are applicable to interrogating multiple different oligonucleotides without necessarily distinguishing between different species, while target-specific capture sequences are applicable to distinguish between different species. A non-limiting example of a universal sequence is a poly-T nucleotide sequence.

[0141] As used herein, a "semi-random" nucleotide sequence comprises or consists of a partially predetermined nucleotide sequence combined with random nucleotide sequences.

[0142] As used herein, the terms "include," "including," "includes," "including," "contain," "containing," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, product-by-process, or composition of matter that includes, includes, or contains an element or list of elements not only includes those elements, but may also include other elements not expressly listed in or inherent to such process, method, product-by-process, or composition of matter.

[0143] As used herein, the term "adapter" generally refers to any linear nucleic acid molecule that can be ligated to an oligonucleotide of the present disclosure. In some embodiments, the adapter comprises two reverse-complementary oligonucleotides that form a double-stranded structure. In some embodiments, the adapter comprises two oligonucleotides that are complementary in one portion and mismatched in another portion, forming a Y-shaped or forked adapter that is double-stranded in the complementary portion and has two floppy overhangs at the mismatched portion. In some embodiments, the adapter is copied onto the library molecule using template-directed polymerase synthesis (e.g., second-strand cDNA synthesis as described herein). In some embodiments, the adapter is ligated to the first complementary strand of the present disclosure. In some embodiments, the adapter comprises two oligonucleotides that are double-stranded in one portion and single-stranded in another portion, forming an adapter with overhangs. In some embodiments, the oligonucleotide primer comprises an adapter nucleotide sequence (e.g., a B15 nucleotide sequence). In some embodiments, the adapter comprises a sequence complementary to the primer. In further embodiments, the adapter comprises a sequence complementary to a P5 primer or a P5' primer. In some embodiments, the adapter comprises a sequence complementary to a P7 primer or a P7' primer. In some embodiments, the adapter comprises a sequence complementary to a B15 primer or a B15' primer. The terms "P5," "P7," "B15," "P5'" (P5 prime), "P7'" (P7 prime), "B15'" (B15 prime), "P15," "P17," and "A14" may be used when referring to oligonucleotide sequences of primers, e.g., clustered primers, and / or examples of oligonucleotide sequences complementary to primers. The terms "P5'" (P5 prime), "P7'" (P7 prime), "B15'" (B15 prime), and "A14'" (A14 prime) refer to the complements of P5, P7, B15, and A14, respectively.It will be understood that any suitable primers can be used in the methods presented herein, and the use of P5, P5', P7, P7', P15, P17, B15, B15', A14 and A14' is only an exemplary embodiment. The use of primers such as P5, P5', P7, P7', P15, P17, B15, B15', A14 and A14' or their complements on a flow cell is known in the art, as exemplified by the disclosures of WO 2019 / 222264, WO 2007 / 010251, WO 2006 / 064199, WO 2005 / 065814, WO 2015 / 106941, WO 1998 / 044151 and WO 2000 / 018957, each of which is incorporated by reference in its entirety.

[0144] For example, any suitable forward amplification primer can be useful in the methods provided herein for hybridization to and amplification of complementary sequences and sequences, whether immobilized or in solution. Similarly, any suitable reverse amplification primer can be useful in the methods provided herein for hybridization to and amplification of complementary sequences and sequences, whether immobilized or in solution. One of skill in the art will understand how to design and use suitable primer sequences for nucleic acid capture and / or amplification as provided herein. In some embodiments, the "first clustered primer" described herein is a P5 primer. In some embodiments, the "first clustered primer" described herein is a P7 primer. In some embodiments, the "first clustered primer" described herein is a P5' primer. In some embodiments, the "first clustered primer" described herein is a P7' primer. In some embodiments, the "second clustered primer" described herein is a P5 primer. In some embodiments, the "second clustered primer" described herein is a P7 primer. In some embodiments, the "second clustered primer" described herein is a P5' primer. In some embodiments, the "second clustered primer" described herein is a P7' primer. In some embodiments, P5 comprises or consists of the polynucleotide sequence 5'AAT GAT ACG GCG ACC ACC GA 3' (SEQ ID NO: 1), or a variant thereof. In some embodiments, P5 comprises or consists of the polynucleotide sequence 5'AAT GAT ACG GCG ACC ACC GAG ATC TAC AC 3' (SEQ ID NO: 2), or a variant thereof. In some embodiments, P7 comprises or consists of the polynucleotide sequence 5'CAA GCA GAA GAC GGC ATA CG 3' (SEQ ID NO: 3), or a variant thereof.In some embodiments, P7 comprises or consists of the polynucleotide sequence 5' CAA GCA GAA GAC GGC ATA CGA GAT 3' (SEQ ID NO:4), or a variant thereof. In some embodiments, P5' comprises or consists of the polynucleotide sequence 5' TCG GTG GTC GCC GTA TCA TT 3' (SEQ ID NO:5), or a variant thereof. In some embodiments, P5' comprises or consists of the polynucleotide sequence 5' GTG TAG ATC TCG GTG GTC GCC GTA TCA TT 3' (SEQ ID NO:6), or a variant thereof. In some embodiments, P7' comprises the polynucleotide sequence 5' CGT ATG CCG TCT TCT GCT TG 3' (SEQ ID NO:7), or a variant thereof. In some embodiments, P7' comprises or consists of the polynucleotide sequence 5' ATC TCG TAT GCC GTC TTC TGC TTG 3' (SEQ ID NO:8), or a variant thereof. In some embodiments, B15 comprises or consists of the polynucleotide sequence 5'GTCTCGTGGGCTCGG 3' (SEQ ID NO: 9), or a variant thereof. In some embodiments, B15' comprises or consists of the polynucleotide sequence 5'CCGAGCCCACGAGAC 3' (SEQ ID NO: 10), or a variant thereof. In some embodiments, P15 comprises or consists of the polynucleotide sequence 5'TTTTTTAATG ATACGGCGAC CACCGAGANC TACAC 3' (SEQ ID NO: 11), or a variant thereof. In some embodiments, P17 comprises or consists of the polynucleotide sequence 5'TTTTTTNNNC AAGCAGAAGA CGGCATACGA GAT 3' (SEQ ID NO: 12), or a variant thereof. The term "variant," as used herein with respect to any of the sequences recited herein, refers to a variant nucleic acid that is substantially identical, i.e., has only some nucleotide sequence variations relative to the non-variant sequence, for example.In some embodiments, variants have at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% overall nucleotide sequence identity to the non-variant nucleic acid sequence. It is understood that references to P5 and P7 herein may refer to different primer sequences. Any suitable combination of primer sequences is encompassed by the present disclosure.

[0145] As used herein, "anchor" refers to a moiety that attaches a nanoscaffold to a substrate. Anchors include chemical moieties, peptides, or oligonucleotides. Polynucleotide anchors can be 4 to 20 nucleotides.

[0146] As used herein, a "splint oligonucleotide" refers to an oligonucleotide that includes a sequence complementary to a region on a surface probe and another sequence complementary to a capture oligonucleotide (e.g., attached to a substrate). Splint oligonucleotides are typically 10 or more nucleotides in length. Splint oligonucleotides can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 60, 75, or 80 nucleotides.

[0147] As used herein, "surface oligonucleotide" refers to an oligonucleotide that includes an anchor sequence for attaching the oligo to the surface of a substrate, a spatial barcode sequence, and a sequence that hybridizes with a splint oligonucleotide. Surface oligonucleotides are typically 20 nucleotides or more in length. Surface oligonucleotides can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 60, 75, or 80 nucleotides or more in length.

[0148] As used herein, the terms "address," "tag," "barcode," or "index," when used in reference to a nucleotide sequence, are intended to mean a unique nucleotide sequence that is distinct from other indexes and from other nucleotide sequences within polynucleotides contained within a sample. A nucleotide "address," "tag," "barcode," or "index" can be a random or specifically designed nucleotide sequence. An "address," "tag," "barcode," or "index" can be of any desired sequence length, so long as it is long enough to be a unique nucleotide sequence within multiple indexes in the population and / or multiple polynucleotides being analyzed or interrogated. The nucleotide "addresses," "tags," "barcodes," or "indexes" of the present disclosure are useful, for example, for attaching to target polynucleotides to tag or mark specific species to identify all members of the tagged species within a population. Thus, an index is useful as a barcode, where different members of the same molecular species can contain the same index, and different species within different polynucleotide populations can have different indexes.

[0149] As used herein, the term "barcode" is also intended to refer to a series of nucleotides in an oligonucleotide that can be used to provide barcode information, including one or more of the oligonucleotide's identity, its spatial address on a surface, its characteristics, or an operation performed on the oligonucleotide. The barcode may be a naturally occurring nucleotide sequence or a nucleotide sequence that does not naturally occur in the organism from which the barcoded nucleic acid is obtained. For example, each nucleic acid capture probe in a population on a substrate for spatial capture of nucleic acids in a biological sample, such as a permeabilized tissue sample or cell suspension, may contain a barcode sequence that is different from all other nucleic acid capture probes in the population. Alternatively, each nucleic acid probe in the population may contain a barcode sequence that is different from some or most other nucleic acid capture probes in the population. For example, each capture probe in the population may have a barcode that is present for several different capture probes in the population, even if capture probes with a common barcode differ from each other in other sequence regions along their length. In various embodiments, one or more barcode sequences used with biological tissue are not present in the genome, transcriptome, or other nucleic acids of the biological specimen. For example, the barcode sequence can have less than 80%, 70%, 60%, 50%, or 40% sequence identity to a nucleic acid sequence in a particular biological tissue.

[0150] A tag / index / barcode sequence may be unique to a single nucleic acid species in a population, or may be shared by several different nucleic acid species in the population. For example, each nucleic acid probe in a population may contain a tag / index / barcode sequence that is different from all other nucleic acid probes in the population. Alternatively, each nucleic acid probe in a population may contain a tag / index / barcode sequence that is different from several or most other nucleic acid capture probes in the population. For example, each probe in a population may have a tag / index / barcode that is present in several different capture probes in the population, even if probes with a common tag / index / barcode differ from each other in other sequence regions along their length. In certain embodiments, one or more tag / index / barcode sequences used with a biological specimen are not present in the genome, transcriptome, or other nucleic acids of the biological specimen. For example, a tag / index / barcode sequence may have less than 80%, 70%, 60%, 50%, or 40% sequence identity to a nucleic acid sequence in a particular biological specimen.

[0151] As used herein, "spatial address," "spatial tag," "spatial barcode," "spatial barcode sequence," or "spatial index," when used in reference to a nucleotide sequence, means an address, tag, barcode, or index that encodes spatial information related to the region or location of origin of an addressed, tagged, barcoded, or indexed nucleic acid in a tissue sample. The sequence can be a naturally occurring sequence or a sequence that does not naturally occur in the organism from which the barcoded nucleic acid is obtained.

[0152] As used herein, "template switch oligo" or "TSO" refers to an oligonucleotide useful in methods of DNA sequencing, in which the oligonucleotide hybridizes to non-templated cytosine (C) nucleotides added to the end of a target RNA or DNA template by a reverse transcriptase enzyme during reverse transcription. For example, the TSO comprises a poly-G sequence that binds to a poly-C sequence added to the target template. In some embodiments, the TSO comprises two to five guanosines that hybridize to the non-templated cytosine nucleotides. In some embodiments, the two to five guanosines are riboguanosines or modified or locked nucleic acids. In some embodiments, the TSO comprises rGrGrG.

[0153] As used herein, the term "amplicon," when used with reference to a nucleic acid, refers to the product of copying a nucleic acid, which product has a nucleotide sequence that is the same as or complementary to at least a portion of the nucleotide sequence of the nucleic acid. Amplicons can be generated by any of a variety of amplification methods using a nucleic acid or its amplicon as a template, including, for example, polymerase extension, polymerase chain reaction (PCR), rolling circle amplification (RCA), ligation extension, or ligation chain reaction. An amplicon can be a nucleic acid molecule having a single copy of a particular nucleotide sequence (e.g., a PCR product) or multiple copies of a nucleotide sequence (e.g., a concatemeric product of RCA). A first amplicon of a target nucleic acid can be a complementary copy. Subsequent amplicons are copies made from the target nucleic acid or the first amplicon after the generation of the first amplicon. Subsequent amplicons can have a sequence that is substantially complementary to or substantially identical to the target nucleic acid.

[0154] The number of template copies or amplicons that can be generated can be modulated by appropriate modification of the amplification reaction, including, for example, varying the number of amplification cycles performed, using polymerases of different processivities in the amplification reaction, and / or varying the length of time the amplification reaction is performed, as well as modifying other conditions known in the art to affect amplification yield. The copy number of the nucleic acid template can be at least 1, 10, 100, 200, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, and 10,000 copies, and can vary depending on the particular application.

[0155] As used herein, the term "complementary," when used with respect to a polynucleotide, is intended to mean a polynucleotide comprising a nucleotide sequence capable of selectively annealing to a specific region of a target polynucleotide under specific conditions; for example, a first oligonucleotide sequence may form a double-stranded structure by matching base pairs with a second oligonucleotide sequence or portion thereof. In various embodiments, "complementary" oligonucleotides are 100% complementary to each other, while in other embodiments, a first oligonucleotide sequence is at least about 95% (meaning greater than or equal to) complementary to a second oligonucleotide sequence over the length of the first oligonucleotide, and is at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, or at least about 50% complementary to a second oligonucleotide over the length of the first oligonucleotide, to the extent that the oligonucleotides can hybridize to each other under the conditions utilized. The percent complementarity is determined over the length of the oligonucleotide. For example, consider a first oligonucleotide in which 18 of the 20 nucleotides of the first oligonucleotide are complementary to a 20-nucleotide region in a second oligonucleotide of 100 nucleotides in total length, and the oligonucleotides are 90 percent complementary. In this example, the remaining non-complementary nucleotides may be clustered or interspersed with complementary nucleobases and need not be adjacent to each other or to complementary nucleotides. As used herein, the term "substantially complementary" and grammatical equivalents are intended to mean a polynucleotide comprising a nucleotide sequence that can specifically anneal to an identified region of a target polynucleotide under specific conditions. Annealing refers to the nucleotide base pairing interaction between one nucleic acid and another nucleic acid, resulting in the formation of a duplex, triplex, or other higher-order structure.The primary interactions are typically nucleotide base-specific, e.g., A:T, A:U, and G:C, through Watson-Crick and Hoogsteen hydrogen bonding. In certain embodiments, base stacking and hydrophobic interactions may also contribute to the stability of the duplex. Conditions under which a polynucleotide anneals to a complementary or substantially complementary region of a target nucleic acid are well known in the art, as described, for example, in Nucleic Acid Hybridization, A Practical Approach, Hames and Higgins, eds., IRL Press, Washington, DC (1985) and Wetmur and Davidson, Mol. Biol. 31:349 (1968). Annealing conditions depend on the particular application and can be routinely determined by those skilled in the art without undue experimentation.

[0156] As used herein, the term "array" refers to a collection of sites that can be distinguished from one another according to their relative positions. Different molecules at different sites of an array can be distinguished from one another according to the site's position within the array. Each site of an array can contain one or more molecules of a particular type. For example, a site can contain a single target nucleic acid molecule having a particular sequence, or a site can contain several nucleic acid molecules having the same sequence (and / or its complementary sequence). The sites of an array can be different features disposed on the same substrate. Exemplary features include, but are not limited to, beads (or other particles) in or on a substrate, droplets, wells in a substrate, protrusions from a substrate, bumps on a substrate, or channels within a substrate. The sites of an array can be separate substrates, each with a different molecule. The different molecules attached to the separate substrates can be identified according to the position of the substrate on a surface to which the substrates are associated, or according to the position of the substrate within a liquid or gel. An exemplary array in which separate substrates are disposed on a surface includes, but is not limited to, beads in wells.

[0157] As used herein, the term "dNTP" refers to deoxynucleoside triphosphate. NTP refers to ribonucleotide triphosphate. Purine bases (Pu) include adenine (A), guanine (G), and their derivatives and analogs. Pyrimidine bases (Py) include cytosine (C), thymine (T), uracil (U), and their derivatives and analogs. Examples of such derivatives or analogs include, but are not limited to, those modified with reporter groups, biotinylated, amine-modified, radiolabeled, alkylated, and the like, including phosphorothioates, phosphites, and derivatives modified at ring atoms. Reporter groups can be fluorescent groups such as fluorescein, chemiluminescent groups such as luminol, terbium chelators such as N-(hydroxyethyl)ethylenediaminetriacetic acid, which allow detection by delayed fluorescence, and the like.

[0158] As used herein, the terms "ligation," "ligating," and their grammatical equivalents are intended to mean forming a covalent or covalent linkage between the ends of two or more nucleic acids, e.g., oligonucleotides and / or polynucleotides, typically in a template-driven reaction. The nature of the bond or linkage can vary widely, and ligation can be performed enzymatically or chemically. As used herein, ligation is typically performed enzymatically, forming a phosphodiester bond between the 5' carbon-terminal nucleotide of one oligonucleotide and the 3' carbon of another nucleotide. Template-driven ligation reactions are described in references such as U.S. Pat. Nos. 4,883,750, 5,476,930, 5,593,826, and 5,871,921, which are incorporated herein by reference in their entireties. The term "ligation" also encompasses the non-enzymatic formation of phosphodiester bonds, as well as the formation of non-phosphodiester covalent bonds between the ends of oligonucleotides, such as phosphorothioate bonds, disulfide bonds, and the like.

[0159] As used herein, the term "each," when used in reference to a set of items, is intended to identify an individual item in the set, but does not necessarily refer to every item in the set, unless the context clearly dictates otherwise.

[0160] As used herein, the term "extending," when used in reference to a nucleic acid, is intended to mean the addition of at least one nucleotide or oligonucleotide to a nucleic acid. In certain embodiments, one or more nucleotides can be added to the 3'-end of a nucleic acid, for example, via polymerase catalysis (e.g., DNA polymerase, RNA polymerase, or reverse transcriptase). Chemical or enzymatic methods can be used to add one or more nucleotides to the 3'- or 5'-end of a nucleic acid. One or more oligonucleotides can be added to the 3'- or 5'-end of a nucleic acid, for example, via chemical or enzymatic (e.g., ligase-catalyzed) methods. The extension reaction, in which nucleotides are added to the 3'-end of an oligonucleotide (e.g., a primer), is performed in the presence of a polymerase, such as a DNA polymerase or an RNA polymerase. In some embodiments, the polymerase is a non-thermostable isothermal strand-displacing polymerase. Suitable non-thermostable strand-displacing polymerases according to the present disclosure can be found, for example, by New England BioLabs, Inc. and may include phi29, Bsu, Klenow, DNA Polymerase I (E. coli), and Therminator. In some embodiments, the extension reaction is performed by recombinase polymerase amplification (RPA). RPA comprises three core enzymes: a recombinase, a single-stranded DNA-binding protein (SSB), and a strand-displacing polymerase, as described by Daher et al. (Rana K Daher, Gale Stewart, Maurice Boissinot, Michel G Bergeron, Recombinase Polymerase Amplification for Diagnostic Applications, Clinical Chemistry, Volume 62, Issue 7, July 1, 2016). One or more oligonucleotides can be added to the 3' or 5' end of the nucleic acid, for example, by chemical or enzymatic (e.g., ligase-catalyzed) methods. A nucleic acid can be extended in a template-directed manner, whereby the extension product is complementary to a template nucleic acid that is hybridized to the nucleic acid being extended.

[0161] Provided herein are arrays and methods for spatial detection and analysis of nucleic acids in tissue samples (e.g., mutation analysis or single nucleotide variation (SNV) detection and indel detection). The arrays described herein can include a substrate to which multiple capture probes are immobilized, such that each capture probe occupies a different position on the array. Some or all of the multiple capture probes can include a unique position tag (i.e., a spatial address or index sequence). The spatial address can describe the position of the capture probe on the array. The position of the capture probe on the array can be correlated to a position in the tissue sample.

[0162] As used herein, the terms "poly T" or "poly A," when used in reference to a nucleic acid sequence (e.g., a capture nucleotide sequence), are intended to mean a string of two or more thiamine (T) or adenine (A) bases, respectively. The poly T or poly A can include at least about 2, 5, 8, 10, 12, 15, 18, 20, 22, 25, 28, 30, 32, 35, 38, 40, or more T or A bases, respectively. Alternatively, or additionally, the poly T or poly A can include up to about 40, 38, 35, 32, 30, 28, 25, 22, 20, 18, 15, 12, 10, 8, 5, or 2 nucleotides. In some embodiments, the present disclosure contemplates the use of "poly-TVN" sequences, where "T" is a capture nucleotide sequence, "V" is adenine (A), cytosine (C), or guanine (G), and "N" is adenine (A), cytosine (C), guanine (G), or thymine (T). Poly-TVN sequences are used in some embodiments to bias reverse transcription toward bases of a poly-A tail on an mRNA molecule, e.g., in template switching.

[0163] As used herein, the terms "tagmentation," "tagment," or "tagmenting" refer to the conversion of nucleic acids, e.g., DNA, into adapter-modified templates in solution ready for clustering and sequencing using transposase-mediated fragmentation and tagging. This process often involves modification of the nucleic acid by a transposome complex containing a transposase enzyme complexed with adapters containing transposon end sequences. Tagging simultaneously fragments the nucleic acid and ligates adapters to the 5' ends of both strands of the double-stranded fragments. Following a purification step to remove the transposase enzyme, additional sequences are added to the ends of the adapted fragments by PCR.

[0164] "Transposase" refers to an enzyme capable of forming a functional complex containing a transposon end-containing composition (e.g., a transposon, a transposon end, a transposon end composition) and catalyzing the insertion or transposition of the transposon end-containing composition into a double-stranded target nucleic acid with which it is incubated, e.g., in an in vitro transposition reaction. Transposases provided herein can also include integrases from retrotransposons and retroviruses. Transposases, transposomes, and transposome complexes are generally known to those of skill in the art, as exemplified by the disclosure of U.S. Patent Application Publication No. 2010 / 0120098, the entire contents of which are incorporated herein by reference. While many embodiments described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it is understood that any transposition system capable of inserting transposon ends with sufficient efficiency to 5' tag and fragment the target nucleic acid for the intended purpose may be used in the present invention. In certain embodiments, a preferred transposition system can insert transposon ends in a random or near-random manner to 5' tag and fragment target nucleic acids.

[0165] As used herein, the term "transposition reaction" refers to a reaction in which one or more transposons are inserted into a target nucleic acid, for example, at random or near-random sites. The essential components of a transposition reaction are a transposase and a DNA oligonucleotide representing the nucleotide sequence of the transposon, including the transferred transposon sequence and its complement (the non-transferred transposon end sequence), as well as other components necessary to form a functional transposition or transposome complex. The DNA oligonucleotide may further include additional sequences (e.g., adapter or primer sequences) if needed or desired. In some embodiments, the methods provided herein are exemplified using transposition complexes formed by hyperactive Tn5 transposase and Tn5-type transposon ends (Goryshin and Reznikoff, 1998, J. Biol. Chem., 273:7367) or MuA transposase and Mu transposon ends containing R1 and R2 end sequences (Mizuuchi, 1983, Cell, 35:785; Savilahti et al., 1995, EMBO J., 14:4893). However, any transposition system capable of inserting transposon ends in a random or near-random manner with sufficient efficiency to 5'-tag and fragment target DNA for the intended purpose can be used in the present invention.Examples of transposition systems known in the art that can be used in the methods of the present invention include Staphylococcus aureus Tn552 (Colegio et al., 2001, J. Bacterid., 183:2384-8; Kirby et al., 2002, Mol. Microbiol., 43:173-86), TyI (Devine and Boeke, 1994, Nucleic Acids Res., 22:3765-72 and International Patent Application No. WO 95 / 23875), Transposon Tn7 (Craig, 1996, Science. 271:1512; Craig, 1996, Review in: Curr. Top Microbiol. Immunol., 204:27-48), TnIO and ISIO (Kleckner et al., 1996, Curr. Top Microbiol. Immunol., 204:27-48). Immunol, 204:49-82), mariner transposase (Lampe et al., 1996, EMBO J., 15:5470-9), Tci (Plasterk, 1996, Curr Top Microbiol Immunol, 204:125-43), P Element (Gloor, 2004, Methods Mol Biol, 260:97-114), TnJ (Ichikawa and Ohtsubo, 1990, J Biol Chem., 265:18829-32), bacterial insertion sequences (Ohtsubo and Sekine, 1996, Curr. Top. Microbiol. Immunol. 204:1-26), retrovirus (Brown et al., 1989, Proc Natl Acad Sci USA, 86:2525-9), and yeast retrotransposons (Boeke and Corces, 1989, Annu Rev Microbiol. 43:403-34). Methods for inserting transposon ends into target sequences can be performed in vitro using any suitable transposon system for which a suitable in vitro transposition system is available or which can be developed based on knowledge in the art.Generally, an in vitro transposition system suitable for use in the methods provided herein requires, at a minimum, a transposase enzyme of sufficient purity, sufficient concentration, and sufficient in vitro transposition activity, and transposon ends that form a functional complex with the respective transposase capable of catalyzing a transposition reaction. Suitable transposase transposon end sequences that can be used in the present invention include, but are not limited to, wild-type, derivative, or mutant transposon end sequences that form a complex with a transposase selected from wild-type, derivative, or mutant forms of the transposase. As used herein, the term "transposome complex" refers to a transposase enzyme that noncovalently binds to double-stranded nucleic acid. For example, the complex can be a transposase enzyme preincubated with double-stranded transposon DNA under conditions that support noncovalent complex formation. The double-stranded transposon DNA can include, but is not limited to, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions, or other double-stranded DNA that can interact with a transposase, such as a hyperactive Tn5 transposase.

[0166] As used herein, the term "random" can be used to refer to the spatial arrangement or composition of locations on a surface. For example, the arrays described herein have at least two types of order: one with respect to the spacing and relative positions of features (also called "sites"), and the second with respect to the identity or predetermined knowledge of specific molecular species present at a particular feature. Thus, the features of an array can be randomly spaced so that nearest neighboring features have variable spacing between each other. Alternatively, the spacing between features can be ordered to form a regular pattern, such as, for example, a rectilinear or hexagonal grid. In another aspect, the features of an array can be random with respect to the identity or predetermined knowledge of the gene of interest (e.g., nucleic acid of a particular sequence) that occupies each feature, regardless of whether the spacing results in a random or regular pattern. The arrays described herein can be ordered in one respect and random in another respect. For example, in some embodiments described herein, a surface is contacted with a population of nucleic acids under conditions in which the nucleic acids attach to sites that are ordered with respect to their relative positions but "randomly arranged" with respect to the sequence knowledge of the nucleic acid species present at any particular site. Reference to nucleic acids being "randomly distributed" at locations on a surface is intended to refer to a lack of knowledge or pre-determination as to which nucleic acids will be captured at which locations (whether or not the locations are arranged in a regular pattern).

[0167] As used herein, a "biological sample" may include one or more biological or chemical substances, such as nucleic acids, oligonucleotides, proteins, cells, tissues, organisms, and / or biologically active chemical compounds, such as analogs or mimetics of the above species.

[0168] As used herein, the term "tissue" is intended to mean an aggregate of cells and, optionally, intercellular material. Typically, cells in tissue are not free-floating in solution but are attached to one another to form multicellular structures. Exemplary tissue types include muscle, nerve, epidermis, and connective tissue. In some cases, the biological sample may include whole blood, lymph, serum, plasma, sweat, tears, saliva, sputum, cerebrospinal fluid, amniotic fluid, semen, vaginal discharge, serous fluid, synovial fluid, pericardial fluid, peritoneal fluid, pleural fluid, transudate, exudate, cystic fluid, bile, urine, gastric juice, intestinal fluid, fecal sample, fluid containing single or multiple cells, fluid containing cellular organelles, tissue fluid, organism fluid, viruses, including viral pathogens, fluid containing multicellular organisms, biological swabs, and biological washes. In further examples, the sample may be derived from an organ comprising, for example, an organ of the musculoskeletal system, such as muscle, bone, tendon, or ligament; an organ of the digestive system, such as the salivary gland, pharynx, esophagus, stomach, small intestine, large intestine, liver, gallbladder, or pancreas; an organ of the respiratory system, such as the larynx, trachea, bronchi, lungs, or diaphragm; an organ of the urinary system, such as the kidney, ureter, bladder, or urethra; a reproductive organ, such as the ovaries, fallopian tubes, uterus, vagina, placenta, testes, epididymis, vas deferens, seminal vesicles, prostate, penis, or scrotum; an organ of the endocrine system, such as the pituitary gland, pineal gland, thyroid gland, parathyroid gland, or adrenal gland; an organ of the circulatory system, such as the heart, arteries, veins, or capillaries; an organ of the lymphatic system, such as the lymphatic vessels, lymph nodes, bone marrow, thymus, or spleen; an organ of the central nervous system, such as the brain, brainstem, cerebellum, spinal cord, cranial nerves, or spinal nerves; a sensory organ, such as the eye, ear, nose, or tongue; or an organ of the integument, such as the skin, subcutaneous tissue, or mammary gland. In various embodiments, the tissue may be derived from a multicellular organism. In some embodiments, a tissue section may be contacted with the surface, for example, by placing the tissue on the surface. The tissue may be freshly excised from the organism, or the tissue may have been previously preserved, for example, by freezing (e.g., fresh frozen tissue), embedding in a material such as paraffin (e.g., formalin-fixed paraffin-embedded (FFPE) samples), formalin fixation, infiltration, dehydration, etc. Optionally, the tissue section may be attached to the surface using, for example, the techniques and compositions described in U.S. Pat. No. 11,390,912, the entire contents of which are incorporated herein by reference.In some embodiments, tissue can be permeabilized, and cells of the tissue can be lysed when the tissue contacts the surface. Any of a variety of treatments can be used, such as those described above for lysing cells. Target proteins and / or nucleic acids released from the permeabilized tissue can be captured by capture oligonucleotides on the surface. Thus, in various embodiments, the biological sample is a tissue sample. The thickness of the tissue sample or other biological sample contacted with the surface in the methods described herein can be any suitable thickness desired. In representative embodiments, the thickness is at least 0.1 μm, 0.25 μm, 0.5 μm, 0.75 μm, 1 μm, 5 μm, 10 μm, 50 μm, 100 μm, or more. Alternatively or additionally, the thickness of the biological sample contacted with the surface is 100 μm, 50 μm, 10 μm, 5 μm, 1 μm, 0.5 μm, 0.25 μm, 0.1 μm, or less.

[0169] As used herein, the term "tissue sample" refers to a piece of tissue obtained from a subject, optionally fixed, sectioned, and mounted on a planar surface, such as a microscope slide. The tissue sample may be a formalin-fixed, paraffin-embedded (FFPE) tissue sample, a fresh tissue sample, a frozen tissue sample, or the like. The methods disclosed herein may be performed before or after staining the tissue sample. For example, after hematoxylin and eosin staining, the tissue sample may be spatially analyzed according to the methods provided herein. The method may include analyzing the histology of the sample (e.g., using hematoxylin and eosin staining) and then spatially analyzing the tissue. In various embodiments, the tissue is removed from the sample by enzymatic digestion. In various embodiments, tissue removal occurs before RNA is removed from the tissue. In various embodiments, the tissue is removed via digestion with proteinase K, for example, at 37°C for 40 minutes.

[0170] As used herein, the term "formalin-fixed paraffin-embedded (FFPE) tissue section" refers to a piece of tissue, e.g., a biopsy, obtained from a subject, fixed in formaldehyde (e.g., 3% to 5% formaldehyde in phosphate-buffered saline) or Bouin's solution, embedded in wax, cut into thin sections, and then mounted on a flat surface, e.g., a microscope slide.

[0171] As used herein, the term "subject" encompasses mammals and non-mammals. Examples of mammals include, but are not limited to, any member of the mammalian class: humans, non-human primates such as chimpanzees, and other ape and monkey species, cows, horses, sheep, goats, pigs, rabbits, dogs, cats, rodents, rats, mice, guinea pigs, etc. Examples of non-mammals include, but are not limited to, birds, fish, etc. The term does not denote a particular age or sex.

[0172] The terms "P5" and "P7" may be used when referring to exemplary adapters. The terms "P5'" (P5 prime) and "P7'" (P7 prime) refer to the complements of P5 and P7, respectively. It will be understood that any suitable adapter may be used in the methods presented herein, and the use of P5 and P7 is only an exemplary embodiment. The use of adapters such as P5 and P7 or their complements on flow cells is known in the art, as exemplified by the disclosures of WO 2007 / 010251, WO 2006 / 064199, WO 2005 / 065814, WO 2015 / 106941, WO 1998 / 044151, and WO 2000 / 018957, which are incorporated by reference in their entireties. For example, any suitable forward amplification primer, whether immobilized or in solution, can be useful in the methods provided herein for hybridization to and amplification of complementary sequences and sequences. Similarly, any suitable reverse amplification primer, whether immobilized or in solution, can be useful in the methods provided herein for hybridization to and amplification of complementary sequences and sequences. Those skilled in the art will understand how to design and use suitable primer sequences for capture and / or amplification of nucleic acids as provided herein.

[0173] As used herein, "hybridizing" refers to the non-covalent association of a first oligonucleotide with a second oligonucleotide along the length of their polymer to form a double-stranded "duplex." As used herein, the term "hybridization" refers to the process by which two single-stranded polynucleotides non-covalently bond to form a stable double-stranded polynucleotide. The resulting double-stranded polynucleotide is a "hybrid" or "duplex." For example, two DNA oligonucleotide strands can associate through complementary base pairing. The strength of association between a first and second oligonucleotide increases with the complementarity between the nucleotide sequences within the oligonucleotides. The strength of hybridization between oligonucleotides can be characterized by the melting temperature (Tm), at which 50% of the duplex has the oligonucleotide strands dissociate from each other. Oligonucleotides that are "partially" hybridized to each other mean that they have sequences that are complementary to each other, but such sequences hybridize to each other only along a portion of their length to form a partial duplex. Oligonucleotides that are "unable" to hybridize include those physically separated from each other with an insufficient number of bases that can contact each other to hybridize. Hybridization conditions typically include a salt concentration of less than about 1 M, more usually less than about 500 mM, and can be less than about 200 mM. Hybridization buffers include buffered salt solutions such as 5% SSPE or other such buffers known in the art. Hybridization temperatures can be as low as 5°C, but are typically higher than 22°C, more typically higher than about 30°C, and typically higher than 37°C. Hybridization is usually performed under stringent conditions, i.e., under conditions in which the probe hybridizes to its target subsequence but does not hybridize to other non-complementary sequences. Stringent conditions are sequence-dependent, vary in different circumstances, and can be routinely determined by those skilled in the art.

[0174] As used herein, the term "plurality" is intended to mean a population of two or more members, which may all be the same, or where two or more members are different. Pluralities can range in size from small, medium, large, to very large. A small-sized plurality can range, for example, from a few members to tens of members. A medium-sized plurality can range, for example, from tens of members to about 100 or hundreds of members. A large plurality can range, for example, from about hundreds of members to about 1,000 members, thousands of members, and tens of thousands of members. A very large plurality can range, for example, from tens of thousands of members to about hundreds of thousands, millions, tens of millions, or hundreds of millions or more members. Thus, pluralities can range in size from 2 to well over 100 million members, as well as all sizes measured by number of members and ranges larger than the exemplary ranges above. Accordingly, the definition of this term is intended to include all integer values ​​greater than 2. An exemplary number of features in a microarray is 1.28 cm. 2 An exemplary plurality of nucleic acids may comprise, for example, about 1×10 5 , 5×10 5 and 1 x 10 6 or more distinct nucleic acid species. Thus, the definition of this term is intended to include all integer values ​​greater than 2. The upper limit of the plurality value can be set, for example, by the theoretical diversity of nucleotide sequences in a nucleic acid sample.

[0175] As used herein, the term "attached" refers to the state in which two things are joined, fastened, adhered, connected, or bonded to each other. For example, oligonucleotides can be attached to a substance such as a gel by covalent or non-covalent bonds. A covalent bond is characterized by the sharing of electron pairs between atoms. A non-covalent bond is a chemical bond that does not involve the sharing of electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0176] In some embodiments, nucleic acids in a tissue sample are transferred to an array and captured thereon. For example, a tissue section is placed in contact with the array, and nucleic acids are captured on the array and tagged by spatial addressing. The spatially tagged DNA molecules are released from the array and analyzed, for example, by high-throughput next-generation sequencing (NGS), such as sequencing-by-synthesis (SBS). In some embodiments, nucleic acids in a tissue section (e.g., a formalin-fixed, paraffin-embedded (FFPE) tissue section) are transferred to an array and captured thereon by hybridization to a capture probe or capture oligonucleotide. In some embodiments, the capture oligonucleotide may be a universal capture probe that hybridizes, for example, to an adapter region in a nucleic acid sequencing library and / or the polyA tail of an mRNA. In some embodiments, the capture probe may be a gene-specific capture probe that hybridizes, for example, to a specifically targeted mRNA or cDNA in a sample, such as a TruSeq™ Custom Amplicon (TSCA) oligonucleotide probe (Illumina, Inc.). The capture oligonucleotide may be a plurality of capture oligonucleotides, for example, a plurality of the same or different capture oligonucleotides.

[0177] In some embodiments, combinatorial indexing (addressing) systems are used to provide spatial information for the analysis of nucleic acids in tissue samples. Combinatorial indexing systems can involve the use of two or more spatial address sequences (e.g., two, three, four, five, or more spatial address sequences).

[0178] In some embodiments, two spatial address sequences are incorporated into nucleic acids during preparation of a sequencing library. The first spatial address can be used to define a specific location in the X dimension (i.e., a capture site) on the capture array, and the second spatial address sequence can be used to define a location in the Y dimension (i.e., a capture site) on the capture array. During library sequencing, both the X and Y spatial address sequences can be determined, and the sequence information can be analyzed to define a specific location on the capture array.

[0179] In some embodiments, three spatial address sequences are incorporated into nucleic acids during preparation of a sequencing library. The first spatial address can be used to define a specific location in the X dimension (i.e., a capture site) on the capture array, the second spatial address sequence can be used to define a location in the Y dimension (i.e., a capture site) on the capture array, and the third spatial address sequence can be used to define the location of a two-dimensional sample section (e.g., the location of a slice of a tissue sample) in a sample (e.g., a tissue biopsy) to provide positional spatial information in the third dimension (Z dimension) of the sample. During library sequencing, the X, Y, and Z spatial address sequences can be determined, and the sequence information can be analyzed to define a specific location on the capture array.

[0180] In some embodiments, a temporal address sequence (T) is optionally incorporated into the nucleic acid during preparation of a sequencing library. In some embodiments, the temporal address sequence can be combined with two or three spatial address sequences. The temporal address sequence can be used, for example, in the context of a time-course experiment to determine time-dependent changes in gene expression in a tissue sample. Time-dependent changes in gene expression can occur in a tissue sample, for example, in response to a chemical, biological, or physical stimulus (e.g., a toxin, drug, or heat). Nucleic acid samples obtained at different time points from comparable tissue samples (e.g., proximal slices of a tissue sample) can be pooled and sequenced in bulk. An optional first spatial address can be used to define a specific location in the X dimension (i.e., a capture site) on the capture array, an optional second spatial address sequence can be used to define a location in the Y dimension (i.e., a capture site) on the capture array, and an optional third spatial address sequence can define the location of a two-dimensional sample section (e.g., the location of a slice of a tissue sample) in a sample (e.g., a tissue biopsy) to provide positional spatial information in the third dimension (Z dimension) of the sample. During library sequencing, the T, X, Y, and Z address sequences are determined and the sequence information is analyzed to define a specific X, Y (and optionally Z) location on the capture array for each time point (T).

[0181] The address sequences X, Y, and optionally Z and / or T may be contiguous nucleic acid sequences, or the address sequences may be separated by one or more nucleic acids (e.g., 2 or more, 3 or more, 10 or more, 30 or more, 100 or more, 300 or more, or 1,000 or more). In some embodiments, the X, Y, and optionally Z and / or T address sequences may each individually and independently be combinatorial nucleic acid sequences.

[0182] In some embodiments, the length of an address sequence (e.g., X, Y, Z, or T) can each individually and independently be 100 nucleic acids or less, 90 nucleic acids or less, 80 nucleic acids or less, 70 nucleic acids or less, 60 nucleic acids or less, 50 nucleic acids or less, 40 nucleic acids or less, 30 nucleic acids or less, 20 nucleic acids or less, 15 nucleic acids or less, 10 nucleic acids or less, 8 nucleic acids or less, 6 nucleic acids or less, or 4 nucleic acids or less. The lengths of two or more address sequences in a nucleic acid can be the same or different. For example, if the length of address sequence X is 10 nucleic acids, the length of address sequence Y can be, for example, 8 nucleic acids, 10 nucleic acids, or 12 nucleic acids.

[0183] An address sequence (eg, a spatial address sequence such as X or Y) may be a partially or fully degenerate sequence.

[0184] In some embodiments, spatially addressed capture probes on the array may be released from the array onto tissue sections for the creation of spatially addressed sequencing libraries. In some embodiments, the capture probes comprise random primer sequences for in situ synthesis of spatially tagged cDNA from RNA in the tissue sections. In some embodiments, the capture probes are TruSeq™ Custom Amplicon (TSCA) oligonucleotide probes (Illumina, Inc.) for capturing and spatially tagging genomic DNA in tissue sections. Spatially tagged nucleic acid molecules (e.g., cDNA or genomic DNA) are recovered from the tissue sections and processed in a single-tube reaction to create a spatially tagged amplicon library.

[0185] In some embodiments, magnetic nanoparticles can be used to capture nucleic acids (e.g., in situ synthesized cDNA) in tissue samples for the creation of spatially addressed libraries.

[0186] In some embodiments, spatial detection and analysis of nucleic acids in tissue samples can be performed on a droplet actuator.

[0187] Described herein are improved methods and compositions for spatial omics applications that preserve spatial information related to the origin of RNA or DNA in tissues. Examples of spatial omics applications include, but are not limited to, spatial genomics applications, spatial proteomics applications, spatial transcriptomics applications, spatial agronomic applications, spatial epigenomics applications, spatial phenomics applications, spatial ligandomics applications, and spatial multiomics applications (e.g., transcriptome and genome applications).

[0188] Oligonucleotides Oligonucleotides are polymers composed of nucleotides. The oligonucleotides of the present disclosure may be of any length, and in various embodiments, include DNA oligonucleotides, RNA oligonucleotides, analogs thereof, or combinations thereof. In any aspect or embodiment described herein, the oligonucleotide is single-stranded, double-stranded, or partially double-stranded.

[0189] Nucleotides may include naturally occurring nucleotides and their functional analogs. Examples of functional analogs are those that are capable of hybridizing to nucleic acids in a sequence-specific manner or that can be used as templates for replicating a specific nucleotide sequence. Naturally occurring nucleotides generally have a backbone containing phosphodiester bonds. Analog structures can have alternative backbone linkages, including any of a variety known in the art. Naturally occurring nucleotides generally have a deoxyribose sugar (e.g., found in DNA) or a ribose sugar (e.g., found in RNA). Analog structures can have alternative sugar moieties, including any of a variety known in the art. Nucleotides can contain natural or unnatural bases. Natural DNA can contain one or more of adenine, thymine, cytosine, and / or guanine, while natural RNA can contain one or more of adenine, uracil, cytosine, and / or guanine. Any unnatural base can be used, such as locked nucleic acids (LNA) and bridged nucleic acids (BNA). Examples of modified nucleotides include inosine, xanthate, hypoxanthate, isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5-hydroxymethylcytosine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propylguanine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 15-halouracil, 15-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine. These include tosine, 6-azothymine, 5-uracil, 4-thiouracil, 8-halo adenine or guanine, 8-amino adenine or guanine, 8-thiol adenine or guanine, 8-thioalkyl adenine or guanine, 8-hydroxyl adenine or guanine, 5-halo substituted uracil or cytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, and the like.As is known in the art, certain nucleotide analogs cannot become incorporated into polynucleotides, e.g., nucleotide analogs such as adenosine 5'-phosphosulfate. A nucleotide can contain any suitable number of phosphates, e.g., 3, 4, 5, 6, or more than 6 phosphates.

[0190] Oligonucleotides contemplated by the present disclosure also include those having at least one modified internucleoside linkage. In some embodiments, the oligonucleotide is entirely or partially a peptide nucleic acid. Other modified internucleoside linkages include at least one phosphorothioate linkage. Still other modified oligonucleotides include those containing one or more universal bases. A "universal base" refers to a molecule that can substitute for any one of A, C, G, T, and U in a nucleic acid by forming a hydrogen bond without significant structural destabilization. Examples of universal bases include, but are not limited to, 5'-nitroindole-2'-deoxyriboside, 3-nitropyrrole, inosine, and hypoxanthine.

[0191] In various aspects, the oligonucleotides of the present disclosure, or modified forms thereof, are generally from about 5 to about 150 nucleotides in length. In further embodiments, the oligonucleotides of the present disclosure are from about 5 to about 125 nucleotides in length, from about 5 to about 100 nucleotides in length, from about 5 to about 90 nucleotides in length, from about 5 to about 50 nucleotides in length, from about 5 to about 45 nucleotides in length, from about 5 to about 40 nucleotides in length, from about 5 to about 35 nucleotides in length, from about 5 to about 30 nucleotides in length, from about 5 to about 25 nucleotides in length, from about 5 to about 20 nucleotides in length, from about 5 to about 15 nucleotides in length, from about 5 to about 10 nucleotides in length, from about 10 to about 15 ... and about 125 nucleotides in length, about 10 to about 100 nucleotides in length, about 10 to about 90 nucleotides in length, about 10 to about 50 nucleotides in length, about 10 to about 45 nucleotides in length, about 10 to about 40 nucleotides in length, about 10 to about 35 nucleotides in length, about 10 to about 30 nucleotides in length, about 10 to about 25 nucleotides in length, about 10 to about 20 nucleotides in length, about 10 to about 15 nucleotides in length, and all oligonucleotides of lengths intermediate to the specifically disclosed sizes to the extent that the oligonucleotide achieves the desired result.Thus, in various embodiments, the oligonucleotides of the present disclosure are 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 or more nucleotides in length, or is at least that long.In further embodiments, the oligonucleotides of the present disclosure are 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86 , 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, and less than 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 or more nucleotides in length. In various embodiments, the length of an oligonucleotide (e.g., a primer) of the present disclosure is from about 5 base pairs (bp) to 40 bp, or from about 5 bp to 35 bp, or from about 5 bp to 30 bp, or from about 10 bp to 35 bp, or from about 10 bp to 30 bp, or from about 20 bp to 40 bp, or from about 20 bp to 35 bp, or from about 20 bp to 30 bp, or from about 9 to 20 bp, or from about 5 to 15 bp, or from about 9 to 15 bp. In some embodiments, the length of an oligonucleotide (e.g., a primer) of the present disclosure is about 10 bp, 13 bp, 15 bp, 20 bp, 25 bp, 30 bp, 35 bp, or 40 bp. As described herein, in various embodiments, the oligonucleotide may be a P5 primer, a P5' primer, a P7 primer, or a P7' primer.

[0192] Preparation of polynucleotides The present disclosure is based in part on the recognition that the amount of RNA or DNA information that can be isolated from fresh or frozen tissue samples, as well as FFPE tissue samples, needs to be improved to provide information related to the genetic profile of the tissue sample. The present disclosure provides methods for improving the capture of genetic information by increasing the quantity and quality of RNA isolated from tissue samples that can be used in spatial transcriptomics analysis.

[0193] Total RNA can include ribosomal RNA (rRNA), messenger RNA (MRNA), transfer RNA (tRNA), microRNA, small nucleolar RNA (snoRNA), small nuclear RNA (snRNA). In various embodiments, the RNA is rRNA and / or mRNA.

[0194] In various embodiments, the RNA capture oligonucleotide is selected from the group consisting of a poly-T sequence, a randomer, a semi-randomer, or a target-specific probe. In various embodiments, the target-specific probe comprises a plurality of different target-specific RNA capture probe sequences. In various embodiments, the RNA capture probe or surface capture probe is 8-80 nucleotides. In certain embodiments, the RNA capture probe or surface probe is between 10 and 80 nucleotides, between 10 and 70 nucleotides, between 10 and 60 nucleotides, between 10 and 50 nucleotides, between 10 and 40 nucleotides, between 10 and 30 nucleotides, between 10 and 20 nucleotides, between 20 and 80 nucleotides, between 20 and 70 nucleotides, between 20 and 60 nucleotides, between 20 and 50 nucleotides, between 20 and 40 nucleotides, or 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, or 80 nucleotides.

[0195] The capture oligonucleotides described herein may comprise a capture sequence, a spatial barcode sequence (SBC), and an adapter sequence. Capture sequences include poly-T sequences, poly-A sequences, gene-specific capture sequences, or universal capture sequences. Universal capture sequences are random nucleotide sequences or non-self-complementary semi-random sequences. In various embodiments, the capture oligonucleotides comprise a 5' clustered sequence, a randomized spatial barcode (SBC), a full-length read 2 adapter sequence (Rd2 FL), a molecular identifier (MI), a fixed sequence (FS), and / or a poly-T capture sequence with a 3' VN terminus (poly-TVN).

[0196] Oligonucleotides comprising a surface oligonucleotide (e.g., a poly-T sequence) may further comprise a spatial index sequence, including, but not limited to, one or more of a P7 sequence, an index sequence, and / or a read 2 adaptor sequence (Rd2 FL). In various embodiments, the surface oligonucleotide comprises a P7 anchor sequence, a spatial barcode, and a sequence that hybridizes to a splint oligonucleotide.

[0197] In some embodiments, total RNA is released from the tissue sample. The release includes tissue lysis or tissue permeabilization. In various embodiments, one or more samples contacted with a solid support can be lysed to release the target nucleic acid. Lysis can be performed using known techniques, such as using one or more of chemical treatment, enzymatic treatment, electroporation, heat, hypotonic treatment, sonication, etc. In the present method, it is contemplated that the tissue sample is permeabilized before contacting the tissue sample with the plurality of capture oligonucleotides. In various embodiments, the tissue sample is treated with one or more blocking reagents before contacting the tissue sample with the plurality of capture oligonucleotides in the present method. In various embodiments, the tissue sample is permeabilized and treated with one or more blocking reagents before contacting the tissue sample with the plurality of capture oligonucleotides in the present method.

[0198] In some embodiments, tissue samples are treated to remove embedding material from the sample (e.g., remove paraffin or formalin) prior to nucleic acid release, capture, or modification. This can be accomplished by contacting the sample with an appropriate solvent (e.g., xylene and ethanol washes). Treatment can occur before contacting the tissue sample with a solid support described herein, or treatment can occur while the tissue sample is on the solid support. It is also contemplated that tissue may be removed from the sample by enzymatic digestion. In various embodiments, tissue removal occurs before RNA is removed from the tissue. In various embodiments, tissue is removed, for example, via digestion with proteinase K at 37°C for 40 minutes. Exemplary methods for engineering tissue for use with solid supports to which nucleic acids are attached are described in U.S. Patent Application Publication No. 2014 / 0066318, incorporated herein by reference.

[0199] Formalin-fixed tissue samples may also be decrosslinked using known techniques. In various embodiments, decrosslinking is performed using Tris-EDTA (TE) buffer, for example, at pH 8, pH 9, or another suitable buffer at an appropriate pH. Decrosslinking may also be performed at elevated temperatures, for example, 70°C.

[0200] The above methods are also useful for improving the capture efficiency of RNA transcripts for in situ RNA transcript library preparation and / or for improving the nucleotide length of polynucleotides used in generating an in situ transcriptome library (e.g., for improving the polynucleotide size of cDNA transcribed from mRNA isolated from a sample and used in generating an in situ transcriptome library).

[0201] Spatial detection and analysis of nucleic acids in tissue samples According to the methods described herein, spatial detection and analysis of nucleic acids in a tissue sample can be performed using a set of two or more capture probes (e.g., three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more capture probes). Typically, at least a first capture probe in the set of capture probes is immobilized on a capture array or nanostructure. In some embodiments, a second capture probe can be immobilized on the same capture array as the first capture probe, e.g., in close proximity to the first capture probe, e.g., at the same capture site. In some embodiments, the second capture probe can be immobilized on a nanostructure or particle, such as a magnetic particle or magnetic nanoparticle. In some embodiments, the second capture probe can be in a solution used to perform an in situ reaction with nucleic acids in a tissue sample, for example. The capture probes in a capture probe set can individually and independently have a variety of different regions, such as a capture region (e.g., a first universal or gene-specific capture region or a first clustered region), a primer binding region (e.g., an SBS primer region such as an SBS3 or SBS12 region), or a second universal region / clustered sequence such as a P5 or P7 region, a spatial address region (e.g., a partial or combinatorial spatial address region), or a cleavable region.

[0202] Exemplary sequences include the following Rd1 and Rd2 adapter sequences: Second universal adapter - Rd1 SBS3 (long):

[0203] [Table 1] Second universal adapter - Rd1 SBS3 (short chain): ACACTCTTTCCCTACACGAC (SEQ ID NO: 14); First universal adapter - Rd2 SBS12 (long chain):

[0204] [Table 2] First universal adaptor - Rd2 SBS12 (short chain): GTGACTGGAGTTCAGACGTGT (SEQ ID NO: 16).

[0205] In some embodiments, only one capture probe in a set of capture probes comprises a capture region. In some embodiments, two or more capture probes in a set of capture probes comprise a capture region.

[0206] In some embodiments, only one probe in a set of capture probes comprises a spatial address region, such as a complete spatial address region that describes the location of a capture site on a capture array. In some embodiments, two or more probes in a set of capture probes can comprise a spatial address region, e.g., two or more probes can each comprise a partial spatial address region (i.e., combinatorial address region), where each partial address region describes the location of a capture site on a capture array, e.g., along the x-axis or y-axis.

[0207] In some embodiments, a set of capture probes (e.g., RNA and surface capture probes) may include at least one capture probe that includes a capture region and a spatial-address region (e.g., a complete or partial spatial-address region). In some embodiments, a capture probe in a set of capture probes does not include both a capture region and a spatial-address region.

[0208] In some embodiments, the capture sites on the substrate are a plurality of capture sites, ie, 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 30,000 or more, 100,000 or more, 300,000 or more, 1,000,000 or more, 3,000,000 or more, or 10,000,000 or 1,000,000,000 or more capture sites.

[0209] In various embodiments, the capture array or substrate has an area of ​​1 square centimeter (cm 2) and includes a capture site density of 1 or more, 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 100,000 or more, 1,000,000 or more capture sites per 100,000 nanoparticle.

[0210] In various embodiments, the pair of capture probes at the capture site is a plurality of pairs of capture probes, hi some embodiments, the plurality of capture probes is 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 30,000 or more, 100,000 or more, 300,000 or more, 1,000,000 or more, 3,000,000 or more, or 10,000,000 or more, 100,000,000 or more, or 1,000,000,000 or more capture probes.

[0211] In some embodiments, the pair of capture probes in a capture site of the substrate is a plurality of pairs of capture probes. In some embodiments, each RNA capture probe in a plurality of pairs of capture probes in the same capture site comprises the same spatial address sequence. In some embodiments, each RNA capture probe in a plurality of pairs of capture probes in different capture sites comprises a different spatial address sequence.

[0212] In some embodiments, the surface of the capture array is a planar surface, such as a glass surface. In some embodiments, the surface of the capture array comprises one or more wells. In some embodiments, the one or more wells correspond to one or more capture sites. In some embodiments, the surface of the capture array is a bead surface.

[0213] In some embodiments, the capture region in the surface capture probe is a gene-specific capture region. In some embodiments, the gene-specific capture region in the surface capture probe comprises the sequence of TruSeq™ Custom Amplicon (TSCA) oligonucleotide probe (Illumina, Inc.). For example, the gene-specific capture region in the multiple second capture probes in the capture site can comprise multiple sequences of TSCA oligonucleotide probe.

[0214] In another embodiment, the present disclosure provides a substrate, such as a flow cell, nanoparticle, or bead, comprising the spatially addressable probes disclosed herein. In certain embodiments, the beads comprise the spatially addressable probes disclosed herein. In further embodiments, the beads comprise streptavidin on the surface of the beads. In yet further embodiments, the beads comprise multiple oligos bound to the beads via linkages or reversible linkages. An example of a reversible linkage includes a biotin molecule, such as a ddBio molecule. The oligos bound to the substrate typically comprise an adapter sequence, such as a P5 sequence or a P7 sequence. As used herein, a P5 sequence comprises a sequence defined by AAT GAT ACG GCG ACC ACC GA (SEQ ID NO: 1) or AAT GAT ACG GCG ACC ACC GAG ATC TAC AC (SEQ ID NO: 2), and a P7 sequence comprises a sequence defined by CAA GCA GAA GAC GGC ATA CG (SEQ ID NO: 3) or CAA GCA GAA GAC GGC ATA CGA GAT (SEQ ID NO: 4). In some embodiments, the P5 or P7 sequence can further comprise a spacer polynucleotide, which can be 1 to 20, e.g., 1 to 15, or 1 to 10, nucleotides, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, the spacer comprises 10 nucleotides. In some embodiments, the spacer comprises 10 nucleotides. In some embodiments, the spacer is a poly-T spacer, such as a 10T spacer. The spacer nucleotide can be included at the 5' end of the polynucleotide or can be attached to a suitable support via linkage to the 5' end of the oligo. Attachment can be achieved by a sulfur-containing nucleophile, such as a phosphorothioate, present at the 5' end of the polynucleotide. In some embodiments, the oligo comprises a poly-T spacer and a 5' phosphorothioate group.Thus, in some embodiments, the P5 sequence comprises 5' phosphorothioate-TTTTTTTTTTAATGATACGGCGACCACCGA-3' (SEQ ID NO: 17), and in some embodiments, the P7 sequence comprises 5' phosphorothioate-TTTTTTTTTTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 18). In certain embodiments, the oligo attached to the bead comprises an address sequence that, when decoded, can determine the x,y position of the oligo / bead. In further embodiments, the address sequence is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides in length, or a range including or between any two of the foregoing nucleotide lengths. In another embodiment, the oligo was attached to a bead containing a transposome hybridization region (Tsm hyb). In yet additional embodiments, the oligo comprises a sequencing primer site sequence. Examples of sequencing primer site sequences include sequences complementary to the R1 and R2 sequencing primers from Illumina™. In further embodiments, the oligos may further comprise one or more linker sequences. In yet further embodiments, the oligos may further comprise one or more index sequences. In certain embodiments, the oligos may comprise one or more unique molecular identifier (UMI) sequences. Unique molecular identifiers (UMIs) are a type of molecular barcoding that provides error correction and improved accuracy during sequencing. These molecular barcodes are short sequences used to uniquely tag each molecule in a sample library. UMIs are used in a wide range of sequencing applications, often PCR duplicates in DNA and cDNA. UMI deduplication is also useful for RNA-seq gene expression analysis and other quantitative sequencing methods. As previously mentioned, oligos contain moieties or sequences that can specifically bind to polynucleotides from biological samples (e.g., tissue samples). Thus, oligos attached to beads are spatially addressable probes for polynucleotides from biological samples.Moieties or sequences capable of specifically binding to polynucleotides from a biological sample may be selected for specific genomic applications. For example, the oligo may include an oligo d(T) sequence for transcriptomics or assays (e.g., RNA-seq assays). Alternatively, the oligo may include a sequence that binds to genomic DNA from a biological sample for genomic applications or assays (e.g., ATAC-seq assays). As provided in the examples presented herein, the nanostructure may include multiple types of oligos with different moieties or sequences such that the spatially addressable probes can specifically bind to two or more different types of polynucleotides from a biological sample. The use of multiple types of oligos is ideally suited for multi-omic or multi-assay applications.

[0215] The generation of the second complementary strand may be performed "on-surface" or "off-surface." In some embodiments, for on-surface generation of the second complementary strand, the first complementary strand remains immobilized on the surface, while the second complementary strand is extended using the first complementary strand as a template. In some embodiments, the second complementary strand is removed (eluted) from the surface, and then the second complementary strand is subjected to indexed PCR for amplification. In some embodiments, for on-surface generation of the second complementary strand, an exclusion amplification (ExAmp) mixture containing an adapter-index oligonucleotide is contacted with the first complementary strand on the surface, thereby generating the second complementary strand via strand invasion and isothermal amplification. In various embodiments, the ExAmp mixture further comprises a recombinase, a single-stranded DNA binding protein (e.g., gp32 ssDNA binding protein), and a polymerase. Similar to any of the methods of generating second complementary strands described herein, generation of the second complementary strands may be followed by amplification of the second complementary strands (e.g., by indexed PCR), during which a second clustered primer sequence (e.g., P5) may be added to one or more of the second complementary strands. In some embodiments, amplifying comprises index PCR, during which a first primer hybridizes to a first clustered primer sequence and a second primer hybridizes to an adapter nucleotide sequence, wherein the second primer comprises a second clustered primer sequence. In various embodiments, an index sequence (e.g., i5) is also added to one or more of the second complementary strands during amplification. In some embodiments, the second primer further comprises an index sequence. Addition of the second clustered primer sequence, and optionally the index sequence, to one or more of the second complementary strands is, in various embodiments, performed away from the surface (e.g., in solution). Amplification of the second complementary strands may be followed by sequencing. The sequencing information can then be correlated with the spatial location of the target nucleic acid in the biological sample.

[0216] In some embodiments, one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site. In further embodiments, the cleavage site is an enzymatic cleavage site. In various embodiments, the enzymatic cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In some embodiments, the cleavage site is a chemical cleavage site. In further embodiments, one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site. In some embodiments, the cleavage site is an enzymatic cleavage site. In further embodiments, the enzymatic cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof.

[0217] In some embodiments, for off-surface generation of a second complementary strand, formation of the first complementary strand is followed by cleavage of the first complementary strand from the surface, and second complementary strand synthesis is performed off-surface (e.g., in solution). In some embodiments, the second complementary strand is then amplified (e.g., via indexed PCR), during which a second clustered primer sequence (e.g., P5) may be added to one or more of the second complementary strands. In various embodiments, an index sequence (e.g., i5) is also added to one or more of the second complementary strands during amplification. Addition of the second clustered primer sequence and optionally the index sequence to one or more of the second complementary strands is, in various embodiments, performed away from the surface (e.g., in solution). Amplification of the second complementary strand may be followed by sequencing. The sequencing information can then be correlated with the spatial location of the target nucleic acid in the biological sample.

[0218] The methods of the present disclosure further provide, in various embodiments, that the biological sample / tissue sample is digested. Digestion of the biological sample can occur after generation of the first complementary strand in various embodiments. In some embodiments, digestion of the biological sample occurs after generation of the first complementary strand but before generation of the second complementary strand. The present disclosure also provides methods in which the target nucleic acid (e.g., RNA) is removed from the surface. Removal of the target nucleic acid from the surface can occur after generation of the first complementary strand in various embodiments. In some embodiments, removal of the target nucleic acid occurs after generation of the first complementary strand but before generation of the second complementary strand. Removal of the target nucleic acid from the surface is achieved, in various embodiments, by changing conditions. In further embodiments, the conditions are temperature, pH, formamide concentration, or a combination thereof.

[0219] Aspects of the present disclosure include those in which a plurality of capture oligonucleotides are immobilized on a surface. The capture oligonucleotides, in various embodiments, hybridize to target nucleic acids in a biological sample. In some embodiments, each of the plurality of capture oligonucleotides comprises the same capture nucleotide sequence. In further embodiments, the plurality of capture oligonucleotides comprises a plurality of different capture nucleotide sequences. In still further embodiments, the plurality of different capture nucleotide sequences comprises one or more gene-specific capture sequences, one or more universal capture sequences, or a combination thereof. In various embodiments, the capture nucleotide sequences are poly-T sequences, poly-A sequences, gene-specific capture sequences, or universal capture sequences. In further embodiments, the universal capture sequences are random nucleotide sequences or non-self-complementary semi-random sequences. Aspects of the present disclosure also include those in which the capture nucleotide sequences are extended after hybridization of the capture oligonucleotides to the target nucleic acid. In some embodiments, the extension of the capture nucleotide sequence is achieved using reverse transcriptase. In some implementations of the methods of the present disclosure, the target nucleic acid is polyadenylated prior to hybridization of the target nucleic acid to the capture nucleotide sequence. In some embodiments, the target nucleic acid is polyadenylated using poly(A) polymerase, hi further embodiments, the target nucleic acid is polyadenylated using chemical or enzymatic ligation.

[0220] How to normalize library size In one aspect, the present disclosure is directed to a method for normalizing library size for on-surface library preparation applications. In various aspects, the present disclosure also provides methods for spatially capturing target nucleic acids in tissue samples. Use of the disclosed methods provides the ability to spatially preserve the location of target nucleic acids in biological samples (e.g., tissue samples). The techniques disclosed herein offer several advantages, including, but not limited to, the following: (1) the techniques disclosed herein provide the ability to capture target analytes (e.g., mRNA or other analytes for multi-omic approaches) on a surface (e.g., an Illumina flow cell (Illumina Inc., San Diego, Calif.)) and then perform sequencing readouts using appropriate (e.g., Illumina Inc., San Diego, Calif.) sequencing infrastructure. Such techniques enable untargeted spatial detection of mRNA / analytes, enabling de novo mapping of signals in the tissue context; and (2) the techniques disclosed herein provide the ability to create spatial transcriptome libraries of optimal size for sequencing. For example, without limitation, in some embodiments, the disclosed methods allow for the creation of transcriptome libraries comprising fragments of a target analyte (e.g., a target nucleic acid) that are about 100-1000 nucleotides in length. In further embodiments, the disclosed methods allow for the creation of transcriptome libraries comprising fragments of a target analyte (e.g., a target nucleic acid) that are about 100-800 nucleotides in length. In some embodiments, the disclosed methods allow for the creation of transcriptome libraries comprising fragments of a target analyte (e.g., a target nucleic acid) that are about 800 nucleotides in length. In some embodiments, the disclosed methods allow for the creation of transcriptome libraries comprising fragments of a target analyte (e.g., a target nucleic acid) that are about 700 nucleotides in length.

[0221] In various aspects, the present disclosure provides methods for preparing an immobilized library of target nucleic acids from a biological sample, the methods comprising: providing a surface comprising capture oligonucleotides that hybridize or otherwise associate with the target nucleic acids from the biological sample; and extending the capture oligonucleotides (e.g., via reverse transcription) to form first complementary strands of the target nucleic acids, thereby preparing an immobilized library of the target nucleic acids. In some embodiments, following the formation of the first complementary strands, multiple oligonucleotide primers are hybridized to the first complementary strands and extended to generate one or more second complementary strands. As described above, the disclosed techniques provide the ability to create spatial transcriptome libraries of optimal size for sequencing. To normalize library fragment size, the disclosed methods include the use of an extension terminator during the extension of the capture oligonucleotides to form the first complementary strands. The extension terminator acts to terminate the synthesis of the growing nucleic acid strand. Extension terminating moieties contemplated by the present disclosure include, but are not limited to, allyl-T or deoxyuridine triphosphate (dUTP), dideoxynucleoside triphosphate (ddNTP), deoxynucleoside triphosphate (dNTP) with a 3' phosphate, deoxynucleoside triphosphate (dNTP) with a 3' phosphate, dideoxynucleoside triphosphate (ddNTP) with a first click chemistry handle, or combinations thereof.

[0222] The generation of the second complementary strand may be performed "on-surface" or "off-surface." In some embodiments, for on-surface generation of the second complementary strand, the first complementary strand remains immobilized on the surface, while the second complementary strand is extended using the first complementary strand as a template. See, for example, Figures 16, 19, and 20. In some embodiments, the second complementary strand is removed (eluted) from the surface, and then the second complementary strand is subjected to indexed PCR for amplification. In some embodiments, for on-surface generation of the second complementary strand, an exclusion amplification (ExAmp) mixture containing an adapter-index oligonucleotide is contacted with the first complementary strand on the surface, thereby generating the second complementary strand via strand invasion and isothermal amplification. In various embodiments, the ExAmp mixture further comprises a recombinase, a single-stranded DNA binding protein (e.g., gp32 ssDNA binding protein), and a polymerase. Similar to any of the methods of generating second complementary strands described herein, generation of the second complementary strands may be followed by amplification of the second complementary strands (e.g., by indexed PCR), during which a second clustered primer sequence (e.g., P5) may be added to one or more of the second complementary strands. In some embodiments, amplifying comprises index PCR, during which a first primer hybridizes to a first clustered primer sequence and a second primer hybridizes to an adapter nucleotide sequence, wherein the second primer comprises a second clustered primer sequence. In various embodiments, an index sequence (e.g., i5) is also added to one or more of the second complementary strands during amplification. In some embodiments, the second primer further comprises an index sequence. Addition of the second clustered primer sequence, and optionally the index sequence, to one or more of the second complementary strands is, in various embodiments, performed away from the surface (e.g., in solution). Amplification of the second complementary strands may be followed by sequencing. The sequencing information can then be correlated with the spatial location of the target nucleic acid in the biological sample.

[0223] In some embodiments, for off-surface generation of a second complementary strand, formation of the first complementary strand is followed by cleavage of the first complementary strand from the surface, and second complementary strand synthesis is performed off-surface (e.g., in solution). See, e.g., FIG. 18. In some embodiments, the second complementary strand is then amplified (e.g., via indexed PCR), during which a second clustered primer sequence (e.g., P5) may be added to one or more of the second complementary strands. In various embodiments, an index sequence (e.g., i5) is also added to one or more of the second complementary strands during amplification. Addition of the second clustered primer sequence and optionally the index sequence to one or more of the second complementary strands is, in various embodiments, performed away from the surface (e.g., in solution). Amplification of the second complementary strand may be followed by sequencing. The sequencing information can then be correlated with the spatial location of the target nucleic acid in the biological sample.

[0224] In some aspects, a method for preparing an immobilized library of target nucleic acids from a biological sample includes providing a surface comprising capture oligonucleotides that hybridize or otherwise associate with the target nucleic acids from the biological sample; and extending the capture oligonucleotides (e.g., via reverse transcription) to form a first complementary strand of the target nucleic acid, where the extension is performed in the presence of an extension terminator, and the extension terminator is allyl-T or deoxyuridine triphosphate (dUTP), thereby preparing an immobilized library of the target nucleic acid. In various embodiments, one or more of the capture oligonucleotides comprise, from 5' to 3', (i) a first clustered primer sequence; (ii) a spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) a capture nucleotide sequence. In some embodiments, a second complementary strand is generated on the surface, and the second complementary strand is removed (e.g., eluted) from the surface. In some embodiments, a second complementary strand is generated on the surface, and the second complementary strand is removed (e.g., eluted) from the surface using an ExAmp mixture. In some embodiments, after the first complementary strand is generated, the surface is contacted with an exonuclease (e.g., to remove unbound surface-captured oligonucleotides from the surface), and a plurality of oligonucleotide primers are hybridized to the first complementary strand, where each of the plurality of oligonucleotide primers comprises, from 5' to 3', (i) an adapter nucleotide sequence (e.g., B15); and (ii) a random nucleotide sequence (e.g., comprising approximately 5-10 nucleotides, 7-10 nucleotides, or 9 nucleotides). In some embodiments, the plurality of oligonucleotide primers are then extended, thereby generating one or more second complementary strands comprising the adapter nucleotide sequence at their termini. In some embodiments, the one or more second complementary strands are removed from the surface and amplified. In further embodiments, the amplification is performed in the presence of an exclusion amplification (ExAmp) mixture, where the ExAmp mixture comprises primers comprising clustered primer sequences.In various embodiments, the ExAmp mixture further comprises a recombinase, a single-stranded DNA binding protein (e.g., gp32 ssDNA binding protein), and a polymerase. In some embodiments, one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site. In some embodiments, the cleavage site is an enzymatic cleavage site. In various embodiments, the enzymatic cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In some embodiments, the cleavage site is a chemical cleavage site. In various embodiments, the cleavage site is cleaved after extending the capture nucleotide sequence and forming a first complementary strand. In some embodiments, the extension terminator is deoxyuridine triphosphate (dUTP), and the method further comprises contacting the surface with uracil-DNA glycosylase (UDG). In some embodiments, the surface is contacted with UDG after the first complementary strand is generated but before the second complementary strand is generated. In some embodiments, the extension terminating portion is allyl-T, and the method further comprises contacting the surface with a universal cleavage mixture (UCM) (see, e.g., International Application Publication No. 2019 / 222264, which is incorporated herein by reference in its entirety, regarding cleavage mixtures). In some embodiments, contacting the surface with the universal cleavage mixture (UCM) occurs before the plurality of oligonucleotide primers hybridize to the first complementary strand. In some embodiments, the second complementary strand is generated from the surface (e.g., in solution).

[0225] In some aspects, a method for preparing an immobilized library of target nucleic acids from a biological sample includes providing a surface comprising capture oligonucleotides that hybridize or otherwise associate with the target nucleic acids from the biological sample; and extending the capture oligonucleotides (e.g., via reverse transcription) to form a first complementary strand of the target nucleic acid, where the extension is performed in the presence of an extension terminator, and the extension terminator is a dideoxynucleoside triphosphate (ddNTP), thereby preparing an immobilized library of the target nucleic acid. In some embodiments, one or more of the plurality of capture oligonucleotides comprises, from 5' to 3', (i) a first clustered primer sequence; (ii) a spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) a capture nucleotide sequence. In some embodiments, a second complementary strand is generated on the surface, and the second complementary strand is removed (e.g., eluted) from the surface. In some embodiments, a second complementary strand is generated on the surface, and the second complementary strand is removed (e.g., eluted) from the surface using an Examp mix. In some embodiments, the second complementary strand is generated from the surface (e.g., in solution). More specifically, in some embodiments, the surface is contacted with an exonuclease, and a plurality of oligonucleotide primers are hybridized to the first complementary strand, where each of the plurality of oligonucleotide primers comprises, from 5' to 3', (i) an adapter nucleotide sequence (e.g., B15); and (ii) a random nucleotide sequence (e.g., comprising approximately 5-10 nucleotides, 7-10 nucleotides, or 9 nucleotides). The plurality of oligonucleotide primers are then extended, thereby generating one or more second complementary strands comprising the adapter nucleotide sequence at their termini. In various embodiments, following removal of the one or more second complementary strands from the surface, the one or more second complementary strands are amplified, for example, via indexed PCR. Amplification of one or more second complementary strands results in the addition of a second clustered primer sequence (e.g., P5) to one or more second complementary strands. In various embodiments, an index sequence (e.g., i5) is also added to one or more second complementary strands during amplification.Thus, in some embodiments, amplification of one or more second complementary strands results in the addition of a second clustered primer sequence (e.g., P5) and an indexing sequence (e.g., i5) to one or more second complementary strands. In various embodiments, removing one or more second complementary strands from the surface is performed in the presence of an exclusion amplification (ExAmp) mixture, where the ExAmp mixture includes primers that include the first clustered primer sequence. In some embodiments, one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site. In some embodiments, the cleavage site is an enzymatic cleavage site. In various embodiments, the enzymatic cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In some embodiments, the cleavage site is a chemical cleavage site. In various embodiments, the cleavage site is cleaved after the capture nucleotide sequence of the hybridized capture oligonucleotide is extended. In some embodiments, the cleavage site is cleaved after one or more second complementary strands are generated. In some embodiments, the ddNTP comprises a first click chemistry handle. In further embodiments, after extending the capture nucleotide sequence of the hybridized capture oligonucleotide, the surface is contacted with an adapter oligonucleotide comprising a second click chemistry handle capable of crosslinking to the first click chemistry handle, thereby ligating the adapter oligonucleotide to the first complementary strand. Any click chemistry moiety is contemplated for use in the disclosed methods. In some embodiments, the adapter oligonucleotide further comprises a second sequencing primer sequence. In some embodiments, the first click chemistry handle is an azide, tetrazine, strained alkene, or alkyne. In some embodiments, the second click chemistry handle is an azide, tetrazine, strained alkene, or alkyne.

[0226] In some aspects, a method for preparing an immobilized library of target nucleic acids from a biological sample includes providing a surface comprising capture oligonucleotides that hybridize or otherwise associate with the target nucleic acids from the biological sample; and extending the capture oligonucleotides (e.g., via reverse transcription) to form a first complementary strand of the target nucleic acid, where the extension is performed in the presence of an extension terminator, and the extension terminator is a deoxynucleoside triphosphate (dNTP) comprising a 3' phosphate, thereby preparing an immobilized library of the target nucleic acid. See, e.g., FIG. 6. In various embodiments, one or more of the plurality of capture oligonucleotides comprises, from 5' to 3', (i) a first clustered primer sequence; (ii) a spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) a capture nucleotide sequence. The surface is then contacted with an exonuclease, followed by ligation to ligate an adapter oligonucleotide to the first complementary strand. The adapter oligonucleotide comprises (i) an adapter nucleotide sequence (e.g., B15); and (ii) a random nucleotide sequence (e.g., comprising about 5-10 nucleotides, 7-10 nucleotides, or 9 nucleotides). In some embodiments, the adapter oligonucleotide further comprises a second oligonucleotide that hybridizes to the adapter nucleotide sequence. In some embodiments, the adapter nucleotide sequence comprises a second sequencing primer sequence. In various embodiments, ligation occurs via splint ligation of the adapter oligonucleotide to a first complementary strand. In various embodiments, ligation is performed using T4 DNA ligase. In some embodiments, ligation occurs via single-stranded DNA ligation of the adapter oligonucleotide to the first complementary strand. In related embodiments, the ligase enzyme is a DNA / RNA ligase. More generally with respect to ligation, in some embodiments, the adapter oligonucleotide further comprises a second oligonucleotide that hybridizes to the adapter nucleotide sequence.These adapter oligonucleotides, including a second oligonucleotide that hybridizes to the adapter nucleotide sequence, may be used, for example, to facilitate splint ligation. In various embodiments, the ligation is enzymatic ligation. In further embodiments, the enzymatic ligation is splint ligation. In some embodiments, the enzymatic ligation is single-stranded DNA ligation. In some embodiments, the ligation is chemical ligation. In some embodiments, the chemical ligation is splint ligation. In some embodiments where splint ligation is utilized, a second complementary strand is generated on the surface using the adapter nucleotide sequence as a primer sequence. In some embodiments where single-stranded DNA ligation is utilized, the second complementary strand is generated on the surface using a primer that is complementary to the adapter nucleotide sequence. In some embodiments, the second complementary strand is then removed (e.g., eluted) from the surface. In some embodiments, the second complementary strand is generated on the surface and then removed (e.g., eluted) from the surface using an ExAmp mixture. In some embodiments where splint ligation is utilized, the second complementary strand is generated from the surface (e.g., in solution) using an adapter nucleotide sequence as a primer sequence. In some embodiments where single-stranded DNA ligation is utilized, the second complementary strand is generated from the surface (e.g., in solution) using a primer that is complementary to the adapter nucleotide sequence. Following ligation of the adapter oligonucleotide to the first complementary strand, the adapter oligonucleotide is extended, thereby generating one or more second complementary strands. The one or more second complementary strands are then removed from the surface and amplified. In various embodiments, amplification is performed in the presence of an exclusion amplification (ExAmp) mixture. In some embodiments, one or more of the multiple capture oligonucleotides are immobilized on the surface via a cleavage site. In some embodiments, the cleavage site is an enzyme cleavage site.In further embodiments, the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof. In some embodiments, the cleavage site is a chemical cleavage site. In various embodiments, the cleavage site is cleaved after the capture nucleotide sequence of the hybridized capture oligonucleotide is extended. In some embodiments, the cleavage site is cleaved after contacting the surface with a ligase enzyme to ligate the adapter oligonucleotide to the first complementary strand.

[0227] In some aspects, a method for preparing an immobilized library of target nucleic acids of a biological sample includes providing a surface including capture oligonucleotides that hybridize or otherwise associate with the target nucleic acids of the biological sample; and extending the capture oligonucleotides (e.g., via reverse transcription) to form a first complementary strand of the target nucleic acid, wherein the extension is performed in the presence of an extension terminating portion, and the extension terminating portion is a deoxynucleoside triphosphate (dNTP) with a 3' phosphate or a dideoxynucleoside triphosphate (ddNTP) with a first click chemistry handle, thereby preparing an immobilized library of the target nucleic acid. See, e.g., FIG. 6 . In various embodiments, one or more of the plurality of capture oligonucleotides includes, from 5' to 3', (i) a first clustered primer sequence; (ii) a spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) a capture nucleotide sequence. In some embodiments, the extension terminating portion is a deoxynucleoside triphosphate (dNTP) with a 3' phosphate. In these embodiments, an adapter oligonucleotide is then chemically ligated to the first complementary strand via a bridging group, where the adapter oligonucleotide comprises, from 5' to 3', (i) an adapter nucleotide sequence (e.g., B15); and (ii) a random nucleotide sequence (e.g., about 5-10 nucleotides, 7-10 nucleotides, or 9 nucleotides). In some embodiments, the adapter oligonucleotide further comprises a second oligonucleotide that hybridizes to the adapter nucleotide sequence. In some embodiments, the adapter nucleotide sequence comprises a second sequencing primer sequence. In various embodiments, the bridging group is a carboxyl-amine reactive group, a BCN-azide reactive group, a DBCO-azide reactive group, a tetrazine-TCO reactive group, or a combination thereof. In some embodiments, the extension terminating moiety is a dideoxynucleoside triphosphate (ddNTP) comprising a first click chemistry handle.In these embodiments, an adapter oligonucleotide is then ligated to the first complementary strand via click chemistry, where the adapter oligonucleotide comprises, from 5' to 3', (i) an adapter nucleotide sequence; and (ii) a random nucleotide sequence, and the adapter oligonucleotide further comprises a second oligonucleotide that hybridizes to the sequencing primer sequence, the second oligonucleotide comprising a second click chemistry handle. In some embodiments, the adapter nucleotide sequence comprises the second sequencing primer sequence. In various embodiments, the first click chemistry handle is an azide, tetrazine, strained alkene, or alkyne. In further embodiments, the second click chemistry handle is an azide, tetrazine, strained alkene, or alkyne.

[0228] The methods of the present disclosure further provide, in various embodiments, that the biological sample is digested. Digestion of the biological sample can occur after generation of the first complementary strand in various embodiments. In some embodiments, digestion of the biological sample occurs after generation of the first complementary strand but before generation of the second complementary strand. The present disclosure also provides methods in which the target nucleic acid (e.g., RNA) is removed from the surface. Removal of the target nucleic acid from the surface can occur after generation of the first complementary strand in various embodiments. In some embodiments, removal of the target nucleic acid occurs after generation of the first complementary strand but before generation of the second complementary strand. Removal of the target nucleic acid from the surface is achieved, in various embodiments, by changing conditions. In further embodiments, the conditions are temperature, pH, formamide concentration, or a combination thereof.

[0229] Aspects of the present disclosure include those in which a plurality of capture oligonucleotides are immobilized on a surface. The capture oligonucleotides, in various embodiments, hybridize to target nucleic acids in a biological sample. In some embodiments, each of the plurality of capture oligonucleotides comprises the same capture nucleotide sequence. In further embodiments, the plurality of capture oligonucleotides comprises a plurality of different capture nucleotide sequences. In still further embodiments, the plurality of different capture nucleotide sequences comprises one or more gene-specific capture sequences, one or more universal capture sequences, or a combination thereof. In various embodiments, the capture nucleotide sequences are poly-T sequences, poly-A sequences, gene-specific capture sequences, or universal capture sequences. In further embodiments, the universal capture sequences are random nucleotide sequences or non-self-complementary semi-random sequences. Aspects of the present disclosure also include those in which the capture nucleotide sequences are extended after hybridization of the capture oligonucleotides to the target nucleic acid. In some embodiments, the extension of the capture nucleotide sequence is achieved using reverse transcriptase. In some implementations of the methods of the present disclosure, the target nucleic acid is polyadenylated prior to hybridization of the target nucleic acid to the capture nucleotide sequence. In some embodiments, the target nucleic acid is polyadenylated using poly(A) polymerase, hi further embodiments, the target nucleic acid is polyadenylated using chemical or enzymatic ligation.

[0230] In various embodiments, primers used in the disclosed methods (e.g., oligonucleotide primers that hybridize to the first complementary strand and then extend) are used at concentrations ranging from 0.1 μM to 100 μM, 1 μM to 100 μM, or 3 μM to 75 μM, or 5 to 50 μM. In some embodiments, primers are used at concentrations of 0.25 μM, 0.5 μM, 1.1 μM, or 2.2 μM. In still further embodiments, primers are used at concentrations of 1 μM, 5 μM, 10 μM, 25 μM, or 50 μM. In various embodiments, such primers are P5 primers, P5' primers, P7 primers, or P7' primers.

[0231] kit Kits and articles of manufacture are also contemplated herein. Such kits may include a carrier, package, or container compartmentalized to receive one or more containers, such as vials, tubes, etc., each containing one of the separate elements used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers may be formed from a variety of materials, such as glass or plastic. For example, the container can contain one or more spatially addressable probes disclosed herein, optionally in a composition or in combination with another agent disclosed herein (e.g., an array, a bead chip). The container optionally has a sterile access port (e.g., the container can be an intravenous solution bag or vial with a stopper pierceable by a hypodermic needle). Such kits optionally include identifying descriptions or labels or instructions for their use in the methods described herein.

[0232] The kit typically includes one or more additional containers, each containing one or more of a variety of materials (such as reagents and / or devices, optionally in concentrated form) desirable from a commercial and user perspective for use with the spatially addressable probes described herein. Non-limiting examples of such materials include, but are not limited to, buffers, diluents, filters, needles, syringes, carriers, packages, containers, vials, and / or tube labels listing the contents and / or instructions for use, and inserts containing instructions for use. A set of instructions for use is also typically included.

[0233] A label can be on or associated with a container. A label can be present on a container when letters, numbers, or other symbols forming the label are attached, molded, or etched into the container itself, or can be associated with a container when the label is present in a receptacle or carrier that also holds the container, for example, as a package insert. A label can be used to indicate that the contents are to be used for a particular spatial omic application. A label can also indicate instructions for using the contents, such as the methods described herein.

[0234] The following examples are intended to illustrate, but not limit, the disclosure. They are typical of those that might be used, although other procedures known to those skilled in the art may also be used. [Example]

[0235] Example 1 Fresh-frozen tissues were sectioned and fixed onto poly-T barcoded capture flow cells. The tissues were fixed in methanol at -20°C for 30 minutes, after which they were stained with hematoxylin and eosin, air-dried, and imaged under a light microscope. The substrate was then placed into a unique device with sealable wells, which allowed for heated incubation on a thermal cycler. Each well had an approximate surface area of ​​approximately 28 mm2 to cover each tissue section.

[0236] The samples were incubated in first-strand cDNA synthesis mix containing the Rd1-containing template switch oligonucleotide at 53°C for 1 hour. The wells were then washed three times with water. NaOH was added to the wells and incubated at room temperature for 5 minutes three times.

[0237] The flow cell was assembled with a gasket to create individual sample wells on the tissue sections. The wells were coated with 0.1x SSC / RNase inhibitor, and the solution was removed. 25 μl of preheated permeabilization mixture (0.1% pepsin, 0.1N HCl) was added to the wells, and the flow cell was incubated at 37°C for 7 minutes, followed by three washes at room temperature in space wash buffer. The permeabilization mixture was then removed, and 25 μl of 1x RT buffer containing RNase inhibitor was added to the wells. The buffer was then removed, and 25 μl of cDNA synthesis mixture (reverse transcription (RT) enzyme, reducing agent, TSO primer, RT reagent, and water) was added to the wells. The flow cell was incubated in first-strand cDNA synthesis mixture containing the Rd1-containing template switch oligonucleotide at 53°C for 1 hour. The solution was then discarded from the wells and washed three times with water. 25 μl of 100% formamide was added to the wells, and the flow cell was incubated at 80°C for 10 minutes.

[0238] The mRNA eluate was stored at -80°C for RT-qPCR QC. The wells were then washed three times with water. 25 μl of 0.08 M KOH was added to the wells, and the flow cell was incubated at room temperature for 5 minutes. The solution was discarded, and the wells were washed once with 50 μl of Buffer EB (Qiagen). Second-strand synthesis was then performed by adding 25 μl of second-strand synthesis mix (second-strand reagents, TSO primer, second-strand enzyme) to the wells, and the flow cell was incubated at 65°C for 15 minutes. The solution was then discarded, and the wells were washed with 50 μl of Buffer EB. The buffer was then discarded, and 25 μl of 0.08 M KOH was added to the wells, and the flow cell was incubated at room temperature for 10 minutes.

[0239] The cDNA eluted in KOH was transferred to a strip tube and neutralized with 3.6 μl of Tris (1 M, pH 7.0). Poly-TVN extension mix (Illumina ASM strand displacement extension mix) was then added to the neutralized cDNA, and the mixture was subjected to the following parameters on a thermocycler: 37°C for 10 minutes, 60°C for 10 minutes, and a 4°C hold. The extension product was purified with 0.7X SPRI and eluted in 12 μl of water. Tagging was then performed using the Illumina Surecell protocol (using diluted transposomes). The tagging reaction mix (tagging enzyme, tagging buffer) was added to the purified sample and incubated at 55°C for 5 minutes. Tagging was stopped with 10 μl of tagging stop buffer and incubated at room temperature for 5 minutes. Index PCR mixture (Tagmentation PCR Mix, P7 primer, N5XX primer) was then added to the samples using the following parameters: 95°C for 30 seconds, followed by 15 cycles of 95°C for 10 seconds, 60°C for 45 seconds, and 72°C for 60 seconds, followed by a final extension of 72°C for 5 minutes and a 4°C hold. Samples were then purified with 1X SPRI and quantified for sequencing. Libraries were sequenced per NovaSeq 6000 S4 flow cell with the following read structure: 100-base read 1 (custom primer), 28-base index read 1, and 8-base read 2 (Figure 2).

[0240] Referring to Figure 4, data generated from the TSO-TAG process described above are shown. An amplicon was generated from the TSO-TAG second-strand cDNA using P7 and TSO primers and 0.7X SPRI-purified to mimic the optimized poly-TVN extension product. This amplicon was used for in-solution tagging evaluation, as shown in Figure 4A. Referring to Figure 4B, a high-input P7 / TSO amplicon (2.5 ng), which served as a control (optimal input for tagging using Illumina's Surecell Library Prep Kit) against a low-input amplicon (100 pg), was tagged using a two-fold serial dilution of Surecell transposomes (B15 transposomes diluted in Illumina's standard storage buffer) starting from 100 femtomolar to 0 femtomolar. Tagging was performed according to Illumina's standard Surecell tagging protocol. Fragment size titration was observed. The library was then 0.7X SPRI-purified. Fifteen cycles of PCR were performed using B15-index P5 and P7, and the products were then 0.7X SPRI-purified. The library was then run on a D5000 DNA screen tape on an Agilent Tapestation. When transposed with 12.5 M B15 transposomes, a sequencing library with a peak at 477 bps can be observed with low-input tagging (60 nM yield). This suggests that low-input tagging, as demonstrated by the readout on the D5000 DNA screen tape on the Tapestation, can create desirable sequencing libraries (desired size range 200-800 bps, high yield), and that the addition of carrier gDNA to prevent over-tagging is not necessary.

[0241] Referring to Figure 6, different conditions were tested to evaluate how process parameters affect the final library preparation. 12.5 femtomoles of B15 Tn5 transposase and 1.25 femtomoles of B15 Tn5 transposase in the tagging mixture were tested, as well as 0.7x SPRI tagging followed by pre-index PCR versus purification without SPRI. Gene mapping numbers for these different conditions are shown in the table below, along with a comparison to a commercially available library preparation method—Visium (10x Genomics). The process according to the present disclosure had improved mapped genes, as measured in transcripts per million (TPM), compared to the commercial product.

[0242] [Table 3]

[0243] Coding alignment data was generated for all TSO-TAG libraries using Illumina's RNA-seq alignment software (v2.0.2) on BaseSpace. Referring to Figure 7, the alignment distribution of the disclosed method was similar to that of the commercially available Visium process. Transcript coverage sequencing data was generated for all TSO-TAG libraries using Illumina's RNA-seq alignment software (v2.0.2) on BaseSpace. Figure 8 shows the transcript coverage of the TSO-TAG method. A slight shift in 3' coverage bias was observed with the disclosed transposition-based library preparation method.

[0244] Example 2 The library preparation process described in Example 1 was performed, except that transposition was performed on beads. A14 transposome beads were formed and stored in 15% glycerol storage buffer. 500 pg, 100 pg, and 10 pg of P7 / TSO amplicons were transposed onto A14 beads. The reaction was stopped with buffer and amplified for 15 cycles with P7 / A14 short strands using the same thermal cycling parameters as described in Example 1. The library was 0.9x-SPRI purified and run on an HD500 Tapestation. Figure 5A is a schematic diagram of the process, and Figure 5B is a graph of the uniform library fragment sizes for 500 pg, 100 pg, and 10 pg.

[0245] The TSO-TAG workflow can also be performed in a "one-pot" reaction when biotinylated TSO second-strand oligos are used in second-strand cDNA synthesis. TSO-TAG is performed in the same manner as outlined in Figure 1. After elution and neutralization of the second-strand cDNA, the second-strand cDNA can be hybridized to streptavidin beads, and subsequent steps (poly-TVN extension, tagging, washing, and PCR) can be performed on the beads with a simple wash step on a magnet (Figure 9A).

[0246] TSO-TAG can be performed on a surface (Figure 9B). After RNA removal, a 3'-blocked SBS12'-polyA is hybridized to the cDNA. A TSO complementary oligo is then gap-filled into the 5' polyA region (using a non-strand-displacing polymerase). The SBS12'-polyA region is then melted off with heat. On-surface tagging is then performed (A14 transposome) to introduce the UMI and add adapters. A unique extension mixture is then added to the surface to add P7 and A14 adapters to the cDNA. The second-strand product is then eluted from the surface and subjected to indexed PCR.

[0247] In addition to TSO-TAG (SBC-TAG and UMI-TAG), various library preparation methods, including transposition, are also contemplated (Figure 10). In one method, SBC-TAG and UMI-TAG use random priming (without template switching) with a mixture of N9-SBS3 randomers and second strands for second-strand cDNA synthesis. The second-strand cDNA is then eluted in its own buffer, and global preamplification is used to build redundancy before transposition, using the same cycle parameters described in Figure 1. The amplified library is SPRI-purified and subjected to tagging according to the protocol described in Figure 4B. To obtain the UMI information, the library is also amplified using P7 and D5XX primers. This approach allows the barcode information to remain double-stranded, allowing transposition onto the capture sequence region.

[0248] Example 3 To demonstrate the feasibility of transposition of amplified TSO libraries, the following experiment was performed. 0.6X SPRI-purified second-strand cDNA (generated as described in Figure 1) was subjected to transposition using Nextera XT transposomes (1 ng library input), Surecell transposomes (3 ng library input), or custom A14ME transposomes (3 ng library input). Tagging was performed according to Illumina's standard tagging protocol. The Nextera library was amplified with UD Index primers using the following cycling parameters: 72°C for 3 minutes, 95°C for 30 seconds, followed by 12 cycles of 95°C for 10 seconds, 55°C for 30 seconds, and 72°C for 30 seconds, with a final extension at 72°C for 5 minutes and a hold at 10°C. The Surecell library was amplified with P7 / N5XX primers using the following cycling parameters: 95° C. for 30 seconds, followed by 12 cycles of 95° C. for 10 seconds, 60° C. for 45 seconds, and 72° C. for 60 seconds, with a final extension at 72° C. for 5 minutes and a hold at 10° C. The custom A14ME library was amplified with P7 / A14-index-P5 primers using the following cycling parameters: 95° C. for 30 seconds, followed by 12 cycles of 95° C. for 10 seconds, 60° C. for 45 seconds, and 72° C. for 60 seconds, with a final extension at 72° C. for 5 minutes and a hold at 10° C. The library was 0.6× SPRI purified and sequenced using the same parameters as described in Figure 2.

[0249] Using the sequencing analysis pipeline, a base composition plot of read 1 was determined (Figure 11B). The A14ME custom library showed little or no amplification in the adapter region of the amplified library. For the Nextera library, there is no transposition of the adapter region by the A14 / B15 transposome.

[0250] The 0.6X SPRI-purified library was run on an HSD5000 DNA Screentape on an Agilent Tapestation to determine library concentration for sequencing (Figure 11C). The A14ME library shows similar library conversion as the Surecell-tagged Nextera library.

[0251] Using the sequencing analysis pipeline, the number of UMIs per 5M input raw reads was determined (Figure 11D). The highest UMI count was determined for the A14ME-transposition library. For Nextera XT, a small number of UMIs were determined due to the A14 / B15 transposome.

[0252] Example 4 Spatial transcriptomics enables highly multiplexed in situ gene expression profiling within complex tissues. A key challenge in achieving single-cell isolation is the assay sensitivity in which tissue RNA is converted into a sequence-ready library. Described herein is a method that combines on-the-spot template switching, single-stranded enzymatic ligation (TSO-LIG), and isothermal amplification to efficiently convert captured tissue RNA, e.g., mRNA, into a spatially barcoded library.

[0253] An exemplary workflow is shown in FIG.

[0254] In steps 1-2 of the workflow, tissue sections are permeabilized to release RNA, e.g., mRNA, from the sample. The released mRNA is then captured by tethered poly(TVN) strands immobilized on a solid substrate. The tethered strands are then converted into first-strand cDNA via template-switching reverse transcriptase. During cDNA synthesis, a template-switching oligo (TSO), e.g., encoding a partial read 1 sequencing adapter (Rd1'), is added to the 3' end of the first-strand cDNA, e.g., by hybridization. In this example, the capture oligo design consists of six components: a) a 5'P7 sequence (for clustering), b) a randomized spatial barcode (SBC, which encodes unique positional information for the transcript), c) a full-length read 2 adapter sequence (Rd2 FL) for decoding the SBC and surface UMI, d) a unique molecular identifier (UMI) that provides a distinct barcode for each captured mRNA transcript, e) a fixed sequence (FS) for quality control, and f) a poly-T capture sequence with a 3'VN-terminus to anchor the captured mRNA to the 3'UTR.

[0255] After exonuclease I treatment (to remove all single-stranded capture oligos) and RNA removal (to remove bound RNA and TSO), an oligo ligation blocker is hybridized (step 3) to prevent ligation of the template switch molecule to the Rd1 adaptor (X) during the subsequent enzymatic ligation step. The ligation blocker is the oligo complement of the Rd1' sequence. An alternative strategy for neutralizing surface capture oligos is to hybridize a complementary oligo blocker to generate a double-stranded end at the 3' end of the capture oligo to prevent ligation.

[0256] During the single-strand ligation step (step 4), splint Rd1 adapters are added to all cDNA molecules that were not template-switched. The splint adapters consist of two parts: a 3' end ( * ) and a single-stranded splint consisting of random bases (NX) with blocking groups at the ends of both strands furthest from the splint.* The double-stranded portion Rd1' contains the Rd1 adapter sequence. The adapter-blocking group prevents adapter self-ligation. cDNA UMIs can also be incorporated into both the TSO and adapter designs to aid downstream analysis of the RNA sequence. The 5' end of the Rd1' sequence contains a phosphate group that allows for enzymatic ligation to the 3' OH end of the captured non-template-switched cDNA. After alkaline treatment (e.g., 0.08 M KOH or 0.1 N NaOH for 5 minutes at room temperature) to remove the ligation blocker and adapter splint strand (step 5), all Rd1'-containing cDNA undergoes on-surface isothermal amplification (step 6). Exponential amplification (ExAmp) occurs via priming of a single full-length Rd1 primer (Rd1 FL) and the surface P7 lone primer, resulting in elution of the amplified second-strand cDNA product (step 7). These elution products are then converted into sequence-ready libraries via indexed PCR, in which i5 indexes and clusterable P5 ends are added (step 8). Strategies for fragment length normalization of either single-stranded or double-stranded cDNA products (including tagging) are contemplated, as described in co-owned U.S. Provisional Patent Application No. 63 / 586,872 (Attny Docket No. IP-2576-P) and U.S. Provisional Patent Application No. 63 / 477,103 (Attny Docket No. IP-2528-P).

[0257] We determined the relative sensitivity for generating second-strand cDNA using template switching (TSO), single-strand splint ligation (LIG), and a combination of both methods (TSO+LIG). Fresh-frozen sections (10 μm) from mouse kidney were mounted on substrates containing spatially barcoded capture oligonucleotides. The tissues were fixed with methanol at -20°C for 30 minutes, after which they were stained with hematoxylin and eosin, air-dried, and imaged under a light microscope. The substrates were then placed into a device with sealable wells, which allowed for heated incubation on a thermal cycler. Each well had a surface area of ​​approximately 28 mm² covering each tissue section, allowing for a surface reaction volume of 80 μL. The tissue sections were then permeabilized with a proprietary permeabilization reagent at 37°C for 7 minutes, followed by three room-temperature washes.

[0258] For TSO only, samples were incubated overnight at 42°C in first-strand cDNA synthesis mix containing the Rd 1-containing template switch oligonucleotide; for single-strand ligation (LIG) only, samples were incubated overnight at 42°C in first-strand cDNA synthesis mix without the Rd 1-containing template switch oligonucleotide; for TSO+LIG, samples were incubated overnight at 42°C in first-strand cDNA synthesis mix containing the Rd 1-containing template switch oligonucleotide, followed by ligation.

[0259] Following first-strand cDNA synthesis, samples were subjected to a 45-minute incubation in oligonucleotide digestion mix at 37°C, a 40-minute tissue removal step in tissue removal mix at 37°C, an RNA removal step involving three 5-minute incubations in RNA removal solution at room temperature, and finally one wash at room temperature in spatial wash buffer. For samples undergoing ligation, a proprietary ligation blocking mix was added and incubated at 40°C for 10 minutes, followed by one wash at room temperature in spatial wash buffer. Ligation mix (containing the Rd1-containing splint adapter) was then added and incubated at 37°C for 75 minutes, followed by one wash at room temperature in spatial wash buffer. Blocker removal solution was added and incubated at room temperature for 5 minutes, followed by one wash at room temperature in spatial wash buffer.

[0260] For all three preparations, a unique second-strand mix was added and incubated at 65°C for 15 minutes. After one wash at room temperature in space wash buffer, the second-strand cDNA was eluted into PCR tubes using 22 μL of elution solution, each with two 5-minute incubations at room temperature. Neutralization solution was added (6 μL), followed by 0.6× SPRI purification. Indexed primers were added to 10% of the eluted second-strand cDNA using 2× Kapa HiFi PCR mix in a 50 μL PCR reaction (11 cycles of 98°C for 45 seconds, 95°C for 30 seconds, 60°C for 1 minute, 72°C for 1 minute, and a final incubation at 72°C for 2 minutes). The PCR reaction was cleaned up using a 0.7× SPRI purification step. Read structure: 16 libraries were sequenced per NovaSeq 6000 S4 flow cell using a 100-base Read 1, a 28-base Index Read 1, and an 8-base Read 2. Each sample received approximately 1,200,000,000 reads, after which the median UMI counts per 100um x 100um area were extracted using proprietary spatial software and then normalized to the TSO condition (Figure 14).

[0261] After converting the captured tissue mRNA to first-strand cDNA on a spatially barcoded substrate (similar to that described in Figure 12), Rd1 adapters were added via either TSO, LIG, or both (TSO+LIG). Samples were then further processed and sequenced as described in Figure 12. Sensitivity was calculated as the median number of UMIs detected per 100 x 100 um and then normalized to the TSO condition. Figure 14 shows increased sensitivity in samples using both TSO+ligation methods.

[0262] We determined the relative Rd1 adapter addition efficiency to first-strand cDNA using template switching (TSO), single-strand splint ligation (LIG), and a combination of both methods (TSO+LIG). After the second-strand cDNA material was eluted from the spacing substrate, a cleavage mix was added and the sample was incubated at 60°C for 30 minutes to cleave the first-strand cDNA from the spacing substrate. The first-strand cDNA was then cleaved from the substrate and subjected to internal (5' gene-specific) and external (5' gene-specific + Rd1) qPCR assays to determine the Rd1 adapter addition efficiency (Figure 15A). qPCR reactions used a probe-based assay and 2x Kapa qPCR mix in a final volume of 10uL and were cycled as follows: 95°C for 3 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 90 seconds. Adapter addition efficiency was calculated using 2x Kapa qPCR mix. -(Cq内側-Cq外側) The Rd1 adaptor addition efficiency was calculated as ρ = 1 / 2 and then normalized to the TSO condition. Figure 15B shows that the Rd1 adaptor addition efficiency increases in samples using both TSO+ ligation methods.

[0263] A key step in converting the Rd2-containing synthetic cDNA into a sequenceable library is the addition of the Rd1 sequence by single-stranded ligation. An exemplary method for accomplishing this is described in Figure 13.

[0264] Ligation options for adding the Rd1 adapter sequence to the 3' end of first-strand cDNA include both enzymatic and chemical methods. Examples of enzymatic methods include T4 DNA ligase-mediated ligation with a splint adapter (see Figure 12) and thermostable 5'App DNA / RNA ligase-mediated ligation with a synthetic pre-adenylated single-stranded oligo adapter. Chemical ligation methods include click chemistry-mediated ligation, in which a 3' azido end is joined to a synthetic 5' alkyne single-stranded oligo, or 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC)-mediated ligation, in which a cDNA bearing a 3' phosphate group is ligated to a splint adapter bearing a 5' hydroxyl end. Incorporation of 3' azido-ddNTP or 3' Phos-dATP can occur during first-strand cDNA synthesis, generating truncated cDNA molecules. Both enzymatic and chemical approaches incorporate molecular identifiers, e.g., (NX), to aid in downstream analysis, and blocking groups ( * ) and compatible with adapters that incorporate it.

[0265] Example 5 Provided herein are methods for preparing immobilized libraries of target nucleic acids from biological samples (e.g., tissue samples). The disclosed methods are advantageous for normalizing library size for surface library preparation applications.

[0266] A schematic workflow of the disclosed method is shown in Figure 16. Figure 16 shows the spatial workflow in which tissue sections are placed on a flow cell (FC) surface, which contains multiple capture oligonucleotides containing the first clustered primer sequence (e.g., the P7 primer sequence shown in Figure 20). Figure 16 also shows how library fragment size can be controlled by adding an optimal concentration of dUTP / allyl-T in the reverse transcription (RT) reaction. This approach is implemented by first capturing transcripts on a barcoded surface containing capture oligonucleotides containing a polyT capture nucleotide sequence. Reverse transcriptase is primed with spiked dUTP / allyl-T during the reaction. After RT, the substrate is prepared for UDG / UCM cleavage by performing exonuclease digestion, tissue digestion, and RNA removal steps. As described herein, the tissue digestion step is optional. UDG / UCM cleavage is used to generate fragments in which the first incorporated dUTP / allyl-T site is the 3' termination site of the cDNA strand. The substrate is then washed, and second-strand synthesis is then performed using a randomer primer containing an adapter. The randomer sequence serves as the UMI for the transcript. After second-strand synthesis, the second cDNA strand is eluted and subjected to indexed PCR and purification before being loaded onto a sequencing instrument. Figure 17 shows the sequencing read structure of the amplified second complementary strand. Read 1 reads the cDNA; Read 2 reads the spatial barcode; and Read 3 reads the sample index. In this example, the total insert size is 155 bps plus the size of the short cDNA insert.

[0267] Another schematic workflow of the disclosed method is shown in Figure 18. Figure 18 shows the spatial workflow in which tissue sections are placed on a flow cell (FC) surface, where the FC surface contains multiple capture oligonucleotides containing a first clustered primer sequence (e.g., the P7 primer sequence shown in Figure 20), and one or more of the multiple capture oligonucleotides are immobilized on the surface via cleavage sites. Figure 18 shows a schematic diagram of library fragment size normalization for in-tube second-strand synthesis using dUTP / allyl-T. Adding an alternative cleavage chemistry upstream of the first clustered primer sequence (shown as P7 in Figure 18) enables in-solution library preparation after RT. The two different cleavage chemistries allow for an on-surface wash step to remove unbound cDNA fragments. In this workflow, transcripts are captured on a barcoded surface containing capture oligonucleotides containing a poly-T capture nucleotide sequence. Reverse transcriptase is primed with dUTP / allyl-T spiked into the reaction. After RT, the substrate is prepared for UDG / UCM cleavage by performing exonuclease digestion, tissue digestion, and RNA removal steps. UDG / UCM cleavage generates fragments in which the first incorporated dUTP / allyle-T site is the 3' termination site of the cDNA strand. The substrate is then washed, and an additional cleavage step upstream of P7 elutes the cDNA from the surface. Second-strand synthesis is performed using a randomer primer containing an adapter. The randomer sequence serves as the UMI for the transcript. After second-strand synthesis, the second cDNA strand (i.e., the second complementary strand) is eluted and subjected to indexed PCR and purification before loading into a sequencing instrument.

[0268] Another schematic workflow of the disclosed method is shown in Figure 19. Figure 19 shows the spatial workflow in which tissue sections are placed on a flow cell (FC) surface, which contains multiple capture oligonucleotides containing a first clustered primer sequence (e.g., the P7 primer sequence shown in Figure 20). Figure 19 shows a schematic diagram of library size normalization using ddNTPs in a reverse transcription reaction. Shorter library fragments can be achieved by adding ddNTPs to the RT reaction. In this workflow, transcripts are captured on a barcoded surface containing capture oligonucleotides containing a poly-T capture nucleotide sequence. Reverse transcriptase is initiated with spiked ddNTPs in the reaction. After RT, the substrate is prepared for second complementary strand synthesis by performing exonuclease digestion, tissue digestion, and RNA removal steps. Second complementary strand synthesis is performed using an adapter-containing randomer primer. The randomer sequence serves as the UMI for the transcript. After second complementary strand synthesis, the second cDNA strand (ie, the second complementary strand) is eluted and subjected to indexed PCR and purification before being loaded onto a sequencing instrument.

[0269] Another schematic workflow of the disclosed method is shown in Figure 20. Similar to Figures 16, 18, and 19, Figure 20 illustrates a spatial workflow in which tissue sections are placed on a flow cell (FC) surface, where the FC surface contains multiple capture oligonucleotides containing a first clustered primer sequence (e.g., the P7 primer sequence shown in Figure 20). Figure 20 shows a schematic diagram in which ExAMP functions as a cDNA elution reagent to establish redundant pre-sequencing. In some embodiments, if an exonuclease step is added to the post-RT workflow (e.g., to remove unbound surface-captured oligonucleotides from the surface), this allows the opportunity to use the on-surface ExAMP reaction to elute the barcoded surface-bound library and establish library yield. After second complementary strand synthesis, an ExAMP mixture (containing P7 and sample index primers) can be added to the substrate. Isothermal amplification with primer strand invasion is then used to create an indexed P5 / P7 library. The eluate is then transferred to a tube, where it is purified and loaded into the sequencing instrument. Efficient exonuclease digestion of unbound surface oligonucleotides improves the workflow.

[0270] Another schematic workflow of the disclosed method is shown in Figure 21. Figure 21 illustrates a spatial workflow in which the FC surface contains multiple capture oligonucleotides containing a first clustered primer sequence (e.g., the P7 primer sequence shown in Figure 21). Figure 21 illustrates how cDNA fragments can be shortened with 3' phosphate dNTPs or azido-ddNTPs. First, 3' Phos dNTPs are added to the RT reaction. The substrate can then be treated with an exonuclease, thereby converting the 3' phosphate to OH, allowing for enzymatic ligation of the UMI and adapter sequence with PNK (sprint ligation with ssDNA ligation). Additionally, chemical ligation with water-soluble carbodiimide (EDC) can be performed. In a further embodiment, azido-ddNTPs are added to the RT reaction, followed by azide / alkyne splint ligation to add the UMI and adapter sequence.

[0271] The foregoing description has been given for clarity of understanding only, and no unnecessary limitations should be understood therefrom, as modifications within the scope of the disclosure may be apparent to those skilled in the art.

[0272] All patents, patent applications, government publications, government regulations, and references cited herein are incorporated by reference in their entirety. In the case of a conflict, the present specification, including definitions, will control.

[0273] Throughout this specification, it is contemplated that compounds, compositions, methods, and / or processes described as comprising components, steps, or materials may also comprise, consist essentially of, or consist of any combination of the listed components or materials, unless otherwise stated. Component concentrations may be expressed as weight concentrations unless otherwise specified. Combinations of components are contemplated to include homogeneous and / or heterogeneous mixtures, as would be understood by one of skill in the art in light of the foregoing disclosure.

Claims

1. 1. A method for preparing an RNA-seq library, comprising: loading the tissue sample onto a substrate comprising a plurality of capture oligonucleotides, the capture oligonucleotides comprising a poly-T sequence and library barcode information comprising a spatial barcode sequence (SBC); capturing polyadenylated mRNA transcripts on the substrate with the capture oligonucleotide; contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase and a template switch oligonucleotide (TSO) under conditions to produce a first strand comprising a first cDNA complementary to the polyadenylated mRNA transcript and a TSO complement hybridized to a 5' end of the first cDNA, wherein the reverse transcriptase incorporates a non-templated cytosine nucleotide at the 5' end of the first cDNA, the TSO comprises a sequence that hybridizes to the non-templated cytosine nucleotide, and the reverse transcriptase is extended to produce the TSO complement at the 5' end of the first cDNA as the complement of the TSO; eluting the polyadenylated mRNA transcripts from the substrate; contacting the first strand with a second strand synthesis mixture comprising a TSO primer and extending the TSO primer using the first strand as a template to generate a second strand complementary to the first strand, wherein the second strand comprises the TSO, a second cDNA complementary to the first cDNA, and second strand barcode information comprising a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence (SBC); eluting the second strand; contacting the second strand with a poly-TVN extension mixture comprising a poly-TVN primer and extending the poly-TVN primer using the second strand as a template to generate a double-stranded product while maintaining a single-stranded 3' region containing the library barcode information; contacting the double-stranded product with a transposome under conditions that tag the double-stranded product to form a tagged product comprising a unique molecular identifier (UMI) and a PCR adapter; amplifying the tagged products using index PCR to create the library; A method comprising:

2. 2. The method of claim 1, wherein the TSO primer in the second strand synthesis mixture is a biotinylated TSO primer such that the second strand comprises a biotinylated TSO.

3. 3. The method of claim 2, further comprising contacting the eluted second strand containing the biotinylated TSO with functionalized beads.

4. The method of claim 3 , wherein the functionalized beads are streptavidin beads.

5. The method of any one of claims 1 to 4, wherein the second strand is neutralized after elution and before contacting with the poly-TVN extension mixture.

6. 6. The method of any one of claims 1 to 5, wherein contacting the first strand with the second strand synthesis mixture comprises incubating the first strand with the second strand synthesis mixture for an incubation time of less than 2 hours.

7. 7. The method of claim 6, wherein the incubation time is from about 10 minutes to about 60 minutes.

8. 8. The method of claim 7, wherein the incubation time is from about 15 minutes to about 30 minutes.

9. The method of any one of claims 1 to 8, wherein the transposome is an A14 transposome or a B15 transposome.

10. The method of any one of claims 1 to 9, wherein the transposome is a transposome-modified bead.

11. The method of any one of claims 1 to 10, comprising purifying the double-stranded product prior to tagging.

12. The method of any one of claims 1 to 11, comprising purifying the double-stranded product after index PCR.

13. 13. The method of any one of claims 1-12, wherein contacting the second strand with the poly-TVN extension mixture comprises incubating the second strand with the poly-TVN extension mixture at a first temperature and for a first time, incubating at a second temperature higher than the first temperature for a second time, and holding at a hold temperature.

14. 14. The method of claim 13, wherein the first temperature is from about 25°C to about 37°C and the first time period is from about 10 minutes to about 30 minutes.

15. 15. The method of claim 13 or 14, wherein the second temperature is from about 60°C to about 65°C and the second time period is from about 10 minutes to about 30 minutes.

16. The method according to claims 13 to 15, wherein the holding temperature is 4°C.

17. 17. The method of any one of claims 1 to 16, wherein the index PCR is carried out using about 10 to 24 cycles, each cycle comprising 15 to 50 minutes.

18. 18. The method of claim 17, wherein the index PCR comprises a final extension comprising a hold of about 5 to 10 minutes.

19. The method of any one of claims 1 to 18, wherein the tagged product is amplified using primers comprising P7 and transposome-index-P5.

20. 20. The method of any one of claims 1 to 19, wherein tagging comprises contacting the double-stranded product with the transposome and a carrier gDNA.

21. 21. The method of any one of claims 1 to 20, wherein the sequence that hybridizes to the non-templated cytosine nucleotide comprises 2 to 5 guanosines.

22. 22. The method of claim 21, wherein the guanosine is riboguanosine.

23. 23. The method of claim 22, wherein the sequence is rGrGrG.

24. 1. A method for preparing an RNA-seq library, comprising: loading the tissue sample onto a substrate comprising a plurality of capture oligonucleotides, the capture oligonucleotides comprising a poly-T sequence and library barcode information comprising a spatial barcode sequence (SBC); capturing polyadenylated mRNA transcripts on the substrate with the capture oligonucleotide; contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase and a template switch oligo (TSO) under conditions to produce a first strand comprising a first cDNA complementary to the polyadenylated mRNA transcript and a TSO complement hybridized to the 5' end of the first cDNA; eluting the polyadenylated mRNA transcripts from the substrate; contacting the first strand with a blocker oligonucleotide and a TSO to hybridize the blocker oligonucleotide and the TSO to the first strand, wherein the blocker oligonucleotide and the TSO hybridize such that a gap exists between the blocker oligonucleotide and the TSO; contacting the hybridized first strand with a non-strand-displacing polymerase to gap-fill the gap and generate a second cDNA; removing the blocker oligonucleotide to form a blocker-free first strand; contacting the blocker-free first strand with a transposome under conditions that tag the blocker-free first strand to form a tagged product that includes a unique molecular identifier (UMI) and a PCR adapter; contacting the tagged product with an extension mixture to generate a second strand complementary to the first strand, the second strand comprising second strand barcode information having a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence, the second cDNA, the unique molecular identifier, and the PCR adaptor; eluting the second strand; amplifying said second strand using index PCR to create said library; A method comprising:

25. 25. The method of claim 24, wherein the blocker oligonucleotide is a 3'-blocked SBS12'-polyA oligonucleotide.

26. 1. A method for preparing an RNA-seq library, comprising: loading the tissue sample onto a substrate comprising a plurality of capture oligonucleotides, the capture oligonucleotides comprising a barcode comprising a poly-T sequence and a spatial barcode sequence (SBC); capturing polyadenylated mRNA transcripts on the substrate with the capture oligonucleotide; contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase under conditions to produce a first strand comprising a first cDNA complementary to the polyadenylated mRNA transcript; eluting the polyadenylated mRNA transcripts from the substrate; contacting the first strand with a second strand synthesis mixture comprising a random primer to produce a second strand comprising a second cDNA and a unique molecular identifier (UMI); eluting the second strand; amplifying the second strand to produce a double-stranded product; contacting the double-stranded product with a transposome under conditions to form a tagged product; generating the library by amplifying the tagged products in a first index PCR to determine the SBC and amplifying the tagged products in a second index PCR to determine the UMI; A method comprising:

27. 1. A method for preparing an RNA-seq library, comprising: loading the tissue sample onto a substrate comprising a plurality of capture oligonucleotides, the capture oligonucleotides comprising one or more gene-specific capture sequences and library barcode information comprising a spatial barcode sequence (SBC); capturing mRNA transcripts on the substrate with the capture oligonucleotide; contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase and a template switch oligonucleotide (TSO) under conditions to produce a first strand comprising a first cDNA complementary to the mRNA transcript and a TSO complement hybridized to a 5' end of the first cDNA, wherein the reverse transcriptase incorporates a non-templated cytosine nucleotide at the 5' end of the first cDNA, the TSO comprising a sequence that hybridizes to the non-templated cytosine nucleotide, and the reverse transcriptase extends to produce the TSO complement at the 5' end of the first cDNA as the complement of the TSO; eluting the mRNA transcripts from the substrate; contacting the first strand with a second strand synthesis mixture comprising a TSO primer and extending the TSO primer using the first strand as a template to generate a second strand complementary to the first strand, wherein the second strand comprises the TSO, a second cDNA complementary to the first cDNA, and second strand barcode information comprising a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence (SBC); eluting the second strand; contacting the second strand with an extension mixture comprising an extension primer and extending the extension primer using the second strand as a template while maintaining a single-stranded 3' region containing the library barcode information to produce a double-stranded product, wherein the extension primer hybridizes to a region of the second strand that does not contain the barcode information of the second strand; contacting the double-stranded product with a transposome under conditions that tag the double-stranded product to form a tagged product comprising a unique molecular identifier (UMI) and a PCR adapter; amplifying the tagged products using index PCR to create the library; A method comprising:

28. 28. The method of claim 27, wherein the second strand is neutralized after elution and before contacting with the extension mixture.

29. 29. The method of claim 27 or 28, wherein contacting the first strand with the second strand synthesis mixture comprises incubating the first strand with the second strand synthesis mixture for an incubation time of less than 2 hours.

30. 30. The method of claim 29, wherein the incubation time is from about 10 minutes to about 60 minutes.

31. 31. The method of claim 30, wherein the incubation time is from about 15 minutes to about 30 minutes.

32. The method of any one of claims 27 to 31, wherein the transposome is an A14 transposome or a B15 transposome.

33. The method of any one of claims 27 to 32, wherein the transposome is a transposome-modified bead.

34. The method of any one of claims 27 to 33, comprising purifying the double-stranded product prior to tagging.

35. The method of any one of claims 27 to 34, comprising purifying the double-stranded product after index PCR.

36. 36. The method of any one of claims 27-35, wherein contacting the second strand with the extension mixture comprises incubating the second strand with the extension mixture at a first temperature and for a first time, incubating at a second temperature higher than the first temperature for a second time, and holding at a hold temperature.

37. 37. The method of claim 36, wherein the first temperature is from about 25°C to about 37°C and the first time period is from about 10 minutes to about 30 minutes.

38. 38. The method of claim 36 or 37, wherein the second temperature is from about 60°C to about 65°C and the second time period is from about 10 minutes to about 30 minutes.

39. The method according to claims 36 to 38, wherein the holding temperature is 4°C.

40. 40. The method of any one of claims 36 to 39, wherein the index PCR is carried out using about 10 to 24 cycles, each cycle comprising 15 to 50 minutes.

41. 41. The method of claim 40, wherein the index PCR comprises a final extension comprising a hold of about 5 to 10 minutes.

42. 42. The method of any one of claims 36 to 41, wherein the tagged product is amplified using primers comprising P7 and transposome-index-P5.

43. 43. The method of any one of claims 36 to 42, wherein tagging comprises contacting the double-stranded product with a transposome and a carrier gDNA.

44. 44. The method of any one of claims 36 to 43, wherein the sequence that hybridizes to the non-templated cytosine nucleotide comprises 2 to 5 guanosines.

45. 45. The method of claim 44, wherein the guanosine is riboguanosine.

46. 46. ​​The method of claim 45, wherein the sequence is rGrGrG.

47. 1. A method for preparing an RNA-seq library, comprising: loading the tissue sample onto a substrate comprising a plurality of capture oligonucleotides, the capture oligonucleotides comprising one or more gene-specific capture sequences and library barcode information comprising a spatial barcode sequence (SBC); capturing mRNA transcripts on the substrate with the capture oligonucleotide; contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase and a template switch oligo (TSO) under conditions to produce a first strand comprising a first cDNA complementary to the mRNA transcript and a TSO complement hybridized to the 5' end of the first cDNA; eluting the mRNA transcripts from the substrate; contacting the first strand with a blocker oligonucleotide and a TSO to hybridize the blocker oligonucleotide and the TSO to the first strand, wherein the blocker oligonucleotide and the TSO hybridize such that a gap exists between the blocker oligonucleotide and the TSO; contacting the hybridized first strand with a non-strand-displacing polymerase to gap-fill the gap and generate a second cDNA; removing the blocker oligonucleotide to form a blocker-free first strand; contacting the blocker-free first strand with a transposome under conditions that tag the blocker-free first strand to form a tagged product that includes a unique molecular identifier (UMI) and a PCR adapter; contacting the tagged product with an extension mixture to generate a second strand complementary to the first strand, the second strand comprising second strand barcode information having a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence, the second cDNA, the unique molecular identifier, and the PCR adaptor; eluting the second strand; amplifying said second strand using index PCR to create said library; A method comprising:

48. 1. A method for preparing an RNA-seq library, comprising: depositing the tissue sample on a substrate comprising a plurality of capture oligonucleotides, the capture oligonucleotides comprising one or more gene-specific capture sequences and a barcode comprising a spatial barcode sequence (SBC); capturing mRNA transcripts on the substrate with the capture oligonucleotide; contacting the substrate with a first strand synthesis mixture comprising a reverse transcriptase under conditions to produce a first strand comprising a first cDNA complementary to the mRNA transcript; eluting the mRNA transcripts from the substrate; contacting the first strand with a second strand synthesis mixture comprising a random primer and extending the random primer to generate a second strand comprising a second cDNA and a unique molecular identifier (UMI); eluting the second strand; amplifying the second strand to produce a double-stranded product; contacting the double-stranded product with a transposome under conditions to form a tagged product; generating the library by amplifying the tagged products in a first index PCR to determine the SBC and amplifying the tagged products in a second index PCR to determine the UMI; A method comprising:

49. 1. A method for preparing a spatially barcoded RNA library from a tissue sample, comprising: a) contacting the tissue sample with a plurality of capture oligonucleotides immobilized on a solid substrate and capable of hybridizing to RNA in the tissue sample, wherein the capture oligonucleotides comprise a capture nucleotide sequence, a spatial barcode sequence (SBC), and an adapter sequence, and wherein RNA transcripts are captured by the capture nucleotide sequences of the plurality of capture oligonucleotides; b) combining the RNA transcripts with a first strand synthesis mixture comprising a reverse transcriptase (RT) and a template switch oligonucleotide (TSO) encoding a first adapter sequence; contacting under conditions to produce a first strand cDNA complementary to the RNA transcript and a first strand cDNA comprising a TSO added to the 3' end of the first strand cDNA, wherein the reverse transcriptase incorporates a non-templated cytosine nucleotide at the 3' end of the first strand cDNA, the TSO comprising a first adapter sequence hybridizes to the 3' end of the first cDNA, and the reverse transcriptase extends to produce a TSO complement; the contacting produces a mixture of template switch molecules and non-template switch molecules, the non-template switch molecules lacking the complement to the first adapter sequence; c) contacting the mixture with a plurality of oligo ligation blockers comprising the first adapter sequence and capable of hybridizing to the 3′ end of the template switch molecule comprising the complement to the first adapter sequence; d) performing a single-stranded ligation step comprising hybridizing a splint adapter to the non-template switch molecule, wherein the splint adapter comprises i) a single-stranded splint sequence comprising a random base sequence (NX), and ii) a double-stranded first adapter sequence comprising a hybridized first adapter and a complement to the first adapter sequence, wherein the complement to the 5' end of the first adapter sequence contains a phosphate group for ligation to the 3' OH terminus of the captured non-template switch molecule; and ligating the 5' end of the splint adapter complement to the 3' OH terminus of the non-template switch molecule; e) removing the ligation blocker and splint sequence and the first adaptor from the ligated molecule; A method comprising:

50. 50. The method of Claim 49, comprising contacting the mixture of template switch molecules and non-template switch molecules with an exonuclease.

51. 51. The method of claim 50, wherein the exonuclease is DNA exonuclease I or RNAse H.

52. 52. The method of any one of claims 49 to 51, wherein the NX sequence has a blocking group at the 5' end of the NX sequence.

53. 53. The method of any one of claims 49 to 52, wherein the hybridized first adapter and complement to the first adapter sequence comprise blocking groups at the ends of both the first adapter and the complement to the first adapter sequence that is furthest from the splint sequence.

54. 54. The method of any one of claims 50 to 53, further comprising contacting the mixture with an alkaline solution after the exonuclease.

55. 55. The method of any one of claims 49-54, further comprising, after the removing step, amplifying the template switch molecule and the non-template switch molecule by contacting the mixture with a second-strand synthesis mixture comprising a single first adaptor primer and extending the first adaptor primer using the first-strand cDNA or its complement as a template to generate a second-strand cDNA complementary to the first strand or its complement, wherein the second-strand cDNA comprises a second cDNA complementary to the first-strand cDNA and second-strand barcode information comprising a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence (SBC) in the capture oligonucleotide.

56. 56. The method of claim 55, wherein the first adapter primer is a full-length primer or a partial primer.

57. 57. The method of any one of claims 49 to 56, further comprising eluting the amplified first-strand and / or second-strand cDNA molecules from the substrate and generating a spatially barcoded RNA library from the eluted molecules using a library preparation kit.

58. 58. The method of any one of claims 49 to 57, wherein the ligated molecule of step (d) further comprises a cleavage sequence.

59. 59. The method of claim 58, wherein removing the ligation blocker, splint sequence, and first adaptor from the ligated molecule is performed remote from the substrate.

60. 59. The method of Claim 57 or 58, wherein amplifying the template switch molecules and non-template switch molecules, eluting the second strand cDNA, and creating a spatially barcoded library are performed in solution.

61. 61. The method of any one of claims 49 to 60, wherein the amplifying step is performed on the substrate.

62. 62. The method of claim 61 , wherein the amplified first strand and / or second strand further comprises a cleavage sequence.

63. 63. The method of claim 61 or 62, wherein the elution of second strand cDNA and creation of a spatially barcoded library is performed in solution.

64. 1. A method for preparing a spatially barcoded RNA library from a tissue sample, comprising: a) contacting the tissue sample with a plurality of capture oligonucleotides immobilized on a solid substrate and capable of hybridizing to RNA in the tissue sample, wherein the capture oligonucleotides comprise a capture nucleotide sequence, a spatial barcode sequence (SBC), and an adapter sequence, and wherein RNA transcripts are captured by the capture nucleotide sequences of the plurality of capture oligonucleotides; b) contacting the RNA transcript with a first strand synthesis mixture comprising a reverse transcriptase (RT) and a template switch oligonucleotide (TSO) encoding a first adapter sequence under conditions to produce a first strand cDNA complementary to the RNA transcript and a first strand cDNA comprising a TSO hybridized to the 3′ end of the first strand cDNA, wherein the reverse transcriptase incorporates a non-templated cytosine nucleotide at the 3′ end of the first strand cDNA, and a TSO comprising a first adapter sequence is added to the 3′ end of the first strand cDNA, and the reverse transcriptase extends to produce a TSO complement; wherein the contacting produces a mixture of template switch molecules and non-template switch molecules, and the non-template switch molecules lack a complement to the first adapter sequence; c) contacting the mixture with a plurality of oligo ligation blockers capable of hybridizing to the 3′ end of the template switch molecule comprising the first adapter sequence and comprising the complement to the first adapter sequence, and a plurality of complementary oligo blockers comprising nuelcotide sequences complementary to all or a portion of the capture nucleotide sequence and a fixed sequence in the capture oligonucleotide to generate a double-stranded 3′ end of the capture oligonucleotide; d) performing a single-stranded ligation step comprising hybridizing a splint adapter to the non-template switch molecule, wherein the splint adapter comprises i) a single-stranded splint sequence comprising a random base sequence (NX), and ii) a double-stranded partial first adapter sequence comprising a hybridized first adapter and a complement to the first adapter sequence, wherein the complement to the 5' end of the first adapter sequence contains a phosphate group for ligation to the 3' OH terminus of the captured non-template switch molecule, and ligating the 5' end of the complement of the splint adapter to the 3' OH terminus of the non-template switch molecule; e) removing the ligation blocker and the splint strand of the adapter; A method comprising:

65. 65. The method of Claim 64, comprising contacting the mixture of template switch molecules and non-template switch molecules with an exonuclease.

66. 66. The method of claim 65, wherein the exonuclease is DNA exonuclease I or RNAse H.

67. 67. The method of any one of claims 64 to 66, wherein the NX sequence has a blocking group at the 5' end of the NX sequence.

68. 68. The method of any one of claims 64 to 67, wherein the hybridized first adapter and complement to the first adapter sequence comprise blocking groups at the ends of both the first adapter and the complement to the first adapter sequence that is furthest from the splint sequence.

69. 69. The method of any one of claims 65 to 68, further comprising contacting the mixture with an alkaline solution after the exonuclease.

70. 70. The method of any one of claims 64-69, further comprising, after the removing step, amplifying the template-switch molecule and the non-template-switch molecule by contacting the mixture with a second-strand synthesis mixture comprising a single first adaptor primer and extending the first adaptor primer using the first-strand cDNA as a template to generate second-strand cDNA complementary to the first strand, wherein the second-strand cDNA comprises a second cDNA complementary to the first-strand cDNA and second-strand barcode information comprising a spatial barcode sequence complement (SBC') complementary to the spatial barcode sequence (SBC) in the capture oligonucleotide.

71. 71. The method of claim 70, wherein the first adapter primer is a full-length primer or a partial primer.

72. 72. The method of any one of claims 49-71, further comprising eluting the amplified first-strand and / or second-strand cDNA molecules from the substrate and generating a spatially barcoded RNA library from the eluted molecules using a library preparation kit.

73. 73. The method of any one of claims 65 to 72, wherein the ligated molecule of step (d) further comprises a cleavage sequence.

74. 74. The method of claim 73, wherein removing the ligation blocker, splint sequence, and first adaptor from the ligated molecule is performed remote from the substrate.

75. 75. The method of Claim 73 or 74, wherein amplifying the template switch molecules and non-template switch molecules, eluting the second strand cDNA, and creating a spatially barcoded library are performed in solution.

76. 76. The method of any one of claims 49 to 75, wherein the amplifying step is performed on the substrate.

77. 77. The method of claim 76, wherein the amplified first strand and / or second strand further comprises a cleavage sequence.

78. 78. The method of claim 76 or 77, wherein the elution of second strand cDNA and creation of a spatially barcoded library is performed in solution.

79. 79. The method of any one of claims 49-78, optionally comprising placing the tissue sample on a substrate comprising the plurality of capture oligonucleotides prior to contacting the tissue with the plurality of capture oligonucleotides.

80. 80. The method of any one of claims 49 to 79, wherein the capture nucleotide sequence is a poly-T sequence, a poly-A sequence, a gene-specific capture sequence, or a universal capture sequence.

81. 81. The method of claim 80, wherein the universal capture sequence is a random nucleotide sequence or a non-self-complementary semi-random sequence.

82. 82. The method of any one of claims 49 to 81, wherein the capture oligonucleotide comprises a 5' clustered sequence, a randomized spatial barcode (SBC), a full-length second adapter sequence (2 FL), a molecular identifier (MI), a fixed sequence (FS), and a poly-T capture sequence with a 3' VN terminus (poly-TVN).

83. 83. The method of claim 82, wherein the first adapter sequence is a read 1 (Rd1) sequence and the second adapter is a read 2 (Rd2) sequence.

84. 84. The method of any one of claims 49 to 83, wherein the first adaptor is a partial adaptor sequence.

85. 85. The method of claim 84, wherein the molecular identifier is a unique molecular identifier, an endogenous molecular identifier, an exogenous molecular identifier, or a virtual molecular identifier.

86. 86. The method of any one of claims 49-85, wherein the ligating step comprises enzymatic ligation of the splint adaptor to the non-templated switch molecule.

87. 87. The method of claim 86, wherein the enzymatic ligation is by T4 ligase, other DNA ligase, or thermostable 5'App DNA / RNA ligase mediated ligation with a synthetic pre-adenylated single-stranded oligo adapter.

88. 88. The method of any one of claims 49-87, wherein the ligating step comprises chemical ligation of the splint adaptor to the non-templated switch molecule.

89. 89. The method of claim 88, wherein the chemical ligation is performed using click chemistry-mediated ligation, in which a 3' azide terminus is joined to a synthesized 5' alkyne single-stranded oligo, or 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC)-mediated ligation, in which a cDNA bearing a 3' phosphate group is ligated to a splint adaptor bearing a 5' hydroxyl terminus.

90. 90. The method of claim 89, wherein 3' azido-ddNTP or 3' Phos-dATP is incorporated onto the Rd1 adaptor during first strand cDNA synthesis.

91. 91. The method of any one of claims 49 to 90, wherein the splint adaptor random sequence comprises 6 to 10 nucleotides.

92. 92. The method of any one of claims 49-91, wherein the splint adaptor random sequence comprises 7 nucleotides.

93. 93. The method of any one of claims 49-92, wherein the splint adapter comprises a blocking group at both the 3' and 5' ends of the splint sequence and a ligation blocking group at the 5' end of the adapter strand that is complementary to the splint strand.

94. 94. The method of claim 93, wherein the ligation blocker group is a phosphate.

95. 95. The method of any one of claims 49 to 94, wherein the ligation blocker and splint adaptor are removed by alkaline treatment.

96. 96. The method of claim 95, wherein the alkaline treatment comprises either 0.08 M KOH or 0.1 N NaON for 5 minutes at room temperature.

97. 97. The method of any one of claims 49 to 96, wherein the 5' clustered sequences comprise a P7 sequence.

98. 98. The method of any one of claims 49 to 97, wherein the capture oligonucleotide further comprises a randomer, a semi-random sequence, or a target-specific probe.

99. 99. The method of any one of claims 49 to 98, wherein the sequence that hybridizes to the non-templated cytosine nucleotide comprises 2 to 5 guanosines.

100. 100. The method of claim 99, wherein the guanosine is a riboguanosine, a modified nucleic acid, or a locked nucleic acid (LNA).

101. 101. The method of claim 100, wherein the sequence is rGrGrG.

102. 102. The method of any one of claims 49 to 101, wherein the poly-T sequence is 20 to 30 nucleotides.

103. The method of any one of claims 49 to 102, wherein the SBC is a randomer.

104. 104. The method of any one of claims 49 to 103, wherein the SBC is 20 to 30 nucleotides.

105. 105. The method of any one of claims 49 to 104, wherein the capture oligonucleotide comprises at least 10 deoxythymidine residues.

106. 106. The method of claim 105, wherein said capture oligonucleotides comprise a plurality of different target-specific RNA capture probe sequences.

107. 79. The method of Claim 78, wherein the target-specific probe comprises at least 10 nucleotides complementary to a nucleotide sequence of a target RNA.

108. 108. The method of any one of claims 49 to 107, wherein the capture oligonucleotide is 8 to 80 nucleotides.

109. 109. The method of any one of claims 49 to 108, further comprising the step of end-repairing the RNA using polynucleotide kinase prior to capturing the RNA from the tissue sample.

110. 109. The method of any one of claims 49 to 108, further comprising the step of performing in situ polyadenylation using polyadenylate polymerase prior to the step of capturing RNA from the tissue sample.

111. 109. The method of any one of claims 49 to 108, further comprising, prior to capturing RNA from the tissue sample, performing end repair of the RNA using polynucleotide kinase, followed by in situ polyadenylation using polyadenylate polymerase.

112. 112. The method of any one of claims 49 to 111, wherein the RNA comprises ribosomal RNA (rRNA), messenger RNA (mRNA), non-coding RNA (ncRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), and / or microRNA (miRNA).

113. 113. The method of any one of claims 49 to 112, wherein the tissue sample is formalin-fixed paraffin-embedded (FFPE) tissue or fresh-frozen (FF) tissue.

114. 114. The method of any one of claims 49 to 113, wherein the removal of the RNA is carried out by melting or digesting the RNA with an RNase.

115. 115. The method of any one of claims 49 to 114, wherein the tissue sample is permeabilized prior to contacting the tissue sample with a plurality of capture oligonucleotides.

116. 116. The method of any one of claims 49 to 115, wherein the tissue sample is treated with one or more blocking reagents prior to contacting the tissue sample with the plurality of capture oligonucleotides.

117. 117. The method of any one of claims 49 to 116, wherein the tissue sample is permeabilized and treated with one or more blocking reagents prior to contacting the tissue sample with the plurality of capture oligonucleotides.

118. 118. The method of any one of claims 49 to 117, wherein the method comprises polyadenylating the RNA in the sample.

119. 119. The method of claim 118, wherein the RNA is polyadenylated using poly(A) polymerase.

120. 119. The method of claim 118, wherein the RNA is polyadenylated using chemical or enzymatic ligation.

121. 121. The method of any one of claims 49 to 120, wherein the substrate is a bead, a bead array, a spot array, a substrate comprising multiple wells, a flow cell, clustered particles arranged on the surface of a chip, a film, or a plate.

122. 122. The method of claim 121, wherein the substrate comprises a plurality of nanowells or microwells.

123. The method of any one of claims 49 to 122, wherein the RNA library is an mRNA library.

124. performing PCR on the second strand cDNA to obtain PCR templates representing one or more RNA transcripts in the tissue sample; eluting the PCR template; performing index PCR to generate a double-stranded PCR product comprising the first strand PCR product and a second strand complementary to the first strand PCR product; 124. The method of any one of claims 49 to 123, further comprising indexing and sequencing the second strand cDNA comprising:

125. 125. The method of Claim 124, further comprising sequencing the PCR product and determining the location of the RNA transcript in the tissue based on the spatial barcode.

126. 126. The method of claim 124 or 125, wherein the double-stranded PCR product comprises a second clustered sequence on a second strand that is complementary to the first strand PCR product, and optionally an index sequence.

127. 126. The method of claim 124 or 125, wherein the double-stranded PCR products are further processed by tagging to create a spatial transcriptomics library.

128. 128. The method of claim 127, wherein said tagging comprises tagging on a substrate.

129. 129. The method of claim 127 or 128, wherein tagging comprises contacting the double-stranded product with a transposome and a carrier gDNA.

130. 130. The method of any one of claims 49-129, further comprising determining the spatial locations of the spatial barcodes of the plurality of capture oligonucleotide molecules prior to contacting the tissue with the substrate.

131. 131. The method of Claim 130, further comprising sequencing at least a portion of said spatially barcoded first strand cDNA or copies thereof to determine the spatial barcode sequence of each molecule.

132. 132. The method of Claim 131, wherein said spatially barcoded first strand cDNA is sequenced in situ.

133. 133. The method of Claim 131 or 132, further comprising determining one or more spatial locations of the spatially barcoded first strand cDNA or copies thereof by correlating the spatial barcode sequences of the spatially barcoded first strand cDNA or copies thereof with the spatial locations of the capture oligonucleotide molecules on the substrate containing corresponding spatial barcode sequences.

134. 133. The method of Claim 132, further comprising recovering said spatially barcoded first strand cDNA and amplifying said first strand cDNA to create a cDNA library.

135. 135. The method of Claim 134, wherein the spatially barcoded first strand cDNA is recovered by contacting the spatially barcoded first strand cDNA on the substrate with a DNA polymerase and one or more primers to generate a spatially barcoded second strand cDNA that is complementary to the spatially barcoded first strand cDNA, and removing the spatially barcoded second strand cDNA from the substrate.

136. 136. The method of claim 135, wherein each of the one or more primers comprises a random priming sequence.

137. 137. The method of claim 136, wherein the random priming sequence comprises nine random nucleotides.

138. 138. The method of claim 136 or 137, wherein each of the spatially barcoded second strand cDNAs comprises a unique molecular identifier (UMI), the UMI comprising an endogenous sequence and an exogenous sequence, the exogenous sequence being complementary to the random priming sequence used to generate the second strand cDNA, and the endogenous sequence being complementary to the first strand cDNA template sequence used to generate the second strand cDNA.

139. 136. The method of Claim 135, wherein each of the one or more primers comprises a molecular identifier barcode.

140. 136. The method of claim 135, wherein each of the one or more primers comprises a UMI barcode.

141. 141. The method of any one of claims 135-140, wherein the spatially barcoded second strand cDNA is removed from the substrate by chemical or physical dehybridization.

142. 136. The method of Claim 135, wherein the capture oligonucleotide comprises an anchor sequence comprising a cleavage site that anchors the capture oligonucleotide to the substrate, and wherein the spatially barcoded first and second strand cDNA hybrids are removed from the substrate by enzymatic cleavage at the cleavage site.

143. 143. The method of claim 142, wherein the cleavage site is a binding site for a restriction endonuclease.

144. 144. The method of any one of claims 134-143, further comprising sequencing at least a portion of said cDNA library to determine said spatial barcode sequence of each molecule.

145. 145. The method of Claim 144, further comprising determining the spatial locations of one or more cDNA molecules by correlating the spatial barcode sequences of said one or more cDNA molecules with the spatial locations of said surface oligonucleotide molecules on the substrate containing corresponding spatial barcode sequences.

146. 146. The method of any one of claims 49 to 145, wherein RNA expression in a single cell within said tissue is determined.

147. 147. The method of any one of claims 49 to 146, wherein RNA expression in subcellular components within a single cell is determined.

148. 148. The method of claim 147, wherein the intracellular component is a nucleus, a mitochondrion, a ribosome, or a cytoplasm.

149. 149. The method of any one of claims 49 to 148, wherein the substrate or the surface of the substrate comprises a material selected from glass, silicon, poly-L-lysine coated material, nitrocellulose, polystyrene, cyclic olefin copolymer (COC), cyclic olefin polymer (COP), polyacrylamide, polypropylene, polyethylene, or polycarbonate.

150. A kit comprising: a) a solid substrate comprising a capture oligonucleotide immobilized thereon, wherein the capture oligonucleotide comprises a capture nucleotide sequence, a spatial barcode sequence (SBC), and an adapter sequence; b) a template switch oligonucleotide (TSO) encoding a reverse transcriptase (RT) and a first adapter sequence; and c) a splint adapter, said splint adapter comprising: i) a single-stranded splint sequence comprising a random base sequence (NX) with a blocking group at the 5' end of the NX sequence; and ii) a double-stranded first adaptor sequence comprising a hybridized first adaptor sequence and a sequence complementary to a first adaptor sequence, wherein, optionally, the hybridized first adaptor sequence and the sequence complementary to the first adaptor sequence comprise blocking groups at the 5' end of the first adaptor and at the 3' end of the complement to the first adaptor sequence; Includes a splint adapter Includes a kit.

151. 1. A method for preparing an immobilized library of target nucleic acids from a biological sample, comprising: (a) providing a surface comprising a plurality of capture oligonucleotides immobilized thereon, wherein one or more of the plurality of capture oligonucleotides are oriented 5' to 3' as follows: (i) a first clustered primer sequence; (ii) spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) capture nucleotide sequence preparing, including; (b) contacting the biological sample with the surface, wherein said contacting causes the target nucleic acids of the biological sample to hybridize to the capture nucleotide sequences of the plurality of capture oligonucleotides to form hybridized capture oligonucleotides; (c) extending the capture nucleotide sequence of the hybridized capture oligonucleotide to form a first complementary strand of the target nucleic acid, wherein the extending is performed in the presence of an extension terminating moiety, and the extension terminating moiety is allyl-T or deoxyuridine triphosphate (dUTP); thereby preparing said immobilized library of target nucleic acids; A method comprising:

152. (d) contacting the surface with an exonuclease; (e) hybridizing a plurality of oligonucleotide primers to the first complementary strand, each of the plurality of oligonucleotide primers 5' to 3': (i) an adapter nucleotide sequence; and (ii) random nucleotide sequences and hybridizing the hybridized protein; (f) extending the plurality of oligonucleotide primers, thereby generating one or more second complementary strands containing the adapter nucleotide sequences at their termini; 152. The method of claim 151, further comprising:

153. (g) removing the one or more second complementary strands from the surface and amplifying the one or more second complementary strands.

153. The method of claim 152, further comprising:

154. 154. The method of claim 153, wherein step (g) is performed in the presence of an exclusion amplification (ExAmp) mixture, wherein said ExAmp mixture comprises primers that include said clustered primer sequences.

155. 152. The method of claim 151, wherein one or more of the plurality of capture oligonucleotides is immobilized on the surface via a cleavage site.

156. 156. The method of claim 155, wherein the cleavage site is an enzyme cleavage site.

157. 157. The method of claim 156, wherein the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof.

158. 156. The method of claim 155, wherein the cleavage site is a chemical cleavage site.

159. 159. The method of any one of claims 155 to 158, wherein the cleavage site is cleaved after step (c).

160. 153. The method of claim 152, wherein one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site.

161. 161. The method of claim 160, wherein the cleavage site is an enzyme cleavage site.

162. 162. The method of claim 161, wherein the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof.

163. 161. The method of claim 160, wherein the cleavage site is a chemical cleavage site.

164. 164. The method of any one of claims 160 to 163, wherein the cleavage site is cleaved after step (f).

165. 165. The method of any one of claims 151-164, wherein the extension terminating moiety is deoxyuridine triphosphate (dUTP) and the method further comprises contacting the surface with uracil-DNA glycosylase (UDG).

166. 165. The method of any one of claims 151-164, wherein the extension terminating portion is allyl-T, and the method further comprises contacting the surface with a universal cleavage mixture (UCM).

167. 165. The method of any one of claims 152-164, wherein the extension terminating moiety is deoxyuridine triphosphate (dUTP), and the method further comprises contacting the surface with uracil-DNA glycosylase (UDG).

168. 165. The method of any one of claims 152-164, wherein the extension terminating portion is allyl-T, and the method further comprises contacting the surface with a universal cleavage mixture (UCM) prior to step (e).

169. 1. A method for preparing an immobilized library of target nucleic acids from a biological sample, comprising: (a) providing a surface comprising a plurality of capture oligonucleotides immobilized thereon, wherein one or more of the plurality of capture oligonucleotides are oriented 5' to 3' as follows: (i) a first clustered primer sequence; (ii) spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) capture nucleotide sequence preparing, including; (b) contacting the biological sample with the surface, wherein said contacting causes the target nucleic acids of the biological sample to hybridize to the capture nucleotide sequences of the plurality of capture oligonucleotides to form hybridized capture oligonucleotides; (c) extending the capture nucleotide sequence of the hybridized capture oligonucleotide to form a first complementary strand of the target nucleic acid, wherein the extending is performed in the presence of an extension terminating moiety, and the extension terminating moiety is a dideoxynucleoside triphosphate (ddNTP); thereby preparing said immobilized library of target nucleic acids; A method comprising:

170. (d) contacting the surface with an exonuclease; (e) hybridizing a plurality of oligonucleotide primers to the first complementary strand, each of the plurality of oligonucleotide primers 5' to 3': (i) an adapter nucleotide sequence; and (ii) random nucleotide sequences and hybridizing the hybridized protein; (f) extending the plurality of oligonucleotide primers, thereby generating one or more second complementary strands containing the adapter nucleotide sequences at their termini; 170. The method of claim 169, further comprising:

171. (g) removing the one or more second complementary strands from the surface and amplifying the one or more second complementary strands.

171. The method of claim 170, further comprising:

172. 172. The method of claim 171, wherein step (g) is performed in the presence of an exclusion amplification (ExAmp) mixture, wherein said ExAmp mixture comprises primers comprising said first clustered primer sequence.

173. 170. The method of claim 169, wherein one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site.

174. 174. The method of claim 173, wherein the cleavage site is an enzyme cleavage site.

175. 175. The method of claim 174, wherein the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof.

176. 174. The method of claim 173, wherein the cleavage site is a chemical cleavage site.

177. 177. The method of any one of claims 173 to 176, wherein the cleavage site is cleaved after step (c).

178. 171. The method of claim 170, wherein one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site.

179. 179. The method of claim 178, wherein the cleavage site is an enzyme cleavage site.

180. 180. The method of claim 179, wherein the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof.

181. 179. The method of claim 178, wherein the cleavage site is a chemical cleavage site.

182. 182. The method of any one of claims 178 to 181, wherein the cleavage site is cleaved after step (f).

183. 183. The method of any one of claims 169 to 182, wherein the ddNTP comprises a first click chemistry handle.

184. 184. The method of claim 183, further comprising, after step (c), contacting the surface with an adapter oligonucleotide comprising a second click chemistry handle capable of crosslinking to the first click chemistry handle, thereby ligating the adapter oligonucleotide to the first complementary strand.

185. 185. The method of claim 184, wherein the adapter oligonucleotide further comprises a second sequencing primer sequence.

186. 186. The method of claim 184 or claim 185, wherein the first click chemistry handle is an azide, a tetrazine, a strained alkene, or an alkyne.

187. 187. The method of any one of claims 184 to 186, wherein the second click chemistry handle is an azide, a tetrazine, a strained alkene, or an alkyne.

188. 1. A method for preparing an immobilized library of target nucleic acids from a biological sample, comprising: (a) providing a surface comprising a plurality of capture oligonucleotides immobilized thereon, wherein one or more of the plurality of capture oligonucleotides are oriented 5' to 3' as follows: (i) a first clustered primer sequence; (ii) spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) capture nucleotide sequence preparing, including; (b) contacting the biological sample with the surface, wherein said contacting causes the target nucleic acids of the biological sample to hybridize to the capture nucleotide sequences of the plurality of capture oligonucleotides to form hybridized capture oligonucleotides; (c) extending the capture nucleotide sequence of the hybridized capture oligonucleotide to form a first complementary strand of the target nucleic acid, wherein the extending is performed in the presence of an extension terminating moiety, and the extension terminating moiety is a deoxynucleoside triphosphate (dNTP) including a 3' phosphate; thereby preparing said immobilized library of target nucleic acids; A method comprising:

189. (d) contacting the surface with an exonuclease; (e) contacting the surface with a ligase enzyme, thereby ligating an adapter oligonucleotide to the first complementary strand, wherein the adapter oligonucleotide is 5' to 3': (i) an adapter nucleotide sequence; and (ii) random nucleotide sequences ligating the ligated fragments together, further comprising: and the adapter oligonucleotide further comprises a second oligonucleotide that hybridizes to the adapter nucleotide sequence.

190. 190. The method of claim 189, wherein the adapter nucleotide sequence comprises a second sequencing primer sequence.

191. 190. The method of claim 189, wherein said ligation occurs via splint ligation of said adapter oligonucleotide to said first complementary strand.

192. 192. The method of any one of claims 189 to 191, wherein the ligase enzyme is T4 DNA ligase.

193. (f) extending the adaptor oligonucleotide, thereby generating one or more second complementary strands.

193. The method of any one of claims 189 to 192, further comprising:

194. (d) contacting the surface with an exonuclease; (e) contacting the surface with a ligase enzyme, thereby ligating an adapter oligonucleotide to the first complementary strand, wherein the adapter oligonucleotide is 5' to 3': (i) a random nucleotide sequence; and (ii) adapter nucleotide sequence ligating the ligated fragments together, 189. The method of claim 188, further comprising:

195. 195. The method of claim 194, wherein the adapter nucleotide sequence comprises a second sequencing primer sequence.

196. 196. The method of claim 194 or claim 195, wherein the ligation occurs via single-stranded DNA ligation to the first complementary strand of the adaptor oligonucleotide.

197. 197. The method of any one of claims 194 to 196, wherein the ligase enzyme is a DNA / RNA ligase.

198. (f) extending the adaptor oligonucleotide, thereby generating one or more second complementary strands.

198. The method of any one of claims 194 to 197, further comprising:

199. (g) removing the one or more second complementary strands from the surface and amplifying the one or more second complementary strands.

199. The method of claim 193 or claim 198, further comprising:

200. 200. The method of claim 199, wherein step (g) is performed in the presence of an exclusion amplification (ExAmp) mixture.

201. 189. The method of claim 188, wherein one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site.

202. 202. The method of claim 201, wherein the cleavage site is an enzyme cleavage site.

203. 203. The method of claim 202, wherein the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof.

204. 202. The method of claim 201, wherein the cleavage site is a chemical cleavage site.

205. The method of any one of claims 201 to 204, wherein the cleavage site is cleaved after step (c).

206. 195. The method of claim 189 or claim 194, wherein one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site.

207. 207. The method of claim 206, wherein the cleavage site is an enzyme cleavage site.

208. 208. The method of claim 207, wherein the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof.

209. 207. The method of claim 206, wherein the cleavage site is a chemical cleavage site.

210. The method of any one of claims 206 to 209, wherein the cleavage site is cleaved after step (e).

211. 1. A method for preparing an immobilized library of target nucleic acids from a biological sample, comprising: (a) providing a surface comprising a plurality of capture oligonucleotides immobilized thereon, wherein one or more of the plurality of capture oligonucleotides are oriented 5' to 3' as follows: (i) a first clustered primer sequence; (ii) spatial barcode (SBC) sequence; (iii) a first sequencing primer sequence; and (iv) capture nucleotide sequence and preparing the (b) contacting the biological sample with the surface, wherein said contacting causes the target nucleic acids of the biological sample to hybridize to the capture nucleotide sequences of the plurality of capture oligonucleotides to form hybridized capture oligonucleotides; (c) extending the capture nucleotide sequence of the hybridized capture oligonucleotide to form a first complementary strand of the target nucleic acid, wherein the extending is performed in the presence of an extension terminating moiety, and the extension terminating moiety is a deoxynucleoside triphosphate (dNTP) comprising a 3' phosphate or a dideoxynucleoside triphosphate (ddNTP) comprising a first click chemistry handle; thereby preparing said immobilized library of target nucleic acids; A method comprising:

212. 212. The method of claim 211, wherein the extension terminating portion is a deoxynucleoside triphosphate (dNTP) containing a 3' phosphate.

213. (d) chemically ligating an adapter oligonucleotide to the first complementary strand via a bridging group, wherein the adapter oligonucleotide is 5' to 3': (i) an adapter nucleotide sequence; and (ii) random nucleotide sequences ligating the ligated fragments together, further comprising:

213. The method of claim 211 or claim 212, wherein the adapter oligonucleotide further comprises a second oligonucleotide that hybridizes to the adapter nucleotide sequence.

214. 214. The method of claim 213, wherein the adapter nucleotide sequence comprises a second sequencing primer sequence.

215. 214. The method of claim 213, wherein the crosslinking groups are carboxyl-amine reactive groups, BCN-azide reactive groups, DBCO-azide reactive groups, tetrazine-TCO reactive groups, or combinations thereof.

216. 212. The method of claim 211, wherein the extension-terminating moiety is a dideoxynucleoside triphosphate (ddNTP) comprising the first click chemistry handle.

217. (d) ligating an adaptor oligonucleotide to the first complementary strand via click chemistry, wherein the adaptor oligonucleotide is 5' to 3': (i) an adapter nucleotide sequence; and (ii) random nucleotide sequences ligating the ligated fragments together, further comprising:

217. The method of claim 211 or claim 216, wherein the adapter oligonucleotide further comprises a second oligonucleotide that hybridizes to the sequencing primer sequence, the second oligonucleotide comprising a second click chemistry handle.

218. 218. The method of claim 217, wherein the adapter nucleotide sequence comprises a second sequencing primer sequence.

219. 218. The method of any one of claims 211, 215, or 217, wherein the first click chemistry handle is an azide, a tetrazine, a strained alkene, or an alkyne.

220. 220. The method of any one of claims 217 to 219, wherein the second click chemistry handle is an azide, a tetrazine, a strained alkene, or an alkyne.

221. (e) extending the adaptor oligonucleotide, thereby generating one or more second complementary strands.

221. The method of any one of claims 213 to 220, further comprising:

222. (f) removing the one or more second complementary strands from the surface and amplifying the one or more second complementary strands.

222. The method of claim 221, further comprising:

223. 223. The method of claim 222, wherein step (f) is performed in the presence of an exclusion amplification (ExAmp) mixture.

224. 212. The method of claim 211, wherein one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site.

225. 225. The method of claim 224, wherein the cleavage site is an enzyme cleavage site.

226. 226. The method of claim 225, wherein the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof.

227. 225. The method of claim 224, wherein the cleavage site is a chemical cleavage site.

228. 228. The method of any one of claims 224 to 227, wherein the cleavage site is cleaved after step (c).

229. 218. The method of claim 213 or claim 217, wherein one or more of the plurality of capture oligonucleotides are immobilized on the surface via a cleavage site.

230. 230. The method of claim 229, wherein the cleavage site is an enzyme cleavage site.

231. 231. The method of claim 230, wherein the enzyme cleavage site comprises a restriction enzyme site, uracil, 8-oxoguanine, or a combination thereof.

232. 230. The method of claim 229, wherein the cleavage site is a chemical cleavage site.

233. 233. The method of any one of claims 229 to 232, wherein the cleavage site is cleaved after step (d).

234. 234. The method of any one of claims 151 to 233, further comprising, after step (c), removing the target nucleic acid from the surface.

235. 235. The method of any one of claims 151 to 234, further comprising removing the biological sample from the surface after step (d).

236. 236. The method of any one of claims 151-235, wherein each of the plurality of capture oligonucleotides comprises the same capture nucleotide sequence.

237. 236. The method of any one of claims 151-235, wherein the plurality of capture oligonucleotides comprises a plurality of different capture nucleotide sequences.

238. 238. The method of claim 237, wherein the plurality of different capture nucleotide sequences comprises one or more gene-specific capture sequences, one or more universal capture sequences, or a combination thereof.

239. 238. The method of any one of claims 151 to 237, wherein the capture nucleotide sequence is a poly-T sequence, a poly-A sequence, a gene-specific capture sequence, or a universal capture sequence.

240. The method of claim 238 or claim 239, wherein the universal capture sequence is a random nucleotide sequence or a non-self-complementary semi-random sequence.

241. 241. The method of any one of claims 151-240, wherein the target nucleic acid is mRNA, gDNA, rRNA, tRNA, or a combination thereof.

242. 241. The method of any one of claims 151 to 240, wherein the target nucleic acid is RNA, mRNA, or a combination thereof.

243. 243. The method of any one of claims 151 to 242, wherein the extension of the captured nucleotide sequence in step (c) is carried out using a reverse transcriptase enzyme.

244. 244. The method of any one of claims 151 to 243, wherein the target nucleic acid is polyadenylated prior to hybridization of the target nucleic acid to the capture nucleotide sequence.

245. 95. The method of claim 94, wherein the target nucleic acid is polyadenylated using poly(A) polymerase.

246. 95. The method of claim 94, wherein the target nucleic acid is polyadenylated using chemical or enzymatic ligation.

247. 223. The method of any one of claims 153, 171, 199, or 222, wherein said amplifying comprises the addition of a second clustered primer sequence to said one or more second complementary strands.

248. 248. The method of claim 247, wherein said amplifying further comprises adding an index sequence.

249. 249. The method of claim 247 or claim 248, wherein said amplifying comprises index PCR, during which a first primer hybridizes to said first clustered primer sequence and a second primer hybridizes to said adapter nucleotide sequence, wherein said second primer comprises said second clustered primer sequence.

250. 250. The method of claim 249, wherein the second primer further comprises the index sequence.

251. 150. The method of any one of claims 49 to 149, wherein the first adapter primer comprises a molecular identifier (SMI) sequence.

252. 252. The method of claim 251, wherein the molecular identifier of the first adapter primer is incorporated during second strand cDNA synthesis.

253. The method of claim 251 or 252, wherein the SMI is a UMI.

Images