Retrotransposon compositions and methods of use
The engineered retrotransposase system addresses the underutilization of transposable elements in DNA manipulation by enabling precise nucleic acid modifications, leveraging high-sequence-identity retrotransposases for efficient gene editing and manipulation.
Patent Information
- Application Number
- JP2025531027
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-23
- Filing Date
- 2023-12-08
- Publication Date
- 2025-12-25
AI Technical Summary
Existing technologies have not fully exploited the potential of transposable elements for DNA manipulation and gene editing applications, despite their recognized importance in gene function and evolution.
An engineered retrotransposase system comprising a double-stranded nucleic acid with a cargo nucleotide sequence and a retrotransposase that can transpose the cargo sequence into a target nucleic acid, utilizing amino acid sequences with high sequence identity to specific SEQ IDs, and optionally including nuclear localization sequences and reverse transcriptase domains.
Enables precise modification of target nucleic acid sequences, including genomic DNA, viral DNA, and bacterial DNA, both in vitro and in vivo, using engineered nuclease systems and vectors like plasmids or adeno-associated viruses, facilitating advanced genetic manipulation.
Smart Images

Figure 2025542108000001_ABST
Abstract
Description
[Technical Field]
[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 386,867, filed December 9, 2022, U.S. Provisional Patent Application No. 63 / 489,156, filed March 8, 2023, and U.S. Provisional Patent Application No. 63 / 491,942, filed March 23, 2023, each of which is incorporated herein by reference in its entirety. [Background technology]
[0002] Transposable elements are mobile DNA sequences that play important roles in gene function and evolution. Transposable elements are found in almost all types of life, but their prevalence varies among organisms, and the majority of eukaryotic genomes encode transposable elements. Summary of the Invention
[0003] Although fundamental research on transposable elements was conducted in the 1940s, their potential utility in DNA manipulation and gene editing applications has only recently been recognized.
[0004] In certain embodiments, the present disclosure describes an engineered retrotransposase system comprising: (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase; and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 75% sequence identity to any one of SEQ ID NOS: 1-16 and 32-47. In some embodiments, the retrotransposase comprises an amino acid sequence having at least about 80% sequence identity to any one of SEQ ID NOS: 1-16 and 32-47. In some embodiments, the retrotransposase comprises an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOS: 1-16 and 32-47. In some embodiments, the retrotransposase comprises an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOS: 1-16 and 32-47. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least about 75% sequence identity to any one of SEQ ID NOs: 17-19, 24, and 76-817. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 95% sequence identity to any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase has less than 80% sequence identity to known retrotransposases. In some embodiments, the cargo nucleotide sequence is flanked by a 3' untranslated region (UTR) and a 5' untranslated region (UTR).In some embodiments, the retrotransposase is configured to transpose the cargo nucleotide sequence via a ribonucleic acid polynucleotide intermediate. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide. In some embodiments, the retrotransposase comprises one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the retrotransposase. In some embodiments, the NLS comprises a sequence at least 80% identical to a sequence from the group consisting of SEQ ID NOs: 49-64. In some embodiments, the NLS comprises SEQ ID NO: 50. In some embodiments, the NLS is proximal to the N-terminus of the retrotransposase. In some embodiments, the NLS comprises SEQ ID NO: 49. In some embodiments, the NLS is proximal to the C-terminus of the retrotransposase. In some embodiments, the retrotransposase is derived from an uncultured microorganism.
[0005] In certain embodiments, the present disclosure provides a polypeptide comprising a reverse transcriptase having an amino acid sequence having at least 75% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47, wherein the polypeptide is fused at the N-terminus or C-terminus to a non-retrotransposase domain or an affinity tag. In some embodiments, the non-retrotransposase domain is an RNA-binding protein domain. In some embodiments, the RNA-binding protein domain comprises a bacteriophage MS2 coat protein (MCP) domain.
[0006] The present disclosure describes, in certain embodiments, nucleic acids encoding the engineered retrotransposase systems described in this disclosure or the polypeptides described in this disclosure.
[0007] In certain embodiments, the present disclosure describes methods for modifying a target nucleic acid sequence, comprising contacting the target nucleic acid sequence with an engineered nuclease system described herein. In some embodiments, modifying the target nucleic acid sequence comprises binding, nicking, or cleaving the target nucleic acid sequence. In some embodiments, the target nucleic acid sequence comprises genomic DNA, viral DNA, viral RNA, or bacterial DNA. In some embodiments, the target nucleic acid sequence comprises deoxyribonucleic acid (DNA). In some embodiments, the modification is in vitro. In some embodiments, the modification is in vivo. In some embodiments, the modification is ex vivo.
[0008] In certain embodiments, the present disclosure describes a method for modifying a target nucleic acid sequence in a mammalian cell, comprising contacting the mammalian cell with an engineered nuclease system described herein.
[0009] In certain embodiments, the present disclosure describes a vector comprising the nucleic acid described herein. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV)-derived virion, or a lentivirus.
[0010] The present disclosure describes, in certain embodiments, cells comprising the engineered nuclease system or polypeptide described herein. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is an immortalized cell. In some embodiments, the cell is an insect cell. In some embodiments, the cell is a yeast cell. In some embodiments, the cell is a plant cell. In some embodiments, the cell is a fungal cell. In some embodiments, the cell is a prokaryotic cell. In some embodiments, the cell is A549, HEK-293, HEK-293T, BHK, CHO, HeLa, MRC5, Sf9, Cos-1, Cos-7, Vero, BSC 1, BSC 40, BMT 10, WI38, HeLa, Saos, C2C12, L cells, HT1080, HepG2, Huh7, K562, primary cells, or derivatives thereof. In some embodiments, the cells are engineered cells. In some embodiments, the cells are stable cells.
[0011] In some aspects, the present disclosure provides an engineered retrotransposase system comprising: (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence, wherein the cargo nucleotide sequence is configured to interact with a retrotransposase; and (b) a retrotransposase, wherein (i) the retrotransposase is configured to transpose the cargo nucleotide sequence to a target nucleic acid locus, and (ii) the retrotransposase is derived from an uncultured microorganism. In some embodiments, the retrotransposase comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOS: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a reverse transcriptase domain. In some embodiments, the retrotransposase further comprises one or more zinc finger domains. In some embodiments, the retrotransposase further comprises an endonuclease domain. In some embodiments, the retrotransposase has less than 80% sequence identity to known retrotransposases. In some embodiments, the cargo nucleotide sequence is flanked by a 3' untranslated region (UTR) and a 5' untranslated region (UTR). In some embodiments, the retrotransposase is configured to transpose the cargo nucleotide sequence via a ribonucleic acid polynucleotide intermediate. In some embodiments, the retrotransposase comprises one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the retrotransposase. In some embodiments, the NLS comprises a sequence that is at least 80% identical to a sequence from the group consisting of SEQ ID NOs: 49-64. In some embodiments, sequence identity is determined by BLASTP, CLUSTALW, MUSCLE, MAFFT, or CLUSTALW using the parameters of the Smith-Waterman homology search algorithm.In some embodiments, sequence identity is determined by the BLASTP homology search algorithm using the BLOSUM62 scoring matrix with word length (W) parameters of 3, expectation (E) parameters of 10, and gap costs set at 11 presence and 1 extension, and with a conditional composition score matrix adjustment.
[0012] In some aspects, the present disclosure provides an engineered retrotransposase system comprising: (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence, wherein the cargo nucleotide sequence is configured to interact with a retrotransposase; and (b) a retrotransposase, wherein (i) the retrotransposase is configured to transpose the cargo nucleotide sequence to a target nucleic acid locus, and (ii) the retrotransposase comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase is derived from an uncultured microorganism. In some embodiments, the retrotransposase comprises a reverse transcriptase domain. In some embodiments, the retrotransposase further comprises one or more zinc finger domains. In some embodiments, the retrotransposase further comprises an endonuclease domain. In some embodiments, the retrotransposase has less than 80% sequence identity to a known retrotransposase. In some embodiments, the cargo nucleotide sequence is flanked by a 3' untranslated region (UTR) and a 5' untranslated region (UTR). In some embodiments, the retrotransposase is configured to transpose the cargo nucleotide sequence via a ribonucleic acid polynucleotide intermediate. In some embodiments, sequence identity is determined by CLUSTALW using the parameters of BLASTP, CLUSTALW, MUSCLE, MAFFT, or Smith-Waterman homology search algorithms. In some embodiments, sequence identity is determined by the BLASTP homology search algorithm using a BLOSUM62 scoring matrix setting parameters of word length (W) of 3, expectation (E) of 10, and gap costs at 11 presence and 1 extension, with a conditional composition score matrix adjustment.
[0013] In some aspects, the present disclosure provides a deoxyribonucleic acid polynucleotide encoding the engineered retrotransposase system according to any one of the aspects or embodiments described in this disclosure.
[0014] In some aspects, the disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes a retrotransposase, wherein the retrotransposase is derived from an uncultivated microorganism, and wherein the organism is not an uncultivated microorganism. In some embodiments, the retrotransposase has at least 75% sequence identity to any one of SEQ ID NOS: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence encoding one or more nuclear localization sequences (NLSs) proximal to the N-terminus or C-terminus of the retrotransposase. In some embodiments, the NLS comprises a sequence selected from SEQ ID NOS: 49-64. In some embodiments, the NLS comprises SEQ ID NO: 50. In some embodiments, the NLS is proximal to the N-terminus of the retrotransposase. In some embodiments, the NLS comprises SEQ ID NO: 49. In some embodiments, the NLS is proximal to the C-terminus of the retrotransposase. In some embodiments, the organism is a prokaryote, bacterium, eukaryote, fungus, plant, mammal, rodent, or human.
[0015] In some aspects, the present disclosure provides a vector comprising the nucleic acid of any one of the aspects or embodiments described herein. In some embodiments, the method further comprises a nucleic acid encoding a cargo nucleotide sequence configured to form a complex with a retrotransposase. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV)-derived virion, or a lentivirus.
[0016] In some aspects, the present disclosure provides a cell comprising the vector of any one of any one of the aspects or embodiments described in this disclosure.
[0017] In some aspects, the present disclosure provides a method of producing a retrotransposase, comprising culturing a cell according to any of the aspects or embodiments described herein.
[0018] In some aspects, the disclosure provides methods for binding, nicking, cleaving, marking, modifying, or transposing a double-stranded deoxyribonucleic acid polynucleotide, the method comprising: (a) contacting the double-stranded deoxyribonucleic acid polynucleotide with a retrotransposase configured to transpose a cargo nucleotide sequence to a target nucleic acid locus; and (b) the retrotransposase comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase is derived from an uncultured microorganism. In some embodiments, the retrotransposase comprises a reverse transcriptase domain. In some embodiments, the retrotransposase further comprises one or more zinc finger domains. In some embodiments, the retrotransposase further comprises an endonuclease domain. In some embodiments, the retrotransposase has less than 80% sequence identity to known retrotransposases. In some embodiments, the cargo nucleotide sequence is flanked by a 3' untranslated region (UTR) and a 5' untranslated region (UTR). In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide is transferred via a ribonucleic acid polynucleotide intermediate. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
[0019] In some aspects, the present disclosure provides a method of modifying a target nucleic acid locus, the method comprising delivering to a target nucleic acid locus an engineered retrotransposase system of any one of the aspects or embodiments described herein, wherein the retrotransposase is configured to transpose a cargo nucleotide sequence to the target nucleic acid locus, and the complex is configured such that upon binding of the complex to the target nucleic acid locus, the complex modifies the target nucleic acid locus. In some embodiments, the target nucleic acid locus comprises binding, nicking, cleaving, marking, modifying, or transposing the target nucleic acid locus. In some embodiments, the target nucleic acid locus comprises deoxyribonucleic acid (DNA). In some embodiments, the target nucleic acid locus comprises genomic DNA, viral DNA, or bacterial DNA. In some embodiments, the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is in a cell. In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, a human cell, or a primary cell. In some embodiments, the cell is a primary cell. In some embodiments, the primary cell is a T cell. In some embodiments, the primary cell is a hematopoietic stem cell (HSC). In some embodiments, delivering the engineered retrotransposase system to the target nucleic acid locus comprises delivering a nucleic acid of any one of the aspects or embodiments described in this disclosure, or a vector of any one of the aspects or embodiments described in this disclosure. In some embodiments, delivering the engineered retrotransposase system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the retrotransposase. In some embodiments, the nucleic acid comprises a promoter to which an open reading frame encoding the retrotransposase is operably linked. In some embodiments, delivering the engineered retrotransposase system to the target nucleic acid locus comprises delivering a capped mRNA containing an open reading frame encoding the retrotransposase.In some embodiments, delivering the engineered retrotransposase system to the target nucleic acid locus comprises delivering a translated polypeptide, hi some embodiments, the retrotransposase does not induce cleavage at or proximal to the target nucleic acid locus.
[0020] In some aspects, the disclosure provides a host cell comprising an open reading frame encoding a heterologous retrotransposase having at least 75% sequence identity to any one of SEQ ID NOS: 1-16 and 32-47, or a variant thereof. In some embodiments, the host cell is an E. coli cell. In some embodiments, the E. coli cell is a λDE3 lysogen, or the E. coli cell is a BL21(DE3) strain. In some embodiments, the E. coli cell has an ompT lon genotype. In some embodiments, the open reading frame is encoded by a T7 promoter sequence, a T7-lac promoter sequence, a lac promoter sequence, a tac promoter sequence, a trc promoter sequence, a ParaBAD promoter sequence, a PrhaBAD promoter sequence, a T5 promoter sequence, a cspA promoter sequence, an araP promoter sequence, a T7-lac promoter sequence, a lac promoter sequence, a tac promoter sequence, a trc promoter sequence, a ParaBAD promoter sequence, a PrhaBAD promoter sequence, a T5 promoter sequence, a cspA promoter sequence, a araP promoter sequence, a T7-lac promoter sequence, a lac promoter sequence, a tac promoter sequence, a trc promoter sequence, a ParaBAD promoter sequence, a PrhaBAD promoter sequence, a T5 promoter sequence, a cspA promoter sequence, a araP promoter sequence, a araP promoter sequence, a rhaBAD ... BADIn some embodiments, the open reading frame is operably linked to a promoter, a strong leftward promoter from phage lambda (pL promoter), or any combination thereof. In some embodiments, the open reading frame comprises a sequence encoding an affinity tag linked in-frame to the sequence encoding the retrotransposase. In some embodiments, the affinity tag is an immobilized metal affinity chromatography (IMAC) tag. In some embodiments, the IMAC tag is a polyhistidine tag. In some embodiments, the affinity tag is a myc tag, a human influenza hemagglutinin (HA) tag, a maltose-binding protein (MBP) tag, a glutathione S-transferase (GST) tag, a streptavidin tag, a FLAG tag, or any combination thereof. In some embodiments, the affinity tag is linked in-frame to the sequence encoding the retrotransposase via a linker sequence encoding a protease cleavage site. In some embodiments, the protease cleavage site is a tobacco etch virus (TEV) protease cleavage site, a PreScission® protease cleavage site, a thrombin cleavage site, a factor Xa cleavage site, an enterokinase cleavage site, or any combination thereof. In some embodiments, the open reading frame is codon-optimized for expression in a host cell. In some embodiments, the open reading frame is provided on a vector. In some embodiments, the open reading frame is integrated into the genome of a host cell.
[0021] In some aspects, the present disclosure provides a culture comprising a host cell according to any one of the aspects or embodiments described in this disclosure in a suitable liquid medium.
[0022] In some aspects, the present disclosure provides a manufacturing method for producing a retrotransposase, comprising culturing the host cell of any one of the aspects or embodiments described herein in a suitable growth medium. In some embodiments, the method further comprises inducing expression of the retrotransposase by adding an additional chemical agent or an increased amount of a nutrient. In some embodiments, the additional chemical agent or increased amount of a nutrient comprises isopropyl β-D-1-thiogalactopyranoside (IPTG) or an additional amount of lactose. In some embodiments, the method further comprises isolating the host cells after culturing and lysing the host cells to produce a protein extract. In some embodiments, the method further comprises subjecting the protein extract to IMAC or ion affinity chromatography. In some embodiments, the open reading frame comprises a sequence encoding an IMAC affinity tag linked in-frame to the sequence encoding the retrotransposase. In some embodiments, the IMAC affinity tag is linked in-frame to the sequence encoding the retrotransposase via a linker sequence encoding a protease cleavage site. In some embodiments, the protease cleavage site comprises a tobacco etch virus (TEV) protease cleavage site, a PreScission® protease cleavage site, a thrombin cleavage site, a factor Xa cleavage site, an enterokinase cleavage site, or any combination thereof. In some embodiments, the method further comprises cleaving the IMAC affinity tag by contacting the retrotransposase with a protease corresponding to the protease cleavage site. In some embodiments, the method further comprises performing subtractive IMAC affinity chromatography to remove the affinity tag from the composition comprising the retrotransposase.
[0023] In some aspects, the present disclosure provides a method of disrupting a locus in a cell, the method comprising contacting the cell with a composition comprising: (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence, wherein the cargo nucleotide sequence is configured to interact with a retrotransposase; and (b) a retrotransposase, wherein (i) the retrotransposase is configured to transpose the cargo nucleotide sequence to a target nucleic acid locus, (ii) the retrotransposase comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOS: 1-16 and 32-47, and (iii) the retrotransposase has transposition activity at least equivalent to that of a demonstrated retrotransposase in the cell. In some embodiments, the transposition activity is measured in vitro by introducing the retrotransposase into a cell containing the target nucleic acid locus and detecting transposition of the target nucleic acid locus in the cell. In some embodiments, the composition comprises 20 pmoles or less of the retrotransposase. In some embodiments, the composition comprises 1 pmol or less of retrotransposase.
[0024] Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in the art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be realized, the present disclosure is capable of other and different embodiments, and its several details are capable of modifications in various obvious respects, all without departing from the present disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive. [Brief explanation of the drawings]
[0025] The novel features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings.
[0026] [Figure 1]Figure 1 shows the genomic context of bacterial retrotransposons. MG140-34 is a predicted retrotransposase (arrow) that encodes a reverse transcriptase domain. Regions flanking the retrotransposase display secondary structures that may represent binding sites for the retrotransposase (secondary structure box and zoomed image). [Figure 2] Figure 2 shows that microbial MG retrotransposases (black branch on clade 4) are more closely related to eukaryotes than viral retrotransposases (gray branch on clade 6). Clade 1: telomerase reverse transcriptases, class 2: group II intron reverse transcriptases, class 3: eukaryotic R1-type retrotransposases, clade 4: microbial and eukaryotic R2 retrotransposases, clade 5: eukaryotic retrovirus-associated reverse transcriptases, and class 6: viral reverse transcriptases. [Figure 3] Figure 3 shows clades 3 and 4 from the phylogenetic gene tree from (A). Some microbial MG retrotransposases contain multiple Zn finger motifs (vertical rectangles), a conserved RVT_1 reverse transcriptase domain, and an APE / RLE or other endonuclease domain (top and bottom panels). Some microbial MG retrotransposases lack the endonuclease domain (middle panel). [Figure 4] Figure 4 shows a phylogenetic tree inferred from multiple sequence alignments of reverse transcriptase domains from diverse enzymes. RT sequences are derived from DNA as well as RNA ensembles. A reference RT was included in the tree for classification purposes. [Figure 5A] Figure 5A shows a phylogenetic tree inferred from multiple sequence alignments of identified RT domains from the family of RTs (MG148). [Figure 5B] Figure 5B shows the genomic context of MG140-34-R2 RT. Predicted genes not associated with RT are shown as white arrows. [Figure 5C]Figure 5C shows a nucleotide sequence alignment of four members of the MG148 family (annotated arrow above the consensus sequence) showing the conserved region upstream of the RT (box below the sequence). [Figure 6] Figure 6 shows the in vitro activity screening of the RTns family of enzymes (MG148) by qPCR. Activity was detected by qPCR using primers that amplify full-length cDNA products derived from primer extension reactions containing each RT. Samples were derived from RT reactions containing 100 nM substrate. The negative control was template-free water in an in vitro transcription / translation system reaction. Positive control: Active candidates, defined as signals at least 10-fold higher than the R2Tg (Taeniopygia guttata) negative control, are marked in dark gray; inactive candidates under these conditions are marked in light gray. [Figure 7A] Figure 7A shows a phylogenetic tree inferred from multiple sequence alignments of full-length group II intron RTs identified from class C sequences. [Figure 7B] Figure 7B shows a summary table of the MG153 family of group II introns. AAI: average pairwise amino acid identity of MG family members to the reference group II intron sequence. [Figure 8A] Figures 8A and 8B show the in vitro activity screening of GII intron class C candidates MG153-22, MG153-23, and MG153-24 by primer extension assay. For Figure 8A, lane numbers correspond to the following: 1 - PURExpress (in vitro transcription / translation system) no template control, 2 - MMLV control RT, 3 - TGIRT-III control RT, 4 - Marathon RT control RT, and 5-7 correspond to candidates MG153-22-24. Bold numbering corresponds to the gel lanes with active candidates. Results are representative of two independent experiments. [Figure 8B]Figures 8A and 8B show the in vitro activity screening of GII intron class C candidates MG153-22, MG153-23, and MG153-24 by primer extension assay. Figure 8B shows the detection of full-length cDNA production by qPCR. Dark gray bars correspond to RTs that generate products at least 10-fold higher than background. Results were determined from two technical replicates. [Figure 9] Figure 9 shows a screen to assess the ability of the indicated control RT and GII intron class C candidates to synthesize cDNA in mammalian cells. Detection of a 542 bp PCR product with the MGD1000 Tape Station for MG153-23. Lanes not relevant to the described experiment are highlighted in black. [Figure 10-1] Figure 10 shows the genomic context of the MG160-7 retron-like single-domain RT. The region upstream of the RT (dotted box) folds into a secondary structure (insertion) that is conserved across MG160 members and may be required for activity and function. [Figure 10-2] Continued from Figure 10. [Figure 11A] Figures 11A and 11B show the in vitro activity screening of retron-like candidate MG160-7 by primer extension assay. Lane numbers in Figure 11A correspond to the following samples: 1 - PURExpress (in vitro transcription / translation system) no-template control, 2 - MMLV control RT, 3 - TGIRT-III control RT, 4: MG160-7. [Figure 11B] Figures 11A and 11B show the screening of retron-like candidate MG160-7 for in vitro activity by primer extension assay. Figure 11B shows quantification of full-length cDNA production by qPCR. Dark gray bars correspond to RTs that generate products at least 10-fold higher than background. Results were determined from two technical replicates. [Figure 12]Figure 12 shows the screening of the ability of MG153 GII-derived RT to synthesize cDNA in mammalian cells. Detection of a 542-bp cDNA synthesis PCR product was assayed by Taqman qPCR. cDNA activity was normalized to an active TGIRT control, with TGIRT representing a value of 1. The Y-axis is shown on a log 10 scale. [Figure 13A] Figures 13A and 13B show the protein expression of MG153 GII-derived RTs by immunoblotting. Figure 13A: Cells were transfected with plasmids containing candidate RTs, and protein expression was assessed by immunoblotting to detect the HA peptide fused to the N-terminus of the RT. All lanes were normalized to total protein concentration. Lanes not relevant to the experiment described in Figure 13A are marked with a black box. [Figure 13B] Figures 13A and 13B show the protein expression of MG153 GII-derived RTs by immunoblotting. Figure 13B: Table of predicted molecular sizes of the tested RTs. [Figure 14] Figure 14 shows the relative activity of MG153-23 GII-derived RT normalized to protein expression. cDNA synthesis was detected by Taqman qPCR, and protein expression was detected by immunoblot. Activity against TGIRT was normalized to total protein concentration. The Y-axis is shown on a linear scale. [Figure 15A] Figures 15A-C show a screen to assess the ability of the indicated control and candidate RTs to synthesize cDNA in mammalian cells. Figure 15A shows a schematic diagram illustrating the method used to detect cDNA synthesis in mammalian cells. The first (FAM) and last (HEX) 100 bp of a 4.1 kb RNA template are detected using Taqman-based qPCR. Taqman qPCR was used to detect the first (FAM probe) and last (HEX probe) 100 bp PCR products amplified from cDNA synthesized from RNA templates by the MG148 family of non-LTR retrotransposon-derived RTs (Figure 15B) and the retron-like MG160-7 (Figure 15C). [Figure 15B]Figures 15A-C show a screen to assess the ability of the indicated control and candidate RTs to synthesize cDNA in mammalian cells. Figure 15A shows a schematic diagram illustrating the method used to detect cDNA synthesis in mammalian cells. The first (FAM) and last (HEX) 100 bp of a 4.1 kb RNA template are detected using Taqman-based qPCR. Taqman qPCR was used to detect the first (FAM probe) and last (HEX probe) 100 bp PCR products amplified from cDNA synthesized from RNA templates by the MG148 family of non-LTR retrotransposon-derived RTs (Figure 15B) and the retron-like MG160-7 (Figure 15C). [Figure 15C] Figures 15A-C show a screen to assess the ability of the indicated control and candidate RTs to synthesize cDNA in mammalian cells. Figure 15A shows a schematic diagram illustrating the method used to detect cDNA synthesis in mammalian cells. The first (FAM) and last (HEX) 100 bp of a 4.1 kb RNA template are detected using Taqman-based qPCR. Taqman qPCR was used to detect the first (FAM probe) and last (HEX probe) 100 bp PCR products amplified from cDNA synthesized from RNA templates by the MG148 family of non-LTR retrotransposon-derived RTs (Figure 15B) and the retron-like MG160-7 (Figure 15C).
[0027] Brief description of the sequence listing The Sequence Listing submitted herein provides exemplary polynucleotide and polypeptide sequences for use in the methods, compositions, and systems according to the present disclosure. Below are exemplary descriptions of the sequences therein.
[0028] MG140 SEQ ID NOs: 1 to 16 show the full-length peptide sequences of the MG140 translocating protein.
[0029] MG148 SEQ ID NOs: 32 to 41 show the full-length peptide sequences of the MG148 reverse transcriptase protein.
[0030] SEQ ID NOs: 25 to 31 show the nucleotide sequences of genes encoding HA-His-tagged MG148 reverse transcriptase proteins.
[0031] SEQ ID NOs: 76 to 80 show the nucleotide sequences of genes encoding MG148 reverse transcriptase proteins optimized for expression in mammalian cells.
[0032] MG153 SEQ ID NOs: 42 to 44 show the full-length peptide sequences of the MG153 reverse transcriptase protein.
[0033] SEQ ID NOs: 17 to 19 show the nucleotide sequences of the E. coli codon-optimized gene encoding the MG153 reverse transcriptase protein.
[0034] SEQ ID NOs: 20 to 23 show the nucleotide sequences of the genes encoding the strep-tagged MG153 reverse transcriptase proteins.
[0035] MG160 SEQ ID NOs: 45 to 47 show the full-length peptide sequences of the MG160 reverse transcriptase protein.
[0036] SEQ ID NO: 24 shows the nucleotide sequence of the E. coli codon-optimized gene encoding the MG160 reverse transcriptase protein.
[0037] SEQ ID NO: 48 shows the nucleotide sequence of the gene encoding the MG160 reverse transcriptase protein optimized for expression in mammalian cells and cloned into the tethered spCas9(H840A) plasmid.
[0038] SEQ ID NO: 81 shows the nucleotide sequence of the gene encoding the MG160 reverse transcriptase protein optimized for expression in mammalian cells.
[0039] Other arrays SEQ ID NOs: 66 to 69 show the nucleotide sequences of the primers.
[0040] SEQ ID NOs: 70-71 show the nucleotide sequences of Taqman probes for qPCR.
[0041] SEQ ID NO: 65 shows the nucleotide sequence of the RNA template for cDNA synthesis.
[0042] SEQ ID NOs: 72 to 75 show the nucleotide sequences of genes encoding control reverse transcriptase proteins optimized for expression in mammalian cells. DETAILED DESCRIPTION OF THE INVENTION
[0043] While various embodiments of the present disclosure have been shown and described in this disclosure, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments of the present disclosure described herein may be employed.
[0044] The practice of some of the methods disclosed in this disclosure employs, unless otherwise indicated, immunological, biochemical, chemical, molecular biology, microbiology, cell biology, genomics, and recombinant DNA techniques.
[0045] As used in this disclosure, the singular forms "a," "an," and "the" ("one") are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent the terms "including," "includes," "having," "has," "with," or variants thereof, are used in either the detailed description or the claims, such terms are intended to be inclusive in a manner similar to the term "comprising."
[0046] The term "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within one or more standard deviations, as is customary in the art. Alternatively, "about" can mean within a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 1% of a given value.
[0047] As used herein, the term "nucleotide" refers to a base-sugar-phosphate combination. Contemplated nucleotides include naturally occurring and synthetic nucleotides. Nucleotides are monomeric units of nucleic acid sequences (e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)). The term nucleotide includes ribonucleoside triphosphates adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP), and deoxyribonucleoside triphosphates, such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives include, for example, [αS]dATP, 7-deaza-dGTP, and 7-deaza-dATP, as well as nucleotide derivatives that confer nuclease resistance to nucleic acid molecules containing them. As used herein, the term nucleotide encompasses dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives. Illustrative examples of ddNTP include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP.Nucleotide can be unlabeled, or can be detectably labeled, for example, by using an optically detectable moiety (e.g., fluorophore) or a moiety containing quantum dot.Detectable labels include, for example, radioisotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels, and enzyme labels. Fluorescent labels for nucleotides include, but are not limited to, fluorescein, 5-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'dimethylaminophenylazo)benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red, cyanine, and 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS).Specific examples of fluorescently labeled nucleotides include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP available from Perkin Elmer (Foster City, Calif.); FluoroLink DeoxyNucleotides, FluoroLink Cy3-dCTP, FluoroLink Cy5-dCTP, FluoroLink Fluor X-dCTP, FluoroLink Cy3-dUTP, and FluoroLink Cy5-dUTP available from Amersham (Arlington Heights, Illinois); Fluorescein-15-dATP, fluorescein-12-dUTP, tetramethyl-rhodamine-6-dUTP, IR770-9-dATP, fluorescein-12-ddUTP, fluorescein-12-UTP, and fluorescein-15-2'-dATP available from Mannheim (Indianapolis, IN), and Molecular Examples of chromosomal labeled nucleotides available from Probes (Eugene, Oregon) include BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cascade Blue-7-UTP, Cascade Blue-7-dUTP, Fluorescein-12-UTP, Fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine Green-5-UTP, Rhodamine Green-5-dUTP, Tetramethylrhodamine-6-UTP, Tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP, and Texas Red-12-dUTP. The term nucleotide encompasses chemically modified nucleotides. An exemplary chemically modified nucleotide is biotin-dNTP.Non-limiting examples of biotinylated dNTPs include biotin-dATP (e.g., bio-N6-ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP), and biotin-dUTP (e.g., biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP).
[0048] The terms "polynucleotide," "oligonucleotide," and "nucleic acid" are used interchangeably to refer to polymeric forms of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof, in either single-, double-, or multiple-stranded form. Contemplated polynucleotides include genes or fragments thereof. Exemplary polynucleotides include, but are not limited to, DNA, RNA, coding or non-coding regions of genes or gene fragments, multiple loci (single loci) defined from binding analyses, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, cell-free polynucleotides, including cell-free DNA (cfDNA) and cell-free RNA (cfRNA), nucleic acid probes, and primers. When referring to T, in polynucleotides, T refers to U (uracil) in RNA and T (thymine) in DNA. Polynucleotides can be exogenous or endogenous to a cell and / or can exist in a cell-free environment. The term polynucleotide encompasses modified polynucleotides (e.g., modified backbones, sugars, or nucleobases). If present, modifications to the nucleotide structure are imparted before or after assembly of the polymer. Non-limiting examples of modifications include 5-bromouracil, peptide nucleic acids, heterologous nucleic acids, morpholinos, locked nucleic acids, glycol nucleic acids, threose nucleic acids, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g., rhodamine or fluorescein attached to the sugar), thiol-containing nucleotides, biotin-conjugated nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, queosine, and wyosine. The sequence of nucleotides can be interrupted by non-nucleotide components.
[0049] The term "transfection" or "transfected" refers to the introduction of a nucleic acid into a cell by non-viral or viral-based methods. The nucleic acid molecule can be a gene sequence that encodes a complete protein or a functional portion thereof.
[0050] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein to refer to a polymer of at least two amino acid residues joined by a peptide bond. The term does not denote a specific length of the polymer, and is not intended to imply or distinguish whether the peptide is produced using recombinant technology, chemical or enzymatic synthesis, or naturally occurring. The term applies to naturally occurring amino acid polymers as well as amino acid polymers containing at least one modified amino acid. In some cases, the polymer is interrupted by non-amino acids. The term includes amino acid chains of any length, including full-length proteins and proteins with or without secondary or tertiary structure (e.g., domains). The term also encompasses amino acid polymers that have been modified by, for example, disulfide bond formation, glycosylation, lipid formation, acetylation, phosphorylation, oxidation, and any other manipulation, such as conjugation with a labeling component. As used in this disclosure, the terms "amino acid" and "amino acids" refer to natural and unnatural amino acids, including, but not limited to, modified amino acids. Modified amino acids include amino acids that have been chemically modified to include a group or chemical moiety that does not occur naturally on the amino acid. The term "amino acid" includes both D- and L-amino acids.
[0051] As used in this disclosure, "non-naturally occurring" refers to a nucleic acid or polypeptide sequence that does not occur in nature. Non-naturally occurring refers to a nucleic acid or polypeptide sequence that does not occur in nature, including modifications such as mutations, insertions, or deletions. The term non-naturally occurring encompasses fusion nucleic acids or polypeptides in which the non-naturally occurring sequence encodes or exhibits an activity (e.g., an enzymatic activity, a methyltransferase activity, an acetyltransferase activity, a kinase activity, a ubiquitination activity, etc.) of the nucleic acid or polypeptide sequence to which it is fused. Non-naturally occurring nucleic acid or polypeptide sequences include those that are linked by genetic engineering to a naturally occurring nucleic acid or polypeptide sequence (or a variant thereof) to produce a chimeric nucleic acid or polypeptide sequence that encodes the chimeric nucleic acid or polypeptide.
[0052] As used in this disclosure, the term "promoter" refers to a regulatory DNA region that controls the transcription or expression of a polynucleotide (e.g., a gene) and may be located adjacent to or overlapping the nucleotide or region of nucleotide at which RNA transcription is initiated. A promoter may contain specific DNA sequences that bind protein factors, often referred to as transcription factors, that facilitate the binding of RNA polymerase to DNA, resulting in gene transcription. Basal promoters in eukaryotes typically, but not necessarily, contain a TATA-box and / or a CAAT box.
[0053] The term "expression," as used in this disclosure, refers to the process by which a nucleic acid sequence or polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcript) and / or the process by which a transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. The transcript and the encoded polypeptide may be collectively referred to as a "gene product." If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
[0054] As used in this disclosure, "operably linked," "operable linkage," "operatively linked," or their grammatical equivalents refer to the arrangement of genetic elements, e.g., promoters, enhancers, polyadenylation sequences, etc., such that operation (e.g., movement or activation) of a first genetic element has some effect on a second genetic element. The effect on the second genetic element can be, but need not be, of the same type as operation of the first genetic element. For example, two genetic elements are operably linked if movement of the first element causes activation of the second element. A regulatory element, which may include, for example, a promoter and / or enhancer sequence, is operably linked to a coding region if the regulatory element helps to initiate transcription of the coding sequence. There can be intervening residues between the regulatory element and the coding region so long as this functional relationship is maintained.
[0055] As used in this disclosure, "vector" refers to a polymer or association of polymers that contains or is associated with a polynucleotide and mediates delivery of the polynucleotide to a cell. Examples of vectors include nucleic acid-based vectors (e.g., plasmids and viral vectors) and liposomes. Exemplary nucleic acid-based vectors generally include genetic elements, e.g., regulatory elements, operably linked to a gene to promote expression of the gene in the target.
[0056] As used in this disclosure, "expression cassette" and "nucleic acid cassette" are used interchangeably to refer to a component of a vector that contains a combination of nucleic acid sequences or elements (e.g., therapeutic gene, promoter, and terminator) that are expressed together or operably linked for expression. The term encompasses expression cassettes that contain a combination of one or more genes with regulatory elements operably linked for expression.
[0057] A "functional fragment" of a DNA or protein sequence refers to a fragment that retains a biological activity (either functional or structural) substantially similar to that of the full-length DNA or protein sequence. The biological activity of a DNA sequence includes the ability to affect expression in a manner attributable to the full-length sequence.
[0058] The terms "engineered," "synthetic," and "artificial" are used interchangeably herein to refer to entities modified by human intervention. For example, the terms refer to polynucleotides or polypeptides that do not occur in nature. Engineered peptides may, but need not, have low sequence identity (e.g., less than 50% sequence identity, less than 25% sequence identity, less than 10% sequence identity, less than 5% sequence identity, less than 1% sequence identity) to naturally occurring human proteins. For example, the VPR domain and the VP64 domain are synthetic transactivation domains. Non-limiting examples include: nucleic acids that are modified by changing their sequence to one that does not occur in nature; nucleic acids that are modified by ligating to a nucleic acid with which they are not naturally associated such that the ligated product possesses a function not present in the original nucleic acid; engineered nucleic acids that are synthesized in vitro using a sequence that does not occur in nature; proteins that are modified by changing their amino acid sequence to a sequence that does not occur in nature; and engineered proteins that acquire new functions or properties. An "engineered" system contains at least one engineered component.
[0059] As used in this disclosure, the term "transposable element" refers to a DNA sequence that can move from one location to another within a genome (i.e., they can "transpose"). Transposable elements can be broadly divided into two classes: Class I transposable elements, or "retrotransposons," are transposed via transcription and translation of an RNA intermediate and then reintegrate into the genome at their new location via reverse transcription (a process mediated by reverse transcriptase). Class II transposable elements, or "DNA transposons," are transposed via a complex of single- or double-stranded DNA flanked on both sides by transposase.
[0060] As used in this disclosure, the term "retrotransposon" refers to a class I transposable element that functions according to a bipartite "copy-and-paste" mechanism involving an RNA intermediate. "Retrotransposase" refers to an enzyme involved in the transposition of retrotransposons. Retrotransposases can contain a reverse transcriptase domain, one or more zinc finger domains, an endonuclease domain, or a combination thereof.
[0061] As used in this disclosure, the terms "gene editing" and "genome editing" can be used interchangeably. Gene editing or genome editing refers to changing the nucleic acid sequence of a gene or genome. Genome editing can include, for example, insertion, deletion, and mutation. Genome editing can be performed by a gene editing system, for example, a retrotransposase.
[0062] As used in this disclosure, the term "complex" refers to the joining of at least two components. Each of the two components may retain the properties / activities it had prior to forming the complex or may acquire properties as a result of forming the complex. Joining may be by, but is not limited to, covalent bonding, non-covalent bonding (i.e., hydrogen bonding, ionic interactions, van der Waals interactions, and hydrophobic bonding), use of a linker, fusion, or any other suitable method. Contemplated components of the complex include polynucleotides, polypeptides, or combinations thereof. For example, the complex may include an endonuclease and a guide polynucleotide.
[0063] The term "sequence identity" or "percent identity" in the context of two or more nucleic acid or polypeptide sequences refers to two (e.g., in a pairwise alignment) or more (e.g., in a multiple sequence alignment) sequences that are identical or have a specified percentage of identical amino acid residues or nucleotides when compared and aligned for maximum correspondence over a local or global comparison window, as measured using a sequence comparison algorithm. Suitable sequence comparison algorithms for polypeptide sequences include, for example, BLASTP using the BLOSUM62 scoring matrix setting parameters of word length (W) of 3, expectation (E) of 10, and presence of 11, gap cost at extension of 1, and using a conditional composition score matrix adjustment for polypeptide sequences longer than 30 residues; BLASTP using parameters of word length (W) of 2, expectation (E) of 1,000,000, and PAM30 scoring setting gap costs at 9 for open gaps and 1 for extended gaps for sequences shorter than 30 residues (these are the default parameters for BLASTP in the BLAST suite available at https: / / blast.ncbi.nlm.nih.gov); CLUSTALW using Smith-Waterman homology search algorithm parameters of 2 matches, -1 mismatches, and -1 gaps; MUSCLE using default parameters; MAFFT using parameters of retries of 2 and maximum repeats of 1,000; Novafold using default parameters; and HMMER hmmalign using default parameters.
[0064] In the context of two or more nucleic acid or polypeptide sequences, the term "optimally aligned" refers to two (e.g., in a pairwise alignment) or more (e.g., in a multiple sequence alignment) sequences aligned for maximum amino acid residue or nucleotide correspondence, as determined, for example, by the alignment producing the highest or "optimized" percent identity score.
[0065] The term "open reading frame" or "ORF" refers to a nucleotide sequence that can encode a protein or a portion of a protein. An open reading frame can begin with a start codon (e.g., represented in standard codes as AUG for RNA molecules and ATG for DNA molecules) and can be read with codon triplets until the frame ends with a stop codon (e.g., represented in standard codes as UAA, UGA, or UAG for RNA molecules and TAA, TGA, or TAG for DNA molecules).
[0066] Variants of any of the enzymes described herein having one or more conservative amino acid substitutions are included in the present disclosure. Such conservative substitutions can be made in the amino acid sequence of a polypeptide without disrupting the three-dimensional structure or function of the polypeptide. Conservative substitutions can be achieved by substituting amino acids with similar hydrophobicity, polarity, and R chain length for each other. Additionally or alternatively, by comparing aligned sequences of homologous proteins from different species, conservative substitutions can be identified by finding amino acid residues (e.g., non-conserved residues) that vary between species without changing the basic function of the encoded protein. Such conservatively substituted variants may include variants having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of the retrotransposase protein sequences described herein (e.g., a retrotransposase of the MG140, MG148, MG153, or MG160 family described herein, or a retrotransposase of any other family described herein). In some embodiments, such conservatively substituted variants are functional variants. Such functional variants can include sequences with substitutions of one or more critical active site residues of the retrotransposase such that the activity is not disrupted. In some embodiments, a functional variant of any of the proteins described herein lacks substitution of at least one conserved or functional residue. In some embodiments, a functional variant of any of the proteins described herein lacks substitution of all conserved or functional residues.
[0067] The disclosure also includes variants (e.g., reduced activity variants) of any of the enzymes described herein that have substitutions of one or more catalytic residues to reduce or eliminate the activity of the enzyme. In some embodiments, reduced activity variants of the proteins described herein include at least one, at least two, or all three catalytic residues.
[0068] Conservative substitution tables providing functionally similar amino acids are available in various references (see, for example, Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman & Co.; 2nd edition (December 1993)). The following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) Cysteine (C), Methionine (M)
[0069] overview The discovery of new transposable elements with unique functionality and structure could further disrupt deoxyribonucleic acid (DNA) editing technologies, offering the potential to improve their speed, specificity, functionality, and ease of use. Compared to the predicted prevalence of transposable elements in microorganisms and indeed in diverse microbial species, there are relatively few functionally characterized transposable elements in the literature. This is, in part, because the vast number of microbial species may not be easily cultivated under laboratory conditions. Metagenomic sequencing from natural environmental niches containing large numbers of microbial species could dramatically increase the number of known new transposable elements, offering the potential to expedite the discovery of novel oligonucleotide editing functions.
[0070] Transposable elements are deoxyribonucleic acid sequences that can change location within a genome, often resulting in the generation or improvement of mutations. In eukaryotes, a large portion of the genome and a large portion of the mass of cellular DNA are attributable to transposable elements. Although transposable elements are "selfish genes" that propagate themselves at the expense of other genes, they perform a variety of important functions and have been found to be important in genome evolution. Based on their mechanism, transposable elements are classified as either class I "retrotransposons" or class II "DNA transposons."
[0071] Class I transposable elements, also known as retrotransposons, function according to a two-part "copy-and-paste" mechanism involving an RNA intermediate. First, the retrotransposon is transcribed. The resulting RNA is then converted back into DNA by a reverse transcriptase (generally encoded by the retrotransposon itself), and the reverse-transcribed retrotransposon is integrated into its new location within the genome by an integrase. Retrotransposons are further classified into three lineages. Long terminal repeat ("LTR") retrotransposons encode reverse transcriptase and are flanked by long stretches of repetitive DNA. Long interspersed nucleotide sequences ("LINE") retrotransposons encode reverse transcriptase, lack LTRs, and are transcribed by RNA polymerase II. Short interspersed nucleotide sequences ("SINE") retrotransposons are transcribed by RNA polymerase III but lack reverse transcriptase and instead rely on the reverse transcription machinery of other transposable elements (e.g., LINEs).
[0072] Class II transposable elements, also known as DNA transposons, function according to a mechanism that does not involve an RNA intermediate. Many DNA transposons exhibit a "cut-and-paste" mechanism, in which a transposase binds to terminal inverted repeats ("TIRs") flanking the transposon, cleaves the transposon from the donor region, and inserts it into the target region of the genome. Others, called "helitrons," involve a single-stranded DNA intermediate and exhibit a "rolling circle" mechanism mediated by an undocumented protein thought to possess HUH endonuclease function and 5' to 3' helicase activity. First, a circular strand of DNA is nicked to create two single DNA strands. The protein remains attached to the 5' phosphate of the nicked strand, leaving the 3' hydroxyl end of the complementary strand exposed, thus allowing polymerase to replicate the unnicked strand. Once replication is complete, the new strand dissociates and replicates itself alongside the original template strand. Yet another DNA transposon, "Pollinton," is theorized to undergo a "self-synthesizing" mechanism. Transposition is initiated by integrase excision of single-stranded extrachromosomal Pollinator elements, which form racket-like structures. Pollinator elements undergo replication by DNA polymerase B, and double-stranded Pollinator elements are inserted into the genome by integrase. In addition, some DNA transposons, such as those of the IS200 / IS605 family, proceed via a "peel and paste" mechanism in which TnpA excises a piece of single-stranded DNA (as a circular "transposon junction") from the lagging-strand template of a donor gene and reinserts it into the replication fork of the target gene.
[0073] Transposable elements have found some use as biological tools, but the demonstrated transposable elements do not encompass the full range of possible biodiversity and targeting possibilities, and may not represent all possible activities. Here, we extracted thousands of genome fragments from multiple metagenomes for transposable elements. The diversity of demonstrated transposable elements may be expanded, and novel systems may be developed into highly targetable, compact, and precise gene editing agents.
[0074] MG enzyme In certain embodiments, the present disclosure describes retrotransposases. In some embodiments, the retrotransposase is MG140, MG148, MG153, or MG160 retrotransposase (FIG. 1). In some embodiments, these retrotransposases are less than about 1,400 amino acids in length. In some embodiments, these retrotransposases simplify delivery and expand therapeutic applications.
[0075] In some embodiments, the present disclosure provides engineered retrotransposase systems discovered through metagenomic sequencing. In some embodiments, metagenomic sequencing is performed using samples. In some embodiments, the samples are collected from various environments. In some embodiments, such environments are human microbiomes, animal microbiomes, hot environments, and cold environments. In some embodiments, the environments include sediments.
[0076] In some embodiments, the present disclosure provides an engineered retrotransposase system comprising a retrotransposase derived from an uncultured microorganism. In some embodiments, the retrotransposase is configured to bind to a 3' untranslated region (UTR). In some embodiments, the retrotransposase binds to a 5' untranslated region (UTR).
[0077] In some embodiments, the retrotransposase comprises a sequence having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence having at least about 70% identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence having at least about 75% identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence having at least about 80% identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence having at least about 85% identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence having at least about 90% identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence having at least about 95% identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence having at least about 96% identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence having at least about 97% identity to any one of SEQ ID NOs: 1-16 and 32-47.In some embodiments, the retrotransposase comprises a sequence having at least about 98% identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence having at least about 99% identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the retrotransposase comprises a sequence having 100% identity to any one of SEQ ID NOs: 1-16 and 32-47.
[0078] In some embodiments, the retrotransposase is an MG140 retrotransposase (i.e., SEQ ID NOS: 1-16). In some embodiments, the retrotransposase comprises a sequence having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOS: 1-16. In some embodiments, the retrotransposase comprises a sequence having at least about 70% identity to any one of SEQ ID NOS: 1-16. In some embodiments, the retrotransposase comprises a sequence having at least about 75% identity to any one of SEQ ID NOs: 1-16. In some embodiments, the retrotransposase comprises a sequence having at least about 80% identity to any one of SEQ ID NOs: 1-16. In some embodiments, the retrotransposase comprises a sequence having at least about 85% identity to any one of SEQ ID NOs: 1-16. In some embodiments, the retrotransposase comprises a sequence having at least about 90% identity to any one of SEQ ID NOs: 1-16. In some embodiments, the retrotransposase comprises a sequence having at least about 95% identity to any one of SEQ ID NOs: 1-16. In some embodiments, the retrotransposase comprises a sequence having at least about 96% identity to any one of SEQ ID NOs: 1-16. In some embodiments, the retrotransposase comprises a sequence having at least about 97% identity to any one of SEQ ID NOs: 1-16. In some embodiments, the retrotransposase comprises a sequence having at least about 98% identity to any one of SEQ ID NOs: 1-16.In some embodiments, the retrotransposase comprises a sequence having at least about 99% identity to any one of SEQ ID NOs: 1-16. In some embodiments, the retrotransposase comprises a sequence having 100% identity to any one of SEQ ID NOs: 1-16.
[0079] In some embodiments, the retrotransposase is MG148 retrotransposase (i.e., SEQ ID NOS: 32-41). In some embodiments, the retrotransposase comprises a sequence having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOS: 32-41. In some embodiments, the retrotransposase comprises a sequence having at least about 70% identity to any one of SEQ ID NOS: 32-41. In some embodiments, the retrotransposase comprises a sequence having at least about 75% identity to any one of SEQ ID NOs: 32-41. In some embodiments, the retrotransposase comprises a sequence having at least about 80% identity to any one of SEQ ID NOs: 32-41. In some embodiments, the retrotransposase comprises a sequence having at least about 85% identity to any one of SEQ ID NOs: 32-41. In some embodiments, the retrotransposase comprises a sequence having at least about 90% identity to any one of SEQ ID NOs: 32-41. In some embodiments, the retrotransposase comprises a sequence having at least about 95% identity to any one of SEQ ID NOs: 32-41. In some embodiments, the retrotransposase comprises a sequence having at least about 96% identity to any one of SEQ ID NOs: 32-41. In some embodiments, the retrotransposase comprises a sequence having at least about 97% identity to any one of SEQ ID NOs: 32-41. In some embodiments, the retrotransposase comprises a sequence having at least about 98% identity to any one of SEQ ID NOs: 32-41.In some embodiments, the retrotransposase comprises a sequence having at least about 99% identity to any one of SEQ ID NOs: 32-41. In some embodiments, the retrotransposase comprises a sequence having 100% identity to any one of SEQ ID NOs: 32-41.
[0080] In some embodiments, the retrotransposase is MG153 retrotransposase (i.e., SEQ ID NOS: 42-44). In some embodiments, the retrotransposase comprises a sequence having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOS: 42-44. In some embodiments, the retrotransposase comprises a sequence having at least about 70% identity to any one of SEQ ID NOS: 42-44. In some embodiments, the retrotransposase comprises a sequence having at least about 75% identity to any one of SEQ ID NOs: 42-44. In some embodiments, the retrotransposase comprises a sequence having at least about 80% identity to any one of SEQ ID NOs: 42-44. In some embodiments, the retrotransposase comprises a sequence having at least about 85% identity to any one of SEQ ID NOs: 42-44. In some embodiments, the retrotransposase comprises a sequence having at least about 90% identity to any one of SEQ ID NOs: 42-44. In some embodiments, the retrotransposase comprises a sequence having at least about 95% identity to any one of SEQ ID NOs: 42-44. In some embodiments, the retrotransposase comprises a sequence having at least about 96% identity to any one of SEQ ID NOs: 42-44. In some embodiments, the retrotransposase comprises a sequence having at least about 97% identity to any one of SEQ ID NOs: 42-44. In some embodiments, the retrotransposase comprises a sequence having at least about 98% identity to any one of SEQ ID NOs: 42-44.In some embodiments, the retrotransposase comprises a sequence having at least about 99% identity to any one of SEQ ID NOs: 42-44. In some embodiments, the retrotransposase comprises a sequence having 100% identity to any one of SEQ ID NOs: 42-44.
[0081] In some embodiments, the retrotransposase is MG160 retrotransposase (i.e., SEQ ID NOS: 45-47). In some embodiments, the retrotransposase comprises a sequence having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOS: 45-47. In some embodiments, the retrotransposase comprises a sequence having at least about 70% identity to any one of SEQ ID NOS: 45-47. In some embodiments, the retrotransposase comprises a sequence having at least about 75% identity to any one of SEQ ID NOs: 45-47. In some embodiments, the retrotransposase comprises a sequence having at least about 80% identity to any one of SEQ ID NOs: 45-47. In some embodiments, the retrotransposase comprises a sequence having at least about 85% identity to any one of SEQ ID NOs: 45-47. In some embodiments, the retrotransposase comprises a sequence having at least about 90% identity to any one of SEQ ID NOs: 45-47. In some embodiments, the retrotransposase comprises a sequence having at least about 95% identity to any one of SEQ ID NOs: 45-47. In some embodiments, the retrotransposase comprises a sequence having at least about 96% identity to any one of SEQ ID NOs: 45-47. In some embodiments, the retrotransposase comprises a sequence having at least about 97% identity to any one of SEQ ID NOs: 45-47.In some embodiments, the retrotransposase comprises a sequence having at least about 98% identity to any one of SEQ ID NOs: 45-47. In some embodiments, the retrotransposase comprises a sequence having at least about 99% identity to any one of SEQ ID NOs: 45-47. In some embodiments, the retrotransposase comprises a sequence having 100% identity to any one of SEQ ID NOs: 45-47.
[0082] In some embodiments, the retrotransposase is encoded by a codon-optimized nucleic acid sequence. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence that is codon-optimized for expression in mammalian cells. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 70% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 75% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 80% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 85% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81.In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 96% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 97% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 98% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 99% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81. In some embodiments, the retrotransposase is encoded by the nucleic acid sequence of any one of SEQ ID NOs: 17-19, 24, and 76-81.
[0083] In some embodiments, the retrotransposase is tagged with a tag, such as a His tag or a strep tag, or is tethered to an enzyme (e.g., spCas9). In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOs:20-23, 25-31, and 48. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 70% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 75% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 80% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 85% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 90% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48.In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 96% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 97% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 98% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48. In some embodiments, the retrotransposase is encoded by a nucleic acid sequence having at least 99% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48. In some embodiments, the retrotransposase is encoded by the nucleic acid sequence of any one of SEQ ID NOs: 20-23, 25-31, and 48.
[0084] In some embodiments, the retrotransposase comprises a reverse transcriptase domain. In some embodiments, the retrotransposase further comprises one or more zinc finger domains. In some embodiments, the retrotransposase further comprises an endonuclease finger domain.
[0085] In some embodiments, the retrotransposase has less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, or less than about 5% sequence identity to known or described retrotransposases.
[0086] In some embodiments, the cargo nucleotide sequence is flanked by a 3' untranslated region (UTR) and a 5' untranslated region (UTR).
[0087] In some embodiments, the retrotransposase may comprise one or more nuclear localization sequences (NLSs), which may be located proximal to the N-terminus or C-terminus of the retrotransposase. In some embodiments, an NLS is attached to the N-terminus or C-terminus of the retrotransposase and comprises any one of SEQ ID NOs: 49-64 or a sequence having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 80% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 85% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 90% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 91% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 92% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 93% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 94% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 95% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 96% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 97% identity to SEQ ID NOs: 49-64.In some cases, the NLS comprises a sequence having at least about 98% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having at least about 99% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having 100% identity to SEQ ID NOs: 49-64. In some cases, the NLS comprises a sequence having 100% identity to SEQ ID NO: 49. In some cases, the NLS comprises a sequence having 100% identity to SEQ ID NO: 50. [Table 1]
[0088] In some embodiments, the retrotransposase comprises a tag. In some embodiments, the tag is an affinity tag. Exemplary affinity tags include, but are not limited to, a His tag, a Flag tag, a Myc tag, a MBP tag, and a GST tag.
[0089] In some embodiments, the retrotransposase comprises a protease cleavage site. Exemplary protease cleavage sites include, but are not limited to, a TEV site, a C3 site, a factor Xa site, and an enterokinase site.
[0090] In some embodiments, the retrotransposase is tethered to a site-specific nuclease. In some embodiments, the retrotransposase is fused to a site-specific nuclease. In some embodiments, the retrotransposase is recruited to the site-specific nuclease. In some embodiments, the site-specific nuclease is an endonuclease. In some embodiments, the site-specific nuclease is a Cas nuclease. In some embodiments, the Cas nuclease is an RNA-guided CRISPR Cas9 nuclease. In some embodiments, the Cas nuclease is a dead nuclease or a nickase. In some embodiments, the site-specific nuclease brings the retrotransposase in proximity to the target site to be modified.
[0091] Guide nucleic acid In some embodiments, the retrotransposase system further comprises a site-specific nuclease and a guide RNA (e.g., gRNA). When referring to T, in polynucleotides, T means U (uracil) in RNA and T (thymine) in DNA. In some embodiments, the retrotransposase system described in the present disclosure comprises a means for directing the site-specific nuclease to a specific position in the target nucleic acid.
[0092] In some embodiments, the guide RNA comprises synthetic or modified nucleotides. In some embodiments, the guide RNA comprises one or more internucleoside linkers modified from natural phosphodiester. In some embodiments, the internucleoside linker of the guide RNA, or all of its contiguous nucleotide sequence, is modified. For example, in some embodiments, the internucleoside linkage comprises sulfur (S), such as a phosphorothioate internucleoside linkage.
[0093] In some embodiments, the guide RNA comprises a modification to the ribose sugar or nucleobase. In some embodiments, the guide RNA comprises one or more nucleosides comprising a modified sugar moiety, where the modified sugar moiety is a modification of the sugar moiety compared to the ribose sugar moiety found in deoxyribose nucleic acids (DNA) and RNA. In some embodiments, the modification is within the ribose ring structure. Exemplary modifications include, but are not limited to, replacement with a hexose ring (HNA), a bicyclic ring having a biradical bridge between the C2 and C4 carbons on the ribose ring (e.g., locked nucleic acids (LNA)), or an unlinked ribose ring that typically lacks a bond between the C2 and C3 carbons (e.g., UNA). In some embodiments, the sugar-modified nucleoside comprises a bicyclohexose nucleic acid or a tricyclic nucleic acid. In some embodiments, the modified nucleoside comprises a nucleoside in which the sugar moiety is replaced with a non-sugar moiety, such as a peptide nucleic acid (PNA) or morpholino nucleic acid.
[0094] In some embodiments, the guide RNA comprises one or more modified sugars. In some embodiments, sugar modifications include modifications made by changing the substituent on the ribose ring to a group other than hydrogen or to the 2'-OH group naturally found in DNA and RNA nucleosides. In some embodiments, the substituent is introduced at the 2', 3', 4', or 5' position, or a combination thereof. In some embodiments, nucleosides having modified sugar moieties include 2'-modified nucleosides, e.g., 2'-substituted nucleosides. 2'-sugar-modified nucleosides, in some embodiments, are nucleosides having a substituent other than -H or -OH at the 2' position (2'-substituted nucleosides) or include a 2'-linked biradical, and include 2'-substituted nucleosides and LNA (2'-4' biradical bridged) nucleosides. Examples of 2'-substituted modified nucleosides include, but are not limited to, 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, the modification in the ribose group comprises a modification at the 2' position of the ribose group. In some embodiments, the modification at the 2' position of the ribose group is selected from the group consisting of 2'-O-methyl, 2'-fluoro, 2'-deoxy, and 2'-O-(2-methoxyethyl).
[0095] In some embodiments, the guide RNA comprises one or more modified sugars. In some embodiments, the guide RNA comprises only modified sugars. In certain embodiments, the guide RNA comprises more than about 10%, 25%, 50%, 75%, or 90% modified sugars. In some embodiments, the modified sugar is a bicyclic sugar. In some embodiments, the modified sugar comprises a 2'-O-methoxyethyl group. In some embodiments, the guide RNA comprises both an internucleoside linker modification and a nucleoside modification.
[0096] In some cases, the guide RNA comprises a sequence complementary to a eukaryotic, fungal, plant, mammalian, or human genomic polynucleotide sequence. In some cases, the guide RNA comprises a sequence complementary to a eukaryotic genomic polynucleotide sequence. In some cases, the guide RNA comprises a sequence complementary to a fungal genomic polynucleotide sequence. In some cases, the guide RNA comprises a sequence complementary to a plant genomic polynucleotide sequence. In some cases, the guide RNA comprises a sequence complementary to a mammalian genomic polynucleotide sequence. In some cases, the guide RNA comprises a sequence complementary to a human genomic polynucleotide sequence.
[0097] In some cases, the guide RNA is 30-400 nucleotides in length. In some cases, the guide RNA is 85-245 nucleotides in length. In some cases, the guide RNA is more than 90 nucleotides in length. In some cases, the guide RNA is less than 245 nucleotides in length. In some embodiments, the guide RNA is 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, or more than 240 nucleotides in length. In some embodiments, the guide RNAs are about 30 to about 40, about 30 to about 50, about 30 to about 60, about 30 to about 70, about 30 to about 80, about 30 to about 90, about 30 to about 100, about 30 to about 120, about 30 to about 140, about 30 to about 160, about 30 to about 180, about 30 to about 200, about 30 to about 220, about 30 to about 240, about 50 to about 60, about 50 to about 70, about 50 to about 80, about 50 to about 90, about 50 to about 100, about 50 The length is about 120, about 50 to about 140, about 50 to about 160, about 50 to about 180, about 50 to about 200, about 50 to about 220, about 50 to about 240, about 100 to about 120, about 100 to about 140, about 100 to about 160, about 100 to about 180, about 100 to about 200, about 100 to about 220, about 100 to about 240, about 160 to about 180, about 160 to about 200, about 160 to about 220, or about 160 to about 240 nucleotides.
[0098] In some embodiments, sequences are identified by the BLASTP, CLUSTALW, MUSCLE, or MAFFT algorithms, or the CLUSTALW algorithm using Smith-Waterman homology search algorithm parameters. In some embodiments, sequences are identified by the BLASTP homology search algorithm using parameters of word length (W) of 3, expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at 11 presence and 1 extension, and using a conditional composition score matrix adjustment.
[0099] Cargo Nucleic Acid In some embodiments, the retrotransposase system comprises a cargo nucleic acid or polynucleotide. In some embodiments, the cargo nucleic acid is comprised in a double-stranded deoxyribonucleic acid. In some embodiments, the cargo nucleic acid is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide. In some embodiments, the cargo nucleotide sequence is flanked by a 3' untranslated region (UTR) and a 5' untranslated region (UTR).
[0100] In some embodiments, the cargo nucleic acid comprises synthetic or modified nucleotides. In some embodiments, the cargo nucleic acid comprises one or more internucleoside linkers modified from natural phosphodiester. In some embodiments, the cargo nucleic acid has modified internucleoside linkers, or all of its contiguous nucleotide sequence. For example, in some embodiments, the internucleoside linkages comprise sulfur (S), such as phosphorothioate internucleoside linkages.
[0101] In some embodiments, the cargo nucleic acid comprises a modification to the ribose sugar or nucleobase. In some embodiments, the cargo nucleic acid comprises one or more nucleosides comprising a modified sugar moiety, which is a modification of the sugar moiety compared to the ribose sugar moiety found in deoxyribose nucleic acids (DNA) and RNA. In some embodiments, the modification is within the ribose ring structure. Exemplary modifications include, but are not limited to, replacement with a hexose ring (HNA), a bicyclic ring having a biradical bridge between the C2 and C4 carbons on the ribose ring (e.g., locked nucleic acids (LNA)), or an unlinked ribose ring that typically lacks a bond between the C2 and C3 carbons (e.g., UNA). In some embodiments, the sugar-modified nucleoside comprises a bicyclohexose nucleic acid or a tricyclic nucleic acid. In some embodiments, the modified nucleoside comprises a nucleoside in which the sugar moiety is replaced with a non-sugar moiety, such as a peptide nucleic acid (PNA) or morpholino nucleic acid.
[0102] In some embodiments, the cargo nucleic acid comprises one or more modified sugars. In some embodiments, sugar modifications include modifications made by changing the substituent on the ribose ring to a group other than hydrogen or to the 2'-OH group naturally found in DNA and RNA nucleosides. In some embodiments, the substituent is introduced at the 2', 3', 4', 5' position, or a combination thereof. In some embodiments, nucleosides having modified sugar moieties include 2'-modified nucleosides, e.g., 2'-substituted nucleosides. 2'-sugar-modified nucleosides, in some embodiments, are nucleosides having a substituent other than -H or -OH at the 2' position (2'-substituted nucleosides) or include a 2'-linked biradical, and include 2'-substituted nucleosides and LNA (2'-4' biradical bridged) nucleosides. Examples of 2'-substituted modified nucleosides include, but are not limited to, 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, the modification in the ribose group comprises a modification at the 2' position of the ribose group. In some embodiments, the modification at the 2' position of the ribose group is selected from the group consisting of 2'-O-methyl, 2'-fluoro, 2'-deoxy, and 2'-O-(2-methoxyethyl).
[0103] In some embodiments, the cargo nucleic acid comprises one or more modified sugars. In some embodiments, the cargo nucleic acid comprises only modified sugars. In certain embodiments, the cargo nucleic acid comprises more than about 10%, 25%, 50%, 75%, or 90% modified sugars. In some embodiments, the modified sugar is a bicyclic sugar. In some embodiments, the modified sugar comprises a 2'-O-methoxyethyl group. In some embodiments, the cargo nucleic acid comprises both an internucleoside linker modification and a nucleoside modification.
[0104] MG series In certain embodiments, the present disclosure describes an engineered retrotransposase system that includes (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase, and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence. In some embodiments, the engineered retrotransposase system described in the present disclosure comprises a means for cleaving the target nucleic acid sequence.
[0105] In some embodiments, an engineered retrotransposase system comprises (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase, and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 70% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, an engineered retrotransposase system comprises (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase, and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 75% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, an engineered retrotransposase system comprises (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase, and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, an engineered retrotransposase system comprises (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase, and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 85% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the engineered retrotransposase system comprises: (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase; and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47.In some embodiments, an engineered retrotransposase system comprises (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase, and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 95% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, an engineered retrotransposase system comprises (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase, and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 96% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, an engineered retrotransposase system comprises (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase, and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 97% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, an engineered retrotransposase system comprises (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase, and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 98% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47. In some embodiments, the engineered retrotransposase system comprises: (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase; and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 99% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47.In some embodiments, the engineered retrotransposase system comprises (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase, and (b) a retrotransposase configured to transpose the cargo nucleotide sequence into a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having 100% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47.
[0106] cell In certain embodiments, the present disclosure describes cells comprising the systems described herein.
[0107] In some embodiments, the cell is a eukaryotic cell (e.g., a plant cell, an animal cell, a protist cell, or a fungal cell), a mammalian cell (Chinese hamster ovary (CHO) cell, baby hamster kidney (BHK), human embryonic kidney (HEK), mouse myeloma (NS0), or human retinal cell), an immortalized cell (e.g., a HeLa cell, a COS cell, a HEK-293T cell, an MDCK cell, a 3T3 cell, a PC12 cell, a Huh7 cell, a HepG2 cell, a K562 cell, an N2a cell, or a SY5Y cell), an insect cell (e.g., a Spodoptera frugiperda cell, a Trichoplusia ni cell, a Drosophila melanogaster cell, an S2 cell, or a Heliothis virescens cell), a yeast cell (e.g., a Saccharomyces In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is an immortalized cell. In some embodiments, the cell is an insect cell. In some embodiments, the cell is a yeast cell. In some embodiments, the cell is a plant cell. In some embodiments, the cell is a fungal cell. In some embodiments, the cell is a prokaryotic cell.
[0108] In some embodiments, the cells are A549, HEK-293, HEK-293T, BHK, CHO, HeLa, MRC5, Sf9, Cos-1, Cos-7, Vero, BSC 1, BSC 40, BMT 10, WI38, HeLa, Saos, C2C12, L cells, HT1080, HepG2, Huh7, K562, primary cells, or derivatives thereof. In some embodiments, the cells are engineered cells. In some embodiments, the cells are stable cells (i.e., cells with constant expression of a particular gene or protein).
[0109] Delivery and Vectors The present disclosure, in some embodiments, discloses nucleic acid sequences that encode the engineered retrotransposase systems described herein.
[0110] In some embodiments, the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence encoding a retrotransposase described herein. In some embodiments, the engineered nucleic acid sequence encoding the retrotransposase is optimized for expression in an organism. In some embodiments, the retrotransposase is derived from an uncultured microorganism. In some embodiments, the organism is not an uncultured organism.
[0111] In some embodiments, the organism is a prokaryote. In some embodiments, the organism is a bacterium. In some embodiments, the organism is a eukaryote. In some embodiments, the organism is a fungus. In some embodiments, the organism is a plant. In some embodiments, the organism is a mammal. In some embodiments, the organism is a rodent. In some embodiments, the organism is a human.
[0112] In some embodiments, the nucleic acid encoding the engineered retrotransposase system is DNA, e.g., linear DNA, plasmid DNA, or minicircle DNA. In some embodiments, the nucleic acid encoding the engineered nuclease system is RNA, e.g., mRNA.
[0113] In some embodiments, the nucleic acid encoding the engineered retrotransposase system is delivered by a nucleic acid-based vector. In some embodiments, the nucleic acid-based vector is a plasmid (e.g., a circular DNA molecule that can replicate autonomously inside a cell), a cosmid (e.g., a pWE or sCos vector), an artificial chromosome, a human artificial chromosome (HAC), a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), a P1-derived artificial chromosome (PAC), a phagemid, a phage derivative, a bacmid, or a virus. In some embodiments, the vector is pSF-CMV-NEO-NH2-PPT-3XFLAG, pSF-CMV-NEO-COOH-3XFLAG, pSF-CMV-PURO-NH2-GST-TEV, pSF-OXB20-COOH-TEV-FLAG(R)-6His, pCEP4 pDEST27, pSF-CMV-Ub-KrYFP, pSF-CMV-FMDV-daGFP, pEF1a-mCherry-N1 vector, pEF1a-tdTomato vector, pSF-CMV-FMDV-Hygro, pSF-CMV-PGK-Puro, pMCP-tag(m), pSF-CMV-PURO-NH2-CMYC, pSF-OXB20-BetaGal, pSF-OXB20-Fluc, pSF-OXB20, pSF-Tac, pRI 101-AN DNA, pCambia2301, pTYB21pKLAC2, pAc5.1 / V5-His A, and pDEST8.
[0114] In some embodiments, the virus is an alphavirus, parvovirus, adenovirus, AAV, baculovirus, dengue virus, lentivirus, herpesvirus, poxvirus, anellovirus, bocavirus, vaccinia virus, or retrovirus. In some embodiments, the virus is an alphavirus. In some embodiments, the virus is a parvovirus. In some embodiments, the virus is an adenovirus. In some embodiments, the virus is an AAV. In some embodiments, the virus is a baculovirus. In some embodiments, the virus is a dengue virus. In some embodiments, the virus is a lentivirus. In some embodiments, the virus is a herpesvirus. In some embodiments, the virus is a poxvirus. In some embodiments, the virus is anellovirus. In some embodiments, the virus is a bocavirus. In some embodiments, the virus is a vaccinia virus. In some embodiments, the virus is a retrovirus.
[0115] In some embodiments, the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-rh8, AAV-rh 10, AAV-rh20, AAV-rh39, AAV-rh74, AAV-rhM4-1, AAV-hu37, AAV-Anc80, AAV-Anc80L65, AAV-7m8, AAV-PHP-B, AAV-PHP-EB, AAV-2.5, AAV-2tYF, In some embodiments, the herpesvirus is AAV-3B, AAV-LK03, AAV-HSC1, AAV-HSC2, AAV-HSC3, AAV-HSC4, AAV-HSC5, AAV-HSC6, AAV-HSC7, AAV-HSC8, AAV-HSC9, AAV-HSC10, AAV-HSC11, AAV-HSC12, AAV-HSC13, AAV-HSC14, AAV-HSC15, AAV-TT, AAV-DJ / 8, AAV-Myo, AAV-NP40, AAV-NP59, AAV-NP22, AAV-NP66, AAV-HSC16, or a derivative thereof. In some embodiments, the herpesvirus is HSV-1, HSV-2, VZV, EBV, CMV, HHV-6, HHV-7, or HHV-8.
[0116] In some embodiments, the nucleic acid encoding the engineered retrotransposase system is delivered by a non-nucleic acid-based delivery system (e.g., a non-viral delivery system). In some embodiments, the non-viral delivery system is a liposome. In some embodiments, the nucleic acid is associated with a lipid. The lipid-associated nucleic acid is, in some embodiments, encapsulated within the aqueous interior of the liposome, interspersed within the lipid bilayer of the liposome, attached to the liposome via a linking molecule associated with both the liposome and the nucleic acid, entrapped in the liposome, complexed with the liposome, dispersed in a solution containing lipids, mixed with lipids, combined with lipids, contained as a suspension in lipids, contained in or complexed with micelles, or otherwise associated with a lipid. In some embodiments, the nucleic acid is contained in a lipid nanoparticle (LNP).
[0117] In some embodiments, the endonuclease or gene editing system (e.g., retrotransposase) is introduced into a cell (e.g., a host cell) by any suitable method, either stably or transiently. In some embodiments, the endonuclease or gene editing system is transfected into the cell. In some embodiments, the cell is transduced or transfected with a nucleic acid construct encoding the endonuclease or gene editing system. For example, the cell is transduced (e.g., with a virus encoding the endonuclease or gene editing system) or transfected (e.g., with a plasmid encoding the endonuclease or gene editing system) with a nucleic acid encoding the endonuclease or gene editing system. In some embodiments, the transduction is stable or transient transduction. In some embodiments, the cell expressing or containing the endonuclease or gene editing system is transduced or transfected with one or more gRNA molecules, for example, when the endonuclease or gene editing system comprises a retrotransposase. In some embodiments, a plasmid expressing an endonuclease or gene editing system is introduced into a cell through electroporation, transient (e.g., lipofection) or stable genomic integration (e.g., piggybac), or viral transduction (e.g., lentivirus or AAV), or other methods known to those of skill in the art. In some embodiments, the gene editing system is introduced into a cell as one or more polypeptides. In some embodiments, delivery is achieved through the use of an RNP complex. Methods for delivering polypeptides and / or RNPs into cells, for example, by electroporation or by cell squeezing, are known in the art.
[0118] Exemplary methods for nucleic acid delivery include lipofection, nucleofection, electroporation, stable genome integration (e.g., piggyback), microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycations or lipid-nucleic acid conjugates, naked DNA, artificial virions, and drug-enhanced uptake of DNA. Lipofection is described, for example, in U.S. Pat. Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam™, Lipofectin™, and SF Cell Line 4D-Nucleofector X Kit™ (Lonza)). Cationic and neutral lipids suitable for efficient receptor-recognition lipofection of polynucleotides include the lipids of WO91 / 17424 and WO91 / 16024. In some embodiments, delivery is to a cell (e.g., in vitro or ex vivo administration) or a target tissue (e.g., in vivo administration). In some embodiments, the nucleic acid is contained in a liposome or nanoparticle that specifically targets the host cell.
[0119] Other methods for delivery of nucleic acids into cells are known to those of skill in the art, see, e.g., US2003 / 0087817.
[0120] How to use The disclosed system can be used for a variety of applications, such as nucleic acid editing (e.g., gene editing), binding to nucleic acid molecules (e.g., sequence-specific binding), etc. Such systems can be used, for example, to address (e.g., remove or replace) genetically inherited mutations that may cause disease in a subject, to inactivate genes to confirm their function in cells, as diagnostic tools to detect disease-causing genetic elements (e.g., via cleavage of reverse-transcribed viral RNA or amplified DNA sequences encoding disease-causing mutations), as inactivating enzymes combined with probes to target and detect specific nucleotide sequences (e.g., sequences encoding antibiotic resistance in bacteria), to inactivate viruses by targeting viral genomes or to prevent them from infecting host cells, to add genes or modify metabolic pathways to engineer organisms to produce valuable small molecules, macromolecules, or secondary metabolites, to establish gene drivers for evolutionary selection, and to detect cellular perturbations by exogenous small molecules and nucleotides as biosensors.
[0121] In certain embodiments, the present disclosure describes methods for modifying a target nucleic acid comprising an engineered retrotransposase system. In some embodiments, the disclosure provides methods for binding, nicking, cleaving, marking, modifying, or transposing a double-stranded deoxyribonucleic acid polynucleotide. In some embodiments, the method can include contacting the double-stranded deoxyribonucleic acid polynucleotide with a retrotransposase.
[0122] In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
[0123] In some embodiments, the retrotransposase is configured to transfer the cargo nucleotide sequence as a single-stranded deoxyribonucleic acid polynucleotide. In some embodiments, the retrotransposase is configured to transfer the cargo nucleotide sequence as a double-stranded deoxyribonucleic acid polynucleotide. In some embodiments, the retrotransposase is configured to transfer the cargo nucleotide sequence via a ribonucleic acid polynucleotide intermediate. In some embodiments, the cargo nucleotide sequence is flanked by a 3' untranslated region (UTR) and a 5' untranslated region (UTR).
[0124] In some embodiments, the present disclosure provides a method of modifying a target nucleic acid sequence. In some embodiments, the method comprises delivering an engineered retrotransposase system described in the present disclosure to the target nucleic acid sequence. In some embodiments, the complex is configured such that, upon binding of the complex to the target nucleic acid sequence, the complex modifies the target nucleic acid sequence.
[0125] In some embodiments, modifying the target nucleic acid sequence comprises binding, nicking, cleaving, marking, modifying, or transferring the target nucleic acid sequence. In some embodiments, the target nucleic acid sequence comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In some embodiments, the target nucleic acid comprises genomic DNA, viral DNA, viral RNA, or bacterial DNA. In some embodiments, the target nucleic acid sequence is in vitro. In some embodiments, the target nucleic acid sequence is in a cell. In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell. In some embodiments, the cell is a primary cell. In some embodiments, the primary cell is a T cell. In some embodiments, the primary cell is a hematopoietic stem cell (HSC). In some embodiments, the cell is a human cell. In some embodiments, the cell is genome edited ex vivo. In some embodiments, the cell is genome edited in vivo.
[0126] In some embodiments, delivering the engineered retrotransposase system to the target nucleic acid sequence comprises delivering a nucleic acid described in this disclosure or a vector described in this disclosure. In some embodiments, delivering the engineered retrotransposase system to the target nucleic acid sequence comprises delivering a nucleic acid comprising an open reading frame encoding the retrotransposase. In some embodiments, the nucleic acid comprises a promoter. In some embodiments, the open reading frame encoding the retrotransposase is operably linked to the promoter.
[0127] In some embodiments, delivering the engineered retrotransposase system to the target nucleic acid sequence comprises delivering a capped mRNA containing an open reading frame encoding the retrotransposase. In some embodiments, delivering the engineered retrotransposase system to the target nucleic acid sequence comprises delivering a translated polypeptide. In some embodiments, delivering the engineered retrotransposase system to the target nucleic acid sequence comprises delivering a deoxyribonucleic acid (DNA) encoding the engineered retrotransposase operably linked to a ribonucleic acid (RNA) pol III promoter.
[0128] In some embodiments, the retrotransposase does not induce cleavage at the target nucleic acid sequence or proximal to the target nucleic acid locus.
[0129] In some embodiments, transposition activity is measured in vitro by introducing a retrotransposase into a cell containing a target nucleic acid sequence and detecting transposition of the target nucleic acid sequence in the cell. In some embodiments, the composition comprises 20 pmoles or less of retrotransposase. In some embodiments, the composition comprises 1 pmol or less of retrotransposase.
[0130] Additionally, certain embodiments of the present disclosure describe methods of producing retrotransposases, which in some embodiments comprise culturing host cells with the engineered retrotransposase systems described in this disclosure.
[0131] In some embodiments, the host cell is a bacterial cell. In some embodiments, the bacterial cell is Bifidobacterium longum, Bifidobacterium lactis, Bifidobacterium animalis, Bifidobacterium breve, Bifidobacterium infantum, Bifidobacterium adolescent, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus paracasei, Lactobacillus salivarius, Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus johnsonii, Lactobacillus plantarum, Lactobacillus ferment, Lactococcus lactis, Streptococcus thermophilus, Lactococcus lactis, Lactococcus diacetylactis, Lactococcus cremoris, Lactobacillus bulgaricus, Lactobacillus helveticus, Lactobacillus delvechii, or Escherichia coli. In some embodiments, the host cell is an E. coli cell. In some embodiments, the E. coli cell is a λDE3 lysogen or a BL21(DE3) strain. In some embodiments, the E. coli cell has an ompT lon genotype.
[0132] In some embodiments, the host cell is an E. coli cell. In some embodiments, the E. coli cell is a λDE3 lysogen or the E. coli cell is a BL21(DE3) strain. In some embodiments, the E. coli cell has an ompT lon genotype.
[0133] In some embodiments, the open reading frame is operably linked to a promoter. In some embodiments, the promoter is selected from the group consisting of a minipromoter, an inducible promoter, a constitutive promoter, and derivatives thereof. In some embodiments, the promoter is selected from the group consisting of CMV, CBA, EF1a, CAG, PGK, TRE, U6, UAS, T7, Sp6, lac, araBad, trp, Ptac, p5, p19, p40, synapsin, CaMKII, GRK1, and derivatives thereof.
[0134] In some embodiments, the open reading frame is selected from the group consisting of a T7 promoter sequence, a T7-lac promoter sequence, a lac promoter sequence, a tac promoter sequence, a trc promoter sequence, a ParaBAD promoter sequence, a PrhaBAD promoter sequence, a T5 promoter sequence, a cspA promoter sequence, an araP promoter sequence, a BAD promoter, the strong leftward promoter from phage lambda (pL promoter), or any combination thereof.
[0135] In some embodiments, the open reading frame comprises a sequence encoding an affinity tag linked in-frame to the sequence encoding the retrotransposase. In some embodiments, the affinity tag is an immobilized metal affinity chromatography (IMAC) tag. In some embodiments, the IMAC tag is a polyhistidine tag. In some embodiments, the affinity tag is a myc tag, a human influenza hemagglutinin (HA) tag, a maltose-binding protein (MBP) tag, a glutathione S-transferase (GST) tag, a streptavidin tag, a FLAG tag, or any combination thereof. In some embodiments, the affinity tag is linked in-frame to the sequence encoding the retrotransposase via a linker sequence encoding a protease cleavage site. In some embodiments, the protease cleavage site is a tobacco etch virus (TEV) protease cleavage site, a PreScission® protease cleavage site, a thrombin cleavage site, a factor Xa cleavage site, an enterokinase cleavage site, or any combination thereof.
[0136] In some embodiments, the open reading frame is codon-optimized for expression in a host cell. In some embodiments, the open reading frame is provided on a vector. In some embodiments, the open reading frame is integrated into the genome of a host cell.
[0137] In some embodiments, the present disclosure provides a culture comprising a host cell described in this disclosure in a compatible liquid medium.
[0138] In some embodiments, the present disclosure provides a method for producing a retrotransposase, comprising culturing a host cell described herein in a compatible growth medium. In some embodiments, the method further comprises inducing expression of the retrotransposase by adding an additional chemical agent or an increased amount of a nutrient. In some embodiments, the additional chemical agent or increased amount of a nutrient comprises isopropyl β-D-1-thiogalactopyranoside (IPTG) or an additional amount of lactose. In some embodiments, the method further comprises isolating the host cells after culturing and lysing the host cells to produce a protein extract. In some embodiments, the method further comprises subjecting the protein extract to IMAC or ion affinity chromatography. In some embodiments, the open reading frame comprises a sequence encoding an IMAC affinity tag linked in-frame to the sequence encoding the retrotransposase. In some embodiments, the IMAC affinity tag is linked in-frame to the sequence encoding the retrotransposase via a linker sequence encoding a protease cleavage site. In some embodiments, the protease cleavage site comprises a tobacco etch virus (TEV) protease cleavage site, a PreScission® protease cleavage site, a thrombin cleavage site, a factor Xa cleavage site, an enterokinase cleavage site, or any combination thereof. In some embodiments, the method further comprises cleaving the IMAC affinity tag by contacting the retrotransposase with a protease corresponding to the protease cleavage site. In some embodiments, the method further comprises performing subtractive IMAC affinity chromatography to remove the affinity tag from the composition comprising the retrotransposase.
[0139] kit In some embodiments, the present disclosure provides kits that include one or more nucleic acid constructs encoding various components of the retrotransposase or gene editing system described in the present disclosure, including, for example, nucleotide sequences encoding components of a retrotransposase or gene editing system capable of modifying a target DNA sequence. In some embodiments, the nucleotide sequences include a heterologous promoter that drives expression of the gene editing system components.
[0140] In some embodiments, any of the retrotransposases or gene editing systems disclosed in the present disclosure are incorporated into pharmaceutical, diagnostic, or research kits to facilitate their use in therapeutic, diagnostic, or research applications. The kits may include one or more containers housing any of the vectors disclosed in the present disclosure and instructions for use.
[0141] Kits can be designed to facilitate researchers' use of the methods described herein and can take many forms. Each of the components of the kit can be provided in liquid form (e.g., in solution) or solid form (e.g., dry powder), if applicable. In certain cases, some of the compositions may be configurable or otherwise processable (e.g., into an active form) by, for example, the addition of a suitable solvent or other species (e.g., water or cell culture medium), which may or may not be provided with the kit. As used herein, "instructions" defines instructional and / or promotional components and may typically involve written instructions on or associated with the packaging of the present disclosure. Instructions may also include any oral or electronic instructions provided in any manner that clearly identifies the instructions to the user as being associated with the kit, such as audiovisual (e.g., videotape, DVD, etc.), internet, and / or web-based communications, etc. The written instructions, in some embodiments, are in a form prescribed by a government agency regulating the manufacture, use, or sale of pharmaceutical or biological products, and the instructions may also reflect approval by the agency of the manufacture, use, or sale for animal administration. [Example]
[0142] [Example 1] A new method for metagenomic analysis of proteins Samples for metagenomic analysis were collected from sediments, soils, and animals. Samples were collected with the owners' consent. Additional raw sequence data from public sources included sequences from animal microbiomes, sediments, soils, hot springs, hydrothermal vents, oceans, peat, Permafrost, and sewage. Deoxyribonucleic acid (DNA) was extracted using a DNA miniprep kit and sequenced. The metagenomic sequence data was searched using a hidden Markov model generated based on validated retrotransposase protein sequences to identify novel retrotransposases. The retrotransposase proteins identified by the search were aligned to validated proteins to identify potential active sites. This metagenomic workflow resulted in the delineation of the MG140 family described in this disclosure.
[0143] [Example 2] Discovery of the MG140, MG148, MG153, and MG160 families of retrotransposases Analysis of the data from the metagenomic analysis of Example 1 revealed a new cluster of putative retrotransposase systems, including one undescribed family (MG140). The protein sequences corresponding to these new enzymes and their subdomains are shown as SEQ ID NOS: 1-16, and 32-47.
[0144] [Example 3] Incorporation of reverse transcription DNA in vitro activity (predictive) Integration activity can be investigated via expression in an E. coli lysate-based expression system. The components required for in vitro testing are three plasmids: an expression plasmid carrying the retrotransposon gene under a T7 promoter, a target plasmid, and a donor plasmid containing the necessary 5' and 3' UTR sequences recognized by the retrotransposase surrounding a selectable marker gene (e.g., a Tet resistance gene). The lysate-based expression product, target DNA, and donor plasmid are incubated to allow transposition to occur. Transposition is detected via PCR. Additionally, transposition products can be tagged with T5 and sequenced via NGS to identify insertion sites in populations of transposition events. Alternatively, in vitro transposition products can be injected into E. coli under antibiotic (e.g., Tet) selection, where growth requires stable integration of the selectable marker into the plasmid. Either single colonies or populations of E. coli can be sequenced to determine the insertion site.
[0145] Incorporation efficiency can be measured via ddPCR or qPCR of the experimental output of target DNA with incorporated cargo, normalized to the amount of unmodified target DNA, also measured via ddPCR.
[0146] This assay can also be performed on purified protein components rather than from lysate-based expression. In this case, the protein is expressed in a protease-deficient E. coli B strain under a T7-inducible promoter, the cells are lysed using sonication, and the His-tagged protein of interest is purified using Ni-NTA affinity chromatography on an FPLC. Purity is measured using SDS-PAGE and densitometry of resolved protein bands on a Coomassie-stained acrylamide gel. The protein is desalted in a storage buffer consisting of 50 mM Tris-HCl, 300 mM NaCl, 1 mM TCEP, 5% glycerol, pH 7.5 (or other buffer determined for maximum stability) and stored at -80°C. After purification, the transposon gene is added to the target DNA and donor plasmid described above in a reaction buffer, e.g., 26 mM HEPES pH 7.5, 4.2 mM TRIS pH 8, 50 μg / mL BSA, 2 mM ATP, 2.1 mM DTT, 0.05 mM EDTA, 0.2 mM MgCl, 30-200 mM NaCl, 21 mM KCl, 1.35% glycerol (final pH 7.5) supplemented with 15 mM MgOAc.
[0147] [Example 4] Verification of retrotransposon ends via gel shift (predictive) Retrotransposon ends are tested for retrotransposase binding via electrophoretic mobility shift assay (EMSA). In this case, target DNA fragments (100-500 bp) are end-labeled with FAM via PCR using FAM-labeled primers. 3'UTR RNA and 5'UTR RNA are generated in vitro using T7 RNA polymerase and purified. Retrotransposase protein is synthesized in an in vitro transcription / translation system. After synthesis, 1 μL of protein is added to 50 nM labeled DNA and 100 ng of 3' or 5'UTR RNA in a 10 μL reaction in binding buffer (e.g., 20 mM HEPES pH 7.5, 2.5 mM Tris pH 7.5, 10 mM NaCl, 0.0625 mM EDTA, 5 mM TCEP, 0.005% BSA, 1 μg / mL poly(dI-dC), and 5% glycerol). The binding is incubated at 30°C for 40 minutes, followed by the addition of 2 μL of 6X loading buffer (60 mM KCl, 10 mM Tris pH 7.6, 50% glycerol). The binding reactions are resolved and visualized on a 5% TBE gel. A shift in the 3' or 5' UTR in the presence of retrotransposase protein and target DNA can result from successful binding and indicates retrotransposase activity. This assay can also be performed with retrotransposase truncations or mutations, as well as using E. coli extracts or purified protein.
[0148] [Example 5] Verification of target DNA cleavage (predictive) To confirm that retrotransposase is responsible for cleaving target DNA, short (approximately 140 bp) DNA fragments are labeled at both ends with FAM via PCR using FAM-labeled primers. In vitro transcribed / translated retrotransposase products are preincubated with 1 μg of Rnase A (negative control) or 3'UTR, 5'UTR, or nonspecific RNA fragments (controls), followed by incubation with labeled target DNA at 37°C. The DNA is then analyzed on a denaturing gel. Cleavage of one or both strands of DNA can result in labeled fragments of various sizes that migrate at different speeds on the gel.
[0149] [Example 6] Integrase activity in E. coli (predictive) The engineered E. coli strain is transformed with a plasmid expressing the retrotransposon gene and a plasmid containing a temperature-sensitive origin of replication with a selectable marker flanked by the 5' and 3' UTRs of the retrotransposon required for integration. Transformants induced for expression of these genes are then screened for marker transfer to the genomic target by selection at the restrictive temperature for plasmid replication, and marker integration within the genome is confirmed by PCR.
[0150] Integration is screened using an unbiased approach. Briefly, purified gDNA is tagged with Tn5, and the DNA of interest is then PCR amplified using primers specific for the Tn5 tagmentation and selectable marker. The amplicons are then prepared for NGS sequencing. Analysis of the resulting sequences involves trimming the transposon sequence and mapping flanking sequences to the genome to determine the insertion location and the insertion rate.
[0151] [Example 7] Integration of reverse transcribed DNA into mammalian genomes (predictive) To demonstrate targeting and cleavage activity in mammalian cells, the integrase protein is purified in E. coli or sf9 cells harboring two NLS peptides at either the N-terminus, C-terminus, or both ends of the protein sequence. Plasmids containing a selectable neomycin resistance marker (NeoR) or a fluorescent marker flanked by the 5' and 3' UTR regions under the control of a CMV promoter, required for transposition, are synthesized. Cells are transfected with the plasmid, allowed to recover for 4-6 hours for RNA transcription, and then electroporated with the purified integrase protein. Antibiotic-resistant integration into the genome is quantified by the number of G418-resistant colonies (selection begins 7 days after transfection), and positive transposition by the fluorescent marker is assayed by fluorescence-activated cell cytometry. Seven to 10 days after the second transfection, genomic DNA is extracted and used for next-generation sequencing (NGS) library preparation. Off-target frequency is assayed by fragmenting the genome and preparing amplicons of the transposon marker and flanking DNA for NGS library preparation. At least 40 different target sites are selected to test the activity of each targeting system.
[0152] Integration into mammalian cells can also be assessed via RNA delivery. An RNA encoding a retrotransposase with two NLSs is designed and capped and poly(A)-tailed. A second RNA is designed to contain a selectable neomycin resistance marker (NeoR) or a fluorescent marker flanked by the 5'UTR and 3'UTR regions. The RNA construct is introduced into mammalian cells via a lysosomal transfection reagent. Ten days after transfection, genomic DNA is extracted and transposition efficiency is measured using ddPCR and NGS.
[0153] [Example 8] Bioinformatic discovery of RT We retrieved predicted proteins with reverse transcriptase function from extensive assembly-driven metagenomic databases of microbial, viral, and eukaryotic genomes. We predicted over 4.5 million RT proteins based on having hits to the PFam domains PF00078 and PF07727, of which 3.4 million had significant e-values (1 × 10). -5 After filtering for complete ORFs with 70% or greater RT domain coverage and predicted catalytic residues ([F / Y]XDD), approximately 500,000 proteins were retained for further analysis. RT domains were extracted from this set of proteins as well as from reference sequences obtained from public databases. Domain sequences were clustered at 50% identity across 80% coverage, representative sequences (26,824 in total) were aligned, and domain alignments were used to infer a phylogenetic tree. Phylogenetic analysis of RT domains suggests that many distinct classes of RTs with high sequence diversity were recovered (Figure 4).
[0154] [Example 9] Non-LTR retrotransposons (MG148 family) Retrotransposon-associated RT bioinformatics analysis The MG148 family of retrotransposon-associated RTs contains highly divergent RT homologs predicted to be active by the presence of all predicted catalytic residues and multiple Zn-binding ribbon motifs (Figures 5A and 5B). Nucleotide-level alignment of several family members did not reveal conserved regions within the 5'UTR that might be involved in RT function, activity, or recruitment (Figure 5C).
[0155] Testing the in vitro activity of retrotransposon RT by qPCR In vitro activity of retrotransposon RT was assessed by primer extension reactions containing RT enzyme from a cell-free expression system and 100 nM RNA template (200 nt) annealed to a DNA primer in a reaction buffer containing 40 mM Tris-HCl (pH 7.5), 0.2 M NaCl, 10 mM MgCl2, 1 mM TCEP, and 0.5 mM dNTPs. The resulting full-length cDNA products were quantified by qPCR by extrapolating values from a standard curve generated using DNA templates of known concentrations. MG148 family members MG140-33-R2 to MG140-34-R2 (SEQ ID NOs: 5-6), MG140-42-R2 to MG140-44-R2 (SEQ ID NOs: 14-16), and MG148-12 (SEQ ID NO: 32) are active in cDNA synthesis as determined by primer extension (Figure 6).
[0156] [Example 10] Group II intron RT (MG153 family) Group II intron bioinformatic analysis Group II introns can incorporate large cargoes into target sites through reverse transcription of an RNA template. RT domains from group II introns were identified and depicted in the phylogenetic tree in Figure 4. More than 10,000 unique full-length group II intron proteins containing RT domains from contigs with >2 kb of sequence flanking the RT enzyme were aligned. From this alignment, a phylogenetic tree was inferred, further identifying group II intron families (Figures 7A and 7B). Class C group II intron enzymes were identified, whose domain architecture includes a predicted active RT domain and a maturase domain involved in intron recruitment. Some group II intron proteins contain an additional endonuclease domain that may be involved in target recognition and cleavage. Many candidates from all identified families were nominated for laboratory characterization.
[0157] Testing the in vitro activity of class C group II intron RTs The in vitro activity of the GII intron class C (MG153) RT was assessed by primer extension reactions containing the RT enzyme derived from a cell-free expression system. The expression construct was codon-optimized for E. coli and contained an N-terminal single Strep tag. RT expression was confirmed by SDS-PAGE analysis. The substrate for the reaction was 100 nM of RNA template (200 nt) annealed to a 5'-FAM-labeled primer. The reaction buffer contained the following components: 50 mM Tris-HCl (pH 8.0), 75 mM KCl, 3 mM MgCl, 10 mM DTT, and 0.5 mM dNTPs. After incubation at 37°C for 1 hour, the reaction was quenched by incubation with Rnase H, followed by the addition of 2X RNA loading dye. The resulting cDNA products were separated on a 10% denaturing polyacrylamide gel and visualized using an imaging system. RT activity was also assessed by qPCR using primers amplifying full-length cDNA products. Products from primer extension assays were diluted to ensure that cDNA concentrations were within the linear range of detection. The amount of cDNA was quantified by extrapolating values from a standard curve generated using DNA templates of known concentrations. By detecting cDNA products on denaturing gels by qPCR, the following GII intron class C candidates were found to be active under these experimental conditions: MG153-22 to MG153-24 (SEQ ID NOs: 42 to 44) (Figures 8A-8B).
[0158] Human cell cDNA synthesis results The ability of these enzymes to produce cDNA in a mammalian environment was tested by expressing them in mammalian cells and detecting cDNA synthesis by PCR followed by agarose gel electrophoresis. Reverse transcriptase was cloned into a plasmid for mammalian expression under the CMV promoter as a fusion protein containing the MS2 coat protein (MCP) at its N-terminus in addition to a flag-HA tag (FH). MCP is a protein derived from the MS2 bacteriophage that recognizes 20-nucleotide RNA stem-loops with high affinity (subnanomolar Kd). Fusing the RT to MCP and having the MS2 loop in the RNA template ensures that, upon translation, the RT will find the RNA template and initiate cDNA synthesis from a DNA primer hybridized to the RNA template.
[0159] Plasmids containing MCP fused to RT candidates under the CMV promoter were cloned and isolated for transfection into HEK293T cells. Transfection was performed using Lipofectamine 2000. mRNA encoding nanoluciferase was generated using an mRNA synthesizer according to the manufacturer's instructions. To degrade any DNA template remaining in the mRNA preparation, the reaction was treated with DNase for 1 hour, and the mRNA was cleaned using a Clean-Up kit. The mRNA was hybridized to a complementary DNA primer in 10 mM Tris pH 7.5, 50 mM NaCl at 95°C for 2 minutes and cooled to 4°C at a rate of 0.1°C / second. The mRNA / DNA hybrids were transfected into HEK293T cells for 6 hours using a liposome-based transfection agent, following transfection of a plasmid containing the MCP-RT fusion. Eighteen hours after mRNA / DNA transfection, cells were lysed using DNA extraction solution, and 100 μL of quick extract was added per 24-well plate. Nanoluciferase is approximately 500 bp in length, and primers were designed to amplify 100-bp and 542-bp products from the newly synthesized cDNA. The cDNA was amplified using the primer set described above, and PCR products were detected by agarose gel electrophoresis or DNA Tape Station.
[0160] Activity against the control GII intron RT, TGIRT, was detected, as indicated by the presence of a 500-bp DNA product (Figure 9). Additionally, cDNA synthesis activity of the GII intron-derived RT, MG153-23 (SEQ ID NO: 43), was also demonstrated (Figure 9). Taken together, this indicates that these newly discovered RTs are expressed, properly folded, and active in living mammalian cells, broadening their options for biotechnological applications.
[0161] Human cell RT expression and cDNA synthesis results The ability of GII RT to synthesize cDNA in a mammalian cell environment was tested as described above with minor modifications. cDNA synthesis was detected using PCR as described above and analyzed by agarose gel electrophoresis. To have a quantitative readout, a Taqman qPCR assay was developed using the Taqman qPCR primers described above with the Taqman probe "ACTCTGTGAGCGGATCTTGGCTTAGCC" (SEQ ID NO: 70). The RTs of MG153-23 and MG153-24 were active to varying degrees, with MG153-23 being nearly as active as the TGIRT control (Figure 12).
[0162] To understand the protein expression and stability of GII RT in mammalian cells, immunoblots were performed. Briefly, transfected cells were lysed with RIPA lysis buffer supplemented with protease inhibitors (80 μL per well in a 24-well format). To remove insoluble aggregates, the lysate was centrifuged at 14,000 g for 10 minutes at 4°C. Protein was quantified using BCA. 3 or 10 μg of total protein was loaded per lane on a 4-12% polyacrylamide SDS gel. All lanes were normalized to the same amount of protein. Protein was transferred to a PVDF membrane using a gel transfer system. Protein was detected using a rabbit HA antibody using an HRP-based detection method. The results show that MG153-23 is expressed in human cells, as indicated by the band intensity (Figures 13A-B). When cDNA synthesis was normalized by quantified expression, MG153-23RT outperformed the TGIRT control by more than six-fold (FIG. 14).
[0163] [Example 11] Retron RT (MG160 family) Retron bioinformatic analysis Bacterial retrons are DNA elements approximately 2000 bp in length that encode a continuous non-coding RNA containing the RT-encoding gene (ret) and the inverted sequences msr and msd. Retrons use a unique mechanism for RT-DNA synthesis, in which the ncRNA template folds into a conserved secondary structure insulated between two inverted repeats (a1 / a2). The retron RT recognizes the folded ncRNA, and reverse transcription initiates from a conserved guanosine 2'OH adjacent to the inverted repeat, forming a 2'-5' linkage between the template RNA and the nascent cDNA strand. In some retrons, this 2'-5' linkage persists into the mature form of the processed RT-DNA, while in other embodiments, an exonuclease cleaves the DNA product, resulting in a free 5' end. Furthermore, RTs target only msr-msd sequences derived from the same retron as their RNA template, providing specificity that can avoid off-target reverse transcription.
[0164] A divergent group of "retron-like" single-domain RT sequences was identified within the retron clade in Figure 4. The single-domain RTs of the MG160 family span 250-300 aa and are predicted to be active based on the presence of the predicted RT catalytic residues [F / Y]XDD. The 5'UTRs of the MG160 family are conserved among family members and fold into a conserved secondary structure that is likely important for element activity or recruitment (Figure 10).
[0165] Testing the in vitro activity of the MG160 family of retron-like RTs The in vitro activity of retron-like RTs (MG160 family) was assessed by primer extension reactions containing RT enzymes derived from a cell-free expression system. The expression constructs were codon-optimized for E. coli and contained an N-terminal single Strep tag. The substrate for the reaction was 100 nM of RNA template (200 nt) annealed to a 5'-FAM-labeled primer. The reaction buffer contained the following components: 50 mM Tris-HCl (pH 8.0), 75 mM KCl, 3 mM MgCl, 10 mM DTT, and 0.5 mM dNTPs. After incubation at 37°C for 1 hour, the reaction was quenched via incubation with Rnase H, followed by the addition of 2X RNA loading dye. The resulting cDNA products were separated on a 10% denaturing polyacrylamide gel and visualized using an imaging system. RT activity was also assessed by qPCR using primers amplifying the full-length cDNA products. The products from the primer extension assay were diluted to confirm that the cDNA concentration was within the linear range of detection. The amount of cDNA was quantified by extrapolating values from a standard curve generated using DNA templates of known concentrations. MG160-7 (SEQ ID NO: 45) is active by gel analysis and qPCR (Figures 11A-B).
[0166] [Example 12] Cell-free expression of retroncRNAs and in vitro transcription of retroncRNAs (predictive) Retron RTs are produced in a cell-free expression system by incubating 10 ng / µL of DNA template encoding the E. coli-optimized gene with an N-terminal single Strep tag bearing in vitro transcription / translation system components for 2 h at 37 °C. All retron RTs tested are expressed as shown by SDS-PAGE analysis.
[0167] Retron ncRNAs were generated using a T7 in vitro transcription kit and DNA templates encoding the respective ncRNA genes behind the T7 promoter. The reaction was then incubated with Dnase-I to remove the DNA template and purified using an RNA cleanup kit. The amount of ncRNA was quantified using Nanodrop, and the purity was assessed by electrophoretic RNA analysis.
[0168] [Example 13] Testing the in vitro activity of Retron RT (predictive) The retron RT enzyme is produced in a cell-free expression system using a construct containing an E. coli codon-optimized gene with an N-terminal single Strep tag as described above. Enzyme expression is confirmed by SDS-PAGE analysis. Retron RT activity on a generic template is determined by the primer extension assay described above, containing a 200-nt RNA annealed to a 5'-FAM-labeled DNA primer. The resulting cDNA product is detected on a denaturing polyacrylamide gel or by qPCR using primers specific for the full-length cDNA product.
[0169] The in vitro activity of retron RT on its own ncRNA is assessed in reactions containing buffer, dNTPs, retron RT produced from a cell-free expression system, and refolded ncRNA. RT activity is compared before and after purification of the RT from a cell-free expression system via an N-terminal single Strep tag. After incubation, half of the reaction is treated with RNase A / T1. Products before and after RNase A / T1 treatment are evaluated on a denaturing polyacrylamide gel and visualized by SYBR gold staining. RNase A / T1 digests the RNA template, which should result in a mass shift to a smaller product containing only ssDNA. Because RNase H is expected to improve the uniformity of the 5' and 3' ssDNA boundaries, the effect of RNase H on product distribution is also assessed by gel analysis. The covalent bond between the ncRNA template and the ssDNA is confirmed by incubating the RT product with 5' to 3' ssDNA exonuclease (RecJ) before or after treatment with debranching enzyme (DBR1). RecJ should only be able to degrade the ssDNA after DBR1 removes the 2'-5' phosphodiester linkage between the RNA and the ssDNA.
[0170] [Example 14] Determination of retron msr-msd boundary by NGS (predictive) The MSr-MSD boundaries are determined by unbiased ligation of adapter sequences to the 5' and 3' ends of the MSDNA products after removal of the 2'-5' phosphodiester linkages by DBR1. The resulting ligation products are PCR-amplified, library-prepared, and subjected to next-generation sequencing. The sequencing reads are aligned to a reference sequence to determine the 5' and 3' boundaries of the MSD. The effect of the presence of RNase H in the RT reaction on the homogeneity of the 5' and 3' MSD boundaries is also assessed.
[0171] [Example 15] Systematic evaluation of insertion sequences into msd for RT activity (predictive) Sequences of distinct length, predicted secondary structure, and GC content are inserted into the MSD at selected insertion sites informed by MSD boundaries determined by NGS and ncRNA secondary structure prediction. The effect of these inserted sequences on RT activity is assessed by gel analysis or NGS as described above.
[0172] [Example 16] Testing the in vitro activity of RT (predictive) RT activity is evaluated using a primer extension assay containing RT derived from a cell-free expression system and an RNA template annealed to the above-mentioned DNA primer. The resulting cDNA product is detected by denaturing polyacrylamide gel and qPCR as described above. The detection of cDNA drop-off products on the denaturing gel provides a relative evaluation of the processivity of the candidate.
[0173] [Example 17] Assessing priming requirements for RT (predictive) The preferred primer length is identified by testing the activity of RT on RNA templates annealed to 5'-FAM-labeled DNA primers of either 6, 8, 10, 13, 16, or 20 nucleotides in length. RT is derived from a cell-free expression system as described above. After incubation, the reaction is quenched via the addition of RNase H. The size distribution of the cDNA product is analyzed on a denaturing polyacrylamide gel as described above. The optimal primer length is determined as the length that allows RT to convert the largest primer into cDNA product. The experimentally determined optimal primer length is then used in subsequent experiments, such as fidelity and processivity assays, to further characterize in vitro RT.
[0174] [Example 18] Assessment of RT fidelity (predictive) RT fidelity is assessed by primer extension assays as described above, except that a 14-nt unique molecular identifier (UMI) barcode is included in the primers for the reverse transcription reaction to account for errors introduced during PCR and sequencing. The resulting full-length cDNA products are PCR-amplified, library-prepared, and subjected to next-generation sequencing. Barcodes with more than five reads are analyzed. After alignment to the reference sequence, mutations, insertions, and deletions are counted only if the error is present in all sequence reads with the same barcode. Errors present in one but not all sequencing reads are considered to have been introduced during PCR or sequencing. In addition to identifying mutation hotspots within the RNA template, further analysis of substitution, insertion, and deletion profiles is performed. Fidelity measurements are also performed using modified bases in the template, such as pseudouridine.
[0175] [Example 19] Determination of the forwardness coefficient of RT (predictive) RT processivity is assessed using a primer extension assay containing RT enzyme derived from a cell-free expression system as described above and RNA templates ranging from 1.6 kb to 6.6 kb in length annealed to either a 5'-FAM-labeled primer (for gel analysis) or an unlabeled primer (for sequencing analysis).
[0176] The reverse transcription reaction is performed under single-cycle conditions that inhibit the rebinding of RT enzymes that have dropped off from the RNA template during cDNA synthesis. The optimal capture molecule and concentration for achieving single-cycle conditions are determined experimentally. The selected conditions must be designed to provide sufficient inhibition of cDNA synthesis when incubated before the start of the reaction, but not otherwise affect the reaction rate. Optimal capture molecules to test include unrelated RNA templates and unrelated RNA templates annealed to DNA primers of various lengths.
[0177] Once single-cycle reaction conditions are optimized, processivity is assessed by pre-equilibrating the RT with an RNA template annealed to a DNA primer in reaction buffer, followed by initiating the reaction with the addition of dNTPs and a selected capture molecule. After incubation, the reaction is quenched by the addition of Rnase H. The size distribution of the cDNA products is analyzed on a denaturing polyacrylamide gel as described above and / or subjected to PCR and libraries prepared for long-read sequencing. From these experiments, the processivity coefficient is quantified as the length of the template, which results in 50% of the full-length cDNA product. The median length of the cDNA products from the single-cycle primer extension reaction is used to estimate the probability that RT will dissociate on the tested template. From this, the probability that RT will dissociate at each nucleotide position is calculated, assuming each dissociation is an independent event and the probability of dissociation is equal at all nucleotide positions. The processivity coefficient, which represents the template length required for 50% of the RT to dissociate, is then calculated as 1 / (2*P d ) where P d is the probability of dissociation at each nucleotide.
[0178] [Example 20] Systematic analysis (predictive) of challenge structures on primer extension To assess the effect of a challenging template on RT activity, primer extension reactions are performed as described above with modifications. The RNA template contains one of the following challenge motifs at a fixed distance (100–300 nt) downstream of the primer binding site: a homopolymer stretch, a thermodynamically stable GC-rich stem-loop, a pseudoknot, a tRNA, a GII intron, and an RNA template containing base or backbone modifications (i.e., pseudouridine, phosphothioate linkages). After quenching the reaction, the size distribution of the cDNA products is analyzed by denaturing polyacrylamide gel. Additionally, adapter sequences are unbiasedly ligated to the 3' ends of the cDNA products using T4 ligase. The ligated products are then PCR-amplified, and the library is prepared for next-generation sequencing to identify both sites of RT misincorporation / insertion / deletion and sites of RT dropoff at single-nucleotide resolution. The degree of RT dropoff at a given position is quantified by comparing the number of sequencing reads corresponding to the dropoff product with the number of sequencing reads corresponding to the full-length product.
[0179] [Example 21] Evaluation of non-templated base addition (predictive) Non-templated base addition to the 5' end of cDNA products is assessed by next-generation sequencing. Primer extension reactions containing RT and RNA templates derived from a cell-free expression system are performed as described above. Systematic analysis of different RNA template lengths and sequence motifs at the 5' end is examined. Adapter sequences are ligated to the 3' end of the resulting cDNA products unbiasedly using T4 ligase, resulting in capture of all cDNA products despite the potentially heterogeneous nature of their 3' ends. The ligated products are then PCR amplified, and the library is prepared for next-generation sequencing. Comparison of the predicted full-length cDNA reference sequence with experimentally generated cDNA sequences longer than full length allows for the identification of both the type and number of base additions to the 5' end that were not templated by RNA.
[0180] [Example 22] Determining 5' and 3' UTR requirements for activity and processivity of R2-like systems (predictive) Proteins of interest are purified via Twin-strep tags after IPTG-induced overexpression in E. coli. Purified proteins are tested against 1 kb and 4 kb cargoes flanked by the 3' UTR identified from their native context and the 5' UTR extending an additional 400 bp beyond the start codon. The effect of the 5' and 3' flanking sequences on activity is assayed via qPCR on sections near the end of the template to determine whether cargoes with these native characteristics are preferred substrates.
[0181] [Example 23] Human cell cDNA synthesis results (Propetic) The ability of these enzymes to produce cDNA in a mammalian environment was tested by expressing them in mammalian cells and detecting cDNA synthesis by PCR followed by agarose gel electrophoresis. Reverse transcriptase was cloned into a plasmid for mammalian expression under the CMV promoter as a fusion protein containing the MS2 coat protein (MCP) at its N-terminus in addition to a flag-HA tag (FH). MCP is a protein derived from the MS2 bacteriophage that recognizes 20-nucleotide RNA stem-loops with high affinity (subnanomolar Kd). Fusing the RT to MCP and having the MS2 loop in the RNA template ensures that, upon translation, the RT will find the RNA template and initiate cDNA synthesis from a DNA primer hybridized to the RNA template.
[0182] Plasmids containing MCP fused to RT candidates under a CMV promoter were cloned and isolated for transfection into HEK293T cells. Transfection was performed using Lipofectamine 2000. mRNA-encoding nanoluciferase was produced using an mRNA synthesizer. To degrade any DNA template remaining in the mRNA preparation, the reaction was treated with DNase for 1 hour, and the mRNA was cleaned using a Transcription Clean-Up Kit. The mRNA was hybridized to a complementary DNA primer in 10 mM Tris pH 7.5, 50 mM NaCl at 95°C for 2 minutes and cooled to 4°C at a rate of 0.1°C / sec. The mRNA / DNA hybrids were transfected into HEK293T cells using Lipofectamine Messenger Max 6 hours after transfection with the plasmid containing the MCP-RT fusion. Eighteen hours after mRNA / DNA transfection, cells were lysed using DNA extraction solution, and 100 µL of quick extract was added per 24-well plate. Nanoluciferase is approximately 500 bp in length, and primers were designed to amplify 100-bp and 542-bp products from newly synthesized cDNA. The cDNA was amplified using the primer set described above, and PCR products were detected by agarose gel electrophoresis.
[0183] [Example 24] RT cDNA synthesis activity can be used for multiple purposes (predictive) RNA-dependent processes important in RNA biology, such as expression, processing, modification, and half-life, as well as quality control steps in biotechnology, require the crucial step of converting RNA to cDNA. Therefore, several RTs have been used for many years to generate cDNA libraries. RTs used for these purposes include MMLV RT, AMV RT, and GsI-IIC RT (TGIRT). The first two represent retroviral RTs, while the latter is a GII intron-derived RT. GII intron-derived RTs, as well as non-LTR-derived RTs, offer several advantages over their retroviral counterparts. For example, they are more processive and can read through structural and modified RNAs. Structural and / or modified RNAs may not be accurately reverse transcribed by retroviral RTs because they generate premature termination products that can be misinterpreted as RNA fragments. Additionally, the switch-templated ability of some RTs can be exploited for early adapter addition, eliminating the adapter ligation step in library preparation. Therefore, highly processive RTs are suitable for generating libraries with complex RNAs. Furthermore, some highly processive RTs are generally smaller than currently used retroviral RTs, making their production and associated downstream processing easier. The data presented in this disclosure show that some RTs outperform commercially available TGIRT enzymes, some with over six-fold greater cDNA synthesis activity than the commercially available ones.
[0184] [Example 25] cDNA synthesis by non-LTR retrotransposon RTs and retro-like RTs Non-LTR retrotransposases can incorporate large cargoes into target sites through reverse transcription of an RNA template. These reverse transcriptases (RTs) incorporate the RNA template via target-primed reverse transcription (TPRT), a mechanism in which cDNA synthesis is primed by the free 3' hydroxyl group of the target DNA nick. The MG160 family of RTs is a branch of previously identified "retron-like" single-domain RT enzymes within the retroRT clade, which form a distant branch. The enzymes are predicted to be active based on the presence of the predicted RT catalytic residues [F / Y]XDD.
[0185] Results: Human cell cDNA synthesis by RT The ability of RTs to produce cDNA in a mammalian environment was tested by expressing them in mammalian cells and detecting cDNA synthesis by qPCR. Reverse transcriptase was cloned into a plasmid for mammalian expression under the CMV promoter as a fusion protein with the MS2 coat protein (MCP) at its N-terminus, in addition to a flag-HA tag (FH). MCP is a protein derived from the MS2 bacteriophage that recognizes 20-nucleotide RNA stem-loops with high affinity (subnanomolar Kd). Fusing RT to MCP and having the MS2 loop in the RNA template ensures that, upon translation, RT will find the RNA template and initiate cDNA synthesis from a DNA primer hybridized to the RNA template.
[0186] A plasmid containing MCP fused to a candidate RT under a CMV promoter was cloned and isolated for transfection into HEK293T cells. Transfection was performed using Lipofectamine 2000. mRNA encoding dCas9 fused to nanoluciferase was generated using an mRNA synthesizer. To degrade any DNA template remaining in the mRNA preparation, the reaction was treated with DNase for 1.5 hours, and the mRNA was cleaned using a Transcription Clean-Up Kit. The mRNA was hybridized to a complementary DNA primer in 10 mM Tris pH 7.5, 50 mM NaCl at 95°C for 2 minutes and cooled to 4°C at a rate of 0.1°C / second. The mRNA / DNA hybrid was transfected into HEK293T cells for 6 hours after transfection with a plasmid containing the MCP-RT fusion. Eighteen hours after mRNA / DNA transfection, cells were lysed using DNA extraction solution, and 100 μL of quick extract was added per 24-well plate in a 24-well plate. The RNA template was approximately 4247 nt. Primers were designed to amplify the first and last 100 bp products from the newly synthesized cDNA (4100 bp), along with a Taqman probe, to quantify their amplification (Figure 15A).
[0187] Activity was detected for the control GII intron RT TGIRT, the retrovirus MMLV (WT and five mutants), and the positive control for the R2 RT, R2Tg, as indicated by the initial amplification of the first and last 100 bp products (see Figures 15B and 15C). As expected for a low-processivity RT, the retrovirus RT (MMLV) showed a high level of amplification of the first 100 bp (FAM signal), but the level of completed cDNA synthesis (the last 100 bp) was low (20-fold lower than the first 100 bp, as observed by the FAM / HEX ratio signal). The control GII intron RT TGIRT and the control R2 non-LTR retrotransposon RT R2Tg showed closer FAM / HEX ratios, indicating their high processivity (Figures 15B and 15C). Five candidates from the MG148 family of non-LTR retrotransposon RTs were tested in mammalian cells (Figure 15B). All candidates tested showed reduced activity compared to the control RT. MG160-7 was also tested. It showed poor activity and poor processivity, as evidenced by FAM and HEX values below background (shown by the dotted line parallel to the x-axis) (Figure 15C).
[0188] While preferred embodiments of the present disclosure have been shown and described in this disclosure, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. It is not intended that the present disclosure be limited by the specific examples provided herein. While the present disclosure has been described with reference to the foregoing specification, the descriptions and illustrations of the embodiments herein are not intended to be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the present disclosure. Furthermore, it should be understood that all aspects of the present disclosure are not limited to the specific depictions, configurations, or relative proportions set forth herein, which depend upon a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the present disclosure described herein may be employed in practicing the present disclosure. Accordingly, it is contemplated that the present disclosure shall cover any such alternatives, modifications, variations, or equivalents. It is intended that the following claims define the scope of the present disclosure, and that methods and structures within the scope of these claims and their equivalents are covered thereby. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] Table 2-8 Table 2-9 Table 2-10 Table 2-11 Table 2-12 Table 2-13 Table 2-14 Table 2-15 Table 2-16 Table 2-17 Table 2-18 Table 2-19 Table 2-20 Table 2-21 Table 2-22 Table 2-23 Table 2-24 Table 2-25 Table 2-26 Table 2-27 Table 2-28 Table 2-29 Table 2-30 Table 2-31 Table 2-32 Table 2-33 Table 2-34 Table 2-35 Table 2-36 Table 2-37 Table 2-38 Table 2-39 Table 2-40 Table 2-41 Table 2-42 Table 2-43 Table 2-44 Table 2-45 Table 2-46 Table 2-47 Table 2-48 Table 2-49 Table 2-50 Table 2-51 Table 2-52 Table 2-53 Table 2-54 Table 2-55 Table 2-56 Table 2-57 Table 2-58 Table 2-59 Table 2-60 Table 2-61 Table 2-62 Table 2-63 Table 2-64 Table 2-65
Claims
1. 1. An engineered retrotransposase system comprising: (a) a double-stranded nucleic acid comprising a cargo nucleotide sequence configured to form a complex with a retrotransposase; (b) a retrotransposase configured to transpose the cargo nucleotide sequence to a target nucleic acid sequence, the retrotransposase comprising an amino acid sequence having at least 75% sequence identity to any one of SEQ ID NOs: 1-16, and 32-47.
2. 2. The engineered retrotransposase system of claim 1, wherein the retrotransposase comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1-16, and 32-47.
3. 2. The engineered retrotransposase system of claim 1, wherein the retrotransposase comprises an amino acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 1-16, and 32-47.
4. 2. The engineered retrotransposase system of claim 1, wherein the retrotransposase comprises an amino acid sequence having at least 95% sequence identity to any one of SEQ ID NOs: 1-16, and 32-47.
5. 2. The engineered retrotransposase system of claim 1, wherein the retrotransposase is encoded by a nucleic acid having at least 75% sequence identity to any one of SEQ ID NOs: 17-19, 24, and 76-817.
6. 2. The engineered retrotransposase system of claim 1, wherein the retrotransposase is encoded by a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 17-19, 24, and 76-81.
7. 2. The engineered retrotransposase system of claim 1, wherein the retrotransposase is encoded by a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 17-19, 24, and 76-81.
8. 2. The engineered retrotransposase system of claim 1, wherein the retrotransposase is encoded by a nucleic acid sequence having at least 95% sequence identity to any one of SEQ ID NOs: 17-19, 24, and 76-81.
9. 5. The engineered retrotransposase system of any one of claims 1 to 4, wherein the retrotransposase has less than 80% sequence identity to known retrotransposases.
10. 10. The engineered retrotransposase system of any one of claims 1 to 9, wherein the cargo nucleotide sequence is flanked by a 3' untranslated region (UTR) and a 5' untranslated region (UTR).
11. 11. The engineered retrotransposase system of any one of claims 1 to 10, wherein the retrotransposase is configured to transpose the cargo nucleotide sequence via a ribonucleic acid polynucleotide intermediate.
12. 12. The engineered retrotransposase system of any one of claims 1 to 11, wherein the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
13. 13. The engineered retrotransposase system of any one of claims 1 to 12, wherein the retrotransposase comprises one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the retrotransposase.
14. 14. The engineered retrotransposase system of any one of claims 13, wherein the NLS comprises a sequence that is at least 80% identical to a sequence from the group consisting of SEQ ID NOs: 49-64.
15. 14. The engineered retrotransposase system of claim 13, wherein the NLS comprises SEQ ID NO:
50.
16. 14. The engineered retrotransposase system of claim 13, wherein the NLS is proximal to the N-terminus of the retrotransposase.
17. 14. The engineered retrotransposase system of claim 13, wherein the NLS comprises SEQ ID NO:
49.
18. 14. The engineered retrotransposase system of claim 13, wherein the NLS is proximal to the C-terminus of the retrotransposase.
19. 19. The engineered retrotransposase system of any one of claims 1 to 18, wherein the retrotransposase is derived from an uncultured microorganism.
20. A polypeptide comprising a reverse transcriptase comprising an amino acid sequence having at least 75% sequence identity to any one of SEQ ID NOs: 1-16 and 32-47 fused at its N-terminus or C-terminus to a non-retrotransposase domain or affinity tag.
21. 21. The polypeptide of claim 20, wherein the non-retrotransposase domain is an RNA-binding protein domain.
22. 22. The polypeptide of claim 21, wherein the RNA-binding protein domain comprises a bacteriophage MS2 coat protein (MCP) domain.
23. A nucleic acid encoding the engineered retrotransposase system of any one of claims 1 to 19 or the polypeptide of any one of claims 20 to 22.
24. 20. A method for modifying a target nucleic acid sequence, the method comprising contacting said target nucleic acid sequence with the engineered nuclease system of any one of claims 1 to 19.
25. 24. The method of claim 23, wherein modifying the target nucleic acid sequence comprises binding, nicking, or cleaving the target nucleic acid sequence.
26. 26. The method of any one of claims 23 to 25, wherein the target nucleic acid sequence comprises genomic DNA, viral DNA, viral RNA, or bacterial DNA.
27. 26. The method of any one of claims 23 to 25, wherein the target nucleic acid sequence comprises deoxyribonucleic acid (DNA).
28. The method of any one of claims 23 to 27, wherein the modification is in vitro.
29. The method of any one of claims 23 to 27, wherein the modification is in vivo.
30. The method of any one of claims 23 to 27, wherein the modification is ex vivo.
31. 20. A method of modifying a target nucleic acid sequence in a mammalian cell, the method comprising contacting said mammalian cell with the engineered nuclease system of any one of claims 1 to 19.
32. A vector comprising the nucleic acid of claim 23.
33. 33. The vector of claim 32, wherein the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV)-derived virion, or a lentivirus.
34. A cell comprising the engineered nuclease system of any one of claims 1 to 19 or the polypeptide of any one of claims 20 to 22.
35. The cell of claim 34, wherein the cell is a eukaryotic cell.
36. The cell of claim 34, wherein the cell is a mammalian cell.
37. The cell of claim 34, wherein the cell is an immortalized cell.
38. 35. The cell of claim 34, wherein the cell is an insect cell.
39. 35. The cell of claim 34, wherein the cell is a yeast cell.
40. 35. The cell of claim 34, wherein the cell is a plant cell.
41. 35. The cell of claim 34, wherein the cell is a fungal cell.
42. 35. The cell of claim 34, wherein the cell is a prokaryotic cell.
43. 35. The cell of claim 34, wherein the cell is A549, HEK-293, HEK-293T, BHK, CHO, HeLa, MRC5, Sf9, Cos-1, Cos-7, Vero, BSC 1, BSC 40, BMT 10, WI38, HeLa, Saos, C2C12, L cells, HT1080, HepG2, Huh7, K562, primary cells, or derivatives thereof.
44. 35. The cell of claim 34, wherein the cell is an engineered cell.
45. The cell of claim 34, wherein the cell is a stable cell.