Method for detecting nucleic acid and sample solution for nucleic acid amplification

Abstract

To provide a method for achieving high detection sensitivity in PCR, and to provide a sample liquid for nucleic acid amplification.SOLUTION: A method for detecting a target nucleic acid using a nucleic acid amplification reaction, the method comprising using a reciprocal flow type nucleic acid amplification reaction apparatus for continuously or intermittently applying light having an excitation wavelength of a component (a) in a reaction solution containing (a) a cyanine dye intercalator, (b) a forward primer and a reverse primer, (c) a sample, (d) a nonionic surfactant, and (e) a fluorescent probe and measuring fluorescence, wherein the concentration of the component (a) is 2 to 4 μ M.SELECTED DRAWING: Figure 2

Description

[Technical Field]

[0001] The present invention relates to a method for rapidly detecting a specific target nucleic acid molecule present in a sample and a sample solution for nucleic acid amplification. [Background technology]

[0002] Nucleic acid detection is central to a variety of fields, including pharmaceutical research and development, forensic medicine, clinical testing, and identification of agricultural crops and pathogenic microorganisms. Nucleic acid amplification by polymerase chain reaction (PCR) is widely used for detecting nucleic acids. PCR is a technology that selectively amplifies specific regions of DNA. Specifically, DNA is amplified by sequentially repeating the following individual reactions through repeated thermal cycling: denaturation of DNA into single strands, annealing of the denatured single strands with primers, and extension of the primers by a thermostable DNA polymerase enzyme.

[0003] Real-time PCR, which simultaneously detects amplified DNA during PCR amplification, has also been developed. Real-time PCR allows for the amount of amplified DNA to be detected in real time during PCR before the plateau is reached, making it possible to quantify the amount of template DNA before PCR based on the DNA amplification process. Therefore, real-time PCR is also known as quantitative PCR.

[0004] Real-time PCR allows for easy confirmation of the presence or absence of target DNA in a sample by generating or quenching fluorescence in response to the amount of target DNA amplified. Known methods include the intercalator method, which utilizes a DNA-intercalating dye that exhibits enhanced fluorescence when bound to double-stranded nucleic acids, and the probe method, which uses a probe that decomposes and emits fluorescence as the nucleic acid amplifies. The increase in fluorescence due to the increase in DNA concentration during amplification can be used to measure the progress of the reaction and / or to determine the copy number of the target molecule.

[0005] The probe method is characterized by its ability to achieve highly specific detection because it uses a probe that binds to the target DNA sequence of interest, whereas the intercalator method lacks specificity because it binds to all double-stranded DNA produced during the PCR reaction and emits fluorescence. For this reason, intercalator reagents are not usually used in conjunction with the probe method.

[0006] When an intercalator reagent is used in combination with the probe method, a technique is known in which the amount of probe is greater than the amount of intercalator reagent, thereby ensuring a difference in the amount of light emitted to label the target nucleic acid and the amount of light emitted to label the control, even if a low-specificity intercalator binds to something other than the target nucleic acid (Patent Document 1). This technique can increase the amount of light emitted to label the target nucleic acid compared to when only one of the probe and intercalator is used, making it easier to detect light using a photodetector.

[0007] It is known that the fluorescence intensity of fluorescent substances such as intercalators is proportional to the concentration when the concentration of the fluorescent substance in the sample is relatively low. On the other hand, when the concentration of the fluorescent substance is high, stacking of intercalators occurs, causing concentration quenching, which is thought to result in a decrease in fluorescence intensity. Therefore, even when using intercalators to detect double-stranded nucleic acids, a relatively low concentration of intercalator is used.

[0008] It has been reported that intercalators that interact with sites containing one or more consecutive GC base pairs in double-stranded nucleic acids, in addition to sites containing consecutive AT base pairs, do not cause concentration quenching up to a certain amount, even when added in amounts exceeding those used for general intercalators, and that fluorescence intensity can be increased by adding an amount exceeding that used for conventional intercalators. Among these, SYBR™ Green I (trade name), an intercalator that interacts with sites containing one or more consecutive GC base pairs in addition to sites containing consecutive AT base pairs, has been reported to exhibit no concentration quenching at concentrations of 1.96 μM to 4.9 μM when the double-stranded nucleic acid to be amplified contains 20 bases. Furthermore, it is speculated that fluorescence intensity decreases at concentrations of 6.53 μM or higher, causing concentration quenching (see Patent Document 2).

[0009] Primers used in PCR are generally used in the range of 0.1–0.6 μM in the reaction solution. Higher primer concentrations are undesirable because they can promote the accumulation of nonspecific products. Lower concentrations may result in primer depletion before the reaction is complete, resulting in low yields of the desired product.

[0010] General-purpose thermal cyclers used in PCR have slow temperature control due to the large heat capacity of the aluminum block heater, and 30 to 40 PCR cycles typically require one to two hours, or even longer in some cases. Even with the latest genetic testing equipment, analysis typically requires more than one hour in total. Speeding up PCR has been a major challenge since the technology's introduction. Reciprocal flow nucleic acid amplifiers have been proposed as a method for speeding up PCR (Patent Document 3). PCR using reciprocal flow nucleic acid amplifiers uses a liquid delivery mechanism, such as a microblower, to transport sample liquid back and forth between a channel maintained at a denaturation temperature and a channel maintained at an extension and annealing temperature, which are connected via an intermediate channel, enabling DNA amplification in a short time. [Prior art documents] [Patent documents]

[0011] [Patent Document 1] Patent Publication No. 2017-143744 [Patent Document 2] Patent No. 4899618 [Patent Document 3] International Publication No. 2016 / 006612 [Patent Document 4] International Publication No. 2020 / 189581 [Patent Document 5] International Publication No. 2022 / 153999 Summary of the Invention [Problem to be solved by the invention]

[0012] In PCR, improved detection sensitivity leads to improved detection speed, so a method for achieving high fluorescence intensity is needed. An object of the present invention is to provide a method for achieving high detection sensitivity in real-time PCR, particularly in real-time PCR using a reciprocal flow nucleic acid amplification device. [Means for solving the problem]

[0013] 1) A method for detecting a target nucleic acid using a nucleic acid amplification reaction, (a) cyanine dye intercalator, (b) forward and reverse primers; (c) sample, (d) nonionic surfactants, (e) Fluorescent probe In a reaction solution containing A reciprocal flow type nucleic acid amplification reaction device is used to continuously or intermittently apply light of the excitation wavelength of component (a) and measure fluorescence. A detection method characterized in that the concentration of component (a) is 2 to 4 μM. 2) The method according to 1), wherein component (a) is N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine. 3) The method according to 1) or 2), wherein the concentration of component (a) is 3 μM. 4) The method according to 1) or 2), wherein the concentration of component (b) is 2 μM to 6 μM. 5) The method according to 1) or 2), wherein the nucleic acid to be amplified contained in component (c) has 150 to 160 bases. 6) The method according to 1) or 2), wherein the ratio of the concentrations of component (a) and component (e) is 10 / 1 to 5 / 1. 7) The method according to 1) or 2), wherein the ratio of the concentrations of component (a) and component (e) is 7.5 / 1. 8) The method according to 1) or 2), wherein the ratio of the concentrations of component (b) and component (e) is 10 / 1 to 20 / 1. 9) The method according to 1) or 2), wherein the ratio of the concentrations of component (b) and component (e) is 14 / 1. 10) A sample solution for nucleic acid amplification used in a reciprocal flow type nucleic acid amplification reaction device, In detecting a target nucleic acid using a nucleic acid amplification reaction, the following components are used: (a) Cyanine dye intercalator (b) Forward and reverse primers (c) Sample (d) Nonionic surfactants (e) Fluorescent probe Contains A sample solution for nucleic acid amplification, characterized in that the concentration of component (a) is 2 to 4 μM. 11) The sample solution for nucleic acid amplification according to 10), wherein component (a) is N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine. 12) The sample solution for nucleic acid amplification according to 10) or 11), wherein the concentration of component (a) is 3 μM. 13) The sample solution for nucleic acid amplification according to 10) or 11), wherein the concentration of component (b) is 2 μM to 6 μM. 14) The sample solution for nucleic acid amplification according to 10) or 11), wherein the nucleic acid to be amplified contained in component (c) has 150 to 160 bases. 15) The sample solution for nucleic acid amplification according to 10) or 11), wherein the concentration ratio of component (a) to component (e) is 10 / 1 to 5 / 1. 16) The sample solution for nucleic acid amplification according to 10) or 11), wherein the ratio of the concentrations of the component (a) and the component (e) is 7.5 / 1. 17) The sample solution for nucleic acid amplification according to 10) or 11), wherein the concentration ratio of component (b) to component (e) is 10 / 1 to 20 / 1. 18) A sample solution for nucleic acid amplification according to 10) or 11), wherein the ratio of the concentrations of component (b) and component (e) is 14 / 1.

[0014] The method for detecting a target nucleic acid described in 1) can achieve high detection sensitivity in real-time PCR by using a cyanine dye intercalator at a specific concentration. By using the concentration described in 3), even higher sensitivity can be achieved. The method described in 4) can achieve high detection sensitivity while suppressing nonspecific amplification of long chains. [Effects of the Invention]

[0015] According to the present invention, it is possible to provide a method for realizing high detection sensitivity in PCR and a sample solution for nucleic acid amplification. [Brief explanation of the drawings]

[0016] [Figure 1] 1 is a graph showing the relationship between intercalator concentration and final fluorescence concentration. [Figure 2] 1 is a graph showing the relationship between intercalator concentration and Ct value. The Ct value in this graph is the number of cycles of gene amplification until a positive result for the target gene is obtained, which is the cycle at which the relative fluorescence intensity reaches 100. DETAILED DESCRIPTION OF THE INVENTION

[0017] Double-stranded nucleic acid structures are formed by base pairing between bases in a target nucleic acid and its complementary nucleic acid sequence. Base pairing occurs through hydrogen bonds between cytosine and guanine, adenine and thymine, or adenine and uracil. In real-time PCR, the intercalator binds to this double-stranded nucleic acid structure and becomes fluorescent.

[0018] In this specification, the term "cyanine dye intercalator" refers to a type of intercalator that is commonly used in real-time PCR, and may be any intercalator that is usable in real-time PCR. Cyanine dye intercalators include N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine (SYBR® Green I®), 2-[[2-(dimethylamino)ethyl]thio]-4-[(3-methyl-2(3H)-benzoxazol-ylidene)methyl]-1-phenylquinolinium (SYBR® Green II®), [2-(4-{[diethyl(methyl)ammonio]methyl}phenyl)-6-methoxy-1-methyl-4-{[(2Z)-3-methyl-1,3-benzoxazol-2-ylidene]methyl}quinolin-1-ium] (SYBR® Gold (trade name), 1-methyl-4-[(3-methyl-2(3H)-benzothiazolylidene)methyl]quinolinium p-tosylate (thiazole orange), 4-[(3-methyl-2(3H)-benzoxazolylidene)methyl]-1-[3-(trimethylammonio)propyl]-quinolinium diiodide (oxazole yellow), and in particular N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine (SYBR (trade name) Green I (trade name)), [2-(4-{[diethyl(methyl)ammonio]methyl}phenyl)-6-methoxy-1-methyl-4-{[(2Z)-3-methyl-1,3-benzoxazol-2-ylidene]methyl}quinolin-1-ium] (SYBR (trade name) Gold (trade name)) are preferred from the viewpoint of DNA detection sensitivity.

[0019] The excitation wavelength of the cyanine dye intercalator varies depending on the derivative. For example, the maximum excitation wavelength is 494 nm for N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine (SYBR® Green I®), 494 nm for 2-[[2-(dimethylamino)ethyl]thio]-4-[(3-methyl-2(3H)-benzoxazol-ylidene)methyl]-1-phenylquinolinium (SYBR® Green I®). II (trade name)) at 497 nm, [2-(4-{[diethyl(methyl)ammonio]methyl}phenyl)-6-methoxy-1-methyl-4-{[(2Z)-3-methyl-1,3-benzoxazol-2-ylidene]methyl}quinolin-1-ium]) (SYBR (trade name)) at 495 nm, 1-methyl-4-[(3-methyl-2(3H)-benzothiazolylidene)methyl]quinolinium p-tosylate (thiazole orange) at 502 nm, and 4-[(3-methyl-2(3H)-benzoxazolylidene)methyl]-1-[3-(trimethylammonio)propyl]-quinolinium diiodide (oxazole yellow) at 490 nm.

[0020] The concentration of a cyanine dye intercalator can be measured using absorbance. The commonly recommended concentration (standard concentration) of an intercalator reagent is 1.0 × 10 for N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine (SYBR® Green I®), which is the concentration at which the absorbance at 494 nm becomes 0.60. ―1For SYBR™ Green I™ nucleic acid gel stain *10,000X concentrate in DMSO (Thermo Scientific), the standard concentration is 1.01 μM when the reagent is diluted 10,000 times (Nucleic Acids Research. 49 (9): 5143-5158). For 2-[[2-(dimethylamino)ethyl]thio]-4-[(3-methyl-2(3H)-benzoxazol-ylidene)methyl]-1-phenylquinolinium (SYBR™ Green II™), the absorbance at 481 nm is 0.56, or 1.0 × 10 ―1 For [2-(4-{[diethyl(methyl)ammonio]methyl}phenyl)-6-methoxy-1-methyl-4-{[(2Z)-3-methyl-1,3-benzoxazol-2-ylidene]methyl}quinolin-1-ium]) (SYBR® Gold®), the concentration at which the absorbance at 488 nm is 0.72 is 1.0 × 10 ―1 The concentration that is 1.24 μM corresponds to the reference concentration, which is 1.24 μM (Nucleic Acids Research. 49 (9): 5143-5158.) With respect to the concentration of the cyanine dye intercalator, assuming that the reference concentration is 1, the concentration of the reaction solution is preferably 1.5 to 4, more preferably 2 to 4, even more preferably 2 to 3.5, and particularly preferably 3.

[0021] The primers used in this embodiment are one forward primer and one reverse primer corresponding to one target gene region. However, as long as a pair of forward primers and reverse primers is formed, the number of forward primers and reverse primers in the solution does not need to be the same. For example, the solution of this embodiment may contain one forward primer and two reverse primers.

[0022] In PCR using a reciprocal flow nucleic acid amplifier, it is possible to amplify the target nucleic acid while suppressing nonspecific amplification, even when using high concentrations of primers. It is known that when nucleic acids are amplified using conventional methods with high concentrations of primers, nonspecific amplification of long chains increases. This is presumed to be nonspecific amplification caused by an increased probability of mistakenly amplifying genomes derived from living organisms. However, in PCR using a reciprocal flow nucleic acid amplifier, the annealing time is extremely short, so it is thought that such nonspecific amplification can be suppressed even when high concentrations of primers are used.

[0023] The concentrations of the forward primer and reverse primer used in this embodiment can each be 0.1 μM to 6 μM. From the viewpoint of improving detection sensitivity, the concentrations are preferably 2 μM to 6 μM, and more preferably 2.2 μM to 3.5 μM.

[0024] The nonionic surfactant used in this embodiment is a surfactant that does not have a group that dissociates into ions in aqueous solution. Examples include propylene oxide-ethylene oxide block copolymers, alkyl glycosides, nonylphenyl ethoxylates, polyethylene glycol trimethylnonyl ether, polyoxyethylene pt-octylphenyl ether (Triton X100, Triton X45, Triton X114 (Dow Chemical Company), etc.), polyethylene alkyl ethers (Bridge 30), sorbitan fatty acid esters (Span surfactants, Arlacel surfactants), polyoxyethylene sorbitan fatty acid esters (Tween surfactants, e.g., Tween 20), polyoxyethylene alkyl ethers (Bridge surfactants), and glycerin fatty acid esters. The content of the nonionic surfactant is not particularly limited, but is preferably 0.001 to 0.5 w / w% of the solution of this embodiment to ensure smooth liquid transfer through a reciprocal flow nucleic acid amplification device.

[0025] The fluorescent probe used in this embodiment is an oligonucleotide bound to a fluorescent dye, and is capable of detecting a target sequence by hybridizing with a complementary sequence. Examples of fluorescent probes include 5-carboxyfluorescein (5-FAM) and 6-carboxyfluorescein (6-FAM), but are not limited to these, as long as they emit fluorescence in the same wavelength range as the cyanine dye intercalator used in the reaction. "Emitting fluorescence in the same wavelength range as the cyanine dye intercalator" means that the wavelength range at which the dye emits fluorescence with an intensity 10% or more of its maximum fluorescence intensity overlaps with that of the cyanine intercalator.

[0026] The detection sensitivity of the fluorescent probe increases with increasing concentration in the reaction solution, but increasing the concentration too much inhibits the nucleic acid amplification reaction. The final amount of amplification product depends on the amount of primer and target nucleic acid to be amplified. In real-time PCR, the fluorescent probe is typically used at 0.1 μM to 0.4 μM. From the viewpoint of detection sensitivity, the ratio of fluorescent probe to primer used in this embodiment is preferably (forward primer + reverse primer) / fluorescent probe = 10 / 1 to 20 / 1, more preferably 13 / 1 to 15 / 1, and most preferably 14 / 1. The ratio of cyanine dye intercalator to fluorescent probe used in this embodiment is preferably 10 / 1 to 5 / 1, more preferably 7.5 / 1.

[0027] The sample used in this embodiment is not particularly limited, but can be purified as needed before use in the reaction.

[0028] The amount of reaction solution used in this embodiment is preferably small from the viewpoint of temperature control. However, if the amount is too small, the reaction solution becomes difficult to handle and volume loss due to evaporation becomes a problem. The amount of reaction solution used in this embodiment is preferably 10 μL to 30 μL, more preferably 15 μL to 25 μL, and most preferably 20 μL.

[0029] The other components are not particularly limited as long as they do not impair the effects of the present invention and can be appropriately selected depending on the purpose. Examples include buffers such as TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA), and deoxynucleotide triphosphates (dNTPs).

[0030] The reciprocal flow type nucleic acid amplification device can be the device described in Patent Documents 3, 4, and 5. A sample solution is introduced into a nucleic acid amplification chip with a flow channel formed therein, and a liquid delivery mechanism is connected to both ends of the flow channel. By using a microblower or air blower as the liquid delivery mechanism, it is possible to move back and forth (liquid delivery, stopping) between the temperature range required for DNA denaturation in the thermal cycler and the temperature range required for DNA elongation and annealing reactions.

[0031] The time for which the sample solution is held in the denaturation temperature range and the time for which the sample solution is held in the extension / annealing temperature range can each be appropriately set depending on the target gene region (type of gene, length of region, etc.) For example, the time for which the sample solution is held in the denaturation temperature range can be about 2 to 10 seconds, and the time for which the sample solution is held in the extension / annealing temperature range can be about 2 to 60 seconds.

[0032] Experimental example (Test Method) 100 μM forward primer (SEQ ID NO: 1), 100 μM reverse primer (SEQ ID NO: 2), GeneSoC™ PCR Master Mix (Kyorin Pharmaceutical Co., Ltd.), and positive control DNA pUC57-N2 (prepared at 500 copies / μL) were mixed in the following ratio per reaction: 0.48 μL:0.64 μL:12.0 μL:1.0 μL. The positive control DNA pUC57-N2 was prepared by inserting an N2-containing sequence (SEQ ID NO: 4) into the EcoRV site of the pUC57 vector, thereby linearizing it. Next, to examine the effect of the intercalator dye, 2.0 μL of RNase-free water or intercalator solution was added to form a mixed solution. The intercalator solution was prepared by diluting SYBR (trademark) Green I (trade name) nucleic acid gel stain *10,000X concentrate in DMSO (manufactured by Thermo Scientific) with RNase-free water. (A) For the intercalator method, RNase-free water was added to the above mixture to make a 20 μL PCR reaction mixture. (B) For the probe + intercalator method, 0.08 μL of 100 μM probe (SEQ ID NO: 3) and RNase-free water were added to the above mixture to make a 20 μL PCR reaction mixture. These PCR reaction mixtures were subjected to real-time PCR using a GeneSoC mini (Kyorin Pharmaceutical Co., Ltd.) and a dedicated chip. The PCR conditions for the GeneSoC mini (Kyorin Pharmaceutical Co., Ltd.) were as follows: activation reaction: 96°C, 10 seconds; thermal denaturation reaction (DN): 96°C, 4 seconds; annealing and extension reaction (AE): 58°C, 8 seconds. 50 cycles of DN and AE were performed, and the fluorescence intensity at the 50th cycle was taken as the final fluorescence intensity. The cycle at which the relative fluorescence intensity reached 100 was taken as the number of cycles (Ct value) of gene amplification until a positive result for the target gene was obtained. Forward primer: AAATTTTGGGGACCAGGAAC (SEQ ID NO: 1) Reverse primer: TGGCAGCTGTGTAGGTCAAC (SEQ ID NO: 2) Probe: FAM-ATGTCGCGCATTGGCATGGA-TAMRA (SEQ ID NO: 3) Insertion sequence: AAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGCTGCCA (SEQ ID NO: 4)

[0033] (Test results) In both methods (A) and (B), an increase in final fluorescence intensity was observed depending on the intercalator concentration (Figure 1). As shown in Figure 2, a decrease in Ct value was observed depending on the intercalator concentration at concentrations 1-3x higher than the reference concentration in method (A), and at concentrations 0-3x higher in method (B). This indicates that the Ct value varies with the intercalator concentration. If the concentration at which the absorbance at 494 nm reaches 0.60 is defined as 1, the Ct value was found to be shortest when the reaction solution concentration was approximately 3x higher than the reference concentration. Specifically, the Ct value was 38.1 at 0x intercalator concentration (i.e., the probe method), whereas the Ct value was 35.1 at 3x intercalator concentration. Furthermore, when the probe was added, the Ct value significantly decreased to 34.6. Under these test conditions, one cycle required 11-12 seconds, meaning that nucleic acid amplification time varied depending on the number of cycles. A decrease of 3 Ct value means that the reaction time was shortened by approximately 32 seconds. It was revealed that the addition of a cyanine dye intercalator at an appropriate concentration is useful for highly sensitive positive detection at earlier cycles in reciprocal flow nucleic acid amplification. Generally, it is said that increasing the concentration of cyanine dye intercalators is undesirable because it inhibits the amplification reaction and reduces detection sensitivity. However, we found that the optimum detection sensitivity was achieved at a concentration of 1.5 to 4 times the reference concentration, especially at around 3 times. [Industrial Applicability]

[0034] The present invention makes it possible to rapidly detect a specific target nucleic acid molecule present in a sample, and has industrial applicability.

Claims

1. A method for detecting a target nucleic acid using a nucleic acid amplification reaction, comprising: (a) a cyanine dye intercalator; (b) a forward primer and a reverse primer; (c) a sample; (d) a nonionic surfactant; (e) Fluorescent probe In a reaction solution containing A reciprocal flow type nucleic acid amplification reaction device is used to continuously or intermittently apply light of the excitation wavelength of component (a) and measure fluorescence. A detection method characterized in that the concentration of component (a) is 2 to 4 μM.

2. 2. The method of claim 1, wherein component (a) is N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine.

3. 3. The method according to claim 1 or claim 2, wherein the concentration of component (a) is 3 μM.

4. 3. The method according to claim 1 or 2, wherein the concentration of component (b) is 2 μM to 6 μM.

5. 3. The method according to claim 1, wherein the nucleic acid to be amplified contained in component (c) has 150 to 160 bases.

6. A sample solution for nucleic acid amplification used in a reciprocal flow type nucleic acid amplification reaction device, In detecting a target nucleic acid using a nucleic acid amplification reaction, the following components are used: (a) Cyanine dye intercalator (b) forward and reverse primers (c) Sample (d) Nonionic surfactant (e) Fluorescent probe Contains A sample solution for nucleic acid amplification, characterized in that the concentration of component (a) is 2 to 4 μM.

7. 7. The sample solution for nucleic acid amplification according to claim 6, wherein component (a) is N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-ium-2-yl]-N-propylpropane-1,3-diamine.

Images