Molecular marker related to slash pine wood property, DNA fragment, kit and application thereof

Abstract

The invention discloses a molecular marker related to slash pine wood property, a DNA (deoxyribonucleic acid) fragment, a kit and application of the molecular marker, the SNP molecular marker is scaffold 18550859010 and is located at the 59010th site of the fragment scaffold 185508; the polymorphism of the SNP sites is C / T, the genotype of the SNP site of the slash pine with high wood density is CC, and the genotype of the SNP site of the slash pine with low wood density is CT; the nucleotide sequence of the DNA fragment related to the slash pine wood property is as shown in SEQ ID NO. 1 or SEQ ID NO. 2; comprising a forward primer and a reverse primer which are used for amplifying a DNA fragment related to slash pine wood property; the nucleotide sequence of the forward primer is as shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.4; the molecular marker, the DNA fragment and the kit are used for slash pine wood property-related phenotype identification, early prediction, breeding and the like, and the problems that existing slash pine wood property-related traits are late in identification, long in breeding period, low in breeding efficiency and the like can be solved.

Description

Technical Field

[0001] This invention relates to the field of molecular markers and genetic breeding technology for slash pine. Specifically, it relates to molecular markers, DNA fragments, kits, and their applications related to the properties of slash pine. Background Technology

[0002] The wood density is that of slash pine ( Pinus elliottii Engelm. var. elliottii One of the most important physicochemical indicators in wood property evaluation is the density of slash pine, which directly determines the suitability and processing performance of wood in different industrial fields. High-density slash pine wood has a higher content of cell wall material and lower porosity, thus exhibiting higher mechanical strength, hardness, and dimensional stability. This type of wood has a dense structure and excellent compressive and bending resistance, making it suitable for applications requiring strength and durability, such as building structural materials, bridges, flooring, and furniture. Conversely, low-density wood has large cell cavities, thin walls, a lightweight texture, is easy to process, has relatively longer fiber lengths, and a higher proportion of cellulose, making it more suitable for industrial applications requiring good fiber separation and flexibility, such as papermaking and engineered wood products. In the pulp and paper industry, low-density slash pine wood has low pulping energy consumption and high pulp yield, producing paper products with uniform texture and moderate strength. In the plywood and particleboard industries, medium-density slash pine wood balances strength and processing performance, ensuring structural stability of the boards while reducing pressing energy consumption. In general, the difference in wood density gives slash pine different industrial adaptability: high-density wood is more suitable for structural materials and high-end furniture production, while low-density wood has an economic advantage in papermaking and composite board manufacturing. Therefore, in slash pine breeding and wood property improvement, density-oriented selection should be carried out according to the needs of the target industry to achieve the optimal balance between wood quality and economic benefits.

[0003] The planting area of ​​slash pine in my country exceeds 22 million mu. Traditional breeding work of slash pine, which mainly uses selection and hybridization breeding, has made great progress. However, the long juvenile period and high genome heterozygosity of slash pine have become bottlenecks affecting the efficiency of its conventional breeding. A breeding cycle can take 15 to 20 years, and the selection speed is far from meeting the demand of the timber market. This has become one of the important factors restricting the development of the pulp and board industry.

[0004] Compared to traditional breeding techniques, molecular marker-assisted breeding allows for early selection of superior strains from the seedling stage, significantly shortening the breeding cycle. This advantage is particularly pronounced in pine breeding aimed at producing timber and pulp. Since molecular marker-assisted breeding relies on linked markers for the target trait, identifying molecular markers and candidate genes related to the timber properties of wetland pine can help improve breeding efficiency and reduce labor and economic costs. Summary of the Invention

[0005] Therefore, the technical problem to be solved by the present invention is to provide a molecular marker, DNA fragment, and reagent kit related to the wood properties of slash pine, and their application in the identification and breeding of slash pine with high wood density and low single-tree density, so as to solve the problems of long breeding cycle and low breeding efficiency of existing slash pine wood property related traits.

[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solution: The SNP molecular marker associated with the wood properties of slash pine is scaffold185508_59010, located at position 59010 of the scaffold185508 fragment. The polymorphism of the SNP site is C / T. The genotype of the SNP site in slash pine with high wood density is CC, and the genotype of the SNP site in slash pine with low wood density is CT.

[0007] The DNA fragment associated with the wood properties of slash pine is located in the PITA_24257 gene region of the slash pine genome (this gene has the function of promoting cell wall polysaccharide degradation, increasing porosity, and reducing lignification, and plays the role of a negative regulator of wood density) and contains the above-mentioned SNP molecular markers associated with the wood properties of slash pine; the nucleotide sequence of the DNA fragment associated with the wood properties of slash pine is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0008] SEQ ID NO.1 (>scaffold185508:58510-59510): CCTGATCATCATCGTCACCCTCTTCATCATCATCAAACATATCGCTCTTCGCATACTTATTATAGAAGCTCCCCCTGGACTCTGATTCATTCACAAATTCCAGGCCATAAGAGGTATTCCTGTATTTCACTAACAGCCAACGAAACAATGTGTCATCCTTGTTCAGGTATTCTAACTCCTTATGGAATTTTGGAGTGACCATCATTGTCATTTGCATCATTTGACTCTGATAGTATCTGCTGTCAAGCTTCTTGATGCCATAACCTAAATACACCTTTCCGAATGACTTGATATCTATCACGACTCCGTTCAATGAATAAACGCGCCTTCCAAAACGAGAGAGAAGCTCGACAATGGCCGCCTTCTCCACCTGGGGGCTTCAGCAGCAACAGACAATCTGTACAGAGGCATTCTCGCACCTCAAGCTTTCCCCACAACTCTTTTGCTCATTTGCACTCCTACGAAAAATATACCGATTAGTTTAGAGCAGCAAAGAAAAT CGATTTCTGCTCAGGGCATAGGTAAATCGTTTCGCGTGGGCATAGTCGTATAGCATCGAGCGTCAGAATCGATTTTTTTGGTTGCGTTTCGAGCGGTCACGGGTATGCTTAGCTTTAGGGTTTAGTTTTTTTTTATGCATTGTAAATTTCTTTTTTATTTTAGTTTTAGTTTAGTTTGTTTTCGTTTAGTTATATTTTAATTTTATTTGCTTAGTCTTTGTTTAAATGTATGTATACGTGGATTGTTAGGTTTAGTTTAGATTTTCTTTTTTTTATTTATTATTTTTATTTTTTTATTTTTTTTAAGATTTCATTATAAAAATAAAAAAACATATAAAAAGCTAAAAAAAATAAAGAATAAAATAAAAATAAAATCTTATCTTAGGGTTTTAGATTTTACATTTTTTTATATTTTTAGGATTTTCAAGTTTTAAATAAGATTTGATTTAGATCTTTTTATTTTCATTTGATTATAAAAATAAAAAATTTAAAAAAGATATA; SEQ ID NO.2(>scaffold185508:58510-59510): CCTGATCATCATCGTCACCCTCTTCATCATCATCAAACATATCGCTCTTCGCATACTTATTATAGAAGCTCCCCCTGGACTCTGATTCATTCACAAATTCCAGGCCATAAGAGGTATTCCTGTATTTCACTAACAGCCAACGAAACAATGTGTCATCCTTGTTCAGGTATTCTAACTCCTTATGGAATTTTGGAGTGACCATCATTGTCATTTGCATCATTTGACTCTGATAGTATCTGCTGTCAAGCTTCTTGATGCCATAACCTAAATACACCTTTCCGAATGACTTGATATCTATCACGACTCCGTTCAATGAATAAACGCGCCTTCCAAAACGAGAGAGAAGCTCGACAATGGCCGCCTTCTCCACCTGGGGGCTTCAGCAGCAACAGACAATCTGTACAGAGGCATTCTCGCACCTCAAGCTTTCCCCACAACTCTTTTGCTCATTTGCACTCCTACGAAAAATATACCGATTAGTTTAGAGCAGCAAAGAAAAT TGATTTCTGCTCAGGGCATAGGTAAATCGTTTCGCGTGGGCATAGTCGTATAGCATCGAGCGTCAGAATCGATTTTTTTGGTTGCGTTTCGAGCGGTCACGGGTATGCTTAGCTTTAGGGTTTAGT TTTTTTTTATGCATTGTAAATTTCTTTTTTATTTAGTTTAGTTTAGTTTGTTTTCGTTTAGTTATATTTTAATTTTATTTGCTTAGTCTTTGTTTAAATGTATGTATACGTGGATTGTTAGGT TTAGTTTAGATTTTCTTTTTTTATTTATTATTTTTATTTTTTTATTTTTTTAAGATTTCATTATAAAAATAAAAAAACATATAAAAAGCTAAAAAAAATAAAGAATAAAAAAAATAAAATCTTATCTTAGGGTTTTAGATTTTACATTTTTTATATTTTTAGGATTTTCAAGTTTTAAATAAGATTTGATTTAGATCTTTTTTTTCATTTGATTATAAAAATAAAAAATTTAAAAAAGATATA.

[0009] A kit for amplifying DNA fragments related to the properties of slash pine includes forward and reverse primers for amplifying the aforementioned DNA fragments related to the properties of slash pine; the nucleotide sequence of the forward primer is shown in SEQ ID NO. 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO. 4; SEQ ID NO.3: 5'-CGCCTTTCCAAAACGAGAGAG-3'; SEQ ID NO.4: 5'-TTGAGGTGCGAGAATGCCTC-3' Application of SNP molecular markers related to slash pine wood properties: The above-mentioned SNP molecular markers related to slash pine wood properties, the above-mentioned DNA fragments related to slash pine wood properties, or the above-mentioned kits related to slash pine wood properties are used to achieve any of the following applications: (1) Used to identify the density phenotype of slash pine wood; (2) Used to achieve early prediction of the density of slash pine timber; (3) Used to improve the density phenotype of slash pine wood; (4) Used for marker-assisted breeding of phenotypic differences in wood density of slash pine; (5) Used for screening high-density slash pine or low-density slash pine.

[0010] The application of the aforementioned SNP molecular markers related to the properties of slash pine, and the method for identifying the high and low density phenotypes of slash pine wood, includes the following steps: Step (1): Extract genomic DNA from the slash pine to be identified; Step (2): Using genomic DNA as a template, PCR amplification is performed using the forward primer shown in SEQ ID NO.3 and the reverse primer shown in SEQ ID NO.4 to obtain the target DNA fragment; Step (3): Sequencing and typing of the target DNA fragment, and determining the phenotype of the density of the slash pine wood to be identified based on the genotype of the SNP molecular marker.

[0011] In the application of the above-mentioned SNP molecular markers related to the properties of slash pine, in step (1), fresh young needle tissue is used as the sample source of cDNA, and the cDNA of slash pine to be identified is extracted using the TaKaRa MiniBEST plant genomic DNA extraction kit.

[0012] The application of the above-mentioned SNP molecular markers related to the properties of slash pine wood, in step (2), the PCR amplification reaction program is as follows: 94℃, 3min, 1 cycle of pre-denaturation; 94℃, 15s, 60℃, 50s extension, 30 cycles; 60℃, 4min, 1 cycle of complete extension.

[0013] In the application of the above-mentioned SNP molecular markers related to the properties of slash pine, in step (2), after amplification, the obtained PCR products are detected and recovered by agarose gel electrophoresis; in the agarose gel electrophoresis detection, the concentration of agarose gel is 1.2wt%; gel recovery is performed using the AxyPrep DNA Gel Recovery Kit.

[0014] In the application of the above-mentioned SNP molecular markers related to the wood properties of slash pine, in step (3), if the genotype of the SNP molecular marker scaffold185508_59010 in the target DNA fragment is CC, then the slash pine to be identified is a high wood density slash pine; if the genotype of the SNP molecular marker scaffold185508_59010 in the target DNA fragment is CT, then the slash pine to be identified is a low wood density slash pine.

[0015] The technical solution of the present invention achieves the following beneficial technical effects: 1. The major SNP locus related to wood properties of *Pinus slashea* identified in this invention is scaffold185508_59010, with a polymorphism of C / T, contributing 15.9% to the high / low wood density phenotype. This SNP marker was used for auxiliary selection of 221 cloned parents of *Pinus slashea*. The results showed that among individuals with the CC genotype at this locus, 50.25% had a wood density higher than the population average (0.40 g / cm³). 3 Among individuals with the CT genotype, 81.82% had wood density lower than the population average. This indicates that the marker is indeed effective in assisting selection.

[0016] 2. In conventional selection breeding of slash pine, the identification of wood density traits requires approximately 10 years of seedling afforestation, which is time-consuming and labor-intensive. The SNP loci related to slash pine wood properties in this invention are clearly located, the detection method is convenient and rapid, unaffected by environmental factors, more targeted, require less work, are more efficient, and have lower costs. Therefore, by detecting these SNP loci, identification and auxiliary screening can be carried out at the seedling stage, greatly saving production costs and improving selection efficiency. In slash pine breeding, the molecular markers and detection methods of this invention can be selected to identify high-wood-density slash pine for breeding, which can improve the selection efficiency of slash pine breeding and accelerate the breeding process. Detailed Implementation

[0017] The 221 clonal parent populations of *Pinus slashii* used in the following examples were all collected and evaluated by the Forest Germplasm Resources Research Group of the Subtropical Forestry Research Institute, Chinese Academy of Forestry, and are preserved in the germplasm resource nursery of Changle Forest Farm, Yuhang District, Hangzhou City, Zhejiang Province. Unless otherwise specified, the experimental materials, reagents, instruments, etc. used in the embodiments of this invention are all commercially available; unless otherwise specified, the technical means used in the embodiments of this invention are all conventional means well known to those skilled in the art.

[0018] 1. Selection and trait determination of slash pine timber populations This embodiment uses a clonal population of first-generation slash pine seed orchards to conduct a genome-wide association analysis (GWAS) to identify the wood density trait. Clonal seedlings of 300 slash pine genotypes were used in a completely randomized block design with 13 replicate blocks. One well-preserved block was selected, resulting in 221 slash pine genotypes for GWAS. The parental population of these 221 slash pine clones was preserved in Changle Forest Farm, Yuhang District, Hangzhou City, Zhejiang Province. At 30 years of age, core samples were obtained using a 1 cm diameter growth cone, dried, and the wood density of these 221 samples was obtained using the water displacement method. The trait analysis results showed significant differences in wood density among the families, indicating that this trait is a quantitative trait.

[0019] 2. Development of SNP markers related to wood properties in slash pine breeding populations 2.1 Population DNA Extraction In July 2023, the slash pine constructed in this embodiment ( Pinus elliottii Engelm. Twenty-two hundred and twenty-one clonal parents were randomly selected from the breeding population for the collection of fresh, young needle tissue. Immediately after sampling, the tissues were stored on ice to prevent DNA degradation. Total DNA was extracted from the young needles using the Plant Genomic DNA Extraction Kit (DP305) from TIANGEN Biotech Co., Ltd. (Beijing, China). The specific extraction steps are as follows: (1) Weigh about 100 mg of fresh needle leaf sample and grind it into fine powder in liquid nitrogen.

[0020] (2) Add 500 μL of lysis buffer GP1, shake vigorously to mix, and lyse in a 65℃ water bath for 10 min.

[0021] (3) Collect the supernatant after centrifugation (12,000 rpm, 2 min).

[0022] (4) Add anhydrous isopropanol at a volume ratio of 1:1, mix gently and centrifuge (12,000 rpm, 2 min).

[0023] (5) Discard the supernatant, wash the DNA precipitate twice with 70% ethanol solution, air dry and dissolve in 50 μL TE buffer.

[0024] DNA purity, concentration, and integrity were assessed using Nanodrop, Qubit 2.0, and 1wt% agarose gel electrophoresis. High-quality samples with OD260 / 280 values ​​between 1.8 and 2.0 and OD260 / 230 > 2.0 were selected for subsequent targeted sequencing.

[0025] 2.2 Probe-targeted capture sequencing High-quality DNA samples were subjected to 51K liquid-phase probe-targeted capture and high-throughput sequencing by Beijing Shengshi Technology Co., Ltd. The capture and sequencing steps in this embodiment are as follows: (1) Use ultrasound to fragment the sample DNA, with a fragment length of about 200-350 bp.

[0026] (2) After end repair and A-tailing, the sequencing adapter is ligated to prepare the sequencing library.

[0027] (3) Hybridization capture was performed using a 51K RNA probe designed for conserved and specific sequences of slash pine and loblolly pine. The probe was biotinylated, and the hybridized double-stranded complex bound to streptavidin magnetic beads to enrich the target sequence.

[0028] (4) After eluting the non-specific hybridization fragments, PCR amplification was performed to obtain the capture enriched library.

[0029] (5) After library quality testing using Qubit and Agilent 2100, paired-end sequencing (PE150) was performed using the MGI DNBSEQ-T7 platform.

[0030] 2.3 SNP marker identification and genotyping (1) The raw reads captured by the 221 pine probes were filtered using the Trim_galore software to remove the adapter sequences.

[0031] (2) Use BWA software v0.7.17 to construct the slash pine genome index file.

[0032] (3) Use BWA software to align the 221 clean reads of slash pine to the reference sequence and remove the sequences that are not aligned; in this embodiment, the pine genome v2.1 is used as the reference sequence.

[0033] (4) SNP identification and filtering using GATK software v4.1.2.0: Identify SNP sites in the sequence and filter them according to the following standards: QualByDepth (QD) > 2.0, FisherStrand (FS) > 30.0, RMSMapping Quality (MQ) > 40.0, MQRankSum > -12.5, ReadPosRankSum > -8.0, SOR > 3.0 to obtain high-quality genotype files.

[0034] All the software used above is publicly available and free.

[0035] 3. Mining of gene loci and linked SNP loci for the wood density trait of slash pine Genotypic data were imputed using Beagle v5.4 software. A mixed linear model using GEMMA v0.98.1 software was used to perform association analysis between the phenotypic data of *Pinus slashlandii* wood density and genotype. The first three principal components calculated based on the genotype data were used as covariates in the model, and the significance threshold was set to P ≤ 8.36E-07. The SNP locus scaffold185508_59010, significantly associated with *Pinus slashlandii* wood density, was identified, with the related candidate gene PITA_24257. The phenotypic variation explained (i.e., the contribution rate) of this marker locus was 15.9%, and its genotype was T / C (see Table 1), where C is the reference sequence base and T is the mutant base. The genotype of the SNP locus scaffold185508_59010 in *Pinus slashianii* is CC, corresponding to *Pinus slashianii* individuals with high wood density, and the genotype of the SNP locus scaffold185508_59010 in *Pinus slashianii* is CT, corresponding to *Pinus slashianii* individuals with low wood density. The wood properties described in this embodiment refer to the wood density of *Pinus slashianii*, in g / cm³. 3 .

[0036] Table 1. Information on candidate genes and linked SNP molecular markers

[0037] 4. Application of slash pine wood quality gene loci and linked SNP molecular markers in slash pine breeding SNP genotyping was performed, and Table 2 shows the genotypes corresponding to the scaffold185508_59010 locus in 221 individual plants. The results indicate that among the plants with the CC genotype at this locus, 50.25% had a wood density higher than the population average (0.40 g / cm³). 3 Among individuals with the low wood density genotype CT at this locus, 81.82% had wood density lower than the population average. This indicates that the marker is indeed effective for selection assistance. Therefore, the DNA fragments and SNP molecular markers related to wood density of slash pine screened in this embodiment can be used to identify the high and low wood density phenotypes of slash pine, or to achieve early prediction of high and low wood density of slash pine, or to improve the high and low wood density of slash pine or to use molecular marker-assisted breeding for high and low wood density of slash pine, or to screen for high wood density slash pine.

[0038] Table 2. Average wood density and genotype data of individual trees from 221 clonal parental lines of Pinus slashii.

[0039]

[0040] 5. Methods for determining the density of slash pine wood This embodiment of the method for identifying the wood density of slash pine using slash pine wood density gene loci and linked SNP molecular markers includes the following steps: (1) Extraction and identification of genomic DNA of slash pine; In this embodiment, the slash pine to be identified was selected from the parent individuals of 221 slash pine clones, and fresh young needle tissue was used as the sample source for cDNA; the slash pine cDNA was extracted using the TaKaRaMiniBEST plant genomic DNA extraction kit (TaKaRa, Dalian, China). (2) Using genomic cDNA as a template, the target DNA fragment is amplified by PCR using primers with sequences as shown in SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequence of the target DNA fragment is shown in SEQ ID NO.1 or SEQ ID NO.2; SEQ ID NO.1: CCTGATCATCATCGTCACCCTTCTCATCATCAAACATATCGCTCTTCGCATACTTATTATAGAAGCTCCCTGGACTCTGATTCATTCACAAATTCCAGGCCATAAGAGGTATTCCTGTATTTCACTAACAGCCAACGAAACAATGTGTCATCCTTGTTCAGGTATTCTAACTCCTTATGGAATTTTGGAGTGACCATCATTGTCATTTGCATCATTTGACTCTGATAGTATCTGCTGTCAAGCTT CTTGATCCATAACCTAAATACACCTTTCCGAATGACTTGATATCTATCACGACTCCGTTCAATGAATAAACGCGCCTTCCAAAACGAGAGAGAAGCTCGACAATGGCCGCCTTCTCCACCTGGG GGCTTCAGCAGCAACAGACAATCTGTACAGAGGCATTCTCGCACCTCAAGCTTTCCCCACAACTCTTTTGCTCATTTGCACTCCTACGAAAAATATACCGATTAGTTTAGAGCAGCAAAGAAAAT CGATTTCTGCTCAGGGCATAGGTAAATCGTTTCGCGTGGGCATAGTCGTATAGCATCGAGCGTCAGAATCGATTTTTTTGGTTGCGTTTCGAGCGGTCACGGGTATGCTTAGCTTTAGGGTTTAGTTTTTTTTTTTATGCATTGTAAATTTCTTTTTTATTTTAGTTTTAGTTTTGTTTTCGTTTAGTTATATTTTAATTTTATTTGCTTAGTCTTTGTTTAAATGTATGTATACGTGGATTGTTAGGTTTAGTTTAGATTTTCTTTTTTTTTTATTTATTTTTTTTTTTTTTTTTTTAAGATTTCATTATAAAAATAAAAAAACATATAAAAAGCTAAAAAAAATAAAGAATAAAATAAAAATAAAATCTTATCTTAGGGTTTTAGATTTTACATTTTTTTATATTTTTAGGATTTTCAAGTTTTAAATAAGATTTGATTTAGATCTTTTTTATTTTCATTTGATTATAAAAATAAAAAATTTAAAAAAGATATA; SEQ ID NO.2: CCTGATCATCATCGTCACCCTCTTCATCATCATCAAACATATCGCTCTTCGCATACTTATTATAGAAGCTCCCCCTGGACTCTGATTCATTCACAAATTCCAGGCCATAAGAGGTATTCCTGTATTTCACTAACAGCCAACGAAACAATGTGTCATCCTTGTTCAGGTATTCTAACTCCTTATGGAATTTTGGAGTGACCATCATTGTCATTTGCATCATTTGACTCTGATAGTATCTGCTGTCAAGCTTCTTGATGCCATAACCTAAATACACCTTTCCGAATGACTTGATATCTATCACGACTCCGTTCAATGAATAAACGCGCCTTCCAAAACGAGAGAGAAGCTCGACAATGGCCGCCTTCTCCACCTGGGGGCTTCAGCAGCAACAGACAATCTGTACAGAGGCATTCTCGCACCTCAAGCTTTCCCCACAACTCTTTTGCTCATTTGCACTCCTACGAAAAATATACCGATTAGTTTAGAGCAGCAAAGAAAAT TGATTTCTGCTCAGGGCATAGGTAAATCGTTTCGCGTGGGCATAGTCGTATAGCATCGAGCGTCAGAATCGATTTTTTTGGTTGCGTTTCGAGCGGTCACGGGTATGCTTAGCTTTAGGGTTTAGT TTTTTTTTATGCATTGTAAATTTCTTTTTTATTTAGTTTAGTTTAGTTTGTTTTCGTTTAGTTATATTTTAATTTTATTTGCTTAGTCTTTGTTTAAATGTATGTATACGTGGATTGTTAGGT TTAGTTTAGATTTTCTTTTTTTATTTATTATTTTTATTTTTTTATTTTTTTAAGATTTCATTATAAAAATAAAAAAACATATAAAAAGCTAAAAAAAATAAAGAATAAAAAAAATAAAATCTTATCTTAGGGTTTTAGATTTTACATTTTTTATATTTTTAGGATTTTCAAGTTTTAAATAAGATTTGATTTAGATCTTTTTTTTCATTTGATTATAAAAATAAAAAATTTAAAAAAGATATA; SEQ ID NO.3: 5'-CGCCTTTCCAAAACGAGAGAG-3'; SEQ ID NO. 4: 5'-TTGAGGTGCGAGAATGCCTC-3'.

[0041] The PCR amplification reaction program was as follows: 94℃, 3 min, 1 cycle for pre-denaturation; 94℃, 15 s for denaturation, 60℃, 50 s for extension, 30 cycles; 60℃, 4 min, 1 cycle for complete extension. After amplification, the obtained PCR products were detected and recovered by agarose gel electrophoresis; the concentration of agarose gel in the agarose gel electrophoresis was 1.2%; gel recovery was performed using the AxyPrep DNA Gel Recovery Kit (AxyGEN, Code No. AP-GX-50).

[0042] (3) Sequencing and typing of PCR products, and determining the phenotype of the wood density of the slash pine to be identified based on the genotype of the SNP molecular marker; specifically, if the genotype of the SNP molecular marker scaffold185508_59010 in the target DNA fragment obtained by PCR amplification is CC, then the slash pine to be identified is a high wood density slash pine; if the genotype of the SNP molecular marker scaffold185508_59010 in the target DNA fragment obtained by PCR amplification is CT, then the wood density of the slash pine to be identified is a low wood density slash pine.

[0043] In summary, the identification of the slash pine wood density gene locus and its closely linked molecular markers provided by this invention is based on genome-wide association analysis of the wood density phenotype in an established first-generation slash pine seed orchard clone population. This invention provides a SNP molecular marker regulating slash pine wood density and its corresponding candidate genes, as well as the application of these molecular markers in the identification and breeding of slash pine wood density phenotypes. By detecting SNP molecular marker loci, identification and assisted screening can be performed at the slash pine seedling stage, greatly saving production costs and improving selection efficiency.

Claims

1. SNP molecular markers related to the properties of slash pine, characterized in that, The SNP molecular marker is scaffold185508_59010, located at position 59010 of fragment scaffold185508; the polymorphism of the SNP site is C / T, the genotype of the SNP site of slash pine with high wood density is CC, and the genotype of the SNP site of slash pine with low wood density is CT.

2. A DNA fragment related to the properties of slash pine wood, characterized in that, The PITA_24257 gene region located in the slash pine genome contains the SNP molecular markers related to slash pine wood properties as described in claim 1; the nucleotide sequence of the DNA fragment related to slash pine wood properties is shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. A reagent kit related to the properties of slash pine wood, characterized in that, Includes a forward primer and a reverse primer for amplifying the DNA fragment related to the properties of slash pine as described in claim 2; the nucleotide sequence of the forward primer is shown in SEQ ID NO. 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

4.

4. The application of SNP molecular markers related to the properties of slash pine, characterized in that, The SNP molecular marker related to slash pine wood properties as described in claim 1, the DNA fragment related to slash pine wood properties as described in claim 2, or the kit related to slash pine wood properties as described in claim 3 can be used to achieve any of the following applications: (1) Used to identify the density phenotype of slash pine wood; (2) Used to achieve early prediction of the density of slash pine timber; (3) Used to improve the density phenotype of slash pine wood; (4) Used for marker-assisted breeding of phenotypic differences in wood density of slash pine; (5) Used for screening high-density slash pine or low-density slash pine.

5. The application of the SNP molecular markers related to the properties of slash pine as described in claim 4, characterized in that, The method for identifying the density phenotype of slash pine wood includes the following steps: Step (1): Extract genomic DNA from the slash pine to be identified; Step (2): Using genomic DNA as a template, PCR amplification is performed using the forward primer shown in SEQ ID NO.3 and the reverse primer shown in SEQ ID NO.4 to obtain the target DNA fragment; Step (3): Sequencing and typing of the target DNA fragment, and determining the phenotype of the density of the slash pine wood to be identified based on the genotype of the SNP molecular marker.

6. The application of the SNP molecular markers related to the properties of slash pine as described in claim 5, characterized in that, In step (1), fresh young needle tissue was used as the sample source for cDNA, and the cDNA of the slash pine to be identified was extracted using the TaKaRa MiniBEST plant genomic DNA extraction kit.

7. The application of the SNP molecular markers related to the properties of slash pine as described in claim 5, characterized in that, In step (2), the PCR amplification reaction program is as follows: 94℃, 3min, 1 cycle for pre-denaturation; 94℃, 15s, 60℃, 50s for extension, 30 cycles; 60℃, 4min, 1 cycle for complete extension.

8. The application of the SNP molecular markers related to the properties of slash pine as described in claim 7, characterized in that, In step (2), after amplification, the obtained PCR products are detected and recovered by agarose gel electrophoresis; the concentration of agarose gel in the agarose gel electrophoresis detection is 1.2 wt%; the gel is recovered using the AxyPrep DNA Gel Recovery Kit.

9. The application of the SNP molecular markers related to the properties of slash pine wood according to claim 5, characterized in that, In step (3), if the genotype of the SNP molecular marker scaffold185508_59010 in the target DNA fragment is CC, then the pine to be identified is a high-density pine; if the genotype of the SNP molecular marker scaffold185508_59010 in the target DNA fragment is CT, then the pine to be identified is a low-density pine.

Images